Nusse, R; Theunissen, H; Wagenaar, E; Rijsewijk, F; Gennissen, A; Otte, A; Schuuring, E; van Ooyen, A
1990-01-01
Wnt-1 (int-1) is a cellular oncogene often activated by insertion of proviral DNA of the mouse mammary tumor virus. We have mapped the 5' end and the promoter area of the Wnt-1 gene by nuclease protection and primer extension assays. In differentiating P19 embryonal carcinoma cells, in which Wnt-1 is naturally expressed, two start sites of transcription were found, one preceded by two TATA boxes and one preceded by several GC boxes. In P19 cells, a 1-kilobase upstream sequence of Wnt-1 was able to confer differentiation-specific expression on a heterologous gene. We have investigated how Wnt-1 transcription was affected by mouse mammary tumor virus proviral integrations in various configurations near the promoters of the gene. One provirus has been inserted in the 5' nontranslated part of Wnt-1, in the same transcriptional orientation, and has functionally replaced the Wnt-1 promoters. Wnt-1 transcription in this tumor starts in the right long terminal repeat of the provirus, with considerable readthrough transcription from the left long terminal repeat. Another provirus has been inserted in the orientation opposite that of Wnt-1 into a GC box, disrupting the first Wnt-1 transcription start site but not the downstream start site. Most insertions have not structurally altered the Wnt-1 transcripts and have enhanced the activity of the normal two promoters. Images PMID:1695322
Melamed, Anat; Laydon, Daniel J.; Gillet, Nicolas A.; Tanaka, Yuetsu; Taylor, Graham P.; Bangham, Charles R. M.
2013-01-01
The regulation of proviral latency is a central problem in retrovirology. We postulate that the genomic integration site of human T lymphotropic virus type 1 (HTLV-1) determines the pattern of expression of the provirus, which in turn determines the abundance and pathogenic potential of infected T cell clones in vivo. We recently developed a high-throughput method for the genome-wide amplification, identification and quantification of proviral integration sites. Here, we used this protocol to test two hypotheses. First, that binding sites for transcription factors and chromatin remodelling factors in the genome flanking the proviral integration site of HTLV-1 are associated with integration targeting, spontaneous proviral expression, and in vivo clonal abundance. Second, that the transcriptional orientation of the HTLV-1 provirus relative to that of the nearest host gene determines spontaneous proviral expression and in vivo clonal abundance. Integration targeting was strongly associated with the presence of a binding site for specific host transcription factors, especially STAT1 and p53. The presence of the chromatin remodelling factors BRG1 and INI1 and certain host transcription factors either upstream or downstream of the provirus was associated respectively with silencing or spontaneous expression of the provirus. Cells expressing HTLV-1 Tax protein were significantly more frequent in clones of low abundance in vivo. We conclude that transcriptional interference and chromatin remodelling are critical determinants of proviral latency in natural HTLV-1 infection. PMID:23555266
Yari, Atefeh; Rezaee, Seyyed Abdolrahim; Valizadeh, Narges; Rajaee, Taraneh; Jazayeri, Seyyed Mohammad; Soltani, Mojdeh; Norouzi, Mehdi
2014-07-01
HTLV-1 is the first human retrovirus that has been recognized and is associated with HAM/TSP and ATLL. Studies have shown that less than five percent of HTLV-1 infected carriers develop HAM/TSP or ATLL and about ninety-five percent remain asymptomatic. Therefore, the proviral load with Tax may affect cellular genes such as cytokines and oncogenes, as well as involve in pathogenicity. Thirty HAM/TSP patients, thirty HTLV-1 healthy carriers, and MT-2 cell line were evaluated for HTLV-1 activity. PBMCs were isolated and activated using PMA and ionomycine. Real-time PCR and TaqMan methods were performed using specific primers and fluorescence probes for Tax expression and proviral load assessment. B2microglobulin (β2m) and albumin were used as controls in Tax expression and in proviral load, respectively. An insignificant increase in Tax expression was observed in rest PBMCs of HAM/TSP patients compared to healthy carriers. However, after lymphocyte activation there was a significant increase in Tax expression in HAM/TSP patients (P=0.042). The Proviral load in patients was significantly higher than in carriers. Moreover, there was a significant correlation between Tax mRNA expression in activated PBMCs and proviral load (R=0.37, P=0.012). Although proviral load had been addressed as a valuable index for monitoring HTLV-1 infected subjects, the results of this study demonstrated that Tax expression in activated PBMCs along with proviral load assessment in HAM/TSP patients are a more reliable factor for determining the prognosis and monitoring healthy carriers and HAM/TSP patients.
ATM facilitates mouse gammaherpesvirus reactivation from myeloid cells during chronic infection
Kulinski, Joseph M.; Darrah, Eric J.; Broniowska, Katarzyna A.; Mboko, Wadzanai P.; Mounce, Bryan C.; Malherbe, Laurent P.; Corbett, John A; Gauld, Stephen B.; Tarakanova, Vera L.
2015-01-01
Gammaherpesviruses are cancer-associated pathogens that establish life-long infection in most adults. Insufficiency of Ataxia-Telangiectasia mutated (ATM) kinase leads to a poor control of chronic gammaherpesvirus infection via an unknown mechanism that likely involves a suboptimal antiviral response. In contrast to the phenotype in the intact host, ATM facilitates gammaherpesvirus reactivation and replication in vitro. We hypothesized that ATM mediates both pro- and antiviral activities to regulate chronic gammaherpesvirus infection in an immunocompetent host. To test the proposed proviral activity of ATM in vivo, we generated mice with ATM deficiency limited to myeloid cells. Myeloid-specific ATM deficiency attenuated gammaherpesvirus infection during the establishment of viral latency. The results of our study uncover a proviral role of ATM in the context of gammaherpesvirus infection in vivo and support a model where ATM combines pro- and antiviral functions to facilitate both gammaherpesvirus-specific T cell immune response and viral reactivation in vivo. PMID:26001649
Persaud, Deborah; Patel, Kunjal; Karalius, Brad; Rainwater-Lovett, Kaitlin; Ziemniak, Carrie; Ellis, Angela; Chen, Ya Hui; Richman, Douglas; Siberry, George K.; Van Dyke, Russell B.; Burchett, Sandra; Seage, George R.; Luzuriaga, Katherine
2014-01-01
Importance Combination antiretroviral therapy (cART) initiated within several weeks of HIV infection in adults limits proviral reservoirs that preclude HIV cure. Biomarkers of restricted proviral reservoirs may aid in the monitoring of HIV remission or cure. Objectives To quantify peripheral blood proviral reservoir size in perinatally HIV-infected adolescents and to identify correlates of limited proviral reservoirs. Design, Setting, and Participants A cross-sectional study including 144 perinatally HIV-infected (PHIV+) youth (median age: 14.3 years), enrolled in the US-based Pediatric HIV/AIDS Cohort Study, on durable (median: 10.2 years) cART, stratified by age at virologic control. Main Outcome and Measures The primary endpoint was peripheral blood mononuclear cell (PBMC) proviral load following virologic control at different ages. Correlations between proviral load and markers of active HIV production (HIV-specific antibodies, 2-long terminal repeat (2-LTR) circles), and markers of immune activation and inflammation were also assessed. Results Proviral reservoir size was markedly reduced in the PHIV+ youth who achieved virologic control by age 1 year (4.2 [interquartile range, 2.6-8 6] copies per 1 million PBMCs) compared to those who achieved virologic control between 1-5 years of age (19.4 [interquartile range, 5.5-99.8] copies per 1 million PBMCs) or after age 5 years (−(70.7 [interquartile range, 23.2-209.4] copies per 1 million PBMCs; P < .00l). A proviral burden <10 copies/million PBMCs was measured in 11 (79%), 20 (40%), and 13 (18%) participants with virologic control at ages <1 year, 1-5 years, and >5 years, respectively (p<0.001). Lower proviral load was associated with undetectable 2-LTR circles (p<0.001) and HIV negative or indeterminate serostatus (p<0.001), but not with concentrations of soluble immune activation markers CD14 and CD163. Conclusions and Relevance Early effective cART along with prolonged virologic suppression after perinatal HIV infection leads to negligible peripheral blood proviral reservoirs in adolescence and is associated with negative or indeterminate HIV serostatus. These findings highlight the long-term effect of early effective control of HIV replication on biomarkers of HIV persistence in perinatal infection and the utility of HIV serostatus as a biomarker for small proviral reservoir size, though not necessarily of cure. PMID:25286283
Swenson, Luke C; Moores, Andrew; Low, Andrew J; Thielen, Alexander; Dong, Winnie; Woods, Conan; Jensen, Mark A; Wynhoven, Brian; Chan, Dennison; Glascock, Christopher; Harrigan, P Richard
2010-08-01
Tropism testing should rule out CXCR4-using HIV before treatment with CCR5 antagonists. Currently, the recombinant phenotypic Trofile assay (Monogram) is most widely utilized; however, genotypic tests may represent alternative methods. Independent triplicate amplifications of the HIV gp120 V3 region were made from either plasma HIV RNA or proviral DNA. These underwent standard, population-based sequencing with an ABI3730 (RNA n = 63; DNA n = 40), or "deep" sequencing with a Roche/454 Genome Sequencer-FLX (RNA n = 12; DNA n = 12). Position-specific scoring matrices (PSSMX4/R5) (-6.96 cutoff) and geno2pheno[coreceptor] (5% false-positive rate) inferred tropism from V3 sequence. These methods were then independently validated with a separate, blinded dataset (n = 278) of screening samples from the maraviroc MOTIVATE trials. Standard sequencing of HIV RNA with PSSM yielded 69% sensitivity and 91% specificity, relative to Trofile. The validation dataset gave 75% sensitivity and 83% specificity. Proviral DNA plus PSSM gave 77% sensitivity and 71% specificity. "Deep" sequencing of HIV RNA detected >2% inferred-CXCR4-using virus in 8/8 samples called non-R5 by Trofile, and <2% in 4/4 samples called R5. Triplicate analyses of V3 standard sequence data detect greater proportions of CXCR4-using samples than previously achieved. Sequencing proviral DNA and "deep" V3 sequencing may also be useful tools for assessing tropism.
Luzuriaga, Katherine; Tabak, Barbara; Garber, Manuel; Chen, Ya Hui; Ziemniak, Carrie; McManus, Margaret M.; Murray, Danielle; Strain, Matthew C.; Richman, Douglas D.; Chun, Tae-Wook; Cunningham, Coleen K.; Persaud, Deborah
2014-01-01
Background. Early initiation of combination antiretroviral therapy (cART) to human immunodeficiency virus type 1 (HIV-1)–infected infants controls HIV-1 replication and reduces mortality. Methods. Plasma viremia (lower limit of detection, <2 copies/mL), T-cell activation, HIV-1–specific immune responses, and the persistence of cells carrying replication-competent virus were quantified during long-term effective combination antiretroviral therapy (cART) in 4 perinatally HIV-1–infected youth who received treatment early (the ET group) and 4 who received treatment late (the LT group). Decay in peripheral blood mononuclear cell (PBMC) proviral DNA levels was also measured over time in the ET youth. Results. Plasma viremia was not detected in any ET youth but was detected in all LT youth (median, 8 copies/mL; P = .03). PBMC proviral load was significantly lower in ET youth (median, 7 copies per million PBMCs) than in LT youth (median, 181 copies; P = .03). Replication-competent virus was recovered from all LT youth but only 1 ET youth. Decay in proviral DNA was noted in all 4 ET youth in association with limited T-cell activation and with absent to minimal HIV-1–specific immune responses. Conclusions. Initiation of early effective cART during infancy significantly limits circulating levels of proviral and replication-competent HIV-1 and promotes continuous decay of viral reservoirs. Continued cART with reduction in HIV-1 reservoirs over time may facilitate HIV-1 eradication strategies. PMID:24850788
ATM facilitates mouse gammaherpesvirus reactivation from myeloid cells during chronic infection.
Kulinski, Joseph M; Darrah, Eric J; Broniowska, Katarzyna A; Mboko, Wadzanai P; Mounce, Bryan C; Malherbe, Laurent P; Corbett, John A; Gauld, Stephen B; Tarakanova, Vera L
2015-09-01
Gammaherpesviruses are cancer-associated pathogens that establish life-long infection in most adults. Insufficiency of Ataxia-Telangiectasia mutated (ATM) kinase leads to a poor control of chronic gammaherpesvirus infection via an unknown mechanism that likely involves a suboptimal antiviral response. In contrast to the phenotype in the intact host, ATM facilitates gammaherpesvirus reactivation and replication in vitro. We hypothesized that ATM mediates both pro- and antiviral activities to regulate chronic gammaherpesvirus infection in an immunocompetent host. To test the proposed proviral activity of ATM in vivo, we generated mice with ATM deficiency limited to myeloid cells. Myeloid-specific ATM deficiency attenuated gammaherpesvirus infection during the establishment of viral latency. The results of our study uncover a proviral role of ATM in the context of gammaherpesvirus infection in vivo and support a model where ATM combines pro- and antiviral functions to facilitate both gammaherpesvirus-specific T cell immune response and viral reactivation in vivo. Copyright © 2015 Elsevier Inc. All rights reserved.
Levin, M C; Fox, R J; Lehky, T; Walter, M; Fox, C H; Flerlage, N; Bamford, R; Jacobson, S
1996-01-01
PCR-in situ hybridization (PCR-ISH) was developed and utilized to determine the distribution of human T-cell lymphotropic virus type 1 (HTLV-1) tax proviral DNA in peripheral blood lymphocytes (PBL) from patients with HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). PCR-ISH of HTLV-1 tax DNA in PBL from patients with HAM/TSP revealed that 1 in 5,000 to 1 in 10,000 PBL contained virus. PCR-ISH was sensitive, because a positive signal was consistently demonstrated from the HTLV-1-infected cell lines HUT-102 (which contains four to six copies of HTLV-1 proviral DNA per cell) and MT-1 (which contains one to three copies of HTLV-1 proviral DNA per cell). Also, intracellular amplification by PCR-ISH significantly increased sensitivity compared with conventional ISH and was shown to be specific for HTLV-1 tax DNA. These results are in contrast to solution-phase PCR amplification in which greater than 1% of cells were estimated to be infected. The discordance between these results is discussed and may indicate that more than one copy of HTLV-1 tax proviral DNA is present in an individual PBL. PMID:8551632
Rev-binding aptamer and CMV promoter act as decoys to inhibit HIV replication.
Konopka, K; Lee, N S; Rossi, J; Düzgüneş, N
2000-09-19
We examined whether the antiviral effect of an HIV-1 Rev-binding aptamer [RBE(apt)] could be enhanced by a ribozyme directed against the HIV-1 env gene, and whether the antiviral activity was affected by different promoters. The efficacy of the aptamer and ribozyme DNAs was tested in HeLa cells co-transfected with the HIV-1 proviral clones, HXBDeltaBgl or pNL4-3, using transferrin-lipoplexes. The RBE(apt) and anti-env ribozyme genes were inserted into the pTZU6+27 plasmid, or constructed under the control of the human cytomegalovirus (CMV) or Rous sarcoma virus (RSV) promoters. The parental vector plasmids were used as controls. Co-transfection of the pTZU6+27 RBE(apt) plasmid with HXBDeltaBgl, or pNL4-3, at a weight ratio of 5:1, inhibited p24 production by 70 and 45%, respectively. The RSV RBE(apt) plasmid co-transfected with either HIV clone, at the same weight ratio, reduced viral production by 88%. The addition of the anti-env ribozyme to the RSV RBE(apt) did not enhance its antiviral activity. When the constructs were under the control of the CMV promoter, the expression of the HIV plasmids was very low and was independent of the presence of the RBE(apt). Thus, the effect of the RBE(apt) was strongly dependent on the promoter of the tested construct. The anti-HIV activity of the CMV RBE(apt) construct was non-specific, because co-transfection with either pCMV. SPORT-betagal or pCMVlacZ significantly suppressed HIV production from the HIV proviral clones. The reduction in p24 could not be attributed to the non-specific toxicity of the transfection procedure. Transfection of acutely HIV-infected HeLa-CD4 cells with pCMV.SPORT-betagal reduced the p24 level by 35%, while the expression of the U6 RBE(apt) did not affect p24 production. The suppression of HIV production from the HIV proviral clones by the CMV promoter constructs in the co-transfection assays may be explained by competition for transcription factors (TFs) between HIV and CMV promoters. This observation points to the potential for misleading results in co-transfections involving CMV constructs and HIV.
A universal real-time PCR assay for the quantification of group-M HIV-1 proviral load.
Malnati, Mauro S; Scarlatti, Gabriella; Gatto, Francesca; Salvatori, Francesca; Cassina, Giulia; Rutigliano, Teresa; Volpi, Rosy; Lusso, Paolo
2008-01-01
Quantification of human immunodeficiency virus type-1 (HIV-1) proviral DNA is increasingly used to measure the HIV-1 cellular reservoirs, a helpful marker to evaluate the efficacy of antiretroviral therapeutic regimens in HIV-1-infected individuals. Furthermore, the proviral DNA load represents a specific marker for the early diagnosis of perinatal HIV-1 infection and might be predictive of HIV-1 disease progression independently of plasma HIV-1 RNA levels and CD4(+) T-cell counts. The high degree of genetic variability of HIV-1 poses a serious challenge for the design of a universal quantitative assay capable of detecting all the genetic subtypes within the main (M) HIV-1 group with similar efficiency. Here, we describe a highly sensitive real-time PCR protocol that allows for the correct quantification of virtually all group-M HIV-1 strains with a higher degree of accuracy compared with other methods. The protocol involves three stages, namely DNA extraction/lysis, cellular DNA quantification and HIV-1 proviral load assessment. Owing to the robustness of the PCR design, this assay can be performed on crude cellular extracts, and therefore it may be suitable for the routine analysis of clinical samples even in developing countries. An accurate quantification of the HIV-1 proviral load can be achieved within 1 d from blood withdrawal.
Edmonds, Tara G.; Ding, Haitao; Yuan, Xing; Wei, Qing; Smith, Kendra S.; Conway, Joan A.; Wieczorek, Lindsay; Brown, Bruce; Polonis, Victoria; West, John T.; Montefiori, David C.; Kappes, John C.; Ochsenbauer, Christina
2010-01-01
Effective vaccine development for human immunodeficiency virus type 1 (HIV-1) will require assays that ascertain the capacity of vaccine immunogens to elicit neutralizing antibodies (NAb) to diverse HIV-1 strains. To facilitate NAb assessment in peripheral blood mononuclear cell (PBMC)-based assays, we developed an assay-adaptable platform based on a Renilla luciferase (LucR) expressing HIV-1 proviral backbone. LucR was inserted into pNL4-3 DNA, preserving all viral open reading frames. The proviral genome was engineered to facilitate expression of diverse HIV-1 env sequences, allowing analysis in an isogenic background. The resulting Env-IMC-LucR viruses are infectious, and LucR is stably expressed over multiple replications in PBMC. HIV-1 neutralization, targeting TZM-bl cells, was highly correlative comparing virus (LucR) and cell (firefly luciferase) readouts. In PBMC, NAb activity can be analyzed either within a single or multiple cycles of replication. These results represent advancement toward a standardizable PBMC-based neutralization assay for assessing HIV-1 vaccine immunogen efficacy. PMID:20863545
Edmonds, Tara G; Ding, Haitao; Yuan, Xing; Wei, Qing; Smith, Kendra S; Conway, Joan A; Wieczorek, Lindsay; Brown, Bruce; Polonis, Victoria; West, John T; Montefiori, David C; Kappes, John C; Ochsenbauer, Christina
2010-12-05
Effective vaccine development for human immunodeficiency virus type 1 (HIV-1) will require assays that ascertain the capacity of vaccine immunogens to elicit neutralizing antibodies (NAb) to diverse HIV-1 strains. To facilitate NAb assessment in peripheral blood mononuclear cell (PBMC)-based assays, we developed an assay-adaptable platform based on a Renilla luciferase (LucR) expressing HIV-1 proviral backbone. LucR was inserted into pNL4-3 DNA, preserving all viral open reading frames. The proviral genome was engineered to facilitate expression of diverse HIV-1 env sequences, allowing analysis in an isogenic background. The resulting Env-IMC-LucR viruses are infectious, and LucR is stably expressed over multiple replications in PBMC. HIV-1 neutralization, targeting TZM-bl cells, was highly correlative comparing virus (LucR) and cell (firefly luciferase) readouts. In PBMC, NAb activity can be analyzed either within a single or multiple cycles of replication. These results represent advancement toward a standardizable PBMC-based neutralization assay for assessing HIV-1 vaccine immunogen efficacy. Copyright © 2010 Elsevier Inc. All rights reserved.
Meekings, Kiran N.; Leipzig, Jeremy; Bushman, Frederic D.; Taylor, Graham P.; Bangham, Charles R. M.
2008-01-01
Human T-lymphotropic virus type 1 (HTLV-1) causes leukaemia or chronic inflammatory disease in ∼5% of infected hosts. The level of proviral expression of HTLV-1 differs significantly among infected people, even at the same proviral load (proportion of infected mononuclear cells in the circulation). A high level of expression of the HTLV-1 provirus is associated with a high proviral load and a high risk of the inflammatory disease of the central nervous system known as HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). But the factors that control the rate of HTLV-1 proviral expression remain unknown. Here we show that proviral integration sites of HTLV-1 in vivo are not randomly distributed within the human genome but are associated with transcriptionally active regions. Comparison of proviral integration sites between individuals with high and low levels of proviral expression, and between provirus-expressing and provirus non-expressing cells from within an individual, demonstrated that frequent integration into transcription units was associated with an increased rate of proviral expression. An increased frequency of integration sites in transcription units in individuals with high proviral expression was also associated with the inflammatory disease HAM/TSP. By comparing the distribution of integration sites in human lymphocytes infected in short-term cell culture with those from persistent infection in vivo, we infer the action of two selective forces that shape the distribution of integration sites in vivo: positive selection for cells containing proviral integration sites in transcriptionally active regions of the genome, and negative selection against cells with proviral integration sites within transcription units. PMID:18369476
1989-03-10
fragment of the HIV-1 genome was isolated from XBH10 and inserted into an M13 phage vector. Mutations were introduced by use of 25-mer oligonucleotides which... M13 by Eco RI and religated into the corresponding position of pHXB2gpt. The mutant AS was prepared directly from pHXB2gpt by digestion with Nde I and...detect immunocomplexes. Molecular Cloning and Sequencing of Proviral DNA A X phage library was constructed from the genomic DNA isolated from Hut78 cells
Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L
1997-05-02
Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.
Takeshima, Shin-Nosuke; Sasaki, Shinji; Meripet, Polat; Sugimoto, Yoshikazu; Aida, Yoko
2017-04-04
Bovine leukemia virus (BLV) is the causative agent of enzootic bovine leukosis, a malignant B cell lymphoma that has spread worldwide and causes serious problems for the cattle industry. The BLV proviral load, which represents the BLV genome integrated into host genome, is a useful index for estimating disease progression and transmission risk. Here, we conducted a genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with BLV proviral load in Japanese Black cattle. The study examined 93 cattle with a high proviral load and 266 with a low proviral load. Three SNPs showed a significant association with proviral load. One SNP was detected in the CNTN3 gene on chromosome 22, and two (which were not in linkage disequilibrium) were detected in the bovine major histocompatibility complex region on chromosome 23. These results suggest that polymorphisms in the major histocompatibility complex region affect proviral load. This is the first report to detect SNPs associated with BLV proviral load in Japanese Black cattle using whole genome association study, and understanding host factors may provide important clues for controlling the spread of BLV in Japanese Black cattle.
Characterization of proviruses cloned from mink cell focus-forming virus-infected cellular DNA.
Khan, A S; Repaske, R; Garon, C F; Chan, H W; Rowe, W P; Martin, M A
1982-01-01
Two proviruses were cloned from EcoRI-digested DNA extracted from mink cells chronically infected with AKR mink cell focus-forming (MCF) 247 murine leukemia virus (MuLV), using a lambda phage host vector system. One cloned MuLV DNA fragment (designated MCF 1) contained sequences extending 6.8 kilobases from an EcoRI restriction site in the 5' long terminal repeat (LTR) to an EcoRI site located in the envelope (env) region and was indistinguishable by restriction endonuclease mapping for 5.1 kilobases (except for the EcoRI site in the LTR) from the 5' end of AKR ecotropic proviral DNA. The DNA segment extending from 5.1 to 6.8 kilobases contained several restriction sites that were not present in the AKR ecotropic provirus. A 0.5-kilobase DNA segment located at the 3' end of MCF 1 DNA contained sequences which hybridized to a xenotropic env-specific DNA probe but not to labeled ecotropic env-specific DNA. This dual character of MCF 1 proviral DNA was also confirmed by analyzing heteroduplex molecules by electron microscopy. The second cloned proviral DNA (designated MCF 2) was a 6.9-kilobase EcoRI DNA fragment which contained LTR sequences at each end and a 2.0-kilobase deletion encompassing most of the env region. The MCF 2 proviral DNA proved to be a useful reagent for detecting LTRs electron microscopically due to the presence of nonoverlapping, terminally located LTR sequences which effected its circularization with DNAs containing homologous LTR sequences. Nucleotide sequence analysis demonstrated the presence of a 104-base-pair direct repeat in the LTR of MCF 2 DNA. In contrast, only a single copy of the reiterated component of the direct repeat was present in MCF 1 DNA. Images PMID:6281459
A human genome-wide loss-of-function screen identifies effective chikungunya antiviral drugs
Karlas, Alexander; Berre, Stefano; Couderc, Thérèse; Varjak, Margus; Braun, Peter; Meyer, Michael; Gangneux, Nicolas; Karo-Astover, Liis; Weege, Friderike; Raftery, Martin; Schönrich, Günther; Klemm, Uwe; Wurzlbauer, Anne; Bracher, Franz; Merits, Andres; Meyer, Thomas F.; Lecuit, Marc
2016-01-01
Chikungunya virus (CHIKV) is a globally spreading alphavirus against which there is no commercially available vaccine or therapy. Here we use a genome-wide siRNA screen to identify 156 proviral and 41 antiviral host factors affecting CHIKV replication. We analyse the cellular pathways in which human proviral genes are involved and identify druggable targets. Twenty-one small-molecule inhibitors, some of which are FDA approved, targeting six proviral factors or pathways, have high antiviral activity in vitro, with low toxicity. Three identified inhibitors have prophylactic antiviral effects in mouse models of chikungunya infection. Two of them, the calmodulin inhibitor pimozide and the fatty acid synthesis inhibitor TOFA, have a therapeutic effect in vivo when combined. These results demonstrate the value of loss-of-function screening and pathway analysis for the rational identification of small molecules with therapeutic potential and pave the way for the development of new, host-directed, antiviral agents. PMID:27177310
A human genome-wide loss-of-function screen identifies effective chikungunya antiviral drugs.
Karlas, Alexander; Berre, Stefano; Couderc, Thérèse; Varjak, Margus; Braun, Peter; Meyer, Michael; Gangneux, Nicolas; Karo-Astover, Liis; Weege, Friderike; Raftery, Martin; Schönrich, Günther; Klemm, Uwe; Wurzlbauer, Anne; Bracher, Franz; Merits, Andres; Meyer, Thomas F; Lecuit, Marc
2016-05-12
Chikungunya virus (CHIKV) is a globally spreading alphavirus against which there is no commercially available vaccine or therapy. Here we use a genome-wide siRNA screen to identify 156 proviral and 41 antiviral host factors affecting CHIKV replication. We analyse the cellular pathways in which human proviral genes are involved and identify druggable targets. Twenty-one small-molecule inhibitors, some of which are FDA approved, targeting six proviral factors or pathways, have high antiviral activity in vitro, with low toxicity. Three identified inhibitors have prophylactic antiviral effects in mouse models of chikungunya infection. Two of them, the calmodulin inhibitor pimozide and the fatty acid synthesis inhibitor TOFA, have a therapeutic effect in vivo when combined. These results demonstrate the value of loss-of-function screening and pathway analysis for the rational identification of small molecules with therapeutic potential and pave the way for the development of new, host-directed, antiviral agents.
Yano, Yoko; Kobayashi, Seiichi; Yasumizu, Ryoji; Tamaki, Junko; Kubo, Mitsumasa; Sasaki, Akio; Hasan, Shahid; Okuyama, Harue; Inaba, Muneo; Ikehara, Susumu; Hiai, Hiroshi; Kakinuma, Mitsuaki
1991-01-01
Among 18 thymic leukemia cell lines which have been established from spontaneous thymic lym‐phomas in AKR mice as well as in bone marrow chimeras which were constructed by transplanting allogeneic bone marrow cells into irradiated AKR mice, three proviral integration sites were identified; near c‐myc, N‐myc and pim‐l loci. No integration site specific for chimeric leukemia cell lines was found. In three thymic leukemia cell lines which contained rearranged N‐myc, genes, insertions of long terminal repeats (LTRs) of murine leukemia viruses were detected at 18 or 20 bp downstream of the translational termination codon. These results demonstrate that the 3’region of the N‐myc gene is one of the integration targets for murine leukemia viruses in spontaneous thymic lymphomas. In these three cell lines, N‐myc mRNA was stably transcribed and transcription of c‐myc mRNA was down‐regulated. The integrated murine leukemia viruses in AKR thymic leukemia were most likely AKV, though the DNA sequence of the LTR inserted in the genome of a leukemic cell line from [(BALB/c × B6)F1‐AKR], CAK20, was different from LTRs of murine leukemia viruses so far reported. PMID:1900822
In vitro modeling of HIV proviral activity in microglia.
Campbell, Lee A; Richie, Christopher T; Zhang, Yajun; Heathward, Emily J; Coke, Lamarque M; Park, Emily Y; Harvey, Brandon K
2017-12-01
Microglia, the resident macrophages of the brain, play a key role in the pathogenesis of HIV-associated neurocognitive disorders (HAND) due to their productive infection by HIV. This results in the release of neurotoxic viral proteins and pro-inflammatory compounds which negatively affect the functionality of surrounding neurons. Because models of HIV infection within the brain are limited, we aimed to create a novel microglia cell line with an integrated HIV provirus capable of recreating several hallmarks of HIV infection. We utilized clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 gene editing technology and integrated a modified HIV provirus into CHME-5 immortalized microglia to create HIV-NanoLuc CHME-5. In the modified provirus, the Gag-Pol region is replaced with the coding region for NanoLuciferase (NanoLuc), which allows for the rapid assay of HIV long terminal repeat activity using a luminescent substrate, while still containing the necessary genetic material to produce established neurotoxic viral proteins (e.g. tat, nef, gp120). We confirmed that HIV-NanoLuc CHME-5 microglia express NanoLuc, along with the HIV viral protein Nef. We subsequently exposed these cells to a battery of experiments to modulate the activity of the provirus. Proviral activity was enhanced by treating the cells with pro-inflammatory factors lipopolysaccharide (LPS) and tumor necrosis factor alpha and by overexpressing the viral regulatory protein Tat. Conversely, genetic modification of the toll-like receptor-4 gene by CRISPR/Cas9 reduced LPS-mediated proviral activation, and pharmacological application of NF-κB inhibitor sulfasalazine similarly diminished proviral activity. Overall, these data suggest that HIV-NanoLuc CHME-5 may be a useful tool in the study of HIV-mediated neuropathology and proviral regulation. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.
Khan, A S
1984-01-01
The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017
Sperber, Göran; Lövgren, Anders; Eriksson, Nils-Einar; Benachenhou, Farid; Blomberg, Jonas
2009-01-01
Background The rapid accumulation of genomic information in databases necessitates rapid and specific algorithms for extracting biologically meaningful information. More or less complete retroviral sequences, also called proviral or endogenous retroviral sequences; ERVs, constitutes at least 5% of vertebrate genomes. After infecting the host, these retroviruses have integrated in germ line cells, and have then been carried in genomes for at least several 100 million years. A better understanding of structure and function of these sequences can have profound biological and medical consequences. Methods RetroTector© (ReTe) is a platform-independent Java program for identification and characterization of proviral sequences in vertebrate genomes. The full ReTe requires a local installation with a MySQL database. Although not overly complicated, the installation may take some time. A "light" version of ReTe, (RetroTector online; ROL) which does not require specific installation procedures is provided, via the World Wide Web. Results ROL was implemented under the Batchelor web interface (A Lövgren et al). It allows both GenBank accession number, file and FASTA cut-and-paste admission of sequences (5 to 10 000 kilobases). Up to ten submissions can be done simultaneously, allowing batch analysis of <= 100 Megabases. Jobs are shown in an IP-number specific list. Results are text files, and can be viewed with the program, RetroTectorViewer.jar (at the same site), which has the full graphical capabilities of the basic ReTe program. A detailed analysis of any retroviral sequences found in the submitted sequence is graphically presented, exportable in standard formats. With the current server, a complete analysis of a 1 Megabase sequence is complete in 10 minutes. It is possible to mask nonretroviral repetitive sequences in the submitted sequence, using host genome specific "brooms", which increase specificity. Discussion Proviral sequences can be hard to recognize, especially if the integration occurred many million years ago. Precise delineation of LTR, gag, pro, pol and env can be difficult, requiring manual work. ROL is a way of simplifying these tasks. Conclusion ROL provides 1. annotation and presentation of known retroviral sequences, 2. detection of proviral chains in unknown genomic sequences, with up to 100 Mbase per submission. PMID:19534753
Sperber, Göran; Lövgren, Anders; Eriksson, Nils-Einar; Benachenhou, Farid; Blomberg, Jonas
2009-06-16
The rapid accumulation of genomic information in databases necessitates rapid and specific algorithms for extracting biologically meaningful information. More or less complete retroviral sequences, also called proviral or endogenous retroviral sequences; ERVs, constitutes at least 5% of vertebrate genomes. After infecting the host, these retroviruses have integrated in germ line cells, and have then been carried in genomes for at least several 100 million years. A better understanding of structure and function of these sequences can have profound biological and medical consequences. RetroTector (ReTe) is a platform-independent Java program for identification and characterization of proviral sequences in vertebrate genomes. The full ReTe requires a local installation with a MySQL database. Although not overly complicated, the installation may take some time. A "light" version of ReTe, (RetroTector online; ROL) which does not require specific installation procedures is provided, via the World Wide Web. ROL http://www.fysiologi.neuro.uu.se/jbgs/ was implemented under the Batchelor web interface (A Lövgren et al). It allows both GenBank accession number, file and FASTA cut-and-paste admission of sequences (5 to 10,000 kilobases). Up to ten submissions can be done simultaneously, allowing batch analysis of
Molecular cytogenetic analysis of feline leukemia virus insertions in cat lymphoid tumor cells.
Fujino, Yasuhito; Satoh, Hitoshi; Ohno, Koichi; Tsujimoto, Hajime
2010-02-01
This study was conducted to map the acquired proviral insertions in the chromosomal genome of feline lymphoid tumors induced by feline leukemia virus (FeLV). Chromosome specimens of the lymphoid tumor-derived cell lines and normal cat lymphocytes were subjected to fluorescence in situ hybridization and tyramide signal amplification, using an exogenous FeLV-A genome as a probe. Specific hybridization signals were detected only on the metaphase chromosomes of the tumor cells. Poisson's distribution-based statistics indicated that 6 chromosomal loci in each cell line showed FeLV integration. In the examination of metaphase chromosomes of FL-74, FT-1 and KO-1 cells, significant signals were detected on B2p15-p14, B2q11, D1p14, E1p14-p13, E1q12 and F2q16; A2p23-p22, B2p15-p14, B4p15-p14, D4q23-q24, E1p14-p13 and E2p13-p12; and A2p22, A3q22, B1p13, B1q13, D1p13 and D3p15-p14, respectively. Consistently, Southern blot hybridization using an FeLV LTR-U3 probe specific for exogenous FeLV revealed the presence of at least 6 copies of exogenous FeLV proviruses at different integration sites in each cell line. These results indicate that there may be common FeLV integration sites at least in A2p22 and B2p15-p14. The cytogenetic analysis used in this study can promptly screen FeLV insertions and provide tags for identifying the novel common integration site. 2009 Elsevier B.V. All rights reserved.
Ruiz-Riol, M; Berdnik, D; Llano, A; Mothe, B; Gálvez, C; Pérez-Álvarez, S; Oriol-Tordera, B; Olvera, A; Silva-Arrieta, S; Meulbroek, M; Pujol, F; Coll, J; Martinez-Picado, J; Ganoza, C; Sanchez, J; Gómez, G; Wyss-Coray, T; Brander, C
2017-08-15
Intact and broad immune cell effector functions and specific individual cytokines have been linked to HIV disease outcome, but their relative contribution to HIV control remains unclear. We asked whether the proteome of secreted cytokines and signaling factors in peripheral blood can be used to discover specific pathways critical for host viral control. A custom glass-based microarray, able to measure >600 plasma proteins involved in cell-to-cell communication, was used to measure plasma protein profiles in 96 HIV-infected, treatment-naive individuals with high (>50,000) or low (<10,000 HIV RNA copies/ml) viral loads. Univariate and regression model analysis demonstrate that plasma levels of soluble interleukin-27 (IL-27) are significantly elevated in individuals with high plasma viremia ( P < 0.0001) and are positively correlated with proviral HIV-DNA copy numbers in peripheral blood mononuclear cells (PBMC) (Rho = 0.4011; P = 0.0027). Moreover, soluble IL-27 plasma levels are negatively associated with the breadth and magnitude of the total virus-specific T-cell responses and directly with plasma levels of molecules involved in Wnt/β-catenin signaling. In addition to IL-27, gene expression levels of the specific IL-27 receptor ( IL27RA ) in PBMC correlated directly with both plasma viral load (Rho = 0.3531; P = 0.0218) and the proviral copy number in the peripheral blood as an indirect measure of partial viral reservoir (Rho = 0.4580; P = 0.0030). These results were validated in unrelated cohorts of early infected subjects as well as subjects before and after initiation of antiretroviral treatment, and they identify IL-27 and its specific receptor as a critical immune axis for the antiviral immune response and as robust correlates of viral load and proviral reservoir size in PBMC. IMPORTANCE The detailed knowledge of immune mechanisms that contribute to HIV control is a prerequisite for the design of effective treatment strategies to achieve HIV cure. Cells communicate with each other by secreting signaling proteins, and the blood is a key conduit for transporting such factors. Investigating the communication factors promoting effective immune responses and having potentially antiviral functions against HIV using a novel focused omics approach ("communicome") has the potential to significantly improve our knowledge of effective host immunity and accelerate the HIV cure agenda. Including 140 subjects with variable viral loads and measuring the plasma levels of >600 soluble proteins, our data highlight the importance of Th17 cells and Wnt/β-catenin signaling in HIV control and especially identify the IL-27/IL-27 receptor subunit alpha (IL-27RA) axis as a predictor of plasma viral load and proviral copy number in the peripheral blood. These data may provide important guidance to therapeutic approaches in the HIV cure agenda. Copyright © 2017 Ruiz-Riol et al.
Shao, Wei; Shan, Jigui; Kearney, Mary F; Wu, Xiaolin; Maldarelli, Frank; Mellors, John W; Luke, Brian; Coffin, John M; Hughes, Stephen H
2016-07-04
The NCI Retrovirus Integration Database is a MySql-based relational database created for storing and retrieving comprehensive information about retroviral integration sites, primarily, but not exclusively, HIV-1. The database is accessible to the public for submission or extraction of data originating from experiments aimed at collecting information related to retroviral integration sites including: the site of integration into the host genome, the virus family and subtype, the origin of the sample, gene exons/introns associated with integration, and proviral orientation. Information about the references from which the data were collected is also stored in the database. Tools are built into the website that can be used to map the integration sites to UCSC genome browser, to plot the integration site patterns on a chromosome, and to display provirus LTRs in their inserted genome sequence. The website is robust, user friendly, and allows users to query the database and analyze the data dynamically. https://rid.ncifcrf.gov ; or http://home.ncifcrf.gov/hivdrp/resources.htm .
A contaminant-free assessment of Endogenous Retroviral RNA in human plasma
Karamitros, Timokratis; Paraskevis, Dimitrios; Hatzakis, Angelos; Psichogiou, Mina; Elefsiniotis, Ioannis; Hurst, Tara; Geretti, Anna-Maria; Beloukas, Apostolos; Frater, John; Klenerman, Paul; Katzourakis, Aris; Magiorkinis, Gkikas
2016-01-01
Endogenous retroviruses (ERVs) comprise 6–8% of the human genome. HERVs are silenced in most normal tissues, up-regulated in stem cells and in placenta but also in cancer and HIV-1 infection. Crucially, there are conflicting reports on detecting HERV RNA in non-cellular clinical samples such as plasma that suggest the study of HERV RNA can be daunting. Indeed, we find that the use of real-time PCR in a quality assured clinical laboratory setting can be sensitive to low-level proviral contamination. We developed a mathematical model for low-level contamination that allowed us to design a laboratory protocol and standard operating procedures for robust measurement of HERV RNA. We focus on one family, HERV-K HML-2 (HK2) that has been most recently active even though they invaded our ancestral genomes almost 30 millions ago. We extensively validated our experimental design on a model cell culture system showing high sensitivity and specificity, totally eliminating the proviral contamination. We then tested 236 plasma samples from patients infected with HIV-1, HCV or HBV and found them to be negative. The study of HERV RNA for human translational studies should be performed with extensively validated protocols and standard operating procedures to control the widespread low-level human DNA contamination. PMID:27640347
Update on gene therapy of inherited immune deficiencies.
Engel, Barbara C; Kohn, Donald B; Podsakoff, Greg M
2003-10-01
Gene therapy has been under development as a way to correct inborn errors for many years. Recently, patients with two forms of inherited severe combined immunodeficiency (SCID), adenosine deaminase and X-linked, treated by three different clinical investigative teams, have shown significant immune reconstitution leading to protective immunity. These advances irrefutably prove the concept that hematopoietic progenitor cell gene therapy can ameliorate these diseases. However, due to proviral insertional oncogenesis, two individuals in one of the X-SCID studies developed T-cell leukemia more than two years after the gene transfer. Depending upon the results of long-term follow-up, the successes together with the side effects highlight the relative merits of this therapeutic approach.
ATM supports gammaherpesvirus replication by attenuating type I interferon pathway.
Darrah, Eric J; Stoltz, Kyle P; Ledwith, Mitchell; Tarakanova, Vera L
2017-10-01
Ataxia-Telangiectasia mutated (ATM) kinase participates in multiple networks, including DNA damage response, oxidative stress, and mitophagy. ATM also supports replication of diverse DNA and RNA viruses. Gammaherpesviruses are prevalent cancer-associated viruses that benefit from ATM expression during replication. This proviral role of ATM had been ascribed to its signaling within the DNA damage response network; other functions of ATM have not been considered. In this study increased type I interferon (IFN) responses were observed in ATM deficient gammaherpesvirus-infected macrophages. Using a mouse model that combines ATM and type I IFN receptor deficiencies we show that increased type I IFN response in the absence of ATM fully accounts for the proviral role of ATM during gammaherpesvirus replication. Further, increased type I IFN response rendered ATM deficient macrophages more susceptible to antiviral effects of type II IFN. This study identifies attenuation of type I IFN responses as the primary mechanism underlying proviral function of ATM during gammaherpesvirus infection. Copyright © 2017 Elsevier Inc. All rights reserved.
Akbarin, Mohammad Mehdi; Rahimi, Hossein; Hassannia, Tahereh; Shoja Razavi, Ghazaleh; Sabet, Faezeh; Shirdel, Abbas
2013-03-01
Human T Lymphocyte Virus Type one (HTLV-I) is a retrovirus that infects about 10-20 million people worldwide. Khorasan province in Iran is an endemic area. The majority of HTLV-I-infected individuals sustain healthy carriers but small proportion of infected population developed two progressive diseases: HAM/TSP and ATL. The proviral load could be a virological marker for disease monitoring, therefore in the present study HTLV-I proviral load has been evaluated in ATL and compared to HAM/TSP and healthy carriers. In this case series study, 47 HTLV-I infected individuals including 13 ATL, 23 HAM/TSP and 11 asymptomatic subjects were studied. Peripheral blood mononuclear cells (PBMCs) were investigated for presence of HTLV-I DNA provirus by PCR using LTR and Tax fragments. Then in infected subjects, HTLV-I proviral load was measured using real time PCR TaqMan method. The average age of patients in ATL was 52±8, in HAM/TSP 45.52±15.17 and in carrier's 38.65±14.9 years which differences were not statistically significant. The analysis of data showed a significant difference in mean WBC among study groups (ATL vs HAM/TSP and carriers P=0.0001). Moreover, mean HTLV-I proviral load was 11967.2 ± 5078, 409 ± 71.3 and 373.6 ± 143.3 in ATL, HAM/TSP and Healthy Carriers, respectively. The highest HTLV-I proviral load was measured in ATL group that had a significant correlation with WBC count (R=0.495, P=0.001). The proviral load variations between study groups was strongly significant (ATL vs carrier P=0.0001; ATL vs HAM/TSP P= 0.0001 and HAM/TSP vs carriers P< 0.05). Conclusion : The present study demonstrated that HTLV-I proviral load was higher in ATL group in comparison with HAM/TSP and healthy carriers. Therefore, HTLV-I proviral load is a prognostic factor for development of HTLV-I associated diseases and can be used as a monitoring marker for the efficiency of therapeutic regime.
Allavena, C; Rodallec, A; Leplat, A; Hall, N; Luco, C; Le Guen, L; Bernaud, C; Bouchez, S; André-Garnier, E; Boutoille, D; Ferré, V; Raffi, F
2018-01-01
Switch of antiretroviral therapy in virologically suppressed HIV-infected patients is frequent, to prevent toxicities, for simplification or convenience reasons. Pretherapeutic genotypic resistance testing on RNA can be lacking in some patients, which could enhance the risk of virologic failure, if resistance-associated mutations of the new regimen are not taken into account. Proviral DNA resistance testing in 69 virologically suppressed patients on antiretroviral treatment with no history of virological failure were pair-wised compared with pre-ART plasma RNA resistance testing. The median time between plasma (RNA testing) and whole blood (proviral DNA testing) was 47 months (IQR 29-63). A stop codon was evidenced in 23% (16/69) of proviral DNA sequences; these strains were considered as defective, non-replicative, and not taken into consideration. Within the non defective strains, concordance rate between plasma RNA and non-defective proviral DNA was high both on protease (194/220 concordant resistance-associated mutations=88%) and reverse transcriptase (28/37 concordant resistance-associated mutations=76%) genes. This study supports that proviral DNA testing might be an informative tool before switching antiretrovirals in virologically suppressed patients with no history of virological failure, but the interpretation should be restricted to non-defective viruses. Copyright © 2017 Elsevier B.V. All rights reserved.
Yin, Bin; Delwel, Ruud; Valk, Peter J.; Wallace, Margaret R.; Loh, Mignon L.; Shannon, Kevin M.
2009-01-01
NF1 inactivation occurs in specific human cancers, including juvenile myelomonocytic leukemia, an aggressive myeloproliferative disorder of childhood. However, evidence suggests that Nf1 loss alone does not cause leukemia. We therefore hypothesized that inactivation of the Nf1 tumor suppressor gene requires cooperating mutations to cause acute leukemia. To search for candidate genes that cooperate with Nf1 deficiency in leukemogenesis, we performed a forward genetic screen using retroviral insertion mutagenesis in Nf1 mutant mice. We identified 43 common proviral insertion sites that contain candidate genes involved in leukemogenesis. One of these genes, Bcl11a, confers a growth advantage in cultured Nf1 mutant hematopoietic cells and causes early onset of leukemia of either myeloid or lymphoid lineage in mice when expressed in Nf1-deficient bone marrow. Bcl11a-expressing cells display compromised p21Cip1 induction, suggesting that Bcl11a's oncogenic effects are mediated, in part, through suppression of p21Cip1. Importantly, Bcl11a is expressed in human chronic myelomonocytic leukemia and juvenile myelomonocytic leukemia samples. A subset of AML patients, who had poor outcomes, of 16 clusters, displayed high levels of BCL11A in leukemic cells. These findings suggest that deregulated Bcl11a cooperates with Nf1 in leukemogenesis, and a therapeutic strategy targeting the BCL11A pathway may prove beneficial in the treatment of leukemia. PMID:18948576
2013-01-01
Background HIV in Chile has a notification rate of 0.01%. Coreceptor antagonists are a family of antiretroviral drugs that are used with the prior knowledge of patients HIV-1 tropism. Viral RNA-based tropism detection requires a plasma viral load ≥1000 copies/mL, while proviral DNA-based detection can be performed regardless of plasma viral load. This test is useful in patients with low or undetectable viral loads and would benefit with a proper therapy. The aim of this study was to determine the correlation between HIV RNA and proviral genotypic DNA tropism tests. Findings Forty three Chilean patients were examined using population-based V3 sequencing, and a geno2pheno false-positive rate (FPR) cutoff values of 5, 5.75, 10 and 20%. With cutoff 5.75% a concordance of 88.4% in tropism prediction was found after a simultaneous comparison between HIV tropism assessment by RNA and DNA. In total, five discrepancies (11.6%) were found, 3 patients were RNA-R5/DNA-X4 and two were RNA-X4/DNA-R5. Proviral DNA enabled the prediction of tropism in patients with a low or undetectable viral load. For cutoff 5 and 5.75% genotypic testing using proviral DNA showed a similar sensitivity for X4 as RNA. We found that the highest sensitivity for detecting the X4 strain occurred with proviral DNA and cutoff of 10 and 20%. Viral loads were higher among X4 strain carriers than among R5 strain carriers (p < 0.05). Conclusions A high degree of concordance was found between tropism testing with RNA and testing with proviral DNA. Our results suggest that proviral DNA-based genotypic tropism testing is a useful option for patients with low or undetectable viral load who require a different therapy. PMID:24165156
McFall, Sally M; Wagner, Robin L; Jangam, Sujit R; Yamada, Douglas H; Hardie, Diana; Kelso, David M
2015-03-01
Early diagnosis and access to treatment for infants with human immunodeficiency virus-1 (HIV-1) is critical to reduce infant mortality. The lack of simple point-of-care tests impedes the timely initiation of antiretroviral therapy. The development of FINA, filtration isolation of nucleic acids, a novel DNA extraction method that can be performed by clinic personnel in less than 2 min has been reported previously. In this report, significant improvements in the DNA extraction and amplification methods are detailed that allow sensitive quantitation of as little as 10 copies of HIV-1 proviral DNA and detection of 3 copies extracted from 100 μl of whole blood. An internal control to detect PCR inhibition was also incorporated. In a preliminary field evaluation of 61 South African infants, the FINA test demonstrated 100% sensitivity and specificity. The proviral copy number of the infant specimens was quantified, and it was established that 100 microliters of whole blood is required for sensitive diagnosis of infants. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Vaccination of rhesus macaques with a vif-deleted simian immunodeficiency virus proviral DNA vaccine
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sparger, Ellen E.; Dubie, Robert A.; Shacklett, Barbara L.
2008-05-10
Studies in non-human primates, with simian immunodeficiency virus (SIV) and simian/human immunodeficiency virus (SHIV) have demonstrated that live-attenuated viral vaccines are highly effective; however these vaccine viruses maintain a low level of pathogenicity. Lentivirus attenuation associated with deletion of the viral vif gene carries a significantly reduced risk for pathogenicity, while retaining the potential for virus replication of low magnitude in the host. This report describes a vif-deleted simian immunodeficiency virus (SIV)mac239 provirus that was tested as an attenuated proviral DNA vaccine by inoculation of female rhesus macaques. SIV-specific interferon-{gamma} enzyme-linked immunospot responses of low magnitude were observed after immunizationmore » with plasmid containing the vif-deleted SIV provirus. However, vaccinated animals displayed strong sustained virus-specific T cell proliferative responses and increasing antiviral antibody titers. These immune responses suggested either persistent vaccine plasmid expression or low level replication of vif-deleted SIV in the host. Immunized and unvaccinated macaques received a single high dose vaginal challenge with pathogenic SIVmac251. A transient suppression of challenge virus load and a greater median survival time was observed for vaccinated animals. However, virus loads for vaccinated and unvaccinated macaques were comparable by twenty weeks after challenge and overall survival curves for the two groups were not significantly different. Thus, a vif-deleted SIVmac239 proviral DNA vaccine is immunogenic and capable of inducing a transient suppression of pathogenic challenge virus, despite severe attenuation of the vaccine virus.« less
Papuchon, Jennifer; Pinson, Patricia; Guidicelli, Gwenda-Line; Bellecave, Pantxika; Thomas, Réjean; LeBlanc, Roger; Reigadas, Sandrine; Taupin, Jean-Luc; Baril, Jean Guy; Routy, Jean Pierre; Wainberg, Mark; Fleury, Hervé
2014-01-01
In patients responding successfully to ART, the next therapeutic step is viral cure. An interesting strategy is antiviral vaccination, particularly involving CD8 T cell epitopes. However, attempts at vaccination are dependent on the immunogenetic background of individuals. The Provir/Latitude 45 project aims to investigate which CTL epitopes in proviral HIV-1 will be recognized by the immune system when HLA alleles are taken into consideration. A prior study (Papuchon et al, PLoS ONE 2013) showed that chronically-infected patients under successful ART exhibited variations of proviral CTL epitopes compared to a reference viral strain (HXB2) and that a generic vaccine may not be efficient. Here, we investigated viral and/or proviral CTL epitopes at different time points in recently infected individuals of the Canadian primary HIV infection cohort and assessed the affinity of these epitopes for HLA alleles during the study period. An analysis of the results confirms that it is not possible to fully predict which epitopes will be recognized by the HLA alleles of the patients if the reference sequences and epitopes are taken as the basis of simulation. Epitopes may be seen to vary in circulating RNA and proviral DNA. Despite this confirmation, the overall variability of the epitopes was low in these patients who are temporally close to primary infection.
Papuchon, Jennifer; Pinson, Patricia; Guidicelli, Gwenda-Line; Bellecave, Pantxika; Thomas, Réjean; LeBlanc, Roger; Reigadas, Sandrine; Taupin, Jean-Luc; Baril, Jean Guy; Routy, Jean Pierre; Wainberg, Mark; Fleury, Hervé
2014-01-01
In patients responding successfully to ART, the next therapeutic step is viral cure. An interesting strategy is antiviral vaccination, particularly involving CD8 T cell epitopes. However, attempts at vaccination are dependent on the immunogenetic background of individuals. The Provir/Latitude 45 project aims to investigate which CTL epitopes in proviral HIV-1 will be recognized by the immune system when HLA alleles are taken into consideration. A prior study (Papuchon et al, PLoS ONE 2013) showed that chronically-infected patients under successful ART exhibited variations of proviral CTL epitopes compared to a reference viral strain (HXB2) and that a generic vaccine may not be efficient. Here, we investigated viral and/or proviral CTL epitopes at different time points in recently infected individuals of the Canadian primary HIV infection cohort and assessed the affinity of these epitopes for HLA alleles during the study period. An analysis of the results confirms that it is not possible to fully predict which epitopes will be recognized by the HLA alleles of the patients if the reference sequences and epitopes are taken as the basis of simulation. Epitopes may be seen to vary in circulating RNA and proviral DNA. Despite this confirmation, the overall variability of the epitopes was low in these patients who are temporally close to primary infection. PMID:24964202
Iwanaga, Masako; Watanabe, Toshiki; Utsunomiya, Atae; Okayama, Akihiko; Uchimaru, Kaoru; Koh, Ki-Ryang; Ogata, Masao; Kikuchi, Hiroshi; Sagara, Yasuko; Uozumi, Kimiharu; Mochizuki, Manabu; Tsukasaki, Kunihiro; Saburi, Yoshio; Yamamura, Masaomi; Tanaka, Junji; Moriuchi, Yukiyoshi; Hino, Shigeo; Kamihira, Shimeru; Yamaguchi, Kazunari
2010-08-26
Definitive risk factors for the development of adult T-cell leukemia (ATL) among asymptomatic human T-cell leukemia virus type I (HTLV-1) carriers remain unclear. Recently, HTLV-1 proviral loads have been evaluated as important predictors of ATL, but a few small prospective studies have been conducted. We prospectively evaluated 1218 asymptomatic HTLV-1 carriers (426 males and 792 females) who were enrolled during 2002 to 2008. The proviral load at enrollment was significantly higher in males than females (median, 2.10 vs 1.39 copies/100 peripheral blood mononuclear cells [PBMCs]; P < .001), in those 40 to 49 and 50 to 59 years of age than that of those 40 years of age and younger (P = .02 and .007, respectively), and in those with a family history of ATL than those without the history (median, 2.32 vs 1.33 copies/100 PBMCs; P = .005). During follow-up, 14 participants progressed to overt ATL. Their baseline proviral load was high (range, 4.17-28.58 copies/100 PBMCs). None developed ATL among those with a baseline proviral load lower than approximately 4 copies. Multivariate Cox analyses indicated that not only a higher proviral load, advanced age, family history of ATL, and first opportunity for HTLV-1 testing during treatment for other diseases were independent risk factors for progression of ATL.
2014-01-01
Background Molecular latency allows HIV-1 to persist in resting memory CD4+ T-cells as transcriptionally silent provirus integrated into host chromosomal DNA. Multiple transcriptional regulatory mechanisms for HIV-1 latency have been described in the context of progressive epigenetic silencing and maintenance. However, our understanding of the determinants critical for the establishment of latency in newly infected cells is limited. Results In this study, we used a recently described, doubly fluorescent HIV-1 latency model to dissect the role of proviral integration sites and cellular activation state on direct non-productive infections at the single cell level. Proviral integration site mapping of infected Jurkat T-cells revealed that productively and non-productively infected cells are indistinguishable in terms of genomic landmarks, surrounding epigenetic landscapes, and proviral orientation relative to host genes. However, direct non-productive infections were inversely correlated with both cellular activation state and NFκB activity. Furthermore, modulating NFκB with either small molecules or by conditional overexpression of NFκB subunits was sufficient to alter the propensity of HIV-1 to directly enter a non-productive latent state in newly infected cells. Importantly, this modulatory effect was limited to a short time window post-infection. Conclusions Taken together, our data suggest that cellular activation state and NFκB activity during the time of infection, but not the site of proviral integration, are important regulators of direct HIV-1 non-productive infections. PMID:24502247
Silverman, Lee R.; Phipps, Andrew J.; Montgomery, Andy; Fernandez, Soledad; Tsukahara, Tomonori; Ratner, Lee; Lairmore, Michael D.
2005-01-01
Human T-cell leukemia virus type 1 (HTLV-1) is the causative agent of adult T-cell lymphoma/leukemia (ATL). The HTLV-1 envelope gene exhibits limited variability when examined from infected individuals, but has not been tested using infectious clones of the virus in animal models. In vitro assays indicate that HTLV-1 envelope (Env) Ser75Ile, Asn95Asp, and Asn195Asp surface unit (SU) mutants are able to replicate in and immortalize lymphocytes. Herein, we examined the effects of these Env mutants in rabbits inoculated with HTLV-1 immortalized ACH.75, ACH.95, or ACH.195 cell lines (expressing full-length molecular clones with the SU mutations) or the ACH.1 cell line (expressing wild-type SU). All rabbits became infected, and the fidelity of the mutations was maintained throughout the 8-week study. However, SU point mutations resulted in decreased antibody responses to viral group-associated antigen (Gag) and Env antigens. ACH.195 rabbits had a selective decreased antibody response to SU, and one ACH.195 rabbit had an antibody response to both HTLV-1 and HTLV-2 SUs. Some mutant inoculation groups had altered proviral loads. However, peripheral-blood mononuclear cell (PBMC) proviral loads did not correlate with antibody responses. Our data are the first to demonstrate that mutations in critical determinants of HTLV-1 Env SU altered antibody responses and proviral loads, but do not prevent viral replication in vivo. PMID:16046523
Hayashi, Takumi; Mekata, Hirohisa; Sekiguchi, Satoshi; Kirino, Yumi; Mitoma, Shuya; Honkawa, Kazuyuki; Horii, Yoichiro; Norimine, Junzo
2017-09-12
The bovine MHC (BoLA) class II DRB3 alleles are associated with polyclonal expansion of lymphocytes caused by bovine leukemia virus (BLV) infection in cattle. To examine whether the DRB3*0902 allele, one of the resistance-associated alleles, is associated with the proviral load, we measured BLV proviral load of BLV-infected cattle and clarified their DRB3 alleles. Fifty-seven animals with DRB3*0902 were identified out of 835 BLV-infected cattle and had significantly lower proviral load (P<0.000001) compared with the rest of the infected animals, in both Japanese Black and Holstein cattle. This result strongly indicates that the BoLA class II DRA/DRB3*0902 molecule plays an important immunological role in suppressing viral replication, resulting in resistance to the disease progression.
Reddy, E P; Mettus, R V; DeFreitas, E; Wroblewska, Z; Cisco, M; Koprowski, H
1988-01-01
Human T-cell lymphotropic virus type 1 (HTLV-I), the etiologic agent of human T-cell leukemia, has recently been shown to be associated with neurologic disorders such as tropical spastic paraparesis, HTLV-associated myelopathy, and possibly with multiple sclerosis. In this communication, we have examined one specific case of neurologic disorder that can be classified as multiple sclerosis or tropical spastic paraparesis. The patient suffering from chronic neurologic disorder was found to contain antibodies to HTLV-I envelope and gag proteins in his serum and cerebrospinal fluid. Lymphocytes from peripheral blood and cerebrospinal fluid of the patient were shown to express viral RNA sequences by in situ hybridization. Southern blot analysis of the patient lymphocyte DNA revealed the presence of HTLV-I-related sequences. Blot-hybridization analysis of the RNA from fresh peripheral lymphocytes stimulated with interleukin 2 revealed the presence of abundant amounts of genomic viral RNA with little or no subgenomic RNA. We have cloned the proviral genome from the DNA of the peripheral lymphocytes and determined its restriction map. This analysis shows that this proviral genome is very similar if not identical to that of the prototype HTLV-I genome. Images PMID:2897123
Genome editing strategies: potential tools for eradicating HIV-1/AIDS
Khalili, Kamel; Gordon, Jennifer; Cosentino, Laura; Hu, Wenhui
2015-01-01
Current therapy for controlling HIV-1 infection and preventing AIDS progression has profoundly decreased viral replication in cells susceptible to HIV-1 infection, but it does not eliminate the low level of viral replication in latently infected cells which contain integrated copies of HIV-1 proviral DNA. There is an urgent need for the development of HIV-1 genome eradication strategies that will lead to a permanent or “sterile” cure of HIV-1/AIDS. In the past few years, novel nuclease-initiated genome editing tools have been developing rapidly, including ZFNs, TALENs, and the CRISPR/Cas9 system. These surgical knives, which can excise any genome, provide a great opportunity to eradicate the HIV-1 genome by targeting highly conserved regions of the HIV-1 long terminal repeats or essential viral genes. Given the time consuming and costly engineering of target-specific ZFNs and TALENs, the RNA-guided endonuclease Cas9 technology has emerged as a simpler and more versatile technology to allow permanent removal of integrated HIV-1 proviral DNA in eukaryotic cells, and hopefully animal models or human patients. The major unmet challenges of this approach at present include inefficient nuclease gene delivery, potential off-target cleavage, and cell-specific genome targeting. Nanoparticle or lentivirus-mediated delivery of next generation Cas9 technologies including nickase or RNA-guided FokI nuclease (RFN) will further improve the potential for genome editing to become a promising approach for curing HIV-1/AIDS. PMID:25716921
Gourraud, P A; Karaouni, A; Woo, J M; Schmidt, T; Oksenberg, J R; Hecht, F M; Liegler, T J; Barbour, J D
2011-03-01
We examined single nucleotide polymorphisms (SNP) in the APOBEC3 locus on chromosome 22, paired with population sequences of pro-viral human immunodeficiency virus-1 (HIV-1) vif from peripheral blood mononuclear cells, from 96 recently HIV-1-infected treatment-naive adults. We found evidence for the existence of an APOBEC3H linkage disequilibrium (LD) block associated with variation in GA → AA, or APOBEC3F/H signature, sequence changes in pro-viral HIV-1 vif sequence (top 10 significant SNPs with a significant p = 4.8 × 10(-3)). We identified a common five position risk haplotype distal to APOBEC3H (A3Hrh). These markers were in high LD (D' = 1; r(2) = 0.98) to a previously described A3H "RED" haplotype containing a variant (E121) with enhanced susceptibility to HIV-1 Vif. This association was confirmed by a haplotype analysis. Homozygote carriers of the A3Hrh had lower GA->AA (A3F/H) sequence editing upon pro-viral HIV-1 vif sequence (p = 0.01), and lower HIV-1 RNA levels over time during early, untreated HIV-1 infection, (p = 0.015 mixed effects model). This effect may be due to enhanced susceptibility of A3H forms to HIV-1 Vif mediated viral suppression of sequence editing activity, slowing viral diversification and escape from immune responses. Copyright © 2011 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
Effect of raltegravir on the total and unintegrated proviral HIV DNA during raltegravir-based HAART.
Nicastri, Emanuele; Tommasi, Chiara; Abbate, Isabella; Bonora, Stefano; Tempestilli, Massimo; Bellagamba, Rita; Viscione, Magdalena; Rozera, Gabriella; Gallo, Anna L; Ivanovic, Jelena; Amendola, Alessandra; Pucillo, Leopoldo; Di Perri, Giovanni; Capobianchi, Maria R; Narciso, Pasquale
2011-01-01
Raltegravir is the first approved antiretroviral able to prevent HIV genome integration into the host chromosomes. The aim of the study is to test if raltegravir plasma concentrations can be associated with proviral DNA decline during raltegravir-based salvage therapy. A total of 33 multidrug-resistant HIV-infected patients were enrolled in a longitudinal open-label pilot study and completed a 24-week follow-up. The CD4(+) T-cell count, plasma viral load, proviral HIV DNA and two-long-terminal repeat (2-LTR) circular forms were assessed at baseline, day 14, 30, 60, 90 and 180. The raltegravir trough concentration (C (trough)) was measured by HPLC-ultraviolet and patients were divided into two groups according to the median raltegravir C (trough). The mean±SD values of baseline HIV RNA, CD4(+) T-cell count and HIV DNA were 4.4±0.82 log copies/ml, 256±177 cells/mm(3) , and 2,668±4,721 copies/10(6) peripheral blood mononuclear cells, respectively. Despite a transient increase of total DNA at week 2, a marked proviral DNA decay (P=0.01) with an increase of the 2-LTR unintegrated/total DNA ratio (P=0.06) over time was observed. At univariate analysis, no correlation between raltegravir C(trough) and classical virological parameters was observed. Nevertheless, the decay of proviral HIV DNA was more pronounced in patients displaying C(trough)<158 ng/ml with respect to those with C(trough)>158 ng/ml (P=0.046). Successful raltegravir-based therapy produces a significant decline in proviral DNA and is associated with an increase of the unintegrated/total DNA ratio. Further studies are necessary to define the possible role of pharmacokinetic raltegravir monitoring and the biological meaning of unintegrated proviral DNA. © 2011 International Medical Press
Hartley, J W; Chattopadhyay, S K; Lander, M R; Taddesse-Heath, L; Naghashfar, Z; Morse, H C; Fredrickson, T N
2000-02-01
Spontaneous lymphomas occur at high frequency in NFS x V+ mice, strains congenic for ecotropic murine leukemia virus (MuLV) proviral genes and expressing virus at high titer. In the present study, a total of 703 NFS x V+ lymphomas were studied by histopathology, immunophenotypic analysis, immunoglobulin heavy chain or T cell receptor beta chain rearrangements, and somatic ecotropic MuLV integrations; 90% of the lymphomas tested were of B cell lineage. Low-grade tumors included small lymphocytic, follicular, and splenic marginal zone lymphomas, while high-grade tumors comprised diffuse large-cell (centroblastic and immunoblastic types), splenic marginal zone, and lymphoblastic lymphomas. Comparison of mice of similar genetic background except for presence (NFS x V+) or absence (NFS x V-) of functional ecotropic MuLV genomes showed that NFS x V-clonal lymphomas developed at about one-half the rate of those occurring in NFS x V+ mice, and most were low-grade B cell lymphomas with extended latent periods. In NFS x V+ mice, clonal outgrowth, defined by Ig gene rearrangements, was associated with acquisition of somatic ecotropic proviral integrations, suggesting that, although generation of B cell clones can be virus independent, ecotropic virus may act to increase the rate of generation of clones and speed their evolution to lymphoma. The mechanism remains undefined, because only rare rearrangements were detected in several cellular loci previously associated with MuLV insertional mutagenesis.
Ryan, G.; Klein, D.; Knapp, E.; Hosie, M. J.; Grimes, T.; Mabruk, M. J. E. M. F.; Jarrett, O.; Callanan, J. J.
2003-01-01
Animal models of human immunodeficiency virus 1, such as feline immunodeficiency virus (FIV), provide the opportunities to dissect the mechanisms of early interactions of the virus with the central nervous system (CNS). The aims of the present study were to evaluate viral loads within CNS, cerebrospinal fluid (CSF), ocular fluid, and the plasma of cats in the first 23 weeks after intravenous inoculation with FIVGL8. Proviral loads were also determined within peripheral blood mononuclear cells (PBMCs) and brain tissue. In this acute phase of infection, virus entered the brain in the majority of animals. Virus distribution was initially in a random fashion, with more diffuse brain involvement as infection progressed. Virus in the CSF was predictive of brain parenchymal infection. While the peak of virus production in blood coincided with proliferation within brain, more sustained production appeared to continue in brain tissue. In contrast, proviral loads in the brain decreased to undetectable levels in the presence of a strengthening PBMC load. A final observation in this study was that there was no direct correlation between viral loads in regions of brain or ocular tissue and the presence of histopathology. PMID:12805447
Zhang, Ao; Bogerd, Hal; Villinger, Francois; Gupta, Jaydip Das; Dong, Beihua; Klein, Eric A.; Hackett, John; Schochetman, Gerald; Cullen, Bryan R.; Silverman, Robert H.
2011-01-01
The gammaretrovirus, xenotropic murine leukemia virus-related virus (XMRV), replicates to high titers in some human cell lines and is able to infect non-human primates. To determine whether APOBEC3 (A3) proteins restrict XMRV infections in a non-human primate model, we sequenced proviral DNA from peripheral blood mononuclear cells of XMRV-infected rhesus macaques. Hypermutation characteristic of A3DE, A3F and A3G activities was observed in the XMRV proviral sequences in vivo. Furthermore, expression of rhesus A3DE, A3F, or A3G in human cells inhibited XMRV infection and caused hypermutation of XMRV DNA. These studies show that some rhesus A3 isoforms are highly effective against XMRV in the blood of a non-human primate model of infection and in cultured human cells. PMID:21982221
Barquero, Nuria; Gomez-Lucia, Esperanza; Arjona, Alvaro; Toural, Cristina; las Heras, Alfonso; Fernández-Garayzabal, José F.; Domenech, Ana
2013-01-01
The diagnosis of Small Ruminant Lentivirus (SRLV) is based on clinical signs, pathological lesions and laboratory testing. No standard reference test for the diagnosis of maedi visna has been validated up to the present, and it is puzzling that tests which detect antibodies against the virus and tests which detect the proviral genome may render opposite results. The aim of this study was to evaluate the presence in milk throughout a lactation period of specific antibodies by ELISA and of SRLV proviral DNA by a PCR of the highly conserved pol region. A six-month study was conducted with the milk of 28 ewes and 31 goats intensively reared. The percentage of animals with antibodies against SRLV increased throughout the study period. Seroprevalence in sheep was 28% at the beginning of the study and by the end it had increased up to 52.4%. In goats, initial seroprevalence of 5.6% increased to 16%. The percentage of PCR positive ewes was stable throughout the study period. Of the positive sheep, 21.4% were PCR-positive before antibodies could be detected and most of them became PCR-negative shortly after the first detection of antibodies. This might suggest that antibodies have a neutralizing effect. In addition, an equal percentage of sheep were always PCR-negative but either became ELISA-positive or was always ELISA-positive, which might support this hypothesis. On the other hand, the PCR results in goats did not follow any pattern and oscillated between 35.3% and 55.6% depending on the month. Most goats positive by PCR failed to develop antibodies in the 6 months tested. We may conclude that the infection and the antibody response to it follow a different trend in sheep and goats. PMID:24153063
Low proviral small ruminant lentivirus load as biomarker of natural restriction in goats.
Crespo, Helena; Bertolotti, Luigi; Proffiti, Margherita; Cascio, Paolo; Cerruti, Fulvia; Acutis, Pier Luigi; de Andrés, Damián; Reina, Ramsés; Rosati, Sergio
2016-08-30
Small ruminant lentiviruses (SRLV) globally affect welfare and production of sheep and goats and are mainly controlled through elimination of infected animals, independently of the viral kinetics within the single animal. Control programs are based on highly sensitive serological tests, however the existence of low antibody responders leads to the permanent presence of seronegative infected animals in the flock, thus perpetuating the infection. On the other hand, long-term non-progressors show a detectable antibody response not indicative of a shedding animal, suggesting immune contention of infection. In this study, we analyse two goat populations within the same herd, harbouring low or high proviral SRLV loads respectively, both showing a robust antibody response. In vivo findings were confirmed in vitro since fibroblastic cell lines obtained from one high and one low proviral load representative goats, showed respectively a high and a faint production of virus upon infection with reference and field circulating SRLV strains. Differences in virus production were relieved when strain CAEV-Co was used for experimental infection. We analysed LTR promoter activity, proviral load, entry step and production of virus and viral proteins. Intriguingly, proteasomal activity was higher in fibroblasts from low proviral load animals and proteasome inhibition increased viral production in both cell lines, suggesting the implication of active proteasome-dependent restriction factors. Among them, we analysed relative expression and sequences of TRIM5α, APOBEC3 (Z1, Z2, Z3 and Z2-Z3) and BST-2 (Tetherin) and found a global antiviral status in low proviral carriers that may confer protection against viral shedding and disease onset. Copyright © 2016 Elsevier B.V. All rights reserved.
Sebastian, Nadia T; Zaikos, Thomas D; Terry, Valeri; Taschuk, Frances; McNamara, Lucy A; Onafuwa-Nuga, Adewunmi; Yucha, Ryan; Signer, Robert A J; Riddell, James; Bixby, Dale; Markowitz, Norman; Morrison, Sean J; Collins, Kathleen L
2017-07-01
Latent HIV infection of long-lived cells is a barrier to viral clearance. Hematopoietic stem and progenitor cells are a heterogeneous population of cells, some of which are long-lived. CXCR4-tropic HIVs infect a broad range of HSPC subtypes, including hematopoietic stem cells, which are multi-potent and long-lived. However, CCR5-tropic HIV infection is limited to more differentiated progenitor cells with life spans that are less well understood. Consistent with emerging data that restricted progenitor cells can be long-lived, we detected persistent HIV in restricted HSPC populations from optimally treated people. Further, genotypic and phenotypic analysis of amplified env alleles from donor samples indicated that both CXCR4- and CCR5-tropic viruses persisted in HSPCs. RNA profiling confirmed expression of HIV receptor RNA in a pattern that was consistent with in vitro and in vivo results. In addition, we characterized a CD4high HSPC sub-population that was preferentially targeted by a variety of CXCR4- and CCR5-tropic HIVs in vitro. Finally, we present strong evidence that HIV proviral genomes of both tropisms can be transmitted to CD4-negative daughter cells of multiple lineages in vivo. In some cases, the transmitted proviral genomes contained signature deletions that inactivated the virus, eliminating the possibility that coincidental infection explains the results. These data support a model in which both stem and non-stem cell progenitors serve as persistent reservoirs for CXCR4- and CCR5-tropic HIV proviral genomes that can be passed to daughter cells.
Tumiotto, Camille; Riviere, Lionel; Bellecave, Pantxika; Recordon-Pinson, Patricia; Vilain-Parce, Alice; Guidicelli, Gwenda-Line; Fleury, Hervé
2017-01-01
One of the strategies for curing viral HIV-1 is a therapeutic vaccine involving the stimulation of cytotoxic CD8-positive T cells (CTL) that are Human Leucocyte Antigen (HLA)-restricted. The lack of efficiency of previous vaccination strategies may have been due to the immunogenic peptides used, which could be different from a patient's virus epitopes and lead to a poor CTL response. To counteract this lack of specificity, conserved epitopes must be targeted. One alternative is to gather as many data as possible from a large number of patients on their HIV-1 proviral archived epitope variants, taking into account their genetic background to select the best presented CTL epitopes. In order to process big data generated by Next-Generation Sequencing (NGS) of the DNA of HIV-infected patients, we have developed a software package called TutuGenetics. This tool combines an alignment derived either from Sanger or NGS files, HLA typing, target gene and a CTL epitope list as input files. It allows automatic translation after correction of the alignment obtained between the HxB2 reference and the reads, followed by automatic calculation of the MHC IC50 value for each epitope variant and the HLA allele of the patient by using NetMHCpan 3.0, resulting in a csv file as output result. We validated this new tool by comparing Sanger and NGS (454, Roche) sequences obtained from the proviral DNA of patients at success of ART included in the Provir Latitude 45 study and showed a 90% correlation between the quantitative results of NGS and Sanger. This automated analysis combined with complementary samples should yield more data regarding the archived CTL epitopes according to the patients' HLA alleles and will be useful for screening epitopes that in theory are presented efficiently to the HLA groove, thus constituting promising immunogenic peptides for a therapeutic vaccine.
Cis-drivers and trans-drivers of bovine leukemia virus oncogenesis.
Safari, Roghaiyeh; Hamaidia, Malik; de Brogniez, Alix; Gillet, Nicolas; Willems, Luc
2017-10-01
The bovine leukemia virus (BLV) is a retrovirus inducing an asymptomatic and persistent infection in ruminants and leading in a minority of cases to the accumulation of B-lymphocytes (lymphocytosis, leukemia or lymphoma). Although the mechanisms of oncogenesis are still largely unknown, there is clear experimental evidence showing that BLV infection drastically modifies the pattern of gene expression of the host cell. This alteration of the transcriptome in infected B-lymphocytes results first, from a direct activity of viral proteins (i.e. transactivation of gene promoters, protein-protein interactions), second, from insertional mutagenesis by proviral integration (cis-activation) and third, from gene silencing by microRNAs. Expression of viral proteins stimulates a vigorous immune response that indirectly modifies gene transcription in other cell types (e.g. cytotoxic T-cells, auxiliary T-cells, macrophages). In principle, insertional mutagenesis and microRNA-associated RNA interference can modify the cell fate without inducing an antiviral immunity. Despite a tight control by the immune response, the permanent attempts of the virus to replicate ultimately induce mutations in the infected cell. Accumulation of these genomic lesions and Darwinian selection of tumor clones are predicted to lead to cancer. Copyright © 2017 Elsevier B.V. All rights reserved.
Hohn, Oliver; Hanke, Kirsten; Lausch, Veronika; Zimmermann, Anja; Mostafa, Saeed; Bannert, Norbert
2014-11-11
The HERV-K(HML-2) family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM) and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations.
Hohn, Oliver; Hanke, Kirsten; Lausch, Veronika; Zimmermann, Anja; Mostafa, Saeed; Bannert, Norbert
2014-01-01
The HERV-K(HML-2) family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM) and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations. PMID:25393897
Porter, Danielle P; Toma, Jonathan; Tan, Yuping; Solberg, Owen; Cai, Suqin; Kulkarni, Rima; Andreatta, Kristen; Lie, Yolanda; Chuck, Susan K; Palella, Frank; Miller, Michael D; White, Kirsten L
2016-02-01
Antiretroviral regimen switching may be considered for HIV-1-infected, virologically-suppressed patients to enable treatment simplification or improve tolerability, but should be guided by knowledge of pre-existing drug resistance. The current study examined the impact of pre-existing drug resistance mutations on virologic outcomes among virologically-suppressed patients switching to Rilpivirine (RPV)/emtricitabine (FTC)/tenofovir disoproxil fumarate (TDF). SPIRIT was a phase 3b study evaluating the safety and efficacy of switching to RPV/FTC/TDF in virologically-suppressed HIV-1-infected patients. Pre-existing drug resistance at baseline was determined by proviral DNA genotyping for 51 RPV/FTC/TDF-treated patients with known mutations by historical RNA genotype and matched controls and compared with clinical outcome at Week 48. Drug resistance mutations in protease or reverse transcriptase were detected in 62.7% of patients by historical RNA genotype and in 68.6% by proviral DNA genotyping at baseline. Proviral DNA sequencing detected 89% of occurrences of NRTI and NNRTI resistance-associated mutations reported by historical genotype. Mutations potentially affecting RPV activity, including E138A/G/K/Q, Y181C, and H221Y, were detected in isolates from 11 patients by one or both assays. None of the patients with single mutants had virologic failure through Week 48. One patient with pre-existing Y181Y/C and M184I by proviral DNA genotyping experienced virologic failure. Nineteen patients with K103N present by historical genotype were confirmed by proviral DNA sequencing and 18/19 remained virologically-suppressed. Virologic success rates were high among virologically-suppressed patients with pre-existing NRTI and NNRTI resistance-associated mutations who switched to RPV/FTC/TDF in the SPIRIT study. While plasma RNA genotyping remains preferred, proviral DNA genotyping may provide additional value in virologically-suppressed patients for whom historical resistance data are unavailable.
Recent Amplification of the Kangaroo Endogenous Retrovirus, KERV, Limited to the Centromere▿
Ferreri, Gianni C.; Brown, Judith D.; Obergfell, Craig; Jue, Nathaniel; Finn, Caitlin E.; O'Neill, Michael J.; O'Neill, Rachel J.
2011-01-01
Mammalian retrotransposons, transposable elements that are processed through an RNA intermediate, are categorized as short interspersed elements (SINEs), long interspersed elements (LINEs), and long terminal repeat (LTR) retroelements, which include endogenous retroviruses. The ability of transposable elements to autonomously amplify led to their initial characterization as selfish or junk DNA; however, it is now known that they may acquire specific cellular functions in a genome and are implicated in host defense mechanisms as well as in genome evolution. Interactions between classes of transposable elements may exert a markedly different and potentially more significant effect on a genome than interactions between members of a single class of transposable elements. We examined the genomic structure and evolution of the kangaroo endogenous retrovirus (KERV) in the marsupial genus Macropus. The complete proviral structure of the kangaroo endogenous retrovirus, phylogenetic relationship among relative retroviruses, and expression of this virus in both Macropus rufogriseus and M. eugenii are presented for the first time. In addition, we show the relative copy number and distribution of the kangaroo endogenous retrovirus in the Macropus genus. Our data indicate that amplification of the kangaroo endogenous retrovirus occurred in a lineage-specific fashion, is restricted to the centromeres, and is not correlated with LINE depletion. Finally, analysis of KERV long terminal repeat sequences using massively parallel sequencing indicates that the recent amplification in M. rufogriseus is likely due to duplications and concerted evolution rather than a high number of independent insertion events. PMID:21389136
Li, Chang Long; Coullin, Philippe; Bernheim, Alain; Joliot, Véronique; Auffray, Charles; Zoroob, Rima; Perbal, Bernard
2006-01-01
Aims Myeloblastosis Associated Virus type 1 (N) [MAV 1(N)] induces specifically nephroblastomas in 8–10 weeks when injected to newborn chicken. The MAV-induced nephroblastomas constitute a unique animal model of the pediatric Wilms' tumor. We have made use of three independent nephroblastomas that represent increasing tumor grades, to identify the host DNA regions in which MAV proviral sequences were integrated. METHODS Cellular sequences localized next to MAV-integration sites in the tumor DNAs were used to screen a Bacterial Artificial Chromosomes (BACs) library and isolate BACs containing about 150 kilobases of normal DNA corresponding to MAV integration regions (MIRs). These BACs were mapped on the chicken chromosomes by Fluorescent In Situ Hybridization (FISH) and used for molecular studies. Results The different MAV integration sites that were conserved after tumor cell selection identify genes involved in the control of cell signaling and proliferation. Syntenic fragments in human DNA contain genes whose products have been involved in normal and pathological kidney development, and several oncogenes responsible for tumorigenesis in human. Conclusion The identification of putative target genes for MAV provides important clues for the understanding of the MAV pathogenic potential. These studies identified ADAMTS1 as a gene upregulated in MAV-induced nephroblastoma and established that ccn3/nov is not a preferential site of integration for MAV as previously thought. The present results support our hypothesis that the highly efficient and specific MAV-induced tumorigenesis results from the alteration of multiple target genes in differentiating blastemal cells, some of which are required for the progression to highly aggressive stages. This study reinforces our previous conclusions that the MAV-induced nephroblastoma constitutes an excellent model in which to characterize new potential oncogenes and tumor suppressors involved in the establishment and maintenance of tumors. PMID:16403231
Boyle, David S; Lehman, Dara A; Lillis, Lorraine; Peterson, Dylan; Singhal, Mitra; Armes, Niall; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie
2013-04-02
Early diagnosis and treatment of human immunodeficiency virus type 1 (HIV-1) infection in infants can greatly reduce mortality rates. However, current infant HIV-1 diagnostics cannot reliably be performed at the point of care, often delaying treatment and compromising its efficacy. Recombinase polymerase amplification (RPA) is a novel technology that is ideal for an HIV-1 diagnostic, as it amplifies target DNA in <20 min at a constant temperature, without the need for complex thermocycling equipment. Here we tested 63 HIV-1-specific primer and probe combinations and identified two RPA assays that target distinct regions of the HIV-1 genome (long terminal repeat [LTR] and pol) and can reliably detect 3 copies of proviral DNA by the use of fluorescence detection and lateral-flow strip detection. These pol and LTR primers amplified 98.6% and 93%, respectively, of the diverse HIV-1 variants tested. This is the first example of an isothermal assay that consistently detects all of the major HIV-1 global subtypes.
Han, Zongchao; Zhong, Li; Maina, Njeri; Hu, Zhongbo; Li, Xiaomiao; Chouthai, Nitin S; Bischof, Daniela; Weigel-Van Aken, Kirsten A; Slayton, William B; Yoder, Mervin C; Srivastava, Arun
2008-03-01
We previously reported that among single-stranded adeno-associated virus (ssAAV) vectors, serotypes 1 through 5, ssAAV1 is the most efficient in transducing murine hematopoietic stem cells (HSCs), but viral second-strand DNA synthesis remains a rate-limiting step. Subsequently, using double-stranded, self-complementary AAV (scAAV) vectors, serotypes 7 through 10, we observed that scAAV7 vectors also transduce murine HSCs efficiently. In the present study, we used scAAV1 and scAAV7 shuttle vectors to transduce HSCs in a murine bone marrow serial transplant model in vivo, which allowed examination of the AAV proviral integration pattern in the mouse genome, as well as recovery and nucleotide sequence analyses of AAV-HSC DNA junction fragments. The proviral genomes were stably integrated, and integration sites were localized to different mouse chromosomes. None of the integration sites was found to be in a transcribed gene, or near a cellular oncogene. None of the animals, monitored for up to 1 year, exhibited pathological abnormalities. Thus, AAV proviral integration-induced risk of oncogenesis was not found in our study, which provides functional confirmation of stable transduction of self-renewing multipotential HSCs by scAAV vectors as well as promise for the use of these vectors in the potential treatment of disorders of the hematopoietic system.
Souquière, Sandrine; Mouinga-Ondeme, Augustin; Makuwa, Maria; Beggio, Paola; Radaelli, Antonia; De Giuli Morghen, Carlo; Mortreux, Franck; Kazanji, Mirdad
2009-08-01
Although a wide variety of non-human primates are susceptible to simian T-cell leukaemia virus type 1 (STLV-1), little is known about the virological or molecular determinants of natural STLV-1 infection. We determined STLV-1 virus tropism in vivo and its relation to the immune response by evaluating cytokine production and T-cell subsets in naturally infected and uninfected mandrills. With real-time PCR methods, we found that STLV-1 in mandrills infects both CD4(+) and CD8(+) T cells; however, proviral loads were significantly higher (P = 0.01) in CD4(+) than in CD8(+) cells (mean STLV-1 copies number per 100 cells (+/- SD) was 7.8 +/- 8 in CD4(+) T cells and 3.9 +/- 4.5 in CD8(+) T cells). After culture, STLV-1 provirus was detected in enriched CD4(+) but not in enriched CD8(+) T cells. After 6 months of culture, STLV-1-transformed cell lines expressing CD3(+), CD4(+) and HLADR(+) were established, and STLV-1 proteins and tax/rex mRNA were detected. In STLV-1 infected monkeys, there was a correlation between high proviral load and elevated levels of interleukin (IL)-2, IL-6, IL-10, interferon-gamma and tumour necrosis factor-alpha. The two monkeys with the highest STLV-1 proviral load had activated CD4(+)HLADR(+) and CD8(+)HLADR(+) T-cell subsets and a high percentage of CD25(+) in CD4(+) and CD8(+) T cells. Our study provides the first cellular, immunological and virological characterization of natural STLV-1 infection in mandrills and shows that they are an appropriate animal model for further physiopathological studies of the natural history of human T-cell leukaemia viruses.
2017-01-01
ABSTRACT Strong viral enhancers in gammaretrovirus vectors have caused cellular proto-oncogene activation and leukemia, necessitating the use of cellular promoters in “enhancerless” self-inactivating integrating vectors. However, cellular promoters result in relatively low transgene expression, often leading to inadequate disease phenotype correction. Vectors derived from foamy virus, a nonpathogenic retrovirus, show higher preference for nongenic integrations than gammaretroviruses/lentiviruses and preferential integration near transcriptional start sites, like gammaretroviruses. We found that strong viral enhancers/promoters placed in foamy viral vectors caused extremely low immortalization of primary mouse hematopoietic stem/progenitor cells compared to analogous gammaretrovirus/lentivirus vectors carrying the same enhancers/promoters, an effect not explained solely by foamy virus' modest insertional site preference for nongenic regions compared to gammaretrovirus/lentivirus vectors. Using CRISPR/Cas9-mediated targeted insertion of analogous proviral sequences into the LMO2 gene and then measuring LMO2 expression, we demonstrate a sequence-specific effect of foamy virus, independent of insertional bias, contributing to reduced genotoxicity. We show that this effect is mediated by a 36-bp insulator located in the foamy virus long terminal repeat (LTR) that has high-affinity binding to the CCCTC-binding factor. Using our LMO2 activation assay, LMO2 expression was significantly increased when this insulator was removed from foamy virus and significantly reduced when the insulator was inserted into the lentiviral LTR. Our results elucidate a mechanism underlying the low genotoxicity of foamy virus, identify a novel insulator, and support the use of foamy virus as a vector for gene therapy, especially when strong enhancers/promoters are required. IMPORTANCE Understanding the genotoxic potential of viral vectors is important in designing safe and efficacious vectors for gene therapy. Self-inactivating vectors devoid of viral long-terminal-repeat enhancers have proven safe; however, transgene expression from cellular promoters is often insufficient for full phenotypic correction. Foamy virus is an attractive vector for gene therapy. We found foamy virus vectors to be remarkably less genotoxic, well below what was expected from their integration site preferences. We demonstrate that the foamy virus long terminal repeats contain an insulator element that binds CCCTC-binding factor and reduces its insertional genotoxicity. Our study elucidates a mechanism behind the low genotoxic potential of foamy virus, identifies a unique insulator, and supports the use of foamy virus as a vector for gene therapy. PMID:29046446
Zapata, Juan C.; Campilongo, Federica; Barclay, Robert A.; DeMarino, Catherine; Iglesias-Ussel, Maria D.; Kashanchi, Fatah; Romerio, Fabio
2017-01-01
Various epigenetic marks at the HIV-1 5′LTR suppress proviral expression and promote latency. Cellular antisense transcripts known as long noncoding RNAs (lncRNAs) recruit the polycomb repressor complex 2 (PRC2) to gene promoters, which catalyzes trimethylation of lysine 27 on histone H3 (H3K27me3), thus promoting nucleosome assembly and suppressing gene expression. We found that an HIV-1 antisense transcript expressed from the 3′LTR and encoding the antisense protein ASP promotes proviral latency. Expression of ASP RNA reduced HIV-1 replication in Jurkat cells. Moreover, ASP RNA expression promoted the establishment and maintenance of HIV-1 latency in Jurkat E4 cells. We show that this transcript interacts with and recruits PRC2 to the HIV-1 5′LTR, increasing accumulation of the suppressive epigenetic mark H3K27me3, while reducing RNA Polymerase II and thus proviral transcription. Altogether, our results suggest that the HIV-1 ASP transcript promotes epigenetic silencing of the HIV-1 5′LTR and proviral latency through the PRC2 pathway. PMID:28340355
Zapata, Juan C; Campilongo, Federica; Barclay, Robert A; DeMarino, Catherine; Iglesias-Ussel, Maria D; Kashanchi, Fatah; Romerio, Fabio
2017-06-01
Various epigenetic marks at the HIV-1 5'LTR suppress proviral expression and promote latency. Cellular antisense transcripts known as long noncoding RNAs (lncRNAs) recruit the polycomb repressor complex 2 (PRC2) to gene promoters, which catalyzes trimethylation of lysine 27 on histone H3 (H3K27me3), thus promoting nucleosome assembly and suppressing gene expression. We found that an HIV-1 antisense transcript expressed from the 3'LTR and encoding the antisense protein ASP promotes proviral latency. Expression of ASP RNA reduced HIV-1 replication in Jurkat cells. Moreover, ASP RNA expression promoted the establishment and maintenance of HIV-1 latency in Jurkat E4 cells. We show that this transcript interacts with and recruits PRC2 to the HIV-1 5'LTR, increasing accumulation of the suppressive epigenetic mark H3K27me3, while reducing RNA Polymerase II and thus proviral transcription. Altogether, our results suggest that the HIV-1 ASP transcript promotes epigenetic silencing of the HIV-1 5'LTR and proviral latency through the PRC2 pathway. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
McFaul, Katie; Liptrott, Neill; Cox, Alison; Martin, Phillip; Egan, Deirdre; Owen, Andrew; Kelly, Sarah; Karolia, Zeenat; Shaw, Kate; Bower, Mark; Boffito, Marta
2016-09-01
The use of combination antiretroviral therapy (cART) and cytotoxic chemotherapy for HIV-associated lymphoma runs the risks of inducing HIV drug resistance. This study examined two possible mechanisms: altered expression of membrane drug transporter protein (MTP) and acquisition of mutations in pro-viral DNA. Expression levels of MTP and pro-viral DNA resistance mutation analysis were performed on peripheral blood mononuclear cells (PBMC) before, during, and after chemotherapy. Twenty nine patients completed the three time point estimations. There were no significant variations before, during, and after chemotherapy in the expression of four MTPs: ABCB1, ABCC1, ABCC2, and SLCO3A1 (OATP3A1). Pro-viral DNA sequencing revealed that only one patient developed a new nucleos/tide reverse transcriptase inhibitor-associated mutation (184V) during the course of the study, giving a mutation rate of 0.0027 per person per year. In conclusion, concomitant administration of cytotoxic chemotherapy and cART does not induce expression of MTP. Furthermore, no significant changes in viral resistance were observed pre- and post-chemotherapy, suggesting mutagenic cytotoxic chemotherapy seems not to induce mutations in HIV pro-viral DNA.
Winckelmann, Anni; Morcilla, Vincent; Shao, Wei; Schleimann, Mariane H; Højen, Jesper F; Schlub, Timothy E; Denton, Paul W; Østergaard, Lars; Søgaard, Ole S; Tolstrup, Martin; Palmer, Sarah
2018-05-11
Therapeutic HIV-1 immunization followed by latency reversal has been suggested as a strategy to eradicate HIV-1. Here we investigate the phylogenetic composition of the HIV-1 regions targeted by the therapeutic HIV-1 peptide vaccine Vacc-4x in participants in a clinical trial. Seventeen participants on suppressive antiretroviral therapy were vaccinated with six doses of Vacc-4x followed by three doses of romidepsin. Seven study participants were selected for sequencing analysis. All participants underwent an analytical treatment interruption. Single-genome/proviral sequencing of the p24-RT region was performed to genetically characterize proviral DNA, cell-associated (CA) RNA and outgrowth viruses during therapy as well as plasma HIV-1 RNA during an analytical treatment interruption. There were no changes in CA HIV-1 RNA (P = 0.83) and DNA (P = 0.09) diversity over the course of the study and no difference between CA HIV-1 RNA and DNA diversity (P = 0.32). Only one participant showed signs of potential vaccine-related selection in the rebounding plasma virus. In five of seven participants, we identified HLA-specific CTL epitopes containing non-silent mutations in 100% of the sequences. We detected no evidence of selective immune pressure reflected in proviral diversity or by occurrence of specific mutation in the vaccine-targeted epitopes. Pre-existing CTL epitope mutations may affect the potency of this therapeutic vaccine. This highlights the challenges of developing effective HIV-1 therapeutic vaccines.This is an open access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal. http://creativecommons.org/licenses/by-nc-nd/4.0.
2011-01-01
Background One member of the W family of human endogenous retroviruses (HERV) appears to have been functionally adopted by the human host. Nevertheless, a highly diversified and regulated transcription from a range of HERV-W elements has been observed in human tissues and cells. Aberrant expression of members of this family has also been associated with human disease such as multiple sclerosis (MS) and schizophrenia. It is not known whether this broad expression of HERV-W elements represents transcriptional leakage or specific transcription initiated from the retroviral promoter in the long terminal repeat (LTR) region. Therefore, potential influences of genomic context, structure and orientation on the expression levels of individual HERV-W elements in normal human tissues were systematically investigated. Results Whereas intronic HERV-W elements with a pseudogene structure exhibited a strong anti-sense orientation bias, intronic elements with a proviral structure and solo LTRs did not. Although a highly variable expression across tissues and elements was observed, systematic effects of context, structure and orientation were also observed. Elements located in intronic regions appeared to be expressed at higher levels than elements located in intergenic regions. Intronic elements with proviral structures were expressed at higher levels than those elements bearing hallmarks of processed pseudogenes or solo LTRs. Relative to their corresponding genes, intronic elements integrated on the sense strand appeared to be transcribed at higher levels than those integrated on the anti-sense strand. Moreover, the expression of proviral elements appeared to be independent from that of their corresponding genes. Conclusions Intronic HERV-W provirus integrations on the sense strand appear to have elicited a weaker negative selection than pseudogene integrations of transcripts from such elements. Our current findings suggest that the previously observed diversified and tissue-specific expression of elements in the HERV-W family is the result of both directed transcription (involving both the LTR and internal sequence) and leaky transcription of HERV-W elements in normal human tissues. PMID:21226900
Ando, Satomi; Hasegawa, Atsuhiko; Murakami, Yuji; Zeng, Na; Takatsuka, Natsuko; Maeda, Yasuhiro; Masuda, Takao; Suehiro, Youko; Kannagi, Mari
2017-02-01
Adult T cell leukemia/lymphoma (ATL), a CD4 + T cell malignancy with a poor prognosis, is caused by human T cell leukemia virus type 1 (HTLV-1) infection. High proviral load (PVL) is a risk factor for the progression to ATL. We previously reported that some asymptomatic carriers had severely reduced functions of CTLs against HTLV-1 Tax, the major target Ag. Furthermore, the CTL responses tended to be inversely correlated with PVL, suggesting that weak HTLV-1-specific CTL responses may be involved in the elevation of PVL. Our previous animal studies indicated that oral HTLV-1 infection, the major route of infection, caused persistent infection with higher PVL in rats compared with other routes. In this study, we found that Tax-specific CD8 + T cells were present, but not functional, in orally infected rats as observed in some human asymptomatic carriers. Even in the infected rats with immune unresponsiveness against Tax, Tax-specific CTL epitope-pulsed dendritic cell (DC) therapy reduced the PVL and induced Tax-specific CD8 + T cells capable of proliferating and producing IFN-γ. Furthermore, we found that monocyte-derived DCs from most infected individuals still had the capacity to stimulate CMV-specific autologous CTLs in vitro, indicating that DC therapy may be applicable to most infected individuals. These data suggest that peptide-pulsed DC immunotherapy will be useful to induce functional HTLV-1-specific CTLs and decrease PVL in infected individuals with high PVL and impaired HTLV-1-specific CTL responses, thereby reducing the risk of the development of ATL. Copyright © 2017 by The American Association of Immunologists, Inc.
Sensitivity of subject-specific models to errors in musculo-skeletal geometry.
Carbone, V; van der Krogt, M M; Koopman, H F J M; Verdonschot, N
2012-09-21
Subject-specific musculo-skeletal models of the lower extremity are an important tool for investigating various biomechanical problems, for instance the results of surgery such as joint replacements and tendon transfers. The aim of this study was to assess the potential effects of errors in musculo-skeletal geometry on subject-specific model results. We performed an extensive sensitivity analysis to quantify the effect of the perturbation of origin, insertion and via points of each of the 56 musculo-tendon parts contained in the model. We used two metrics, namely a Local Sensitivity Index (LSI) and an Overall Sensitivity Index (OSI), to distinguish the effect of the perturbation on the predicted force produced by only the perturbed musculo-tendon parts and by all the remaining musculo-tendon parts, respectively, during a simulated gait cycle. Results indicated that, for each musculo-tendon part, only two points show a significant sensitivity: its origin, or pseudo-origin, point and its insertion, or pseudo-insertion, point. The most sensitive points belong to those musculo-tendon parts that act as prime movers in the walking movement (insertion point of the Achilles Tendon: LSI=15.56%, OSI=7.17%; origin points of the Rectus Femoris: LSI=13.89%, OSI=2.44%) and as hip stabilizers (insertion points of the Gluteus Medius Anterior: LSI=17.92%, OSI=2.79%; insertion point of the Gluteus Minimus: LSI=21.71%, OSI=2.41%). The proposed priority list provides quantitative information to improve the predictive accuracy of subject-specific musculo-skeletal models. Copyright © 2012 Elsevier Ltd. All rights reserved.
Sekizuka, Tsuyoshi; Yamochi, Tadanori; Firouzi, Sanaz; Sato, Tomoo; Umeki, Kazumi; Sasaki, Daisuke; Hasegawa, Hiroo; Kubota, Ryuji; Sobata, Rieko; Matsumoto, Chieko; Kaneko, Noriaki; Momose, Haruka; Araki, Kumiko; Saito, Masumichi; Nosaka, Kisato; Utsunomiya, Atae; Koh, Ki-Ryang; Ogata, Masao; Uchimaru, Kaoru; Iwanaga, Masako; Sagara, Yasuko; Yamano, Yoshihisa; Okayama, Akihiko; Miura, Kiyonori; Satake, Masahiro; Saito, Shigeru; Itabashi, Kazuo; Yamaguchi, Kazunari; Kuroda, Makoto; Watanabe, Toshiki; Okuma, Kazu
2017-01-01
ABSTRACT Western blotting (WB) for human T cell leukemia virus type 1 (HTLV-1) is performed to confirm anti-HTLV-1 antibodies detected at the initial screening of blood donors and in pregnant women. However, the frequent occurrence of indeterminate results is a problem with this test. We therefore assessed the cause of indeterminate WB results by analyzing HTLV-1 provirus genomic sequences. A quantitative PCR assay measuring HTLV-1 provirus in WB-indeterminate samples revealed that the median proviral load was approximately 100-fold lower than that of WB-positive samples (0.01 versus 0.71 copy/100 cells). Phylogenic analysis of the complete HTLV-1 genomes of WB-indeterminate samples did not identify any specific phylogenetic groups. When we analyzed the nucleotide changes in 19 HTLV-1 isolates from WB-indeterminate samples, we identified 135 single nucleotide substitutions, composed of four types, G to A (29%), C to T (19%), T to C (19%), and A to G (16%). In the most frequent G-to-A substitution, 64% occurred at GG dinucleotides, indicating that APOBEC3G is responsible for mutagenesis in WB-indeterminate samples. Moreover, interestingly, five WB-indeterminate isolates had nonsense mutations in Pol and/or Tax, Env, p12, and p30. These findings suggest that WB-indeterminate carriers have low production of viral antigens because of a combination of a low proviral load and mutations in the provirus, which may interfere with host recognition of HTLV-1 antigens. PMID:28701419
Kuramitsu, Madoka; Sekizuka, Tsuyoshi; Yamochi, Tadanori; Firouzi, Sanaz; Sato, Tomoo; Umeki, Kazumi; Sasaki, Daisuke; Hasegawa, Hiroo; Kubota, Ryuji; Sobata, Rieko; Matsumoto, Chieko; Kaneko, Noriaki; Momose, Haruka; Araki, Kumiko; Saito, Masumichi; Nosaka, Kisato; Utsunomiya, Atae; Koh, Ki-Ryang; Ogata, Masao; Uchimaru, Kaoru; Iwanaga, Masako; Sagara, Yasuko; Yamano, Yoshihisa; Okayama, Akihiko; Miura, Kiyonori; Satake, Masahiro; Saito, Shigeru; Itabashi, Kazuo; Yamaguchi, Kazunari; Kuroda, Makoto; Watanabe, Toshiki; Okuma, Kazu; Hamaguchi, Isao
2017-09-01
Western blotting (WB) for human T cell leukemia virus type 1 (HTLV-1) is performed to confirm anti-HTLV-1 antibodies detected at the initial screening of blood donors and in pregnant women. However, the frequent occurrence of indeterminate results is a problem with this test. We therefore assessed the cause of indeterminate WB results by analyzing HTLV-1 provirus genomic sequences. A quantitative PCR assay measuring HTLV-1 provirus in WB-indeterminate samples revealed that the median proviral load was approximately 100-fold lower than that of WB-positive samples (0.01 versus 0.71 copy/100 cells). Phylogenic analysis of the complete HTLV-1 genomes of WB-indeterminate samples did not identify any specific phylogenetic groups. When we analyzed the nucleotide changes in 19 HTLV-1 isolates from WB-indeterminate samples, we identified 135 single nucleotide substitutions, composed of four types, G to A (29%), C to T (19%), T to C (19%), and A to G (16%). In the most frequent G-to-A substitution, 64% occurred at GG dinucleotides, indicating that APOBEC3G is responsible for mutagenesis in WB-indeterminate samples. Moreover, interestingly, five WB-indeterminate isolates had nonsense mutations in Pol and/or Tax, Env, p12, and p30. These findings suggest that WB-indeterminate carriers have low production of viral antigens because of a combination of a low proviral load and mutations in the provirus, which may interfere with host recognition of HTLV-1 antigens. Copyright © 2017 American Society for Microbiology.
Jangam, Sujit R.; Yamada, Douglas H.; McFall, Sally M.; Kelso, David M.
2009-01-01
PCR detection of human immunodeficiency virus type 1 (HIV-1) proviral DNA is the method recommended for use for the diagnosis of HIV-1 infection in infants in limited-resource settings. Currently, testing must be performed in central laboratories, which are usually located some distance from health care facilities. While the collection and transportation of samples, such as dried blood spots, has improved test accessibility, the results are often not returned for several weeks. To enable PCR to be performed at the point of care while the mothers wait, we have developed a vertical filtration method that uses a separation membrane and an absorbent pad to extract cellular DNA from whole blood in less than 2 min. Cells are trapped in the separation membrane as the specimen is collected, and then a lysis buffer is added. The membrane retains the DNA, while the buffer washes away PCR inhibitors, which get wicked into the absorbent blotter pad. The membrane containing the entrapped DNA is then added to the PCR mixture without further purification. The method demonstrates a high degree of reproducibility and analytical sensitivity and allows the quantification of as few as 20 copies of HIV-1 proviral DNA from 100 μl of blood. In a blinded study with 182 longitudinal samples from infants (ages, 0 to 72 weeks) obtained from the Women and Infants Transmission Study, our assay demonstrated a sensitivity of 99% and a specificity of 100%. PMID:19644129
Nagy, Peter D; Pogany, Judit; Xu, Kai
2016-03-03
Plant positive strand RNA viruses are intracellular infectious agents that take advantage of cellular lipids and membranes to support replication and protect viral RNA from degradation by host antiviral responses. In this review, we discuss how Tomato bushy stunt virus (TBSV) co-opts lipid transfer proteins and modulates lipid metabolism and transport to facilitate the assembly of the membrane-bound viral replicase complexes within intricate replication compartments. Identification and characterization of the proviral roles of specific lipids and proteins involved in lipid metabolism based on results from yeast (Saccharomyces cerevisiae) model host and cell-free approaches are discussed. The review also highlights the advantage of using liposomes with chemically defined composition to identify specific lipids required for TBSV replication. Remarkably, all the known steps in TBSV replication are dependent on cellular lipids and co-opted membranes.
Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E; Greenwood, Alex D
2015-11-24
Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals.
Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E.; Greenwood, Alex D.
2015-01-01
Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals. PMID:26610552
Avian sarcoma virus 17 carries the jun oncogene.
Maki, Y; Bos, T J; Davis, C; Starbuck, M; Vogt, P K
1987-01-01
Biologically active molecular clones of avian sarcoma virus 17 (ASV 17) contain a replication-defective proviral genome of 3.5 kilobases (kb). The genome retains partial gag and env sequences, which flank a cell-derived putative oncogene of 0.93 kb, termed jun. The jun gene lacks preserved coding domains of tyrosine-specific protein kinases. It also shows no significant nucleic acid homology with other known oncogenes. The probable transformation-specific protein in ASV 17-transformed cells is a 55-kDa gag-jun fusion product. Images PMID:3033666
Pau, Chou-Pong; Wells, Susan K; Granade, Timothy C
2012-01-01
This chapter describes a real-time PCR method for the detection of HIV-1 proviral DNA in whole blood samples using a novel double-stranded primer system. The assay utilizes a simple commercially available DNA extraction method and a rapid and easy-to-perform real-time PCR protocol to consistently detect a minimum of four copies of HIV-1 group M proviral DNA in as little as 90 min after sample (whole blood) collection. Co-amplification of the human RNase P gene serves as an internal control to monitor the efficiency of both the DNA extraction and amplification. Once the assay is validated properly, it may be suitable as an alternative confirmation test for HIV-1 infections in a variety of HIV testing venues including the mother-to-child transmission testing sites, clinics, and diagnostic testing centers.
Etenna, Sonia Lekana-Douki; Caron, Mélanie; Besson, Guillaume; Makuwa, Maria; Gessain, Antoine; Mahé, Antoine; Kazanji, Mirdad
2008-11-01
Human T-cell leukemia virus type 1 (HTLV-1) is highly endemic in areas of central Africa; mother-to-child transmission and sexual transmission are considered to be the predominant routes. To determine the prevalence and subtypes of HTLV-1/2 in pregnant women in Gabon, we conducted an epidemiological survey in the five main cities of the country. In 907 samples, the HTLV-1 seroprevalence was 2.1%, which is lower than that previously reported. Only one case of HTLV-2 infection was found. The HTLV-1 seroprevalence increased with age and differed between regions (P = 0.05), with the highest prevalence (5%) in the southeastern region. A wide range of HTLV-1 proviral loads was observed among the infected women. The level of the proviral load was correlated with a high HTLV-1 antibody titer (P = 0.02). Sequencing of HTLV-1 env and long terminal repeat fragments showed that all but one strain belonged to the central African subtype B; the outlier was of cosmopolitan subtype A. The new strains of subtype B exhibited wide genetic diversity, but there was no evidence of clustering of specific genomes within geographical regions of the country. Some strains were closely related to simian T-cell leukemia virus type 1 strains of great apes, suggesting that in these areas some HTLV-1 strains could arise from relatively recent interspecies transmission. The sole HTLV-2 strain belonged to subtype B. In this study we showed that the prevalence of HTLV-1 in the southeast is one of the highest in the world for pregnant women.
Zella, D; Cavicchini, A; Cattaneo, E; Cimarelli, A; Bertazzoni, U
1995-02-01
The detection of proviral DNA by Polymerase Chain Reaction (PCR) is regarded as an important tool in the diagnosis of HIV-1 infection, specially among adults at risk of AIDS and children born to seropositive mothers. However, application of PCR in routine testing is hampered by the need to use radioactive probes. In this study, a non-radioactive test based on a microtiter plate (DNA Enzyme ImmunoAssay, DEIA) was used for the detection of proviral sequences of HIV-1 in peripheral blood cells of different patients. The results of the PCR-DEIA assay were compared to those obtained by liquid hybridization (PCR-LH), virus isolation (VI) and Western blot (WB). The study population included 92 patients belonging to three different groups: seropositive subjects with a well-defined clinical status and WB profile; adults at risk of infection with negative or indeterminate WB; children born to seropositive mothers with still unestablished HIV-1 infection. In the seropositive subjects, both PCR-LH and PCR-DEIA confirmed infection and gave the same results as WB. In adults at risk of infection, PCR with both methods anticipated the seroconversion in one patient with indeterminate WB and confirmed the absence of infection among seronegative and other indeterminate patients. In children born to seropositive mothers, both PCR systems as well as VI permitted an early diagnosis of infection, as confirmed by the clinical follow-up. This study has shown that in subjects at risk of AIDS and in children born to seropositive mothers, the non-isotopic DEIA method presents the same sensitivity and specificity for the detection of HIV-1 infection as the radioactive procedure. The DEIA method appears to be particularly useful for the detection of PCR products in routine diagnostic analyses.
Burgess, Shawn; Reim, Gerlinde; Chen, Wenbiao; Hopkins, Nancy; Brand, Michael
2002-02-01
In early embryonic development, the brain is divided into three main regions along the anteroposterior axis: the forebrain, midbrain and hindbrain. Through retroviral insertional mutagenesis and chemical mutagenesis experiments in zebrafish, we have isolated mutations that cause abnormal hindbrain organization and a failure of the midbrain-hindbrain boundary (MHB) to form, a region that acts as an organizer for the adjacent brain regions. The mutations fail to complement the spiel-ohne-grenzen (spg) mutation, which causes a similar phenotype, but for which the affected gene is unknown. We show through genetic mapping, cloning of the proviral insertion site and allele sequencing that spg mutations disrupt pou2, a gene encoding the Pou2 transcription factor. Based on chromosomal synteny, phylogenetic sequence comparison, and expression and functional data, we suggest that pou2 is the zebrafish ortholog of mouse Oct3/Oct4 and human POU5F1. For the mammalian genes, a function in brain development has so far not been described. In the absence of functional pou2, expression of markers for the midbrain, MHB and the hindbrain primordium (pax2.1, wnt1, krox20) are severely reduced, correlating with the neuroectoderm-specific expression phase of pou2. Injection of pou2 mRNA restores these defects in spg mutant embryos, but does not activate these markers ectopically, demonstrating a permissive role for pou2. Injections of pou2-morpholinos phenocopy the spg phenotype at low concentration, further proving that spg encodes pou2. Two observations suggest that pou2 has an additional earlier function: higher pou2-morpholino concentrations specifically cause a pre-gastrula arrest of cell division and morphogenesis, and expression of pou2 mRNA itself is reduced in spg-homozygous embryos at this stage. These experiments suggest two roles for pou2. Initially, Pou2 functions during early proliferation and morphogenesis of the blastomeres, similar to Oct3/4 in mammals during formation of the inner cell mass. During zebrafish brain formation, Pou2 then functions a second time to activate gene expression in the midbrain and hindbrain primordium, which is reflected at later stages in the specific lack in spg embryos of the MHB and associated defects in the mid- and hindbrain.
Ostrowski, Sisse R; Katzenstein, Terese L; Thim, Per T; Pedersen, Bente K; Gerstoft, Jan; Ullum, Henrik
2005-02-01
Immunological and virological consequences of low-level viremia in human immunodeficiency virus (HIV) type 1-infected patients receiving highly active antiretroviral therapy (HAART) remain to be determined. For 24 months, 101 HAART-treated, HIV-1-infected patients with HIV RNA levels =200 copies/mL were followed prospectively: HIV RNA level and CD4 and CD8 cell counts were investigated every 3 months, and proviral DNA and T cell subsets were investigated every 6 months. During follow-up, 33 patients had HIV RNA levels =20 copies/mL at all visits (uVL patients), whereas 68 patients had HIV RNA levels >20 copies/mL at >/=1 visit (dVL patients) (median increase, 81 copies/mL [interquartile range, 37-480 copies/mL]). dVL patients had higher concentrations of CD8 cells, activated and memory T cells, and proviral DNA, compared with uVL patients (P<.05). A higher HIV RNA level was independently associated with reduced CD4 gain (P<.001). A higher HIV RNA level also was associated with increases in activated CD8(+)CD38(+) and CD8(+)HLA-DR(+) cells (P<.05), and a higher level of activated CD8(+)CD38(+) cells was independently associated with reduced CD4 gain (P<.05). A higher proviral DNA level was associated with increases in CD4(+)CD45RA(-)CD28(-) effector cells and reductions in naive CD4(+)CD45RA(+)CD62L(+) and CD8(+)CD45RA(+)CD62L(+) cells (P<.05). Higher levels of activated CD4(+)HLA-DR(+) and early differentiated CD4(+)CD45RA(-)CD28(+) cells predicted increased risk of subsequent detectable viremia in patients with undetectable HIV RNA (P<.05). These findings indicate that low-level viremia and proviral DNA are intimately associated with the immunological and virological equilibrium in patients receiving HAART.
Potential Links between Hepadnavirus and Bornavirus Sequences in the Host Genome and Cancer.
Honda, Tomoyuki
2017-01-01
Various viruses leave their sequences in the host genomes during infection. Such events occur mainly in retrovirus infection but also sometimes in DNA and non-retroviral RNA virus infections. If viral sequences are integrated into the genomes of germ line cells, the sequences can become inherited as endogenous viral elements (EVEs). The integration events of viral sequences may have oncogenic potential. Because proviral integrations of some retroviruses and/or reactivation of endogenous retroviruses are closely linked to cancers, viral insertions related to non-retroviral viruses also possibly contribute to cancer development. This article focuses on genomic viral sequences derived from two non-retroviral viruses, whose endogenization is already reported, and discusses their possible contributions to cancer. Viral insertions of hepatitis B virus play roles in the development of hepatocellular carcinoma. Endogenous bornavirus-like elements, the only non-retroviral RNA virus-related EVEs found in the human genome, may also be involved in cancer formation. In addition, the possible contribution of the interactions between viruses and retrotransposons, which seem to be a major driving force for generating EVEs related to non-retroviral RNA viruses, to cancers will be discussed. Future studies regarding the possible links described here may open a new avenue for the development of novel therapeutics for tumor virus-related cancers and/or provide novel insights into EVE functions.
hnRNP K Coordinates Transcriptional Silencing by SETDB1 in Embryonic Stem Cells
Thompson, Peter J.; Dulberg, Vered; Moon, Kyung-Mee; Foster, Leonard J.; Chen, Carol; Karimi, Mohammad M.; Lorincz, Matthew C.
2015-01-01
Retrotransposition of endogenous retroviruses (ERVs) poses a substantial threat to genome stability. Transcriptional silencing of a subset of these parasitic elements in early mouse embryonic and germ cell development is dependent upon the lysine methyltransferase SETDB1, which deposits H3K9 trimethylation (H3K9me3) and the co-repressor KAP1, which binds SETDB1 when SUMOylated. Here we identified the transcription co-factor hnRNP K as a novel binding partner of the SETDB1/KAP1 complex in mouse embryonic stem cells (mESCs) and show that hnRNP K is required for ERV silencing. RNAi-mediated knockdown of hnRNP K led to depletion of H3K9me3 at ERVs, concomitant with de-repression of proviral reporter constructs and specific ERV subfamilies, as well as a cohort of germline-specific genes directly targeted by SETDB1. While hnRNP K recruitment to ERVs is dependent upon KAP1, SETDB1 binding at these elements requires hnRNP K. Furthermore, an intact SUMO conjugation pathway is necessary for SETDB1 recruitment to proviral chromatin and depletion of hnRNP K resulted in reduced SUMOylation at ERVs. Taken together, these findings reveal a novel regulatory hierarchy governing SETDB1 recruitment and in turn, transcriptional silencing in mESCs. PMID:25611934
Novel disease susceptibility factors for fungal necrotrophic pathogens in Arabidopsis.
Dobón, Albor; Canet, Juan Vicente; García-Andrade, Javier; Angulo, Carlos; Neumetzler, Lutz; Persson, Staffan; Vera, Pablo
2015-04-01
Host cells use an intricate signaling system to respond to invasions by pathogenic microorganisms. Although several signaling components of disease resistance against necrotrophic fungal pathogens have been identified, our understanding for how molecular components and host processes contribute to plant disease susceptibility is rather sparse. Here, we identified four transcription factors (TFs) from Arabidopsis that limit pathogen spread. Arabidopsis mutants defective in any of these TFs displayed increased disease susceptibility to Botrytis cinerea and Plectosphaerella cucumerina, and a general activation of non-immune host processes that contribute to plant disease susceptibility. Transcriptome analyses revealed that the mutants share a common transcriptional signature of 77 up-regulated genes. We characterized several of the up-regulated genes that encode peptides with a secretion signal, which we named PROVIR (for provirulence) factors. Forward and reverse genetic analyses revealed that many of the PROVIRs are important for disease susceptibility of the host to fungal necrotrophs. The TFs and PROVIRs identified in our work thus represent novel genetic determinants for plant disease susceptibility to necrotrophic fungal pathogens.
Guimaraes, Ana M S; Brandão, Paulo E; de Moraes, Wanderlei; Cubas, Zalmir S; Santos, Leonilda C; Villarreal, Laura Y B; Robes, Rogério R; Coelho, Fabiana M; Resende, Mauricio; Santos, Renata C F; Oliveira, Rosangela C; Yamaguti, Mauricio; Marques, Lucas M; Neto, Renata L; Buzinhani, Melissa; Marques, Regina; Messick, Joanne B; Biondo, Alexander W; Timenetsky, Jorge
2009-06-01
A total of 57 captive neotropical felids (one Leopardus geoffroyi, 14 Leopardus pardalis, 17 Leopardus wiedii, 22 Leopardus tigrinus, and three Puma yagouaroundi) from the Itaipu Binacional Wildlife Research Center (Refúgio Bela Vista, Southern Brazil) were anesthetized for blood collection. Feces samples were available for 44 animals, including one L. geoffroyi, eight L. pardalis, 14 L. wiedii, 20 L. tigrinus, and one P. yagouaroundi. Total DNA and RNA were extracted from blood and feces, respectively, using commercial kits. Blood DNA samples were evaluated by polymerase chain reaction (PCR) for feline leukemia virus (FeLV) proviral DNA, whereas reverse transcriptase-PCR was run on fecal samples for detection of coronavirus RNA. None of the samples were positive for coronaviruses. A male L. pardalis and a female L. tigrinus were positive for FeLV proviral DNA, and identities of PCR products were confirmed by sequencing. This is the first evidence of FeLV proviral DNA in these species in Southern Brazil.
Ma, Yuyuan; Lv, Maomin; Xu, Shu; Wu, Jianmin; Tian, Kegong; Zhang, Jingang
2010-07-01
Existence of porcine endogenous retrovirus (PERV) hinders pigs to be used in clinical xenotransplantation to alleviate the shortage of human transplants. Chinese miniature pigs are potential organ donors for xenotransplantation in China. However, so far, an adequate level of information on the molecular characteristics of PERV from Chinese miniature pigs has not been available. We described here the cloning and characterization of full-length proviral DNA of PERV from Chinese Wuzhishan miniature pigs inbred (WZSP). Full-length nucleotide sequences of PERV-WZSP and other PERVs were aligned and phylogenetic tree was constructed from deduced amino-acid sequences of env. The results demonstrated that the full-length proviral DNA of PERV-WZSP belongs to gammaretrovirus and shares high similarity with other PERVs. Sequence analysis also suggested that different patterns of LTR existed in the same porcine germ line and partial PERV-C sequence may recombine with PERV-A sequence in LTR. (c) 2008 Elsevier Ltd. All rights reserved.
Patient-specific simulation of guidewire deformation during transcatheter aortic valve implantation.
Vy, Phuoc; Auffret, Vincent; Castro, Miguel; Badel, Pierre; Rochette, Michel; Haigron, Pascal; Avril, Stéphane
2018-06-01
Transcatheter aortic valve implantation is a recent mini-invasive procedure to implant an aortic valve prosthesis. Prosthesis positioning in transcatheter aortic valve implantation appears as an important aspect for the success of the intervention. Accordingly, we developed a patient-specific finite element framework to predict the insertion of the stiff guidewire, used to position the aortic valve. We simulated the guidewire insertion for 2 patients based on their pre-operative CT scans. The model was designed to primarily predict the position and the angle of the guidewires in the aortic valve, and the results were successfully compared with intraoperative images. The present paper describes extensively the numerical model, which was solved by using the ANSYS software with an implicit resolution scheme, as well as the stabilization techniques which were used to overcome numerical instabilities. We performed sensitivity analysis on the properties of the guidewire (curvature angle, curvature radius, and stiffness) and the conditions of insertion (insertion force and orientation). We also explored the influence of the model parameters. The accuracy of the model was quantitatively evaluated as the distance and the angle difference between the simulated guidewires and the intraoperative ones. A good agreement was obtained between the model predictions and intraoperative views available for 2 patient cases. In conclusion, we showed that the shape of the guidewire in the aortic valve was mainly determined by the geometry of the patient's aorta and by the conditions of insertion (insertion force and orientation). Copyright © 2018 John Wiley & Sons, Ltd.
2013-01-01
Background Human T-cell leukemia virus type 1 (HTLV-1) causes chronic infection leading to development of adult T-cell leukemia (ATL) and inflammatory diseases. Non-human primates infected with simian T-cell leukemia virus type 1 (STLV-1) are considered to constitute a suitable animal model for HTLV-1 research. However, the function of the regulatory and accessory genes of STLV-1 has not been analyzed in detail. In this study, STLV-1 in naturally infected Japanese macaques was analyzed. Results We identified spliced transcripts of STLV-1 corresponding to HTLV-1 tax and HTLV-1 bZIP factor (HBZ). STLV-1 Tax activated the NFAT, AP-1 and NF-κB signaling pathways, whereas STLV-1 bZIP factor (SBZ) suppressed them. Conversely, SBZ enhanced TGF-β signaling and induced Foxp3 expression. Furthermore, STLV-1 Tax activated the canonical Wnt pathway while SBZ suppressed it. STLV-1 Tax enhanced the viral promoter activity while SBZ suppressed its activation. Then we addressed the clonal proliferation of STLV-1+ cells by massively sequencing the provirus integration sites. Some clones proliferated distinctively in monkeys with higher STLV-1 proviral loads. Notably, one of the monkeys surveyed in this study developed T-cell lymphoma in the brain; STLV-1 provirus was integrated in the lymphoma cell genome. When anti-CCR4 antibody, mogamulizumab, was administered into STLV-1-infected monkeys, the proviral load decreased dramatically within 2 weeks. We observed that some abundant clones recovered after discontinuation of mogamulizumab administration. Conclusions STLV-1 Tax and SBZ have functions similar to those of their counterparts in HTLV-1. This study demonstrates that Japanese macaques naturally infected with STLV-1 resemble HTLV-1 carriers and are a suitable model for the investigation of persistent HTLV-1 infection and asymptomatic HTLV-1 carrier state. Using these animals, we verified that mogamulizumab, which is currently used as a drug for relapsed ATL, is also effective in reducing the proviral load in asymptomatic individuals. PMID:24156738
Novel Disease Susceptibility Factors for Fungal Necrotrophic Pathogens in Arabidopsis
García-Andrade, Javier; Angulo, Carlos; Neumetzler, Lutz; Persson, Staffan; Vera, Pablo
2015-01-01
Host cells use an intricate signaling system to respond to invasions by pathogenic microorganisms. Although several signaling components of disease resistance against necrotrophic fungal pathogens have been identified, our understanding for how molecular components and host processes contribute to plant disease susceptibility is rather sparse. Here, we identified four transcription factors (TFs) from Arabidopsis that limit pathogen spread. Arabidopsis mutants defective in any of these TFs displayed increased disease susceptibility to Botrytis cinerea and Plectosphaerella cucumerina, and a general activation of non-immune host processes that contribute to plant disease susceptibility. Transcriptome analyses revealed that the mutants share a common transcriptional signature of 77 up-regulated genes. We characterized several of the up-regulated genes that encode peptides with a secretion signal, which we named PROVIR (for provirulence) factors. Forward and reverse genetic analyses revealed that many of the PROVIRs are important for disease susceptibility of the host to fungal necrotrophs. The TFs and PROVIRs identified in our work thus represent novel genetic determinants for plant disease susceptibility to necrotrophic fungal pathogens. PMID:25830627
Liu, Weihua; Yang, Yi; Wang, Shuqing; Liu, Yang
2014-01-01
Order insertion often occurs in the scheduling process of logistics service supply chain (LSSC), which disturbs normal time scheduling especially in the environment of mass customization logistics service. This study analyses order similarity coefficient and order insertion operation process and then establishes an order insertion scheduling model of LSSC with service capacity and time factors considered. This model aims to minimize the average unit volume operation cost of logistics service integrator and maximize the average satisfaction degree of functional logistics service providers. In order to verify the viability and effectiveness of our model, a specific example is numerically analyzed. Some interesting conclusions are obtained. First, along with the increase of completion time delay coefficient permitted by customers, the possible inserting order volume first increases and then trends to be stable. Second, supply chain performance reaches the best when the volume of inserting order is equal to the surplus volume of the normal operation capacity in mass service process. Third, the larger the normal operation capacity in mass service process is, the bigger the possible inserting order's volume will be. Moreover, compared to increasing the completion time delay coefficient, improving the normal operation capacity of mass service process is more useful.
Broering, R; Trippler, M; Werner, M; Real, C I; Megger, D A; Bracht, T; Schweinsberg, V; Sitek, B; Eisenacher, M; Meyer, H E; Baba, H A; Weber, F; Hoffmann, A-C; Gerken, G; Schlaak, J F
2016-05-01
The interferon-stimulated gene 15 (ISG15) plays an important role in the pathogenesis of hepatitis C virus (HCV) infection. ISG15-regulated proteins have previously been identified that putatively affect this proviral interaction. The present observational study aimed to elucidate the relation between ISG15 and these host factors during HCV infection. Transcriptomic and proteomic analyses were performed using liver samples of HCV-infected (n = 54) and uninfected (n = 10) or HBV-infected controls (n = 23). Primary human hepatocytes (PHH) were treated with Toll-like receptor ligands, interferons and kinase inhibitors. Expression of ISG15 and proteasome subunit alpha type-6 (PSMA6) was suppressed in subgenomic HCV replicon cell lines using specific siRNAs. Comparison of hepatic expression patterns revealed significantly increased signals for ISG15, IFIT1, HNRNPK and PSMA6 on the protein level as well as ISG15, IFIT1 and PSMA6 on the mRNA level in HCV-infected patients. In contrast to interferon-stimulated genes, PSMA6 expression occurred independent of HCV load and genotype. In PHH, the expression of ISG15 and PSMA6 was distinctly induced by poly(I:C), depending on IRF3 activation or PI3K/AKT signalling, respectively. Suppression of PSMA6 in HCV replicon cells led to significant induction of ISG15 expression, thus combined knock-down of both genes abrogated the antiviral effect induced by the separate suppression of ISG15. These data indicate that hepatic expression of PSMA6, which is upregulated during viral hepatitis, likely depends on TLR3 activation. PSMA6 affects the expression of immunoregulatory ISG15, a proviral factor in the pathogenesis of HCV infection. Therefore, the proteasome might be involved in the enigmatic interaction between ISG15 and HCV. © 2016 John Wiley & Sons Ltd.
Robinson, Andrew P; Tipping, Jill; Cullen, David M; Hamilton, David; Brown, Richard; Flynn, Alex; Oldfield, Christopher; Page, Emma; Price, Emlyn; Smith, Andrew; Snee, Richard
2016-12-01
Patient-specific absorbed dose calculations for molecular radiotherapy require accurate activity quantification. This is commonly derived from Single-Photon Emission Computed Tomography (SPECT) imaging using a calibration factor relating detected counts to known activity in a phantom insert. A series of phantom inserts, based on the mathematical models underlying many clinical dosimetry calculations, have been produced using 3D printing techniques. SPECT/CT data for the phantom inserts has been used to calculate new organ-specific calibration factors for (99m) Tc and (177)Lu. The measured calibration factors are compared to predicted values from calculations using a Gaussian kernel. Measured SPECT calibration factors for 3D printed organs display a clear dependence on organ shape for (99m) Tc and (177)Lu. The observed variation in calibration factor is reproduced using Gaussian kernel-based calculation over two orders of magnitude change in insert volume for (99m) Tc and (177)Lu. These new organ-specific calibration factors show a 24, 11 and 8 % reduction in absorbed dose for the liver, spleen and kidneys, respectively. Non-spherical calibration factors from 3D printed phantom inserts can significantly improve the accuracy of whole organ activity quantification for molecular radiotherapy, providing a crucial step towards individualised activity quantification and patient-specific dosimetry. 3D printed inserts are found to provide a cost effective and efficient way for clinical centres to access more realistic phantom data.
Okuma, Kazu; Yamagishi, Makoto; Yamochi, Tadanori; Firouzi, Sanaz; Momose, Haruka; Mizukami, Takuo; Takizawa, Kazuya; Araki, Kumiko; Sugamura, Kazuo; Yamaguchi, Kazunari; Watanabe, Toshiki
2014-01-01
Quantitative PCR (qPCR) for human T-lymphotropic virus 1 (HTLV-1) is useful for measuring the amount of integrated HTLV-1 proviral DNA in peripheral blood mononuclear cells. Many laboratories in Japan have developed different HTLV-1 qPCR methods. However, when six independent laboratories analyzed the proviral load of the same samples, there was a 5-fold difference in their results. To standardize HTLV-1 qPCR, preparation of a well-defined reference material is needed. We analyzed the integrated HTLV-1 genome and the internal control (IC) genes of TL-Om1, a cell line derived from adult T-cell leukemia, to confirm its suitability as a reference material for HTLV-1 qPCR. Fluorescent in situ hybridization (FISH) showed that HTLV-1 provirus was monoclonally integrated in chromosome 1 at the site of 1p13 in the TL-Om1 genome. HTLV-1 proviral genome was not transferred from TL-Om1 to an uninfected T-cell line, suggesting that the HTLV-1 proviral copy number in TL-Om1 cells is stable. To determine the copy number of HTLV-1 provirus and IC genes in TL-Om1 cells, we used FISH, digital PCR, and qPCR. HTLV-1 copy numbers obtained by these three methods were similar, suggesting that their results were accurate. Also, the ratio of the copy number of HTLV-1 provirus to one of the IC genes, RNase P, was consistent for all three methods. These findings indicate that TL-Om1 cells are an appropriate reference material for HTLV-1 qPCR. PMID:25502533
Prevalence of koala retrovirus in geographically diverse populations in Australia.
Simmons, G S; Young, P R; Hanger, J J; Jones, K; Clarke, D; McKee, J J; Meers, J
2012-10-01
To determine the prevalence of koala retrovirus (KoRV) in selected koala populations and to estimate proviral copy number in a subset of koalas. Blood or tissue samples from 708 koalas in Queensland, New South Wales, Victoria and South Australia were tested for KoRV pol provirus gene using standard polymerase chain reaction (PCR), nested PCR and real-time PCR (qPCR). Prevalence of KoRV provirus-positive koalas was 100% in four regions of Queensland and New South Wales, 72.2% in mainland Victoria, 26.6% on four Victorian islands and 14.8% on Kangaroo Island, South Australia. Estimated proviral copy number per cell in four groups of koalas from Queensland and Victoria showed marked variation, ranging from a mean of 165 copies per cell in the Queensland group to 1.29 × 10(-4) copies per cell in one group of Victorian koalas. The higher prevalence of KoRV-positive koalas in the north of Australia and high proviral loads in Queensland koalas may indicate KoRV entered and became endogenous in the north and is spreading southwards. It is also possible there are genetic differences between koalas in northern and southern Australia that affect susceptibility to KoRV infection or endogenisation, or that environmental factors affecting transmission in northern states are absent or uncommon in southern regions. Although further studies are required, the finding of proviral copy numbers orders of magnitude lower than what would be expected for the presence of a single copy in every cell for many Victorian animals suggests that KoRV is not endogenous in these animals and likely reflects ongoing exogenous infection. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.
Okuma, Kazu; Yamochi, Tadanori; Sato, Tomoo; Sasaki, Daisuke; Hasegawa, Hiroo; Umeki, Kazumi; Kubota, Ryuji; Sobata, Rieko; Matsumoto, Chieko; Kaneko, Noriaki; Naruse, Isao; Yamagishi, Makoto; Nakashima, Makoto; Momose, Haruka; Araki, Kumiko; Mizukami, Takuo; Mizusawa, Saeko; Okada, Yoshiaki; Ochiai, Masaki; Utsunomiya, Atae; Koh, Ki-Ryang; Ogata, Masao; Nosaka, Kisato; Uchimaru, Kaoru; Iwanaga, Masako; Sagara, Yasuko; Yamano, Yoshihisa; Satake, Masahiro; Okayama, Akihiko; Mochizuki, Manabu; Izumo, Shuji; Saito, Shigeru; Itabashi, Kazuo; Kamihira, Shimeru; Yamaguchi, Kazunari; Watanabe, Toshiki
2015-01-01
Quantitative PCR (qPCR) analysis of human T-cell leukemia virus type 1 (HTLV-1) was used to assess the amount of HTLV-1 provirus DNA integrated into the genomic DNA of host blood cells. Accumulating evidence indicates that a high proviral load is one of the risk factors for the development of adult T-cell leukemia/lymphoma and HTLV-1-associated myelopathy/tropical spastic paraparesis. However, interlaboratory variability in qPCR results makes it difficult to assess the differences in reported proviral loads between laboratories. To remedy this situation, we attempted to minimize discrepancies between laboratories through standardization of HTLV-1 qPCR in a collaborative study. TL-Om1 cells that harbor the HTLV-1 provirus were serially diluted with peripheral blood mononuclear cells to prepare a candidate standard. By statistically evaluating the proviral loads of the standard and those determined using in-house qPCR methods at each laboratory, we determined the relative ratios of the measured values in the laboratories to the theoretical values of the TL-Om1 standard. The relative ratios of the laboratories ranged from 0.84 to 4.45. Next, we corrected the proviral loads of the clinical samples from HTLV-1 carriers using the relative ratio. As expected, the overall differences between the laboratories were reduced by half, from 7.4-fold to 3.8-fold on average, after applying the correction. HTLV-1 qPCR can be standardized using TL-Om1 cells as a standard and by determining the relative ratio of the measured to the theoretical standard values in each laboratory. PMID:26292315
Kuramitsu, Madoka; Okuma, Kazu; Yamochi, Tadanori; Sato, Tomoo; Sasaki, Daisuke; Hasegawa, Hiroo; Umeki, Kazumi; Kubota, Ryuji; Sobata, Rieko; Matsumoto, Chieko; Kaneko, Noriaki; Naruse, Isao; Yamagishi, Makoto; Nakashima, Makoto; Momose, Haruka; Araki, Kumiko; Mizukami, Takuo; Mizusawa, Saeko; Okada, Yoshiaki; Ochiai, Masaki; Utsunomiya, Atae; Koh, Ki-Ryang; Ogata, Masao; Nosaka, Kisato; Uchimaru, Kaoru; Iwanaga, Masako; Sagara, Yasuko; Yamano, Yoshihisa; Satake, Masahiro; Okayama, Akihiko; Mochizuki, Manabu; Izumo, Shuji; Saito, Shigeru; Itabashi, Kazuo; Kamihira, Shimeru; Yamaguchi, Kazunari; Watanabe, Toshiki; Hamaguchi, Isao
2015-11-01
Quantitative PCR (qPCR) analysis of human T-cell leukemia virus type 1 (HTLV-1) was used to assess the amount of HTLV-1 provirus DNA integrated into the genomic DNA of host blood cells. Accumulating evidence indicates that a high proviral load is one of the risk factors for the development of adult T-cell leukemia/lymphoma and HTLV-1-associated myelopathy/tropical spastic paraparesis. However, interlaboratory variability in qPCR results makes it difficult to assess the differences in reported proviral loads between laboratories. To remedy this situation, we attempted to minimize discrepancies between laboratories through standardization of HTLV-1 qPCR in a collaborative study. TL-Om1 cells that harbor the HTLV-1 provirus were serially diluted with peripheral blood mononuclear cells to prepare a candidate standard. By statistically evaluating the proviral loads of the standard and those determined using in-house qPCR methods at each laboratory, we determined the relative ratios of the measured values in the laboratories to the theoretical values of the TL-Om1 standard. The relative ratios of the laboratories ranged from 0.84 to 4.45. Next, we corrected the proviral loads of the clinical samples from HTLV-1 carriers using the relative ratio. As expected, the overall differences between the laboratories were reduced by half, from 7.4-fold to 3.8-fold on average, after applying the correction. HTLV-1 qPCR can be standardized using TL-Om1 cells as a standard and by determining the relative ratio of the measured to the theoretical standard values in each laboratory. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Zinc finger nuclease: a new approach for excising HIV-1 proviral DNA from infected human T cells.
Qu, Xiying; Wang, Pengfei; Ding, Donglin; Wang, Xiaohui; Zhang, Gongmin; Zhou, Xin; Liu, Lin; Zhu, Xiaoli; Zeng, Hanxian; Zhu, Huanzhang
2014-09-01
A major reason that Acquired Immune Deficiency Syndrome (AIDS) cannot be completely cured is the human immunodeficiency virus 1 (HIV-1) provirus integrated into the human genome. Though existing therapies can inhibit replication of HIV-1, they cannot eradicate it. A molecular therapy gains popularity due to its specifically targeting to HIV-1 infected cells and effectively removing the HIV-1, regardless of viral genes being active or dormant. Now, we propose a new method which can excellently delete the HIV provirus from the infected human T cell genome. First, we designed zinc-finger nucleases (ZFNs) that target a sequence within the long terminal repeat (LTR) U3 region that is highly conserved in whole clade. Then, we screened out one pair of ZFN and named it as ZFN-U3. We discovered that ZFN-U3 can exactly target and eliminate the full-length HIV-1 proviral DNA after the infected human cell lines treated with it, and the frequency of its excision was about 30 % without cytotoxicity. These results prove that ZFN-U3 can efficiently excise integrated HIV-1 from the human genome in infected cells. This method to delete full length HIV-1 in human genome can therefore provide a novel approach to cure HIV-infected individuals in the future.
Yang, Yi; Wang, Shuqing; Liu, Yang
2014-01-01
Order insertion often occurs in the scheduling process of logistics service supply chain (LSSC), which disturbs normal time scheduling especially in the environment of mass customization logistics service. This study analyses order similarity coefficient and order insertion operation process and then establishes an order insertion scheduling model of LSSC with service capacity and time factors considered. This model aims to minimize the average unit volume operation cost of logistics service integrator and maximize the average satisfaction degree of functional logistics service providers. In order to verify the viability and effectiveness of our model, a specific example is numerically analyzed. Some interesting conclusions are obtained. First, along with the increase of completion time delay coefficient permitted by customers, the possible inserting order volume first increases and then trends to be stable. Second, supply chain performance reaches the best when the volume of inserting order is equal to the surplus volume of the normal operation capacity in mass service process. Third, the larger the normal operation capacity in mass service process is, the bigger the possible inserting order's volume will be. Moreover, compared to increasing the completion time delay coefficient, improving the normal operation capacity of mass service process is more useful. PMID:25276851
Yersinia pestis IS1541 transposition provides for escape from plague immunity.
Cornelius, Claire A; Quenee, Lauriane E; Elli, Derek; Ciletti, Nancy A; Schneewind, Olaf
2009-05-01
Yersinia pestis is perhaps the most feared infectious agent due to its ability to cause epidemic outbreaks of plague disease in animals and humans with high mortality. Plague infections elicit strong humoral immune responses against the capsular antigen (fraction 1 [F1]) of Y. pestis, and F1-specific antibodies provide protective immunity. Here we asked whether Y. pestis generates mutations that enable bacterial escape from protective immunity and isolated a variant with an IS1541 insertion in caf1A encoding the F1 outer membrane usher. The caf1A::IS1541 insertion prevented assembly of F1 pili and provided escape from plague immunity via F1-specific antibodies without a reduction in virulence in mouse models of bubonic or pneumonic plague. F1-specific antibodies interfere with Y. pestis type III transport of effector proteins into host cells, an inhibitory effect that was overcome by the caf1A::IS1541 insertion. These findings suggest a model in which IS1541 insertion into caf1A provides for reversible changes in envelope structure, enabling Y. pestis to escape from adaptive immune responses and plague immunity.
HIV proviral DNA associated with decreased neuropsychological function.
Shiramizu, Bruce; Paul, Robert; Williams, Andrew; Shikuma, Cecilia; Watters, Michael; Grove, John; Valcour, Victor
2007-01-01
The authors previously found a strong association between elevated HIV proviral DNA (HIV DNA) and a diagnosis of HIV-1-associated dementia (HAD) vs. normal cognition. It is unclear whether HIV DNA globally affects the diagnosis of HAD or whether the effect is limited to individual neuropsychological deficits. This exploratory study examined baseline HIV DNA and its association with individual neuropsychological deficits. HIV DNA was significantly associated with baseline neuropsychological deficits independent of age, ethnicity, IQ, and plasma HIV-1 RNA levels. However, HIV DNA did not predict future changes in neuropsychological deficits. The data suggest that HIV DNA and neuropsychological deficits may co-vary over time.
Ancestry of a human endogenous retrovirus family.
Mariani-Costantini, R; Horn, T M; Callahan, R
1989-01-01
The human endogenous retrovirus type II (HERVII) family of HERV genomes has been found by Southern blot analysis to be characteristic of humans, apes, and Old World monkeys. New World monkeys and prosimians lack HERVII proviral genomes. Cellular DNAs of humans, common chimpanzees, gorillas, and orangutans, but not lesser ape lar gibbons, appear to contain the HERVII-related HLM-2 proviral genome integrated at the same site (HLM-2 maps to human chromosome 1). This suggests that the ancestral HERVII retrovirus(es) entered the genomes of Old World anthropoids by infection after the divergence of New World monkeys (platyrrhines) but before the evolutionary radiation of large hominoids. Images PMID:2507793
Hybridization capture reveals evolution and conservation across the entire Koala retrovirus genome.
Tsangaras, Kyriakos; Siracusa, Matthew C; Nikolaidis, Nikolas; Ishida, Yasuko; Cui, Pin; Vielgrader, Hanna; Helgen, Kristofer M; Roca, Alfred L; Greenwood, Alex D
2014-01-01
The koala retrovirus (KoRV) is the only retrovirus known to be in the midst of invading the germ line of its host species. Hybridization capture and next generation sequencing were used on modern and museum DNA samples of koala (Phascolarctos cinereus) to examine ca. 130 years of evolution across the full KoRV genome. Overall, the entire proviral genome appeared to be conserved across time in sequence, protein structure and transcriptional binding sites. A total of 138 polymorphisms were detected, of which 72 were found in more than one individual. At every polymorphic site in the museum koalas, one of the character states matched that of modern KoRV. Among non-synonymous polymorphisms, radical substitutions involving large physiochemical differences between amino acids were elevated in env, potentially reflecting anti-viral immune pressure or avoidance of receptor interference. Polymorphisms were not detected within two functional regions believed to affect infectivity. Host sequences flanking proviral integration sites were also captured; with few proviral loci shared among koalas. Recently described variants of KoRV, designated KoRV-B and KoRV-J, were not detected in museum samples, suggesting that these variants may be of recent origin.
Hybridization Capture Reveals Evolution and Conservation across the Entire Koala Retrovirus Genome
Ishida, Yasuko; Cui, Pin; Vielgrader, Hanna; Helgen, Kristofer M.; Roca, Alfred L.; Greenwood, Alex D.
2014-01-01
The koala retrovirus (KoRV) is the only retrovirus known to be in the midst of invading the germ line of its host species. Hybridization capture and next generation sequencing were used on modern and museum DNA samples of koala (Phascolarctos cinereus) to examine ca. 130 years of evolution across the full KoRV genome. Overall, the entire proviral genome appeared to be conserved across time in sequence, protein structure and transcriptional binding sites. A total of 138 polymorphisms were detected, of which 72 were found in more than one individual. At every polymorphic site in the museum koalas, one of the character states matched that of modern KoRV. Among non-synonymous polymorphisms, radical substitutions involving large physiochemical differences between amino acids were elevated in env, potentially reflecting anti-viral immune pressure or avoidance of receptor interference. Polymorphisms were not detected within two functional regions believed to affect infectivity. Host sequences flanking proviral integration sites were also captured; with few proviral loci shared among koalas. Recently described variants of KoRV, designated KoRV-B and KoRV-J, were not detected in museum samples, suggesting that these variants may be of recent origin. PMID:24752422
Retroviral integration: Site matters
Demeulemeester, Jonas; De Rijck, Jan
2015-01-01
Here, we review genomic target site selection during retroviral integration as a multistep process in which specific biases are introduced at each level. The first asymmetries are introduced when the virus takes a specific route into the nucleus. Next, by co‐opting distinct host cofactors, the integration machinery is guided to particular chromatin contexts. As the viral integrase captures a local target nucleosome, specific contacts introduce fine‐grained biases in the integration site distribution. In vivo, the established population of proviruses is subject to both positive and negative selection, thereby continuously reshaping the integration site distribution. By affecting stochastic proviral expression as well as the mutagenic potential of the virus, integration site choice may be an inherent part of the evolutionary strategies used by different retroviruses to maximise reproductive success. PMID:26293289
NASA Astrophysics Data System (ADS)
Asati, Vivek; Bharti, Sanjay Kumar; Budhwani, Ashok Kumar
2017-04-01
The proviral insertion site in moloney murine leukemia virus (PIM) is a family of serine/threonine kinase of Ca2+-calmodulin-dependent protein kinase (CAMK) group which is responsible for the activation and regulation of cellular transcription and translation. The three isoforms of PIM kinase (PIM-1, PIM-2 and PIM-3) share high homology and functional idleness are widely expressed and involved in a variety of biological processes including cell survival, proliferation, differentiation and apoptosis. Altered expression of PIM-1 kinase correlated with hematologic malignancies and solid tumors. In the present study, atom-based 3D-QSAR, docking and virtual screening studies have been performed on a series of thiazolidine-2,4-dione derivatives as PIM-1 kinase inhibitors. 3D-QSAR and docking approach has shortlisted the most active thiazolidine-2,4-dione derivatives such as 28, 31, 33 and 35 with the incorporation of more than one structural feature in a single molecule. External validations by various parameters and molecular docking studies at the active site of PIM-1 kinase have proved the reliability of the developed 3D-QSAR model. The generated pharmacophore (AADHR.33) from 3D-QSAR study was used for screening of drug like compounds from ZINC database, where ZINC15056464 and ZINC83292944 showed potential binding affinities at the active site amino acid residues (LYS67, GLU171, ASP128 and ASP186) of PIM-1 kinase.
Transcriptional regulation of latent feline immunodeficiency virus in peripheral CD4+ T-lymphocytes.
McDonnel, Samantha J; Sparger, Ellen E; Luciw, Paul A; Murphy, Brian G
2012-05-01
Feline immunodeficiency virus (FIV), the lentivirus of domestic cats responsible for feline AIDS, establishes a latent infection in peripheral blood CD4+ T-cells approximately eight months after experimental inoculation. In this study, cats experimentally infected with the FIV-C strain in the asymptomatic phase demonstrated an estimated viral load of 1 infected cell per approximately 10(3) CD4+ T-cells, with about 1 copy of viral DNA per cell. Approximately 1 in 10 proviral copies was capable of transcription in the asymptomatic phase. The latent FIV proviral promoter was associated with deacetylated, methylated histones, which is consistent with a condensed chromatin structure. In contrast, the transcriptionally active FIV promoter was associated with histone acetylation and demethylation. In addition, RNA polymerase II appeared to be paused on the latent viral promoter, and short promoter-proximal transcripts were detected. Our findings for the FIV promoter in infected cats are similar to results obtained in studies of human immunodeficiency virus (HIV)-1 latent proviruses in cell culture in vitro studies. Thus, the FIV/cat model may offer insights into in vivo mechanisms of HIV latency and provides a unique opportunity to test novel therapeutic interventions aimed at eradicating latent virus.
Sun, Wei-Wei; Jiao, Shi; Sun, Li; Zhou, Zhaocai; Jin, Xia; Wang, Jian-Hua
2018-05-01
The postintegrational latency of HIV-1 is characterized by reversible silencing of long terminal repeat (LTR)-driven transcription of the HIV genome. It is known that the formation of repressive chromatin at the 5'-LTR of HIV-1 proviral DNA impedes viral transcription by blocking the recruitment of positive transcription factors. How the repressive chromatin is formed and modulated during HIV-1 infection remains elusive. Elucidation of which chromatin reassembly factor mediates the reorganization of chromatin is likely to facilitate the understanding of the host's modulation of HIV-1 transcription and latency. Here we revealed that "Sad1 and UNC84 domain containing 2" (SUN2), an inner nuclear membrane protein, maintained the repressive chromatin and inhibited HIV LTR-driven transcription of proviral DNA through an association with lamin A/C. Specifically, lamin A/C tethered SUN2 to the nucleosomes 1 and 2 of the HIV-1 5'-LTR to block the initiation and elongation of HIV-1 transcription. SUN2 knockdown converted chromatin to an active form and thus enhanced the phosphorylation of RNA polymerase II and its recruitment to the 5'-LTR HIV-1 proviral DNA, leading to reactivation of HIV-1 from latency. Conversely, the exogenous factors such as tumor necrosis factor alpha (TNF-α) induced reactivation, and the replication of HIV-1 led to the disassociation between SUN2 and lamin A/C, suggesting that disruption of the association between SUN2 and lamin A/C to convert the repressive chromatin to the active form might be a prerequisite for the initiation of HIV-1 transcription and replication. Together, our findings indicate that SUN2 is a novel chromatin reassembly factor that helps to maintain chromatin in a repressive state and consequently inhibits HIV-1 transcription. IMPORTANCE Despite the successful use of scores of antiretroviral drugs, HIV latency poses a major impediment to virus eradication. Elucidation of the mechanism of latency facilitates the discovery of new therapeutic strategies. It has been known that the formation of repressive chromatin at the 5'-LTR of HIV-1 proviral DNA impedes viral transcription and maintains viral latency, but how the repressive chromatin is formed and modulated during HIV-1 infection remains elusive. In this study, we performed in-depth virological and cell biological studies and discovered that an inner nuclear membrane protein, SUN2, is a novel chromatin reassembly factor that maintains repressive chromatin and thus modulates HIV-1 transcription and latency: therefore, targeting SUN2 may lead to new strategies for HIV cure. Copyright © 2018 Sun et al.
Cardozo, Erwing Fabian; Andrade, Adriana; Mellors, John W.; ...
2017-07-05
The kinetics of HIV-1 decay under treatment depends on the class of antiretrovirals used. Mathematical models are useful to interpret the different profiles, providing quantitative information about the kinetics of virus replication and the cell populations contributing to viral decay. We modeled proviral integration in short- and long-lived infected cells to compare viral kinetics under treatment with and without the integrase inhibitor raltegravir (RAL). We fitted the model to data obtained from participants treated with RAL-containing regimes or with a four-drug regimen of protease and reverse transcriptase inhibitors. Our model explains the existence and quantifies the three phases of HIV-1more » RNA decay in RAL-based regimens vs. the two phases observed in therapies without RAL. Our findings indicate that HIV-1 infection is mostly sustained by short-lived infected cells with fast integration and a short viral production period, and by long-lived infected cells with slow integration but an equally short viral production period. We propose that these cells represent activated and resting infected CD4+ T-cells, respectively, and estimate that infection of resting cells represent ~4% of productive reverse transcription events in chronic infection. RAL reveals the kinetics of proviral integration, showing that in short-lived cells the pre-integration population has a half-life of ~7 hours, whereas in long-lived cells this half-life is ~6 weeks. We also show that the efficacy of RAL can be estimated by the difference in viral load at the start of the second phase in protocols with and without RAL. Altogether, we provide a mechanistic model of viral infection that parsimoniously explains the kinetics of viral load decline under multiple classes of antiretrovirals.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cardozo, Erwing Fabian; Andrade, Adriana; Mellors, John W.
The kinetics of HIV-1 decay under treatment depends on the class of antiretrovirals used. Mathematical models are useful to interpret the different profiles, providing quantitative information about the kinetics of virus replication and the cell populations contributing to viral decay. We modeled proviral integration in short- and long-lived infected cells to compare viral kinetics under treatment with and without the integrase inhibitor raltegravir (RAL). We fitted the model to data obtained from participants treated with RAL-containing regimes or with a four-drug regimen of protease and reverse transcriptase inhibitors. Our model explains the existence and quantifies the three phases of HIV-1more » RNA decay in RAL-based regimens vs. the two phases observed in therapies without RAL. Our findings indicate that HIV-1 infection is mostly sustained by short-lived infected cells with fast integration and a short viral production period, and by long-lived infected cells with slow integration but an equally short viral production period. We propose that these cells represent activated and resting infected CD4+ T-cells, respectively, and estimate that infection of resting cells represent ~4% of productive reverse transcription events in chronic infection. RAL reveals the kinetics of proviral integration, showing that in short-lived cells the pre-integration population has a half-life of ~7 hours, whereas in long-lived cells this half-life is ~6 weeks. We also show that the efficacy of RAL can be estimated by the difference in viral load at the start of the second phase in protocols with and without RAL. Altogether, we provide a mechanistic model of viral infection that parsimoniously explains the kinetics of viral load decline under multiple classes of antiretrovirals.« less
Grandi, Nicole; Cadeddu, Marta; Blomberg, Jonas; Tramontano, Enzo
2016-09-09
Human endogenous retroviruses (HERVs) are ancient sequences integrated in the germ line cells and vertically transmitted through the offspring constituting about 8 % of our genome. In time, HERVs accumulated mutations that compromised their coding capacity. A prominent exception is HERV-W locus 7q21.2, producing a functional Env protein (Syncytin-1) coopted for placental syncytiotrophoblast formation. While expression of HERV-W sequences has been investigated for their correlation to disease, an exhaustive description of the group composition and characteristics is still not available and current HERV-W group information derive from studies published a few years ago that, of course, used the rough assemblies of the human genome available at that time. This hampers the comparison and correlation with current human genome assemblies. In the present work we identified and described in detail the distribution and genetic composition of 213 HERV-W elements. The bioinformatics analysis led to the characterization of several previously unreported features and provided a phylogenetic classification of two main subgroups with different age and structural characteristics. New facts on HERV-W genomic context of insertion and co-localization with sequences putatively involved in disease development are also reported. The present work is a detailed overview of the HERV-W contribution to the human genome and provides a robust genetic background useful to clarify HERV-W role in pathologies with poorly understood etiology, representing, to our knowledge, the most complete and exhaustive HERV-W dataset up to date.
Pan-vertebrate comparative genomics unmasks retrovirus macroevolution.
Hayward, Alexander; Cornwallis, Charlie K; Jern, Patric
2015-01-13
Although extensive research has demonstrated host-retrovirus microevolutionary dynamics, it has been difficult to gain a deeper understanding of the macroevolutionary patterns of host-retrovirus interactions. Here we use recent technological advances to infer broad patterns in retroviral diversity, evolution, and host-virus relationships by using a large-scale phylogenomic approach using endogenous retroviruses (ERVs). Retroviruses insert a proviral DNA copy into the host cell genome to produce new viruses. ERVs are provirus insertions in germline cells that are inherited down the host lineage and consequently present a record of past host-viral associations. By mining ERVs from 65 host genomes sampled across vertebrate diversity, we uncover a great diversity of ERVs, indicating that retroviral sequences are much more prevalent and widespread across vertebrates than previously appreciated. The majority of ERV clades that we recover do not contain known retroviruses, implying either that retroviral lineages are highly transient over evolutionary time or that a considerable number of retroviruses remain to be identified. By characterizing the distribution of ERVs, we show that no major vertebrate lineage has escaped retroviral activity and that retroviruses are extreme host generalists, having an unprecedented ability for rampant host switching among distantly related vertebrates. In addition, we examine whether the distribution of ERVs can be explained by host factors predicted to influence viral transmission and find that internal fertilization has a pronounced effect on retroviral colonization of host genomes. By capturing the mode and pattern of retroviral evolution and contrasting ERV diversity with known retroviral diversity, our study provides a cohesive framework to understand host-virus coevolution better.
Pan-vertebrate comparative genomics unmasks retrovirus macroevolution
Hayward, Alexander; Cornwallis, Charlie K.; Jern, Patric
2015-01-01
Although extensive research has demonstrated host-retrovirus microevolutionary dynamics, it has been difficult to gain a deeper understanding of the macroevolutionary patterns of host–retrovirus interactions. Here we use recent technological advances to infer broad patterns in retroviral diversity, evolution, and host–virus relationships by using a large-scale phylogenomic approach using endogenous retroviruses (ERVs). Retroviruses insert a proviral DNA copy into the host cell genome to produce new viruses. ERVs are provirus insertions in germline cells that are inherited down the host lineage and consequently present a record of past host–viral associations. By mining ERVs from 65 host genomes sampled across vertebrate diversity, we uncover a great diversity of ERVs, indicating that retroviral sequences are much more prevalent and widespread across vertebrates than previously appreciated. The majority of ERV clades that we recover do not contain known retroviruses, implying either that retroviral lineages are highly transient over evolutionary time or that a considerable number of retroviruses remain to be identified. By characterizing the distribution of ERVs, we show that no major vertebrate lineage has escaped retroviral activity and that retroviruses are extreme host generalists, having an unprecedented ability for rampant host switching among distantly related vertebrates. In addition, we examine whether the distribution of ERVs can be explained by host factors predicted to influence viral transmission and find that internal fertilization has a pronounced effect on retroviral colonization of host genomes. By capturing the mode and pattern of retroviral evolution and contrasting ERV diversity with known retroviral diversity, our study provides a cohesive framework to understand host–virus coevolution better. PMID:25535393
Gene-specific cell labeling using MiMIC transposons
Gnerer, Joshua P.; Venken, Koen J. T.; Dierick, Herman A.
2015-01-01
Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. PMID:25712101
Saravanan, Shanmugam; Gomathi, Selvamurthi; Delong, Allison; Kausalya, Bagavathi; Sivamalar, Sathasivam; Poongulali, Selvamuthu; Brooks, Katherine; Kumarasamy, Nagalingeswaran; Balakrishnan, Pachamuthu; Solomon, Sunil S; Cu-Uvin, Susan; Kantor, Rami
2018-05-24
Examine HIV-1 plasma viral load (PVL) and genital tract (GT) viral load (GVL) and drug resistance in India. At the YRG Centre for AIDS Research and Education, Chennai, we tested: PVL in women on first-line ART for ≥6 months; GVL when PVL >2000 copies/mL; and plasma, genital and proviral reverse transcriptase drug resistance when GVL >2000 copies/mL. Wilcoxon rank-sum and Fisher's exact tests were used to identify failure and resistance associations. Pearson correlations were calculated to evaluate PVL-GVL associations. Inter-compartmental resistance discordance was evaluated using generalized estimating equations. Of 200 women, 37% had detectable (>400 copies/mL) PVL and 31% had PVL >1000 copies/mL. Of women with detectable PVL, 74% had PVL >2000 copies/mL, of which 74% had detectable GVL. Higher PVL was associated with higher GVL. Paired plasma and genital sequences were available for 21 women; mean age of 34 years, median ART duration of 33 months, median CD4 count of 217 cells/mm3, median PVL of 5.4 log10 copies/mL and median GVL of 4.6 log10 copies/mL. Drug resistance was detected in 81%-91% of samples and 67%-76% of samples had dual-class resistance. Complete three-compartment concordance was seen in only 10% of women. GT-proviral discordance was significantly larger than plasma-proviral discordance. GT or proviral mutations discordant from plasma led to clinically relevant resistance in 24% and 30%, respectively. We identified high resistance and high inter-compartmental resistance discordance in Indian women, which might lead to unrecognized resistance transmission and re-emergence compromising treatment outcomes, particularly relevant to countries like India, where sexual HIV transmission is predominant.
[The recent advances of HAM/TSP research].
Osame, M
1999-12-01
The ninth international conference on HTLVs and related disorders was held on April 5-9, 1999 at Kagoshima, Japan under the conference chairperson, Dr. Mitsuhiro Osame. In this meeting, world-wide epidemiological data on HTLV-I carriers, ATL patients, and HAM/TSP patients were summarized as shown in the table. The total number of them was supposed to be more than 2.2 millions, 1,200, and 3,000, respectively. To elucidate the localization of HTLV-I proviral DNA directly, double staining using immunohistochemistry and PCR in situ hybridization in the spinal cords of HAM/TSP patients were performed. HTLV-I proviral DNA was localized only to OPD 4-positive cells (Matsuoka et al, 1998). The localization of HTLV-I messenger RNA was the same (Moritoyo et al, 1996). A novel technique to detect HTLV-I tax protein was also developed. In HAM/TSP patients, 0.04-1.16% of the CSF cells and 0.02-0.54% of PBMCs were positive for HTLV-I tax protein (Moritoyo et al, 1999). It was also hypothesized that HLA alleles control HTLV-I proviral load and thus influence susceptibility to HAM/TSP. Two hundred and thirty-two cases of HAM/TSP were compared with 201 randomly selected HTLV-I seropositive asymptomatic blood donors. It was shown that, after infection with HTLV-I, the class I allele HLA-A*02 halves the odds of HAM/TSP (p < 0.0001), preventing 28% of potential cases of HAM/TSP. Furthermore, HLA-A*02 positive healthy HTLV-I carriers have a proviral load one-third that (p = 0.0114) of HLA-A*02 negative HTLV-I carriers. An association of HLA-DRB1*0101 with disease susceptibility was also identified, which doubled the odds of HAM/TSP in the absence of the protective effect of HLA-A*02 (Jeffery and Usuku et al, 1999).
Shayakhmetov, D; Kovalenko, D; Yurov, G; Borisenko, A; Tikchonenko, T
1997-08-01
Use of viral inducible promoters which can be activated by virus-specific transactivator proteins to drive expression of antisense (as)RNA genes appears to be an attractive approach to inhibit virus infections in vivo. To this end, we have constructed an asRNA gene expressed from the bovine leukaemia virus (BLV) U3 promoter that is complementary to the R-U5 region of the BLV genome. This is the region that is most susceptible to inhibition by asRNA. With plasmid pLU, which expresses the asRNA gene under the control of the BLV U3 promoter, 75% inhibition of virus replication was attained in CC81 cells (the molar ratio of pLU DNA over BLV proviral DNA in the transfection mixture was 5:1). Plasmid pLT, which contains only the BLV U3 promoter without any asRNA-coding region, also efficiently (up to 60%) inhibited virus replication when cotransfected with BLV proviral DNA at a ratio of 20:1. It was suggested that competition between functional and 'empty' viral promoters for the viral transactivator protein p38tax could account for this inhibition. An immunoblotting assay showed that in the presence of nuclear extracts from CC81 cells exogenous BLV p38tax specifically associates with its responsive sequence located in the BLV U3 promoter. Moreover, the additional expression of p38tax in CC81 cells abolishes the inhibitory effect of the empty viral promoter. These observations suggest a new mechanism of BLV inhibition caused, most probably, by sequestering of the viral transactivator protein.
Mok, Hoyin; Cheng, Xing; Xu, Qi; Zengel, James R; Parhy, Bandita; Zhao, Jackie; Wang, C. Kathy; Jin, Hong
2012-01-01
Live attenuated recombinant measles vaccine virus (MV) Edmonston-Zagreb (EZ) strain was evaluated as a viral vector to express the ectodomains of fusion protein of respiratory syncytial virus (RSV F) or glycoprotein 350 of Epstein-Barr virus (EBV gp350) as candidate vaccines for prophylaxis of RSV and EBV. The glycoprotein gene was inserted at the 1st or the 3rd position of the measles virus genome and the recombinant viruses were generated. Insertion of the foreign gene at the 3rd position had a minimal impact on viral replication in vitro. RSV F or EBV gp350 protein was secreted from infected cells. In cotton rats, EZ-RSV F and EZ-EBV gp350 induced MV- and insert-specific antibody responses. In addition, both vaccines also induced insert specific interferon gamma (IFN-γ) secreting T cell response. EZ-RSV F protected cotton rats from pulmonary replication of RSV A2 challenge infection. In rhesus macaques, although both EZ-RSV F and EZ-EBV gp350 induced MV specific neutralizing antibody responses, only RSV F specific antibody response was detected. Thus, the immunogenicity of the foreign antigens delivered by measles vaccine virus is dependent on the nature of the insert and the animal models used for vaccine evaluation. PMID:22383906
Endogenous avian leukosis viral loci in the Red Jungle Fowl genome assembly.
Benkel, Bernhard; Rutherford, Katherine
2014-12-01
The current build (galGal4) of the genome of the ancestor of the modern chicken, the Red Jungle Fowl, contains a single endogenous avian leukosis viral element (ALVE) on chromosome 1 (designated RSV-LTR; family ERVK). The assembly shows the ALVE provirus juxtaposed with a member of a second family of avian endogenous retroviruses (designated GGERV20; family ERVL); however, the status of the 3' end of the ALVE element as well as its flanking region remain unclear due to a gap in the reference genome sequence. In this study, we filled the gap in the assembly using a combination of long-range PCR (LR-PCR) and a short contig present in the unassembled portion of the reference genome database. Our results demonstrate that the ALVE element (ALVE-JFevB) is inserted into the putative envelope region of a GGERV20 element, roughly 1 kbp from its 3' end, and that ALVE-JFevB is complete, and depending on its expression status, potentially capable of directing the production of virus. Moreover, the unassembled portion of the genome database contains junction fragments for a second, previously characterized endogenous proviral element, ALVE-6. ©2014 Poultry Science Association Inc.
Im, Wonpil; Brooks, Charles L.
2005-01-01
The mechanism of interfacial folding and membrane insertion of designed peptides is explored by using an implicit membrane generalized Born model and replica-exchange molecular dynamics. Folding/insertion simulations initiated from fully extended peptide conformations in the aqueous phase, at least 28 Å away from the membrane interface, demonstrate a general mechanism for structure formation and insertion (when it occurs). The predominately hydrophobic peptides from the synthetic WALP and TMX series first become localized at the membrane-solvent interface where they form significant helical secondary structure via a helix–turn–helix motif that inserts the central hydrophobic residues into the membrane interior, and then fluctuations occur that provide a persistent helical structure throughout the peptide and it inserts with its N-terminal end moving across the membrane. More specifically, we observed that: (i) the WALP peptides (WALP16, WALP19, and WALP23) spontaneously insert in the membrane as just noted; (ii) TMX-1 also inserts spontaneously after a similar mechanism and forms a transmembrane helix with a population of ≈50% at 300 K; and (iii) TMX-3 does not insert, but exists in a fluctuating membrane interface-bound form. These findings are in excellent agreement with available experimental data and demonstrate the potential for new implicit solvent/membrane models together with advanced simulation protocols to guide experimental programs in exploring the nature and mechanism of membrane-associated folding and insertion of biologically important peptides. PMID:15860587
Gene-specific cell labeling using MiMIC transposons.
Gnerer, Joshua P; Venken, Koen J T; Dierick, Herman A
2015-04-30
Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Modelling the role of Tax expression in HTLV-I persistence in vivo.
Li, Michael Y; Lim, Aaron G
2011-12-01
Human T-lymphotropic virus type I (HTLV-I) is a persistent human retrovirus characterized by life-long infection and risk of developing HAM/TSP, a progressive neurological and inflammatory disease, and adult T-cell leukemia (ATL). Chronically infected individuals often harbor high proviral loads despite maintaining a persistently activated immune response. Based on a new hypothesis for the persistence of HTLV-I infection, a three-dimensional compartmental model is constructed that describes the dynamic interactions among latently infected target cells, target-cell activation, and immune responses to HTLV-I, with an emphasis on understanding the role of Tax expression in the persistence of HTLV-I.
The FACT Complex Promotes Avian Leukosis Virus DNA Integration.
Winans, Shelby; Larue, Ross C; Abraham, Carly M; Shkriabai, Nikolozi; Skopp, Amelie; Winkler, Duane; Kvaratskhelia, Mamuka; Beemon, Karen L
2017-04-01
All retroviruses need to integrate a DNA copy of their genome into the host chromatin. Cellular proteins regulating and targeting lentiviral and gammaretroviral integration in infected cells have been discovered, but the factors that mediate alpharetroviral avian leukosis virus (ALV) integration are unknown. In this study, we have identified the FACT protein complex, which consists of SSRP1 and Spt16, as a principal cellular binding partner of ALV integrase (IN). Biochemical experiments with purified recombinant proteins show that SSRP1 and Spt16 are able to individually bind ALV IN, but only the FACT complex effectively stimulates ALV integration activity in vitro Likewise, in infected cells, the FACT complex promotes ALV integration activity, with proviral integration frequency varying directly with cellular expression levels of the FACT complex. An increase in 2-long-terminal-repeat (2-LTR) circles in the depleted FACT complex cell line indicates that this complex regulates the ALV life cycle at the level of integration. This regulation is shown to be specific to ALV, as disruption of the FACT complex did not inhibit either lentiviral or gammaretroviral integration in infected cells. IMPORTANCE The majority of human gene therapy approaches utilize HIV-1- or murine leukemia virus (MLV)-based vectors, which preferentially integrate near genes and regulatory regions; thus, insertional mutagenesis is a substantial risk. In contrast, ALV integrates more randomly throughout the genome, which decreases the risks of deleterious integration. Understanding how ALV integration is regulated could facilitate the development of ALV-based vectors for use in human gene therapy. Here we show that the FACT complex directly binds and regulates ALV integration efficiency in vitro and in infected cells. Copyright © 2017 American Society for Microbiology.
Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine
2007-02-01
In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.
Prinold, Joe A I; Mazzà, Claudia; Di Marco, Roberto; Hannah, Iain; Malattia, Clara; Magni-Manzoni, Silvia; Petrarca, Maurizio; Ronchetti, Anna B; Tanturri de Horatio, Laura; van Dijkhuizen, E H Pieter; Wesarg, Stefan; Viceconti, Marco
2016-01-01
Juvenile idiopathic arthritis (JIA) is the leading cause of childhood disability from a musculoskeletal disorder. It generally affects large joints such as the knee and the ankle, often causing structural damage. Different factors contribute to the damage onset, including altered joint loading and other mechanical factors, associated with pain and inflammation. The prediction of patients' joint loading can hence be a valuable tool in understanding the disease mechanisms involved in structural damage progression. A number of lower-limb musculoskeletal models have been proposed to analyse the hip and knee joints, but juvenile models of the foot are still lacking. This paper presents a modelling pipeline that allows the creation of juvenile patient-specific models starting from lower limb kinematics and foot and ankle MRI data. This pipeline has been applied to data from three children with JIA and the importance of patient-specific parameters and modelling assumptions has been tested in a sensitivity analysis focused on the variation of the joint reaction forces. This analysis highlighted the criticality of patient-specific definition of the ankle joint axes and location of the Achilles tendon insertions. Patient-specific detection of the Tibialis Anterior, Tibialis Posterior, and Peroneus Longus origins and insertions were also shown to be important.
Singh, Sagar; Lo, Meng-Chen; Damodaran, Vinod B.; Kaplan, Hilton M.; Kohn, Joachim; Zahn, Jeffrey D.; Shreiber, David I.
2016-01-01
Single-unit recording neural probes have significant advantages towards improving signal-to-noise ratio and specificity for signal acquisition in brain-to-computer interface devices. Long-term effectiveness is unfortunately limited by the chronic injury response, which has been linked to the mechanical mismatch between rigid probes and compliant brain tissue. Small, flexible microelectrodes may overcome this limitation, but insertion of these probes without buckling requires supporting elements such as a stiff coating with a biodegradable polymer. For these coated probes, there is a design trade-off between the potential for successful insertion into brain tissue and the degree of trauma generated by the insertion. The objective of this study was to develop and validate a finite element model (FEM) to simulate insertion of coated neural probes of varying dimensions and material properties into brain tissue. Simulations were performed to predict the buckling and insertion forces during insertion of coated probes into a tissue phantom with material properties of brain. The simulations were validated with parallel experimental studies where probes were inserted into agarose tissue phantom, ex vivo chick embryonic brain tissue, and ex vivo rat brain tissue. Experiments were performed with uncoated copper wire and both uncoated and coated SU-8 photoresist and Parylene C probes. Model predictions were found to strongly agree with experimental results (<10% error). The ratio of the predicted buckling force-to-predicted insertion force, where a value greater than one would ideally be expected to result in successful insertion, was plotted against the actual success rate from experiments. A sigmoidal relationship was observed, with a ratio of 1.35 corresponding to equal probability of insertion and failure, and a ratio of 3.5 corresponding to a 100% success rate. This ratio was dubbed the “safety factor”, as it indicated the degree to which the coating should be over-designed to ensure successful insertion. Probability color maps were generated to visually compare the influence of design parameters. Statistical metrics derived from the color maps and multi-variable regression analysis confirmed that coating thickness and probe length were the most important features in influencing insertion potential. The model also revealed the effects of manufacturing flaws on insertion potential. PMID:26959021
Bui, Huyen T.; Karren, Mary A.; Bhar, Debjani
2012-01-01
To initiate mitochondrial fission, dynamin-related proteins (DRPs) must bind specific adaptors on the outer mitochondrial membrane. The structural features underlying this interaction are poorly understood. Using yeast as a model, we show that the Insert B domain of the Dnm1 guanosine triphosphatase (a DRP) contains a novel motif required for association with the mitochondrial adaptor Mdv1. Mutation of this conserved motif specifically disrupted Dnm1–Mdv1 interactions, blocking Dnm1 recruitment and mitochondrial fission. Suppressor mutations in Mdv1 that restored Dnm1–Mdv1 interactions and fission identified potential protein-binding interfaces on the Mdv1 β-propeller domain. These results define the first known function for Insert B in DRP–adaptor interactions. Based on the variability of Insert B sequences and adaptor proteins, we propose that Insert B domains and mitochondrial adaptors have coevolved to meet the unique requirements for mitochondrial fission of different organisms. PMID:23148233
Rice, W G; Schaeffer, C A; Graham, L; Bu, M; McDougal, J S; Orloff, S L; Villinger, F; Young, M; Oroszlan, S; Fesen, M R
1993-01-01
The C-nitroso compound 3-nitrosobenzamide, which has been shown to remove zinc from the retroviral-type zinc finger of p7NC nucleocapsid proteins, inhibits acute infection of human immunodeficiency virus type 1 in cultured human lymphocytes. The attachment of the virus to lymphocytes and the activities of critical viral enzymes, such as reverse transcriptase, protease, and integrase, are not affected by 3-nitrosobenzamide. However, the process of reverse transcription to form proviral DNA is effectively abolished by the drug, identifying the mode of action of 3-nitrosobenzamide as interrupting the role of p7NC in accurate proviral DNA synthesis during the infectious phase of the virus life cycle. Images Fig. 3 Fig. 4 PMID:7692451
Carlson, Jonathan; Lyon, Monique; Bishop, Jeanette; Vaiman, Anne; Cribiu, Edmond; Mornex, Jean-François; Brown, Susan; Knudson, Dennis; DeMartini, James; Leroux, Caroline
2003-01-01
A family of endogenous retroviruses (enJSRV) closely related to Jaagsiekte sheep retrovirus (JSRV) is ubiquitous in domestic and wild sheep and goats. Southern blot hybridization studies indicate that there is little active replication or movement of the enJSRV proviruses in these species. Two approaches were used to investigate the distribution of proviral loci in the sheep genome. Fluorescence in situ hybridization (FISH) to metaphase chromosome spreads using viral DNA probes was used to detect loci on chromosomes. Hybridization signals were reproducibly detected on seven sheep chromosomes and eight goat chromosomes in seven cell lines. In addition, a panel of 30 sheep-hamster hybrid cell lines, each of which carries one or more sheep chromosomes and which collectively contain the whole sheep genome, was examined for enJSRV sequences. DNA from each of the lines was used as a template for PCR with JSRV gag-specific primers. A PCR product was amplified from 27 of the hybrid lines, indicating that JSRV gag sequences are found on at least 15 of the 28 sheep chromosomes, including those identified by FISH. Thus, enJSRV proviruses are essentially randomly distributed among the chromosomes of sheep and goats. FISH and/or Southern blot hybridization on DNA from several of the sheep-hamster hybrid cell lines suggests that loci containing multiple copies of enJSRV are present on chromosomes 6 and 9. The origin and functional significance of these arrays is not known. PMID:12915578
Adeno-associated virus-mediated gene transfer
Srivastava, Arun
2008-01-01
Although the remarkable versatility and efficacy of recombinant adeno-associated virus 2 (AAV2) vectors in transducing a wide variety of cells and tissues in vitro, and in numerous pre-clinical animal models of human diseases in vivo, have been well established, the published literature is replete with controversies with regard to the efficacy of AAV2 vectors in hematopoietic stem cell (HSC) transduction. A number of factors have contributed to these controversies, the molecular bases of which have begun to come to light in recent years. With the availability of several novel serotypes (AAV1 through AAV12), rational design of AAV capsid mutants, and strategies (self-complementary vector genomes, hematopoietic cell-specific promoters), it is indeed becoming feasible to achieve efficient transduction of HSC by AAV vectors in a murine serial bone marrow transplantation model in vivo, where stable integration of the proviral AAV genome does not lead to any overt hematological abnormalities. Thus, a better understanding of the AAV-HSC interactions, and the availability of a vast repertoire of novel serotype vectors, are likely to have significant implications in the use of AAV vectors in high-efficiency transduction of HSCs as well as in gene therapy applications involving the hematopoietic system. PMID:18500727
Patel, M; Carritt, K; Lane, J; Jayappa, H; Stahl, M; Bourgeois, M
2015-07-01
Four vaccines for feline leukemia virus (FeLV) are available in the United States. This study's purpose was to compare the efficacy of Nobivac feline 2-FeLV (an inactivated, adjuvanted whole-virus vaccine) and PureVax recombinant FeLV (a live, canarypox virus-vectored vaccine) following FeLV challenge. Cats were vaccinated at 9 and 12 weeks with Nobivac feline 2-FeLV (group A, n = 11) or PureVax recombinant FeLV (group B, n = 10). Group C (n = 11) comprised unvaccinated controls. At 3 months postvaccination, cats were immunosuppressed and challenged with FeLV-A/61E. The outcomes measured were persistent antigenemia at 12 weeks postchallenge (PC) and proviral DNA and viral RNA at 3 to 9 weeks PC. Persistent antigenemia was observed in 0 of 11 cats in group A, 5 of 10 cats in group B, and 10 of 11 cats in group C. Group A was significantly protected compared to those in groups B (P < 0.013) and C (P < 0.0001). No difference was found between groups B and C (P > 0.063). The preventable fraction was 100% for group A and 45% for group B. At 9 weeks PC, proviral DNA and viral RNA were detected 1 of 11 cats in group A, 6 of 10 cats in group B, and 9 of 11 cats in group C. Nucleic acid loads were significantly lower in group A than in group C (P < 0.01). Group A had significantly lower proviral DNA loads than group B at weeks 6 to 9 (P < 0.02). The viral RNA loads were significantly lower in group A than in group B at weeks 7 to 9 (P < 0.01). The results demonstrate that Nobivac feline 2-FeLV-vaccinated cats were fully protected against persistent antigenemia and had significantly smaller amounts of proviral DNA and plasma viral RNA loads than PureVax recombinant FeLV-vaccinated cats and unvaccinated controls. Copyright © 2015, Patel et al.
Ostrowski, S R; Ullum, H; Pedersen, B K; Gerstoft, J; Katzenstein, T L
2005-01-01
Human immunodeficiency virus (HIV)-1 infection influences natural killer (NK) cell expression of inhibitory NK receptors and activating natural cytotoxicity receptors. It is unknown whether expression of the co-stimulatory NK cell receptor 2B4 (CD244) on NK cells and CD3+ CD8+ cells are affected by highly active antiretroviral therapy (HAART), low-level viraemia, proviral-DNA or immune activation in HIV-1 infected patients. A total of 101 HAART-treated HIV-1 infected patients with ≤ 200 HIV-RNA copies/ml were followed prospectively for 24 months. HIV-RNA was investigated 3-monthly and 2B4 expression on CD3− CD16+ NK cells and CD3+ CD8+ cells, proviral-DNA and plasma soluble tumour necrosis factor receptor (sTNFr)-II were investigated 6-monthly. For comparison, 2B4 expression was investigated in 20 healthy individuals. The concentration of 2B4+ NK cells was initially reduced in HIV-1 infected patients (P < 0·001) but increased to a normal level during the 24 months’ follow-up. The concentration of CD3+ CD8+ 2B4+ cells in HIV-1 infected patients was normal and did not change during follow-up. The relative fluorescence intensity (RFI) of 2B4 increased on both NK cells and CD3+ CD8+ cells during follow-up (both P < 0·001). Higher levels of proviral-DNA carrying cells and plasma sTNFrII were associated with reductions in the concentration of 2B4+ NK cells (all P < 0·05). HIV-RNA had no effect on 2B4 expression on NK cells or CD3+ CD8+ cells. These findings demonstrate that the concentration of 2B4+ NK cells normalizes during long-term HAART in HIV-1 infected patients. The finding that proviral-DNA and sTNFrII were associated negatively with the concentration of 2B4+ NK cells suggests that immune activation in HIV-1 infected patients receiving HAART influences the target cell recognition by NK cells. PMID:16045743
Ostrowski, S R; Ullum, H; Pedersen, B K; Gerstoft, J; Katzenstein, T L
2005-09-01
Human immunodeficiency virus (HIV)-1 infection influences natural killer (NK) cell expression of inhibitory NK receptors and activating natural cytotoxicity receptors. It is unknown whether expression of the co-stimulatory NK cell receptor 2B4 (CD244) on NK cells and CD3+ CD8+ cells are affected by highly active antiretroviral therapy (HAART), low-level viraemia, proviral-DNA or immune activation in HIV-1 infected patients. A total of 101 HAART-treated HIV-1 infected patients with < or = 200 HIV-RNA copies/ml were followed prospectively for 24 months. HIV-RNA was investigated 3-monthly and 2B4 expression on CD3- CD16+ NK cells and CD3+ CD8+ cells, proviral-DNA and plasma soluble tumour necrosis factor receptor (sTNFr)-II were investigated 6-monthly. For comparison, 2B4 expression was investigated in 20 healthy individuals. The concentration of 2B4+ NK cells was initially reduced in HIV-1 infected patients (P < 0.001) but increased to a normal level during the 24 months' follow-up. The concentration of CD3+ CD8+ 2B4+ cells in HIV-1 infected patients was normal and did not change during follow-up. The relative fluorescence intensity (RFI) of 2B4 increased on both NK cells and CD3+ CD8+ cells during follow-up (both P < 0.001). Higher levels of proviral-DNA carrying cells and plasma sTNFrII were associated with reductions in the concentration of 2B4+ NK cells (all P < 0.05). HIV-RNA had no effect on 2B4 expression on NK cells or CD3+ CD8+ cells. These findings demonstrate that the concentration of 2B4+ NK cells normalizes during long-term HAART in HIV-1 infected patients. The finding that proviral-DNA and sTNFrII were associated negatively with the concentration of 2B4+ NK cells suggests that immune activation in HIV-1 infected patients receiving HAART influences the target cell recognition by NK cells.
Poveda, E; Hernández-Quero, J; Pérez-Elías, M J; Ribas, M A; Martínez-Madrid, O J; Flores, J; Navarro, J; Gutiérrez, F; García-Deltoro, M; Imaz, A; Ocampo, A; Artero, A; Blanco, F; Bernal, E; Pasquau, J; Mínguez-Gallego, C; Pérez, N; Aiestaran, A; García, F; Paredes, R
2017-08-01
Maraviroc (MVC) is a suitable drug for aviraemic subjects on antiretroviral treatment (ART) developing toxicity. Its prescription requires prior tropism testing. It is unknown if proviral DNA genotypic tropism testing is reliable for guiding MVC initiation in aviraemic subjects, so this study was carried out to address this issue. PROTEST was a phase 4, prospective, single-arm clinical trial carried out in 24 HIV care centres in Spain. MVC-naïve HIV-1-infected patients with HIV-1 RNA < 50 copies/mL on stable ART during the previous 6 months who required an ART change because of toxicity and who had R5 HIV, as determined by proviral DNA genotypic tropism testing, initiated MVC with two nucleoside reverse transcriptase inhibitors (NRTIs) and were followed for 48 weeks. Virological failure was defined as two consecutive viral load measurements > 50 copies/mL. Tropism results were available for 141 of 175 (80.6%) subjects screened: 60% had R5 and 85% of these (n = 74) were finally included in the study. Previous ART included protease inhibitors (PIs) in 62% of subjects, nonnucleoside reverse transcriptase inhibitors (NNRTIs) in 36%, and integrase inhibitors (INIs) in 2%. Main reasons for treatment change were dyslipidaemia (42%), gastrointestinal symptoms (22%) and liver toxicity (15%). MVC was given alongside tenofovir (TDF)/emtricitabine (FTC) (54%) and abacavir (ABC)/lamivudine (3TC) (40%) in most patients. Eighty-four per cent of patients maintained a viral load < 50 copies/mL to week 48, whereas 16% discontinued treatment: two withdrew informed consent, one had an R5 to X4 shift between screening and baseline, one was lost to follow-up, one developed an adverse event (rash), two died from non-study-related causes, and five developed protocol-defined virological failure. Initiation of MVC plus two NRTIs in aviraemic subjects based on genotypic tropism testing of proviral HIV-1 DNA is associated with low rates of virological failure for up to 1 year. © 2016 British HIV Association.
Vieyres, P; Durand, A; Patat, F; Descamps, P; Gregoire, J M; Pourcelot, D; Pourcelot, L
1991-12-01
A computer model was used to study the primary factors generating the reduction in resistance index, (S-D)/S, values observed by ultrasonic Doppler measurements in the umbilical artery, from the fetal insertion to the placental insertion (S represents the amplitude of the systolic peak and D the amplitude of the diastolic peak). This hemodynamic approach shows that the placental resistance is the primary factor, the viscosity and the cord length playing secondary roles. Clinically, the position of the measurement along the cord is an important factor. To increase the sensitivity of the index, the Doppler measurement must be performed near the fetal insertion, whereas a measurement near the placental insertion will make the Doppler examination more specific.
Sultan, Torky; Khedr, Ayman E; Sayed, Mostafa
2013-01-01
NONE DECLARED Defect tracking systems play an important role in the software development organizations as they can store historical information about defects. There are many research in defect tracking models and systems to enhance their capabilities to be more specifically tracking, and were adopted with new technology. Furthermore, there are different studies in classifying bugs in a step by step method to have clear perception and applicable method in detecting such bugs. This paper shows a new proposed defect tracking model for the purpose of classifying the inserted defects reports in a step by step method for more enhancement of the software quality.
Matsumoto, Chieko; Sagara, Yasuko; Sobata, Rieko; Inoue, Yukiko; Morita, Maiko; Uchida, Shigeharu; Kiyokawa, Hiroyuki; Satake, Masahiro; Tadokoro, Kenji
2017-08-01
Adult T-cell leukemia/lymphoma (ATL) occurs in approximately 5% of individuals infected with human T-cell leukemia virus type 1 (HTLV-1). A high proviral load (PVL; more than four copies per 100 peripheral blood mononuclear cells (PBMCs) or 1.6 copies per 100 blood leukocytes) and being male are risk factors for ATL development. Whether anti-HTLV-1 antibody level is related to such risk is unknown. Here, PVL and antibody levels were examined using real-time PCR and other tests in 600 HTLV-1 positive screened Japanese blood donors to understand the relationship between PVL and antibody level in asymptomatic carriers and to gain insights toward better antibody testing for HTLV-1 infection. The 430 donors in whom proviral DNA was detected were considered as true positives for HTLV-1 infection. Among donors aged 40 years or older, more males than females had a PVL corresponding to more than 1.6% infected leukocytes, and an antibody titer below the median (P = 0.0018). In antibody tests using an HTLV-1 positive cell line or Env antigens there was a large discrepancy in antibody titer among 13 provirus-positive samples, probably suggesting that antibody-based screening tests should incorporate multiple HTLV-1 antigens, such as Gag and Env antigens. © 2017 Wiley Periodicals, Inc.
Noguera-Julian, Marc; Bellido, Rocío; Puertas, Maria C.; Carrillo, Jorge; Rodriguez, C.; Perez-Alvarez, Núria; Cobarsí, Patricia; Gomez, Carmen E.; Esteban, Mariano; Jímenez, Jose Luis; García, Felipe; Blanco, Julià; Martinez-Picado, Javier; Paredes, Roger
2017-01-01
The most relevant endpoint in therapeutic HIV vaccination is the assessment of time to viral rebound or duration of sustained control of low-level viremia upon cART treatment cessation. Structured treatment interruptions (STI) are however not without risk to the patient and reliable predictors of viral rebound/control after therapeutic HIV-1 vaccination are urgently needed to ensure patient safety and guide therapeutic vaccine development. Here, we integrated immunological and virological parameters together with viral rebound dynamics after STI in a phase I therapeutic vaccine trial of a polyvalent MVA-B vaccine candidate to define predictors of viral control. Clinical parameters, proviral DNA, host HLA genetics and measures of humoral and cellular immunity were evaluated. A sieve effect analysis was conducted comparing pre-treatment viral sequences to breakthrough viruses after STI. Our results show that a reduced proviral HIV-1 DNA at study entry was independently associated with two virological parameters, delayed HIV-1 RNA rebound (p = 0.029) and lower peak viremia after treatment cessation (p = 0.019). Reduced peak viremia was also positively correlated with a decreased number of HLA class I allele associated polymorphisms in Gag sequences in the rebounding virus population (p = 0.012). Our findings suggest that proviral DNA levels and the number of HLA-associated Gag polymorphisms may have an impact on the clinical outcome of STI. Incorporation of these parameters in future therapeutic vaccine trials may guide refined immunogen design and help conduct safer STI approaches. PMID:28953921
NASA Astrophysics Data System (ADS)
Durieux, A.; Martin, B.; Laubier, D.
2017-11-01
DECLIC, a Facility dedicated to the study of transparent media under microgravity, will be used in an ISS EXPRESS Rack. This paper focuses on the EXL which contains two optical boxes disposed on two opposite sides of the cavity where the Inserts to be studied shall be locked. At the moment, three types of inserts are planned to be accommodated in the EXL. Various optical diagnostics are available by configuring the EXL (sources, sensors, mechanisms). After the presentation of the EXL design, this article deals with some manufacturing and testing aspects, such as the use of COTS (cameras). Specific OGSE have been developed in order to simulate the optical interfaces and the propagation of beams in the inserts. Three models of the EXL have been integrated and fully tested, including the Flight Model. The sequence of tests, the performances measured, and then some images of the experiments performed with the inserts will be presented.
46 CFR 160.052-1 - Incorporation by reference.
Code of Federal Regulations, 2010 CFR
2010-10-01
..., Model AP. Sheet 2—Cutting Pattern and General Arrangement, Model CPM. Sheet 3—Cutting Pattern and General Arrangement, Model CPS. Sheet 4—Insert Patterns. (c) Copies on file. The manufacturer shall keep a... Specifications and Standards may be purchased from the Business Service Center, General Services Administration...
Topology of the membrane protein LamB by epitope tagging and a comparison with the X-ray model.
Newton, S M; Klebba, P E; Michel, V; Hofnung, M; Charbit, A
1996-06-01
We previously developed a genetic approach to study, with a single antibody, the topology of the outer membrane protein LamB, an Escherichia coli porin with specificity towards maltodextrins and a receptor for bacteriophage lambda. Our initial procedure consisted of inserting at random the same reporter epitope (the C3 neutralization epitope from poliovirus) into permissive sites of LamB (i.e., sites which tolerate insertions without deleterious effects on the protein activities or the cell). A specific monoclonal antibody was then used to examine the position of the inserted epitope with respect to the protein and the membrane. In the present work, we set up a site-directed procedure to insert the C3 epitope at new sites in order to distinguish between two-dimensional folding models. This allowed us to identify two new surface loops of LamB and to predict another periplasmic exposed region. The results obtained by random and directed epitope tagging are analyzed in light of the recently published X-ray structure of the LamB protein. Study of 23 hybrid LamB-C3 proteins led to the direct identification of five of the nine external loops (L4, L5, L6, L7, and L9) and led to the prediction of four periplasmic loops (I1, I4, I5, and I8) of LamB. Nine of the hybrid proteins did not lead to topological conclusions, and none led to the wrong predictions or conclusions. The comparison indicates that parts of models based on secondary structure predictions alone are not reliable and points to the importance of experimental data in the establishment of outer membrane protein topological models. The advantages and limitations of genetic foreign epitope insertion for the study of integral membrane proteins are discussed.
Yasuda, Hiroyuki; Hamamoto, Junko; Oashi, Ayano; Ishioka, Kota; Arai, Daisuke; Nukaga, Shigenari; Miyawaki, Masayoshi; Kawada, Ichiro; Naoki, Katsuhiko; Costa, Daniel B.; Kobayashi, Susumu S.; Betsuyaku, Tomoko; Soejima, Kenzo
2015-01-01
EGFR mutated lung cancer accounts for a significant subgroup of non-small-cell lung cancer (NSCLC). Over the last decade, multiple EGFR tyrosine kinase inhibitors (EGFR-TKIs) have been developed to target mutated EGFR. However, there is little information regarding mutation specific potency of EGFR-TKIs against various types of EGFR mutations. The purpose of this study is to establish an in vitro model to determine the “therapeutic window” of EGFR-TKIs against various types of EGFR mutations, including EGFR exon 20 insertion mutations. The potency of 1st (erlotinib), 2nd (afatinib) and 3rd (osimertinib and rociletinib) generation EGFR-TKIs was compared in vitro for human lung cancer cell lines and Ba/F3 cells, which exogenously express mutated or wild type EGFR. An in vitro model of mutation specificity was created by calculating the ratio of IC50 values between mutated and wild type EGFR. The in vitro model identified a wide therapeutic window of afatinib for exon 19 deletions and L858R and of osimertinib and rociletinib for T790M positive mutations. The results obtained with our models matched well with previously reported preclinical and clinical data. Interestingly, for EGFR exon 20 insertion mutations, most of which are known to be resistant to 1st and 2nd generation EGFR-TKIS, osimertinib was potent and presented a wide therapeutic window. To our knowledge, this is the first report that has identified the therapeutic window of osimertinib for EGFR exon 20 insertion mutations. In conclusion, this model will provide a preclinical rationale for proper selection of EGFR-TKIs against clinically-relevant EGFR mutations. PMID:26515464
Reliability Technology to Achieve Insertion of Advanced Packaging (RELTECH) program
NASA Astrophysics Data System (ADS)
Fayette, Daniel F.; Speicher, Patricia; Stoklosa, Mark J.; Evans, Jillian V.; Evans, John W.; Gentile, Mike; Pagel, Chuck A.; Hakim, Edward
1993-08-01
A joint military-commercial effort to evaluate multichip module (MCM) structures is discussed. The program, Reliability Technology to Achieve Insertion of Advanced Packaging (RELTECH), has been designed to identify the failure mechanisms that are possible in MCM structures. The RELTECH test vehicles, technical assessment task, product evaluation plan, reliability modeling task, accelerated and environmental testing, and post-test physical analysis and failure analysis are described. The information obtained through RELTECH can be used to address standardization issues, through development of cost effective qualification and appropriate screening criteria, for inclusion into a commercial specification and the MIL-H-38534 general specification for hybrid microcircuits.
Reliability Technology to Achieve Insertion of Advanced Packaging (RELTECH) program
NASA Technical Reports Server (NTRS)
Fayette, Daniel F.; Speicher, Patricia; Stoklosa, Mark J.; Evans, Jillian V.; Evans, John W.; Gentile, Mike; Pagel, Chuck A.; Hakim, Edward
1993-01-01
A joint military-commercial effort to evaluate multichip module (MCM) structures is discussed. The program, Reliability Technology to Achieve Insertion of Advanced Packaging (RELTECH), has been designed to identify the failure mechanisms that are possible in MCM structures. The RELTECH test vehicles, technical assessment task, product evaluation plan, reliability modeling task, accelerated and environmental testing, and post-test physical analysis and failure analysis are described. The information obtained through RELTECH can be used to address standardization issues, through development of cost effective qualification and appropriate screening criteria, for inclusion into a commercial specification and the MIL-H-38534 general specification for hybrid microcircuits.
Computer Modeling of Protocellular Functions: Peptide Insertion in Membranes
NASA Technical Reports Server (NTRS)
Rodriquez-Gomez, D.; Darve, E.; Pohorille, A.
2006-01-01
Lipid vesicles became the precursors to protocells by acquiring the capabilities needed to survive and reproduce. These include transport of ions, nutrients and waste products across cell walls and capture of energy and its conversion into a chemically usable form. In modem organisms these functions are carried out by membrane-bound proteins (about 30% of the genome codes for this kind of proteins). A number of properties of alpha-helical peptides suggest that their associations are excellent candidates for protobiological precursors of proteins. In particular, some simple a-helical peptides can aggregate spontaneously and form functional channels. This process can be described conceptually by a three-step thermodynamic cycle: 1 - folding of helices at the water-membrane interface, 2 - helix insertion into the lipid bilayer and 3 - specific interactions of these helices that result in functional tertiary structures. Although a crucial step, helix insertion has not been adequately studied because of the insolubility and aggregation of hydrophobic peptides. In this work, we use computer simulation methods (Molecular Dynamics) to characterize the energetics of helix insertion and we discuss its importance in an evolutionary context. Specifically, helices could self-assemble only if their interactions were sufficiently strong to compensate the unfavorable Free Energy of insertion of individual helices into membranes, providing a selection mechanism for protobiological evolution.
Concise classification of the genomic porcine endogenous retroviral gamma1 load to defined lineages.
Klymiuk, Nikolai; Wolf, Eckhard; Aigner, Bernhard
2008-02-05
We investigated the infection history of porcine endogenous retroviruses (PERV) gamma1 by analyzing published env and LTR sequences. PERV sequences from various breeds, porcine cell lines and infected human primary cells were included in the study. We identified a considerable number of retroviral lineages indicating multiple independent colonization events of the porcine genome. A recent boost of the proviral load in an isolated pig herd and exclusive occurrence of distinct lineages in single studies indicated the ongoing colonization of the porcine genome with endogenous retroviruses. Retroviral recombination between co-packaged genomes was a general factor for PERV gamma1 diversity which indicated the simultaneous expression of different proviral loci over a period of time. In total, our detailed description of endogenous retroviral lineages is the prerequisite for breeding approaches to minimize the infectious potential of porcine tissues for the subsequent use in xenotransplantation.
Hepatitis C Virus Core Protein Promotes miR-122 Destabilization by Inhibiting GLD-2
Kim, Geon-Woo; Lee, Seung-Hoon; Cho, Hee; Kim, Minwoo; Shin, Eui-Cheol; Oh, Jong-Won
2016-01-01
The liver-specific microRNA miR-122, which has essential roles in liver development and metabolism, is a key proviral factor for hepatitis C virus (HCV). Despite its crucial role in the liver and HCV life cycle, little is known about the molecular mechanism of miR-122 expression regulation by HCV infection. Here, we show that the HCV core protein downregulates the abundance of miR-122 by promoting its destabilization via the inhibition of GLD-2, a non-canonical cytoplasmic poly(A) polymerase. The decrease in miR-122 expression resulted in the dysregulation of the known functions of miR-122, including its proviral activity for HCV. By high-throughput sequencing of small RNAs from human liver biopsies, we found that the 22-nucleotide (nt) prototype miR-122 is modified at its 3′ end by 3′-terminal non-templated and templated nucleotide additions. Remarkably, the proportion of miR-122 isomers bearing a single nucleotide tail of any ribonucleotide decreased in liver specimens from patients with HCV. We found that these single-nucleotide-tailed miR-122 isomers display increased miRNA activity and stability over the 22-nt prototype miR-122 and that the 3′-terminal extension is catalyzed by the unique terminal nucleotidyl transferase activity of GLD-2, which is capable of adding any single ribonucleotide without preference of adenylate to the miR-122 3′ end. The HCV core protein specifically inhibited GLD-2, and its interaction with GLD-2 in the cytoplasm was found to be responsible for miR-122 downregulation. Collectively, our results provide new insights into the regulatory role of the HCV core protein in controlling viral RNA abundance and miR-122 functions through miR-122 stability modulation. PMID:27366906
Tu, Po-An; Shiu, Jia-Shian; Lee, Shu-Hwae; Pang, Victor Fei; Wang, De-Chi; Wang, Pei-Hwa
2017-05-01
Caprine arthritis-encephalitis (CAE) in goats is a complex disease syndrome caused by a lentivirus. This persistent viral infection results in arthritis in adult goats and encephalitis in lambs. The prognosis for the encephalitic form is normally poor, and this form of the disease has caused substantial economic losses for goat farmers. Hence, a more efficient detection platform based on recombinase polymerase amplification (RPA) and a lateral flow dipstick (LFD) was developed in the present study for detecting the proviral DNA of caprine arthritis-encephalitis virus (CAEV). Under the optimal incubation conditions, specifically, 30min at 37°C for RPA followed by 5min at room temperature for LFD, the assay was found to be sensitive to a lower limit of 80pg of total DNA and 10 copies of plasmid DNA. Furthermore, there was no cross-reaction with other tested viruses, including goat pox virus and bovine leukemia virus. Given its simplicity and portability, this RPA-LFD protocol can serve as an alternative tool to ELISA for the primary screening of CAEV, one that is suitable for both laboratory and field application. When the RPA-LFD was applied in parallel with serological ELISA for the detection of CAEV in field samples, the RPA-LFD assay exhibited a higher sensitivity than the traditional method, and 82% of the 200 samples collected in Taiwan were found to be positive. To our knowledge, this is the first report providing evidence to support the use of an RPA-LFD assay as a specific and sensitive platform for detecting CAEV proviral DNA in goats in a faster manner, one that is also applicable for on-site utilization at farms and that should be useful in both eradication programs and epidemiological studies. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Feudo, Christopher V.
1994-04-01
This dissertation demonstrates that inadequately protected wireless LANs are more vulnerable to rogue program attack than traditional LANs. Wireless LANs not only run the same risks as traditional LANs, but they also run additional risks associated with an open transmission medium. Intruders can scan radio waves and, given enough time and resources, intercept, analyze, decipher, and reinsert data into the transmission medium. This dissertation describes the development and instantiation of an abstract model of the rogue code insertion process into a DOS-based wireless communications system using radio frequency (RF) atmospheric signal transmission. The model is general enough to be applied to widely used target environments such as UNIX, Macintosh, and DOS operating systems. The methodology and three modules, the prober, activator, and trigger modules, to generate rogue code and insert it into a wireless LAN were developed to illustrate the efficacy of the model. Also incorporated into the model are defense measures against remotely introduced rogue programs and a cost-benefit analysis that determined that such defenses for a specific environment were cost-justified.
Khedr, Ayman E.; Sayed, Mostafa
2013-01-01
CONFLICT OF INTEREST: NONE DECLARED Defect tracking systems play an important role in the software development organizations as they can store historical information about defects. There are many research in defect tracking models and systems to enhance their capabilities to be more specifically tracking, and were adopted with new technology. Furthermore, there are different studies in classifying bugs in a step by step method to have clear perception and applicable method in detecting such bugs. This paper shows a new proposed defect tracking model for the purpose of classifying the inserted defects reports in a step by step method for more enhancement of the software quality. PMID:24039334
Mental models in risk assessment: informing people about drugs.
Jungermann, H; Schütz, H; Thüring, M
1988-03-01
One way to communicate about the risks of drugs is through the use of package inserts. The problems associated with this medium of informing patients have been investigated by several researchers who found that people require information about drugs they are using, including extensive risk information, and that they are willing to take this information into account in their usage of drugs. But empirical results also show that people easily misinterpret the information given. A conceptual framework is proposed that might be used for better understanding the cognitive processes involved in such a type of risk assessment and communication. It is based on the idea that people develop, through experience, a mental model of how a drug works, which effects it might produce, that contraindications have to be considered, etc. This mental model is "run" when a specific package insert has been read and a specific question arises such as, for example, whether certain symptoms can be explained as normal or whether they require special attention and action. We argue that the mental model approach offers a useful perspective for examining how people understand package inserts, and consequently for improving their content and design. The approach promises to be equally useful for other aspects of risk analysis that are dependent upon human judgment and decision making, e.g., threat diagnosis and human reliability analysis.
Mahalingam, S; Awad, Z; Tolley, N S; Khemani, S
2016-08-01
The objective of this study was to identify and investigate the face and content validity of ventilation tube insertion (VTI) training models described in the literature. A review of literature was carried out to identify articles describing VTI simulators. Feasible models were replicated and assessed by a group of experts. Postgraduate simulation centre. Experts were defined as surgeons who had performed at least 100 VTI on patients. Seventeen experts were participated ensuring sufficient statistical power for analysis. A standardised 18-item Likert-scale questionnaire was used. This addressed face validity (realism), global and task-specific content (suitability of the model for teaching) and curriculum recommendation. The search revealed eleven models, of which only five had associated validity data. Five models were found to be feasible to replicate. None of the tested models achieved face or global content validity. Only one model achieved task-specific validity, and hence, there was no agreement on curriculum recommendation. The quality of simulation models is moderate and there is room for improvement. There is a need for new models to be developed or existing ones to be refined in order to construct a more realistic training platform for VTI simulation. © 2015 John Wiley & Sons Ltd.
Galindo-González, Leonardo; Mhiri, Corinne; Grandbastien, Marie-Angèle; Deyholos, Michael K
2016-12-07
Initial characterization of the flax genome showed that Ty1-copia retrotransposons are abundant, with several members being recently inserted, and in close association with genes. Recent insertions indicate a potential for ongoing transpositional activity that can create genomic diversity among accessions, cultivars or varieties. The polymorphisms generated constitute a good source of molecular markers that may be associated with phenotype if the insertions alter gene activity. Flax, where accessions are bred mainly for seed nutritional properties or for fibers, constitutes a good model for studying the relationship of transpositional activity with diversification and breeding. In this study, we estimated copy number and used a type of transposon display known as Sequence-Specific Amplification Polymorphisms (SSAPs), to characterize six families of Ty1-copia elements across 14 flax accessions. Polymorphic insertion sites were sequenced to find insertions that could potentially alter gene expression, and a preliminary test was performed with selected genes bearing transposable element (TE) insertions. Quantification of six families of Ty1-copia elements indicated different abundances among TE families and between flax accessions, which suggested diverse transpositional histories. SSAPs showed a high level of polymorphism in most of the evaluated retrotransposon families, with a trend towards higher levels of polymorphism in low-copy number families. Ty1-copia insertion polymorphisms among cultivars allowed a general distinction between oil and fiber types, and between spring and winter types, demonstrating their utility in diversity studies. Characterization of polymorphic insertions revealed an overwhelming association with genes, with insertions disrupting exons, introns or within 1 kb of coding regions. A preliminary test on the potential transcriptional disruption by TEs of four selected genes evaluated in three different tissues, showed one case of significant impact of the insertion on gene expression. We demonstrated that specific Ty1-copia families have been active since breeding commenced in flax. The retrotransposon-derived polymorphism can be used to separate flax types, and the close association of many insertions with genes defines a good source of potential mutations that could be associated with phenotypic changes, resulting in diversification processes.
Glowacka, Ilona; Korn, Klaus; Potthoff, Sebastian A; Lehmann, Ulrich; Kreipe, Hans H; Ivens, Katrin; Barg-Hock, Hannelore; Schulz, Thomas F; Heim, Albert
2013-11-01
Human T-cell lymphotropic virus type 1 (HTLV-1) screening of blood and organ donors is not mandatory in Germany because of its low prevalence (about 7/100 000). An HTLV-1 transmission event caused by a multiple organ donor was investigated. Validity of diagnostic procedures and HTLV-1 disease association in immunosuppressed organ recipients were analyzed. Two screening immunoassays and an immunoblot (confirmatory assay) were used for detection of HLTV-1/2 antibodies. Proviral DNA was quantified in blood and biopsies of organ recipients by HTLV-1 real-time polymerase chain reaction (PCR). Proviral HTLV-1-DNA was detected in all blood samples of 3 organ recipients (1-100 copies/10(2) cells), but seroconversion was delayed for up to 2 years in screening assays and >6 years in the confirmatory assay. In 2 of 3 organ recipients, a cutaneous T-cell lymphoma was diagnosed 2 and 3 years after infection, respectively. Proviral HTLV-1 DNA concentration was almost 100 copies/10(2) cells in cutaneous lymphoma biopsies whereas in biopsies of other tissues ≤3.0 copies/10(2) cells were found. The third organ recipient did not suffer from lymphoma, but detailed clinical data on this patient were not available to us. Biopsy results support an etiological role for HTLV-1 in these cases of primary cutaneous T-cell lymphoma after solid organ transplant. HTLV-1-associated lymphoma can arise quickly in immunocompromised transplant recipients. The diagnosis of potentially HTLV-1-associated disease in organ recipients may require PCR because of delayed seroconversion.
Groner, B; Hynes, N E
1980-01-01
The Southern DNA filter transfer technique was used to characterize the genomic location of the mouse mammary tumor proviral DNA in different inbred strains of mice. Two of the strains (C3H and CBA) arose from a cross of a Bagg albino (BALB/c) mouse and a DBA mouse. The mouse mammary tumor virus-containing restriction enzyme DNA fragments of these strains had similar patterns, suggesting that the proviruses of these mice are in similar genomic locations. Conversely, the pattern arising from the DNA of the GR mouse, a strain genetically unrelated to the others, appeared different, suggesting that its mouse mammary tumor proviruses are located in different genomic sites. The structure of another gene, that coding for beta-globin, was also compared. The mice strains which we studied can be categorized into two classes, expressing either one or two beta-globin proteins. The macroenvironment of the beta-globin gene appeared similar among the mice strains belonging to one genetic class. Female mice of the C3H strain exogenously transmit mouse mammary tumor virus via the milk, and their offspring have a high incidence of mammary tumor occurrence. DNA isolated from individual mammary tumors taken from C3H mice or from BALB/c mice foster nursed on C3H mothers was analyzed by the DNA filter transfer technique. Additional mouse mammary tumor virus-containing fragments were found in the DNA isolated from each mammary tumor. These proviral sequences were integrated into different genomic sites in each tumor. Images PMID:6245257
Wiegand, Ann; Spindler, Jonathan; Hong, Feiyu F; Shao, Wei; Cyktor, Joshua C; Cillo, Anthony R; Halvas, Elias K; Coffin, John M; Mellors, John W; Kearney, Mary F
2017-05-02
Little is known about the fraction of human immunodeficiency virus type 1 (HIV-1) proviruses that express unspliced viral RNA in vivo or about the levels of HIV RNA expression within single infected cells. We developed a sensitive cell-associated HIV RNA and DNA single-genome sequencing (CARD-SGS) method to investigate fractional proviral expression of HIV RNA (1.3-kb fragment of p6, protease, and reverse transcriptase) and the levels of HIV RNA in single HIV-infected cells from blood samples obtained from individuals with viremia or individuals on long-term suppressive antiretroviral therapy (ART). Spiking experiments show that the CARD-SGS method can detect a single cell expressing HIV RNA. Applying CARD-SGS to blood mononuclear cells in six samples from four HIV-infected donors (one with viremia and not on ART and three with viremia suppressed on ART) revealed that an average of 7% of proviruses (range: 2-18%) expressed HIV RNA. Levels of expression varied from one to 62 HIV RNA molecules per cell (median of 1). CARD-SGS also revealed the frequent expression of identical HIV RNA sequences across multiple single cells and across multiple time points in donors on suppressive ART consistent with constitutive expression of HIV RNA in infected cell clones. Defective proviruses were found to express HIV RNA at levels similar to those proviruses that had no obvious defects. CARD-SGS is a useful tool to characterize fractional proviral expression in single infected cells that persist despite ART and to assess the impact of experimental interventions on proviral populations and their expression.
Nesina, Stefanie; Katrin Helfer-Hungerbuehler, A; Riond, Barbara; Boretti, Felicitas S; Willi, Barbara; Meli, Marina L; Grest, Paula; Hofmann-Lehmann, Regina
2015-12-21
The feline leukemia virus (FeLV) is a gamma-retrovirus of domestic cats that was discovered half a century ago. Cats that are infected with FeLV may develop a progressive infection resulting in persistent viremia, immunodeficiency, tumors, anemia and death. A significant number of cats mount a protective immune response that suppresses viremia; these cats develop a regressive infection characterized by the absence of viral replication and the presence of low levels of proviral DNA. The biological importance of these latter provirus carriers is largely unknown. Here, we demonstrate that ten cats that received a transfusion of blood from aviremic provirus carriers developed active FeLV infections, some with a progressive outcome and the development of fatal FeLV-associated disease. The infection outcome, disease spectrum and evolution into FeLV-C in one cat mirrored those of natural infection. Two cats developed persistent antigenemia; six cats were transiently antigenemic. Reactivation of infection occurred in some cats. One recipient developed non-regenerative anemia associated with FeLV-C, and four others developed a T-cell lymphoma, one with secondary lymphoblastic leukemia. Five of the ten recipient cats received provirus-positive aviremic blood, whereas the other five received provirus- and viral RNA-positive but aviremic blood. Notably, the cats that received blood containing only proviral DNA exhibited a later onset but graver outcome of FeLV infection than the cats that were transfused with blood containing proviral DNA and viral RNA. Leukocyte counts and cytokine analyses indicated that the immune system of the latter cats reacted quicker and more efficiently. Our results underline the biological and epidemiological relevance of FeLV provirus carriers and the risk of inadvertent FeLV transmission via blood transfusion and demonstrate the replication capacity of proviral DNA if uncontrolled by the immune system. Our results have implications not only for veterinary medicine, such as the requirement for testing blood donors and blood products for FeLV provirus by sensitive polymerase chain reaction, but are also of general interest by revealing the importance of latent retroviral DNA in infected hosts. When aiming to eliminate a retroviral infection from a population, provirus carriers must be considered.
Efficient transposition of the Tnt1 tobacco retrotransposon in the model legume Medicago truncatula.
d'Erfurth, Isabelle; Cosson, Viviane; Eschstruth, Alexis; Lucas, Helene; Kondorosi, Adam; Ratet, P
2003-04-01
The tobacco element, Tnt1, is one of the few active retrotransposons in plants. Its transposition is activated during protoplast culture in tobacco and tissue culture in the heterologous host Arabidopsis thaliana. Here, we report its transposition in the R108 line of Medicago truncatula during the early steps of the in vitro transformation-regeneration process. Two hundred and twenty-five primary transformants containing Tnt1 were obtained. Among them, 11.2% contained only transposed copies of the element, indicating that Tnt1 transposed very early and efficiently during the in vitro transformation process, possibly even before the T-DNA integration. The average number of insertions per transgenic line was estimated to be about 15. These insertions were stable in the progeny and could be separated by segregation. Inspection of the sequences flanking the insertion sites revealed that Tnt1 had no insertion site specificity and often inserted in genes (one out of three insertions). Thus, our work demonstrates the functioning of an efficient transposable element in leguminous plants. These results indicate that Tnt1 can be used as a powerful tool for insertion mutagenesis in M. truncatula.
Semi-empirical master curve concept describing the rate capability of lithium insertion electrodes
NASA Astrophysics Data System (ADS)
Heubner, C.; Seeba, J.; Liebmann, T.; Nickol, A.; Börner, S.; Fritsch, M.; Nikolowski, K.; Wolter, M.; Schneider, M.; Michaelis, A.
2018-03-01
A simple semi-empirical master curve concept, describing the rate capability of porous insertion electrodes for lithium-ion batteries, is proposed. The model is based on the evaluation of the time constants of lithium diffusion in the liquid electrolyte and the solid active material. This theoretical approach is successfully verified by comprehensive experimental investigations of the rate capability of a large number of porous insertion electrodes with various active materials and design parameters. It turns out, that the rate capability of all investigated electrodes follows a simple master curve governed by the time constant of the rate limiting process. We demonstrate that the master curve concept can be used to determine optimum design criteria meeting specific requirements in terms of maximum gravimetric capacity for a desired rate capability. The model further reveals practical limits of the electrode design, attesting the empirically well-known and inevitable tradeoff between energy and power density.
Adeno-associated virus-mediated gene transfer.
Srivastava, Arun
2008-09-01
Although the remarkable versatility and efficacy of recombinant adeno-associated virus 2 (AAV2) vectors in transducing a wide variety of cells and tissues in vitro, and in numerous pre-clinical animal models of human diseases in vivo, have been well established, the published literature is replete with controversies with regard to the efficacy of AAV2 vectors in hematopoietic stem cell (HSC) transduction. A number of factors have contributed to these controversies, the molecular bases of which have begun to come to light in recent years. With the availability of several novel serotypes (AAV1 through AAV12), rational design of AAV capsid mutants, and strategies (self-complementary vector genomes, hematopoietic cell-specific promoters), it is indeed becoming feasible to achieve efficient transduction of HSC by AAV vectors. Using a murine serial bone marrow transplantation model in vivo, we have recently documented stable integration of the proviral AAV genome into mouse chromosomes, which does not lead to any overt hematological abnormalities. Thus, a better understanding of the AAV-HSC interactions, and the availability of a vast repertoire of novel serotype and capsid mutant vectors, are likely to have significant implications in the use of AAV vectors in high-efficiency transduction of HSCs as well as in gene therapy applications involving the hematopoietic system. (c) 2008 Wiley-Liss, Inc.
FELINE IMMUNODEFICIENCY VIRUS (FIV) IN WILD PALLAS’ CATS
Brown, Meredith A.; Munkhtsog, Bariushaa; Troyer, Jennifer L.; Ross, Steve; Sellers, Rani; Fine, Amanda E.; Swanson, William F.; Roelke, Melody E.; O’Brien1, Stephen J.
2009-01-01
Feline immunodeficiency virus (FIV), a feline lentivirus related to HIV, causes immune dysfunction in domestic and wild cats. The Pallas’ cat is the only species from Asia known to harbor a species-specific strain of FIV designated FIVOma in natural populations. Here, a 25% seroprevalence of FIV is reported from 28 wild Mongolian Pallas’ cats sampled from 2000-2008. Phylogenetic analysis of proviral RT-Pol from eight FIVOma isolates from Mongolia, Russia, China and Kazakhstan reveals a unique monophyletic lineage of the virus within the Pallas’ cat population, most closely related to the African cheetah and leopard FIV strains. Histopathological examination of lymph node and spleen from infected and uninfected Pallas’ cats suggests that FIVOma causes immune depletion in its’ native host. PMID:19926144
Federal Register 2010, 2011, 2012, 2013, 2014
2012-05-03
... who are subject to the information collection requirements may introduce up to 15 new models in a 3... will be required are to insert the specific information that pertains to the new model. Additionally... model to collect the information and mail it to the Commission. Therefore, an additional 2.5 hours have...
Gifford, Robert J.; Rhee, Soo-Yon; Eriksson, Nicolas; Liu, Tommy F.; Kiuchi, Mark; Das, Amar K.; Shafer, Robert W.
2008-01-01
Design Promiscuous guanine (G) to adenine (A) substitutions catalysed by apolipoprotein B RNA-editing catalytic component (APOBEC) enzymes are observed in a proportion of HIV-1 sequences in vivo and can introduce artifacts into some genetic analyses. The potential impact of undetected lethal editing on genotypic estimation of transmitted drug resistance was assessed. Methods Classifiers of lethal, APOBEC-mediated editing were developed by analysis of lentiviral pol gene sequence variation and evaluated using control sets of HIV-1 sequences. The potential impact of sequence editing on genotypic estimation of drug resistance was assessed in sets of sequences obtained from 77 studies of 25 or more therapy-naive individuals, using mixture modelling approaches to determine the maximum likelihood classification of sequences as lethally edited as opposed to viable. Results Analysis of 6437 protease and reverse transcriptase sequences from therapy-naive individuals using a novel classifier of lethal, APOBEC3G-mediated sequence editing, the polypeptide-like 3G (APOBEC3G)-mediated defectives (A3GD) index’, detected lethal editing in association with spurious ‘transmitted drug resistance’ in nearly 3% of proviral sequences obtained from whole blood and 0.2% of samples obtained from plasma. Conclusion Screening for lethally edited sequences in datasets containing a proportion of proviral DNA, such as those likely to be obtained for epidemiological surveillance of transmitted drug resistance in the developing world, can eliminate rare but potentially significant errors in genotypic estimation of transmitted drug resistance. PMID:18356601
de Wilde, Adriaan H.; Wannee, Kazimier F.; Scholte, Florine E. M.; Goeman, Jelle J.; ten Dijke, Peter; Snijder, Eric J.
2015-01-01
ABSTRACT To identify host factors relevant for severe acute respiratory syndrome-coronavirus (SARS-CoV) replication, we performed a small interfering RNA (siRNA) library screen targeting the human kinome. Protein kinases are key regulators of many cellular functions, and the systematic knockdown of their expression should provide a broad perspective on factors and pathways promoting or antagonizing coronavirus replication. In addition to 40 proteins that promote SARS-CoV replication, our study identified 90 factors exhibiting an antiviral effect. Pathway analysis grouped subsets of these factors in specific cellular processes, including the innate immune response and the metabolism of complex lipids, which appear to play a role in SARS-CoV infection. Several factors were selected for in-depth validation in follow-up experiments. In cells depleted for the β2 subunit of the coatomer protein complex (COPB2), the strongest proviral hit, we observed reduced SARS-CoV protein expression and a >2-log reduction in virus yield. Knockdown of the COPB2-related proteins COPB1 and Golgi-specific brefeldin A-resistant guanine nucleotide exchange factor 1 (GBF1) also suggested that COPI-coated vesicles and/or the early secretory pathway are important for SARS-CoV replication. Depletion of the antiviral double-stranded RNA-activated protein kinase (PKR) enhanced virus replication in the primary screen, and validation experiments confirmed increased SARS-CoV protein expression and virus production upon PKR depletion. In addition, cyclin-dependent kinase 6 (CDK6) was identified as a novel antiviral host factor in SARS-CoV replication. The inventory of pro- and antiviral host factors and pathways described here substantiates and expands our understanding of SARS-CoV replication and may contribute to the identification of novel targets for antiviral therapy. IMPORTANCE Replication of all viruses, including SARS-CoV, depends on and is influenced by cellular pathways. Although substantial progress has been made in dissecting the coronavirus replicative cycle, our understanding of the host factors that stimulate (proviral factors) or restrict (antiviral factors) infection remains far from complete. To study the role of host proteins in SARS-CoV infection, we set out to systematically identify kinase-regulated processes that influence virus replication. Protein kinases are key regulators in signal transduction, controlling a wide variety of cellular processes, and many of them are targets of approved drugs and other compounds. Our screen identified a variety of hits and will form the basis for more detailed follow-up studies that should contribute to a better understanding of SARS-CoV replication and coronavirus-host interactions in general. The identified factors could be interesting targets for the development of host-directed antiviral therapy to treat infections with SARS-CoV or other pathogenic coronaviruses. PMID:26041291
Liao, Sam; Neidlin, Michael; Li, Zhiyong; Simpson, Benjamin; Gregory, Shaun D
2018-04-27
Left ventricular assist devices are associated with thromboembolic events, which are potentially caused by altered intraventricular flow. Due to patient variability, differences in apical wall thickness affects cannula insertion lengths, potentially promoting unfavourable intraventricular flow patterns which are thought to be correlated to the risk of thrombosis. This study aimed to present a 3D multiscale computational fluid dynamic model of the left ventricle (LV) developed using a commercial software, Ansys, and evaluate the risk of thrombosis with varying inflow cannula insertion lengths in a severely dilated LV. Based on a HeartWare HVAD inflow cannula, insertion lengths of 5, 19, 24 and 50 mm represented cases of apical hypertrophy, typical ranges of apical thicknesses and an experimental length, respectively. The risk of thrombosis was evaluated based on blood washout, residence time, instantaneous blood stagnation and a pulsatility index. By introducing fresh blood to displace pre-existing blood in the LV, after 5 cardiac cycles, 46.7%, 45.7%, 45.1% and 41.8% of pre-existing blood remained for insertion lengths of 5, 19, 24 and 50 mm, respectively. Compared to the 50 mm insertion, blood residence time was at least 9%, 7% and 6% higher with the 5, 19 and 24 mm insertion lengths, respectively. No instantaneous stagnation at the apex was observed directly after the E-wave. Pulsatility indices adjacent to the cannula increased with shorter insertion lengths. For the specific scenario studied, a longer insertion length, relative to LV size, may be advantageous to minimise thrombosis by increasing LV washout and reducing blood residence time. Copyright © 2018 Elsevier Ltd. All rights reserved.
Determination of Surface-Exposed, Functional Domains of Gonococcal Transferrin-Binding Protein A
Yost-Daljev, Mary Kate; Cornelissen, Cynthia Nau
2004-01-01
The gonococcal transferrin receptor is composed of two distinct proteins, TbpA and TbpB. TbpA is a member of the TonB-dependent family of integral outer membrane transporters, while TbpB is lipid modified and thought to be peripherally surface exposed. We previously proposed a hypothetical topology model for gonococcal TbpA that was based upon computer predictions and similarity with other TonB-dependent transporters for which crystal structures have been determined. In the present study, the hemagglutinin epitope was inserted into TbpA to probe the surface topology of this protein and secondarily to test the functional impacts of site-specific mutagenesis. Twelve epitope insertion mutants were constructed, five of which allowed us to confirm the surface exposure of loops 2, 3, 5, 7, and 10. In contrast to the predictions set forth by the hypothetical model, insertion into the plug region resulted in an epitope that was surface accessible, while epitope insertions into two putative loops (9 and 11) were not surface accessible. Insertions into putative loop 3 and β strand 9 abolished transferrin binding and utilization, and the plug insertion mutant exhibited decreased transferrin-binding affinity concomitant with an inability to utilize it. Insertion into putative β strand 16 generated a mutant that was able to bind transferrin normally but that was unable to mediate utilization. Mutants with insertions into putative loops 2, 9, and 11 maintained wild-type binding affinity but could utilize only transferrin in the presence of TbpB. This is the first demonstration of the ability of TbpB to compensate for a mutation in TbpA. PMID:14977987
Ioannou, Christopher; Knight, Matthew; Daniele, Luca; Flueckiger, Lee; Tan, Ezekiel S L
2016-10-17
The objective of this study is to analyse the effectiveness of the surgical torque limiter during operative use. The study also investigates the potential differences in torque between hand and drill-based screw insertion into locking plates using a standardised torque limiter. Torque for both hand and power screw insertion was measured through a load cell, registering 6.66 points per second. This was performed in a controlled environment using synthetic bone, a locking plate and locking screws to simulate plate fixation. Screws were inserted by hand and by drill with torque values measured. The surgical torque limiter (1.5 Nm) was effective as the highest recorded reading in the study was 1.409 Nm. Comparatively, there is a statistically significant difference between screw insertion methods. Torque produced for manually driven screw insertion into locking plates was 1.289 Nm (95 % CI 1.269-1.308) with drill-powered screw insertion at 0.740 Nm (95 % CI 0.723-0.757). The surgical torque limiter proved to be effective as per product specifications. Screws inserted under power produce significantly less torque when compared to manual insertion by hand. This is likely related to the mechanism of the torque limiter when being used at higher speeds for which it was designed. We conclude that screws may be inserted using power to the plate with the addition of a torque limiter. It is recommended that all screws inserted by drill be hand tightened to achieve adequate torque values.
Cassar, Olivier; Einsiedel, Lloyd; Afonso, Philippe V; Gessain, Antoine
2013-01-01
HTLV-1 infection is endemic among people of Melanesian descent in Papua New Guinea, the Solomon Islands and Vanuatu. Molecular studies reveal that these Melanesian strains belong to the highly divergent HTLV-1c subtype. In Australia, HTLV-1 is also endemic among the Indigenous people of central Australia; however, the molecular epidemiology of HTLV-1 infection in this population remains poorly documented. Studying a series of 23 HTLV-1 strains from Indigenous residents of central Australia, we analyzed coding (gag, pol, env, tax) and non-coding (LTR) genomic proviral regions. Four complete HTLV-1 proviral sequences were also characterized. Phylogenetic analyses implemented with both Neighbor-Joining and Maximum Likelihood methods revealed that all proviral strains belong to the HTLV-1c subtype with a high genetic diversity, which varied with the geographic origin of the infected individuals. Two distinct Australians clades were found, the first including strains derived from most patients whose origins are in the North, and the second comprising a majority of those from the South of central Australia. Time divergence estimation suggests that the speciation of these two Australian clades probably occurred 9,120 years ago (38,000-4,500). The HTLV-1c subtype is endemic to central Australia where the Indigenous population is infected with diverse subtype c variants. At least two Australian clades exist, which cluster according to the geographic origin of the human hosts. These molecular variants are probably of very ancient origin. Further studies could provide new insights into the evolution and modes of dissemination of these retrovirus variants and the associated ancient migration events through which early human settlement of Australia and Melanesia was achieved.
Telomere Length, Proviral Load and Neurologic Impairment in HTLV-1 and HTLV-2-Infected Subjects.
Usadi, Benjamin; Bruhn, Roberta; Lin, Jue; Lee, Tzong-Hae; Blackburn, Elizabeth; Murphy, Edward L
2016-08-11
Short or damaged telomeres have been implicated in degenerative conditions. We hypothesized that analysis of telomere length (TL) in human T-cell lymphotropic virus (HTLV) infection and HTLV-associated neuropathy might provide clues to the etiology of HTLV-associated disease and viral dynamics. A subset of 45 human T-cell lymphotropic virus type 1 (HTLV-1), 45 human T-cell lymphotropic virus type 2 (HTLV-2), and 45 seronegative subjects was selected from the larger HTLV Outcomes Study (HOST) cohort, matched on age, sex and race/ethnicity. Telomere-to-single-copy gene (T/S) ratio (a measure of TL) and HTLV-1 and HTLV-2 proviral loads were measured in peripheral blood mononuclear cells (PBMCs) using quantitative PCR (qPCR). Vibration sensation measured by tuning fork during neurologic examinations performed as part of the HOST study allowed for an assessment of peripheral neuropathy. TL was compared between groups using t-tests, linear and logistic regression. Mean T/S ratio was 1.02 ± 0.16 in HTLV-1, 1.03 ± 0.17 in HTLV-2 and 0.99 ± 0.18 in HTLV seronegative subjects (p = 0.322). TL was not associated with HTLV-1 or -2 proviral load. Shorter TL was significantly associated with impaired vibration sense in the HTLV-2 positive group only. Overall, we found no evidence that telomere length was affected by chronic HTLV-1 and HTLV-2 infection. That TL was only associated with peripheral neuropathy in the HTLV-2-positive group is intriguing, but should be interpreted cautiously. Studies with larger sample size and telomere length measurement in lymphocyte subsets may clarify the relationship between TL and HTLV-infection.
Cruickshank, J K; Richardson, J H; Morgan, O S; Porter, J; Klenerman, P; Knight, J; Newell, A L; Rudge, P; Dalgleish, A G
1990-01-01
OBJECTIVE--To compare the prevalence of antibody to and proviral DNA of the retrovirus HTLV-I in relatives of 11 British patients with tropical spastic paraparesis who had migrated from Jamaica before they developed symptoms, and to examine factors possibly related to transmission of HTLV-I. DESIGN--Migrant, family study. Antibody state was determined by several methods and confirmed by western blotting; the polymerase chain reaction was used to detect proviral DNA. SETTING--Britain and Jamaica. SUBJECTS--All available first degree relatives: those born and still resident in Jamaica (group 1); those born in Jamaica who migrated to Britain (group 2); and index patients' children who were born and resident in Britain (group 3). All had been breast fed and none had had blood transfusions. RESULTS--Of the 66 living relatives, 60 were traced. Seroprevalence among those born in Jamaica (irrespective of current residence) was 22% (10/46; 95% confidence limits 9 to 34%) compared with zero among British born offspring (0/14) and was higher in group 2 at 33% (7/21; 12 to 55%) than in group 1 at 12% (3/25; 0 to 25%). (Patients in group 1 had the greatest mean age.) Proviral DNA was not detected in any subject negative for HTLV-I antibody, making prolonged viral incubation in those negative for the antibody unlikely. CONCLUSION--In this sample factors related to place of birth and early residence were more important in transmission of HTLV-I than maternal or age effects. In areas with a low to moderate prevalence policies of preventing mothers who are carriers of the virus from breast feeding would be premature. PMID:2106960
Martins, Marina Lobato; de Freitas Carneiro-Proietti, Anna Bárbara; Nicolato, Rodrigo; de Miranda, Débora Marques; Romanelli, Luiz Cláudio Ferreira
2018-03-27
An elevated human T cell leukemia virus type 1 (HTLV-1) proviral load (PVL) is an important risk factor for HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP), although there is a considerable frequency of asymptomatic carriers (AC) with high PVL in blood. Our objective was to evaluate whether PVL quantified in cerebrospinal fluid (CSF) is helpful to distinguish AC from HAM when AC have high PVL in blood (AC H ). AC H (n = 7) were characterized to have high PVL in blood by quantification of samples collected over time (mean 7 years). HAM patients (n = 14) also had analyzed blood samples collected at different times (mean 9 years). Comparing paired CSF and blood samples of each individual, CSF PVL mean was 4.7-fold higher than blood PVL in the AC H group and 10.8-fold in the HAM group. CSF PVL was significantly greater than blood PVL in the HAM group (p = 0.004), but not in the AC H group. Important to highlight, CSF PVL was not significantly different between the AC H and the HAM groups. These results suggested that significantly higher PVL in CSF than in blood is a hallmark of HAM/TSP patients, but this is also true for asymptomatic carriers with high PVL in blood, thus reducing its usefulness as a marker for HAM/TSP. A greater number of AC H should be analyzed, but whether they will eventually develop HAM/TSP or why they have not developed the disease are still questions to be clarified. Longitudinal studies are necessary to answer these questions.
Wiegand, Ann; Spindler, Jonathan; Hong, Feiyu F.; Shao, Wei; Cyktor, Joshua C.; Cillo, Anthony R.; Halvas, Elias K.; Coffin, John M.; Mellors, John W.; Kearney, Mary F.
2017-01-01
Little is known about the fraction of human immunodeficiency virus type 1 (HIV-1) proviruses that express unspliced viral RNA in vivo or about the levels of HIV RNA expression within single infected cells. We developed a sensitive cell-associated HIV RNA and DNA single-genome sequencing (CARD-SGS) method to investigate fractional proviral expression of HIV RNA (1.3-kb fragment of p6, protease, and reverse transcriptase) and the levels of HIV RNA in single HIV-infected cells from blood samples obtained from individuals with viremia or individuals on long-term suppressive antiretroviral therapy (ART). Spiking experiments show that the CARD-SGS method can detect a single cell expressing HIV RNA. Applying CARD-SGS to blood mononuclear cells in six samples from four HIV-infected donors (one with viremia and not on ART and three with viremia suppressed on ART) revealed that an average of 7% of proviruses (range: 2–18%) expressed HIV RNA. Levels of expression varied from one to 62 HIV RNA molecules per cell (median of 1). CARD-SGS also revealed the frequent expression of identical HIV RNA sequences across multiple single cells and across multiple time points in donors on suppressive ART consistent with constitutive expression of HIV RNA in infected cell clones. Defective proviruses were found to express HIV RNA at levels similar to those proviruses that had no obvious defects. CARD-SGS is a useful tool to characterize fractional proviral expression in single infected cells that persist despite ART and to assess the impact of experimental interventions on proviral populations and their expression. PMID:28416661
Bertine, Mélanie; Charpentier, Charlotte; Visseaux, Benoit; Storto, Alexandre; Collin, Gilles; Larrouy, Lucile; Damond, Florence; Matheron, Sophie; Brun-Vézinet, Françoise; Descamps, Diane
2015-04-24
In HIV-1, hypermutation introduced by APOBEC3F/3G cytidine deaminase activity leads to defective viruses. In-vivo impact of APOBEC3F/3G editing on HIV-2 sequences remains unknown. The objective of this study was to assess the level of APOBEC3F/3G editing in HIV-2-infected antiretroviral-naive patients. Direct sequencing of vif and pol regions was performed on HIV-2 proviral DNA from antiretroviral-naive patients included in the French Agence Nationale de Recherches sur le SIDA et les hépatites virales CO5 HIV-2 cohort. Hypermutated sequences were identified using Hypermut2.0 program. HIV-1 proviral sequences from Genbank were also assessed. Among 82 antiretroviral-naive HIV-2-infected patients assessed, 15 (28.8%) and five (16.7%) displayed Vif proviral defective sequences in HIV-2 groups A and B, respectively. A lower proportion of defective sequences was observed in protease-reverse transcriptase region. A higher median number of G-to-A mutations was observed in HIV-2 group B than in group A, both in Vif and protease-reverse transcriptase regions (P = 0.02 and P = 0.006, respectively). Compared with HIV-1 Vif sequences, a higher number of Vif defective sequences was observed in HIV-2 group A (P = 0.00001) and group B sequences (P = 0.013). We showed for the first time a high level of APOBEC3F/3G editing in HIV-2 sequences from antiretroviral-naive patients. Our study reported a group effect with a significantly higher level of APOBEC3F/3G editing in HIV-2 group B than in group A sequences.
Razooky, Brandon S.; Weinberger, Leor S.
2014-01-01
Upon infection of a CD4+ T cell, HIV-l appears to ‘choose’ between two alternate fates: active replication or a long-lived dormant statetermed proviral latency. A transcriptional positive-feedback loop generated by the HIV-l Tat protein appears sufficient to mediate this decision. Here, we describea coupled wet-lab and computational approach that uses mathematical modeling and live-cell time-lapse microscopy to map the architecture of the HIV-l Tat transcriptional regulatorycircuit and generate predictive models of HIV-l latency. This approach provided the first characterization of a ‘decision-making’ circuit that lacks bistability andinstead exploits stochastic fluctuations in cellular molecules (i.e. noise) to generate a decision between an on or off transcriptional state. PMID:21167940
Michalovova, M; Vyskot, B; Kejnovsky, E
2013-10-01
We analysed the size, relative age and chromosomal localization of nuclear sequences of plastid and mitochondrial origin (NUPTs-nuclear plastid DNA and NUMTs-nuclear mitochondrial DNA) in six completely sequenced plant species. We found that the largest insertions showed lower divergence from organelle DNA than shorter insertions in all species, indicating their recent origin. The largest NUPT and NUMT insertions were localized in the vicinity of the centromeres in the small genomes of Arabidopsis and rice. They were also present in other chromosomal regions in the large genomes of soybean and maize. Localization of NUPTs and NUMTs correlated positively with distribution of transposable elements (TEs) in Arabidopsis and sorghum, negatively in grapevine and soybean, and did not correlate in rice or maize. We propose a model where new plastid and mitochondrial DNA sequences are inserted close to centromeres and are later fragmented by TE insertions and reshuffled away from the centromere or removed by ectopic recombination. The mode and tempo of TE dynamism determines the turnover of NUPTs and NUMTs resulting in their species-specific chromosomal distributions.
Mayer, Jens; Tsangaras, Kyriakos; Heeger, Felix; Avila-Arcos, María; Stenglein, Mark D; Chen, Wei; Sun, Wei; Mazzoni, Camila J; Osterrieder, Nikolaus; Greenwood, Alex D
2013-08-15
Transcriptome analysis of polar bears (Ursus maritimus) yielded sequences with highest similarity to the human endogenous retrovirus group HERV-K(HML-2). Further analysis of the polar bear draft genome identified an endogenous betaretrovirus group comprising 26 proviral copies and 231 solo LTRs. Molecular dating indicates the group originated before the divergence of bears from a common ancestor but is not present in all carnivores. Closely related sequences were identified in the giant panda (Ailuropoda melanoleuca) and characterized from its genome. We have designated the polar bear and giant panda sequences U. maritimus endogenous retrovirus (UmaERV) and A. melanoleuca endogenous retrovirus (AmeERV), respectively. Phylogenetic analysis demonstrated that the bear virus group is nested within the HERV-K supergroup among bovine and bat endogenous retroviruses suggesting a complex evolutionary history within the HERV-K group. All individual remnants of proviral sequences contain numerous frameshifts and stop codons and thus, the virus is likely non-infectious. Copyright © 2013 Elsevier Inc. All rights reserved.
Mayer, Jens; Tsangaras, Kyriakos; Heeger, Felix; Ávila-Arcos, Maria; Stenglein, Mark D.; Chen, Wei; Sun, Wei; Mazzoni, Camila; Osterrieder, Nikolaus; Greenwood, Alex D.
2013-01-01
Transcriptome analysis of polar bears (Ursus maritimus) yielded sequences with highest similarity to the human endogenous retrovirus group HERV-K(HML-2). Further analysis of the polar bear draft genome identified an endogenous betaretrovirus group comprising 26 proviral copies and 231 solo LTRs. Molecular dating indicates the group originated before the divergence of bears from a common ancestor but is not present in all carnivores. Closely related sequences were identified in the giant panda (Ailuropoda melanoleuca) and characterized from its genome. We have designated the polar bear and giant panda sequences Ursus maritimus endogenous retrovirus (UmaERV) and Ailuropoda melanoleuca endogenous retrovirus (AmeERV), respectively. Phylogenetic analysis demonstrated that the bear virus group is nested within the HERV-K supergroup among bovine and bat endogenous retroviruses suggesting a complex evolutionary history within the HERV-K group. All individual remnants of proviral sequences contain numerous frameshifts and stop codons and thus, the virus is likely non-infectious. PMID:23725819
Negative Feedback Regulation of HIV-1 by Gene Editing Strategy.
Kaminski, Rafal; Chen, Yilan; Salkind, Julian; Bella, Ramona; Young, Won-Bin; Ferrante, Pasquale; Karn, Jonathan; Malcolm, Thomas; Hu, Wenhui; Khalili, Kamel
2016-08-16
The CRISPR/Cas9 gene editing method is comprised of the guide RNA (gRNA) to target a specific DNA sequence for cleavage and the Cas9 endonuclease for introducing breaks in the double-stranded DNA identified by the gRNA. Co-expression of both a multiplex of HIV-1-specific gRNAs and Cas9 in cells results in the modification and/or excision of the segment of viral DNA, leading to replication-defective virus. In this study, we have personalized the activity of CRISPR/Cas9 by placing the gene encoding Cas9 under the control of a minimal promoter of HIV-1 that is activated by the HIV-1 Tat protein. We demonstrate that functional activation of CRISPR/Cas9 by Tat during the course of viral infection excises the designated segment of the integrated viral DNA and consequently suppresses viral expression. This strategy was also used in a latently infected CD4+ T-cell model after treatment with a variety of HIV-1 stimulating agents including PMA and TSA. Controlled expression of Cas9 by Tat offers a new strategy for safe implementation of the Cas9 technology for ablation of HIV-1 at a very early stage of HIV-1 replication during the course of the acute phase of infection and the reactivation of silent proviral DNA in latently infected cells.
Bii, Victor M; Rae, Dustin T; Trobridge, Grant D
2015-11-24
Breast cancer (BC) is the second leading cause of malignancy among U.S. women. Metastasis results in a poor prognosis and increased mortality, but the molecular mechanisms by which metastatic tumors occur are not well understood. Identifying the genes that drive the metastatic process could provide targets for improved therapy and biomarkers to improve BC patient outcomes. Using a forward mutagenesis screen, BC cells mutagenized with a replication-incompetent gammaretroviral vector (γRV) were xenotransplanted into the mammary fat pad of immunodeficient mice. In this approach the vector provirus dysregulates nearby genes, providing a selective advantage to transduced cells to form metastases. Metastatic tumors were analyzed for proviral integration sites to identify nearby candidate metastasis genes. The γRV has a transgene cassette that allows for rescue in bacteria and rapid identification of vector integration sites. Using this approach, we identified the previously described metastasis gene WWTR1 (TAZ), and three other novel candidate metastasis genes including SHARPIN. SHARPIN was independently validated in vivo as a BC metastasis gene. Analysis of patient data showed that SHARPIN expression predicts metastasis-free survival after adjuvant therapy. Our approach has broad potential to identify genes involved in oncogenic processes for BC and other cancers. We show here it can identify both known (WWTR1) and novel (SHARPIN) BC metastasis genes.
Houang, Evelyne M; Bates, Frank S; Sham, Yuk Y; Metzger, Joseph M
2017-11-30
An all-atom phospholipid bilayer and triblock copolymer model was developed for molecular dynamics (MD) studies. These were performed to investigate the mechanism of interaction between membrane-stabilizing triblock copolymer P188 and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphatidylcholine (POPC) lipid bilayers under applied lateral surface tension (γ) to model membrane mechanical stress. Results showed that P188 insertion is driven by the hydrophobic poly(propylene oxide) (PPO) core and dependent on bilayer area per lipid. Moreover, insertion of P188 increased the bilayer's resistance to mechanical rupture, as observed by a significant increase in the absolute lateral pressure required to disrupt the bilayer. To further investigate the specific chemical features of P188 underlying membrane stabilizer function, a series of MD simulations with triblock copolymers of the same class as P188 but of varying chemical composition and sizes were performed. Results showed that triblock copolymer insertion into the lipid bilayer is dependent on overall copolymer hydrophobicity, with higher copolymer hydrophobicity requiring a reduced bilayer area per lipid ratio for insertion. Further analysis revealed that the effect of copolymer insertion on membrane mechanical integrity was also dependent on hydrophobicity. Here, P188 insertion significantly increased the absolute apparent lateral pressure required to rupture the POPC bilayer, thereby protecting the membrane against mechanical stress. In marked contrast, highly hydrophobic copolymers decreased the lateral pressure necessary for membrane rupture and thus rendering the membrane significantly more susceptible to mechanical stress. These new in silico findings align with recent experimental findings using synthetic lipid bilayers and in muscle cells in vitro and mouse models in vivo. Collectively, these data underscore the importance of PEO-PPO-PEO copolymer chemical composition in copolymer-based muscle membrane stabilization in vitro and in vivo. All-atom modeling with MD simulations holds promise for investigating novel copolymers with enhanced membrane interacting properties.
De Moura, Dref C; Bryksa, Brian C; Yada, Rickey Y
2014-01-01
The plant-specific insert is an approximately 100-residue domain found exclusively within the C-terminal lobe of some plant aspartic proteases. Structurally, this domain is a member of the saposin-like protein family, and is involved in plant pathogen defense as well as vacuolar targeting of the parent protease molecule. Similar to other members of the saposin-like protein family, most notably saposins A and C, the recently resolved crystal structure of potato (Solanum tuberosum) plant-specific insert has been shown to exist in a substrate-bound open conformation in which the plant-specific insert oligomerizes to form homodimers. In addition to the open structure, a closed conformation also exists having the classic saposin fold of the saposin-like protein family as observed in the crystal structure of barley (Hordeum vulgare L.) plant-specific insert. In the present study, the mechanisms of tertiary and quaternary conformation changes of potato plant-specific insert were investigated in silico as a function of pH. Umbrella sampling and determination of the free energy change of dissociation of the plant-specific insert homodimer revealed that increasing the pH of the system to near physiological levels reduced the free energy barrier to dissociation. Furthermore, principal component analysis was used to characterize conformational changes at both acidic and neutral pH. The results indicated that the plant-specific insert may adopt a tertiary structure similar to the characteristic saposin fold and suggest a potential new structural motif among saposin-like proteins. To our knowledge, this acidified PSI structure presents the first example of an alternative saposin-fold motif for any member of the large and diverse SAPLIP family.
De Moura, Dref C.; Bryksa, Brian C.; Yada, Rickey Y.
2014-01-01
The plant-specific insert is an approximately 100-residue domain found exclusively within the C-terminal lobe of some plant aspartic proteases. Structurally, this domain is a member of the saposin-like protein family, and is involved in plant pathogen defense as well as vacuolar targeting of the parent protease molecule. Similar to other members of the saposin-like protein family, most notably saposins A and C, the recently resolved crystal structure of potato (Solanum tuberosum) plant-specific insert has been shown to exist in a substrate-bound open conformation in which the plant-specific insert oligomerizes to form homodimers. In addition to the open structure, a closed conformation also exists having the classic saposin fold of the saposin-like protein family as observed in the crystal structure of barley (Hordeum vulgare L.) plant-specific insert. In the present study, the mechanisms of tertiary and quaternary conformation changes of potato plant-specific insert were investigated in silico as a function of pH. Umbrella sampling and determination of the free energy change of dissociation of the plant-specific insert homodimer revealed that increasing the pH of the system to near physiological levels reduced the free energy barrier to dissociation. Furthermore, principal component analysis was used to characterize conformational changes at both acidic and neutral pH. The results indicated that the plant-specific insert may adopt a tertiary structure similar to the characteristic saposin fold and suggest a potential new structural motif among saposin-like proteins. To our knowledge, this acidified PSI structure presents the first example of an alternative saposin-fold motif for any member of the large and diverse SAPLIP family. PMID:25188221
Tabor, Daniel P; Kusaka, Ryoji; Walsh, Patrick S; Sibert, Edwin L; Zwier, Timothy S
2015-05-21
The water hexamer and heptamer are the smallest sized water clusters that support three-dimensional hydrogen-bonded networks, with several competing structures that could be altered by interactions with a solute. Using infrared-ultraviolet double resonance spectroscopy, we record isomer-specific OH stretch infrared spectra of gas-phase benzene-(H2O)(6,7) clusters that demonstrate benzene's surprising role in reshaping (H2O)(6,7). The single observed isomer of benzene-(H2O)6 incorporates an inverted book structure rather than the cage or prism. The main conformer of benzene-(H2O)7 is an inserted-cubic structure in which benzene replaces one water molecule in the S4-symmetry cube of the water octamer, inserting itself into the water cluster by engaging as a π H-bond acceptor with one water and via C-H···O donor interactions with two others. The corresponding D(2d)-symmetry inserted-cube structure is not observed, consistent with the calculated energetic preference for the S4 over the D(2d) inserted cube. A reduced-dimension model that incorporates stretch-bend Fermi resonance accounts for the spectra in detail and sheds light on the hydrogen-bonding networks themselves and on the perturbations imposed on them by benzene.
Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.
Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia
2016-09-12
Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.
Abdullah, Kamarul A; McEntee, Mark F; Reed, Warren; Kench, Peter L
2018-04-30
An ideal organ-specific insert phantom should be able to simulate the anatomical features with appropriate appearances in the resultant computed tomography (CT) images. This study investigated a 3D printing technology to develop a novel and cost-effective cardiac insert phantom derived from volumetric CT image datasets of anthropomorphic chest phantom. Cardiac insert volumes were segmented from CT image datasets, derived from an anthropomorphic chest phantom of Lungman N-01 (Kyoto Kagaku, Japan). These segmented datasets were converted to a virtual 3D-isosurface of heart-shaped shell, while two other removable inserts were included using computer-aided design (CAD) software program. This newly designed cardiac insert phantom was later printed by using a fused deposition modelling (FDM) process via a Creatbot DM Plus 3D printer. Then, several selected filling materials, such as contrast media, oil, water and jelly, were loaded into designated spaces in the 3D-printed phantom. The 3D-printed cardiac insert phantom was positioned within the anthropomorphic chest phantom and 30 repeated CT acquisitions performed using a multi-detector scanner at 120-kVp tube potential. Attenuation (Hounsfield Unit, HU) values were measured and compared to the image datasets of real-patient and Catphan ® 500 phantom. The output of the 3D-printed cardiac insert phantom was a solid acrylic plastic material, which was strong, light in weight and cost-effective. HU values of the filling materials were comparable to the image datasets of real-patient and Catphan ® 500 phantom. A novel and cost-effective cardiac insert phantom for anthropomorphic chest phantom was developed using volumetric CT image datasets with a 3D printer. Hence, this suggested the printing methodology could be applied to generate other phantoms for CT imaging studies. © 2018 The Authors. Journal of Medical Radiation Sciences published by John Wiley & Sons Australia, Ltd on behalf of Australian Society of Medical Imaging and Radiation Therapy and New Zealand Institute of Medical Radiation Technology.
Envelope-specific antibodies and antibody-derived molecules for treating and curing HIV infection
Ferrari, Guido; Haynes, Barton F.; Koenig, Scott; Nordstrom, Jeffrey L.; Margolis, David M.; Tomaras, Georgia D.
2017-01-01
HIV-1 is a retrovirus that integrates into host chromatin and can remain transcriptionally quiescent in a pool of immune cells. This characteristic enables HIV-1 to evade both host immune responses and antiretroviral drugs, leading to persistent infection. Upon reactivation of proviral gene expression, HIV-1 envelope (HIV-1 Env) glycoproteins are expressed on the cell surface, transforming latently infected cells into targets for HIV-1 Env-specific monoclonal antibodies (mAbs), which can engage immune effector cells to kill productively infected CD4+ T cells and thus limit the spread of progeny virus. Recent innovations in antibody engineering have resulted in novel immunotherapeutics such as bispecific dual-affinity re-targeting (DART) molecules and other bi- and trispecific antibody designs that can recognize HIV-1 Env and recruit cytotoxic effector cells to kill CD4+ T cells latently infected with HIV‑1. Here, we review these immunotherapies, which are designed with the goal of curing HIV-1 infection. PMID:27725635
USDA-ARS?s Scientific Manuscript database
Small ruminant lentiviruses include members that infect sheep (ovine lentivirus [OvLV]; also known as ovine progressive pneumonia virus/maedi-visna virus) and goats (caprine arthritis encephalitis virus [CAEV]). Breed differences in seroprevalence and proviral concentration of OvLV had suggested a s...
Automated dental implantation using image-guided robotics: registration results.
Sun, Xiaoyan; McKenzie, Frederic D; Bawab, Sebastian; Li, Jiang; Yoon, Yongki; Huang, Jen-K
2011-09-01
One of the most important factors affecting the outcome of dental implantation is the accurate insertion of the implant into the patient's jaw bone, which requires a high degree of anatomical accuracy. With the accuracy and stability of robots, image-guided robotics is expected to provide more reliable and successful outcomes for dental implantation. Here, we proposed the use of a robot for drilling the implant site in preparation for the insertion of the implant. An image-guided robotic system for automated dental implantation is described in this paper. Patient-specific 3D models are reconstructed from preoperative Cone-beam CT images, and implantation planning is performed with these virtual models. A two-step registration procedure is applied to transform the preoperative plan of the implant insertion into intra-operative operations of the robot with the help of a Coordinate Measurement Machine (CMM). Experiments are carried out with a phantom that is generated from the patient-specific 3D model. Fiducial Registration Error (FRE) and Target Registration Error (TRE) values are calculated to evaluate the accuracy of the registration procedure. FRE values are less than 0.30 mm. Final TRE values after the two-step registration are 1.42 ± 0.70 mm (N = 5). The registration results of an automated dental implantation system using image-guided robotics are reported in this paper. Phantom experiments show that the practice of robot in the dental implantation is feasible and the system accuracy is comparable to other similar systems for dental implantation.
Papadimitroulas, P; Loudos, G; Le Maitre, A; Efthimiou, N; Visvikis, D; Nikiforidis, G; Kagadis, G C
2012-06-01
In the present study a patient-specific dataset of realistic PET simulations was created, taking into account the variability of clinical oncology data. Tumor variability was tested in the simulated results. A comparison of the produced simulated data was performed to clinical PET/CT data, for the validation and the evaluation of the procedure. Clinical PET/CT data of oncology patients were used as the basis of the simulated variability inserting patient-specific characteristics in the NCAT and the Zubal anthropomorphic phantoms. GATE Monte Carlo toolkit was used for simulating a commercial PET scanner. The standard computational anthropomorphic phantoms were adapted to the CT data (organ shapes), using a fitting algorithm. The activity map was derived from PET images. Patient tumors were segmented and inserted in the phantom, using different activity distributions. The produced simulated data were reconstructed using the STIR opensource software and compared to the original clinical ones. The accuracy of the procedure was tested in four different oncology cases. Each pathological situation was illustrated simulating a) a healthy body, b) insertion of the clinical tumor with homogenous activity, and c) insertion of the clinical tumor with variable activity (voxel-by-voxel) based on the clinical PET data. The accuracy of the presented dataset was compared to the original PET/CT data. Partial Volume Correction (PVC) was also applied in the simulated data. In this study patient-specific characteristics were used in computational anthropomorphic models for simulating realistic pathological patients. Voxel-by-voxel activity distribution with PVC within the tumor gives the most accurate results. Radiotherapy applications can utilize the benefits of the accurate realistic imaging simulations, using the anatomicaland biological information of each patient. Further work will incorporate the development of analytical anthropomorphic models with motion and cardiac correction, combined with pathological patients to achieve high accuracy in tumor imaging. This research was supported by the Joint Research and Technology Program between Greece and France; 2009-2011 (protocol ID: 09FR103). © 2012 American Association of Physicists in Medicine.
Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil
2017-10-27
Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes from the A and B subgenomes.
Surface expression of an immunodominant malaria protein B cell epitope by yellow fever virus.
Bonaldo, Myrna C; Garratt, Richard C; Caufour, Philippe S; Freire, Marcos S; Rodrigues, Mauricio M; Nussenzweig, Ruth S; Galler, Ricardo
2002-01-25
The yellow fever 17D virus (YF17D) has several characteristics that are desirable for the development of new, live attenuated vaccines. We approached its development as a vector for heterologous antigens by studying the expression of a humoral epitope at the surface of the E protein based on the results of modelling its three-dimensional structure. This model indicated that the most promising insertion site is between beta-strands f and g, a site that is exposed at the external surface of the virus. The large deletion of six residues from the fg loop of the E protein from yellow fever virus, compared to tick-born encephalitis virus, leaves space at the dimer interface for a large insertion without creating steric hindrance. We have tested this hypothesis by inserting a model humoral epitope from the circumsporozoite protein of Plasmodium falciparum consisting of triple NANP repeats. Recombinant virus (17D/8) expressing this insertion flanked by two glycine residues at each end, is specifically neutralized by a monoclonal antibody to the model epitope. Furthermore, mouse antibodies raised to the recombinant virus recognize the parasite protein in an ELISA assay. Serial passage analysis confirmed the genetic stability of the insertion made in the viral genome and the resulting 17D/8 virus is significantly more attenuated in mouse neurovirulence tests than the 17DD vaccine. The fg loop belongs to the dimerization domain of the E protein and lies at the interface between monomers. This domain undergoes a low pH transition, which is related to the fusion of the viral envelope to the endosome membrane. It is conceivable that a slower rate of fusion, resulting from the insertion close to the dimer interface, may delay the onset of virus production and thereby lead to a milder infection of the host. This would account for the more attenuated phenotype of the recombinant virus in the mouse model and lower extent of replication in cultured cells. The vectorial capacity of the yellow fever virus is being further explored for the expression and presentation of other epitopes, including those mediating T-cell responses. Copyright 2002 Academic Press.
Leal, Fabio E; Menezes, Soraya Maria; Costa, Emanuela A S; Brailey, Phillip M; Gama, Lucio; Segurado, Aluisio C; Kallas, Esper G; Nixon, Douglas F; Dierckx, Tim; Khouri, Ricardo; Vercauteren, Jurgen; Galvão-Castro, Bernardo; Saraiva Raposo, Rui Andre; Van Weyenbergh, Johan
2018-01-01
HTLV-1-Associated Myelopathy (HAM/TSP) is a progressive neuroinflammatory disorder for which no disease-modifying treatment exists. Modest clinical benefit from type I interferons (IFN-α/β) in HAM/TSP contrasts with its recently identified IFN-inducible gene signature. In addition, IFN-α treatment in vivo decreases proviral load and immune activation in HAM/TSP, whereas IFN-β therapy decreases tax mRNA and lymphoproliferation. We hypothesize this "IFN paradox" in HAM/TSP might be explained by both cell type- and gene-specific effects of type I IFN in HTLV-1-associated pathogenesis. Therefore, we analyzed ex vivo transcriptomes of CD4 + T cells, PBMCs and whole blood in healthy controls, HTLV-1-infected individuals, and HAM/TSP patients. First, we used a targeted approach, simultaneously quantifying HTLV-1 mRNA (HBZ, Tax), proviral load and 42 host genes with known antiretroviral (anti-HIV) activity in purified CD4 + T cells. This revealed two major clusters ("antiviral/protective" vs. "proviral/deleterious"), as evidenced by significant negative (TRIM5/TRIM22/BST2) vs. positive correlation (ISG15/PAF1/CDKN1A) with HTLV-1 viral markers and clinical status. Surprisingly, we found a significant inversion of antiretroviral activity of host restriction factors, as evidenced by opposite correlation to in vivo HIV-1 vs. HTLV-1 RNA levels. The anti-HTLV-1 effect of antiviral cluster genes was significantly correlated to their adaptive chimp/human evolution score, for both Tax mRNA and PVL. Six genes of the proposed antiviral cluster underwent lentivirus-driven purifying selection during primate evolution (TRIM5/TRIM22/BST2/APOBEC3F-G-H), underscoring the cross-retroviral evolutionary imprint. Secondly, we examined the genome-wide type I IFN response in HAM/TSP patients, following short-term ex vivo culture of PBMCs with either IFN-α or IFN-β. Microarray analysis evidenced 12 antiretroviral genes (including TRIM5α/TRIM22/BST2) were significantly up-regulated by IFN-β, but not IFN-α, in HAM/TSP. This was paralleled by a significant decrease in lymphoproliferation by IFN-β, but not IFN-α treatment. Finally, using published ex vivo whole blood transcriptomic data of independent cohorts, we validated the significant positive correlation between TRIM5, TRIM22, and BST2 in HTLV-1-infected individuals and HAM/TSP patients, which was independent of the HAM/TSP disease signature. In conclusion, our results provide ex vivo mechanistic evidence for the observed immunovirological effect of in vivo IFN-β treatment in HAM/TSP, reconcile an apparent IFN paradox in HTLV-1 research and identify biomarkers/targets for a precision medicine approach.
Leal, Fabio E.; Menezes, Soraya Maria; Costa, Emanuela A. S.; Brailey, Phillip M.; Gama, Lucio; Segurado, Aluisio C.; Kallas, Esper G.; Nixon, Douglas F.; Dierckx, Tim; Khouri, Ricardo; Vercauteren, Jurgen; Galvão-Castro, Bernardo; Saraiva Raposo, Rui Andre; Van Weyenbergh, Johan
2018-01-01
HTLV-1-Associated Myelopathy (HAM/TSP) is a progressive neuroinflammatory disorder for which no disease-modifying treatment exists. Modest clinical benefit from type I interferons (IFN-α/β) in HAM/TSP contrasts with its recently identified IFN-inducible gene signature. In addition, IFN-α treatment in vivo decreases proviral load and immune activation in HAM/TSP, whereas IFN-β therapy decreases tax mRNA and lymphoproliferation. We hypothesize this “IFN paradox” in HAM/TSP might be explained by both cell type- and gene-specific effects of type I IFN in HTLV-1-associated pathogenesis. Therefore, we analyzed ex vivo transcriptomes of CD4+ T cells, PBMCs and whole blood in healthy controls, HTLV-1-infected individuals, and HAM/TSP patients. First, we used a targeted approach, simultaneously quantifying HTLV-1 mRNA (HBZ, Tax), proviral load and 42 host genes with known antiretroviral (anti-HIV) activity in purified CD4+ T cells. This revealed two major clusters (“antiviral/protective” vs. “proviral/deleterious”), as evidenced by significant negative (TRIM5/TRIM22/BST2) vs. positive correlation (ISG15/PAF1/CDKN1A) with HTLV-1 viral markers and clinical status. Surprisingly, we found a significant inversion of antiretroviral activity of host restriction factors, as evidenced by opposite correlation to in vivo HIV-1 vs. HTLV-1 RNA levels. The anti-HTLV-1 effect of antiviral cluster genes was significantly correlated to their adaptive chimp/human evolution score, for both Tax mRNA and PVL. Six genes of the proposed antiviral cluster underwent lentivirus-driven purifying selection during primate evolution (TRIM5/TRIM22/BST2/APOBEC3F-G-H), underscoring the cross-retroviral evolutionary imprint. Secondly, we examined the genome-wide type I IFN response in HAM/TSP patients, following short-term ex vivo culture of PBMCs with either IFN-α or IFN-β. Microarray analysis evidenced 12 antiretroviral genes (including TRIM5α/TRIM22/BST2) were significantly up-regulated by IFN-β, but not IFN-α, in HAM/TSP. This was paralleled by a significant decrease in lymphoproliferation by IFN-β, but not IFN-α treatment. Finally, using published ex vivo whole blood transcriptomic data of independent cohorts, we validated the significant positive correlation between TRIM5, TRIM22, and BST2 in HTLV-1-infected individuals and HAM/TSP patients, which was independent of the HAM/TSP disease signature. In conclusion, our results provide ex vivo mechanistic evidence for the observed immunovirological effect of in vivo IFN-β treatment in HAM/TSP, reconcile an apparent IFN paradox in HTLV-1 research and identify biomarkers/targets for a precision medicine approach. PMID:29872426
Li, Haoyan; Liang, Yongqiang; Zheng, Qiang
2015-01-01
To evaluate correlations between marginal bone resorption and high insertion torque value (> 50 Ncm) of dental implants and to assess the significance of immediate and early/conventional loading of implants under a certain range torque value. Specific inclusion and exclusion criteria were used to retrieve eligible articles from Ovid, PubMed, and EBSCO up to December 2013. Screening of eligible studies, quality assessment, and data extraction were conducted in duplicate. The results were expressed as random/fixed-effects models using weighted mean differences for continuous outcomes with 95% confidence intervals. Initially, 154 articles were selected (11 from Ovid, 112 from PubMed, and 31 from EBSCO). After exclusion of duplicate articles and articles that did not meet the inclusion criteria, six clinical studies were selected. Assessment of P values revealed that correlations between marginal bone resorption and high insertion torque were not statistically significant and that there was no difference between immediately versus early/conventionally loaded implants under a certain range of torque. None of the meta-analyses revealed any statistically significant differences between high insertion torque and conventional insertion torque in terms of effects on marginal bone resorption.
Chromosomal localization of Emv-16 and Emv-17, two closely linked ecotropic proviruses of RF/J mice.
Buchberg, A M; Taylor, B A; Jenkins, N A; Copeland, N G
1986-01-01
Emv-16 and Emv-17, the two closely linked ecotropic proviral loci of RF/J mice, have been mapped to chromosome 1 between leaden, ln, and the mouse engrailed homeo-box locus, En-1, by using recombinant inbred strains and conventional backcross analysis. Images PMID:2878091
Influenza vaccination of HIV-1-positive and HIV-1-negative former intravenous drug users.
Amendola, A; Boschini, A; Colzani, D; Anselmi, G; Oltolina, A; Zucconi, R; Begnini, M; Besana, S; Tanzi, E; Zanetti, A R
2001-12-01
The immunogenicity of an anti-influenza vaccine was assessed in 409 former intravenous drug user volunteers and its effect on the levels of HIV-1 RNA, proviral DNA and on CD4+ lymphocyte counts in a subset HIV-1-positive subjects was measured. HIV-1-positive individuals (n = 72) were divided into three groups on the basis of their CD4+ lymphocyte counts, while the 337 HIV-1-negative participants were allocated into group four. Haemagglutination inhibiting (HI) responses varied from 45.8 to 70% in the HIV-1-positive subjects and were significantly higher in group four (80.7% responses to the H1N1 strain, 81.6% to the H3N2 strain, and 83% to the B strain). The percentage of subjects with HI protective antibody titres (> or = 1:40) increased significantly after vaccination, especially in HIV-1 uninfected subjects. Immunization caused no significant changes in CD4+ counts and in neither plasma HIV-1 RNA nor proviral DNA levels. Therefore, vaccination against influenza may benefit persons infected by HIV-1. Copyright 2001 Wiley-Liss, Inc.
De Nicola, Beatrice; Lech, Christopher J.; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N.; Phan, Anh Tuân
2016-01-01
The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. PMID:27298260
Lillis, Lorraine; Lehman, Dara A.; Siverson, Joshua B.; Weis, Julie; Cantera, Jason; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie; Boyle, David S.
2016-01-01
A low complexity diagnostic test that rapidly and reliably detects HIV infection in infants at the point of care could facilitate early treatment, improving outcomes. However, many infant HIV diagnostics can only be performed in laboratory settings. Recombinase polymerase amplification (RPA) is an isothermal amplification technology that can rapidly amplify proviral DNA from multiple subtypes of HIV-1 in under twenty minutes without complex equipment. In this study we added reverse transcription (RT) to RPA to allow detection of both HIV-1 RNA and DNA. We show that this RT-RPA HIV-1 assay has a limit of detection of 10 to 30 copies of an exact sequence matched DNA or RNA, respectively. In addition, at 100 copies of RNA or DNA, the assay detected 171 of 175 (97.7 %) sequence variants that represent all the major subtypes and recombinant forms of HIV-1 Groups M and O. This data suggests that the application of RT-RPA for the combined detection of HIV-1 viral RNA and proviral DNA may prove a highly sensitive tool for rapid and accurate diagnosis of infant HIV. PMID:26821087
Jousset, Florian; Maguy, Ange; Rohr, Stephan; Kucera, Jan P.
2016-01-01
Fibrotic myocardial remodeling is typically accompanied by the appearance of myofibroblasts (MFBs). In vitro, MFBs were shown to slow conduction and precipitate ectopic activity following gap junctional coupling to cardiomyocytes (CMCs). To gain further mechanistic insights into this arrhythmogenic MFB-CMC crosstalk, we performed numerical simulations in cell-based high-resolution two-dimensional tissue models that replicated experimental conditions. Cell dimensions were determined using confocal microscopy of single and co-cultured neonatal rat ventricular CMCs and MFBs. Conduction was investigated as a function of MFB density in three distinct cellular tissue architectures: CMC strands with endogenous MFBs, CMC strands with coating MFBs of two different sizes, and CMC strands with MFB inserts. Simulations were performed to identify individual contributions of heterocellular gap junctional coupling and of the specific electrical phenotype of MFBs. With increasing MFB density, both endogenous and coating MFBs slowed conduction. At MFB densities of 5–30%, conduction slowing was most pronounced in strands with endogenous MFBs due to the MFB-dependent increase in axial resistance. At MFB densities >40%, very slow conduction and spontaneous activity was primarily due to MFB-induced CMC depolarization. Coating MFBs caused non-uniformities of resting membrane potential, which were more prominent with large than with small MFBs. In simulations of MFB inserts connecting two CMC strands, conduction delays increased with increasing insert lengths and block appeared for inserts >1.2 mm. Thus, electrophysiological properties of engineered CMC-MFB co-cultures depend on MFB density, MFB size and their specific positioning in respect to CMCs. These factors may influence conduction characteristics in the heterocellular myocardium. PMID:27833567
Effect of vibration frequency on biopsy needle insertion force.
Tan, Lei; Qin, Xuemei; Zhang, Qinhe; Zhang, Hongcai; Dong, Hongjian; Guo, Tuodang; Liu, Guowei
2017-05-01
Needle insertion is critical in many clinical medicine procedures, such as biopsy, brachytherapy, and injection therapy. A platform with two degrees of freedom was set up to study the effect of vibration frequency on needle insertion force. The gel phantom deformation at the needle cutting edge and the Voigt model are utilized to develop a dynamic model to explain the relationship between the insertion force and needle-tip velocity. The accuracy of this model was verified by performing needle insertions into phantom gel. The effect of vibration on insertion force can be explained as the vibration increasing the needle-tip velocity and subsequently increasing the insertion force. In a series of needle insertion experiments with different vibration frequencies, the peak forces were selected for comparison to explore the effect of vibration frequency on needle insertion force. The experimental results indicate that the insertion force at 500Hz increases up to 17.9% compared with the force at 50Hz. Copyright © 2017 IPEM. Published by Elsevier Ltd. All rights reserved.
Multi-plug insole design to reduce peak plantar pressure on the diabetic foot during walking
Actis, Ricardo L.; Ventura, Liliana B.; Lott, Donovan J.; Smith, Kirk E.; Commean, Paul K.; Hastings, Mary K.; Mueller, Michael J.
2009-01-01
There is evidence that appropriate footwear is an important factor in the prevention of foot pain in otherwise healthy people or foot ulcers in people with diabetes and peripheral neuropathy. A standard care for reducing forefoot plantar pressure is the utilization of orthotic devices such as total contact inserts (TCI) with therapeutic footwear. Most neuropathic ulcers occur under the metatarsal heads, and foot deformity combined with high localized plantar pressure, appear to be the most significant factors contributing to these ulcers. In this study, patient-specific finite element models of the second ray of the foot were developed to study the influence of TCI design on peak plantar pressure (PPP) under the metatarsal heads. A typical full contact insert was modified based on the results of finite element analyses, by inserting 4 mm diameter cylindrical plugs of softer material in the regions of high pressure. Validation of the numerical model was addressed by comparing the numerical results obtained by the finite element method with measured pressure distribution in the region of the metatarsal heads for a shoe and TCI condition. Two subjects, one with a history of forefoot pain and one with diabetes and peripheral neuropathy, were tested in the laboratory while wearing therapeutic shoes and customized inserts. The study showed that customized inserts with softer plugs distributed throughout the regions of high plantar pressure reduced the PPP over that of the TCI alone. This supports the outcome as predicted by the numerical model, without causing edge effects as reported by other investigators using different plug designs, and provides a greater degree of flexibility for customizing orthotic devices than current practice allows. PMID:18266017
Multi-plug insole design to reduce peak plantar pressure on the diabetic foot during walking.
Actis, Ricardo L; Ventura, Liliana B; Lott, Donovan J; Smith, Kirk E; Commean, Paul K; Hastings, Mary K; Mueller, Michael J
2008-04-01
There is evidence that appropriate footwear is an important factor in the prevention of foot pain in otherwise healthy people or foot ulcers in people with diabetes and peripheral neuropathy. A standard care for reducing forefoot plantar pressure is the utilization of orthotic devices such as total contact inserts (TCI) with therapeutic footwear. Most neuropathic ulcers occur under the metatarsal heads, and foot deformity combined with high localized plantar pressure, appear to be the most significant factors contributing to these ulcers. In this study, patient-specific finite element models of the second ray of the foot were developed to study the influence of TCI design on peak plantar pressure (PPP) under the metatarsal heads. A typical full contact insert was modified based on the results of finite element analyses, by inserting 4 mm diameter cylindrical plugs of softer material in the regions of high pressure. Validation of the numerical model was addressed by comparing the numerical results obtained by the finite element method with measured pressure distribution in the region of the metatarsal heads for a shoe and TCI condition. Two subjects, one with a history of forefoot pain and one with diabetes and peripheral neuropathy, were tested in the laboratory while wearing therapeutic shoes and customized inserts. The study showed that customized inserts with softer plugs distributed throughout the regions of high plantar pressure reduced the PPP over that of the TCI alone. This supports the outcome as predicted by the numerical model, without causing edge effects as reported by other investigators using different plug designs, and provides a greater degree of flexibility for customizing orthotic devices than current practice allows.
Post-transplantation HTLV-1 myelopathy in three recipients from a single donor.
Zarranz Imirizaldu, J J; Gomez Esteban, J C; Rouco Axpe, I; Perez Concha, T; Velasco Juanes, F; Allue Susaeta, I; Corral Carranceja, J M
2003-08-01
This paper reports for the first time three cases of infection by HTLV-I via organ transplantation; all the organs coming from the same asymptomatic infected donor. The need is considered for the implementation of compulsory screenings for HTLV antibodies on organ donors and on blood banks. The determination of antibodies for HTLV-I/II on samples of serum and cerebral spinal fluid from the patients and the donor was performed by enzyme immunoassay and western blot. Analysis of proviral DNA was performed by polymerase chain reaction. To detect changes in the sequence of amino acids, the tax gene was sequentiated, amplified, and compared with ATK prototype stocks. Spinal cord magnetic resonance imaging, cerebral spinal fluid, and somatosensory evoked potential studies were carried out in all patients. All three transplanted patients developed a myelopathy within a very short period of time. In all three patients and donor the virus belonged to the Cosmopolitan A subtype. The homology of HTLV-I sequences recovered from the patients and donor was 100% in all four cases. Proviral load was high in all three patients. The factors that certainly contributed to the infection in the first place, and the development of the disease later, were on the one hand the high proviral load and their immunosuppressed condition, and on the other the virus genotype, which proved to be an aggressive variant. However, the analysis of the histocompatibility antigen showed that two of the patients carried an haplotype that has been associated with a lower risk of developing this disease. It is argued that, although in Spain and other European countries there is not compulsory screening for HTLV antibodies because of the studies that show a low seroprevalence, in view of the cases here reported, and to avoid the serious consequences that such infection has on transplanted patients, compulsory screenings, both on organ donors and on blood banks, should be implemented.
Medina, Fernando; Quintremil, Sebastián; Alberti, Carolina; Godoy, Fabián; Pando, María E; Bustamante, Andrés; Barriga, Andrés; Cartier, Luis; Puente, Javier; Tanaka, Yuetsu; Valenzuela, María A; Ramírez, Eugenio
2016-03-01
Human T-lymphotropic virus-type 1 (HTLV-1) is the etiologic agent of the neurologic disease HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). Tax viral protein plays a critical role in viral pathogenesis. Previous studies suggested that extracellular Tax might involve cytokine-like extracellular effects. We evaluated Tax secretion in 18 h-ex vivo peripheral blood mononuclear cells (PBMCs) cultures from 15 HAM/TSP patients and 15 asymptomatic carriers. Futhermore, Tax plasma level was evaluated from other 12 HAM/TSP patients and 10 asymptomatic carriers. Proviral load and mRNA encoding Tax were quantified by PCR and real-time RT-PCR, respectively. Intracellular Tax in CD4(+)CD25(+) cells occurred in 100% and 86.7% of HAM/TSP patients and asymptomatic carriers, respectively. Percentage of CD4(+)CD25(+) Tax+, proviral load and mRNA encoding Tax were significantly higher in HAM/TSP patients. Western blot analyses showed higher secretion levels of ubiquitinated Tax in HAM/TSP patients than in asymptomatic carriers. In HTLV-1-infected subjects, Western blot of plasma Tax showed higher levels in HAM/TSP patients than in asymptomatic carriers, whereas no Tax was found in non-infected subjects. Immunoprecipitated plasma Tax resolved on SDS-PAGE gave two major bands of 57 and 48 kDa allowing identification of Tax and Ubiquitin peptides by mass spectrometry. Relative percentage of either CD4(+)CD25(+) Tax+ cells, or Tax protein released from PBMCs, or plasma Tax, correlates neither with tax mRNA nor with proviral load. This fact could be explained by a complex regulation of Tax expression. Tax secreted from PBMCs or present in plasma could potentially become a biomarker to distinguish between HAM/TSP patients and asymptomatic carriers. © 2015 Wiley Periodicals, Inc.
Development of neurologic diseases in a patient with primate T lymphotropic virus type 1 (PTLV-1).
Enose-Akahata, Yoshimi; Caruso, Breanna; Haner, Benjamin; Charlip, Emily; Nair, Govind; Massoud, Raya; Billioux, Bridgette J; Ohayon, Joan; Switzer, William M; Jacobson, Steven
2016-08-12
Virus transmission from various wild and domestic animals contributes to an increased risk of emerging infectious diseases in human populations. HTLV-1 is a human retrovirus associated with acute T-cell leukemia and HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). HTLV-1 originated from ancient zoonotic transmission from nonhuman primates, although cases of zoonotic infections continue to occur. Similar to HTLV-1, the simian counterpart, STLV-1, causes chronic infection and leukemia and lymphoma in naturally infected monkeys, and combined are called primate T-lymphotropic viruses (PTLV-1). However, other clinical syndromes typically seen in humans such as a chronic progressive myelopathy have not been observed in nonhuman primates. Little is known about the development of neurologic and inflammatory diseases in human populations infected with STLV-1-like viruses following nonhuman primate exposure. We performed detailed laboratory analyses on an HTLV-1 seropositive patient with typical HAM/TSP who was born in Liberia and now resides in the United States. Using a novel droplet digital PCR for the detection of the HTLV-1 tax gene, the proviral load in PBMC and cerebrospinal fluid cells was 12.98 and 51.68 %, respectively; however, we observed a distinct difference in fluorescence amplitude of the positive droplet population suggesting possible mutations in proviral DNA. A complete PTLV-1 proviral genome was amplified from the patient's PBMC DNA using an overlapping PCR strategy. Phylogenetic analysis of the envelope and LTR sequences showed the virus was highly related to PTLV-1 from sooty mangabey monkeys (smm) and humans exposed via nonhuman primates in West Africa. These results demonstrate the patient is infected with a simian variant of PTLV-1, suggesting for the first time that PTLV-1smm infection in humans may be associated with a chronic progressive neurologic disease.
Mitsuya, H; Jarrett, R F; Cossman, J; Cohen, O J; Kao, C S; Guo, H G; Reitz, M S; Broder, S
1986-01-01
Human T lymphotropic virus-I (HTLV-I)-specific T cell lines were established and cloned. K5, an OKT8+ clone bearing multiple proviral integration sites, retained its HTLV-I-specific cytotoxicity and a normal dependence on interleukin 2 (IL-2), indicating that there is a finite number of transforming integration sites. R2, an OKT4+ HTLV-I-infected clone, initially mounted a proliferative response to HTLV-I; but then its IL-2-independent proliferation increased and the antigen specificity was lost. All HTLV-I-infected clones tested including K7, another OKT8+ transformed cytotoxic clone that had lost its reactivity, expressed comparable levels of T cell receptor beta-chain (TCR-beta) messenger (m)RNA. Although clones K5 and K7 had different functional properties, they had the same rearrangement of the TCR-beta gene, suggesting that they had the same clonal origin. These data indicate that HTLV-I-specific T cells retain their immune reactivity for variable periods of time following infection, but then usually lose it; in some cases, however, no alteration in function can be detected. The data also suggest that different consequences can take place in the same clone depending on the pattern of retroviral infection. Images PMID:2877011
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, R; Jee, K; Sharp, G
Purpose: Proton radiography, which images the patients with the same type of particles that they are to be treated with, is a promising approach for image guidance and range uncertainties reduction. This study aimed to realize quality proton radiography by measuring dose rate functions (DRF) in time domain using a single flat panel and retrieve water equivalent path length (WEPL) from them. Methods: An amorphous silicon flat panel (PaxScan™ 4030CB, Varian Medical Systems, Inc., Palo Alto, CA) was placed behind phantoms to measure DRFs from a proton beam modulated by the modulator wheel. To retrieve WEPL and RSP, calibration modelsmore » based on the intensity of DRFs only, root mean square (RMS) of DRFs only and the intensity weighted RMS were tested. The quality of obtained WEPL images (in terms of spatial resolution and level of details) and the accuracy of WEPL were compared. Results: RSPs for most of the Gammex phantom inserts were retrieved within ± 1% errors by calibration models based on the RMS and intensity weighted RMS. The mean percentage error for all inserts was reduced from 1.08% to 0.75% by matching intensity in the calibration model. In specific cases such as the insert with a titanium rod, the calibration model based on RMS only fails while the that based on intensity weighted RMS is still valid. The quality of retrieved WEPL images were significantly improved for calibration models including intensity matching. Conclusion: For the first time, a flat panel, which is readily available in the beamline for image guidance, was tested to acquire quality proton radiography with WEPL accurately retrieved from it. This technique is promising to be applied for image-guided proton therapy as well as patient specific RSP determination to reduce uncertainties of beam ranges.« less
Insertional engineering of chromosomes with Sleeping Beauty transposition: an overview.
Grabundzija, Ivana; Izsvák, Zsuzsanna; Ivics, Zoltán
2011-01-01
Novel genetic tools and mutagenesis strategies based on the Sleeping Beauty (SB) transposable element are currently under development with a vision to link primary DNA sequence information to gene functions in vertebrate models. By virtue of its inherent capacity to insert into DNA, the SB transposon can be developed into powerful tools for chromosomal manipulations. Mutagenesis screens based on SB have numerous advantages including high throughput and easy identification of mutated alleles. Forward genetic approaches based on insertional mutagenesis by engineered SB transposons have the advantage of providing insight into genetic networks and pathways based on phenotype. Indeed, the SB transposon has become a highly instrumental tool to induce tumors in experimental animals in a tissue-specific -manner with the aim of uncovering the genetic basis of diverse cancers. Here, we describe a battery of mutagenic cassettes that can be applied in conjunction with SB transposon vectors to mutagenize genes, and highlight versatile experimental strategies for the generation of engineered chromosomes for loss-of-function as well as gain-of-function mutagenesis for functional gene annotation in vertebrate models.
Long-term infection and vertical transmission of a gammaretrovirus in a foreign host species.
Sakuma, Toshie; Tonne, Jason M; Malcolm, Jessica A; Thatava, Tayaramma; Ohmine, Seiga; Peng, Kah-Whye; Ikeda, Yasuhiro
2012-01-01
Increasing evidence has indicated natural transspecies transmission of gammaretroviruses; however, viral-host interactions after initial xeno-exposure remain poorly understood. Potential association of xenotropic murine leukemia virus-related virus (XMRV) in patients with prostate cancer and chronic fatigue syndrome has attracted broad interests in this topic. Although recent studies have indicated that XMRV is unlikely a human pathogen, further understanding of XMRV xenoinfection would allow in vivo modeling of the initial steps of gammaretroviral interspecies transmission, evolution and dissemination in a new host population. In this study, we monitored the long-term consequences of XMRV infection and its possible vertical transmission in a permissive foreign host, wild-derived Mus pahari mice. One year post-infection, XMRV-infected mice showed no notable pathological changes, while proviral DNA was detected in three out of eight mice. XMRV-infected mice remained seropositive throughout the study although the levels of gp70 Env- and p30 capsid-specific antibodies gradually decreased. When vertical XMRV transmission was assessed, no viremia, humoral immune responses nor endogenization were observed in nine offspring from infected mothers, yet one offspring was found PCR-positive for XMRV-specific sequences. Amplified viral sequences from the offspring showed several mutations, including one amino acid deletion in the receptor binding domain of Env SU. Our results therefore demonstrate long-term asymptomatic infection, low incidence of vertical transmission and limited evolution of XMRV upon transspecies infection of a permissive new host, Mus pahari.
46 CFR 160.060-1 - Incorporation by reference.
Code of Federal Regulations, 2010 CFR
2010-10-01
...-1: Sheet 1—Cutting Pattern and General Arrangement, Model AY. Sheet 2—Cutting Pattern and General Arrangement, Model CYM. Sheet 3—Cutting Pattern and General Arrangement, Model CYS. Sheet 4—Insert Pattern, Model AY. Sheet 5—Insert Pattern, Model CYM. Sheet 6—Insert Pattern, Model CYS. (c) Copies on file...
Transposon tagging of genes for cell-cell interactions in Myxococcus xanthus.
Kalos, M; Zissler, J
1990-01-01
The prokaryote Myxococcus xanthus is a model for cell interactions important in multicellular behavior. We used the transposon TnphoA to specifically identify genes for cell-surface factors involved in cell interactions. From a library of 10,700 insertions of TnphoA, we isolated 36 that produced alkaline phosphatase activity. Three TnphoA insertions tagged cell motility genes, called cgl, which control the adventurous movement of cells. The products of the tagged cgl genes could function in trans upon other cells and were localized primarily in the cell envelope and extracellular space, consistent with TnphoA tagging genes for extracellular factors controlling motility. Images PMID:2172982
Systematic Functional Characterization of Resistance to PI3K Inhibition in Breast Cancer.
Le, Xiuning; Antony, Rajee; Razavi, Pedram; Treacy, Daniel J; Luo, Flora; Ghandi, Mahmoud; Castel, Pau; Scaltriti, Maurizio; Baselga, Jose; Garraway, Levi A
2016-10-01
PIK3CA (which encodes the PI3K alpha isoform) is the most frequently mutated oncogene in breast cancer. Small-molecule PI3K inhibitors have shown promise in clinical trials; however, intrinsic and acquired resistance limits their utility. We used a systematic gain-of-function approach to identify genes whose upregulation confers resistance to the PI3K inhibitor BYL719 in breast cancer cells. Among the validated resistance genes, Proviral Insertion site in Murine leukemia virus (PIM) kinases conferred resistance by maintaining downstream PI3K effector activation in an AKT-independent manner. Concurrent pharmacologic inhibition of PIM and PI3K overcame this resistance mechanism. We also observed increased PIM expression and activity in a subset of breast cancer biopsies with clinical resistance to PI3K inhibitors. PIM1 overexpression was mutually exclusive with PIK3CA mutation in treatment-naïve breast cancers, suggesting downstream functional redundancy. Together, these results offer new insights into resistance to PI3K inhibitors and support clinical studies of combined PIM/PI3K inhibition in a subset of PIK3CA-mutant cancers. PIM kinase overexpression confers resistance to small-molecule PI3K inhibitors. Combined inhibition of PIM and PI3K may therefore be warranted in a subset of breast cancers. Cancer Discov; 6(10); 1134-47. ©2016 AACR.This article is highlighted in the In This Issue feature, p. 1069. ©2016 American Association for Cancer Research.
USDA-ARS?s Scientific Manuscript database
Small ruminant lentivirus (SRLV), also called ovine progressive pneumonia virus or maedi-visna, is present in 24% of U.S. sheep. Like human immunodeficiency virus, SRLV is a macrophage-tropic lentivirus that causes lifelong infection. The production impacts from SRLV are due to a range of disease sy...
Arza, Elvira; Alvarez-Barrientos, Alberto; Fabregat, Isabel; Garcia-Bravo, Maria; Meza, Nestor W.; Segovia, Jose C.
2012-01-01
The fusion of bone marrow (BM) hematopoietic cells with hepatocytes to generate BM derived hepatocytes (BMDH) is a natural process, which is enhanced in damaged tissues. However, the reprogramming needed to generate BMDH and the identity of the resultant cells is essentially unknown. In a mouse model of chronic liver damage, here we identify a modification in the chromatin structure of the hematopoietic nucleus during BMDH formation, accompanied by the loss of the key hematopoietic transcription factor PU.1/Sfpi1 (SFFV proviral integration 1) and gain of the key hepatic transcriptional regulator HNF-1A homeobox A (HNF-1A/Hnf1a). Through genome-wide expression analysis of laser captured BMDH, a differential gene expression pattern was detected and the chromatin changes observed were confirmed at the level of chromatin regulator genes. Similarly, Tranforming Growth Factor-β1 (TGF-β1) and neurotransmitter (e.g. Prostaglandin E Receptor 4 [Ptger4]) pathway genes were over-expressed. In summary, in vivo BMDH generation is a process in which the hematopoietic cell nucleus changes its identity and acquires hepatic features. These BMDHs have their own cell identity characterized by an expression pattern different from hematopoietic cells or hepatocytes. The role of these BMDHs in the liver requires further investigation. PMID:22457803
Lago, M A; Rupérez, M J; Monserrat, C; Martínez-Martínez, F; Martínez-Sanchis, S; Larra, E; Díez-Ajenjo, M A; Peris-Martínez, C
2015-11-01
The purpose of this study was the simulation of the implantation of intrastromal corneal-ring segments for patients with keratoconus. The aim of the study was the prediction of the corneal curvature recovery after this intervention. Seven patients with keratoconus diagnosed and treated by implantation of intrastromal corneal-ring segments were enrolled in the study. The 3D geometry of the cornea of each patient was obtained from its specific topography and a hyperelastic model was assumed to characterize its mechanical behavior. To simulate the intervention, the intrastromal corneal-ring segments were modeled and placed at the same location at which they were placed in the surgery. The finite element method was then used to obtain a simulation of the deformation of the cornea after the ring segment insertion. Finally, the predicted curvature was compared with the real curvature after the intervention. The simulation of the ring segment insertion was validated comparing the curvature change with the data after the surgery. Results showed a flattening of the cornea which was in consonance with the real improvement of the corneal curvature. The mean difference obtained was of 0.74 mm using properties of healthy corneas. For the first time, a patient-specific model of the cornea has been used to predict the outcomes of the surgery after the intrastromal corneal-ring segments implantation in real patients. Copyright © 2015 Elsevier Ltd. All rights reserved.
Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers
2012-01-01
Background Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Results Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. Conclusions This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion. PMID:22541534
Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers.
Walker, Jerilyn A; Konkel, Miriam K; Ullmer, Brygg; Monceaux, Christopher P; Ryder, Oliver A; Hubley, Robert; Smit, Arian Fa; Batzer, Mark A
2012-04-30
Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion.
A stochastic evolution model for residue Insertion-Deletion Independent from Substitution.
Lèbre, Sophie; Michel, Christian J
2010-12-01
We develop here a new class of stochastic models of gene evolution based on residue Insertion-Deletion Independent from Substitution (IDIS). Indeed, in contrast to all existing evolution models, insertions and deletions are modeled here by a concept in population dynamics. Therefore, they are not only independent from each other, but also independent from the substitution process. After a separate stochastic analysis of the substitution and the insertion-deletion processes, we obtain a matrix differential equation combining these two processes defining the IDIS model. By deriving a general solution, we give an analytical expression of the residue occurrence probability at evolution time t as a function of a substitution rate matrix, an insertion rate vector, a deletion rate and an initial residue probability vector. Various mathematical properties of the IDIS model in relation with time t are derived: time scale, time step, time inversion and sequence length. Particular expressions of the nucleotide occurrence probability at time t are given for classical substitution rate matrices in various biological contexts: equal insertion rate, insertion-deletion only and substitution only. All these expressions can be directly used for biological evolutionary applications. The IDIS model shows a strongly different stochastic behavior from the classical substitution only model when compared on a gene dataset. Indeed, by considering three processes of residue insertion, deletion and substitution independently from each other, it allows a more realistic representation of gene evolution and opens new directions and applications in this research field. Copyright © 2010 Elsevier Ltd. All rights reserved.
FGF and TGFβ signaling link form and function during jaw development and evolution.
Woronowicz, Katherine C; Gline, Stephanie E; Herfat, Safa T; Fields, Aaron J; Schneider, Richard A
2018-05-16
How does form arise during development and change during evolution? How does form relate to function, and what enables embryonic structures to presage their later use in adults? To address these questions, we leverage the distinct functional morphology of the jaw in duck, chick, and quail. In connection with their specialized mode of feeding, duck develop a secondary cartilage at the tendon insertion of their jaw adductor muscle on the mandible. An equivalent cartilage is absent in chick and quail. We hypothesize that species-specific jaw architecture and mechanical forces promote secondary cartilage in duck through the differential regulation of FGF and TGFβ signaling. First, we perform transplants between chick and duck embryos and demonstrate that the ability of neural crest mesenchyme (NCM) to direct the species-specific insertion of muscle and the formation of secondary cartilage depends upon the amount and spatial distribution of NCM-derived connective tissues. Second, we quantify motility and build finite element models of the jaw complex in duck and quail, which reveals a link between species-specific jaw architecture and the predicted mechanical force environment. Third, we investigate the extent to which mechanical load mediates FGF and TGFβ signaling in the duck jaw adductor insertion, and discover that both pathways are mechano-responsive and required for secondary cartilage formation. Additionally, we find that FGF and TGFβ signaling can also induce secondary cartilage in the absence of mechanical force or in the adductor insertion of quail embryos. Thus, our results provide novel insights on molecular, cellular, and biomechanical mechanisms that couple musculoskeletal form and function during development and evolution. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Khadka, Bijendra; Gupta, Radhey S
2017-08-01
Homologs of the phosphatidylinositol-4-phosphate-5-kinase (PIP5K), which controls a multitude of essential cellular functions, contain a 8 aa insert in a conserved region that is specific for the Saccharomycetaceae family of fungi. Using structures of human PIP4K proteins as templates, structural models were generated of the Saccharomyces cerevisiae and human PIP5K proteins. In the modeled S. cerevisiae PIP5K, the 8 aa insert forms a surface exposed loop, present on the same face of the protein as the activation loop of the kinase domain. Electrostatic potential analysis indicates that the residues from 8 aa conserved loop form a highly positively charged surface patch, which through electrostatic interaction with the anionic portions of phospholipid head groups, is expected to play a role in the membrane interaction of the yeast PIP5K. To unravel this prediction, molecular dynamics (MD) simulations were carried out to examine the binding interaction of PIP5K, either containing or lacking the conserved signature insert, with two different membrane lipid bilayers. The results from MD studies provide insights concerning the mechanistic of interaction of PIP5K with lipid bilayer, and support the contention that the identified 8 aa conserved insert in fungal PIP5K plays an important role in the binding of this protein with membrane surface. Proteins 2017; 85:1454-1467. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Teaching project: a low-cost swine model for chest tube insertion training.
Netto, Fernando Antonio Campelo Spencer; Sommer, Camila Garcia; Constantino, Michael de Mello; Cardoso, Michel; Cipriani, Raphael Flávio Fachini; Pereira, Renan Augusto
2016-02-01
to describe and evaluate the acceptance of a low-cost chest tube insertion porcine model in a medical education project in the southwest of Paraná, Brazil. we developed a low-cost and low technology porcine model for teaching chest tube insertion and used it in a teaching project. Medical trainees - students and residents - received theoretical instructions about the procedure and performed thoracic drainage in this porcine model. After performing the procedure, the participants filled a feedback questionnaire about the proposed experimental model. This study presents the model and analyzes the questionnaire responses. seventy-nine medical trainees used and evaluated the model. The anatomical correlation between the porcine model and human anatomy was considered high and averaged 8.1±1.0 among trainees. All study participants approved the low-cost porcine model for chest tube insertion. the presented low-cost porcine model for chest tube insertion training was feasible and had good acceptability among trainees. This model has potential use as a teaching tool in medical education.
Carignano, H A; Beribe, M J; Caffaro, M E; Amadio, A; Nani, J P; Gutierrez, G; Alvarez, I; Trono, K; Miretti, M M; Poli, M A
2017-08-01
Bovine leukemia virus (BLV) infections, causing persistent lymphocytosis and lethal lymphosarcoma in cattle, have reached high endemicity on dairy farms. We observed extensive inter-individual variation in the level of infection (LI) by assessing differences in proviral load in peripheral blood. This phenotypic variation appears to be determined by host genetics variants, especially those located in the BoLA-DRB3 MHCII molecule. We performed an association study using sequencing-based typed BOLA-DRB3 alleles from over 800 Holstein and Holstein × Jersey cows considering LI in vivo and accounting for filial relationships. The DBR3*0902 allele was associated with a low level of infection (LLI) (<1% of circulating infected B-cells), whereas the DRB3*1001 and DRB3*1201 alleles were related to a high level of infection (HLI). We found evidence that 13 polymorphic positions located in the pockets of the peptide-binding cleft of the BOLA-DRB3 alleles were associated with LI. DRB3*0902 had unique haplotypes for each of the pockets: Ser 13 -Glu 70 -Arg 71 -Glu 74 (pocket 4), Ser 11 -Ser 30 (pocket 6), Glu 28 -Trp 61 -Arg 71 (pocket 7) and Asn 37 -Asp 57 (pocket 9), and all of them were significantly associated with LLI. Conversely, Lys 13 -Arg 70 -Ala 71 -Ala 74 and Ser 13 -Arg 70 -Ala 71 -Ala 74 , corresponding to the DRB3*1001 and *1201 alleles respectively, were associated with HLI. We showed that the specific amino acid pattern in the DRB3*0902 peptide-binding cleft may be related to the set point of a very low proviral load level in adult cows. Moreover, we identified two BOLA-DRB3 alleles associated with a HLI, which is compatible with a highly contagious profile. © 2017 Stichting International Foundation for Animal Genetics.
Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine
2010-06-18
Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.
3D kinematics of mobile-bearing total knee arthroplasty using X-ray fluoroscopy.
Yamazaki, Takaharu; Futai, Kazuma; Tomita, Tetsuya; Sato, Yoshinobu; Yoshikawa, Hideki; Tamura, Shinichi; Sugamoto, Kazuomi
2015-04-01
Total knee arthroplasty (TKA) 3D kinematic analysis requires 2D/3D image registration of X-ray fluoroscopic images and a computer-aided design (CAD) model of the knee implant. However, these techniques cannot provide information on the radiolucent polyethylene insert, since the insert silhouette does not appear clearly in X-ray images. Therefore, it is difficult to obtain the 3D kinematics of the polyethylene insert, particularly the mobile-bearing insert. A technique for 3D kinematic analysis of a mobile-bearing insert used in TKA was developed using X-ray fluoroscopy. The method was tested and a clinical application was evaluated. Tantalum beads and a CAD model of the mobile-bearing TKA insert are used for 3D pose estimation of the mobile-bearing insert used in TKA using X-ray fluoroscopy. The insert model was created using four identical tantalum beads precisely located at known positions in a polyethylene insert using a specially designed insertion device. Finally, the 3D pose of the insert model was estimated using a feature-based 2D/3D registration technique, using the silhouette of beads in fluoroscopic images and the corresponding CAD insert model. In vitro testing for the repeatability of the positioning of the tantalum beads and computer simulations for 3D pose estimation of the mobile-bearing insert were performed. The pose estimation accuracy achieved was sufficient for analyzing mobile-bearing TKA kinematics (RMS error: within 1.0 mm and 1.0°, except for medial-lateral translation). In a clinical application, nine patients with mobile-bearing TKA were investigated and analyzed with respect to a deep knee bending motion. A 3D kinematic analysis technique was developed that enables accurate quantitative evaluation of mobile-bearing TKA kinematics. This method may be useful for improving implant design and optimizing TKA surgical techniques.
Targeting specific azimuthal modes using wall changes in turbulent pipe flow
NASA Astrophysics Data System (ADS)
van Buren, Tyler; Hellström, Leo; Marusic, Ivan; Smits, Alexander
2017-11-01
We experimentally study turbulent pipe flow at Re =3486 using stereoscopic particle image velocimetry. Using pipe inserts with non-circular geometry to perturb the flow upstream of the measurement location, we excite specific naturally occurring energetic modes. We consider inserts that directly manipulate the flow momentum (vortex generators), and/or induce secondary flows through Reynolds stresses (sinusoidally varying wall shape). These inserts substantially change the mean flow, and produce distinct regions of low and high momentum corresponding to the mode being excited. The inserts add energy in the targeted modes while simultaneously reducing the energy in the non-excited azimuthal modes. In addition, inserts designed to excite two modes simultaneously exhibit non-linear interactions. Supported under ONR Grant N00014-15-1-2402, Program Manager/Director Thomas Fu and the Australian Research Council.
Thrasher, James F.; Davis, Rachel E.; Popova, Lucy; Cho, Yoo Jin; Salloum, Ramzi G.; Louviere, Jordan; Hammond, David
2018-01-01
This study assessed smokers’ responses to different smoking cessation topics and imagery for cigarette package inserts. Adult smokers from Canada (n = 1000) participated in three discrete choice experiments (DCEs): DCE 1 assessed five cessation benefit topics and five imagery types; DCE 2 assessed five messages with tips to improve cessation success and five imagery types; DCE 3 assessed four reproductive health benefits of cessation topics and four imagery types. In each DCE, participants evaluated four or five sets of four inserts, selecting the most and least motivating (DCEs 1 & 3) or helpful (DCE 2) for quitting. Linear mixed models regressed choices on insert and smoker characteristics. For DCE 1, the most motivating messages involved novel disease topics and imagery of younger women. For DCE 2, topics of social support, stress reduction and nicotine replacement therapy were selected as most helpful, with no differences by imagery type. For DCE 3, imagery influenced choices more than topic, with imagery of a family or a mom and baby selected as most motivating. Statistically significant interactions for all three experiments indicated that the influence of imagery type on choices depended on the message topic. Messages to promote smoking cessation through cigarette pack inserts should consider specific combinations of message topic and imagery. PMID:29415523
Chromatin Regulation and the Histone Code in HIV Latency .
Turner, Anne-Marie W; Margolis, David M
2017-06-01
The formation of a latent reservoir of Human Immunodeficiency Virus (HIV) infection hidden from immune clearance remains a significant obstacle to approaches to eradicate HIV infection. Towards an understanding of the mechanisms of HIV persistence, there is a growing body of work implicating epigenetic regulation of chromatin in establishment and maintenance of this latent reservoir. Here we discuss recent advances in the field of chromatin regulation, specifically in our understanding of the histone code, and how these discoveries relate to our current knowledge of the chromatin mechanisms linked to HIV transcriptional repression and the reversal of latency. We also examine mechanisms unexplored in the context of HIV latency and briefly discuss current therapies aimed at the induction of proviral expression within latently infected cells. We aim to emphasize that a greater understanding of the epigenetic mechanisms which govern HIV latency could lead to new therapeutic targets for latency reversal and clearance cure strategies.
Chromatin Regulation and the Histone Code in HIV Latency
Turner, Anne-Marie W.; Margolis, David M.
2017-01-01
The formation of a latent reservoir of Human Immunodeficiency Virus (HIV) infection hidden from immune clearance remains a significant obstacle to approaches to eradicate HIV infection. Towards an understanding of the mechanisms of HIV persistence, there is a growing body of work implicating epigenetic regulation of chromatin in establishment and maintenance of this latent reservoir. Here we discuss recent advances in the field of chromatin regulation, specifically in our understanding of the histone code, and how these discoveries relate to our current knowledge of the chromatin mechanisms linked to HIV transcriptional repression and the reversal of latency. We also examine mechanisms unexplored in the context of HIV latency and briefly discuss current therapies aimed at the induction of proviral expression within latently infected cells. We aim to emphasize that a greater understanding of the epigenetic mechanisms which govern HIV latency could lead to new therapeutic targets for latency reversal and clearance cure strategies. PMID:28656010
46 CFR 160.052-5 - Construction-standard vests.
Code of Federal Regulations, 2010 CFR
2010-10-01
...: SPECIFICATIONS AND APPROVAL LIFESAVING EQUIPMENT Specification for a Buoyant Vest, Unicellular Plastic Foam... arranged and distributed so as to provide the flotation characteristics and buoyancy required to hold the...) Buoyant inserts. The unicellular plastic foam buoyant inserts shall be cut and formed as shown on Dwg. 160...
Biopores/membrane proteins in synthetic polymer membranes.
Garni, Martina; Thamboo, Sagana; Schoenenberger, Cora-Ann; Palivan, Cornelia G
2017-04-01
Mimicking cell membranes by simple models based on the reconstitution of membrane proteins in lipid bilayers represents a straightforward approach to understand biological function of these proteins. This biomimetic strategy has been extended to synthetic membranes that have advantages in terms of chemical and mechanical stability, thus providing more robust hybrid membranes. We present here how membrane proteins and biopores have been inserted both in the membrane of nanosized and microsized compartments, and in planar membranes under various conditions. Such bio-hybrid membranes have new properties (as for example, permeability to ions/molecules), and functionality depending on the specificity of the inserted biomolecules. Interestingly, membrane proteins can be functionally inserted in synthetic membranes provided these have appropriate properties to overcome the high hydrophobic mismatch between the size of the biomolecule and the membrane thickness. Functional insertion of membrane proteins and biopores in synthetic membranes of compartments or in planar membranes is possible by an appropriate selection of the amphiphilic copolymers, and conditions of the self-assembly process. These hybrid membranes have new properties and functionality based on the specificity of the biomolecules and the nature of the synthetic membranes. Bio-hybrid membranes represent new solutions for the development of nanoreactors, artificial organelles or active surfaces/membranes that, by further gaining in complexity and functionality, will promote translational applications. This article is part of a Special Issue entitled: Lipid order/lipid defects and lipid-control of protein activity edited by Dirk Schneider. Copyright © 2016. Published by Elsevier B.V.
Chikobaeva, M G; Schatzl, H; Rose, D; Bush, U; Iakovleva, L A; Deinhardt, F; Helm, K; Lapin, B A
1993-01-01
Polymerase chain reaction (PCR) was developed for the detection of simian T-lymphotropic virus type 1 (STLV-1) infection of P. hamadryas and direct sequencing using oligo-nucleotide primer pairs specific for the tax and env regions of the related human T-lymphotropic virus type 1 (HTLV-1). Excellent specificity was shown in the detection of STLV-1 provirus in infected baboons by PCR using HTLV-1-derived primers. The nucleotide sequences of env 467bp and tax 159bp of the proviral genome (env position 5700-6137, tax position 7373-7498 HTLV-1, according to Seiki et al., 1983) derived from STLV-1-infected P. hamadryas were analysed using PCR and direct sequencing techniques. Two STLV-1 isolates from different sources (Sukhumi main-SuTLV-1 and forest stocks-STLV-1F) were compared. Two variants of STLV-1 among P. hamadryas with different level of homology to HTLV-1 were wound (83.8% and 95.2%, respectively). A possible role of nucleotide changes in env and tax sequenced fragments and oncogenicity of STLV-1 variants is discussed.
Shoe inserts and orthotics for sport and physical activities.
Nigg, B M; Nurse, M A; Stefanyshyn, D J
1999-07-01
The purposes of this paper were to discuss the perceived benefits of inserts and orthotics for sport activities and to propose a new concept for inserts and orthotics. There is evidence that inserts or orthotics reduce or prevent movement-related injuries. However, there is limited knowledge about the specific functioning an orthotic or insert provides. The same orthotic or insert is often proposed for different problems. Changes in skeletal movement due to inserts or orthotics seem to be small and not systematic. Based on the results of a study using bone pins, one may question the idea that a major function of orthotics or inserts consists in aligning the skeleton. Impact cushioning with shoe inserts or orthotics is typically below 10%. Such small reductions might not be important for injury reduction. It has been suggested that changes in material properties might produce adjustments in the muscular response of the locomotor system. The foot has various sensors to detect input signals with subject specific thresholds. Subjects with similar sensitivity threshold levels seem to respond in their movement pattern in a similar way. Comfort is an important variable. From a biomechanical point of view, comfort may be related to fit, additional stabilizing muscle work, fatigue, and damping of soft tissue vibrations. Based on the presented evidence, the concept of minimizing muscle work is proposed when using orthotics or inserts. A force signal acts as an input variable on the shoe. The shoe sole acts as a first filter, the insert or orthotic as a second filter, the plantar surface of the foot as a third filter for the force input signal. The filtered information is transferred to the central nervous system that provides a subject specific dynamic response. The subject performs the movement for the task at hand. For a given movement task, the skeleton has a preferred path. If an intervention supports/counteracts the preferred movement path, muscle activity can/must be reduced/increased. Based on this concept, an optimal insert or orthotic would reduce muscle activity, feel comfortable, and should increase performance.
A generalized reconstruction framework for unconventional PET systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mathews, Aswin John, E-mail: amathews@wustl.edu; Li, Ke; O’Sullivan, Joseph A.
2015-08-15
Purpose: Quantitative estimation of the radionuclide activity concentration in positron emission tomography (PET) requires precise modeling of PET physics. The authors are focused on designing unconventional PET geometries for specific applications. This work reports the creation of a generalized reconstruction framework, capable of reconstructing tomographic PET data for systems that use right cuboidal detector elements positioned at arbitrary geometry using a regular Cartesian grid of image voxels. Methods: The authors report on a variety of design choices and optimization for the creation of the generalized framework. The image reconstruction algorithm is maximum likelihood-expectation–maximization. System geometry can be specified using amore » simple script. Given the geometry, a symmetry seeking algorithm finds existing symmetry in the geometry with respect to the image grid to improve the memory usage/speed. Normalization is approached from a geometry independent perspective. The system matrix is computed using the Siddon’s algorithm and subcrystal approach. The program is parallelized through open multiprocessing and message passing interface libraries. A wide variety of systems can be modeled using the framework. This is made possible by modeling the underlying physics and data correction, while generalizing the geometry dependent features. Results: Application of the framework for three novel PET systems, each designed for a specific application, is presented to demonstrate the robustness of the framework in modeling PET systems of unconventional geometry. Three PET systems of unconventional geometry are studied. (1) Virtual-pinhole half-ring insert integrated into Biograph-40: although the insert device improves image quality over conventional whole-body scanner, the image quality varies depending on the position of the insert and the object. (2) Virtual-pinhole flat-panel insert integrated into Biograph-40: preliminary results from an investigation into a modular flat-panel insert are presented. (3) Plant PET system: a reconfigurable PET system for imaging plants, with resolution of greater than 3.3 mm, is shown. Using the automated symmetry seeking algorithm, the authors achieved a compression ratio of the storage and memory requirement by a factor of approximately 50 for the half-ring and flat-panel systems. For plant PET system, the compression ratio is approximately five. The ratio depends on the level of symmetry that exists in different geometries. Conclusions: This work brings the field closer to arbitrary geometry reconstruction. A generalized reconstruction framework can be used to validate multiple hypotheses and the effort required to investigate each system is reduced. Memory usage/speed can be improved with certain optimizations.« less
A generalized reconstruction framework for unconventional PET systems.
Mathews, Aswin John; Li, Ke; Komarov, Sergey; Wang, Qiang; Ravindranath, Bosky; O'Sullivan, Joseph A; Tai, Yuan-Chuan
2015-08-01
Quantitative estimation of the radionuclide activity concentration in positron emission tomography (PET) requires precise modeling of PET physics. The authors are focused on designing unconventional PET geometries for specific applications. This work reports the creation of a generalized reconstruction framework, capable of reconstructing tomographic PET data for systems that use right cuboidal detector elements positioned at arbitrary geometry using a regular Cartesian grid of image voxels. The authors report on a variety of design choices and optimization for the creation of the generalized framework. The image reconstruction algorithm is maximum likelihood-expectation-maximization. System geometry can be specified using a simple script. Given the geometry, a symmetry seeking algorithm finds existing symmetry in the geometry with respect to the image grid to improve the memory usage/speed. Normalization is approached from a geometry independent perspective. The system matrix is computed using the Siddon's algorithm and subcrystal approach. The program is parallelized through open multiprocessing and message passing interface libraries. A wide variety of systems can be modeled using the framework. This is made possible by modeling the underlying physics and data correction, while generalizing the geometry dependent features. Application of the framework for three novel PET systems, each designed for a specific application, is presented to demonstrate the robustness of the framework in modeling PET systems of unconventional geometry. Three PET systems of unconventional geometry are studied. (1) Virtual-pinhole half-ring insert integrated into Biograph-40: although the insert device improves image quality over conventional whole-body scanner, the image quality varies depending on the position of the insert and the object. (2) Virtual-pinhole flat-panel insert integrated into Biograph-40: preliminary results from an investigation into a modular flat-panel insert are presented. (3) Plant PET system: a reconfigurable PET system for imaging plants, with resolution of greater than 3.3 mm, is shown. Using the automated symmetry seeking algorithm, the authors achieved a compression ratio of the storage and memory requirement by a factor of approximately 50 for the half-ring and flat-panel systems. For plant PET system, the compression ratio is approximately five. The ratio depends on the level of symmetry that exists in different geometries. This work brings the field closer to arbitrary geometry reconstruction. A generalized reconstruction framework can be used to validate multiple hypotheses and the effort required to investigate each system is reduced. Memory usage/speed can be improved with certain optimizations.
A generalized reconstruction framework for unconventional PET systems
Mathews, Aswin John; Li, Ke; Komarov, Sergey; Wang, Qiang; Ravindranath, Bosky; O’Sullivan, Joseph A.; Tai, Yuan-Chuan
2015-01-01
Purpose: Quantitative estimation of the radionuclide activity concentration in positron emission tomography (PET) requires precise modeling of PET physics. The authors are focused on designing unconventional PET geometries for specific applications. This work reports the creation of a generalized reconstruction framework, capable of reconstructing tomographic PET data for systems that use right cuboidal detector elements positioned at arbitrary geometry using a regular Cartesian grid of image voxels. Methods: The authors report on a variety of design choices and optimization for the creation of the generalized framework. The image reconstruction algorithm is maximum likelihood-expectation–maximization. System geometry can be specified using a simple script. Given the geometry, a symmetry seeking algorithm finds existing symmetry in the geometry with respect to the image grid to improve the memory usage/speed. Normalization is approached from a geometry independent perspective. The system matrix is computed using the Siddon’s algorithm and subcrystal approach. The program is parallelized through open multiprocessing and message passing interface libraries. A wide variety of systems can be modeled using the framework. This is made possible by modeling the underlying physics and data correction, while generalizing the geometry dependent features. Results: Application of the framework for three novel PET systems, each designed for a specific application, is presented to demonstrate the robustness of the framework in modeling PET systems of unconventional geometry. Three PET systems of unconventional geometry are studied. (1) Virtual-pinhole half-ring insert integrated into Biograph-40: although the insert device improves image quality over conventional whole-body scanner, the image quality varies depending on the position of the insert and the object. (2) Virtual-pinhole flat-panel insert integrated into Biograph-40: preliminary results from an investigation into a modular flat-panel insert are presented. (3) Plant PET system: a reconfigurable PET system for imaging plants, with resolution of greater than 3.3 mm, is shown. Using the automated symmetry seeking algorithm, the authors achieved a compression ratio of the storage and memory requirement by a factor of approximately 50 for the half-ring and flat-panel systems. For plant PET system, the compression ratio is approximately five. The ratio depends on the level of symmetry that exists in different geometries. Conclusions: This work brings the field closer to arbitrary geometry reconstruction. A generalized reconstruction framework can be used to validate multiple hypotheses and the effort required to investigate each system is reduced. Memory usage/speed can be improved with certain optimizations. PMID:26233187
Double control systems for human T-cell leukemia virus type 1 by innate and acquired immunity.
Kannagi, Mari; Hasegawa, Atsuhiko; Kinpara, Shuichi; Shimizu, Yukiko; Takamori, Ayako; Utsunomiya, Atae
2011-04-01
Human T-cell leukemia virus type 1 (HTLV-1) is the causative retrovirus of adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). HTLV-1-specific T-cell responses elicit antitumor and antiviral effects in experimental models, and are considered to be one of the most important determinants of the disease manifestation, since they are activated in HAM/TSP but not in ATL patients. The combination of low T-cell responses and elevated HTLV-1 proviral loads are features of ATL, and are also observed in a subpopulation of HTLV-1 carriers at the asymptomatic stage, suggesting that these features may be underlying risk factors. These risks may potentially be reduced by vaccination to activate HTLV-1-specific T-cell responses. HAM/TSP and ATL patients also differ in their levels of HTLV-1 mRNA expression, which are generally low in vivo but slightly higher in HAM/TSP patients. Our recent study indicated that viral expression in HTLV-1-infected T-cells is suppressed by stromal cells in culture through type-I IFNs. The suppression was reversible after isolation from the stromal cells, mimicking a long-standing puzzling phenomenon in HTLV-1 infection where the viral expression is very low in vivo and rapidly induced in vitro. Collectively, HTLV-1 is controlled by both acquired and innate immunity in vivo: HTLV-1-specific T-cells survey infected cells, and IFNs suppress viral expression. Both effects would contribute to a reduction in viral pathogenesis, although they may potentially influence or conflict with one another. The presence of double control systems for HTLV-1 infection provides a new concept for understanding the pathogenesis of HTLV-1-mediated malignant and inflammatory diseases. © 2011 Japanese Cancer Association.
Kaneyama, Shuichi; Sugawara, Taku; Sumi, Masatoshi
2015-03-15
Clinical trial for midcervical pedicle screw insertion using a novel patient-specific intraoperative screw guiding device. To evaluate the availability of the "Screw Guide Template" (SGT) system for insertion of midcervical pedicle screws. Despite many efforts for accurate midcervical pedicle screw insertion, there still remain unacceptable rate of screw malpositioning that might cause neurovascular injuries. We developed patient-specific SGT system for safe and accurate intraoperative screw navigation tool and have reported its availability for the screw insertion to C2 vertebra and thoracic spine. Preoperatively, the bone image on computed tomography was analyzed and the trajectories of the screws were designed in 3-dimensional format. Three types of templates were created for each lamina: location template, drill guide template, and screw guide template. During the operations, after engaging the templates directly with the laminae, drilling, tapping, and screwing were performed with each template. We placed 80 midcervical pedicle screws for 20 patients. The accuracy and safety of the screw insertion by SGT system were evaluated using postoperative computed tomographic scan by calculation of screw deviation from the preplanned trajectory and evaluation of screw breach of pedicle wall. All templates fitted the laminae and screw navigation procedures proceeded uneventfully. All screws were inserted accurately with the mean screw deviation from planned trajectory of 0.29 ± 0.31 mm and no neurovascular complication was experienced. We demonstrated that our SGT system could support the precise screw insertion in midcervical pedicle. SGT prescribes the safe screw trajectory in a 3-dimensional manner and the templates fit and lock directly to the target laminae, which prevents screwing error along with the change of spinal alignment during the surgery. These advantages of the SGT system guarantee the high accuracy in screw insertion, which allowed surgeons to insert cervical pedicle screws safely. 3.
Experimental investigation of the noise reduction of supersonic exhaust jets with fluidic inserts
NASA Astrophysics Data System (ADS)
Powers, Russell William Walter
The noise produced by the supersonic, high temperature jets that exhaust from military aircraft is becoming a hazard to naval personnel and a disturbance to communities near military bases. Methods to reduce the noise produced from these jets in a practical full-scale environment are difficult. The development and analysis of distributed nozzle blowing for the reduction of radiated noise from supersonic jets is described. Model scale experiments of jets that simulate the exhaust jets from typical low-bypass ratio military jet aircraft engines during takeoff are performed. Fluidic inserts are created that use distributed blowing in the divergent section of the nozzle to simulate mechanical, hardwall corrugations, while having the advantage of being an active control method. This research focuses on model scale experiments to better understand the fluidic insert noise reduction method. Distributed blowing within the divergent section of the military-style convergent divergent nozzle alters the shock structure of the jet in addition to creating streamwise vorticity for the reduction of mixing noise. Enhancements to the fluidic insert design have been performed along with experiments over a large number of injection parameters and core jet conditions. Primarily military-style round nozzles have been used, with preliminary measurements of hardwall corrugations and fluidic inserts in rectangular nozzle geometries also performed. It has been shown that the noise reduction of the fluidic inserts is most heavily dependent upon the momentum flux ratio between the injector and core jet. Maximum reductions of approximately 5.5 dB OASPL have been observed with practical mass flow rates and injection pressures. The first measurements with fluidic inserts in the presence of a forward flight stream have been performed. Optimal noise reduction occurs at similar injector parameters in the presence of forward flight. Fluidic inserts in the presence of a forward flight stream were observed to reduce the peak mixing noise below the already reduced levels by nearly 4 dB OASP and the broadband shock-associated noise by nearly 3 dB OASP. Unsteady velocity measurements are used to complement acoustic results of jets with fluidic inserts. Measured axial turbulence intensities and mean axial velocity are examined to illuminate the differences in the flow field from jets with fluidic inserts. Comparisons of laser Doppler measurements with RANS CFD simulations are shown with good agreement. Analysis of the effect of spatial turbulence on the measured quantities is performed. Experimental model scale measurements of jets with and without fluidic inserts over a simulated carrier deck are presented. The model carrier environment consists of a ground plane of adjustable distance below the jet, and a simulated jet blast deflector similar to those found in practice. Measurements are performed with far-field microphones, near-field microphones, and unsteady pressure sensors. The constructive and destructive interference that results from the interaction of the direct and reflected sound waves is observed and compared with results from free jets. The noise reduction of fluidic inserts in a realistic carrier deck environment with steering of the "quiet planes" is examined. The overall sound pressure level in heat-simulated jets is reduced by 3-5 dB depending on the specific angle and ground plane height. Jets impinging upon a modeled jet blast deflector are tested in addition to jets solely in the presence of the carrier deck. Observed modifications to the acoustic field from the presence of the jet blast deflector include downstream acoustic shielding and low frequency augmentation. The region of maximum noise radiation for heat-simulated jets from nozzles with fluidic inserts impinging on the jet blast deflector is reduced in overall sound pressure level by 4-7 dB. This region includes areas where aircraft carrier personnel are located. iv.
Localization of HTLV-I tax proviral DNA in mononuclear cells.
Zucker-Franklin, Dorothea; Pancake, Bette A; Najfeld, Vesna
2003-01-01
The tax sequence of HTLV-I is demonstrable in the skin and blood mononuclear cells of patients with mycosis fungoides, as well as in the mononuclear leukocytes of some healthy blood donors, but was not demonstrable when PCR/Southern analyses were carried out on preparations of high-molecular-weight genomic DNA. Therefore, it was postulated that tax DNA may not be integrated. To investigate this possibility fluorescence in situ hybridization was carried out on cells arrested in metaphase, using a probe containing the HTLV-I tax proviral DNA full-length open reading frame coding sequence. While metaphases prepared from C91PL cells, a cell line infected with HTLV-I, showed an abundance of chromosome-associated as well as extra-chromosomal signals, metaphases prepared with blood mononuclear cells from healthy tax sequence positive donors did not reveal any tax DNA associated with chromosomes. Such signals were readily detected extra-chromosomally. Although it has been demonstrated that transactivation of genes by gene products encoded by extra-chromosomal DNA may have nosocomial implications, whether transactivation by p40 tax generated from extra-chromosomal tax sequences is responsible for the development of neoplasia remains to be investigated.
2012-01-01
Background The Interleukin 28B (IL28B) rs12979860 polymorphisms was recently reported to be associated with the human T-cell leukemia virus type 1 (HTLV-1) proviral load (PvL) and the development of the HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). Methods In an attempt to examine this hypothesis, we assessed the association of the rs12979860 genotypes with HTLV-1 PvL levels and clinical status in 112 unrelated Brazilian subjects (81 HTLV-1 asymptomatic carriers, 24 individuals with HAM/TSP and 7 with Adult T cell Leukemia/Lymphoma (ATLL)). Results All 112 samples were successfully genotyped and their PvLs compared. Neither the homozygote TT nor the heterozygote CT mutations nor the combination genotypes (TT/CT) were associated with a greater PvL. We also observed no significant difference in allele distribution between asymptomatic carriers and patients with HTLV-1 associated HAM/TSP. Conclusions Our study failed to support the previously reported positive association between the IL28B rs12979860 polymorphisms and an increased risk of developing HAM/TSP in the Brazilian population. PMID:23259930
De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân
2016-07-27
The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pechenick Jowers, Tali; Featherstone, Rebecca J.; Reynolds, Danielle K.
2015-01-15
Vaccinia virus (VACV) is a large double-stranded DNA virus with a complex cytoplasmic replication cycle that exploits numerous cellular proteins. This work characterises the role of a proviral cellular protein, the small GTPase RAB1A, in VACV replication. Using siRNA, we identified RAB1A as required for the production of extracellular enveloped virions (EEVs), but not intracellular mature virions (IMVs). Immunofluorescence and electron microscopy further refined the role of RAB1A as facilitating the wrapping of IMVs to become intracellular enveloped virions (IEVs). This is consistent with the known function of RAB1A in maintenance of ER to Golgi transport. VACV can therefore bemore » added to the growing list of viruses which require RAB1A for optimal replication, highlighting this protein as a broadly proviral host factor. - Highlights: • Characterisation of the role of the small GTPase RAB1A in VACV replication. • RAB1A is not required for production of the primary virion form (IMV). • RAB1A is required for production of processed virion forms (IEVs, CEVs and EEVs). • Consistent with known role of RAB1A in ER to Golgi transport.« less
Lillis, Lorraine; Lehman, Dara A; Siverson, Joshua B; Weis, Julie; Cantera, Jason; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie; Boyle, David S
2016-04-01
A low complexity diagnostic test that rapidly and reliably detects HIV infection in infants at the point of care could facilitate early treatment, improving outcomes. However, many infant HIV diagnostics can only be performed in laboratory settings. Recombinase polymerase amplification (RPA) is an isothermal amplification technology that can rapidly amplify proviral DNA from multiple subtypes of HIV-1 in under twenty minutes without complex equipment. In this study we added reverse transcription (RT) to RPA to allow detection of both HIV-1 RNA and DNA. We show that this RT-RPA HIV-1 assay has a limit of detection of 10-30 copies of an exact sequence matched DNA or RNA, respectively. In addition, at 100 copies of RNA or DNA, the assay detected 171 of 175 (97.7%) sequence variants that represent all the major subtypes and recombinant forms of HIV-1 Groups M and O. This data suggests that the application of RT-RPA for the combined detection of HIV-1 viral RNA and proviral DNA may prove a highly sensitive tool for rapid and accurate diagnosis of infant HIV. Copyright © 2016 Elsevier B.V. All rights reserved.
Nguyen, Yann; Bernardeschi, Daniele; Kazmitcheff, Guillaume; Miroir, Mathieu; Vauchel, Thomas; Ferrary, Evelyne; Sterkers, Olivier
2015-02-01
Loading otoprotective drug into cochlear implant might change its mechanical properties, thus compromising atraumatic insertion. This study evaluated the effect of incorporation of dexamethasone (DXM) in the silicone of cochlear implant arrays on insertion forces. Local administration of DXM with embedded array can potentially reduce inflammation and fibrosis after cochlear implantation procedure to improve hearing preservation and reduce long-term impedances. Four models of arrays have been tested: 0.5-mm distal diameter array (n = 5) used as a control, drug-free 0.4-mm distal diameter array (n = 5), 0.4-mm distal diameter array with 1% eluded DXM silicone (n = 5), and 0.4-mm distal diameter array with 10% eluded DXM silicone (n = 5). Via a motorized insertion bench, each array has been inserted into an artificial scala tympani model. The forces were recorded by a 6-axis force sensor. Each array was tested seven times for a total number of 140 insertions. During the first 10-mm insertion, no difference between the four models was observed. From 10- to 24-mm insertion, the 0.5-mm distal diameter array presented higher insertion forces than the drug-free 0.4-mm distal diameter arrays, with or without DXM. Friction forces for drug-free 0.4-mm distal diameter array and 0.4-mm distal diameter DXM eluded arrays were similar on all insertion lengths. Incorporation of DXM in silicone for cochlear implant design does not change electrode array insertion forces. It does not raise the risk of trauma during array insertion, making it suitable for long-term in situ administration to the cochlea.
Effect of shoe inserts on kinematics, center of pressure, and leg joint moments during running.
Nigg, Benno M; Stergiou, Pro; Cole, Gerald; Stefanyshyn, Darren; Mündermann, Anne; Humble, Neil
2003-02-01
The purposes of this project were to assess the effect of four different shoe inserts on the path of the center of pressure (COP), to quantify the effect of these inserts on selected knee joint moments during running, and to assess the potential of COP data to predict the effects of inserts/orthotics on knee joint moments. Kinematics for the lower extremities, resultant ankle and knee joint moments, and the path of the COP were collected from the right foot of 15 male subjects while running heel-toe with five different shoe inserts (full or half with 4.5-mm postings). Individual movement changes with respect to the neutral insert condition were typically small and not systematic. Significant changes for the path of the COP were registered only for the full lateral insert condition with an average shift toward the lateral side. The mediolateral shift of the COP was not consistent for the full medial and the two half-shoe inserts. The subject-specific reactions to the inserts' intervention in the corresponding knee joint moments were typically not consistent. Compared with the neutral insert condition, subjects showed increases or decreases of the knee joint moments. The correlation between the individual COP shifts and the resultant knee joint moment was generally small. The results of this study showed that subject-specific reactions to the tested inserts were often not as expected. Additionally, reactions were not consistent between the subjects. This result suggests that the prescription of inserts and/or orthotics is a difficult task and that methods must be developed to test and assess these effects. Such methods, however, are not currently available.
Teleoperated master-slave needle insertion.
Abolhassani, Niki; Patel, Rajni V
2009-12-01
Accuracy of needle tip placement and needle tracking in soft tissue are of particular importance in many medical procedures. In recent years, developing autonomous and teleoperated systems for needle insertion has become an active area of research. In this study, needle insertion was performed using a master-slave set-up with multi-degrees of freedom. The effect of force feedback on the accuracy of needle insertion was investigated. In addition, this study compared autonomous, teleoperated and semi-autonomous needle insertion. The results of this study show that incorporation of force feedback can improve teleoperated needle insertion. However, autonomous and semi-autonomous needle insertions, which use feedback from a deflection model, provide significantly better performance. Development of a haptic master-slave needle insertion system, which is capable of performing some autonomous tasks based on feedback from tissue deformation and needle deflection models, can improve the performance of autonomous robotics-based insertions as well as non-autonomous teleoperated manual insertions. Copyright (c) 2009 John Wiley & Sons, Ltd.
Using PATIMDB to Create Bacterial Transposon Insertion Mutant Libraries
Urbach, Jonathan M.; Wei, Tao; Liberati, Nicole; Grenfell-Lee, Daniel; Villanueva, Jacinto; Wu, Gang; Ausubel, Frederick M.
2015-01-01
PATIMDB is a software package for facilitating the generation of transposon mutant insertion libraries. The software has two main functions: process tracking and automated sequence analysis. The process tracking function specifically includes recording the status and fates of multiwell plates and samples in various stages of library construction. Automated sequence analysis refers specifically to the pipeline of sequence analysis starting with ABI files from a sequencing facility and ending with insertion location identifications. The protocols in this unit describe installation and use of PATIMDB software. PMID:19343706
Van Maele, Bénédicte; De Rijck, Jan; De Clercq, Erik; Debyser, Zeger
2003-01-01
Lentiviral vectors derived from human immunodeficiency virus type 1 (HIV-1) show great promise as gene carriers for future gene therapy. Insertion of a fragment containing the central polypurine tract (cPPT) in HIV-1 vector constructs is known to enhance transduction efficiency drastically, reportedly by facilitating the nuclear import of HIV-1 cDNA through a central DNA flap. We have studied the impact of the cPPT on the kinetics of HIV-1 vector transduction by real-time PCR. The kinetics of total HIV-1 DNA, two-long-terminal-repeat (2-LTR) circles, and, by an Alu-PCR, integrated proviral DNA were monitored. About 6 to 12 h after transduction, the total HIV-1 DNA reached a maximum level, followed by a steep decrease. The 2-LTR circles peaked after 24 to 48 h and were diluted upon cell division. Integration of HIV-1 DNA was first detected at 12 h postinfection. When HIV-1 vectors that contained the cPPT were used, DNA synthesis was similar but a threefold higher amount of 2-LTR circles was detected, confirming the impact on nuclear import. Moreover, a 10-fold increase in the amount of integrated DNA was observed in the presence of the cPPT. Only in the absence of the cPPT was a saturation in 2-LTR circle formation seen at a high multiplicity of infection, suggesting a role for the cPPT in overcoming a barrier to the nuclear import of HIV-1 DNA. A major effect of the central DNA flap on the juxtaposition of both LTRs is unlikely, since transduction with HIV-1 vectors containing ectopic cPPT fragments resulted in increased amounts of 2-LTR circles as well as integrated DNA. Inhibitors of transduction by cPPT-containing HIV vectors were also studied by real-time PCR. The reverse transcriptase inhibitor azidothymidine (AZT) and the nonnucleoside reverse transcriptase inhibitor α-APA clearly inhibited viral DNA synthesis, whereas integrase inhibitors such as the diketo acid L-708,906 and the pyranodipyrimidine V-165 specifically inhibited integration. PMID:12663775
A proposed model membrane and test method for microneedle insertion studies.
Larrañeta, Eneko; Moore, Jessica; Vicente-Pérez, Eva M; González-Vázquez, Patricia; Lutton, Rebecca; Woolfson, A David; Donnelly, Ryan F
2014-09-10
A commercial polymeric film (Parafilm M(®), a blend of a hydrocarbon wax and a polyolefin) was evaluated as a model membrane for microneedle (MN) insertion studies. Polymeric MN arrays were inserted into Parafilm M(®) (PF) and also into excised neonatal porcine skin. Parafilm M(®) was folded before the insertions to closely approximate thickness of the excised skin. Insertion depths were evaluated using optical coherence tomography (OCT) using either a force applied by a Texture Analyser or by a group of human volunteers. The obtained insertion depths were, in general, slightly lower, especially for higher forces, for PF than for skin. However, this difference was not a large, being less than the 10% of the needle length. Therefore, all these data indicate that this model membrane could be a good alternative to biological tissue for MN insertion studies. As an alternative method to OCT, light microscopy was used to evaluate the insertion depths of MN in the model membrane. This provided a rapid, simple method to compare different MN formulations. The use of Parafilm M(®), in conjunction with a standardised force/time profile applied by a Texture Analyser, could provide the basis for a rapid MN quality control test suitable for in-process use. It could also be used as a comparative test of insertion efficiency between candidate MN formulations. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
46 CFR 160.052-5 - Construction-standard vests.
Code of Federal Regulations, 2011 CFR
2011-10-01
...) Buoyant inserts. The unicellular plastic foam buoyant inserts shall be cut and formed as shown on Dwg. 160...: SPECIFICATIONS AND APPROVAL LIFESAVING EQUIPMENT Specification for a Buoyant Vest, Unicellular Plastic Foam.... Two pieces of fabric shall be cut to the pattern shown on Dwg. No. 160.052-1, Sheet 1 for adult size...
46 CFR 160.052-5 - Construction-standard vests.
Code of Federal Regulations, 2012 CFR
2012-10-01
...) Buoyant inserts. The unicellular plastic foam buoyant inserts shall be cut and formed as shown on Dwg. 160...: SPECIFICATIONS AND APPROVAL LIFESAVING EQUIPMENT Specification for a Buoyant Vest, Unicellular Plastic Foam.... Two pieces of fabric shall be cut to the pattern shown on Dwg. No. 160.052-1, Sheet 1 for adult size...
46 CFR 160.052-5 - Construction-standard vests.
Code of Federal Regulations, 2014 CFR
2014-10-01
...) Buoyant inserts. The unicellular plastic foam buoyant inserts shall be cut and formed as shown on Dwg. 160...: SPECIFICATIONS AND APPROVAL LIFESAVING EQUIPMENT Specification for a Buoyant Vest, Unicellular Plastic Foam.... Two pieces of fabric shall be cut to the pattern shown on Dwg. No. 160.052-1, Sheet 1 for adult size...
46 CFR 160.052-5 - Construction-standard vests.
Code of Federal Regulations, 2013 CFR
2013-10-01
...) Buoyant inserts. The unicellular plastic foam buoyant inserts shall be cut and formed as shown on Dwg. 160...: SPECIFICATIONS AND APPROVAL LIFESAVING EQUIPMENT Specification for a Buoyant Vest, Unicellular Plastic Foam.... Two pieces of fabric shall be cut to the pattern shown on Dwg. No. 160.052-1, Sheet 1 for adult size...
Achievable accuracy of hip screw holding power estimation by insertion torque measurement.
Erani, Paolo; Baleani, Massimiliano
2018-02-01
To ensure stability of proximal femoral fractures, the hip screw must firmly engage into the femoral head. Some studies suggested that screw holding power into trabecular bone could be evaluated, intraoperatively, through measurement of screw insertion torque. However, those studies used synthetic bone, instead of trabecular bone, as host material or they did not evaluate accuracy of predictions. We determined prediction accuracy, also assessing the impact of screw design and host material. We measured, under highly-repeatable experimental conditions, disregarding clinical procedure complexities, insertion torque and pullout strength of four screw designs, both in 120 synthetic and 80 trabecular bone specimens of variable density. For both host materials, we calculated the root-mean-square error and the mean-absolute-percentage error of predictions based on the best fitting model of torque-pullout data, in both single-screw and merged dataset. Predictions based on screw-specific regression models were the most accurate. Host material impacts on prediction accuracy: the replacement of synthetic with trabecular bone decreased both root-mean-square errors, from 0.54 ÷ 0.76 kN to 0.21 ÷ 0.40 kN, and mean-absolute-percentage errors, from 14 ÷ 21% to 10 ÷ 12%. However, holding power predicted on low insertion torque remained inaccurate, with errors up to 40% for torques below 1 Nm. In poor-quality trabecular bone, tissue inhomogeneities likely affect pullout strength and insertion torque to different extents, limiting the predictive power of the latter. This bias decreases when the screw engages good-quality bone. Under this condition, predictions become more accurate although this result must be confirmed by close in-vitro simulation of the clinical procedure. Copyright © 2018 Elsevier Ltd. All rights reserved.
Transposable elements and insecticide resistance.
Rostant, Wayne G; Wedell, Nina; Hosken, David J
2012-01-01
Transposable elements (TEs) are mobile DNA sequences that are able to copy themselves within a host genome. They were initially characterized as selfish genes because of documented or presumed costs to host fitness, but it has become increasingly clear that not all TEs reduce host fitness. A good example of TEs benefiting hosts is seen with insecticide resistance, where in a number of cases, TE insertions near specific genes confer resistance to these man-made products. This is particularly true of Accord and associated TEs in Drosophila melanogaster and Doc insertions in Drosophila simulans. The first of these insertions also has sexually antagonistic fitness effects in the absence of insecticides, and although the magnitude of this effect depends on the genetic background in which Accord finds itself, this represents an excellent example of intralocus sexual conflict where the precise allele involved is well characterized. We discuss this finding and the role of TEs in insecticide resistance. We also highlight areas for further research, including the need for surveys of the prevalence and fitness consequences of the Doc insertion and how Drosophila can be used as models to investigate resistance in pest species. Copyright © 2012 Elsevier Inc. All rights reserved.
New class of two-loop neutrino mass models with distinguishable phenomenology
NASA Astrophysics Data System (ADS)
Cao, Qing-Hong; Chen, Shao-Long; Ma, Ernest; Yan, Bin; Zhang, Dong-Ming
2018-04-01
We discuss a new class of neutrino mass models generated in two loops, and explore specifically three new physics scenarios: (A) doubly charged scalar, (B) dark matter, and (C) leptoquark and diquark, which are verifiable at the 14 TeV LHC Run-II. We point out how the different Higgs insertions will distinguish our two-loop topology with others if the new particles in the loop are in the simplest representations of the SM gauge group.
Agrawal, Himani; Zelisko, Matthew; Liu, Liping; Sharma, Pradeep
2016-05-06
A key step in the HIV-infection process is the fusion of the virion membrane with the target cell membrane and the concomitant transfer of the viral RNA. Experimental evidence suggests that the fusion is preceded by considerable elastic softening of the cell membranes due to the insertion of fusion peptide in the membrane. What are the mechanisms underpinning the elastic softening of the membrane upon peptide insertion? A broader question may be posed: insertion of rigid proteins in soft membranes ought to stiffen the membranes not soften them. However, experimental observations perplexingly appear to show that rigid proteins may either soften or harden membranes even though conventional wisdom only suggests stiffening. In this work, we argue that regarding proteins as merely non-specific rigid inclusions is flawed, and each protein has a unique mechanical signature dictated by its specific interfacial coupling to the surrounding membrane. Predicated on this hypothesis, we have carried out atomistic simulations to investigate peptide-membrane interactions. Together with a continuum model, we reconcile contrasting experimental data in the literature including the case of HIV-fusion peptide induced softening. We conclude that the structural rearrangements of the lipids around the inclusions cause the softening or stiffening of the biological membranes.
NASA Astrophysics Data System (ADS)
Agrawal, Himani; Zelisko, Matthew; Liu, Liping; Sharma, Pradeep
2016-05-01
A key step in the HIV-infection process is the fusion of the virion membrane with the target cell membrane and the concomitant transfer of the viral RNA. Experimental evidence suggests that the fusion is preceded by considerable elastic softening of the cell membranes due to the insertion of fusion peptide in the membrane. What are the mechanisms underpinning the elastic softening of the membrane upon peptide insertion? A broader question may be posed: insertion of rigid proteins in soft membranes ought to stiffen the membranes not soften them. However, experimental observations perplexingly appear to show that rigid proteins may either soften or harden membranes even though conventional wisdom only suggests stiffening. In this work, we argue that regarding proteins as merely non-specific rigid inclusions is flawed, and each protein has a unique mechanical signature dictated by its specific interfacial coupling to the surrounding membrane. Predicated on this hypothesis, we have carried out atomistic simulations to investigate peptide-membrane interactions. Together with a continuum model, we reconcile contrasting experimental data in the literature including the case of HIV-fusion peptide induced softening. We conclude that the structural rearrangements of the lipids around the inclusions cause the softening or stiffening of the biological membranes.
Effect of shoe insert construction on foot and leg movement.
Nigg, B M; Khan, A; Fisher, V; Stefanyshyn, D
1998-04-01
The purpose of this study was to quantify changes in foot eversion and tibial rotation during running resulting from systematic changes of material composition of five shoe inserts of the same shape. Tests were performed with 12 subjects. The inserts had a bilayer design using two different materials at the top and bottom of the insert. The functional kinematic variables examined in this study were the foot-leg in-eversion angle, beta, and the leg-foot tibial rotation, rho. Additionally, the subject characteristics of arch height, relative arch deformation, and active range of motion were quantified. The statistical analysis used was a two way repeated measures MANOVA (within trials and inserts). The average group changes resulting from the studied inserts in total shoe eversion, total foot eversion, and total internal tibial rotation were typically smaller than 1 degree when compared with the no-insert condition and were statistically not significant. The measured ranges of total foot eversion for all subjects were smallest for the softest and about twice as large for the hardest insert construction. Thus, the soft insert construction was more restrictive, forcing all feet into a similar movement pattern, whereas the harder combinations allowed for more individual variation of foot and leg movement and did not force the foot into a preset movement pattern. The individual results showed substantial differences between subjects and a trend: Subjects who generally showed a reduction of tibial rotation with all tested inserts typically had a flexible foot. However, subjects who generally showed an increase of tibial rotation typically had a stiff foot. The results of this study suggest that subject specific factors such as static, dynamic, and neuro-physiological characteristics of foot and leg are important to match specific feet and shoe inserts optimally.
Soria, Alessandro; Cavarelli, Mariangela; Sala, Stefania; Alessandrini, Anna Ida; Scarlatti, Gabriella; Lazzarin, Adriano; Castagna, Antonella
2008-06-01
An unexpected dramatic immune recovery was observed in a patient with full-blown AIDS receiving enfuvirtide-based antiretroviral therapy after multiple treatment failures. A complex interplay of viral and host factors, including the control of X4 viruses and proviral burden, may favor immune restoration with HIV neutralizing activity, despite persistent viremia.
Billman, Martin R; Rueda, David; Bangham, Charles R M
2017-01-01
Background: The human leukaemia virus HTLV-1 expresses essential accessory genes that manipulate the expression, splicing and transport of viral mRNAs. Two of these genes, tax and hbz, also promote proliferation of the infected cell, and both genes are thought to contribute to oncogenesis in adult T-cell leukaemia/lymphoma. The regulation of HTLV-1 proviral latency is not understood. tax, on the proviral plus strand, is usually silent in freshly-isolated cells, whereas the minus-strand-encoded hbz gene is persistently expressed at a low level. However, the persistently activated host immune response to Tax indicates frequent expression of tax in vivo. Methods: We used single-molecule RNA-FISH to quantify the expression of HTLV-1 transcripts at the single-cell level in a total of >19,000 cells from five T-cell clones, naturally infected with HTLV-1, isolated by limiting dilution from peripheral blood of HTLV-1-infected subjects. Results: We found strong heterogeneity both within and between clones in the expression of the proviral plus-strand (detected by hybridization to the tax gene) and the minus-strand ( hbz gene). Both genes are transcribed in bursts; tax expression is enhanced in the absence of hbz, while hbz expression increased in cells with high tax expression. Surprisingly, we found that hbz expression is strongly associated with the S and G 2/M phases of the cell cycle, independent of tax expression. Contrary to current belief, hbz is not expressed in all cells at all times, even within one clone. In hbz-positive cells, the abundance of hbz transcripts showed a very strong positive linear correlation with nuclear volume. Conclusions: The occurrence of intense, intermittent plus-strand gene bursts in independent primary HTLV-1-infected T-cell clones from unrelated individuals strongly suggests that the HTLV-1 plus-strand is expressed in bursts in vivo. Our results offer an explanation for the paradoxical correlations observed between the host immune response and HTLV-1 transcription. PMID:29062917
Baires-Campos, Felipe-Eduardo; Jimbo, Ryo; Fonseca-Oliveira, Maiolino-Thomaz; Moura, Camila; Zanetta-Barbosa, Darceny; Coelho, Paulo-Guilherme
2015-01-01
Background This study histologically evaluated two implant designs: a classic thread design versus another specifically designed for healing chamber formation placed with two drilling protocols. Material and Methods Forty dental implants (4.1 mm diameter) with two different macrogeometries were inserted in the tibia of 10 Beagle dogs, and maximum insertion torque was recorded. Drilling techniques were: until 3.75 mm (regular-group); and until 4.0 mm diameter (overdrilling-group) for both implant designs. At 2 and 4 weeks, samples were retrieved and processed for histomorphometric analysis. For torque and BIC (bone-to-implant contact) and BAFO (bone area fraction occupied), a general-linear model was employed including instrumentation technique and time in vivo as independent. Results The insertion torque recorded for each implant design and drilling group significantly decreased as a function of increasing drilling diameter for both implant designs (p<0.001). No significant differences were detected between implant designs for each drilling technique (p>0.18). A significant increase in BIC was observed from 2 to 4 weeks for both implants placed with the overdrilling technique (p<0.03) only, but not for those placed in the 3.75 mm drilling sites (p>0.32). Conclusions Despite the differences between implant designs and drilling technique an intramembranous-like healing mode with newly formed woven bone prevailed. Key words: Histomorphometry, biomechanical, in vivo, initial stability, insertion torque, osseointegration. PMID:25858087
Objective evaluation of insert material for diabetic and athletic footwear.
Brodsky, J W; Kourosh, S; Stills, M; Mooney, V
1988-12-01
Five of the most commonly used materials for shoe inserts (soft Plastazote, medium Pelite, PPT, Spenco, and Sorbothane) were objectively evaluated in the laboratory to characterize their behavior in the following three specific functions that correspond to clinical use: (1) the effect on the materials of repeated compression. (2) the effect of a combination of repetitive shear and compression. (3) the force-distribution (force-attenuation) properties of these materials, both when new and after repeated compression. The last function represents a model for relief of pressure beneath plantar bony prominences, a topic of special concern for the insensitive foot. All materials were effective in reducing transmitted force over the simulated bony prominence with a rank order of effectiveness. Other factors considered were: amount and rate of permanent deformation offset by considerations of enhanced moldability when comparing the neoprene and urethane materials with the polyethylene foams. The ideal insert represents a combination of material to achieve both durability and moldability.
Finke, John M; Cheung, Margaret S; Onuchic, José N
2004-09-01
Modeling the structure of natively disordered peptides has proved difficult due to the lack of structural information on these peptides. In this work, we use a novel application of the host-guest method, combining folding theory with experiments, to model the structure of natively disordered polyglutamine peptides. Initially, a minimalist molecular model (C(alpha)C(beta)) of CI2 is developed with a structurally based potential and captures many of the folding properties of CI2 determined from experiments. Next, polyglutamine "guest" inserts of increasing length are introduced into the CI2 "host" model and the polyglutamine is modeled to match the resultant change in CI2 thermodynamic stability between simulations and experiments. The polyglutamine model that best mimics the experimental changes in CI2 thermodynamic stability has 1), a beta-strand dihedral preference and 2), an attractive energy between polyglutamine atoms 0.75-times the attractive energy between the CI2 host Go-contacts. When free-energy differences in the CI2 host-guest system are correctly modeled at varying lengths of polyglutamine guest inserts, the kinetic folding rates and structural perturbation of these CI2 insert mutants are also correctly captured in simulations without any additional parameter adjustment. In agreement with experiments, the residues showing structural perturbation are located in the immediate vicinity of the loop insert. The simulated polyglutamine loop insert predominantly adopts extended random coil conformations, a structural model consistent with low resolution experimental methods. The agreement between simulation and experimental CI2 folding rates, CI2 structural perturbation, and polyglutamine insert structure show that this host-guest method can select a physically realistic model for inserted polyglutamine. If other amyloid peptides can be inserted into stable protein hosts and the stabilities of these host-guest mutants determined, this novel host-guest method may prove useful to determine structural preferences of these intractable but biologically relevant protein fragments.
Gladyshev, Eugene A; Arkhipova, Irina R
2009-12-15
Ribosomal DNA genes in many eukaryotes contain insertions of non-LTR retrotransposable elements belonging to the R2 clade. These elements persist in the host genomes by inserting site-specifically into multicopy target sites, thereby avoiding random disruption of single-copy host genes. Here we describe R9 retrotransposons from the R2 clade in the 28S RNA genes of bdelloid rotifers, small freshwater invertebrate animals best known for their long-term asexuality and for their ability to survive repeated cycles of desiccation and rehydration. While the structural organization of R9 elements is highly similar to that of other members of the R2 clade, they are characterized by two distinct features: site-specific insertion into a previously unreported target sequence within the 28S gene, and an unusually long target site duplication of 126 bp. We discuss the implications of these findings in the context of bdelloid genome organization and the mechanisms of target-primed reverse transcription.
Tarity, T David; Koch, Chelsea N; Burket, Jayme C; Wright, Timothy M; Westrich, Geoffrey H
2017-03-01
Adverse local tissue reaction formation has been suggested to occur with the Modular Dual Mobility (MDM) acetabular design. Few reports in the literature have evaluated fretting and corrosion damage between the acetabular shell and modular metal inserts in this modular system. We evaluated a series of 18 retrieved cobalt chromium MDM inserts for evidence of fretting and corrosion. We assessed the backsides of 18 MDM components for evidence of fretting and corrosion in polar and taper regions based on previously established methods. We collected and assessed 30 similarly designed modular inserts retrieved from metal-on-metal (MoM) total hip arthroplasties as a control. No specific pattern of fretting or corrosion was identified on the MDM inserts. Both fretting and corrosion were significantly greater in the MoM cohort than the MDM cohort, driven by higher fretting and corrosion scores in the engaged taper region of the MoM inserts. MoM components demonstrated more fretting and corrosion than MDM designs, specifically at the taper region, likely driven by differences in the taper engagement mechanism and geometry among the insert designs. The lack of significant fretting and corrosion observed in the MDM inserts are inconsistent with recent claims that this interface may produce clinically significant metallosis and adverse local tissue reactions. Copyright © 2016 Elsevier Inc. All rights reserved.
Amundsen, Spencer; Lee, Yuo-Yu; González Della Valle, Alejandro
2017-06-01
Intra-operative sensing technology is an alternative to standard techniques in total knee arthroplasty (TKA) for determining balance by providing quantitative analysis of loads and point of contact throughout a range of motion. We used intra-operative sensing (VERASENSE-OrthoSensor, Inc.) to examine pie-crusting release of the medial collateral ligament in knees with varus deformity (study group) in comparison to a control group where balance was obtained using a classic release technique and assessed using laminar spreaders, spacer blocks, manual stress, and a ruler. The surgery was performed by a single surgeon utilizing measured resection and posterior-stabilized, cemented implants. Seventy-five study TKAs were matched 1:3 with 225 control TKAs. Outcome variables included the use of a constrained insert, functional- and knee-specific Knee Society score (KSS) at six weeks, four months, and one year post-operatively. Outcomes were analyzed in a multivariate model controlling for age, sex, BMI, and severity of deformity. The use of a constrained insert was significantly lower in the study group (5.3 vs. 13.8%; p = 0.049). The use of increased constraint was not significant between groups with increasing deformity. There was no difference in functional KSS and knee-specific KSS between groups at any follow-up interval. An algorithmic pie-crusting technique guided by intra-operative sensing is associated with decreased use of constrained inserts in TKA patients with a pre-operative varus deformity. This may cause a positive shift in value and cost savings.
DeLuca, Jesse P.; Lammlein, Kyle P.
2016-01-01
We describe the use of ultrasound guidance for hyperosmolar dextrose (prolotherapy) injection of the distal calcaneal tendon specifically just anterior to identified enthesophytes in patients with insertional Achilles calcific tendinosis refractory to conservative treatment. This specific technique has not to our knowledge been described or used in literature previously. PMID:27974984
Chen, Tingfang; Luo, Na; Xie, Huaping; Wu, Xiushan; Deng, Yun
2010-02-01
In an effort to generate a desired expression construct for making heart-specific expression transgenic zebrafish, a Tol2 plasmid, which can drive EGFP reporter gene specifically expressed in the heart, was modified using subcloning technology. An IRES fragment bearing multiple cloning site (MCS) was amplified directly from pIRES2-EGFP plasmid and was inserted between the CMLC2 promoter and EGFP fragment of the pDestTol2CG vector. This recombinant expression plasmid pTol2-CMLC2-IRES-EGFP can drive any interested gene specifically expressed in the zebrafish heart along with EGFP reporter gene. To test the effectiveness of this new expression plasmid, we constructed pTol2-CMLC2-RED-IRES-EGFP plasmid by inserting another reporter gene DsRed-Monome into MCS downstream of the CMLC2 promoter and injected this transgenic recombinant plasmid into one-cell stage embryos of zebrafish. Under fluorescence microscope, both the red fluorescence and the green fluorescence produced by pTol2-CMLC2-RED-IRES-EGFP were detected specifically in the heart tissue in the same expression pattern. This novel expression construct pTol2-CMLC2-IRES-EGFP will become an important tool for our research on identifying heart development candidate genes' function using zebrafish as a model.
Diederich, Emily; Thomas, Laura; Mahnken, Jonathan; Lineberry, Matthew
2018-06-01
Within simulation-based mastery learning (SBML) courses, there is inconsistent inclusion of learner pretesting, which requires considerable resources and is contrary to popular instructional frameworks. However, it may have several benefits, including its direct benefit as a form of deliberate practice and its facilitation of more learner-specific subsequent deliberate practice. We consider an unexplored potential benefit of pretesting: its ability to predict variable long-term learner performance. Twenty-seven residents completed an SBML course in central line insertion. Residents were tested on simulated central line insertion precourse, immediately postcourse, and after between 64 and 82 weeks. We analyzed pretest scores' prediction of delayed test scores, above and beyond prediction by program year, line insertion experiences in the interim, and immediate posttest scores. Pretest scores related strongly to delayed test scores (r = 0.59, P = 0.01; disattenuated ρ = 0.75). The number of independent central lines inserted also related to year-delayed test scores (r = 0.44, P = 0.02); other predictors did not discernibly relate. In a regression model jointly predicting delayed test scores, pretest was a significant predictor (β = 0.487, P = 0.011); number of independent insertions was not (β = 0.234, P = 0.198). This study suggests that pretests can play a major role in predicting learner variance in learning gains from SBML courses, thus facilitating more targeted refresher training. It also exposes a risk in SBML courses that learners who meet immediate mastery standards may be incorrectly assumed to have equal long-term learning gains.
Sugawara, Taku; Higashiyama, Naoki; Kaneyama, Shuichi; Sumi, Masatoshi
2017-03-15
Prospective clinical trial of the screw insertion method for posterior C1-C2 fixation utilizing the patient-specific screw guide template technique. To evaluate the efficacy of this method for insertion of C1 lateral mass screws (LMS), C2 pedicle screws (PS), and C2 laminar screws (LS). Posterior C1LMS and C2PS fixation, also known as the Goel-Harms method, can achieve immediate rigid fixation and high fusion rate, but the screw insertion carries the risk of injury to neuronal and vascular structures. Dissection of venous plexus and C2 nerve root to confirm the insertion point of the C1LMS may also cause problems. We have developed an intraoperative screw guiding method using patient-specific laminar templates. Preoperative bone images of computed tomography (CT) were analyzed using three-dimensional (3D)/multiplanar imaging software to plan the trajectories of the screws. Plastic templates with screw guiding structures were created for each lamina using 3D design and printing technology. Three types of templates were made for precise multistep guidance, and all templates were specially designed to fit and lock on the lamina during the procedure. Surgery was performed using this patient-specific screw guide template system, and placement of the screws was postoperatively evaluated using CT. Twelve patients with C1-C2 instability were treated with a total of 48 screws (24 C1LMS, 20 C2PS, 4 C2LS). Intraoperatively, each template was found to exactly fit and lock on the lamina and screw insertion was completed successfully without dissection of the venous plexus and C2 nerve root. Postoperative CT showed no cortical violation by the screws, and mean deviation of the screws from the planned trajectories was 0.70 ± 0.42 mm. The multistep, patient-specific screw guide template system is useful for intraoperative screw navigation in posterior C1-C2 fixation. This simple and economical method can improve the accuracy of screw insertion, and reduce operation time and radiation exposure of posterior C1-C2 fixation surgery. 3.
Advances and hope for perinatal HIV remission and cure in children and adolescents.
Rainwater-Lovett, Kaitlin; Uprety, Priyanka; Persaud, Deborah
2016-02-01
The known timing of HIV infection in perinatal transmission, combined with the capacity for early antiretroviral therapy (ART) initiation and immune reconstitution, can provide unique insights into HIV persistence. The scientific basis for a pediatric-specific research agenda aimed at HIV remission and cure is discussed. Accumulating evidence supports a favorable biomarker profile for immunotherapeutic interventions in early treated, perinatally infected individuals. HIV DNA concentrations in infected cells of early treated infants decrease over the first few years of life and, after more than 10 years of ART, the overwhelming majority of noninduced proviral genomes are replication-deficient. With early ART initiation, approximately half of perinatally infected individuals become seronegative. Studies of untreated infants and vaccine trials indicate that infected infants can generate HIV-specific humoral responses. Taken together, this evidence suggests that early treatment results in low levels of replication-competent provirus, an absence of HIV-specific immunity, and the capacity to generate immune responses to potential immunotherapeutic interventions. Perinatally HIV-infected individuals require lifelong ART because of the prompt establishment of viral latency in long-lived resting memory CD4 T cells that rekindle viremia upon treatment cessation. However, intense research efforts are ongoing to perturb HIV latency toward reservoir clearance for virologic remission and cure in which perinatally infected individuals can discontinue ART.
Nose, Hirohisa; Kubota, Ryuji; Seth, Nilufer P.; Goon, Peter K.; Tanaka, Yuetsu; Izumo, Shuji; Usuku, Koichiro; Ohara, Yoshiro; Wucherpfennig, Kai W.; Bangham, Charles R. M.; Osame, Mitsuhiro; Saito, Mineki
2015-01-01
HLA-DRB1*0101 is associated with susceptibility to human T lymphotropic virus type 1 (HTLV-1)–associated myelopathy/tropical spastic paraparesis (HAM/TSP). Here, we used a synthetic tetramer of DRB1*0101 and its epitope peptide to analyze HTLV-1–specific CD4+ T cells ex vivo. The frequency of tetramer+CD4+ T cells was significantly greater in patients with HAM/TSP than in healthy HTLV-1 carriers (HCs) at a given proviral load and correlated with HTLV-1 tax messenger RNA expression in HCs but not in patients with HAM/TSP. These cells displayed an early to intermediate effector memory phenotype and were preferentially infected by HTLV-1. T cell receptor gene analyses of 2 unrelated DRB1*0101-positive patients with HAM/TSP showed similar Vβ repertoires and amino acid motifs in complementarity-determining region 3. Our data suggest that efficient clonal expansion of virus-specific CD4+ T cells in patients with HAM/TSP does not simply reflect higher viral burden but rather reflects a rapid turnover caused by preferential infection and/or in vivo stimulation by major histocompatibility complex–peptide complexes. PMID:18190256
NASA Astrophysics Data System (ADS)
Mia, Mozammel; Al Bashir, Mahmood; Dhar, Nikhil Ranjan
2016-10-01
Hard turning is increasingly employed in machining, lately, to replace time-consuming conventional turning followed by grinding process. An excessive amount of tool wear in hard turning is one of the main hurdles to be overcome. Many researchers have developed tool wear model, but most of them developed it for a particular work-tool-environment combination. No aggregate model is developed that can be used to predict the amount of principal flank wear for specific machining time. An empirical model of principal flank wear (VB) has been developed for the different hardness of workpiece (HRC40, HRC48 and HRC56) while turning by coated carbide insert with different configurations (SNMM and SNMG) under both dry and high pressure coolant conditions. Unlike other developed model, this model includes the use of dummy variables along with the base empirical equation to entail the effect of any changes in the input conditions on the response. The base empirical equation for principal flank wear is formulated adopting the Exponential Associate Function using the experimental results. The coefficient of dummy variable reflects the shifting of the response from one set of machining condition to another set of machining condition which is determined by simple linear regression. The independent cutting parameters (speed, rate, depth of cut) are kept constant while formulating and analyzing this model. The developed model is validated with different sets of machining responses in turning hardened medium carbon steel by coated carbide inserts. For any particular set, the model can be used to predict the amount of principal flank wear for specific machining time. Since the predicted results exhibit good resemblance with experimental data and the average percentage error is <10 %, this model can be used to predict the principal flank wear for stated conditions.
Otto, Claudia; Csanadi, Agnes; Fisch, Paul; Werner, Martin; Kayser, Gian
2012-10-22
Lung cancer is the leading cause of death among malignant diseases in humans worldwide. In the last decade development of new targeted drugs for the treatment of non-small cell lung cancer proved to be a promising approach to prolong the otherwise very poor prognosis of patients with advanced UICC stages. Epidermal growth factor receptor (EGFR) has been in the focus of this lung cancer science and specific activating mutations are eligible for the treatment with specific tyrosine kinase inhibitors like gefitinib or erlotinib. Beside typical deletions in exon 19 and point mutations in exons 18 and 21 several insertions in exon 19 have been described and attributed activating properties as well. This is the first European and overall the 5th description in English literature of one of these specific insertions. To elucidate its structural changes leading to the activating properties we performed molecular modeling studies. These revealed conformational and electrostatic force field changes in the kinase domain of EGFR. To not miss uncommon mutations thorough and precise characterization of EGFR hotspots, i. e. at least exons 18, 19 and 21, should therefore be conducted to provide best medical care and to offer lung cancer patients appropriate cancer treatment. The vistual slides for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/2209889658102062.
Varghese, Vicky; Saravana Kumar, Gurunathan; Krishnan, Venkatesh
2017-02-01
Pedicle screws are widely used for the treatment of spinal instability by spine fusion. Screw loosening is a major problem of spine fusion, contributing to delayed patient recovery. The present study aimed to understand the factor and interaction effects of density, insertion depth and insertion angle on pedicle screw pull out strength and insertion torque. A pull out study was carried out on rigid polyurethane foam blocks representing osteoporotic to normal bone densities according to the ASTM-1839 standard. It was found that density contributes most to pullout strength and insertion torque. The interaction effect is significant (p < 0.05) and contributes 8% to pull out strength. Axial pullout strength was 34% lower than angled pull out strength in the osteoporotic bone model. Insertion angle had no significant effect (p > 0.05) on insertion torque. Pullout strength and insertion torque had no significant correlation (p > 0.05) in the case of the extremely osteoporotic bone model. Copyright © 2016 IPEM. Published by Elsevier Ltd. All rights reserved.
Rossa, Carlos; Lehmann, Thomas; Sloboda, Ronald; Usmani, Nawaid; Tavakoli, Mahdi
2017-08-01
Global modelling has traditionally been the approach taken to estimate needle deflection in soft tissue. In this paper, we propose a new method based on local data-driven modelling of needle deflection. External measurement of needle-tissue interactions is collected from several insertions in ex vivo tissue to form a cloud of data. Inputs to the system are the needle insertion depth, axial rotations, and the forces and torques measured at the needle base by a force sensor. When a new insertion is performed, the just-in-time learning method estimates the model outputs given the current inputs to the needle-tissue system and the historical database. The query is compared to every observation in the database and is given weights according to some similarity criteria. Only a subset of historical data that is most relevant to the query is selected and a local linear model is fit to the selected points to estimate the query output. The model outputs the 3D deflection of the needle tip and the needle insertion force. The proposed approach is validated in ex vivo multilayered biological tissue in different needle insertion scenarios. Experimental results in five different case studies indicate an accuracy in predicting needle deflection of 0.81 and 1.24 mm in the horizontal and vertical lanes, respectively, and an accuracy of 0.5 N in predicting the needle insertion force over 216 needle insertions.
Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E
2018-02-27
Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.
Chandler, John E; Lee, Cameron M; Babchanik, Alexander P; Melville, C David; Saunders, Michael D; Seibel, Eric J
2012-01-01
Purpose Direct visualization of pancreatic ductal tissue is critical for early diagnosis of pancreatic diseases and for guiding therapeutic interventions. A novel, ultrathin (5 Fr) scanning fiber endoscope (SFE) with tip-bending capability has been developed specifically to achieve high resolution imaging as a pancreatoscope during endoscopic retrograde cholangiopancreatography (ERCP). This device has potential to dramatically improve both diagnostic and therapeutic capabilities during ERCP by providing direct video feedback and tool guidance to clinicians. Methods Invasiveness of the new tip-bending SFE was evaluated by a performance comparison to ERCP guide wires, which are routinely inserted into the pancreatic duct during ERCP. An in vitro test model with four force sensors embedded in a synthetic pancreas was designed to detect and compare the insertion forces for 0.89 mm and 0.53 mm diameter guide wires as well as the 1.7 mm diameter SFE. Insertions were performed through the working channel of a therapeutic duodenoscope for the two types of guide wires and using a statistically similar direct insertion method for comparison to the SFE. Results Analysis of the forces detected by the sensors showed the smaller diameter 0.53 mm wire produced significantly less average and maximum forces during insertion than the larger diameter 0.89 mm wire. With the use of tip-bending and optical visualization, the 1.7 mm diameter SFE produced significantly less average force during insertion than the 0.89 mm wire at every sensor, despite its larger size. It was further shown that the use of tip-bending with the SFE significantly reduced the forces at all sensors, compared to insertions when tip-bending was not used. Conclusion Combining high quality video imaging with two-axis tip-bending allows a larger diameter guide wire-style device to be inserted into the pancreatic duct during ERCP with improved capacity to perform diagnostics and therapy. PMID:23166452
Saksela, K; Muchmore, E; Girard, M; Fultz, P; Baltimore, D
1993-01-01
We have examined human immunodeficiency virus type 1 (HIV-1) infection in chimpanzees by analyzing HIV-1 DNA and RNA in lymph nodes and peripheral mononuclear cells (PBMCs). Like certain asymptomatic HIV-infected persons, these chimpanzees had no detectable viral replication in their PBMCs. However, viral replication and a high viral load were observed in the lymphatic tissue. Despite the absence of viral replication in PBMCs, 1/1,000 to 1/10,000 of the PBMCs contained HIV-1 proviral DNA, and HIV transcription could be rapidly induced in these cells in vitro. These results provide direct evidence of cellular latency of HIV in vivo and suggest that HIV infection in chimpanzees may be a useful model for clinical latency of HIV infection in humans. Images PMID:8230463
Lo, Te-Wen; Pickle, Catherine S; Lin, Steven; Ralston, Edward J; Gurling, Mark; Schartner, Caitlin M; Bian, Qian; Doudna, Jennifer A; Meyer, Barbara J
2013-10-01
Exploitation of custom-designed nucleases to induce DNA double-strand breaks (DSBs) at genomic locations of choice has transformed our ability to edit genomes, regardless of their complexity. DSBs can trigger either error-prone repair pathways that induce random mutations at the break sites or precise homology-directed repair pathways that generate specific insertions or deletions guided by exogenously supplied DNA. Prior editing strategies using site-specific nucleases to modify the Caenorhabditis elegans genome achieved only the heritable disruption of endogenous loci through random mutagenesis by error-prone repair. Here we report highly effective strategies using TALE nucleases and RNA-guided CRISPR/Cas9 nucleases to induce error-prone repair and homology-directed repair to create heritable, precise insertion, deletion, or substitution of specific DNA sequences at targeted endogenous loci. Our robust strategies are effective across nematode species diverged by 300 million years, including necromenic nematodes (Pristionchus pacificus), male/female species (Caenorhabditis species 9), and hermaphroditic species (C. elegans). Thus, genome-editing tools now exist to transform nonmodel nematode species into genetically tractable model organisms. We demonstrate the utility of our broadly applicable genome-editing strategies by creating reagents generally useful to the nematode community and reagents specifically designed to explore the mechanism and evolution of X chromosome dosage compensation. By developing an efficient pipeline involving germline injection of nuclease mRNAs and single-stranded DNA templates, we engineered precise, heritable nucleotide changes both close to and far from DSBs to gain or lose genetic function, to tag proteins made from endogenous genes, and to excise entire loci through targeted FLP-FRT recombination.
Finite Element Analysis of Patient-Specific Mitral Valve with Mitral Regurgitation.
Pham, Thuy; Kong, Fanwei; Martin, Caitlin; Wang, Qian; Primiano, Charles; McKay, Raymond; Elefteriades, John; Sun, Wei
2017-03-01
Functional mitral regurgitation (FMR) is a significant complication of left ventricular dysfunction and strongly associated with a poor prognosis. In this study, we developed a patient-specific finite element (FE) model of the mitral apparatus in a FMR patient which included: both leaflets with thickness, annulus, chordae tendineae, and chordae insertions on the leaflets and origins on the papillary muscles. The FE model incorporated human age- and gender-matched anisotropic hyperelastic material properties, and MV closure at systole was simulated. The model was validated by comparing the FE results from valve closure simulation with the in vivo geometry of the MV at systole. It was found that the FE model could not replicate the in vivo MV geometry without the application of tethering pre-tension force in the chordae at diastole. Upon applying the pre-tension force and performing model optimization by adjusting the chordal length, position, and leaflet length, a good agreement between the FE model and the in vivo model was established. Not only were the chordal forces high at both diastole and systole, but the tethering force on the anterior papillary muscle was higher than that of the posterior papillary muscle, which resulted in an asymmetrical gap with a larger orifice area at the anterolateral commissure resulting in MR. The analyses further show that high peak stress and strain were found at the chordal insertions where large chordal tethering forces were found. This study shows that the pre-tension tethering force plays an important role in accurately simulating the MV dynamics in this FMR patient, particularly in quantifying the degree of leaflet coaptation and stress distribution. Due to the complexity of the disease, the patient-specific computational modeling procedure of FMR patients presented should be further evaluated using a large patient cohort. However, this study provides useful insights into the MV biomechanics of a FMR patient, and could serve as a tool to assist in pre-operative planning for MV repair or replacement surgical or interventional procedures.
Activation of int-1 and int-2 loci in GRf mammary tumors.
Gray, D A; Jackson, D P; Percy, D H; Morris, V L
1986-10-30
The Mtv-2 locus is known to be associated with a high mammary tumor incidence (97%) and early development of mammary tumors (3-13 months) in GR mice. However, it was not previously known whether the provirus which resides at the Mtv-2 locus is tumorigenic in and of itself or whether reintegration of proviruses generated from Mtv-2 is required for tumorigenesis. Foster-nursing GR mice on C57/BL mice eliminates the milk-borne source of GR virus, and allows the study of Mtv-2 derived proviruses alone. Using this approach, we have tested predictions which follow from the "positional" versus "reintegrational" models of tumorigenesis. Specifically, we have examined tumors from primary foster-nursed (GRf) mice to determine if MMTV proviruses derived from Mtv-2 were scattered randomly throughout the genome or were clustered in the vicinity of the int-1 and int-2 loci, which are thought to be associated with mammary tumorigenesis. It was found that the majority of spontaneous GRf mammary tumors that were tested have MMTV proviral integrations in either or both of the int-1 and int-2 loci and have transcription of either or both of the int loci. Tumors induced by Mtv-2, therefore, appear to have arisen via a mechanism similar to the activation of the int loci by exogenous (milk-borne) MMTV proviruses.
Fluorinated Aromatic Amino Acids Distinguish Cation-π Interactions from Membrane Insertion*
He, Tao; Gershenson, Anne; Eyles, Stephen J.; Lee, Yan-Jiun; Liu, Wenshe R.; Wang, Jiangyun; Gao, Jianmin; Roberts, Mary F.
2015-01-01
Cation-π interactions, where protein aromatic residues supply π systems while a positive-charged portion of phospholipid head groups are the cations, have been suggested as important binding modes for peripheral membrane proteins. However, aromatic amino acids can also insert into membranes and hydrophobically interact with lipid tails. Heretofore there has been no facile way to differentiate these two types of interactions. We show that specific incorporation of fluorinated amino acids into proteins can experimentally distinguish cation-π interactions from membrane insertion of the aromatic side chains. Fluorinated aromatic amino acids destabilize the cation-π interactions by altering electrostatics of the aromatic ring, whereas their increased hydrophobicity enhances membrane insertion. Incorporation of pentafluorophenylalanine or difluorotyrosine into a Staphylococcus aureus phosphatidylinositol-specific phospholipase C variant engineered to contain a specific PC-binding site demonstrates the effectiveness of this methodology. Applying this methodology to the plethora of tyrosine residues in Bacillus thuringiensis phosphatidylinositol-specific phospholipase C definitively identifies those involved in cation-π interactions with phosphatidylcholine. This powerful method can easily be used to determine the roles of aromatic residues in other peripheral membrane proteins and in integral membrane proteins. PMID:26092728
Human lamina cribrosa insertion and age.
Sigal, Ian A; Flanagan, John G; Lathrop, Kira L; Tertinegg, Inka; Bilonick, Richard
2012-10-03
To test the hypothesis that in healthy human eyes the lamina cribrosa (LC) insertion into the pia mater increases with age. The optic nerve heads (ONHs) of donor eyes fixed at either 5 or 50 mm Hg of IOP were sectioned, stained, and imaged under bright- and dark-field conditions. A 3-dimensional (3D) model of each ONH was reconstructed. From the 3D models we measured the area of LC insertion into the peripapillary scleral flange and into the pia, and computed the total area of insertion and fraction of LC inserting into the pia. Linear mixed effect models were used to determine if the measurements were associated with age or IOP. We analyzed 21 eyes from 11 individuals between 47 and 91 years old. The LC inserted into the pia in all eyes. The fraction of LC inserting into the pia (2.2%-29.6%) had a significant decrease with age (P = 0.049), which resulted from a nonsignificant increase in the total area of LC insertion (P = 0.41) and a nonsignificant decrease in the area of LC insertion into the pia (P = 0.55). None of the measures was associated with fixation IOP (P values 0.44-0.81). Differences between fellow eyes were smaller than differences between unrelated eyes. The LC insertion into the pia mater is common in middle-aged and older eyes, and does not increase with age. The biomechanical and vascular implications of the LC insertion into the pia mater are not well understood and should be investigated further.
Human Lamina Cribrosa Insertion and Age
Sigal, Ian A.; Flanagan, John G.; Lathrop, Kira L.; Tertinegg, Inka; Bilonick, Richard
2012-01-01
Purpose. To test the hypothesis that in healthy human eyes the lamina cribrosa (LC) insertion into the pia mater increases with age. Methods. The optic nerve heads (ONHs) of donor eyes fixed at either 5 or 50 mm Hg of IOP were sectioned, stained, and imaged under bright- and dark-field conditions. A 3-dimensional (3D) model of each ONH was reconstructed. From the 3D models we measured the area of LC insertion into the peripapillary scleral flange and into the pia, and computed the total area of insertion and fraction of LC inserting into the pia. Linear mixed effect models were used to determine if the measurements were associated with age or IOP. Results. We analyzed 21 eyes from 11 individuals between 47 and 91 years old. The LC inserted into the pia in all eyes. The fraction of LC inserting into the pia (2.2%–29.6%) had a significant decrease with age (P = 0.049), which resulted from a nonsignificant increase in the total area of LC insertion (P = 0.41) and a nonsignificant decrease in the area of LC insertion into the pia (P = 0.55). None of the measures was associated with fixation IOP (P values 0.44–0.81). Differences between fellow eyes were smaller than differences between unrelated eyes. Conclusions. The LC insertion into the pia mater is common in middle-aged and older eyes, and does not increase with age. The biomechanical and vascular implications of the LC insertion into the pia mater are not well understood and should be investigated further. PMID:22956611
Tanikawa, Taichiro; Uchida, Yuko; Saito, Takehiko
2017-09-01
Previous research revealed the induction of chicken USP18 (chUSP18) in the lungs of chickens infected with highly pathogenic avian influenza viruses (HPAIVs). This activity was correlated with the degree of pathogenicity of the viruses to chickens. As mammalian ubiquitin-specific protease (USP18) is known to remove type I interferon (IFN I)-inducible ubiquitin-like molecules from conjugated proteins and block IFN I signalling, we explored the function of the chicken homologue of USP18 during avian influenza virus infection. With this aim, we cloned chUSP18 from cultured chicken cells and revealed that the putative chUSP18 ORF comprises 1137 bp. Comparative analysis of the predicted aa sequence of chUSP18 with those of human and mouse USP18 revealed relatively high sequence similarity among the sequences, including domains specific for the ubiquitin-specific processing protease family. Furthermore, we found that chUSP18 expression was induced by chicken IFN I, as observed for mammalian USP18. Experiments based on chUSP18 over-expression and depletion demonstrated that chUSP18 significantly enhanced the replication of a low-pathogenic avian influenza virus (LPAIV), but not an HPAIV. Our findings suggest that chUSP18, being similar to mammalian USP18, acts as a pro-viral factor during LPAIV replication in vitro.
Archin, Nancie M.
2017-01-01
Abstract Quiescent proviral genomes that persist during human immunodeficiency virus type 1 (HIV-1) infection despite effective antiretroviral therapy (ART) can fuel rebound viremia after ART interruption and is a central obstacle to the cure of HIV infection. The induction of quiescent provirus is the goal of a new class of potential therapeutics, latency reversing agents (LRAs). The discovery, development, and testing of HIV LRAs is a key part of current efforts to develop latency reversal and viral clearance strategies to eradicate established HIV infection. The development of LRAs is burdened by many uncertainties that make drug discovery difficult. The biology of HIV latency is complex and incompletely understood. Potential targets for LRAs are host factors, and the potential toxicities of host-directed therapies in individuals that are otherwise clinically stable may be unacceptable. Assays to measure latency reversal and assess the effectiveness of potential therapeutics are complex and incompletely validated. Despite these obstacles, novel LRAs are under development and beginning to enter combination testing with viral clearance strategies. It is hoped that the steady advances in the development of LRAs now being paired with emerging immunotherapeutics to clear persistently infected cells will soon allow measurable clinical advances toward an HIV cure. PMID:28520964
Leal, Rodolfo O; Gil, Solange; Duarte, Ana; McGahie, David; Sepúlveda, Nuno; Niza, Maria M R E; Tavares, Luís
2015-04-01
This study assesses viremia, provirus and blood cytokine profile in naturally FIV-infected cats treated with two distinct protocols of interferon omega (rFeIFN-ω). Samples from FIV-cats previously submitted to two single-arm studies were used: 7/18 received the licensed/subcutaneous protocol (SC) while 11/18 were treated orally (PO). Viremia, provirus and blood mRNA expression of interleukin (IL)-1, IL-4, IL-6, IL-10, IL-12p40, Interferon-γ and Tumor Necrosis Factor-α were monitored by Real-Time qPCR. Concurrent plasma levels of IL-6, IL-12p40 and IL-4 were assessed by ELISA. IL-6 plasma levels decreased in the SC group (p = 0.031). IL-6 mRNA expression (p = 0.037) decreased in the PO group, albeit not sufficiently to change concurrent plasma levels. Neither viremia nor other measured cytokines changed with therapy. Proviral load increased in the SC group (p = 0.031), which can be justified by a clinically irrelevant increase of lymphocyte count. Independently of the protocol, rFeIFN-ω seems to act on innate immunity by reducing pro-inflammatory stimulus. Copyright © 2015 Elsevier Ltd. All rights reserved.
Dunham, Stephen P; Bruce, Jennifer; Klein, Dieter; Flynn, J Norman; Golder, Matthew C; MacDonald, Susan; Jarrett, Oswald; Neil, James C
2006-11-30
Protection against feline immunodeficiency virus (FIV) has been achieved using a variety of vaccines notably whole inactivated virus (WIV) and DNA. However protection against more virulent isolates, typical of those encountered in natural infections, has been difficult to achieve. In an attempt to improve protection against virulent FIV(GL8), we combined both DNA and WIV vaccines in a "prime-boost" approach. Thirty cats were divided into four groups receiving vaccinations and one unvaccinated control group. Following viral challenge, two vaccinated animals, one receiving DNA alone and one the prime-boost vaccine remained free of viraemia, whilst all controls became viraemic. Animals vaccinated with WIV showed apparent early enhancement of infection at 2 weeks post challenge (pc) with higher plasma viral RNA loads than control animals or cats immunised with DNA alone. Despite this, animals vaccinated with WIV or DNA alone showed significantly lower proviral loads in peripheral blood mononuclear cells and mesenteric lymph node cells, whilst those receiving the DNA-WIV prime-boost vaccine showed significantly lower proviral loads in PBMC, than control animals, at 35 weeks pc. Therefore both DNA and WIV vaccines conferred limited protection against viral challenge but the combination of WIV and DNA in a prime-boost approach appeared to offer no significant advantage over either vaccine alone.
Juliarena, Marcela A; Barrios, Clarisa N; Ceriani, M Carolina; Esteban, Eduardo N
2016-06-01
The bovine leukemia virus (BLV) causes leukemia or lymphoma in cattle. Although most BLV-infected animals do not develop the disease, they maintain the transmission chain of BLV at the herd level. As a feasible approach to control the virus, selection of cattle carrying the BoLA-DRB3*0902 allele has been proposed, as this allele is strongly associated with a BLV infection profile or the low proviral load (LPL) phenotype. To test whether these cattle affect the BLV transmission chain under natural conditions, selected BLV-infected LPL-BoLA-DRB3*0902 heterozygous cows were incorporated into a BLV-negative dairy herd. An average ratio of 5.4 (range 4.17-6.37) BLV-negative cows per BLV-infected cow was maintained during the 20mo of the experiment, and no BLV-negative cattle became infected. The BLV incidence rate in this herd was thus zero, whereas BLV incidence rates in different local herds varied from 0.06 to 0.17 cases per 100 cattle-days. This finding strongly suggests that LPL-BoLA-DRB3*0902 cattle disrupted the BLV-transmission chain in the study period. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Guérillot, Romain; Siguier, Patricia; Gourbeyre, Edith; Chandler, Michael; Glaser, Philippe
2014-01-01
Transposable elements (TEs) are major components of both prokaryotic and eukaryotic genomes and play a significant role in their evolution. In this study, we have identified new prokaryotic DDE transposase families related to the eukaryotic Mutator-like transposases. These genes were retrieved by cascade PSI-Blast using as initial query the transposase of the streptococcal integrative and conjugative element (ICE) TnGBS2. By combining secondary structure predictions and protein sequence alignments, we predicted the DDE catalytic triad and the DNA-binding domain recognizing the terminal inverted repeats. Furthermore, we systematically characterized the organization and the insertion specificity of the TEs relying on these prokaryotic Mutator-like transposases (p-MULT) for their mobility. Strikingly, two distant TE families target their integration upstream σA dependent promoters. This allowed us to identify a transposase sequence signature associated with this unique insertion specificity and to show that the dissymmetry between the two inverted repeats is responsible for the orientation of the insertion. Surprisingly, while DDE transposases are generally associated with small and simple transposons such as insertion sequences (ISs), p-MULT encoding TEs show an unprecedented diversity with several families of IS, transposons, and ICEs ranging in size from 1.1 to 52 kb. PMID:24418649
Software-implemented fault insertion: An FTMP example
NASA Technical Reports Server (NTRS)
Czeck, Edward W.; Siewiorek, Daniel P.; Segall, Zary Z.
1987-01-01
This report presents a model for fault insertion through software; describes its implementation on a fault-tolerant computer, FTMP; presents a summary of fault detection, identification, and reconfiguration data collected with software-implemented fault insertion; and compares the results to hardware fault insertion data. Experimental results show detection time to be a function of time of insertion and system workload. For the fault detection time, there is no correlation between software-inserted faults and hardware-inserted faults; this is because hardware-inserted faults must manifest as errors before detection, whereas software-inserted faults immediately exercise the error detection mechanisms. In summary, the software-implemented fault insertion is able to be used as an evaluation technique for the fault-handling capabilities of a system in fault detection, identification and recovery. Although the software-inserted faults do not map directly to hardware-inserted faults, experiments show software-implemented fault insertion is capable of emulating hardware fault insertion, with greater ease and automation.
Einsiedel, Lloyd; Cassar, Olivier; Spelman, Tim; Joseph, Sheela; Gessain, Antoine
2016-05-01
An association between blood stream infections (BSI) and HTLV-1 seropositivity in Indigenous Australians might result from HTLV-1 mediated inflammation and parasite coinfections that provide portals of entry for bacteria. To determine whether BSI risk increases with HTLV-1c proviral load (PVL) and to identify the pathogens responsible in the context of HTLV-1 related conditions. Indigenous adults admitted to Alice Springs Hospital, central Australia, were recruited as cases or controls according to whether they had a BSI. Clinical data were extracted from case notes and the hospital pathology database. HTLV-1 serology and PVL assays were then performed and risk factors for BSI were determined for HTLV-1 infected subjects. Risk factors were compared between 44 cases and 30 controls who were HTLV-1 Western blot positive. In a multivariable model, high HTLV-1c PVL was predictive of BSI during the study period (OR, 9.10; 95% CI, 2.40-34.4). Median (IQR) HTLV-1c PVL (copies per 100 PBL) was 39-fold higher for patients recording any BSI (0.116 (0.009, 0.277)) relative to those who had no BSI (0.003 (0.000, 0.067))(p=0.0007). Mean (SD) PVL for subjects with no BSI (n=27), 1 BSI (n=37) and ≥2 BSI (n=10) during the study period were 0.120 (0.301), 0.271 (0.622) and 0.500 (0.654) copies per 100 PBL, respectively (p=0.0007). Five BSI were associated with possible complications of HTLV-1; strongyloidiasis (3), infective dermatitis (1), HTLV-1 associated bronchiectasis (1). Higher HTLV-1c PVL predicts BSI risk; however; most BSI were not associated with recognised complications of HTLV-1 infection. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.
Germline transformation of the western corn rootworm, Diabrotica virgifera virgifera.
Chu, F; Klobasa, W; Wu, P; Pinzi, S; Grubbs, N; Gorski, S; Cardoza, Y; Lorenzen, M D
2017-08-01
The western corn rootworm (WCR), a major pest of maize, is notorious for rapidly adapting biochemically, behaviourally and developmentally to a variety of control methods. Despite much effort, the genetic basis of WCR adaptation remains a mystery. Since transformation-based applications such as transposon tagging and enhancer trapping have facilitated genetic dissection of model species such as Drosophila melanogaster, we developed a germline-transformation system for WCR in an effort to gain a greater understanding of the basic biology of this economically important insect. Here we report the use of a fluorescent-marked Minos element to create transgenic WCR. We demonstrate that the transgenic strains express both an eye-specific fluorescent marker and piggyBac transposase. We identified insertion-site junction sequences via inverse PCR and assessed insertion copy number using digital droplet PCR (ddPCR). Interestingly, most WCR identified as transgenic via visual screening for DsRed fluorescence proved to carry multiple Minos insertions when tested via ddPCR. A total of eight unique insertion strains were created by outcrossing the initial transgenic strains to nontransgenic WCR mates. Establishing transgenic technologies for this beetle is the first step towards bringing a wide range of transformation-based tools to bear on understanding WCR biology. © 2017 The Royal Entomological Society.
Maffettone, Carmen; Chen, Guohua; Drozdov, Ignat; Ouzounis, Christos; Pantopoulos, Kostas
2010-04-13
Iron regulatory proteins, IRP1 and IRP2, bind to mRNAs harboring iron responsive elements and control their expression. IRPs may also perform additional functions. Thus, IRP1 exhibited apparent tumor suppressor properties in a tumor xenograft model. Here we examined the effects of IRP2 in a similar setting. Human H1299 lung cancer cells or clones engineered for tetracycline-inducible expression of wild type IRP2, or the deletion mutant IRP2(Delta73) (lacking a specific insert of 73 amino acids), were injected subcutaneously into nude mice. The induction of IRP2 profoundly stimulated the growth of tumor xenografts, and this response was blunted by addition of tetracycline in the drinking water of the animals, to turnoff the IRP2 transgene. Interestingly, IRP2(Delta73) failed to promote tumor growth above control levels. As expected, xenografts expressing the IRP2 transgene exhibited high levels of transferrin receptor 1 (TfR1); however, the expression of other known IRP targets was not affected. Moreover, these xenografts manifested increased c-MYC levels and ERK1/2 phosphorylation. A microarray analysis identified distinct gene expression patterns between control and tumors containing IRP2 or IRP1 transgenes. By contrast, gene expression profiles of control and IRP2(Delta73)-related tumors were more similar, consistently with their growth phenotype. Collectively, these data demonstrate an apparent pro-oncogenic activity of IRP2 that depends on its specific 73 amino acids insert, and provide further evidence for a link between IRPs and cancer biology.
Maffettone, Carmen; Chen, Guohua; Drozdov, Ignat; Ouzounis, Christos; Pantopoulos, Kostas
2010-01-01
Iron regulatory proteins, IRP1 and IRP2, bind to mRNAs harboring iron responsive elements and control their expression. IRPs may also perform additional functions. Thus, IRP1 exhibited apparent tumor suppressor properties in a tumor xenograft model. Here we examined the effects of IRP2 in a similar setting. Human H1299 lung cancer cells or clones engineered for tetracycline-inducible expression of wild type IRP2, or the deletion mutant IRP2Δ73 (lacking a specific insert of 73 amino acids), were injected subcutaneously into nude mice. The induction of IRP2 profoundly stimulated the growth of tumor xenografts, and this response was blunted by addition of tetracycline in the drinking water of the animals, to turnoff the IRP2 transgene. Interestingly, IRP2Δ73 failed to promote tumor growth above control levels. As expected, xenografts expressing the IRP2 transgene exhibited high levels of transferrin receptor 1 (TfR1); however, the expression of other known IRP targets was not affected. Moreover, these xenografts manifested increased c-MYC levels and ERK1/2 phosphorylation. A microarray analysis identified distinct gene expression patterns between control and tumors containing IRP2 or IRP1 transgenes. By contrast, gene expression profiles of control and IRP2Δ73-related tumors were more similar, consistently with their growth phenotype. Collectively, these data demonstrate an apparent pro-oncogenic activity of IRP2 that depends on its specific 73 amino acids insert, and provide further evidence for a link between IRPs and cancer biology. PMID:20405006
Survey of the enthesopathy of X-linked hypophosphatemia and its characterization in Hyp mice.
Liang, Guoying; Katz, Lee D; Insogna, Karl L; Carpenter, Thomas O; Macica, Carolyn M
2009-09-01
X-linked hypophosphatemia (XLH) is characterized by rickets and osteomalacia as a result of an inactivating mutation of the PHEX (phosphate-regulating gene with homology to endopeptidases on the X chromosome) gene. PHEX encodes an endopeptidase that, when inactivated, results in elevated circulating levels of FGF-23, a novel phosphate-regulating hormone (a phosphatonin), thereby resulting in increased phosphate excretion and impaired bone mineralization. A generalized and severe mineralizing enthesopathy in patients with XLH was first reported in 1985; we likewise report a survey in which we found evidence of enthesopathy in fibrocartilaginous insertion sites, as well as osteophyte formation, in the majority of patients. Nonetheless, there has been very little focus on the progression and pathogenesis underlying the paradoxical heterotopic calcification of tendon and ligament insertion sites. Such studies have been hampered by lack of a model of mineralizing enthesopathy. We therefore characterized the involvement of the most frequently targeted fibrocartilaginous tendon insertion sites in Hyp mice, a murine model of the XLH mutation that phenocopies the human syndrome in every detail including hypophosphatemia and elevated FGF-23. Histological examination of the affected entheses revealed that mineralizing insertion sites, while thought to involve bone spur formation, were not due to bone-forming osteoblasts but instead to a significant expansion of mineralizing fibrocartilage. Our finding that enthesis fibrocartilage cells specifically express fibroblast growth factor receptor 3 (FGFR3)/Klotho suggests that the high circulating levels of FGF-23, characteristic of XLH and Hyp mice, may be part of the biochemical milieu that underlies the expansion of mineralizing enthesis fibrocartilage.
NASA Technical Reports Server (NTRS)
Norga, Koenraad K.; Gurganus, Marjorie C.; Dilda, Christy L.; Yamamoto, Akihiko; Lyman, Richard F.; Patel, Prajal H.; Rubin, Gerald M.; Hoskins, Roger A.; Mackay, Trudy F.; Bellen, Hugo J.
2003-01-01
BACKGROUND: The identification of the function of all genes that contribute to specific biological processes and complex traits is one of the major challenges in the postgenomic era. One approach is to employ forward genetic screens in genetically tractable model organisms. In Drosophila melanogaster, P element-mediated insertional mutagenesis is a versatile tool for the dissection of molecular pathways, and there is an ongoing effort to tag every gene with a P element insertion. However, the vast majority of P element insertion lines are viable and fertile as homozygotes and do not exhibit obvious phenotypic defects, perhaps because of the tendency for P elements to insert 5' of transcription units. Quantitative genetic analysis of subtle effects of P element mutations that have been induced in an isogenic background may be a highly efficient method for functional genome annotation. RESULTS: Here, we have tested the efficacy of this strategy by assessing the extent to which screening for quantitative effects of P elements on sensory bristle number can identify genes affecting neural development. We find that such quantitative screens uncover an unusually large number of genes that are known to function in neural development, as well as genes with yet uncharacterized effects on neural development, and novel loci. CONCLUSIONS: Our findings establish the use of quantitative trait analysis for functional genome annotation through forward genetics. Similar analyses of quantitative effects of P element insertions will facilitate our understanding of the genes affecting many other complex traits in Drosophila.
Gedvilaite, Alma; Kucinskaite-Kodze, Indre; Lasickiene, Rita; Timinskas, Albertas; Vaitiekaite, Ausra; Ziogiene, Danguole; Zvirbliene, Aurelija
2015-01-01
Recombinant virus-like particles (VLPs) represent a promising tool for protein engineering. Recently, trichodysplasia spinulosa-associated polyomavirus (TSPyV) viral protein 1 (VP1) was efficiently produced in yeast expression system and shown to self-assemble to VLPs. In the current study, TSPyV VP1 protein was exploited as a carrier for construction of chimeric VLPs harboring selected B and T cell-specific epitopes and evaluated in comparison to hamster polyomavirus VP1 protein. Chimeric VLPs with inserted either hepatitis B virus preS1 epitope DPAFR or a universal T cell-specific epitope AKFVAAWTLKAAA were produced in yeast Saccharomyces cerevisiae. Target epitopes were incorporated either at the HI or BC loop of the VP1 protein. The insertion sites were selected based on molecular models of TSPyV VP1 protein. The surface exposure of the insert positions was confirmed using a collection of monoclonal antibodies raised against the intact TSPyV VP1 protein. All generated chimeric proteins were capable to self-assemble to VLPs, which induced a strong immune response in mice. The chimeric VLPs also activated dendritic cells and T cells as demonstrated by analysis of cell surface markers and cytokine production profiles in spleen cell cultures. In conclusion, TSPyV VP1 protein represents a new potential carrier for construction of chimeric VLPs harboring target epitopes. PMID:26230706
In vitro modifications of the scala tympani environment and the cochlear implant array surface.
Kontorinis, Georgios; Scheper, Verena; Wissel, Kirsten; Stöver, Timo; Lenarz, Thomas; Paasche, Gerrit
2012-09-01
To investigate the influence of alterations of the scala tympani environment and modifications of the surface of cochlear implant electrode arrays on insertion forces in vitro. Research experimental study. Fibroblasts producing neurotrophic factors were cultivated on the surface of Nucleus 24 Contour Advance electrodes. Forces were recorded by an Instron 5542 Force Measurement System as three modified arrays were inserted into an artificial scala tympani model filled with phosphate-buffered saline (PBS). The recorded forces were compared to control groups including three unmodified electrodes inserted into a model filled with PBS (unmodified environment) or Healon (current practice). Fluorescence microscopy was used before and after the insertions to identify any remaining fibroblasts. Additionally, three Contour Advance electrodes were inserted into an artificial model, filled with alginate/barium chloride solution at different concentrations, while insertion forces were recorded. Modification of the scala tympani environment with 50% to 75% alginate gel resulted in a significant decrease in the insertion forces. The fibroblast-coated arrays also led to decreased forces comparable to those recorded with Healon. Fluorescence microscopy revealed fully cell-covered arrays before and partially covered arrays after the insertion; the fibroblasts on the arrays' modiolar surface remained intact. Modifications of the scala tympani's environment with 50% to 75% alginate/barium chloride and of the cochlear implant electrode surface with neurotrophic factor-producing fibroblasts drastically reduce the insertion forces. As both modifications may serve future intracochlear therapies, it is expected that these might additionally reduce possible insertion trauma. Copyright © 2012 The American Laryngological, Rhinological, and Otological Society, Inc.
Mantokoudis, Georgios; Huth, Markus E; Weisstanner, Christian; Friedrich, Hergen M; Nauer, Claude; Candreia, Claudia; Caversaccio, Marco D; Senn, Pascal
2016-01-01
The preservation of residual hearing in cochlear implantation opens the door for optimal functional results. This atraumatic surgical technique requires training; however, the traditional human cadaveric temporal bones have become less available or unattainable in some institutions. This study investigates the suitability of an alternative model, using cadaveric lamb temporal bone, for surgical training of atraumatic round window electrode insertion. A total of 14 lamb temporal bones were dissected for cochlear implantation by four surgeons. After mastoidectomy, visualization, and drilling of the round window niche, an atraumatic round window insertion of a Medel Flex24 electrode was performed. Electrode insertion depth and position were verified by computed tomography scans. All cochleas were successfully implanted using the atraumatic round window approach; however, surgical access through the mastoid was substantially different when compared human anatomy. The mean number of intracochlear electrode contacts was 6.5 (range, 4-11) and the mean insertion depth 10.4 mm (range, 4-20 mm), which corresponds to a mean angular perimodiolar insertion depth of 229 degrees (range 67-540°). Full insertion of the electrode was not possible because of the smaller size of the lamb cochlea in comparison to that of the human. The lamb temporal bone model is well suited as a training model for atraumatic cochlear implantation at the level of the round window. The minimally pneumatized mastoid as well as the smaller cochlea can help prepare a surgeon for difficult cochlear implantations. Because of substantial differences to human anatomy, it is not an adequate training model for other surgical techniques such as mastoidectomy and posterior tympanotomy as well as full electrode insertion.
Single-cell transcriptional dynamics of flavivirus infection
Bekerman, Elena
2018-01-01
Dengue and Zika viral infections affect millions of people annually and can be complicated by hemorrhage and shock or neurological manifestations, respectively. However, a thorough understanding of the host response to these viruses is lacking, partly because conventional approaches ignore heterogeneity in virus abundance across cells. We present viscRNA-Seq (virus-inclusive single cell RNA-Seq), an approach to probe the host transcriptome together with intracellular viral RNA at the single cell level. We applied viscRNA-Seq to monitor dengue and Zika virus infection in cultured cells and discovered extreme heterogeneity in virus abundance. We exploited this variation to identify host factors that show complex dynamics and a high degree of specificity for either virus, including proteins involved in the endoplasmic reticulum translocon, signal peptide processing, and membrane trafficking. We validated the viscRNA-Seq hits and discovered novel proviral and antiviral factors. viscRNA-Seq is a powerful approach to assess the genome-wide virus-host dynamics at single cell level. PMID:29451494
Kolappan, Subramaniapillai; Roos, Justin; Yuen, Alex S W; Pierce, Owen M; Craig, Lisa
2012-05-01
The type IV pili are helical filaments found on many Gram-negative pathogenic bacteria, with multiple diverse roles in pathogenesis, including microcolony formation, adhesion, and twitching motility. Many pathogenic enterotoxigenic Escherichia coli (ETEC) isolates express one of two type IV pili belonging to the type IVb subclass: CFA/III or Longus. Here we show a direct correlation between CFA/III expression and ETEC aggregation, suggesting that these pili, like the Vibrio cholerae toxin-coregulated pili (TCP), mediate microcolony formation. We report a 1.26-Å resolution crystal structure of CofA, the major pilin subunit from CFA/III. CofA is very similar in structure to V. cholerae TcpA but possesses a 10-amino-acid insertion that replaces part of the α2-helix with an irregular loop containing a 3(10)-helix. Homology modeling suggests a very similar structure for the Longus LngA pilin. A model for the CFA/III pilus filament was generated using the TCP electron microscopy reconstruction as a template. The unique 3(10)-helix insert fits perfectly within the gap between CofA globular domains. This insert, together with differences in surface-exposed residues, produces a filament that is smoother and more negatively charged than TCP. To explore the specificity of the type IV pilus assembly apparatus, CofA was expressed heterologously in V. cholerae by replacing the tcpA gene with that of cofA within the tcp operon. Although CofA was synthesized and processed by V. cholerae, no CFA/III filaments were detected, suggesting that the components of the type IVb pilus assembly system are highly specific to their pilin substrates.
Analysis and comparison of end effects in linear switched reluctance and hybrid motors
NASA Astrophysics Data System (ADS)
Barhoumi, El Manaa; Abo-Khalil, Ahmed Galal; Berrouche, Youcef; Wurtz, Frederic
2017-03-01
This paper presents and discusses the longitudinal and transversal end effects which affects the propulsive force of linear motors. Generally, the modeling of linear machine considers the forces distortion due to the specific geometry of linear actuators. The insertion of permanent magnets on the stator allows improving the propulsive force produced by switched reluctance linear motors. Also, the inserted permanent magnets in the hybrid structure allow reducing considerably the ends effects observed in linear motors. The analysis was conducted using 2D and 3D finite elements method. The permanent magnet reinforces the flux produced by the winding and reorients it which allows modifying the impact of end effects. Presented simulations and discussions show the importance of this study to characterize the end effects in two different linear motors.
Optimization of Phase Change Memory with Thin Metal Inserted Layer on Material Properties
NASA Astrophysics Data System (ADS)
Harnsoongnoen, Sanchai; Sa-Ngiamsak, Chiranut; Siritaratiwat, Apirat
This works reports, for the first time, the thorough study and optimisation of Phase Change Memory (PCM) structure with thin metal inserted chalcogenide via electrical resistivity (ρ) using finite element modeling. PCM is one of the best candidates for next generation non-volatile memory. It has received much attention recently due to its fast write speed, non-destructive readout, superb scalability, and great compatibility with current silicon-based mass fabrication. The setback of PCM is a high reset current typically higher than 1mA based on 180nm lithography. To reduce the reset current and to solve the over-programming failure, PCM with thin metal inserted chalcogenide (bottom chalcogenide/metal inserted/top chalcogenide) structure has been proposed. Nevertheless, reports on optimisation of the electrical resistivity using the finite element method for this new PCM structure have never been published. This work aims to minimize the reset current of this PCM structure by optimizing the level of the electrical resistivity of the PCM profile using the finite element approach. This work clearly shows that PCM characteristics are strongly affected by the electrical resistivity. The 2-D simulation results reveal clearly that the best thermal transfer of and self-joule-heating at the bottom chalcogenide layer can be achieved under conditions; ρ_bottom chalcogenide > ρ_metal inserted > ρ_top chalcogenide More specifically, the optimized electrical resistivity of PCMTMI is attained with ρ_top chalcogenide: ρ_metal inserted: ρ_bottom chalcogenide ratio of 1:6:16 when ρ_top chalcogenide is 10-3 Ωm. In conclusion, high energy efficiency can be obtained with the reset current as low as 0.3mA and with high speed operation of less than 30ns.
Molecular Studies of HTLV-1 in a Newly Recognized High Risk Population (AIDS).
1992-06-16
proviral DNA from preipheral blood mononuclear cells DNA . Overall rate of infection if 12% for Jews arriving from Khurusan-North-Eastern Iran. No...to policies of applicable Federal Law 45 CFR 46. .1 ) In conducting research utilizing recombinant DNA technology,theestigator(s) adhered to current...clustering and outbreaks of HD suggest possible viral ethiology (11-13). The increasingly frequent reports of Epstein Bar Virus ( EBV ) genome detection
Prach, Lisa M; Puren, Adrian; Lippman, Sheri A; Carmona, Sergio; Stephenson, Sophie; Cutler, Ewalde; Barnhart, Scott; Liegler, Teri
2015-03-01
An external quality assurance program was developed for HIV-1 RNA viral load measurements taken from dried blood spots using a reference panel and field-collected specimens. The program demonstrated that accurate and reproducible quantitation can be obtained from field-collected specimens. Residual proviral DNA may confound interpretation in virologically suppressed subjects. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Ultrathin Ceramic Membranes as Scaffolds for Functional Cell Coculture Models on a Biomimetic Scale
Jud, Corinne; Ahmed, Sher; Müller, Loretta; Kinnear, Calum; Vanhecke, Dimitri; Umehara, Yuki; Frey, Sabine; Liley, Martha; Angeloni, Silvia; Petri-Fink, Alke; Rothen-Rutishauser, Barbara
2015-01-01
Abstract Epithelial tissue serves as an interface between biological compartments. Many in vitro epithelial cell models have been developed as an alternative to animal experiments to answer a range of research questions. These in vitro models are grown on permeable two-chamber systems; however, commercially available, polymer-based cell culture inserts are around 10 μm thick. Since the basement membrane found in biological systems is usually less than 1 μm thick, the 10-fold thickness of cell culture inserts is a major limitation in the establishment of realistic models. In this work, an alternative insert, accommodating an ultrathin ceramic membrane with a thickness of only 500 nm (i.e., the Silicon nitride Microporous Permeable Insert [SIMPLI]-well), was produced and used to refine an established human alveolar barrier coculture model by both replacing the conventional inserts with the SIMPLI-well and completing it with endothelial cells. The structural–functional relationship of the model was evaluated, including the translocation of gold nanoparticles across the barrier, revealing a higher translocation if compared to corresponding polyethylene terephthalate (PET) membranes. This study demonstrates the power of the SIMPLI-well system as a scaffold for epithelial tissue cell models on a truly biomimetic scale, allowing construction of more functionally accurate models of human biological barriers. PMID:26713225
In vivo and in vitro disease modeling with CRISPR/Cas9.
Kato, Tomoko; Takada, Shuji
2017-01-01
In the past few years, extensive progress has been made in the development of genome-editing technology. Among several genome-editing tools, the clustered regularly interspaced short palindrome repeat-associated Cas9 nuclease (CRISPR/Cas9) system is particularly widely used owing to the ease of sequence-specific nuclease construction and the highly efficient introduction of mutations. The CRISPR/Cas9 system was originally constructed to induce small insertion and deletion mutations, but various methods have been developed to introduce point mutations, deletions, insertions, chromosomal translocations and so on. These methods should be useful for the reconstruction of disease-causing mutations in cultured cell lines and living organisms to elucidate disease pathogenesis and for disease prevention, treatment and drug discovery. This review summarizes the current technical aspects of the CRISPR/Cas9 system for disease modeling in cultured cells and living organisms, mainly mice. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Rapid and sensitive insulated isothermal PCR for point-of-need feline leukaemia virus detection.
Wilkes, Rebecca P; Anis, Eman; Dunbar, Dawn; Lee, Pei-Yu A; Tsai, Yun-Long; Lee, Fu-Chun; Chang, Hsiao-Fen G; Wang, Hwa-Tang T; Graham, Elizabeth M
2018-04-01
Objectives Feline leukaemia virus (FeLV), a gamma retrovirus, causes diseases of the feline haematopoietic system that are invariably fatal. Rapid and accurate testing at the point-of-need (PON) supports prevention of virus spread and management of clinical disease. This study evaluated the performance of an insulated isothermal PCR (iiPCR) that detects proviral DNA, and a reverse transcription (RT)-iiPCR that detects both viral RNA and proviral DNA, for FeLV detection at the PON. Methods Mycoplasma haemofelis, feline coronavirus, feline herpesvirus, feline calicivirus and feline immunodeficiency virus were used to test analytical specificity. In vitro transcribed RNA, artificial plasmid, FeLV strain American Type Culture Collection VR-719 and a clinical FeLV isolate were used in the analytical sensitivity assays. A retrospective study including 116 clinical plasma and serum samples that had been tested with virus isolation, real-time PCR and ELISA, and a prospective study including 150 clinical plasma and serum samples were implemented to evaluate the clinical performances of the iiPCR-based methods for FeLV detection. Results Ninety-five percent assay limit of detection was calculated to be 16 RNA and five DNA copies for the RT-iiPCR, and six DNA copies for the iiPCR. Both reactions had analytical sensitivity comparable to a reference real-time PCR (qPCR) and did not detect five non-target feline pathogens. The clinical performance of the RT-iiPCR and iiPCR had 98.82% agreement (kappa[κ] = 0.97) and 100% agreement (κ = 1.0), respectively, with the qPCR (n = 85). The agreement between an automatic nucleic extraction/RT-iiPCR system and virus isolation to detect FeLV in plasma or serum was 95.69% (κ = 0.95) and 98.67% (κ = 0.85) in a retrospective (n = 116) and a prospective (n = 150) study, respectively. Conclusions and relevance These results suggested that both RT-iiPCR and iiPCR assays can serve as reliable tools for PON FeLV detection.
From non-preemptive to preemptive scheduling using synchronization synthesis.
Černý, Pavol; Clarke, Edmund M; Henzinger, Thomas A; Radhakrishna, Arjun; Ryzhyk, Leonid; Samanta, Roopsha; Tarrach, Thorsten
2017-01-01
We present a computer-aided programming approach to concurrency. The approach allows programmers to program assuming a friendly, non-preemptive scheduler, and our synthesis procedure inserts synchronization to ensure that the final program works even with a preemptive scheduler. The correctness specification is implicit, inferred from the non-preemptive behavior. Let us consider sequences of calls that the program makes to an external interface. The specification requires that any such sequence produced under a preemptive scheduler should be included in the set of sequences produced under a non-preemptive scheduler. We guarantee that our synthesis does not introduce deadlocks and that the synchronization inserted is optimal w.r.t. a given objective function. The solution is based on a finitary abstraction, an algorithm for bounded language inclusion modulo an independence relation, and generation of a set of global constraints over synchronization placements. Each model of the global constraints set corresponds to a correctness-ensuring synchronization placement. The placement that is optimal w.r.t. the given objective function is chosen as the synchronization solution. We apply the approach to device-driver programming, where the driver threads call the software interface of the device and the API provided by the operating system. Our experiments demonstrate that our synthesis method is precise and efficient. The implicit specification helped us find one concurrency bug previously missed when model-checking using an explicit, user-provided specification. We implemented objective functions for coarse-grained and fine-grained locking and observed that different synchronization placements are produced for our experiments, favoring a minimal number of synchronization operations or maximum concurrency, respectively.
Li, Zihui; Kuhn, Gisela; Schirmer, Michael; Müller, Ralph; Ruffoni, Davide
2017-01-01
Although osteoporotic bone, with low bone mass and deteriorated bone architecture, provides a less favorable mechanical environment than healthy bone for implant fixation, there is no general agreement on the impact of osteoporosis on peri-implant bone (re)modeling, which is ultimately responsible for the long term stability of the bone-implant system. Here, we inserted an implant in a mouse model mimicking estrogen deficiency-induced bone loss and we monitored with longitudinal in vivo micro-computed tomography the spatio-temporal changes in bone (re)modeling and architecture, considering the separate contributions of trabecular, endocortical and periosteal surfaces. Specifically, 12 week-old C57BL/6J mice underwent OVX/SHM surgery; 9 weeks after we inserted special metal-ceramics implants into the 6th caudal vertebra and we measured bone response with in vivo micro-CT weekly for the following 6 weeks. Our results indicated that ovariectomized mice showed a reduced ability to increase the thickness of the cortical shell close to the implant because of impaired peri-implant bone formation, especially at the periosteal surface. Moreover, we observed that healthy mice had a significantly higher loss of trabecular bone far from the implant than estrogen depleted animals. Such behavior suggests that, in healthy mice, the substantial increase in peri-implant bone formation which rapidly thickened the cortex to secure the implant may raise bone resorption elsewhere and, specifically, in the trabecular network of the same bone but far from the implant. Considering the already deteriorated bone structure of estrogen depleted mice, further bone loss seemed to be hindered. The obtained knowledge on the dynamic response of diseased bone following implant insertion should provide useful guidelines to develop advanced treatments for osteoporotic fracture fixation based on local and selective manipulation of bone turnover in the peri-implant region.
Li, Zihui; Kuhn, Gisela; Schirmer, Michael; Müller, Ralph
2017-01-01
Although osteoporotic bone, with low bone mass and deteriorated bone architecture, provides a less favorable mechanical environment than healthy bone for implant fixation, there is no general agreement on the impact of osteoporosis on peri-implant bone (re)modeling, which is ultimately responsible for the long term stability of the bone-implant system. Here, we inserted an implant in a mouse model mimicking estrogen deficiency-induced bone loss and we monitored with longitudinal in vivo micro-computed tomography the spatio-temporal changes in bone (re)modeling and architecture, considering the separate contributions of trabecular, endocortical and periosteal surfaces. Specifically, 12 week-old C57BL/6J mice underwent OVX/SHM surgery; 9 weeks after we inserted special metal-ceramics implants into the 6th caudal vertebra and we measured bone response with in vivo micro-CT weekly for the following 6 weeks. Our results indicated that ovariectomized mice showed a reduced ability to increase the thickness of the cortical shell close to the implant because of impaired peri-implant bone formation, especially at the periosteal surface. Moreover, we observed that healthy mice had a significantly higher loss of trabecular bone far from the implant than estrogen depleted animals. Such behavior suggests that, in healthy mice, the substantial increase in peri-implant bone formation which rapidly thickened the cortex to secure the implant may raise bone resorption elsewhere and, specifically, in the trabecular network of the same bone but far from the implant. Considering the already deteriorated bone structure of estrogen depleted mice, further bone loss seemed to be hindered. The obtained knowledge on the dynamic response of diseased bone following implant insertion should provide useful guidelines to develop advanced treatments for osteoporotic fracture fixation based on local and selective manipulation of bone turnover in the peri-implant region. PMID:28910363
A single gene mutation that increases maize seed weight
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giroux, M.J.; Shaw, J.; Hannah, L.C.
1996-06-11
The maize endosperm-specific gene shrunken2 (Sh2) encodes the large subunit of the heterotetrameric starch synthetic enzyme adenosine diphosphoglucose pyrophosphorylase (AGP; EC 2.7.7.27). Here we exploit an in vivo, site-specific mutagenesis system to create short insertion mutations in a region of the gene known to be involved in the allosteric regulation of AGP. The site-specific mutagen is the transposable element dissociation (Ds). Approximately one-third (8 of 23) of the germinal revertants sequenced restored the wild-type sequence, whereas the remaining revertants contained insertions of 3 or 6 bp. All revertants retained the original reading frame 3 feet to the insertion site andmore » involved the addition of tyrosine and/or serine. Each insertion revertant reduced total AGP activity and the amount of the SH2 protein. The revertant containing additional tyrosine and serine residues increased seed weight 11-18% without increasing or decreasing the percentage of starch. Other insertion revertants lacking an additional serine reduced seed weight. Reduced sensitivity to phosphate, a long-known inhibitor of AGP, was found in the high seed-weight revertant. This alteration is likely universally important since insertion of tyrosine and serine in the potato large subunit of AGP at the comparable position and expression in Escherichia coli also led to a phosphate-insensitive enzyme. These results show that single gene mutations giving rise to increased seed weight, and therefore perhaps yield, are clearly possible in a plant with a long history of intensive and successful breeding efforts. 20 refs., 5 figs., 5 tabs.« less
Modeling of laser welding of steel and titanium plates with a composite insert
NASA Astrophysics Data System (ADS)
Isaev, V. I.; Cherepanov, A. N.; Shapeev, V. P.
2017-10-01
A 3D model of laser welding proposed before by the authors was extended to the case of welding of metallic plates made of dissimilar materials with a composite multilayer intermediate insert. The model simulates heat transfer in the welded plates and takes into account phase transitions. It was proposed to select the composition of several metals and dimensions of the insert to avoid the formation of brittle intermetallic phases in the weld joint negatively affecting its strength properties. The model accounts for key physical phenomena occurring during the complex process of laser welding. It is capable to calculate temperature regimes at each point of the plates. The model can be used to select the welding parameters reducing the risk of formation of intermetallic plates. It can forecast the dimensions and crystalline structure of the solidified melt. Based on the proposed model a numerical algorithm was constructed. Simulations were carried out for the welding of titanium and steel plates with a composite insert comprising four different metals: copper and niobium (intermediate plates) with steel and titanium (outer plates). The insert is produced by explosion welding. Temperature fields and the processes of melting, evaporation, and solidification were studied.
Hornof, Margit; Weyenberg, Wim; Ludwig, Annick; Bernkop-Schnürch, Andreas
2003-05-20
The aim of the study was to develop a mucoadhesive ocular insert for the controlled delivery of ophthalmic drugs and to evaluate its efficacy in vivo. The inserts tested were based either on unmodified or thiolated poly(acrylic acid). Water uptake and swelling behavior of the inserts as well as the drug release rates of the model drugs fluorescein and two diclofenac salts with different solubility properties were evaluated in vitro. Fluorescein was used as fluorescent tracer to study the drug release from the insert in humans. The mean fluorescein concentration in the cornea/tearfilm compartment as a function of time was determined after application of aqueous eye drops and inserts composed of unmodified and of thiolated poly(acrylic acid). The acceptability of the inserts by the volunteers was also evaluated. Inserts based on thiolated poly(acrylic acid) were not soluble and had good cohesive properties. A controlled release was achieved for the incorporated model drugs. The in vivo study showed that inserts based on thiolated poly(acrylic acid) provide a fluorescein concentration on the eye surface for more than 8 h, whereas the fluorescein concentration rapidly decreased after application of aqueous eye drops or inserts based on unmodified poly(acrylic acid). Moreover, these inserts were well accepted by the volunteers. The present study indicates that ocular inserts based on thiolated poly(acrylic acid) are promising new solid devices for ocular drug delivery.
A new molecular evolution model for limited insertion independent of substitution.
Lèbre, Sophie; Michel, Christian J
2013-10-01
We recently introduced a new molecular evolution model called the IDIS model for Insertion Deletion Independent of Substitution [13,14]. In the IDIS model, the three independent processes of substitution, insertion and deletion of residues have constant rates. In order to control the genome expansion during evolution, we generalize here the IDIS model by introducing an insertion rate which decreases when the sequence grows and tends to 0 for a maximum sequence length nmax. This new model, called LIIS for Limited Insertion Independent of Substitution, defines a matrix differential equation satisfied by a vector P(t) describing the sequence content in each residue at evolution time t. An analytical solution is obtained for any diagonalizable substitution matrix M. Thus, the LIIS model gives an expression of the sequence content vector P(t) in each residue under evolution time t as a function of the eigenvalues and the eigenvectors of matrix M, the residue insertion rate vector R, the total insertion rate r, the initial and maximum sequence lengths n0 and nmax, respectively, and the sequence content vector P(t0) at initial time t0. The derivation of the analytical solution is much more technical, compared to the IDIS model, as it involves Gauss hypergeometric functions. Several propositions of the LIIS model are derived: proof that the IDIS model is a particular case of the LIIS model when the maximum sequence length nmax tends to infinity, fixed point, time scale, time step and time inversion. Using a relation between the sequence length l and the evolution time t, an expression of the LIIS model as a function of the sequence length l=n(t) is obtained. Formulas for 'insertion only', i.e. when the substitution rates are all equal to 0, are derived at evolution time t and sequence length l. Analytical solutions of the LIIS model are explicitly derived, as a function of either evolution time t or sequence length l, for two classical substitution matrices: the 3-parameter symmetric substitution matrix [12] (LIIS-SYM3) and the HKY asymmetric substitution matrix[9] (LIIS-HKY). An evaluation of the LIIS model (precisely, LIIS-HKY) based on four statistical analyses of the GC content in complete genomes of four prokaryotic taxonomic groups, namely Chlamydiae, Crenarchaeota, Spirochaetes and Thermotogae, shows the expected improvement from the theory of the LIIS model compared to the IDIS model. Copyright © 2013 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Yamagata, Atsushi; Yoshida, Tomoyuki; Sato, Yusuke; Goto-Ito, Sakurako; Uemura, Takeshi; Maeda, Asami; Shiroshima, Tomoko; Iwasawa-Okamoto, Shiho; Mori, Hisashi; Mishina, Masayoshi; Fukai, Shuya
2015-04-01
Synapse formation is triggered through trans-synaptic interaction between pairs of pre- and postsynaptic adhesion molecules, the specificity of which depends on splice inserts known as `splice-insert signaling codes'. Receptor protein tyrosine phosphatase δ (PTPδ) can bidirectionally induce pre- and postsynaptic differentiation of neurons by trans-synaptically binding to interleukin-1 receptor accessory protein (IL-1RAcP) and IL-1RAcP-like-1 (IL1RAPL1) in a splicing-dependent manner. Here, we report crystal structures of PTPδ in complex with IL1RAPL1 and IL-1RAcP. The first immunoglobulin-like (Ig) domain of IL1RAPL1 directly recognizes the first splice insert, which is critical for binding to IL1RAPL1. The second splice insert functions as an adjustable linker that positions the Ig2 and Ig3 domains of PTPδ for simultaneously interacting with the Ig1 domain of IL1RAPL1 or IL-1RAcP. We further identified the IL1RAPL1-specific interaction, which appears coupled to the first-splice-insert-mediated interaction. Our results thus reveal the decoding mechanism of splice-insert signaling codes for synaptic differentiation induced by trans-synaptic adhesion between PTPδ and IL1RAPL1/IL-1RAcP.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gaede, S; Jordan, K; Western University, London, ON
Purpose: To present a customized programmable moving insert for the ArcCHECK™ phantom that can, in a single delivery, check both entrance dosimetry, while simultaneously verifying the delivery of respiratory-gated VMAT. Methods: The cylindrical motion phantom uses a computer-controlled stepping motor to move an insert inside a stationery sleeve. Insert motion is programmable and can include rotational motion in addition to linear motion along the axis of the cylinder. The sleeve fits securely in the bore of the ArcCHECK™. Interchangeable inserts, including an A1SL chamber, optically-stimulated luminescence dosimeters, radiochromic film, or 3D gels, allow this combination to be used for commissioning,more » routine quality assurance, and patient-specific dosimetric verification of respiratory-gated VMAT. Before clinical implementation, the effect of a moving insert on the ArcCHECK™ measurements was considered. First, the measured dose to the ArcCHECK™ containing multiple inserts in the static position was compared to the calculated dose during multiple VMAT treatment deliveries. Then, dose was measured under both sinusoidal and real-patient motion conditions to determine any effect of the moving inserts on the ArcCHECK™ measurements. Finally, dose was measured during gated VMAT delivery to the same inserts under the same motion conditions to examine any effect of various beam “on-and-off” and dose rate ramp “up-and-down”. Multiple comparisons between measured and calculated dose to different inserts were also considered. Results: The pass rate for the static delivery exceeded 98% for all measurements (3%/3mm), suggesting a valid setup for entrance dosimetry. The pass rate was not altered for any measurement delivered under motion conditions. A similar Result was observed under gated VMAT conditions, including agreement of measured and calculated dose to the various inserts. Conclusion: Incorporating a programmable moving insert within the ArcCHECK™ phantom provides an efficient verification of respiratory-gated VMAT delivery that is useful during commissioning, routine quality assurance, and patient-specific dose verification. Prototype phantom development and testing was performed in collaboration with Modus Medical Devices Inc. (London, ON). No financial support was granted.« less
Vachhani, Raj; Patel, Toral; Centor, Robert M; Estrada, Carlos A
2017-01-01
Meta-analyses based on peer-reviewed publications report a sensitivity of approximately 85% for rapid antigen streptococcus tests to diagnose group A streptococcal (GAS) pharyngitis. Because these meta-analyses excluded package inserts, we examined the test characteristics of rapid antigen streptococcal tests and molecular methods that manufacturers report in their package inserts. We included tests available in the US market (Food and Drug Administration, period searched 1993-2015) and used package insert data to calculate pooled sensitivity and specificity. To examine quality, we used the Quality Assessment of Diagnostic Accuracy Studies-2. We excluded 26 tests having different trade names but identical methods and data. The study design was prospective in 41.7% (10 of 24). The pooled sensitivity of the most commonly used method, lateral flow/immunochromatographic, was 95% (95% confidence interval [CI] 94-96) and the pooled specificity was 98% (96-98); 7108 patients. The pooled sensitivity of the polymerase chain reaction or molecular methods was 98% (95% CI 96-98) and the pooled specificity was 96% (95% CI 95-97); 5685 patients. Package inserts include sponsored studies that overestimate the sensitivity of rapid tests to diagnose GAS pharyngitis by approximately 10%. Physicians should understand that package inserts overestimate diagnostic test utility; a negative test cannot be used to exclude GAS pharyngitis.
Efficient Exploration of Membrane-Associated Phenomena at Atomic Resolution.
Vermaas, Josh V; Baylon, Javier L; Arcario, Mark J; Muller, Melanie P; Wu, Zhe; Pogorelov, Taras V; Tajkhorshid, Emad
2015-06-01
Biological membranes constitute a critical component in all living cells. In addition to providing a conducive environment to a wide range of cellular processes, including transport and signaling, mounting evidence has established active participation of specific lipids in modulating membrane protein function through various mechanisms. Understanding lipid-protein interactions underlying these mechanisms at a sufficiently high resolution has proven extremely challenging, partly due to the semi-fluid nature of the membrane. In order to address this challenge computationally, multiple methods have been developed, including an alternative membrane representation termed highly mobile membrane mimetic (HMMM) in which lateral lipid diffusion has been significantly enhanced without compromising atomic details. The model allows for efficient sampling of lipid-protein interactions at atomic resolution, thereby significantly enhancing the effectiveness of molecular dynamics simulations in capturing membrane-associated phenomena. In this review, after providing an overview of HMMM model development, we will describe briefly successful application of the model to study a variety of membrane processes, including lipid-dependent binding and insertion of peripheral proteins, the mechanism of phospholipid insertion into lipid bilayers, and characterization of optimal tilt angle of transmembrane helices. We conclude with practical recommendations for proper usage of the model in simulation studies of membrane processes.
WE-FG-207B-08: Dual-Energy CT Iodine Accuracy Across Vendors and Platforms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jacobsen, M; Wood, C; Cody, D
Purpose: Although a major benefit of dual-energy CT is its quantitative capabilities, it is critical to understand how results vary by scanner manufacturer and/or model before making clinical patient management decisions. Each manufacturer utilizes a specific dual-energy CT approach; cross-calibration may be required for facilities with more than one dual-energy CT scanner type. Methods: A solid dual-energy quality control phantom (Gammex, Inc.; Appleton, WI) representing a large body cross-section containing three Iodine inserts (2mg/ml, 5mg/ml, 15 mg/ml) was scanned on these CT systems: GE HD-750 (80/140kVp), prototype GE Revolution CT with GSI (80/140kVp), Siemens Flash (80/140kVp and 100/140kVp), and Philipsmore » IQon (120kVp and 140kVp). Iodine content was measured in units of concentration (mg/ml) from a single 5mm-thick central image. Three to five acquisitions were performed on each scanner platform in order to compute standard deviation. Scan acquisitions were approximately dose-matched (∼25mGy CTDIvol) and image parameters were as consistent as possible (thickness, kernel, no noise reduction applied). Results: Iodine measurement error ranges were −0.24-0.16 mg/ml for the 2mg/ml insert (−12.0 − 8.0%), −0.28–0.26 mg/ml for the 5mg/ml insert (−5.6 − 5.2%), and −1.16−0.99 mg/ml for the 15mg/ml insert (−7.7 − 6.6%). Standard deviations ranged from 0 to 0.19 mg/ml for the repeated acquisitions from each scanner. The average iodine measurement error and standard deviation across all systems and inserts was −0.21 ± 0.48 mg/ml (−1.5 ± 6.48%). The largest absolute measurement error was found in the 15mg/ml iodine insert. Conclusion: There was generally good agreement in Iodine quantification across 3 dual-energy CT manufacturers and 4 scanner models. This was unexpected given the widely different underlying dual-energy CT mechanisms employed. Future work will include additional scanner platforms, independent verification of the Iodine insert standard concentrations (especially the 15 mg/ml insert), and how much measurement variability can be clinically tolerated. This research has been supported by funds from Dr. William Murphy, Jr., the John S. Dunn, Sr. Distinguished Chair in Diagnostic Imaging at MD Anderson Cancer Center.« less
Characterisation of protein stability in rod-insert vaginal rings.
Pattani, Aditya; Lowry, Deborah; Curran, Rhonda M; McGrath, Stephanie; Kett, Vicky L; Andrews, Gavin P; Malcolm, R Karl
2012-07-01
A major goal in vaccine development is elimination of the 'cold chain', the transport and storage system for maintenance and distribution of the vaccine product. This is particularly pertinent to liquid formulation of vaccines. We have previously described the rod-insert vaginal ring (RiR) device, comprising an elastomeric body into which are inserted lyophilised, rod-shaped, solid drug dosage forms, and having potential for sustained mucosal delivery of biomacromolecules, such as HIV envelope protein-based vaccine candidates. Given the solid, lyophilised nature of these insert dosage forms, we hypothesised that antigen stability may be significantly increased compared with more conventional solubilised vaginal gel format. In this study, we prepared and tested vaginal ring devices fitted with lyophilised rod inserts containing the model antigen bovine serum albumin (BSA). Both the RiRs and the gels that were freeze-dried to prepare the inserts were evaluated for BSA stability using PAGE, turbidimetry, microbial load, MALDI-TOF and qualitative precipitate solubility measurements. When stored at 4 °C, but not when stored at 40 °C/75% RH, the RiR formulation offered protection against structural and conformational changes to BSA. The insert also retained matrix integrity and release characteristics. The results demonstrate that lypophilised gels can provide relative protection against degradation at lower temperatures compared to semi-solid gels. The major mechanism of degradation at 40 °C/75% RH was shown to be protein aggregation. Finally, in a preliminary study, we found that addition of trehalose to the formulation significantly reduces the rate of BSA degradation compared to the original formulation when stored at 40 °C/75% RH. Establishing the mechanism of degradation, and finding that degradation is decelerated in the presence of trehalose, will help inform further development of RiRs specifically and polymer based freeze-dried systems in general. Copyright © 2012 Elsevier B.V. All rights reserved.
ENDOGENOUS RETROVIRUSES MOBILIZED DURING FRIEND MURINE LEUKEMIA VIRUS INFECTION
Hansen, Ethan; Hendrick, Duncan; Malik, Frank; Evans, Leonard H.
2016-01-01
We have demonstrated in a mouse model that infection with a retrovirus can lead not only to the generation of recombinants between exogenous and endogenous gammaretrovirus, but also to the mobilization of endogenous proviruses by pseudotyping entire polytropic proviral transcripts and facilitating their infectious spread to new cells. However, the frequency of this occurrence, the kinetics, and the identity of mobilized endogenous proviruses was unclear. Here we find that these mobilized transcripts are detected after only one day of infection. They predominate over recombinant polytropic viruses early in infection, persist throughout the course of disease and are comprised of multiple different polytropic proviruses. Other endogenous retroviral elements such as intracisternal A particles (IAPs) were not detected. The integration of the endogenous transcripts into new cells could result in loss of transcriptional control and elevated expression which may facilitate pathogenesis, perhaps by contributing to the generation of polytropic recombinant viruses. PMID:27657834
Andrei, Alexandru; Welkenhuysen, Marleen; Ameye, Lieveke; Nuttin, Bart; Eberle, Wolfgang
2011-01-01
Understanding the mechanical interactions between implants and the surrounding tissue is known to have an important role for improving the bio-compatibility of such devices. Using a recently developed model, a particular micro-machined neural implant design aiming the reduction of insertion forces dependence on the insertion speed was optimized. Implantations with 10 and 100 μm/s insertion speeds showed excellent agreement with the predicted behavior. Lesion size, gliosis (GFAP), inflammation (ED1) and neuronal cells density (NeuN) was evaluated after 6 week of chronic implantation showing no insertion speed dependence.
An image guidance system for positioning robotic cochlear implant insertion tools
NASA Astrophysics Data System (ADS)
Bruns, Trevor L.; Webster, Robert J.
2017-03-01
Cochlear implants must be inserted carefully to avoid damaging the delicate anatomical structures of the inner ear. This has motivated several approaches to improve the safety and efficacy of electrode array insertion by automating the process with specialized robotic or manual insertion tools. When such tools are used, they must be positioned at the entry point to the cochlea and aligned with the desired entry vector. This paper presents an image guidance system capable of accurately positioning a cochlear implant insertion tool. An optical tracking system localizes the insertion tool in physical space while a graphical user interface incorporates this with patient- specific anatomical data to provide error information to the surgeon in real-time. Guided by this interface, novice users successfully aligned the tool with an mean accuracy of 0.31 mm.
Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health
Martin, William F.
2017-01-01
Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. PMID:28444372
Incorporation of excess wild-type and mutant tRNA(3Lys) into human immunodeficiency virus type 1.
Huang, Y; Mak, J; Cao, Q; Li, Z; Wainberg, M A; Kleiman, L
1994-01-01
Human immunodeficiency virus (HIV) particles produced in COS-7 cells transfected with HIV type 1 (HIV-1) proviral DNA contain 8 molecules of tRNA(3Lys) per 2 molecules of genomic RNA and 12 molecules of tRNA1,2Lys per 2 molecules of genomic RNA. When COS-7 cells are transfected with a plasmid containing both HIV-1 proviral DNA and a human tRNA3Lys gene, there is a large increase in the amount of cytoplasmic tRNA3Lys per microgram of total cellular RNA, and the tRNA3Lys content in the virus increases from 8 to 17 molecules per 2 molecules of genomic RNA. However, the total number of tRNALys molecules per 2 molecules of genomic RNA remains constant at 20; i.e., the viral tRNA1,2Lys content decreases from 12 to 3 molecules per 2 molecules of genomic RNA. All detectable tRNA3Lys is aminoacylated in the cytoplasm of infected cells and deacylated in the virus. When COS-7 cells are transfected with a plasmid containing both HIV-1 proviral DNA and a mutant amber suppressor tRNA3Lys gene (in which the anticodon is changed from TTT to CTA), there is also a large increase in the relative concentration of cytoplasmic tRNA3Lys, and the tRNA3Lys content in the virus increases from 8 to 15 molecules per 2 molecules of genomic RNA, with a decrease in viral tRNA1,2Lys from 12 to 5 molecules per 2 molecules of genomic RNA. Thus, the total number of molecules of tRNALys in the virion remains at 20. The alteration of the anticodon has little effect on the viral packaging of this mutant tRNA in spite of the fact that it no longer contains the modified base mcm 5s2U at position 34, and its ability to be aminoacylated is significantly impaired compared with that of wild-type tRNA3Lys. Viral particles which have incorporated either excess wild-type tRNA3Lys or mutant suppressor tRNA3Lys show no differences in viral infectivity compared with wild-type HIV-1. Images PMID:7966556
Loss of retrovirus production in JB/RH melanoma cells transfected with H-2Kb and TAP-1 genes.
Li, M; Xu, F; Muller, J; Huang, X; Hearing, V J; Gorelik, E
1999-01-20
JB/RH1 melanoma cells, as well as other melanomas of C57BL/6 mice (B16 and JB/MS), express a common melanoma-associated antigen (MAA) encoded by an ecotropic melanoma-associated retrovirus (MelARV). JB/RH1 cells do not express the H-2Kb molecules due to down-regulation of the H-2Kb and TAP-1 genes. When JB/RH1 cells were transfected with the H-2Kb and cotransfected with the TAP-1 gene, it resulted in the appearance of H-2Kb molecules and an increase in their immunogenicity, albeit they lost expression of retrovirus-encoded MAA recognized by MM2-9B6 mAb. Loss of MAA was found to result from a complete and stable elimination of ecotropic MelARV production in the H-2Kb/TAP-1-transfected JB/RH1 cells. Northern blot analysis showed no differences in ecotropic retroviral messages in MelARV-producing and -nonproducing melanoma cells, suggesting that loss of MelARV production was not due to down-regulation of MelARV transcription. Southern blot analysis revealed several rearrangements in the proviral DNA of H-2Kb-positive JB/RH1 melanoma cells. Sequence analysis of the ecotropic proviral DNA from these cells showed numerous nucleotide substitutions, some of which resulted in the appearance of a novel intraviral PstI restriction site and the loss of a HindIII restriction site in the pol region. PCR amplification of the proviral DNAs indicates that an ecotropic provirus found in the H-2Kb-positive cells is novel and does not preexist in the parental H-2Kb-negative melanoma cells. Conversely, the ecotropic provirus of the parental JB/RH1 cells was not amplifable from the H-2Kb-positive cells. Our data indicate that stable loss of retroviral production in the H-2Kb/TAP-1-transfected melanoma cells is probably due to the induction of recombination between a productive ecotropic MelARV and a defective nonecotropic provirus leading to the generation of a defective ecotropic provirus and the loss of MelARV production and expression of the retrovirus-encoded MAA. Copyright 1999 Academic Press.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stromberg, Loreen R.; Hengartner, Nicolas W.; Swingle, Kirstie L.
Shiga toxin-producing Escherichia coli is an important cause of foodborne illness, with cases attributable to beef, fresh produce and other sources. Many serotypes of the pathogen cause disease, and differentiating one serotype from another requires specific identification of the O antigen located on the lipopolysaccharide (LPS) molecule. The amphiphilic structure of LPS poses a challenge when using classical detection methods, which do not take into account its lipoglycan biochemistry. Typically, detection of LPS requires heat or chemical treatment of samples and relies on bioactivity assays for the conserved lipid A portion of the molecule. Our goal was to develop assaysmore » to facilitate the direct and discriminative detection of the entire LPS molecule and its O antigen in complex matrices using minimal sample processing. To perform serogroup identification of LPS, we used a method called membrane insertion on a waveguide biosensor, and tested three serogroups of LPS. The membrane insertion technique allows for the hydrophobic association of LPS with a lipid bilayer, where the exposed O antigen can be targeted for specific detection. Samples of beef lysate were spiked with LPS to perform O antigen specific detection of LPS from E. coli O157. To validate assay performance, we evaluated the biophysical interactions of LPS with lipid bilayers both in- and outside of a flow cell using fluorescence microscopy and fluorescently doped lipids. Our results indicate that membrane insertion allows for the qualitative and reliable identification of amphiphilic LPS in complex samples like beef homogenates. In addition, we also demonstrated that LPS-induced hole formation does not occur under the conditions of the membrane insertion assays. Together, these findings describe for the first time the serogroup-specific detection of amphiphilic LPS in complex samples using a membrane insertion assay, and highlight the importance of LPS molecular conformations in detection architectures.« less
Stromberg, Loreen R.; Hengartner, Nicolas W.; Swingle, Kirstie L.; ...
2016-05-26
Shiga toxin-producing Escherichia coli is an important cause of foodborne illness, with cases attributable to beef, fresh produce and other sources. Many serotypes of the pathogen cause disease, and differentiating one serotype from another requires specific identification of the O antigen located on the lipopolysaccharide (LPS) molecule. The amphiphilic structure of LPS poses a challenge when using classical detection methods, which do not take into account its lipoglycan biochemistry. Typically, detection of LPS requires heat or chemical treatment of samples and relies on bioactivity assays for the conserved lipid A portion of the molecule. Our goal was to develop assaysmore » to facilitate the direct and discriminative detection of the entire LPS molecule and its O antigen in complex matrices using minimal sample processing. To perform serogroup identification of LPS, we used a method called membrane insertion on a waveguide biosensor, and tested three serogroups of LPS. The membrane insertion technique allows for the hydrophobic association of LPS with a lipid bilayer, where the exposed O antigen can be targeted for specific detection. Samples of beef lysate were spiked with LPS to perform O antigen specific detection of LPS from E. coli O157. To validate assay performance, we evaluated the biophysical interactions of LPS with lipid bilayers both in- and outside of a flow cell using fluorescence microscopy and fluorescently doped lipids. Our results indicate that membrane insertion allows for the qualitative and reliable identification of amphiphilic LPS in complex samples like beef homogenates. In addition, we also demonstrated that LPS-induced hole formation does not occur under the conditions of the membrane insertion assays. Together, these findings describe for the first time the serogroup-specific detection of amphiphilic LPS in complex samples using a membrane insertion assay, and highlight the importance of LPS molecular conformations in detection architectures.« less
Simmons, Greg; Clarke, Daniel; McKee, Jeff; Young, Paul; Meers, Joanne
2014-01-01
Gibbon ape leukaemia virus (GALV) and koala retrovirus (KoRV) share a remarkably close sequence identity despite the fact that they occur in distantly related mammals on different continents. It has previously been suggested that infection of their respective hosts may have occurred as a result of a species jump from another, as yet unidentified vertebrate host. To investigate possible sources of these retroviruses in the Australian context, DNA samples were obtained from 42 vertebrate species and screened using PCR in order to detect proviral sequences closely related to KoRV and GALV. Four proviral partial sequences totalling 2880 bases which share a strong similarity with KoRV and GALV were detected in DNA from a native Australian rodent, the grassland melomys, Melomys burtoni. We have designated this novel gammaretrovirus Melomys burtoni retrovirus (MbRV). The concatenated nucleotide sequence of MbRV shares 93% identity with the corresponding sequence from GALV-SEATO and 83% identity with KoRV. The geographic ranges of the grassland melomys and of the koala partially overlap. Thus a species jump by MbRV from melomys to koalas is conceivable. However the genus Melomys does not occur in mainland South East Asia and so it appears most likely that another as yet unidentified host was the source of GALV.
The retrovirus HTLV-1 inserts an ectopic CTCF-binding site into the human genome.
Satou, Yorifumi; Miyazato, Paola; Ishihara, Ko; Yaguchi, Hiroko; Melamed, Anat; Miura, Michi; Fukuda, Asami; Nosaka, Kisato; Watanabe, Takehisa; Rowan, Aileen G; Nakao, Mitsuyoshi; Bangham, Charles R M
2016-03-15
Human T-lymphotropic virus type 1 (HTLV-1) is a retrovirus that causes malignant and inflammatory diseases in ∼10% of infected people. A typical host has between 10(4) and 10(5) clones of HTLV-1-infected T lymphocytes, each clone distinguished by the genomic integration site of the single-copy HTLV-1 provirus. The HTLV-1 bZIP (HBZ) factor gene is constitutively expressed from the minus strand of the provirus, whereas plus-strand expression, required for viral propagation to uninfected cells, is suppressed or intermittent in vivo, allowing escape from host immune surveillance. It remains unknown what regulates this pattern of proviral transcription and latency. Here, we show that CTCF, a key regulator of chromatin structure and function, binds to the provirus at a sharp border in epigenetic modifications in the pX region of the HTLV-1 provirus in T cells naturally infected with HTLV-1. CTCF is a zinc-finger protein that binds to an insulator region in genomic DNA and plays a fundamental role in controlling higher order chromatin structure and gene expression in vertebrate cells. We show that CTCF bound to HTLV-1 acts as an enhancer blocker, regulates HTLV-1 mRNA splicing, and forms long-distance interactions with flanking host chromatin. CTCF-binding sites (CTCF-BSs) have been propagated throughout the genome by transposons in certain primate lineages, but CTCF binding has not previously been described in present-day exogenous retroviruses. The presence of an ectopic CTCF-BS introduced by the retrovirus in tens of thousands of genomic locations has the potential to cause widespread abnormalities in host cell chromatin structure and gene expression.
Kim, T; Mudry, R A; Rexrode, C A; Pathak, V K
1996-01-01
Retroviruses mutate at a high rate in vivo during viral replication. Mutations may occur during proviral transcription by RNA polymerase II, during minus-strand DNA synthesis (RNA template) by viral reverse transcriptase, or during plus-strand DNA synthesis (DNA template) by reverse transcriptase. To determine the contributions of different stages of replication to the retroviral mutation rates, we developed a spleen necrosis virus-based in vivo system to selectively identify mutations occurring during the early stage (RNA transcription plus minus-strand synthesis) and the late stage (plus-strand synthesis plus DNA repair). A lacZalpha reporter gene was inserted into the long terminal repeat (LTR) of a spleen necrosis virus shuttle vector, and proviruses were recovered from infected cells as plasmids containing either one or both LTRs. Plasmids containing both LTRs generated a mutant phenotype only if the lacZalpha genes in both LTRs were mutated, which is most likely to occur during the early stage. Mutant phenotypes were identified from plasmids containing one LTR regardless of the stage at which the mutations occurred. Thus, mutant frequencies obtained after recovery of plasmids containing both LTRs or one LTR provided early-stage and total mutation rates, respectively. Analysis of 56,409 proviruses suggested that the retroviral mutation rates during the early and late stages of replication were equal or within twofold of each other. In addition, two mutants with A-to-G hypermutations were discovered, suggesting a role for mammalian double-stranded RNA adenosine deaminase enzyme in retroviral mutations. These experiments provide a system to selectively identify mutations in the early stage of retroviral replication and to provide upper and lower limits to the in vivo mutation rates during minus-strand and plus-strand synthesis, respectively. PMID:8892879
Rechargeable Aluminum-Ion Batteries Based on an Open-Tunnel Framework.
Kaveevivitchai, Watchareeya; Huq, Ashfia; Wang, Shaofei; Park, Min Je; Manthiram, Arumugam
2017-09-01
Rechargeable batteries based on an abundant metal such as aluminum with a three-electron transfer per atom are promising for large-scale electrochemical energy storage. Aluminum can be handled in air, thus offering superior safety, easy fabrication, and low cost. However, the development of Al-ion batteries has been challenging due to the difficulties in identifying suitable cathode materials. This study presents the use of a highly open framework Mo 2.5 + y VO 9 + z as a cathode for Al-ion batteries. The open-tunnel oxide allows a facile diffusion of the guest species and provides sufficient redox centers to help redistribute the charge within the local host lattice during the multivalent-ion insertion, thus leading to good rate capability with a specific capacity among the highest reported in the literature for Al-based batteries. This study also presents the use of Mo 2.5 + y VO 9 + z as a model host to develop a novel ultrafast technique for chemical insertion of Al ions into host structures. The microwave-assisted method employing diethylene glycol and aluminum diacetate (Al(OH)(C 2 H 3 O 2 ) 2 ) can be performed in air in as little as 30 min, which is far superior to the traditional chemical insertion techniques involving moisture-sensitive organometallic reagents. The Al-inserted Al x Mo 2.5 + y VO 9 + z obtained by the microwave-assisted chemical insertion can be used in Al-based rechargeable batteries. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Towards the use of computationally inserted lesions for mammographic CAD assessment
NASA Astrophysics Data System (ADS)
Ghanian, Zahra; Pezeshk, Aria; Petrick, Nicholas; Sahiner, Berkman
2018-03-01
Computer-aided detection (CADe) devices used for breast cancer detection on mammograms are typically first developed and assessed for a specific "original" acquisition system, e.g., a specific image detector. When CADe developers are ready to apply their CADe device to a new mammographic acquisition system, they typically assess the CADe device with images acquired using the new system. Collecting large repositories of clinical images containing verified cancer locations and acquired by the new image acquisition system is costly and time consuming. Our goal is to develop a methodology to reduce the clinical data burden in the assessment of a CADe device for use with a different image acquisition system. We are developing an image blending technique that allows users to seamlessly insert lesions imaged using an original acquisition system into normal images or regions acquired with a new system. In this study, we investigated the insertion of microcalcification clusters imaged using an original acquisition system into normal images acquired with that same system utilizing our previously-developed image blending technique. We first performed a reader study to assess whether experienced observers could distinguish between computationally inserted and native clusters. For this purpose, we applied our insertion technique to clinical cases taken from the University of South Florida Digital Database for Screening Mammography (DDSM) and the Breast Cancer Digital Repository (BCDR). Regions of interest containing microcalcification clusters from one breast of a patient were inserted into the contralateral breast of the same patient. The reader study included 55 native clusters and their 55 inserted counterparts. Analysis of the reader ratings using receiver operating characteristic (ROC) methodology indicated that inserted clusters cannot be reliably distinguished from native clusters (area under the ROC curve, AUC=0.58±0.04). Furthermore, CADe sensitivity was evaluated on mammograms with native and inserted microcalcification clusters using a commercial CADe system. For this purpose, we used full field digital mammograms (FFDMs) from 68 clinical cases, acquired at the University of Michigan Health System. The average sensitivities for native and inserted clusters were equal, 85.3% (58/68). These results demonstrate the feasibility of using the inserted microcalcification clusters for assessing mammographic CAD devices.
NASA Technical Reports Server (NTRS)
Zipf, Mark E.
1989-01-01
An overview is presented of research work focussed on the design and insertion of classical models of human pilot dynamics within the flight control loops of V/STOL aircraft. The pilots were designed and configured for use in integrated control system research and design. The models of human behavior that were considered are: McRuer-Krendel (a single variable transfer function model); and Optimal Control Model (a multi-variable approach based on optimal control and stochastic estimation theory). These models attempt to predict human control response characteristics when confronted with compensatory tracking and state regulation tasks. An overview, mathematical description, and discussion of predictive limitations of the pilot models is presented. Design strategies and closed loop insertion configurations are introduced and considered for various flight control scenarios. Models of aircraft dynamics (both transfer function and state space based) are developed and discussed for their use in pilot design and application. Pilot design and insertion are illustrated for various flight control objectives. Results of pilot insertion within the control loops of two V/STOL research aricraft (Sikorski Black Hawk UH-60A, McDonnell Douglas Harrier II AV-8B) are presented and compared against actual pilot flight data. Conclusions are reached on the ability of the pilot models to adequately predict human behavior when confronted with similar control objectives.
Han, Mengxue; Sun, Qibao; Zhou, Junyong; Qiu, Huarong; Guo, Jing; Lu, Lijuan; Mu, Wenlei; Sun, Jun
2017-09-01
Insertion of a solo LTR, which possesses strong bidirectional, stem-specific promoter activities, is associated with the evolution of a dwarfing apple spur mutation. Spur mutations in apple scions revolutionized global apple production. Since long terminal repeat (LTR) retrotransposons are tightly related to natural mutations, inter-retrotransposon-amplified polymorphism technique and genome walking were used to find sequences in the apple genome based on these LTRs. In 'Red Delicious' spur mutants, a novel, 2190-bp insertion was identified as a spur-specific, solo LTR (sLTR) located at the 1038th nucleotide of another sLTR, which was 1536 bp in length. This insertion-within-an-insertion was localized within a preexisting Gypsy-50 retrotransposon at position 3,762,767 on chromosome 4. The analysis of transcriptional activity of the two sLTRs (the 2190- and 1536-bp inserts) indicated that the 2190-bp sLTR is a promoter, capable of bidirectional transcription. GUS expression in the 2190-bp-sense and 2190-bp-antisense transgenic lines was prominent in stems. In contrast, no promoter activity from either the sense or the antisense strand of the 1536-bp sLTR was detected. From ~150 kb of DNA on each side of the 2190 bp, sLTR insertion site, corresponding to 300 kb of the 'Golden Delicious' genome, 23 genes were predicted. Ten genes had predicted functions that could affect shoot development. This first report, of a sLTR insertion associated with the evolution of apple spur mutation, will facilitate apple breeding, cloning of spur-related genes, and discovery of mechanisms behind dwarf habit.
Tang, Dalin; Yang, Chun; Geva, Tal; del Nido, Pedro J.
2010-01-01
Recent advances in medical imaging technology and computational modeling techniques are making it possible that patient-specific computational ventricle models be constructed and used to test surgical hypotheses and replace empirical and often risky clinical experimentation to examine the efficiency and suitability of various reconstructive procedures in diseased hearts. In this paper, we provide a brief review on recent development in ventricle modeling and its potential application in surgical planning and management of tetralogy of Fallot (ToF) patients. Aspects of data acquisition, model selection and construction, tissue material properties, ventricle layer structure and tissue fiber orientations, pressure condition, model validation and virtual surgery procedures (changing patient-specific ventricle data and perform computer simulation) were reviewed. Results from a case study using patient-specific cardiac magnetic resonance (CMR) imaging and right/left ventricle and patch (RV/LV/Patch) combination model with fluid-structure interactions (FSI) were reported. The models were used to evaluate and optimize human pulmonary valve replacement/insertion (PVR) surgical procedure and patch design and test a surgical hypothesis that PVR with small patch and aggressive scar tissue trimming in PVR surgery may lead to improved recovery of RV function and reduced stress/strain conditions in the patch area. PMID:21344066
Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji
1999-01-01
Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208
Genome-wide analysis of Tol2 transposon reintegration in zebrafish.
Kondrychyn, Igor; Garcia-Lecea, Marta; Emelyanov, Alexander; Parinov, Sergey; Korzh, Vladimir
2009-09-08
Tol2, a member of the hAT family of transposons, has become a useful tool for genetic manipulation of model animals, but information about its interactions with vertebrate genomes is still limited. Furthermore, published reports on Tol2 have mainly been based on random integration of the transposon system after co-injection of a plasmid DNA harboring the transposon and a transposase mRNA. It is important to understand how Tol2 would behave upon activation after integration into the genome. We performed a large-scale enhancer trap (ET) screen and generated 338 insertions of the Tol2 transposon-based ET cassette into the zebrafish genome. These insertions were generated by remobilizing the transposon from two different donor sites in two transgenic lines. We found that 39% of Tol2 insertions occurred in transcription units, mostly into introns. Analysis of the transposon target sites revealed no strict specificity at the DNA sequence level. However, Tol2 was prone to target AT-rich regions with weak palindromic consensus sequences centered at the insertion site. Our systematic analysis of sequential remobilizations of the Tol2 transposon from two independent sites within a vertebrate genome has revealed properties such as a tendency to integrate into transcription units and into AT-rich palindrome-like sequences. This information will influence the development of various applications involving DNA transposons and Tol2 in particular.
Torsional Dynamics of Steerable Needles: Modeling and Fluoroscopic Guidance
Swensen, John P.; Lin, MingDe; Okamura, Allison M.; Cowan, Noah J.
2017-01-01
Needle insertions underlie a diversity of medical interventions. Steerable needles provide a means by which to enhance existing needle-based interventions and facilitate new ones. Tip-steerable needles follow a curved path and can be steered by twisting the needle base during insertion, but this twisting excites torsional dynamics that introduce a discrepancy between the base and tip twist angles. Here, we model the torsional dynamics of a flexible rod—such as a tip-steerable needle—during subsurface insertion and develop a new controller based on the model. The torsional model incorporates time-varying mode shapes to capture the changing boundary conditions inherent during insertion. Numerical simulations and physical experiments using two distinct setups—stereo camera feedback in semi-transparent artificial tissue and feedback control with real-time X-ray imaging in optically opaque artificial tissue— demonstrate the need to account for torsional dynamics in control of the needle tip. PMID:24860026
Redundant via insertion in self-aligned double patterning
NASA Astrophysics Data System (ADS)
Song, Youngsoo; Jung, Jinwook; Shin, Youngsoo
2017-03-01
Redundant via (RV) insertion is employed to enhance via manufacturability, and has been extensively studied. Self-aligned double patterning (SADP) process, brings a new challenge to RV insertion since newly created cut for each RV insertion has to be taken care of. Specifically, when a cut for RV, which we simply call RV-cut, is formed, cut conflict may occur with nearby line-end cuts, which results in a decrease in RV candidates. We introduce cut merging to reduce the number of cut conflicts; merged cuts are processed with stitch using litho-etch-litho-etch (LELE) multi-patterning method. In this paper, we propose a new RV insertion method with cut merging in SADP for the first time. In our experiments, a simple RV insertion yields 55.3% vias to receives RVs; our proposed method that considers cut merging increases that number to 69.6% on average of test circuits.
NASA Technical Reports Server (NTRS)
Crouch, Myscha; Carswell, Bill; Farmer, Jeff; Rose, Fred; Tidwell, Paul
2000-01-01
The Material Science Research Rack I (MSRR-1) of the Material Science Research Facility (MSRF) contains an Experiment Module (EM) being developed collaboratively by NASA and the European Space Agency (ESA). This NASA/ESA EM will accommodate several different removable and replaceable Module Inserts (MIs) which are installed on orbit NASA's planned inserts include the Quench Module Insert (QMI) and the Diffusion Module Insert (DMI). The QMI is a high-gradient Bridgman-type vacuum furnace with quench capabilities used for experiments on directional solidification of metal alloys. The DMI is a vacuum Bridgman-Stockbarger-type furnace for experiments on Fickian and Soret diffusion in liquids. This paper discusses specific design features and performance capabilities of each insert. The paper also presents current prototype QMI hardware analysis and testing activities and selected results.
Stepwise Loop Insertion Strategy for Active Site Remodeling to Generate Novel Enzyme Functions.
Hoque, Md Anarul; Zhang, Yong; Chen, Liuqing; Yang, Guangyu; Khatun, Mst Afroza; Chen, Haifeng; Hao, Liu; Feng, Yan
2017-05-19
The remodeling of active sites to generate novel biocatalysts is an attractive and challenging task. We developed a stepwise loop insertion strategy (StLois), in which randomized residue pairs are inserted into active site loops. The phosphotriesterase-like lactonase from Geobacillus kaustophilus (GkaP-PLL) was used to investigate StLois's potential for changing enzyme function. By inserting six residues into active site loop 7, the best variant ML7-B6 demonstrated a 16-fold further increase in catalytic efficiency toward ethyl-paraoxon compared with its initial template, that is a 609-fold higher, >10 7 fold substrate specificity shift relative to that of wild-type lactonase. The remodeled variants displayed 760-fold greater organophosphate hydrolysis activity toward the organophosphates parathion, diazinon, and chlorpyrifos. Structure and docking computations support the source of notably inverted enzyme specificity. Considering the fundamental importance of active site loops, the strategy has potential for the rapid generation of novel enzyme functions by loop remodeling.
Selinger, D A; Chandler, V L
1999-12-21
The b locus encodes a transcription factor that regulates the expression of genes that produce purple anthocyanin pigment. Different b alleles are expressed in distinct tissues, causing tissue-specific anthocyanin production. Understanding how phenotypic diversity is produced and maintained at the b locus should provide models for how other regulatory genes, including those that influence morphological traits and development, evolve. We have investigated how different levels and patterns of pigmentation have evolved by determining the phenotypic and evolutionary relationships between 18 alleles that represent the diversity of b alleles in Zea mays. Although most of these alleles have few phenotypic differences, five alleles have very distinct tissue-specific patterns of pigmentation. Superimposing the phenotypes on the molecular phylogeny reveals that the alleles with strong and distinctive patterns of expression are closely related to alleles with weak expression, implying that the distinctive patterns have arisen recently. We have identified apparent insertions in three of the five phenotypically distinct alleles, and the fourth has unique upstream restriction fragment length polymorphisms relative to closely related alleles. The insertion in B-Peru has been shown to be responsible for its unique expression and, in the other two alleles, the presence of the insertion correlates with the phenotype. These results suggest that major changes in gene expression are probably the result of large-scale changes in DNA sequence and/or structure most likely mediated by transposable elements.
Spertzel, R O
1989-12-01
The search for a model of HIV infection continues. While much of the initial work focussed on animal models of AIDS, more recent efforts have sought animal models of HIV infection in which one or more signs of AIDS may be reproduced. Most initial small animal modelling efforts were negative and many such efforts remain unpublished. In 1988, the Public Health Service (PHS) AIDS Animal Model Committee conducted a survey among PHS agencies to identify published and unpublished data on animal models of HIV. To date, the chimpanzee is the only animal to be reliably infected with HIV albeit without development of signs and symptoms normally associated with human AIDS. One recent study has shown the gibbon to be similarly susceptible to infection with HIV. Mice carrying a chimera of elements of the human immune system have been shown to support the growth of HIV and F1 progeny of transgenic mice containing intact copies of HIV proviral DNA, have developed a disease that resembles some aspects of human AIDS. Rabbits, baboons and rhesus monkeys have also been shown to be infected under certain conditions and/or with selected strains of HIV but again without the development of AIDS symptomatology. This report briefly summarizes published and available unpublished data on these efforts to develop an animal model of HIV infection.
Modeling and characterization of partially inserted electrical connector faults
NASA Astrophysics Data System (ADS)
Tokgöz, ćaǧatay; Dardona, Sameh; Soldner, Nicholas C.; Wheeler, Kevin R.
2016-03-01
Faults within electrical connectors are prominent in avionics systems due to improper installation, corrosion, aging, and strained harnesses. These faults usually start off as undetectable with existing inspection techniques and increase in magnitude during the component lifetime. Detection and modeling of these faults are significantly more challenging than hard failures such as open and short circuits. Hence, enabling the capability to locate and characterize the precursors of these faults is critical for timely preventive maintenance and mitigation well before hard failures occur. In this paper, an electrical connector model based on a two-level nonlinear least squares approach is proposed. The connector is first characterized as a transmission line, broken into key components such as the pin, socket, and connector halves. Then, the fact that the resonance frequencies of the connector shift as insertion depth changes from a fully inserted to a barely touching contact is exploited. The model precisely captures these shifts by varying only two length parameters. It is demonstrated that the model accurately characterizes a partially inserted connector.
A Predictive Model of Intein Insertion Site for Use in the Engineering of Molecular Switches
Apgar, James; Ross, Mary; Zuo, Xiao; Dohle, Sarah; Sturtevant, Derek; Shen, Binzhang; de la Vega, Humberto; Lessard, Philip; Lazar, Gabor; Raab, R. Michael
2012-01-01
Inteins are intervening protein domains with self-splicing ability that can be used as molecular switches to control activity of their host protein. Successfully engineering an intein into a host protein requires identifying an insertion site that permits intein insertion and splicing while allowing for proper folding of the mature protein post-splicing. By analyzing sequence and structure based properties of native intein insertion sites we have identified four features that showed significant correlation with the location of the intein insertion sites, and therefore may be useful in predicting insertion sites in other proteins that provide native-like intein function. Three of these properties, the distance to the active site and dimer interface site, the SVM score of the splice site cassette, and the sequence conservation of the site showed statistically significant correlation and strong predictive power, with area under the curve (AUC) values of 0.79, 0.76, and 0.73 respectively, while the distance to secondary structure/loop junction showed significance but with less predictive power (AUC of 0.54). In a case study of 20 insertion sites in the XynB xylanase, two features of native insertion sites showed correlation with the splice sites and demonstrated predictive value in selecting non-native splice sites. Structural modeling of intein insertions at two sites highlighted the role that the insertion site location could play on the ability of the intein to modulate activity of the host protein. These findings can be used to enrich the selection of insertion sites capable of supporting intein splicing and hosting an intein switch. PMID:22649521
Factors influencing initial cup stability in total hip arthroplasty.
Amirouche, Farid; Solitro, Giovanni; Broviak, Stefanie; Gonzalez, Mark; Goldstein, Wayne; Barmada, Riad
2014-12-01
One of the main goals in total hip replacement is to preserve the integrity of the hip kinematics, by well positioning the cup and to make sure its initial stability is congruent and attained. Achieving the latter is not trivial. A finite element model of the cup-bone interface simulating a realistic insertion and analysis of different scenarios of cup penetration, insertion, under-reaming and loading is investigated to determine certain measurable factors sensitivity to stress-strain outcome. The insertion force during hammering and its relation to the cup penetration during implantation is also investigated with the goal of determining the initial stability of the acetabular cup during total hip arthroplasty. The mathematical model was run in various configurations to simulate 1 and 2mm of under-reaming at various imposed insertion distances to mimic hammering and insertion of cup insertion into the pelvis. Surface contact and micromotion at the cup-bone interface were evaluated after simulated cup insertion and post-operative loading conditions. The results suggest a direct correlation between under-reaming and insertion force used to insert the acetabular cup on the micromotion and fixation at the cup-bone interface. While increased under-reaming and insertion force result in an increase amount of stability at the interface, approximately the same percentage of surface contact and micromotion reduction can be achieved with less insertion force. We need to exercise caution to determine the optimal configuration which achieves a good conformity without approaching the yield strength for bone. Copyright © 2014 Elsevier Ltd. All rights reserved.
Moscardini, Mila; Pistello, Mauro; Bendinelli, M; Ficheux, Damien; Miller, Jennifer T; Gabus, Caroline; Le Grice, Stuart F J; Surewicz, Witold K; Darlix, Jean-Luc
2002-04-19
All lentiviruses and oncoretroviruses examined so far encode a major nucleic-acid binding protein (nucleocapsid or NC* protein), approximately 2500 molecules of which coat the dimeric RNA genome. Studies on HIV-1 and MoMuLV using in vitro model systems and in vivo have shown that NC protein is required to chaperone viral RNA dimerization and packaging during virus assembly, and proviral DNA synthesis by reverse transcriptase (RT) during infection. The human cellular prion protein (PrP), thought to be the major component of the agent causing transmissible spongiform encephalopathies (TSE), was recently found to possess a strong affinity for nucleic acids and to exhibit chaperone properties very similar to HIV-1 NC protein in the HIV-1 context in vitro. Tight binding of PrP to nucleic acids is proposed to participate directly in the prion disease process. To extend our understanding of lentiviruses and of the unexpected nucleic acid chaperone properties of the human prion protein, we set up an in vitro system to investigate replication of the feline immunodeficiency virus (FIV), which is functionally and phylogenetically distant from HIV-1. The results show that in the FIV model system, NC protein chaperones viral RNA dimerization, primer tRNA(Lys,3) annealing to the genomic primer-binding site (PBS) and minus strand DNA synthesis by the homologous FIV RT. FIV NC protein is able to trigger specific viral DNA synthesis by inhibiting self-priming of reverse transcription. The human prion protein was found to mimic the properties of FIV NC with respect to primer tRNA annealing to the viral RNA and chaperoning minus strand DNA synthesis. Copyright 2002 Elsevier Science Ltd.
Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.
Hazkani-Covo, Einat; Martin, William F
2017-05-01
Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Expression of a model gene in prostate cancer cells lentivirally transduced in vitro and in vivo.
Bastide, C; Maroc, N; Bladou, F; Hassoun, J; Maitland, N; Mannoni, P; Bagnis, C
2003-01-01
In a preclinical model for prostate cancer gene therapy, we have tested lentiviral vectors as a practical possibility for the transfer and long-term expression of the EGFP gene both in vitro and in vivo. The human prostate cancer cell lines DU145 and PC3 were transduced using experimental conditions which permitted analysis of the expression from a single proviral vector per cell. The transduced cells stably expressed the EGFP transgene for 4 months. After injection of the transduced cell populations into Nod-SCID mice a decrease in EGFP was only observed in a minority of cases, while the majority of tumors maintained transgene expression at in vitro levels. In vivo injection of viral vector preparations directly into pre-established subcutaneous or orthotopic tumor masses, obtained by implantation of untransduced PC3 and DU145 cells led to a high transduction efficiency. While the efficiency of direct intratumoral transduction was proportional to the dose of virus injected, the results indicated some technical limitations inherent in these approaches to prostate cancer gene therapy.
Quench Module Insert (QMI) and the Diffusion Module Insert (DMI) Furnace Development
NASA Technical Reports Server (NTRS)
Crouch, Myscha R.; Carswell, William E.; Farmer, Jeff; Rose, Fred; Tidwell, Paul H., II
2000-01-01
The Quench Module Insert (QMI) and the Diffusion Module Insert (DMI) are microgravity furnaces under development at Marshall Space Flight Center. The furnaces are being developed for the first Materials Science Research Rack (MSRR-1) of the Materials Science Research Facility (MSRF), one of the first International Space Station (ISS) scientific payloads. QMI is a Bridgman furnace with quench capability for studying interface behavior during directional solidification of metallic and alloy materials. DMI will be a Bridgman-Stockbarger furnace to study diffusion processes in semiconductors. The design for each insert, both QMI and DMI, is driven by specific science, operations and safety requirements, as well as by constraints arising from resource limitations, such as volume, mass and power. Preliminary QMI analysis and testing indicates that the design meets these requirements.
How to use Gagne's model of instructional design in teaching psychomotor skills
Rostami, Kamran; Ishaq, Sauid
2011-01-01
Gagne's model of instructional design is based on the information processing model of the mental events that occur when adults are presented with various stimuli and focuses on the learning outcomes and how to arrange specific instructional events to achieve those outcomes. Applying Gagne's nine-step model is an excellent way to ensure an effective and systematic learning program as it gives structure to the lesson plans and a holistic view to the teaching. In this paper, we have chosen a routine practical procedure that junior doctors need to learn: insertion of a peritoneal (ascitic) drain and we use Gagne's “events of instruction” to design a lesson plan for this subject. PMID:24834168
How to use Gagne's model of instructional design in teaching psychomotor skills.
Khadjooi, Kayvan; Rostami, Kamran; Ishaq, Sauid
2011-01-01
Gagne's model of instructional design is based on the information processing model of the mental events that occur when adults are presented with various stimuli and focuses on the learning outcomes and how to arrange specific instructional events to achieve those outcomes. Applying Gagne's nine-step model is an excellent way to ensure an effective and systematic learning program as it gives structure to the lesson plans and a holistic view to the teaching. In this paper, we have chosen a routine practical procedure that junior doctors need to learn: insertion of a peritoneal (ascitic) drain and we use Gagne's "events of instruction" to design a lesson plan for this subject.
Rossa, Carlos; Sloboda, Ron; Usmani, Nawaid; Tavakoli, Mahdi
2016-07-01
This paper proposes a method to predict the deflection of a flexible needle inserted into soft tissue based on the observation of deflection at a single point along the needle shaft. We model the needle-tissue as a discretized structure composed of several virtual, weightless, rigid links connected by virtual helical springs whose stiffness coefficient is found using a pattern search algorithm that only requires the force applied at the needle tip during insertion and the needle deflection measured at an arbitrary insertion depth. Needle tip deflections can then be predicted for different insertion depths. Verification of the proposed method in synthetic and biological tissue shows a deflection estimation error of [Formula: see text]2 mm for images acquired at 35 % or more of the maximum insertion depth, and decreases to 1 mm for images acquired closer to the final insertion depth. We also demonstrate the utility of the model for prostate brachytherapy, where in vivo needle deflection measurements obtained during early stages of insertion are used to predict the needle deflection further along the insertion process. The method can predict needle deflection based on the observation of deflection at a single point. The ultrasound probe can be maintained at the same position during insertion of the needle, which avoids complications of tissue deformation caused by the motion of the ultrasound probe.
Roles of Pro-viral Host Factors in Mosquito-Borne Flavivirus Infections.
Campos, Rafael K; Garcia-Blanco, Mariano A; Bradrick, Shelton S
2017-07-09
Identification and analysis of viral host factors is a growing area of research which aims to understand the how viruses molecularly interface with the host cell. Investigations into flavivirus-host interactions has led to new discoveries in viral and cell biology, and will potentially bolster strategies to control the important diseases caused by these pathogens. Here, we address the current knowledge of prominent host factors required for the flavivirus life-cycle and mechanisms by which they promote infection.
TEs or not TEs? That is the evolutionary question.
Vaknin, Keren; Goren, Amir; Ast, Gil
2009-10-23
Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.
The New Chemicals Exposure Limits (NCELs) section 5(e) Consent Order insert presents the standard NCELs provisions. The actual NCEL concentration is an empty blank to be completed depending on the toxicity of the specific chemical involved.
Health Instruction Packages: Specific Nursing Skills.
ERIC Educational Resources Information Center
Bates, Clarice; And Others
Text, illustrations, and exercises are utilized in a set of five learning modules designed to instruct nursing students in a variety of clinical skills. The first module, "Down the Tube: Insertion of a Nasogastric Tube" by Clarice Bates, describes materials and procedures used to insert a nasogastric tube through the nose and esophagus…
2009-04-22
Implementation Issues Another RCIP implementation risk is program management burnout . The ACRI program manager specifically identified the potential...of burnout in his program management team due to the repeated, intense Integration phases. To investigate the possibility and severity of this risk to...the ACRI simulation. This suggests that the burnout risk will be larger for RCIP than it was for ACRI. Successfully implementing a sustainable RCIP
2017-01-02
to model various aspects of the problem, such as continuous travel times , constraints on weight and rest/active time constraints, using the language of... travel time ; if no feasible insertion point exists, then a new vehicle is added to the solution. This procedure 3 resembles our initialization heuristic...and only if aircraft a is used in the schedule. Each event e must occur at a specific location or “port”. We let τe,e′,a denote the travel time of
Crystal Structure of the Extracellular Cholinesterase-Like Domain from Neuroligin-2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koehnke,J.; Jin, X.; Budreck, E.
Neuroligins (NLs) are catalytically inactive members of a family of cholinesterase-like transmembrane proteins that mediate cell adhesion at neuronal synapses. Postsynaptic neuroligins engage in Ca2+-dependent transsynaptic interactions via their extracellular cholinesterase domain with presynaptic neurexins (NRXs). These interactions may be regulated by two short splice insertions (termed A and B) in the NL cholinesterase domain. Here, we present the 3.3- Angstroms crystal structure of the ectodomain from NL2 containing splice insertion A (NL2A). The overall structure of NL2A resembles that of cholinesterases, but several structural features are unique to the NL proteins. First, structural elements surrounding the esterase active-site regionmore » differ significantly between active esterases and NL2A. On the opposite surface of the NL2A molecule, the positions of the A and B splice insertions identify a candidate NRX interaction site of the NL protein. Finally, sequence comparisons of NL isoforms allow for mapping the location of residues of previously identified mutations in NL3 and NL4 found in patients with autism spectrum disorders. Overall, the NL2 structure promises to provide a valuable model for dissecting NL isoform- and synapse-specific functions.« less
Efficiency of vibrational sounding in parasitoid host location depends on substrate density.
Fischer, S; Samietz, J; Dorn, S
2003-10-01
Parasitoids of concealed hosts have to drill through a substrate with their ovipositor for successful parasitization. Hymenopteran species in this drill-and-sting guild locate immobile pupal hosts by vibrational sounding, i.e., echolocation on solid substrate. Although this host location strategy is assumed to be common among the Orussidae and Ichneumonidae there is no information yet whether it is adapted to characteristics of the host microhabitat. This study examined the effect of substrate density on responsiveness and host location efficiency in two pupal parasitoids, Pimpla turionellae and Xanthopimpla stemmator (Hymenoptera: Ichneumonidae), with different host-niche specialization and corresponding ovipositor morphology. Location and frequency of ovipositor insertions were scored on cylindrical plant stem models of various densities. Substrate density had a significant negative effect on responsiveness, number of ovipositor insertions, and host location precision in both species. The more niche-specific species X. stemmator showed a higher host location precision and insertion activity. We could show that vibrational sounding is obviously adapted to the host microhabitat of the parasitoid species using this host location strategy. We suggest the attenuation of pulses during vibrational sounding as the energetically costly limiting factor for this adaptation.
Crystal structure of the extracellular cholinesterase-like domain from neuroligin-2
Koehnke, Jesko; Jin, Xiangshu; Budreck, Elaine C.; Posy, Shoshana; Scheiffele, Peter; Honig, Barry; Shapiro, Lawrence
2008-01-01
Neuroligins (NLs) are catalytically inactive members of a family of cholinesterase-like transmembrane proteins that mediate cell adhesion at neuronal synapses. Postsynaptic neuroligins engage in Ca2+-dependent transsynaptic interactions via their extracellular cholinesterase domain with presynaptic neurexins (NRXs). These interactions may be regulated by two short splice insertions (termed A and B) in the NL cholinesterase domain. Here, we present the 3.3-Å crystal structure of the ectodomain from NL2 containing splice insertion A (NL2A). The overall structure of NL2A resembles that of cholinesterases, but several structural features are unique to the NL proteins. First, structural elements surrounding the esterase active-site region differ significantly between active esterases and NL2A. On the opposite surface of the NL2A molecule, the positions of the A and B splice insertions identify a candidate NRX interaction site of the NL protein. Finally, sequence comparisons of NL isoforms allow for mapping the location of residues of previously identified mutations in NL3 and NL4 found in patients with autism spectrum disorders. Overall, the NL2 structure promises to provide a valuable model for dissecting NL isoform- and synapse-specific functions. PMID:18250328
Ducassou, Lionel; Dhers, Laura; Jonasson, Gabriella; Pietrancosta, Nicolas; Boucher, Jean-Luc; Mansuy, Daniel; André, François
2017-09-01
Human cytochrome P450 2U1 (CYP2U1) is an orphan CYP that exhibits several distinctive characteristics among the 57 human CYPs with a highly conserved sequence in almost all living organisms. We compared its protein sequence with those of the 57 human CYPs and constructed a 3D structure of a full-length CYP2U1 model bound to a POPC membrane. We also performed docking experiments of arachidonic acid (AA) and N-arachidonoylserotonin (AS) in this model. The protein sequence of CYP2U1 displayed two unique characteristics when compared to those of the human CYPs, the presence of a longer N-terminal region upstream of the putative trans-membrane helix (TMH) containing 8 proline residues, and of an insert of about 20 amino acids containing 5 arginine residues between helices A' and A. Its N-terminal part upstream of TMH involved an additional short terminal helix, in a manner similar to what was reported in the crystal structure of Saccharomyces cerevisiae CYP51. Our model also showed a specific interaction between the charged residues of insert AA' and phosphate groups of lipid polar heads, suggesting a possible role of this insert in substrate recruitment. Docking of AA and AS in this model showed these substrates in channel 2ac, with the terminal alkyl chain of AA or the indole ring of AS close to the heme, in agreement with the reported CYP2U1-catalyzed AA and AS hydroxylation regioselectivities. This model should be useful to find new endogenous or exogenous CYP2U1 substrates and to interpret the regioselectivity of their hydroxylation. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Henle, E S; Han, Z; Tang, N; Rai, P; Luo, Y; Linn, S
1999-01-08
Preferential cleavage sites have been determined for Fe2+/H2O2-mediated oxidations of DNA. In 50 mM H2O2, preferential cleavages occurred at the nucleoside 5' to each of the dG moieties in the sequence RGGG, a sequence found in a majority of telomere repeats. Within a plasmid containing a (TTAGGG)81 human telomere insert, 7-fold more strand breakage occurred in the restriction fragment with the insert than in a similar-sized control fragment. This result implies that telomeric DNA could protect coding DNA from oxidative damage and might also link oxidative damage and iron load to telomere shortening and aging. In micromolar H2O2, preferential cleavage occurred at the thymidine within the sequence RTGR, a sequence frequently found to be required in promoters for normal responses of many procaryotic and eucaryotic genes to iron or oxygen stress. Computer modeling of the interaction of Fe2+ with RTGR in B-DNA suggests that due to steric hindrance with the thymine methyl, Fe2+ associates in a specific manner with the thymine flipped out from the base stack so as to allow an octahedrally-oriented coordination of the Fe2+ with the three purine N7 residues. Fe2+-dependent changes in NMR spectra of duplex oligonucleotides containing ATGA versus those containing AUGA or A5mCGA were consistent with this model.
Yuan, Cheng-song; Chen, Wan; Chen, Chen; Yang, Guang-hua; Hu, Chao; Tang, Kang-lai
2015-01-01
We investigated the effects on subtalar joint stress distribution after cannulated screw insertion at different positions and directions. After establishing a 3-dimensional geometric model of a normal subtalar joint, we analyzed the most ideal cannulated screw insertion position and approach for subtalar joint stress distribution and compared the differences in loading stress, antirotary strength, and anti-inversion/eversion strength among lateral-medial antiparallel screw insertion, traditional screw insertion, and ideal cannulated screw insertion. The screw insertion approach allowing the most uniform subtalar joint loading stress distribution was lateral screw insertion near the border of the talar neck plus medial screw insertion close to the ankle joint. For stress distribution uniformity, antirotary strength, and anti-inversion/eversion strength, lateral-medial antiparallel screw insertion was superior to traditional double-screw insertion. Compared with ideal cannulated screw insertion, slightly poorer stress distribution uniformity and better antirotary strength and anti-inversion/eversion strength were observed for lateral-medial antiparallel screw insertion. Traditional single-screw insertion was better than double-screw insertion for stress distribution uniformity but worse for anti-rotary strength and anti-inversion/eversion strength. Lateral-medial antiparallel screw insertion was slightly worse for stress distribution uniformity than was ideal cannulated screw insertion but superior to traditional screw insertion. It was better than both ideal cannulated screw insertion and traditional screw insertion for anti-rotary strength and anti-inversion/eversion strength. Lateral-medial antiparallel screw insertion is an approach with simple localization, convenient operation, and good safety. Copyright © 2015 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.
Sawamura, Jitsuki; Morishita, Shigeru; Ishigooka, Jun
2014-05-07
Previously, we suggested prototypal models that describe some clinical states based on group postulates. Here, we demonstrate a group/category theory-like model for molecular/genetic biology as an alternative application of our previous model. Specifically, we focus on deoxyribonucleic acid (DNA) base sequences. We construct a wallpaper pattern based on a five-letter cruciform motif with letters C, A, T, G, and E. Whereas the first four letters represent the standard DNA bases, the fifth is introduced for ease in formulating group operations that reproduce insertions and deletions of DNA base sequences. A basic group Z5 = {r, u, d, l, n} of operations is defined for the wallpaper pattern, with which a sequence of points can be generated corresponding to changes of a base in a DNA sequence by following the orbit of a point of the pattern under operations in group Z5. Other manipulations of DNA sequence can be treated using a vector-like notation 'Dj' corresponding to a DNA sequence but based on the five-letter base set; also, 'Dj's are expressed graphically. Insertions and deletions of a series of letters 'E' are admitted to assist in describing DNA recombination. Likewise, a vector-like notation Rj can be constructed for sequences of ribonucleic acid (RNA). The wallpaper group B = {Z5×∞, ●} (an ∞-fold Cartesian product of Z5) acts on Dj (or Rj) yielding changes to Dj (or Rj) denoted by 'Dj◦B(j→k) = Dk' (or 'Rj◦B(j→k) = Rk'). Based on the operations of this group, two types of groups-a modulo 5 linear group and a rotational group over the Gaussian plane, acting on the five bases-are linked as parts of the wallpaper group for broader applications. As a result, changes, insertions/deletions and DNA (RNA) recombination (partial/total conversion) are described. As an exploratory study, a notation for the canonical "central dogma" via a category theory-like way is presented for future developments. Despite the large incompleteness of our methodology, there is fertile ground to consider a symmetry model for genetic coding based on our specific wallpaper group. A more integrated formulation containing "central dogma" for future molecular/genetic biology remains to be explored.
Insertion loss of noise barriers on an aboveground, full-scale model longwall coal mining shearer.
Sweeney, Daniel D; Slagley, Jeremy M; Smith, David A
2010-05-01
The U.S. mining industry struggles with hazardous noise and dust exposures in underground mining. Specifically, longwall coal mine shearer operators are routinely exposed to noise levels at 151% of the allowable daily dose, and approximately 20% exceed regulatory dust levels. In the current study, a partial barrier was mounted on the full-scale mock shearer at the National Institute for Occupational Safety and Health Pittsburgh Research Laboratory. A simulated, full-scale, coal mine longwall shearer operation was employed to test the feasibility of utilizing a barrier to separate the shearer operator from the direct path of the noise and dust source during mining operations. In this model, noise levels at the operators' positions were reduced by 2.6 to 8.2 A-weighted decibels (dBA) from the application of the test barriers. Estimated insertion loss underground was 1.7 to 7.3 dBA. The barrier should be tested in an underground mining operation to determine if it can reduce shearer operators' noise exposure to below regulatory limits.
Going, going, gone: predicting the fate of genomic insertions in plant RNA viruses.
Willemsen, Anouk; Carrasco, José L; Elena, Santiago F; Zwart, Mark P
2018-05-10
Horizontal gene transfer is common among viruses, while they also have highly compact genomes and tend to lose artificial genomic insertions rapidly. Understanding the stability of genomic insertions in viral genomes is therefore relevant for explaining and predicting their evolutionary patterns. Here, we revisit a large body of experimental research on a plant RNA virus, tobacco etch potyvirus (TEV), to identify the patterns underlying the stability of a range of homologous and heterologous insertions in the viral genome. We obtained a wide range of estimates for the recombination rate-the rate at which deletions removing the insertion occur-and these appeared to be independent of the type of insertion and its location. Of the factors we considered, recombination rate was the best predictor of insertion stability, although we could not identify the specific sequence characteristics that would help predict insertion instability. We also considered experimentally the possibility that functional insertions lead to higher mutational robustness through increased redundancy. However, our observations suggest that both functional and non-functional increases in genome size decreased the mutational robustness. Our results therefore demonstrate the importance of recombination rates for predicting the long-term stability and evolution of viral RNA genomes and suggest that there are unexpected drawbacks to increases in genome size for mutational robustness.
Meursinge Reynders, Reint; Ladu, Luisa; Ronchi, Laura; Di Girolamo, Nicola; de Lange, Jan; Roberts, Nia; Plüddemann, Annette
2015-04-02
Hitting a dental root during the insertion of orthodontic mini-implants (OMIs) is a common adverse effect of this intervention. This condition can permanently damage these structures and can cause implant instability. Increased torque levels (index test) recorded during the insertion of OMIs may provide a more accurate and immediate diagnosis of implant-root contact (target condition) than radiographic imaging (reference standard). An accurate index test could reduce or eliminate X-ray exposure. These issues, the common use of OMIs, the high prevalence of the target condition, and because most OMIs are placed between roots warrant a systematic review. We will assess 1) the diagnostic accuracy and the adverse effects of the index test, 2) whether OMIs with root contact have higher insertion torque values than those without, and 3) whether intermediate torque values have clinical diagnostic utility. The Preferred Reporting Items for Systematic review and Meta-Analysis Protocols (PRISMA-P) 2015 statement was used as a the guideline for reporting this protocol. Inserting implants deliberately into dental roots of human participants would not be approved by ethical review boards and adverse effects of interventions are generally underreported. We will therefore apply broad spectrum eligibility criteria, which will include clinical, animal and cadaver models. Not including these models could slow down knowledge translation. Both randomized and non-randomized research studies will be included. Comparisons of interest and subgroups are pre-specified. We will conduct searches in MEDLINE and more than 40 other electronic databases. We will search the grey literature and reference lists and hand-search ten journals. All methodological procedures will be conducted by three reviewers. Study selection, data extraction and analyses, and protocols for contacting authors and resolving conflicts between reviewers are described. Designed specific risk of bias tools will be tailored to the research question. Different research models will be analysed separately. Parameters for exploring statistical heterogeneity and conducting meta-analyses are pre-specified. The quality of evidence for outcomes will be assessed through the Grading of Recommendations Assessment, Development and Evaluation (GRADE) approach. The findings of this systematic review will be useful for patients, clinicians, researchers, guideline developers, policymakers, and surgical companies.
Optimization of Insertion Cost for Transfer Trajectories to Libration Point Orbits
NASA Technical Reports Server (NTRS)
Howell, K. C.; Wilson, R. S.; Lo, M. W.
1999-01-01
The objective of this work is the development of efficient techniques to optimize the cost associated with transfer trajectories to libration point orbits in the Sun-Earth-Moon four body problem, that may include lunar gravity assists. Initially, dynamical systems theory is used to determine invariant manifolds associated with the desired libration point orbit. These manifolds are employed to produce an initial approximation to the transfer trajectory. Specific trajectory requirements such as, transfer injection constraints, inclusion of phasing loops, and targeting of a specified state on the manifold are then incorporated into the design of the transfer trajectory. A two level differential corrections process is used to produce a fully continuous trajectory that satisfies the design constraints, and includes appropriate lunar and solar gravitational models. Based on this methodology, and using the manifold structure from dynamical systems theory, a technique is presented to optimize the cost associated with insertion onto a specified libration point orbit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ramirez, Jean Marie; Houzet, Laurent; Koller, Richard
2004-12-20
Alternative splicing in Mo-MuLV recruits a splice donor site, SD', within the gag that is required for optimal replication in vitro. Remarkably, this SD' site was also found to be utilized for production of oncogenic gag-myb fusion RNA in 100% of murine-induced myeloid leukemia (MML) in pristane-treated BALB/c mice. Therefore, we investigated the influence of silent mutations of SD' in this model. Although there was no decrease in the overall incidence of disease, there was a decrease in the incidence of myeloid leukemia with a concomitant increase in lymphoid leukemia. Importantly, there was a complete lack of myeloid tumors associatedmore » with 5' insertional mutagenic activation of c-myb, suggesting the specific requirement of the SD' site in this mechanism.« less
46 CFR 160.047-4 - Construction.
Code of Federal Regulations, 2012 CFR
2012-10-01
... AF-1, CFM-1, and CFS-1. The buoyant pad inserts for Models AF-1, CFM-1, and CFS-1 buoyant vests shall...)—Distribution of Fibrous Glass in Buoyant Pad Inserts Model AF-1 (minimum) Model CFM-1 (minimum) Model CFS-1... and CFM-1 Each Models CKS-1 and CFS-1 Each Front pads 61/4 pounds ±1/4 pound 41/4 pounds ±1/4 pound 23...
46 CFR 160.047-4 - Construction.
Code of Federal Regulations, 2011 CFR
2011-10-01
... AF-1, CFM-1, and CFS-1. The buoyant pad inserts for Models AF-1, CFM-1, and CFS-1 buoyant vests shall...)—Distribution of Fibrous Glass in Buoyant Pad Inserts Model AF-1 (minimum) Model CFM-1 (minimum) Model CFS-1... and CFM-1 Each Models CKS-1 and CFS-1 Each Front pads 61/4 pounds ±1/4 pound 41/4 pounds ±1/4 pound 23...
Aubry, S; Pousse, A; Sarliève, P; Laborie, L; Delabrousse, E; Kastler, B
2006-11-01
To model vertebrae in 3D to improve radioanatomic knowledge of the spine with the vascular and nerve environment and simulate CT-guided interventions. Vertebra acquisitions were made with multidetector CT. We developed segmentation software and specific viewer software using the Delphi programming environment. This segmentation software makes it possible to model 3D high-resolution segments of vertebrae and their environment from multidetector CT acquisitions. Then the specific viewer software provides multiplanar reconstructions of the CT volume and the possibility to select different 3D objects of interest. This software package improves radiologists' radioanatomic knowledge through a new 3D anatomy presentation. Furthermore, the possibility of inserting virtual 3D objects in the volume can simulate CT-guided intervention. The first volumetric radioanatomic software has been born. Furthermore, it simulates CT-guided intervention and consequently has the potential to facilitate learning interventions using CT guidance.
Study on Quality of IUD Services Provided by Trained Professionals at Teaching Institutes.
Prasad, Noopur; Jain, M L; Meena, B S
2018-06-01
Access the completeness in IUD services provided by trained professionals and find out the weak links. Study was conducted on 100 IUD trained professionals of tertiary care hospital and nursing teaching institute. All were given questionnaire that was duly filled by them. Data obtained were analysed. Protocols of case selection, pre-insertion counselling, insertion process and follow-up were assessed. All the four criteria were assessed on score of ten. Study group could not get ten points under any of the set criteria. Average of 53% case selection, 31.4% pre-insertion counselling, 42.5% insertion protocols and 46.1% follow-up counselling criteria were observed by study group. Highest compliance of protocols was seen among postgraduate students. Although IUD training is given to all medical professionals and IUD facility is available up to subcentres but the study shows that completeness in services is still lacking. Ensuring ideal place for IUD insertion, proper case selection, use of specific instruments for insertion and observance of insertion protocols are very vital for the success of IUD.
Templated sequence insertion polymorphisms in the human genome
NASA Astrophysics Data System (ADS)
Onozawa, Masahiro; Aplan, Peter
2016-11-01
Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.
Disrupting the male germ line to find infertility and contraception targets.
Archambeault, Denise R; Matzuk, Martin M
2014-05-01
Genetically-manipulated mouse models have become indispensible for broadening our understanding of genes and pathways related to male germ cell development. Until suitable in vitro systems for studying spermatogenesis are perfected, in vivo models will remain the gold standard for inquiry into testicular function. Here, we discuss exciting advances that are allowing researchers faster, easier, and more customizable access to their mouse models of interest. Specifically, the trans-NIH Knockout Mouse Project (KOMP) is working to generate knockout mouse models of every gene in the mouse genome. The related Knockout Mouse Phenotyping Program (KOMP2) is performing systematic phenotypic analysis of this genome-wide collection of knockout mice, including fertility screening. Together, these programs will not only uncover new genes involved in male germ cell development but also provide the research community with the mouse models necessary for further investigations. In addition to KOMP/KOMP2, another promising development in the field of mouse models is the advent of CRISPR (clustered regularly interspaced short palindromic repeat)-Cas technology. Utilizing 20 nucleotide guide sequences, CRISPR/Cas has the potential to introduce sequence-specific insertions, deletions, and point mutations to produce null, conditional, activated, or reporter-tagged alleles. CRISPR/Cas can also successfully target multiple genes in a single experimental step, forgoing the multiple generations of breeding traditionally required to produce mouse models with deletions, insertions, or mutations in multiple genes. In addition, CRISPR/Cas can be used to create mouse models carrying variants identical to those identified in infertile human patients, providing the opportunity to explore the effects of such mutations in an in vivo system. Both the KOMP/KOMP2 projects and the CRISPR/Cas system provide powerful, accessible genetic approaches to the study of male germ cell development in the mouse. A more complete understanding of male germ cell biology is critical for the identification of novel targets for potential non-hormonal contraceptive intervention. Copyright © 2014. Published by Elsevier Masson SAS.
Krishnaiah, Anil; Soothill, James; Wade, Angie; Mok, Quen Q; Ramnarayan, Padmanabhan
2012-05-01
To compare the rate of central venous catheter-associated bloodstream infections between pediatric intensive care unit admissions where central venous catheters were inserted within the same hospital (internal central venous catheters) and those where central venous catheters were inserted before transfer from other hospitals (external central venous catheters). Retrospective analysis of prospectively collected data. A tertiary care pediatric intensive care unit in London, UK. Consecutive pediatric intensive care unit admissions between May 2007 and March 2009. None. Catheter-associated bloodstream infections were identified using a widely accepted surveillance definition. The rate and time to occurrence of catheter-associated bloodstream infection were compared between internal and external nontunneled central venous catheters. A multilevel Cox-regression model was used to study the association between location of central venous catheter insertion and time to catheter-associated bloodstream infection. In total, 382 central venous catheters were studied (245 internal; 137 external) accounting for a total of 1,737 central venous catheter days. There was a higher catheter-associated bloodstream infection incidence density among external central venous catheters (23.1 [95% confidence interval 11.0-35.2] vs. 9.7 [95% confidence interval 3.9-15.5] per 1,000 catheter-days). Multivariable analyses demonstrated higher infection risk with external central venous catheters (hazard ratio 2.65 [95% confidence interval 1.18-5.96]) despite adjustment for confounding variables. The rate of catheter-associated bloodstream infections in the pediatric intensive care unit is significantly affected by external insertion of the central venous catheter. Future interventions to reduce nosocomial infections on pediatric intensive care units will need to be specifically targeted at this high-risk patient group.
Trinh, T. Q.; Sinden, R. R.
1993-01-01
We describe a system to measure the frequency of both deletions and duplications between direct repeats. Short 17- and 18-bp palindromic and nonpalindromic DNA sequences were cloned into the EcoRI site within the chloramphenicol acetyltransferase gene of plasmids pBR325 and pJT7. This creates an insert between direct repeated EcoRI sites and results in a chloramphenicol-sensitive phenotype. Selection for chloramphenicol resistance was utilized to select chloramphenicol resistant revertants that included those with precise deletion of the insert from plasmid pBR325 and duplication of the insert in plasmid pJT7. The frequency of deletion or duplication varied more than 500-fold depending on the sequence of the short sequence inserted into the EcoRI site. For the nonpalindromic inserts, multiple internal direct repeats and the length of the direct repeats appear to influence the frequency of deletion. Certain palindromic DNA sequences with the potential to form DNA hairpin structures that might stabilize the misalignment of direct repeats had a high frequency of deletion. Other DNA sequences with the potential to form structures that might destabilize misalignment of direct repeats had a very low frequency of deletion. Duplication mutations occurred at the highest frequency when the DNA between the direct repeats contained no direct or inverted repeats. The presence of inverted repeats dramatically reduced the frequency of duplications. The results support the slippage-misalignment model, suggesting that misalignment occurring during DNA replication leads to deletion and duplication mutations. The results also support the idea that the formation of DNA secondary structures during DNA replication can facilitate and direct specific mutagenic events. PMID:8325478
Rathleff, M S; Mølgaard, C M; Fredberg, U; Kaalund, S; Andersen, K B; Jensen, T T; Aaskov, S; Olesen, J L
2015-06-01
The aim of this study was to investigate the effectiveness of shoe inserts and plantar fascia-specific stretching vs shoe inserts and high-load strength training in patients with plantar fasciitis. Forty-eight patients with ultrasonography-verified plantar fasciitis were randomized to shoe inserts and daily plantar-specific stretching (the stretch group) or shoe inserts and high-load progressive strength training (the strength group) performed every second day. High-load strength training consisted of unilateral heel raises with a towel inserted under the toes. Primary outcome was the foot function index (FFI) at 3 months. Additional follow-ups were performed at 1, 6, and 12 months. At the primary endpoint, at 3 months, the strength group had a FFI that was 29 points lower [95% confidence interval (CI): 6-52, P = 0.016] compared with the stretch group. At 1, 6, and 12 months, there were no differences between groups (P > 0.34). At 12 months, the FFI was 22 points (95% CI: 9-36) in the strength group and 16 points (95% CI: 0-32) in the stretch group. There were no differences in any of the secondary outcomes. A simple progressive exercise protocol, performed every second day, resulted in superior self-reported outcome after 3 months compared with plantar-specific stretching. High-load strength training may aid in a quicker reduction in pain and improvements in function. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
NASA Astrophysics Data System (ADS)
Poplavskaya, T. V.; Kirilovskiy, S. V.; Mironov, S. G.
2017-10-01
Numerical simulation of supersonic flow past a cylinder with a frontal gas-permeable insert is performed using the skeleton model of a highly porous cellular material. Numerical simulation was carried out within the framework of two-dimensional RANS equations written in an axisymmetric form. The skeleton model is a system of coaxial rings of different diameters, arranged in staggered order. The calculations were carried out in a wide range of determining parameters: Mach numbers M∞ = 3, 4.85 and 7, unit Reynolds numbers Re1∞ = 13.8×105 ÷ 13.8×106 m-1, the cylinder diameter 6÷40mm, the length of the porous insert 3÷45mm, the cell diameter of 1 and 3 mm. The results of the calculations are consistent with the available experimental data. The applicability of the skeleton model for the description of supersonic flow around axisymmetric bodies with front inserts from cellular-porous materials is shown.
Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B
2017-01-01
CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex.
Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.
2017-01-01
CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex. PMID:28052104
Kris, M. G.; Camidge, D. R.; Giaccone, G.; Hida, T.; Li, B. T.; O'Connell, J.; Taylor, I.; Zhang, H.; Arcila, M. E.; Goldberg, Z.; Jänne, P. A.
2015-01-01
Background HER2 mutations and amplifications have been identified as oncogenic drivers in lung cancers. Dacomitinib, an irreversible inhibitor of HER2, EGFR (HER1), and HER4 tyrosine kinases, has demonstrated activity in cell-line models with HER2 exon 20 insertions or amplifications. Here, we studied dacomitinib in patients with HER2-mutant or amplified lung cancers. Patients and methods As a prespecified cohort of a phase II study, we included patients with stage IIIB/IV lung cancers with HER2 mutations or amplification. We gave oral dacomitinib at 30–45 mg daily in 28-day cycles. End points included partial response rate, overall survival, and toxicity. Results We enrolled 30 patients with HER2-mutant (n = 26, all in exon 20 including 25 insertions and 1 missense mutation) or HER2-amplified lung cancers (n = 4). Three of 26 patients with tumors harboring HER2 exon 20 mutations [12%; 95% confidence interval (CI) 2% to 30%] had partial responses lasting 3+, 11, and 14 months. No partial responses occurred in four patients with tumors with HER2 amplifications. The median overall survival was 9 months from the start of dacomitinib (95% CI 7–21 months) for patients with HER2 mutations and ranged from 5 to 22 months with amplifications. Treatment-related toxicities included diarrhea (90%; grade 3/4: 20%/3%), dermatitis (73%; grade 3/4: 3%/0%), and fatigue (57%; grade 3/4: 3%/0%). One patient died on study likely due to an interaction of dacomitinib with mirtazapine. Conclusions Dacomitinib produced objective responses in patients with lung cancers with specific HER2 exon 20 insertions. This observation validates HER2 exon 20 insertions as actionable targets and justifies further study of HER2-targeted agents in specific HER2-driven lung cancers. ClinicalTrials.gov NCT00818441. PMID:25899785
Correction of hypermobile flatfoot in children by molded insert.
Bordelon, R L
1980-11-01
One hundred feet in 50 children between the ages of 3 and 9 years with a diagnosis of idiopathic hypermobile flatfoot had a custom-molded insert ordered. A specific method of casting, correcting the various components of the deformity was utilized. An 1/8-inch polypropolene insert was fabricated from the positive cast. The insert was worn in leather shoes with a long counter, steel shank, and Thomas heel. The flatfoot was evaluated and classified by measurement of the talometatarsal angle on a standing lateral X-ray. The insert was fabricated so that the standing lateral talometatarsal angle was corrected to neutral with the insert on the foot and the foot in the shoe. The preliminary reports indicate that a correction can be obtained at the rate of 0.41 degrees per month or approximately 5 degrees per year. There was no significant loss of motion of the foot or the ankle. Perhaps this regimen may be utilized in those children with a hypermobile flatfoot for whom treatment is advised.
21 CFR 310.515 - Patient package inserts for estrogens.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 5 2010-04-01 2010-04-01 false Patient package inserts for estrogens. 310.515 Section 310.515 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS FOR HUMAN USE NEW DRUGS Requirements for Specific New Drugs or Devices § 310.515 Patient...
Complete genome sequences of two novel European clade bovine foamy viruses from Germany and Poland.
Hechler, Torsten; Materniak, Magdalena; Kehl, Timo; Kuzmak, Jacek; Löchelt, Martin
2012-10-01
Bovine foamy virus (BFV), or bovine spumaretrovirus, is an infectious agent of cattle with no obvious disease association but high prevalence in its host. Here, we report two complete BFV sequences, BFV-Riems, isolated in 1978 in East Germany, and BFV100, isolated in 2005 in Poland. Both new BFV isolates share the overall genetic makeup of other foamy viruses (FV). Although isolated almost 25 years apart and propagated in either bovine (BFV-Riems) or nonbovine (BFV100) cells, both viruses are highly related, forming the European BFV clade. Despite clear differences, BFV-Riems and BFV100 are still very similar to BFV isolates from China and the United States, comprising the non-European BFV clade. The genomic sequences presented here confirm the concept of high sequence conservation across most of the FV genome. Analyses of cell culture-derived genomes reveal that proviral DNA may specifically lack introns in the env-bel coding region. The spacing of the splice sites in this region suggests that BFV has developed a novel mode to express a secretory but nonfunctional Env protein.
Complete Genome Sequences of Two Novel European Clade Bovine Foamy Viruses from Germany and Poland
Hechler, Torsten; Materniak, Magdalena; Kehl, Timo; Kuzmak, Jacek
2012-01-01
Bovine foamy virus (BFV), or bovine spumaretrovirus, is an infectious agent of cattle with no obvious disease association but high prevalence in its host. Here, we report two complete BFV sequences, BFV-Riems, isolated in 1978 in East Germany, and BFV100, isolated in 2005 in Poland. Both new BFV isolates share the overall genetic makeup of other foamy viruses (FV). Although isolated almost 25 years apart and propagated in either bovine (BFV-Riems) or nonbovine (BFV100) cells, both viruses are highly related, forming the European BFV clade. Despite clear differences, BFV-Riems and BFV100 are still very similar to BFV isolates from China and the United States, comprising the non-European BFV clade. The genomic sequences presented here confirm the concept of high sequence conservation across most of the FV genome. Analyses of cell culture-derived genomes reveal that proviral DNA may specifically lack introns in the env-bel coding region. The spacing of the splice sites in this region suggests that BFV has developed a novel mode to express a secretory but nonfunctional Env protein. PMID:22966195
Wang, Cheng; Goff, Stephen P
2017-02-07
Replication of the murine leukemia viruses is strongly suppressed in mouse embryonic stem (ES) cells. Proviral DNAs are formed normally but are then silenced by a large complex bound to DNA by the ES cell-specific zinc-finger protein ZFP809. We show here that ZFP809 expression is not regulated by transcription but rather by protein turnover: ZFP809 protein is stable in embryonic cells but highly unstable in differentiated cells. The protein is heavily modified by the accumulation of polyubiquitin chains in differentiated cells and stabilized by the proteasome inhibitor MG132. A short sequence of amino acids at the C terminus of ZFP809, including a single lysine residue (K391), is required for the rapid turnover of the protein. The silencing cofactor TRIM28 was found to promote the degradation of ZFP809 in differentiated cells. These findings suggest that the stem cell state is established not only by an unusual transcriptional profile but also by unusual regulation of protein levels through the proteasomal degradation pathway.
PrPC has nucleic acid chaperoning properties similar to the nucleocapsid protein of HIV-1.
Derrington, Edmund; Gabus, Caroline; Leblanc, Pascal; Chnaidermann, Jonas; Grave, Linda; Dormont, Dominique; Swietnicki, Wieslaw; Morillas, Manuel; Marck, Daniel; Nandi, Pradip; Darlix, Jean-Luc
2002-01-01
The function of the cellular prion protein (PrPC) remains obscure. Studies suggest that PrPC functions in several processes including signal transduction and Cu2+ metabolism. PrPC has also been established to bind nucleic acids. Therefore we investigated the properties of PrPC as a putative nucleic acid chaperone. Surprisingly, PrPC possesses all the nucleic acid chaperoning properties previously specific to retroviral nucleocapsid proteins. PrPC appears to be a molecular mimic of NCP7, the nucleocapsid protein of HIV-1. Thus PrPC, like NCP7, chaperones the annealing of tRNA(Lys) to the HIV-1 primer binding site, the initial step of retrovirus replication. PrPC also chaperones the two DNA strand transfers required for production of a complete proviral DNA with LTRs. Concerning the functions of NCP7 during budding, PrPC also mimices NCP7 by dimerizing the HIV-1 genomic RNA. These data are unprecedented because, although many cellular proteins have been identified as nucleic acid chaperones, none have the properties of retroviral nucleocapsid proteins.
Clarridge, Katherine E; Blazkova, Jana; Einkauf, Kevin; Petrone, Mary; Refsland, Eric W; Justement, J Shawn; Shi, Victoria; Huiting, Erin D; Seamon, Catherine A; Lee, Guinevere Q; Yu, Xu G; Moir, Susan; Sneller, Michael C; Lichterfeld, Mathias; Chun, Tae-Wook
2018-01-01
Therapeutic strategies aimed at achieving antiretroviral therapy (ART)-free HIV remission in infected individuals are under active investigation. Considering the vast majority of HIV-infected individuals experience plasma viral rebound upon cessation of therapy, clinical trials evaluating the efficacy of curative strategies would likely require inclusion of ART interruption. However, it is unclear what impact short-term analytical treatment interruption (ATI) and subsequent reinitiation of ART have on immunologic and virologic parameters of HIV-infected individuals. Here, we show a significant increase of HIV burden in the CD4+ T cells of infected individuals during ATI that was correlated with the level of plasma viral rebound. However, the size of the HIV reservoirs as well as immune parameters, including markers of exhaustion and activation, returned to pre-ATI levels 6-12 months after the study participants resumed ART. Of note, the proportions of near full-length, genome-intact and structurally defective HIV proviral DNA sequences were similar prior to ATI and following reinitiation of ART. In addition, there was no evidence of emergence of antiretroviral drug resistance mutations within intact HIV proviral DNA sequences following reinitiation of ART. These data demonstrate that short-term ATI does not necessarily lead to expansion of the persistent HIV reservoir nor irreparable damages to the immune system in the peripheral blood, warranting the inclusion of ATI in future clinical trials evaluating curative strategies.
Petrone, Mary; Justement, J. Shawn; Shi, Victoria; Huiting, Erin D.; Yu, Xu G.; Moir, Susan; Sneller, Michael C.; Lichterfeld, Mathias
2018-01-01
Therapeutic strategies aimed at achieving antiretroviral therapy (ART)-free HIV remission in infected individuals are under active investigation. Considering the vast majority of HIV-infected individuals experience plasma viral rebound upon cessation of therapy, clinical trials evaluating the efficacy of curative strategies would likely require inclusion of ART interruption. However, it is unclear what impact short-term analytical treatment interruption (ATI) and subsequent reinitiation of ART have on immunologic and virologic parameters of HIV-infected individuals. Here, we show a significant increase of HIV burden in the CD4+ T cells of infected individuals during ATI that was correlated with the level of plasma viral rebound. However, the size of the HIV reservoirs as well as immune parameters, including markers of exhaustion and activation, returned to pre-ATI levels 6–12 months after the study participants resumed ART. Of note, the proportions of near full-length, genome-intact and structurally defective HIV proviral DNA sequences were similar prior to ATI and following reinitiation of ART. In addition, there was no evidence of emergence of antiretroviral drug resistance mutations within intact HIV proviral DNA sequences following reinitiation of ART. These data demonstrate that short-term ATI does not necessarily lead to expansion of the persistent HIV reservoir nor irreparable damages to the immune system in the peripheral blood, warranting the inclusion of ATI in future clinical trials evaluating curative strategies. PMID:29324842
Addai, Amma B.; Pandhare, Jui; Paromov, Victor; Mantri, Chinmay K.; Pratap, Siddharth; Dash, Chandravanu
2015-01-01
Epidemiologic studies suggest that cocaine abuse worsens HIV-1 disease progression. Increased viral load has been suggested to play a key role for the accelerated HIV disease among cocaine-abusing patients. The goal of this study was to investigate whether cocaine enhances proviral DNA integration as a mechanism to increase viral load. We infected CD4+ T cells that are the primary targets of HIV-1 in vivo and treated the cells with physiologically relevant concentrations of cocaine (1 µM–100 µM). Proviral DNA integration in the host genome was measured by nested qPCR. Our results illustrated that cocaine from 1 µM through 50 µM increased HIV-1 integration in CD4+ T cells in a dose-dependent manner. As integration can be modulated by several early postentry steps of HIV-1 infection, we examined the direct effects of cocaine on viral integration by in vitro integration assays by use of HIV-1 PICs. Our data illustrated that cocaine directly increases viral DNA integration. Furthermore, our MS analysis showed that cocaine is able to enter CD4+ T cells and localize to the nucleus-. In summary, our data provide strong evidence that cocaine can increase HIV-1 integration in CD4+ T cells. Therefore, we hypothesize that increased HIV-1 integration is a novel mechanism by which cocaine enhances viral load and worsens disease progression in drug-abusing HIV-1 patients. PMID:25691383
Gabus, C; Derrington, E; Leblanc, P; Chnaiderman, J; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W K; Marc, D; Nandi, P; Darlix, J L
2001-06-01
Transmissible spongiform encephalopathies are fatal neurodegenerative diseases associated with the accumulation of a protease-resistant form of the prion protein (PrP). Although PrP is conserved in vertebrates, its function remains to be identified. In vitro PrP binds large nucleic acids causing the formation of nucleoprotein complexes resembling human immunodeficiency virus type 1 (HIV-1) nucleocapsid-RNA complexes and in vivo MuLV replication accelerates the scrapie infectious process, suggesting possible interactions between retroviruses and PrP. Retroviruses, including HIV-1 encode a major nucleic acid binding protein (NC protein) found within the virus where 2000 NC protein molecules coat the dimeric genome. NC is required in virus assembly and infection to chaperone RNA dimerization and packaging and in proviral DNA synthesis by reverse transcriptase (RT). In HIV-1, 5'-leader RNA/NC interactions appear to control these viral processes. This prompted us to compare and contrast the interactions of human and ovine PrP and HIV-1 NCp7 with HIV-1 5'-leader RNA. Results show that PrP has properties characteristic of NCp7 with respect to viral RNA dimerization and proviral DNA synthesis by RT. The NC-like properties of huPrP map to the N-terminal region of huPrP. Interestingly, PrP localizes in the membrane and cytoplasm of PrP-expressing cells. These findings suggest that PrP is a multifunctional protein possibly participating in nucleic acid metabolism.
Automated model-based quantitative analysis of phantoms with spherical inserts in FDG PET scans.
Ulrich, Ethan J; Sunderland, John J; Smith, Brian J; Mohiuddin, Imran; Parkhurst, Jessica; Plichta, Kristin A; Buatti, John M; Beichel, Reinhard R
2018-01-01
Quality control plays an increasingly important role in quantitative PET imaging and is typically performed using phantoms. The purpose of this work was to develop and validate a fully automated analysis method for two common PET/CT quality assurance phantoms: the NEMA NU-2 IQ and SNMMI/CTN oncology phantom. The algorithm was designed to only utilize the PET scan to enable the analysis of phantoms with thin-walled inserts. We introduce a model-based method for automated analysis of phantoms with spherical inserts. Models are first constructed for each type of phantom to be analyzed. A robust insert detection algorithm uses the model to locate all inserts inside the phantom. First, candidates for inserts are detected using a scale-space detection approach. Second, candidates are given an initial label using a score-based optimization algorithm. Third, a robust model fitting step aligns the phantom model to the initial labeling and fixes incorrect labels. Finally, the detected insert locations are refined and measurements are taken for each insert and several background regions. In addition, an approach for automated selection of NEMA and CTN phantom models is presented. The method was evaluated on a diverse set of 15 NEMA and 20 CTN phantom PET/CT scans. NEMA phantoms were filled with radioactive tracer solution at 9.7:1 activity ratio over background, and CTN phantoms were filled with 4:1 and 2:1 activity ratio over background. For quantitative evaluation, an independent reference standard was generated by two experts using PET/CT scans of the phantoms. In addition, the automated approach was compared against manual analysis, which represents the current clinical standard approach, of the PET phantom scans by four experts. The automated analysis method successfully detected and measured all inserts in all test phantom scans. It is a deterministic algorithm (zero variability), and the insert detection RMS error (i.e., bias) was 0.97, 1.12, and 1.48 mm for phantom activity ratios 9.7:1, 4:1, and 2:1, respectively. For all phantoms and at all contrast ratios, the average RMS error was found to be significantly lower for the proposed automated method compared to the manual analysis of the phantom scans. The uptake measurements produced by the automated method showed high correlation with the independent reference standard (R 2 ≥ 0.9987). In addition, the average computing time for the automated method was 30.6 s and was found to be significantly lower (P ≪ 0.001) compared to manual analysis (mean: 247.8 s). The proposed automated approach was found to have less error when measured against the independent reference than the manual approach. It can be easily adapted to other phantoms with spherical inserts. In addition, it eliminates inter- and intraoperator variability in PET phantom analysis and is significantly more time efficient, and therefore, represents a promising approach to facilitate and simplify PET standardization and harmonization efforts. © 2017 American Association of Physicists in Medicine.
ERIC Educational Resources Information Center
Namba, Kazuhiko
2012-01-01
This article investigates English-Japanese children's code-switching (CS) from the structural point of view. Muysken categorises it into three types, that is, insertion, alternation and congruent lexicalisation. Regarding insertion, using Myers-Scotton's matrix language frame (MLF) model, for example, the matrix language (ML) of a bilingual clause…
2013-03-01
Weave Welding Method Wheel Assembly Wind Load Wind Loads Wind Uplift Resistance Wind Uplift Resistance Class Window Category Window Finish Window... wind - blast Elongation UFGS 2.1 percent Insert Value Visual Defects UFGS 2.1 n/a Insert Value ERDC/CERL CR-13-1 39 Attribute Source...Sustainability COBie Guide n/a insert reqts FRP Strengthening UFGS 1.2 n/a seismic - wind - blast Elongation UFGS 2.2 percent Insert Value Tensile
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Xiangjie; Belser, Jessica A.; Tumpey, Terrence M., E-mail: tft9@cdc.gov
In 2012, an avian influenza A H7N3 (A/Mexico/InDRE7218/2012; Mx/7218) virus was responsible for two confirmed cases of human infection and led to the death or culling of more than 22 million chickens in Jalisco, Mexico. Interestingly, this virus acquired an 8-amino acid (aa)-insertion (..PENPK-DRKSRHRR-TR/GLF) near the hemagglutinin (HA) cleavage site by nonhomologous recombination with host rRNA. It remains unclear which specific residues at the cleavage site contribute to the virulence of H7N3 viruses in mammals. Using loss-of-function approaches, we generated a series of cleavage site mutant viruses by reverse genetics and characterized the viruses in vitro and in vivo. Wemore » found that the 8-aa insertion and the arginine at position P4 of the Mx/7218 HA cleavage site are essential for intracellular HA cleavage in 293T cells, but have no effect on the pH of membrane fusion. However, we identified a role for the histidine residue at P5 position in viral fusion pH. In mice, the 8-aa insertion is required for Mx/7218 virus virulence; however, the basic residues upstream of the P4 position are dispensable for virulence. Overall, our study provides the first line of evidence that the insertion in the Mx/7218 virus HA cleavage site confers its intracellular cleavability, and consequently contributes to enhanced virulence in mice. - Highlights: • An avian influenza H7N3 virus acquired a unique 8-amino acid (aa) insertion. • The role of specific basic residues in the HA insertion in viral pathogenesis was determined. • In mice, the 8-aa insertion is required for H7N3 virus virulence. • The R residue at position P4 is essential for HA intracellular cleavage and virus virulence.« less
Bacterial molybdoenzymes: old enzymes for new purposes.
Leimkühler, Silke; Iobbi-Nivol, Chantal
2016-01-01
Molybdoenzymes are widespread in eukaryotic and prokaryotic organisms where they play crucial functions in detoxification reactions in the metabolism of humans and bacteria, in nitrate assimilation in plants and in anaerobic respiration in bacteria. To be fully active, these enzymes require complex molybdenum-containing cofactors, which are inserted into the apoenzymes after folding. For almost all the bacterial molybdoenzymes, molybdenum cofactor insertion requires the involvement of specific chaperones. In this review, an overview on the molybdenum cofactor biosynthetic pathway is given together with the role of specific chaperones dedicated for molybdenum cofactor insertion and maturation. Many bacteria are involved in geochemical cycles on earth and therefore have an environmental impact. The roles of molybdoenzymes in bioremediation and for environmental applications are presented. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
48 CFR 852.211-75 - Product specifications.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Product specifications... Product specifications. As prescribed in 811.204, insert the following clause: Product Specifications (JAN 2008) The products offered under this solicitation shall be type ________, grade ________, in...
Bhogal, Maninder; Lwin, Chan N.; Seah, Xin-Yi; Murugan, Elavazhagan; Adnan, Khadijah; Lin, Shu-Jun; Mehta, Jodhbir S.
2017-01-01
Purpose To establish a method for assessing graft viability, in-vivo, following corneal transplantation. Methods Optimization of calcein AM fluorescence and toxicity assessment was performed in cultured human corneal endothelial cells and ex-vivo corneal tissue. Descemet membrane endothelial keratoplasty grafts were incubated with calcein AM and imaged pre and post preparation, and in-situ after insertion and unfolding in a pig eye model. Global, macroscopic images of the entire graft and individual cell resolution could be attained by altering the magnification of a clinical confocal scanning laser microscope. Patterns of cell loss observed in situ were compared to those seen using standard ex-vivo techniques. Results Calcein AM showed a positive dose-fluorescence relationship. A dose of 2.67μmol was sufficient to allow clear discrimination between viable and non-viable areas (sensitivity of 96.6% with a specificity of 96.1%) and was not toxic to cultured endothelial cells or ex-vivo corneal tissue. Patterns of cell loss seen in-situ closely matched those seen on ex-vivo assessment with fluorescence viability imaging, trypan blue/alizarin red staining or scanning electron microscopy. Iatrogenic graft damage from preparation and insertion varied between 7–35% and incarceration of the graft tissue within surgical wounds was identified as a significant cause of endothelial damage. Conclusions In-situ graft viability assessment using clinical imaging devices provides comparable information to ex-vivo methods. This method shows high sensitivity and specificity, is non-toxic and can be used to evaluate immediate cell viability in new grafting techniques in-vivo. PMID:28977017
1989-09-25
Orders and test specifications. Some mandatory replacement of high failure items are directed by Technical Orders to extend MTBF. Precision bearing and...Experience is very high but natural attrition is reducing the numbers faster than training is furnishing younger mechanics. Surge conditions would be...model validation run output revealed that utilization of equipment is very low and manpower is high . Based on this analysis and the brainstorming
Liang, Emily C; Sceats, Lindsay; Bayless, Nicholas L; Strauss-Albee, Dara M; Kubo, Jessica; Grant, Philip M; Furman, David; Desai, Manisha; Katzenstein, David A; Davis, Mark M; Zolopa, Andrew R; Blish, Catherine A
2014-08-01
Generalized immune activation during HIV infection is associated with an increased risk of cardiovascular disease, neurocognitive disease, osteoporosis, metabolic disorders, and physical frailty. The mechanisms driving this immune activation are poorly understood, particularly for individuals effectively treated with antiretroviral medications. We hypothesized that viral characteristics such as sequence diversity may play a role in driving HIV-associated immune activation. We therefore sequenced proviral DNA isolated from peripheral blood mononuclear cells from HIV-infected individuals on fully suppressive antiretroviral therapy. We performed phylogenetic analyses, calculated viral diversity and divergence in the env and pol genes, and determined coreceptor tropism and the frequency of drug resistance mutations. Comprehensive immune profiling included quantification of immune cell subsets, plasma cytokine levels, and intracellular signaling responses in T cells, B cells, and monocytes. These antiretroviral therapy-treated HIV-infected individuals exhibited a wide range of diversity and divergence in both env and pol genes. However, proviral diversity and divergence in env and pol, coreceptor tropism, and the level of drug resistance did not significantly correlate with markers of immune activation. A clinical history of virologic failure was also not significantly associated with levels of immune activation, indicating that a history of virologic failure does not inexorably lead to increased immune activation as long as suppressive antiretroviral medications are provided. Overall, this study demonstrates that latent viral diversity is unlikely to be a major driver of persistent HIV-associated immune activation. Chronic immune activation, which is associated with cardiovascular disease, neurologic disease, and early aging, is likely to be a major driver of morbidity and mortality in HIV-infected individuals. Although treatment of HIV with antiretroviral medications decreases the level of immune activation, levels do not return to normal. The factors driving this persistent immune activation, particularly during effective treatment, are poorly understood. In this study, we investigated whether characteristics of the latent, integrated HIV provirus that persists during treatment are associated with immune activation. We found no relationship between latent viral characteristics and immune activation in treated individuals, indicating that qualities of the provirus are unlikely to be a major driver of persistent inflammation. We also found that individuals who had previously failed treatment but were currently effectively treated did not have significantly increased levels of immune activation, providing hope that past treatment failures do not have a lifelong "legacy" impact. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Zhang; Watson; Dullaghan; Gorun; Sweigart
1999-08-01
Stable unsaturated heterocycles such as benzofuran are difficult to remove from petroleum by conventional catalytic hydrotreating. However, in a model system, coordination of Mn(CO)(3)(+) to the aromatic ring of benzofuran activates the C-O bond towards insertion of [Pt(PPh(3))(2)] [Eq. (1)]. The insertion is preceded by precoordination to the furan C=C bond; thus, the 2,3-dihydro analogue of 1, which lacks this double bond, does not undergo insertion of the Pt moiety.
NASA Technical Reports Server (NTRS)
Dunn, Mariea C.; Alves, Jeffrey R.; Hutchinson, Sonya L.
1999-01-01
This paper describes the human engineering analysis performed on the Materials Science Research Rack-1 and Quench Module Insert (MSRR-1/QMI) using Transom Jack (Jack) software. The Jack software was used to model a virtual environment consisting of the MSRR-1/QMI hardware configuration and human figures representing the 95th percentile male and 5th percentile female. The purpose of the simulation was to assess the human interfaces in the design for their ability to meet the requirements of the Pressurized Payloads Interface Requirements Document - International Space Program, Revision C (SSP 57000). Jack was used in the evaluation because of its ability to correctly model anthropometric body measurements and the physical behavior of astronauts working in microgravity, which is referred to as the neutral body posture. The Jack model allows evaluation of crewmember interaction with hardware through task simulation including but not limited to collision avoidance behaviors, hand/eye coordination, reach path planning, and automatic grasping to part contours. Specifically, this virtual simulation depicts the human figures performing the QMI installation and check-out, sample cartridge insertion and removal, and gas bottle drawer removal. These tasks were evaluated in terms of adequate clearance in reach envelopes, adequate accessibility in work envelopes, appropriate line of sight in visual envelopes, and accommodation of full size range for male and female stature maneuverability. The results of the human engineering analysis virtual simulation indicate that most of the associated requirements of SSP 57000 were met. However, some hardware design considerations and crew procedures modifications are recommended to improve accessibility, provide an adequate work envelope, reduce awkward body posture, and eliminate permanent protrusions.
Relationship between footwear comfort of shoe inserts and anthropometric and sensory factors.
Mündermann, A; Stefanyshyn, D J; Nigg, B M
2001-11-01
The purposes of this study were (a) to determine lower extremity anthropometric and sensory factors that are related to differences in comfort perception of shoe inserts with varying shape and material and (b) to investigate whether shoe inserts that improve comfort decrease injury frequency in a military population. 206 military personnel volunteered for this study. The shoe inserts varied in arch and heel cup shape, hardness, and elasticity in the heel and forefoot regions. A no insert condition was included as the control condition. Measured subject characteristics included foot shape, foot and leg alignment, and tactile and vibration sensitivity of the plantar surface of the foot. Footwear comfort was assessed using a visual analog scale. Injury frequency was evaluated with a questionnaire. The statistical analyses included Student's t-tests for repeated measures, ANOVA (within subjects), MANOVA (within insert combinations), and chi-square tests. The average comfort ratings for all shoe inserts were significantly higher than the average comfort rating for the control condition. The incidence of stress fractures and pain at different locations was reduced by 1.5-13.4% for the insert compared with the control group. Foot arch height, foot and leg alignment, and foot sensitivity were significantly related to differences in comfort ratings for the hard/soft, the viscous/elastic, and the high arch/low arch insert combinations. Shoe inserts of different shape and material that are comfortable are able to decrease injury frequency. The results of this study showed that subject specific characteristics influence comfort perception of shoe inserts.
Troyer, Jennifer L; Pecon-Slattery, Jill; Roelke, Melody E; Johnson, Warren; VandeWoude, Sue; Vazquez-Salat, Nuria; Brown, Meredith; Frank, Laurence; Woodroffe, Rosie; Winterbach, Christiaan; Winterbach, Hanlie; Hemson, Graham; Bush, Mitch; Alexander, Kathleen A; Revilla, Eloy; O'Brien, Stephen J
2005-07-01
Feline immunodeficiency virus (FIV) infects numerous wild and domestic feline species and is closely related to human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV). Species-specific strains of FIV have been described for domestic cat (Felis catus), puma (Puma concolor), lion (Panthera leo), leopard (Panthera pardus), and Pallas' cat (Otocolobus manul). Here, we employ a three-antigen Western blot screening (domestic cat, puma, and lion FIV antigens) and PCR analysis to survey worldwide prevalence, distribution, and genomic differentiation of FIV based on 3,055 specimens from 35 Felidae and 3 Hyaenidae species. Although FIV infects a wide variety of host species, it is confirmed to be endemic in free-ranging populations of nine Felidae and one Hyaenidae species. These include the large African carnivores (lion, leopard, cheetah, and spotted hyena), where FIV is widely distributed in multiple populations; most of the South American felids (puma, jaguar, ocelot, margay, Geoffroy's cat, and tigrina), which maintain a lower FIV-positive level throughout their range; and two Asian species, the Pallas' cat, which has a species-specific strain of FIV, and the leopard cat, which has a domestic cat FIV strain in one population. Phylogenetic analysis of FIV proviral sequence demonstrates that most species for which FIV is endemic harbor monophyletic, genetically distinct species-specific FIV strains, suggesting that FIV transfer between cat species has occurred in the past but is quite infrequent today.
Troyer, Jennifer L.; Pecon-Slattery, Jill; Roelke, Melody E.; Johnson, Warren; VandeWoude, Sue; Vazquez-Salat, Nuria; Brown, Meredith; Frank, Laurence; Woodroffe, Rosie; Winterbach, Christiaan; Winterbach, Hanlie; Hemson, Graham; Bush, Mitch; Alexander, Kathleen A.; Revilla, Eloy; O'Brien, Stephen J.
2005-01-01
Feline immunodeficiency virus (FIV) infects numerous wild and domestic feline species and is closely related to human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV). Species-specific strains of FIV have been described for domestic cat (Felis catus), puma (Puma concolor), lion (Panthera leo), leopard (Panthera pardus), and Pallas' cat (Otocolobus manul). Here, we employ a three-antigen Western blot screening (domestic cat, puma, and lion FIV antigens) and PCR analysis to survey worldwide prevalence, distribution, and genomic differentiation of FIV based on 3,055 specimens from 35 Felidae and 3 Hyaenidae species. Although FIV infects a wide variety of host species, it is confirmed to be endemic in free-ranging populations of nine Felidae and one Hyaenidae species. These include the large African carnivores (lion, leopard, cheetah, and spotted hyena), where FIV is widely distributed in multiple populations; most of the South American felids (puma, jaguar, ocelot, margay, Geoffroy's cat, and tigrina), which maintain a lower FIV-positive level throughout their range; and two Asian species, the Pallas' cat, which has a species-specific strain of FIV, and the leopard cat, which has a domestic cat FIV strain in one population. Phylogenetic analysis of FIV proviral sequence demonstrates that most species for which FIV is endemic harbor monophyletic, genetically distinct species-specific FIV strains, suggesting that FIV transfer between cat species has occurred in the past but is quite infrequent today. PMID:15956574
Höger, T A; Jacobson, S; Kawanishi, T; Kato, T; Nishioka, K; Yamamoto, K
1997-08-15
Human T lymphotropic virus type I (HTLV-I)-associated myelopathy/tropical spastic paraperesis (HAM/TSP) is a slowly progressive neurologic disorder following infection with HTLV-I. It is characterized by spasticity and hyper-reflexia of the lower extremities, urinary bladder disturbance, lower extremity muscle weakness, and sensory disturbances. HTLV-I, as an inducer of a strong humoral and cytotoxic response, is a well-known pathogenic factor for the progression of HAM/TSP. Peptides derived from proviral tax and env genes provide epitopes recognized by T cells. We herein report an accumulation of distinct clonotypes of alpha/beta TCR+ peripheral blood T lymphocytes from HAM/TSP patients in comparison with that observed in both asymptomatic carriers and healthy controls, using the reverse-transcriptase PCR/single-strand conformation polymorphism method. We also found that some of the accumulated T cell clones in the peripheral blood and cerebrospinal fluid are HTLV-I Tax(11-19) peptide specific. Such clones were found to expand strongly after being cultured with an HTLV-I Tax(11-19) peptide. Moreover, the cultured samples exhibited a strong MHC class I-restricted cytotoxic activity against HTLV-I Tax(11-19) peptide-expressing targets, and therefore most likely also include the disease-associated T cell clones observed in the patients. This is the first report of a direct assessment of Ag-specific T cell responses in fresh PBL and cerebrospinal fluid.
Rahman, Masmudur M.; Liu, Jia; Chan, Winnie M.; Rothenburg, Stefan; McFadden, Grant
2013-01-01
Myxoma virus (MYXV)-encoded protein M029 is a member of the poxvirus E3 family of dsRNA-binding proteins that antagonize the cellular interferon signaling pathways. In order to investigate additional functions of M029, we have constructed a series of targeted M029-minus (vMyx-M029KO and vMyx-M029ID) and V5-tagged M029 MYXV. We found that M029 plays a pivotal role in determining the cellular tropism of MYXV in all mammalian cells tested. The M029-minus viruses were able to replicate only in engineered cell lines that stably express a complementing protein, such as vaccinia E3, but underwent abortive or abated infection in all other tested mammalian cell lines. The M029-minus viruses were dramatically attenuated in susceptible host European rabbits and caused no observable signs of myxomatosis. Using V5-tagged M029 virus, we observed that M029 expressed as an early viral protein is localized in both the nuclear and cytosolic compartments in virus-infected cells, and is also incorporated into virions. Using proteomic approaches, we have identified Protein Kinase R (PKR) and RNA helicase A (RHA)/DHX9 as two cellular binding partners of M029 protein. In virus-infected cells, M029 interacts with PKR in a dsRNA-dependent manner, while binding with DHX9 was not dependent on dsRNA. Significantly, PKR knockdown in human cells rescued the replication defect of the M029-knockout viruses. Unexpectedly, this rescue of M029-minus virus replication by PKR depletion could then be reversed by RHA/DHX9 knockdown in human monocytic THP1 cells. This indicates that M029 not only inhibits generic PKR anti-viral pathways, but also binds and conscripts RHA/DHX9 as a pro-viral effector to promote virus replication in THP1 cells. Thus, M029 is a critical host range and virulence factor for MYXV that is required for replication in all mammalian cells by antagonizing PKR-mediated anti-viral functions, and also conscripts pro-viral RHA/DHX9 to promote viral replication specifically in myeloid cells. PMID:23853588
2012-01-01
Background Zoonotic transmission of simian retroviruses in Central Africa is ongoing and can result in pandemic human infection. While simian foamy virus (SFV) infection was reported in primate hunters in Cameroon and Gabon, little is known about the distribution of SFV in Africa and whether human-to-human transmission and disease occur. We screened 3,334 plasmas from persons living in rural villages in central Democratic Republic of Congo (DRC) using SFV-specific EIA and Western blot (WB) tests. PCR amplification of SFV polymerase sequences from DNA extracted from buffy coats was used to measure proviral loads. Phylogenetic analysis was used to define the NHP species origin of SFV. Participants completed questionnaires to capture NHP exposure information. Results Sixteen (0.5%) samples were WB-positive; 12 of 16 were from women (75%, 95% confidence limits 47.6%, 92.7%). Sequence analysis detected SFV in three women originating from Angolan colobus or red-tailed monkeys; both monkeys are hunted frequently in DRC. NHP exposure varied and infected women lived in distant villages suggesting a wide and potentially diverse distribution of SFV infections across DRC. Plasmas from 22 contacts of 8 WB-positive participants were all WB negative suggesting no secondary viral transmission. Proviral loads in the three women ranged from 14 – 1,755 copies/105 cells. Conclusions Our study documents SFV infection in rural DRC for the first time and identifies infections with novel SFV variants from Colobus and red-tailed monkeys. Unlike previous studies, women were not at lower risk for SFV infection in our population, providing opportunities for spread of SFV both horizontally and vertically. However, limited testing of close contacts of WB-positive persons did not identify human-to-human transmission. Combined with the broad behavioral risk and distribution of NHPs across DRC, our results suggest that SFV infection may have a wider geographic distribution within DRC. These results also reinforce the potential for an increased SFV prevalence throughout the forested regions of Africa where humans and simians co-exist. Our finding of endemic foci of SFV infection in DRC will facilitate longitudinal studies to determine the potential for person-to-person transmissibility and pathogenicity of these zoonotic retroviral infections. PMID:23217108
2015-01-01
A hallmark of penicillin-binding protein 2 (PBP2) from penicillin-resistant strains of Neisseria gonorrhoeae is insertion of an aspartate after position 345. The insertion resides on a loop near the active site and is immediately adjacent to an existing aspartate (Asp346) that forms a functionally important hydrogen bond with Ser363 of the SxN conserved motif. Insertion of other amino acids, including Glu and Asn, can also lower the rate of acylation by penicillin, but these insertions abolish transpeptidase function. Although the kinetic consequences of the Asp insertion are well-established, how it impacts the structure of PBP2 is unknown. Here, we report the 2.2 Å resolution crystal structure of a truncated construct of PBP2 containing all five mutations present in PBP2 from the penicillin-resistant strain 6140, including the Asp insertion. Commensurate with the strict specificity for the Asp insertion over similar amino acids, the insertion does not cause disordering of the structure, but rather induces localized flexibility in the β2c−β2d loop. The crystal structure resolves the ambiguity of whether the insertion is Asp345a or Asp346a (due to the adjacent Asp) because the hydrogen bond between Asp346 and Ser362 is preserved and the insertion is therefore Asp346a. The side chain of Asp346a projects directly toward the β-lactam-binding site near Asn364 of the SxN motif. The Asp insertion may lower the rate of acylation by sterically impeding binding of the antibiotic or by hindering breakage of the β-lactam ring during acylation because of the negative charge of its side chain. PMID:25403720
Fedarovich, Alena; Cook, Edward; Tomberg, Joshua; Nicholas, Robert A; Davies, Christopher
2014-12-09
A hallmark of penicillin-binding protein 2 (PBP2) from penicillin-resistant strains of Neisseria gonorrhoeae is insertion of an aspartate after position 345. The insertion resides on a loop near the active site and is immediately adjacent to an existing aspartate (Asp346) that forms a functionally important hydrogen bond with Ser363 of the SxN conserved motif. Insertion of other amino acids, including Glu and Asn, can also lower the rate of acylation by penicillin, but these insertions abolish transpeptidase function. Although the kinetic consequences of the Asp insertion are well-established, how it impacts the structure of PBP2 is unknown. Here, we report the 2.2 Å resolution crystal structure of a truncated construct of PBP2 containing all five mutations present in PBP2 from the penicillin-resistant strain 6140, including the Asp insertion. Commensurate with the strict specificity for the Asp insertion over similar amino acids, the insertion does not cause disordering of the structure, but rather induces localized flexibility in the β2c-β2d loop. The crystal structure resolves the ambiguity of whether the insertion is Asp345a or Asp346a (due to the adjacent Asp) because the hydrogen bond between Asp346 and Ser362 is preserved and the insertion is therefore Asp346a. The side chain of Asp346a projects directly toward the β-lactam-binding site near Asn364 of the SxN motif. The Asp insertion may lower the rate of acylation by sterically impeding binding of the antibiotic or by hindering breakage of the β-lactam ring during acylation because of the negative charge of its side chain.
Li, Yan; Deng, Jianxin; Zhou, Jun; Li, Xueen
2016-11-01
Corresponding to pre-puncture and post-puncture insertion, elastic and viscoelastic mechanical properties of brain tissues on the implanting trajectory of sub-thalamic nucleus stimulation are investigated, respectively. Elastic mechanical properties in pre-puncture are investigated through pre-puncture needle insertion experiments using whole porcine brains. A linear polynomial and a second order polynomial are fitted to the average insertion force in pre-puncture. The Young's modulus in pre-puncture is calculated from the slope of the two fittings. Viscoelastic mechanical properties of brain tissues in post-puncture insertion are investigated through indentation stress relaxation tests for six interested regions along a planned trajectory. A linear viscoelastic model with a Prony series approximation is fitted to the average load trace of each region using Boltzmann hereditary integral. Shear relaxation moduli of each region are calculated using the parameters of the Prony series approximation. The results show that, in pre-puncture insertion, needle force almost increases linearly with needle displacement. Both fitting lines can perfectly fit the average insertion force. The Young's moduli calculated from the slope of the two fittings are worthy of trust to model linearly or nonlinearly instantaneous elastic responses of brain tissues, respectively. In post-puncture insertion, both region and time significantly affect the viscoelastic behaviors. Six tested regions can be classified into three categories in stiffness. Shear relaxation moduli decay dramatically in short time scales but equilibrium is never truly achieved. The regional and temporal viscoelastic mechanical properties in post-puncture insertion are valuable for guiding probe insertion into each region on the implanting trajectory.
The impact of a modified cutting flute implant design on osseointegration.
Jimbo, R; Tovar, N; Marin, C; Teixeira, H S; Anchieta, R B; Silveira, L M; Janal, M N; Shibli, J A; Coelho, P G
2014-07-01
Information concerning the effects of the implant cutting flute design on initial stability and its influence on osseointegration in vivo is limited. This study evaluated the early effects of implants with a specific cutting flute design placed in the sheep mandible. Forty-eight dental implants with two different macro-geometries (24 with a specific cutting flute design - Blossom group; 24 with a self-tapping design - DT group) were inserted into the mandibular bodies of six sheep; the maximum insertion torque was recorded. Samples were retrieved and processed for histomorphometric analysis after 3 and 6 weeks. The mean insertion torque was lower for Blossom implants (P<0.001). No differences in histomorphometric results were observed between the groups. At 3 weeks, P=0.58 for bone-to-implant contact (BIC) and P=0.52 for bone area fraction occupied (BAFO); at 6 weeks, P=0.55 for BIC and P=0.45 for BAFO. While no histomorphometric differences were observed, ground sections showed different healing patterns between the implants, with better peri-implant bone organization around those with the specific cutting flute design (Blossom group). Implants with the modified cutting flute design had a significantly reduced insertion torque compared to the DT implants with a traditional cutting thread, and resulted in a different healing pattern. Copyright © 2014 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.
Grant, Angeline; Njiru, James; Okoth, Edgar; Awino, Imelda; Briend, André; Murage, Samuel; Abdirahman, Saida; Myatt, Mark
2018-01-01
A novel approach for improving community case-detection of acute malnutrition involves mothers/caregivers screening their children for acute malnutrition using a mid-upper arm circumference (MUAC) insertion tape. The objective of this study was to test three simple MUAC classification devices to determine whether they improved the sensitivity of mothers/caregivers at detecting acute malnutrition. Prospective, non-randomised, partially-blinded, clinical diagnostic trial describing and comparing the performance of three "Click-MUAC" devices and a MUAC insertion tape. The study took place in twenty-one health facilities providing integrated management of acute malnutrition (IMAM) services in Isiolo County, Kenya. Mothers/caregivers classified their child ( n =1040), aged 6-59 months, using the "Click-MUAC" devices and a MUAC insertion tape. These classifications were compared to a "gold standard" classification (the mean of three measurements taken by a research assistant using the MUAC insertion tape). The sensitivity of mother/caregiver classifications was high for all devices (>93% for severe acute malnutrition (SAM), defined by MUAC < 115 mm, and > 90% for global acute malnutrition (GAM), defined by MUAC < 125 mm). Mother/caregiver sensitivity for SAM and GAM classification was higher using the MUAC insertion tape (100% sensitivity for SAM and 99% sensitivity for GAM) than using "Click-MUAC" devices. Younden's J for SAM classification, and sensitivity for GAM classification, were significantly higher for the MUAC insertion tape (99% and 99% respectively). Specificity was high for all devices (>96%) with no significant difference between the "Click-MUAC" devices and the MUAC insertion tape. The results of this study indicate that, although the "Click-MUAC" devices performed well, the MUAC insertion tape performed best. The results for sensitivity are higher than found in previous studies. The high sensitivity for both SAM and GAM classification by mothers/caregivers with the MUAC insertion tape could be due to the use of an improved MUAC tape design which has a number of new design features. The one-on-one demonstration provided to mothers/caregivers on the use of the devices may also have helped improve sensitivity. The results of this study provide evidence that mothers/caregivers can perform sensitive and specific classifications of their child's nutritional status using MUAC. Clinical trials registration number: NCT02833740.
Filtration Isolation of Nucleic Acids: A Simple and Rapid DNA Extraction Method.
McFall, Sally M; Neto, Mário F; Reed, Jennifer L; Wagner, Robin L
2016-08-06
FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 µl whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.
Srivatsan, Anjana; Bowen, Nikki; Kolodner, Richard D.
2014-01-01
DNA mismatch repair is initiated by either the Msh2-Msh6 or the Msh2-Msh3 mispair recognition heterodimer. Here we optimized the expression and purification of Saccharomyces cerevisiae Msh2-Msh3 and performed a comparative study of Msh2-Msh3 and Msh2-Msh6 for mispair binding, sliding clamp formation, and Mlh1-Pms1 recruitment. Msh2-Msh3 formed sliding clamps and recruited Mlh1-Pms1 on +1, +2, +3, and +4 insertion/deletions and CC, AA, and possibly GG mispairs, whereas Msh2-Msh6 formed mispair-dependent sliding clamps and recruited Mlh1-Pms1 on 7 of the 8 possible base:base mispairs, the +1 insertion/deletion mispair, and to a low level on the +2 but not the +3 or +4 insertion/deletion mispairs and not on the CC mispair. The mispair specificity of sliding clamp formation and Mlh1-Pms1 recruitment but not mispair binding alone correlated best with genetic data on the mispair specificity of Msh2-Msh3- and Msh2-Msh6-dependent mismatch repair in vivo. Analysis of an Msh2-Msh6/Msh3 chimeric protein and mutant Msh2-Msh3 complexes showed that the nucleotide binding domain and communicating regions but not the mispair binding domain of Msh2-Msh3 are responsible for the extremely rapid dissociation of Msh2-Msh3 sliding clamps from DNA relative to that seen for Msh2-Msh6, and that amino acid residues predicted to stabilize Msh2-Msh3 interactions with bent, strand-separated mispair-containing DNA are more critical for the recognition of small +1 insertion/deletions than larger +4 insertion/deletions. PMID:24550389
Srivatsan, Anjana; Bowen, Nikki; Kolodner, Richard D
2014-03-28
DNA mismatch repair is initiated by either the Msh2-Msh6 or the Msh2-Msh3 mispair recognition heterodimer. Here we optimized the expression and purification of Saccharomyces cerevisiae Msh2-Msh3 and performed a comparative study of Msh2-Msh3 and Msh2-Msh6 for mispair binding, sliding clamp formation, and Mlh1-Pms1 recruitment. Msh2-Msh3 formed sliding clamps and recruited Mlh1-Pms1 on +1, +2, +3, and +4 insertion/deletions and CC, AA, and possibly GG mispairs, whereas Msh2-Msh6 formed mispair-dependent sliding clamps and recruited Mlh1-Pms1 on 7 of the 8 possible base:base mispairs, the +1 insertion/deletion mispair, and to a low level on the +2 but not the +3 or +4 insertion/deletion mispairs and not on the CC mispair. The mispair specificity of sliding clamp formation and Mlh1-Pms1 recruitment but not mispair binding alone correlated best with genetic data on the mispair specificity of Msh2-Msh3- and Msh2-Msh6-dependent mismatch repair in vivo. Analysis of an Msh2-Msh6/Msh3 chimeric protein and mutant Msh2-Msh3 complexes showed that the nucleotide binding domain and communicating regions but not the mispair binding domain of Msh2-Msh3 are responsible for the extremely rapid dissociation of Msh2-Msh3 sliding clamps from DNA relative to that seen for Msh2-Msh6, and that amino acid residues predicted to stabilize Msh2-Msh3 interactions with bent, strand-separated mispair-containing DNA are more critical for the recognition of small +1 insertion/deletions than larger +4 insertion/deletions.
Collagen V expression is crucial in regional development of the supraspinatus tendon.
Connizzo, Brianne K; Adams, Sheila M; Adams, Thomas H; Birk, David E; Soslowsky, Louis J
2016-12-01
Manipulations in cell culture and mouse models have demonstrated that reduction of collagen V results in altered fibril structure and matrix assembly. A tissue-dependent role for collagen V in determining mechanical function was recently established, but its role in determining regional properties has not been addressed. The objective of this study was to define the role(s) of collagen V expression in establishing the site-specific properties of the supraspinatus tendon. The insertion and midsubstance of tendons from wild type, heterozygous and tendon/ligament-specific null mice were assessed for crimp morphology, fibril morphology, cell morphology, as well as total collagen and pyridinoline cross-link (PYD) content. Fibril morphology was altered at the midsubstance of both groups with larger, but fewer, fibrils and no change in cell morphology or collagen compared to the wild type controls. In contrast, a significant disruption of fibril assembly was observed at the insertion site of the null group with the presence of structurally aberrant fibrils. Alterations were also present in cell density and PYD content. Altogether, these results demonstrate that collagen V plays a crucial role in determining region-specific differences in mouse supraspinatus tendon structure. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 34:2154-2161, 2016. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
Canine MPV17 truncation without clinical manifestations
Hänninen, Reetta L.; Ahonen, Saija; Màrquez, Merce; Myöhänen, Maarit J.; Hytönen, Marjo K.; Lohi, Hannes
2015-01-01
ABSTRACT Mitochondrial DNA depletion syndromes (MDS) are often serious autosomal recessively inherited disorders characterized by tissue-specific mtDNA copy number reduction. Many genes, including MPV17, are associated with the hepatocerebral form of MDS. MPV17 encodes for a mitochondrial inner membrane protein with a poorly characterized function. Several MPV17 mutations have been reported in association with a heterogeneous group of early-onset manifestations, including liver disease and neurological problems. Mpv17-deficient mice present renal and hearing defects. We describe here a MPV17 truncation mutation in dogs. We found a 1-bp insertion in exon 4 of the MPV17 gene, resulting in a frameshift and early truncation of the encoded protein. The mutation halves MPV17 expression in the lymphocytes of the homozygous dogs and the truncated protein is not translated in transfected cells. The insertion mutation is recurrent and exists in many unrelated breeds, although is highly enriched in the Boxer breed. Unexpectedly, despite the truncation of MPV17, we could not find any common phenotypes in the genetically affected dogs. The lack of observable phenotype could be due to a late onset, mild symptoms or potential tissue-specific compensatory mechanisms. This study suggests species-specific differences in the manifestation of the MPV17 defects and establishes a novel large animal model to further study MPV17 function and role in mitochondrial biology. PMID:26353863
NASA Astrophysics Data System (ADS)
Mironov, S. G.; Poplavskaya, T. V.; Kirilovskiy, S. V.
2017-10-01
The paper presents the results of an experimental investigation of supersonic flow around a solid cylinder with a gas-permeable porous insert on its front end and of supersonic flow around a hollow cylinder with internal porous inserts in the presence of heating of the porous material. The experiments were performed in a supersonic wind tunnel with Mach number 4.85 and 7 with porous inserts of cellular-porous nickel. The results of measurements on the filtration stand of the air filtration rate through the cellular-porous nickel when it is heated are also shown. For a number of experiments, numerical modeling based on the skeletal model of a cellular-porous material was carried out.
Keller, Marla J; Buckley, Niall; Katzen, Lauren L; Walsh, Jennifer; Friedland, Barbara; Littlefield, Sarah; Lin, Juan; Xue, Xiaonan; Cornelison, Terri; Herold, Betsy C; Einstein, Mark H
2013-12-01
Applicator dye staining and ultraviolet (UV) light have been used in trials to measure adherence, but not in the setting of before and after sex gel dosing (BAT-24). This study was designed to determine if semen or presex gel dosing impacts the sensitivity and specificity of a dye stain assay (DSA) for measuring vaginal insertion of placebo-filled applicators with BAT-24 dosing. Healthy monogamous couples received Microlax-type applicators (Tectubes, Åstorp, Sweden) filled with hydroxyethylcelluose placebo gel. Women were instructed to vaginally insert 1 dose of gel before and a second dose after sex and to return applicators within 48 hours after sex. Applicators were stained to detect semen, followed by UV then DSA, and scored by 2 readers. Positive and negative controls were randomly included in applicator batches. Fifteen couples completed the study. Each woman returned at least 6 applicators over a 30-day period. The sensitivity for insertion of postsex applicators was higher for UV (97%) compared with DSA (90%), and the specificity was similar (≥96%). For presex applicators, the sensitivity and specificity were higher for DSA (100%) compared with UV testing (87% sensitivity, 96% specificity). Among returned postsex applicators, 95% tested positive by UV compared with 87% by DSA. Agreement between readers was significantly better on the presex applicators for DSA than for UV, and for postsex readings, agreement was less than half that for UV, although the results were not statistically significant. Applicator tests are feasible for measuring adherence in trials with gel dosing before and after sex.
Ocean Engineering Studies Compiled 1991. Volume 9. External Pressure Housing - Conrete
1991-01-01
by inserts of different rigidities would thus be obtained. Table 1. Description of Concrete Sphere Models and Test...relationship between the insert’s rigidity and the strain increase in its vicinity. Planned investigation by NCEL employing photoelastic analysis of models of ... structural , in which only the load -carrying ability of the structure was checked. In the operational tests, the small-scale model habitat
Forgie, Marie M; Greer, Danielle M; Kram, Jessica J F; Vander Wyst, Kiley B; Salvo, Nicole P; Siddiqui, Danish S
2016-03-01
Foley catheters are used for cervical ripening during induction of labor. Previous studies suggest that use of a stylette (a thin, rigid wire) to guide catheter insertion decreases insertion failure. However, stylette effects on insertion outcomes have been sparsely studied. The purpose of this study was to compare catheter insertion times, patient-assessed pain levels, and insertion failure rates between women who received a digitally placed Foley catheter for cervical ripening with the aid of a stylette and women who received the catheter without a stylette. We conducted a randomized clinical trial of women aged ≥ 18 years who presented for induction of labor. Inclusion criteria were singletons with intact membranes and cephalic presentation. Women received a computer-generated random assignment of a Foley catheter insertion with a stylette (treatment group, n = 62) or without a stylette (control group, n = 61). For all women, a standard insertion technique protocol was used. Three primary outcomes were of interest, including the following: (1) insertion time (total minutes to successful catheter placement), (2) patient-assessed pain level (0-10), and (3) failure rate of the randomly assigned insertion method. Treatment control differences were first examined using the Pearson's test of independence and the Student t test. Per outcome, we also constructed 4 regression models, each including the random effect of physician and fixed effects of stylette use with patient nulliparity, a history of vaginal delivery, cervical dilation at presentation, or postgraduate year of the performing resident physician. Women who received the Foley catheter with the stylette vs without the stylette did not differ by age, race/ethnicity, body mass index, or any of several other characteristics. Regression models revealed that insertion time, patient pain, and insertion failure were unrelated to stylette use, nulliparity, and history of vaginal delivery. However, overall insertion time and failure were significantly influenced by cervical dilation, with insertion time decreasing by 21% (95% confidence interval [CI], 5-34%) and odds of failure decreasing by 71% (odds ratio, 0.29; 95% CI, 0.10-0.86) per 1 cm dilation. Resident postgraduate year also significantly influenced insertion time, with greater time required of physicians with less experience. Mean insertion time was 51% (95% CI, 23-69%) shorter for fourth-year than second-year residents. Statistically nonsignificant but prominent patterns in outcomes were also observed, suggesting stylette use may lengthen the overall insertion procedure but minimize variability in pain levels and decrease insertion failure. The randomized trial suggests that, even after accounting for nulliparity, history of vaginal delivery, cervical dilation, and physician experience, Foley catheter insertions with and without a stylette are equivalent in insertion times, patient pain levels, and failure of catheter placement. Copyright © 2016 Elsevier Inc. All rights reserved.
3D tracking of laparoscopic instruments using statistical and geometric modeling.
Wolf, Rémi; Duchateau, Josselin; Cinquin, Philippe; Voros, Sandrine
2011-01-01
During a laparoscopic surgery, the endoscope can be manipulated by an assistant or a robot. Several teams have worked on the tracking of surgical instruments, based on methods ranging from the development of specific devices to image processing methods. We propose to exploit the instruments' insertion points, which are fixed on the patients abdominal cavity, as a geometric constraint for the localization of the instruments. A simple geometric model of a laparoscopic instrument is described, as well as a parametrization that exploits a spherical geometric grid, which offers attracting homogeneity and isotropy properties. The general architecture of our proposed approach is based on the probabilistic Condensation algorithm.
48 CFR 536.570-8 - Specifications and drawings.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Specifications and drawings. 536.570-8 Section 536.570-8 Federal Acquisition Regulations System GENERAL SERVICES... 536.570-8 Specifications and drawings. Insert the clause at 552.236-77, Specifications and Drawings...
48 CFR 552.236-77 - Specifications and Drawings
Code of Federal Regulations, 2010 CFR
2010-10-01
... Drawings 552.236-77 Section 552.236-77 Federal Acquisition Regulations System GENERAL SERVICES....236-77 Specifications and Drawings As prescribed in 536.570-8, insert the following clause: Specifications and Drawings (SEP 1999) The requirements of the clause entitled “Specifications and Drawings for...
Protein secretion and membrane insertion systems in gram-negative bacteria.
Saier, Milton H
2006-01-01
In contrast to other organisms, gram-negative bacteria have evolved numerous systems for protein export. Eight types are known that mediate export across or insertion into the cytoplasmic membrane, while eight specifically mediate export across or insertion into the outer membrane. Three of the former secretory pathway (SP) systems, type I SP (ISP, ABC), IIISP (Fla/Path) and IVSP (Conj/Vir), can export proteins across both membranes in a single energy-coupled step. A fourth generalized mechanism for exporting proteins across the two-membrane envelope in two distinct steps (which we here refer to as type II secretory pathways [IISP]) utilizes either the general secretory pathway (GSP or Sec) or the twin-arginine targeting translocase for translocation across the inner membrane, and either the main terminal branch or one of several protein-specific export systems for translocation across the outer membrane. We here survey the various well-characterized protein translocation systems found in living organisms and then focus on the systems present in gram-negative bacteria. Comparisons between these systems suggest specific biogenic, mechanistic and evolutionary similarities as well as major differences.
Jia, Xianbo; Lin, Xinjian; Chen, Jichen
2017-11-02
Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.
A Novel Assay for the Identification of NOTCH1 PEST Domain Mutations in Chronic Lymphocytic Leukemia
Petroni, Roberta Cardoso; Muto, Nair Hideko; Sitnik, Roberta; de Carvalho, Flavia Pereira; Bacal, Nydia Strachman; Velloso, Elvira Deolinda Rodrigues Pereira; Oliveira, Gislaine Borba; Pinho, João Renato Rebello; Torres, Davi Coe; Mansur, Marcela Braga; Hassan, Rocio; Lorand-Metze, Irene Gyongyvér Heidemarie; Chiattone, Carlos Sérgio; Hamerschlak, Nelson; Mangueira, Cristovão Luis Pitangueira
2016-01-01
Aims. To develop a fast and robust DNA-based assay to detect insertions and deletions mutations in exon 34 that encodes the PEST domain of NOTCH1 in order to evaluate patients with chronic lymphocytic leukemia (CLL). Methods. We designed a multiplexed allele-specific polymerase chain reaction (PCR) combined with a fragment analysis assay to detect specifically the mutation c.7544_7545delCT and possibly other insertions and deletions in exon 34 of NOTCH1. Results. We evaluated our assay in peripheral blood samples from two cohorts of patients with CLL. The frequency of NOTCH1 mutations was 8.4% in the first cohort of 71 unselected CLL patients. We then evaluated a second cohort of 26 CLL patients with known cytogenetic abnormalities that were enriched for patients with trisomy 12. NOTCH1 mutations were detected in 43.7% of the patients with trisomy 12. Conclusions. We have developed a fast and robust assay combining allele-specific PCR and fragment analysis able to detect NOTCH1 PEST domain insertions and deletions. PMID:28074183
Ecomorphology of parasite attachment: experiments with feather lice.
Bush, Sarah E; Sohn, Edward; Clayton, Dale H
2006-02-01
The host specificity of some parasites can be reinforced by morphological specialization for attachment to mobile hosts. For example, ectoparasites with adaptations for attaching to hosts of a particular size might not be able to remain attached to larger or smaller hosts. This hypothesis is suggested by the positive correlation documented between the body sizes of many parasites and their hosts. We adopted an ecomorphological approach to test the attachment hypothesis. We tested the ability of host-specific feather lice (Phthiraptera: Ischnocera) to attach to 6 novel species of pigeons and doves that vary in size by nearly 2 orders of magnitude. Surprisingly, Rock Pigeon lice (Columbicola columbae) remained attached equally well to all 6 novel host species. We tested the relative importance of 3 factors that could facilitate louse attachment: whole-body insertion, tarsal claw use, and mandible use. Insertion, per se, was not necessary for attachment. However, insertion on coarse feathers of large hosts allowed lice to access feather barbules with their mandibles. Mandible use was a key component of attachment regardless of feather size. Attachment constraints do not appear to reinforce host specificity in this system.
Bhattarai, Sushila; Alany, Raid G; Bunt, Craig R; Abdelkader, Hamdy; Rathbone, Michael J
2015-01-01
This manuscript reports (for the first time) on antibiotic-free polymeric inserts for the prevention and/or treatment of bovine mastitis. Polyethylene oxide (PEO)-based inserts were prepared using different concentrations of various hydrophilic polymers and water-soluble and water-insoluble drug-release-modifying excipients. A simple and scalable melt-extrusion method was employed to prepare the inserts. The prepared inserts were characterised for their dimension, rheological and mechanical properties. The in vitro release of a model bacteriostatic drug (salicylic acid) from the prepared inserts was studied to demonstrate the effectiveness and reproducibility of the melt-extrusion manufacturing method. Further, the in vitro stability of the inserts was evaluated using gel permeation chromatography (GPC) to monitor any change in molecular weight under real-time and accelerated storage conditions. The investigated inserts were stable at accelerated storage conditions over a period of 6 months. PEO inserts have the potential to serve a dual purpose, act as a physical barrier against pathogens invading the teat canal of cows and possibly control the release of a drug.
Ab initio modeling of transport and thermodynamic stability for hafnia memristive devices
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhong, Xiaoliang; Rungger, Ivan; Zapol, Peter
HfO 2-based memristive switching devices are currently under intensive investigation due to their high performance and mature fabrication techniques. However, several critical issues have to be addressed to bring them from lab to market. We have recently looked into two important issues with the use of density functional theory methods. One is the wide distribution of device resistance in off-states. We have modeled the switching process of a Pt-HfO 2-Pt structure for which quantized conductance was observed. Oxygen atoms moving inside a conductive oxygen vacancy filament divide the filament into several quantum wells. Device conductance changes exponentially when one oxygenmore » atom moves away from interface into filament. We propose that the high sensitivity of device conductance to the position of oxygen atoms results in the large variation of device off-state resistance. Another issue that we have recently addressed is the poor switching performance of devices based on a TiN-HfO 2-TiN structure. While recent experiments have shown that by inserting an "oxygen scavenger" metal between positive electrode and oxide significantly improves device performance, the fundamental understanding of the improvement is lacking.We provide detailed understanding how scavenger layers improve device performance. First, we show that Ta insertion facilitates formation of on-states by reducing the formation energy. Second, the inserted Ta layer reduces the Schottky barrier height in the off-states by changing interface electric dipole at the oxide electrode interface. Nevertheless, the device maintains a high on/off resistance ratio. Finally, with Ta insertion the on-state conductance becomes much less sensitive to the specific location from which the oxygen was removed from the oxide. In conclusion, our studies provide fundamental understanding needed for enabling realization of a non-volatile memory technology with reduced energy consumption.« less
Ab initio modeling of transport and thermodynamic stability for hafnia memristive devices
Zhong, Xiaoliang; Rungger, Ivan; Zapol, Peter; ...
2017-09-05
HfO 2-based memristive switching devices are currently under intensive investigation due to their high performance and mature fabrication techniques. However, several critical issues have to be addressed to bring them from lab to market. We have recently looked into two important issues with the use of density functional theory methods. One is the wide distribution of device resistance in off-states. We have modeled the switching process of a Pt-HfO 2-Pt structure for which quantized conductance was observed. Oxygen atoms moving inside a conductive oxygen vacancy filament divide the filament into several quantum wells. Device conductance changes exponentially when one oxygenmore » atom moves away from interface into filament. We propose that the high sensitivity of device conductance to the position of oxygen atoms results in the large variation of device off-state resistance. Another issue that we have recently addressed is the poor switching performance of devices based on a TiN-HfO 2-TiN structure. While recent experiments have shown that by inserting an "oxygen scavenger" metal between positive electrode and oxide significantly improves device performance, the fundamental understanding of the improvement is lacking.We provide detailed understanding how scavenger layers improve device performance. First, we show that Ta insertion facilitates formation of on-states by reducing the formation energy. Second, the inserted Ta layer reduces the Schottky barrier height in the off-states by changing interface electric dipole at the oxide electrode interface. Nevertheless, the device maintains a high on/off resistance ratio. Finally, with Ta insertion the on-state conductance becomes much less sensitive to the specific location from which the oxygen was removed from the oxide. In conclusion, our studies provide fundamental understanding needed for enabling realization of a non-volatile memory technology with reduced energy consumption.« less
Poirier, Christophe; Qin, Yangjun; Adams, Carolyn P; Anaya, Yanett; Singer, Jonathan B; Hill, Annie E; Lander, Eric S; Nadeau, Joseph H; Bishop, Colin E
2004-11-01
The transgenic insertional mouse mutation Odd Sex (Ods) represents a model for the long-range regulation of Sox9. The mutation causes complete female-to-male sex reversal by inducing a male-specific expression pattern of Sox9 in XX Ods/+ embryonic gonads. We previously described an A/J strain-specific suppressor of Ods termed Odsm1(A). Here we show that phenotypic sex depends on a complex interaction between the suppressor and the transgene. Suppression can be achieved only if the transgene is transmitted paternally. In addition, the suppressor itself exhibits a maternal effect, suggesting that it may act on chromatin in the early embryo.
Poirier, Christophe; Qin, Yangjun; Adams, Carolyn P.; Anaya, Yanett; Singer, Jonathan B.; Hill, Annie E.; Lander, Eric S.; Nadeau, Joseph H.; Bishop, Colin E.
2004-01-01
The transgenic insertional mouse mutation Odd Sex (Ods) represents a model for the long-range regulation of Sox9. The mutation causes complete female-to-male sex reversal by inducing a male-specific expression pattern of Sox9 in XX Ods/+ embryonic gonads. We previously described an A/J strain-specific suppressor of Ods termed Odsm1A. Here we show that phenotypic sex depends on a complex interaction between the suppressor and the transgene. Suppression can be achieved only if the transgene is transmitted paternally. In addition, the suppressor itself exhibits a maternal effect, suggesting that it may act on chromatin in the early embryo. PMID:15579706
Orthodontic mechanics using mini-implant measured by FBG
NASA Astrophysics Data System (ADS)
Trannin, Pamela G.; Milczewski, Maura S.; de Oliveira, Walmir; Guariza Filho, Odilon; Lopes, Stephani C. P. S.; Kalinowski, Hypolito J.
2015-07-01
The magnitude of the force generated during orthodontic mechanics anchored in mini-implant in a maxilla model was analyzed. Data was collected during the insertion of the mini-implant and at the moment of applying forces to the structure of the maxilla and dentition. To obtain quantitative results, the Fibre Bragg Gratings (FBG) were inserted in an elastomeric material reproducing a maxilla model. It was observed levels of forces of approximately 3,78N next to the root of first premolar by the insertion of the mini-implant and different levels of the force to different orthodontic mechanics applied on the dental system.
In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome
2013-01-01
Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783
Cast iron cutting with nano TiN and multilayer TiN-CrN coated inserts
NASA Astrophysics Data System (ADS)
Perucca, M.; Durante, S.; Semmler, U.; Rüger, C.; Fuentes, G. G.; Almandoz, E.
2012-09-01
During the past decade great success has been achieved in the development of duplex and multilayer multi-functional surface systems. Among these surface systems outstanding properties have nanoscale multilayer coatings. Within the framework of the M3-2S project funded in the 7th European Framework Programme, several nanoscale multilayer coatings have been developed and investigated for experimental and industrial validation. This paper shows the performance of TiN and TiN/CrN nanoscale multilayer coatings on WC cutting inserts when machining GJL250 cast iron. The thin films have been deposited by cathodic arc evaporation in an industrial PVD system. The multilayer deposition characteristic and its properties are shown. The inserts have been investigated in systematic cutting experiments of cast iron bars on a turning machine specifically equipped for force measurements, accompanied by wear determination. Furthermore, equivalent experiments have been carried out on an industrial turning unit. Industrial validation criteria have been applied to assess the comparative performance of the coatings. The choice of the material and the machined parts is driven by an interest in automotive applications. The industrial tests show the need to further optimise the multi-scale modelling approach in order to reduce the lead time of the coating development as well as to improve simulation reliability.
Neutron Reflectometry Study of the Conformation of HIV Nef Bound to Lipid Membranes
Kent, Michael S.; Murton, Jaclyn K.; Sasaki, Darryl Y.; Satija, Sushil; Akgun, Bulent; Nanda, Hirsh; Curtis, Joseph E.; Majewski, Jaroslaw; Morgan, Christopher R.; Engen, John R.
2010-01-01
Nef is an HIV-1 accessory protein that directly contributes to AIDS progression. Nef is myristoylated on the N-terminus, associates with membranes, and may undergo a transition from a solution conformation to a membrane-associated conformation. It has been hypothesized that conformational rearrangement enables membrane-associated Nef to interact with cellular proteins. Despite its medical relevance, to our knowledge there is no direct information about the conformation of membrane-bound Nef. In this work, we used neutron reflection to reveal what we believe are the first details of the conformation of membrane-bound Nef. The conformation of Nef was probed upon binding to Langmuir monolayers through the interaction of an N-terminal His tag with a synthetic metal-chelating lipid, which models one of the possible limiting cases for myr-Nef. The data indicate that residues are inserted into the lipid headgroups during interaction, and that the core domain lies directly against the lipid headgroups, with a thickness of ∼40 Å. Binding of Nef through the N-terminal His tag apparently facilitates insertion of residues, as no insertion occurred upon binding of Nef through weak electrostatic interactions in the absence of the specific interaction through the His tag. PMID:20858440
NASA Astrophysics Data System (ADS)
Tafur, Miguel; Alayo, W.; Munayco, P.; Baggio-Saitovitch, E.; Nascimento, V. P.; Alvarenga, A. D.; Brewer, W. D.
2007-05-01
We have studied the influence of an inserted nano-oxide layer (NOL) on the interfacial magnetism in spin-valve systems showing the giant magnetoresistance effect. Specifically, we performed a magnetic depth profile of these structures with and without a NOL, using the x-ray magnetic circular dichroism technique. We found that insertion of a NOL into the spin-valve structure is correlated with a stronger reduction of the magnetic moments at the ferromagnetic (FM)/NOL/FM interface in comparison with a spin valve without NOL.
Dowen, Jill M.; Putnam, Christopher D.; Kolodner, Richard D.
2010-01-01
The Msh2-Msh3 heterodimer recognizes various DNA mispairs, including loops of DNA ranging from 1 to 14 nucleotides and some base-base mispairs. Homology modeling of the mispair-binding domain (MBD) of Msh3 using the related Msh6 MBD revealed that mismatch recognition must be different, even though the MBD folds must be similar. Model-based point mutation alleles of Saccharomyces cerevisiae msh3 designed to disrupt mispair recognition fell into two classes. One class caused defects in repair of both small and large insertion/deletion mispairs, whereas the second class caused defects only in the repair of small insertion/deletion mispairs; mutations of the first class also caused defects in the removal of nonhomologous tails present at the ends of double-strand breaks (DSBs) during DSB repair, whereas mutations of the second class did not cause defects in the removal of nonhomologous tails during DSB repair. Thus, recognition of small insertion/deletion mispairs by Msh3 appears to require a greater degree of interactions with the DNA conformations induced by small insertion/deletion mispairs than with those induced by large insertion/deletions that are intrinsically bent and strand separated. Mapping of the two classes of mutations onto the Msh3 MBD model appears to distinguish mispair recognition regions from DNA stabilization regions. PMID:20421420
Dowen, Jill M; Putnam, Christopher D; Kolodner, Richard D
2010-07-01
The Msh2-Msh3 heterodimer recognizes various DNA mispairs, including loops of DNA ranging from 1 to 14 nucleotides and some base-base mispairs. Homology modeling of the mispair-binding domain (MBD) of Msh3 using the related Msh6 MBD revealed that mismatch recognition must be different, even though the MBD folds must be similar. Model-based point mutation alleles of Saccharomyces cerevisiae msh3 designed to disrupt mispair recognition fell into two classes. One class caused defects in repair of both small and large insertion/deletion mispairs, whereas the second class caused defects only in the repair of small insertion/deletion mispairs; mutations of the first class also caused defects in the removal of nonhomologous tails present at the ends of double-strand breaks (DSBs) during DSB repair, whereas mutations of the second class did not cause defects in the removal of nonhomologous tails during DSB repair. Thus, recognition of small insertion/deletion mispairs by Msh3 appears to require a greater degree of interactions with the DNA conformations induced by small insertion/deletion mispairs than with those induced by large insertion/deletions that are intrinsically bent and strand separated. Mapping of the two classes of mutations onto the Msh3 MBD model appears to distinguish mispair recognition regions from DNA stabilization regions.
Peer-assisted learning model enhances clinical clerk's procedural skills.
Huang, Chia-Chang; Hsu, Hui-Chi; Yang, Ling-Yu; Chen, Chen-Huan; Yang, Ying-Ying; Chang, Ching-Chih; Chuang, Chiao-Lin; Lee, Wei-Shin; Lee, Fa-Yauh; Hwang, Shinn-Jang
2018-05-17
Failure to transfer procedural skills learned in a laboratory to the bedside is commonly due to a lack of peer support/stimulation. A digital platform (Facebook) allows new clinical clerks to share experiences and tips that help augment their procedural skills in a peer-assisted learning/teaching method. This study aims to investigate the effectiveness of the innovation of using the digital platform to support the transfer of laboratory-trained procedural skills in the clinical units. Volunteer clinical clerks (n = 44) were enrolled into the peer-assisted learning (PAL) group, which was characterized by the peer-assisted learning of procedural skills during their final 3-month clinical clerkship block. Other clerks (n = 51) did not join the procedural skills-specific Facebook group and served as the self-directed learning regular group. The participants in both the PAL and regular groups completed pre- and post-intervention self-assessments for general self-assessed efficiency ratings (GSER) and skills specific self-assessed efficiency ratings (SSSER) for performing vein puncture, intravenous (IV) catheter and nasogastric (NG) tube insertion. Finally, all clerks received the post-intervention 3-station Objective Structured Clinical Skills Examination (OSCE) to test their proficiency for the abovementioned three procedural skills. Higher cumulative numbers of vein punctures, IV catheter insertions and NG tube insertions at the bedside were carried out by the PAL group than the regular group. A greater improvement in GSERs and SSSERs for medical procedures was found in the PAL group than in the regular group. The PAL group obtained higher procedural skills scores in the post-intervention OSCEs than the regular group. Our study suggested that the implementation of a procedural skill-specific digital platform effectively helps clerks to transfer laboratory-trained procedural skills into the clinical units. In comparison with the regular self-directed learning group, the peer-assisted learning characteristics of Facebook give additional benefits to the PAL group by enhancing their procedural skills. Copyright © 2018. Published by Elsevier Taiwan LLC.
Similar Patterns of Infection with Bovine Foamy Virus in Experimentally Inoculated Calves and Sheep
Hechler, Torsten; Löchelt, Martin; Kuźmak, Jacek
2013-01-01
Foamy viruses (FVs) are the least known retroviruses commonly found in primates, cats, horses, and cattle. Although FVs are considered apathogenic, simian and feline FVs have been shown to be associated with some transient health abnormalities in animal models. Currently, data regarding the course of infection with bovine FV (BFV) are not available. In this study, we conducted experimental infections of natural (cattle) and heterologous (sheep) hosts with the BFV100 isolate and monitored infection patterns in both hosts during the early phase postinoculation as well as after long-term infection. Four calves and six sheep inoculated with BFV100 showed no signs of pathology but developed persistent infection, as confirmed by virus rescue, consistent detection of BFV-specific antibodies, and presence of viral DNA. In both hosts, antibodies against BFV Gag and Bet appeared early after infection and persisted at high and stable levels while seroreactivity toward Env was consistently detectable only in BFV-infected sheep. Interestingly, the BFV proviral DNA load was highest in lung, spleen, and liver and moderate in leukocytes, while salivary glands contained either low or undetectable DNA loads in calves or sheep, respectively. Additionally, comparison of partial BFV sequences from inoculum and infected animals demonstrated very limited changes after long-term infection in the heterologous host, clearly less than those found in BFV field isolates. The persistence of BFV infection in both hosts suggests full replication competence of the BFV100 isolate with no requirement of genetic adaptation for productive replication in the authentic and even in a heterologous host. PMID:23325680
Similar patterns of infection with bovine foamy virus in experimentally inoculated calves and sheep.
Materniak, Magdalena; Hechler, Torsten; Löchelt, Martin; Kuzmak, Jacek
2013-03-01
Foamy viruses (FVs) are the least known retroviruses commonly found in primates, cats, horses, and cattle. Although FVs are considered apathogenic, simian and feline FVs have been shown to be associated with some transient health abnormalities in animal models. Currently, data regarding the course of infection with bovine FV (BFV) are not available. In this study, we conducted experimental infections of natural (cattle) and heterologous (sheep) hosts with the BFV(100) isolate and monitored infection patterns in both hosts during the early phase postinoculation as well as after long-term infection. Four calves and six sheep inoculated with BFV(100) showed no signs of pathology but developed persistent infection, as confirmed by virus rescue, consistent detection of BFV-specific antibodies, and presence of viral DNA. In both hosts, antibodies against BFV Gag and Bet appeared early after infection and persisted at high and stable levels while seroreactivity toward Env was consistently detectable only in BFV-infected sheep. Interestingly, the BFV proviral DNA load was highest in lung, spleen, and liver and moderate in leukocytes, while salivary glands contained either low or undetectable DNA loads in calves or sheep, respectively. Additionally, comparison of partial BFV sequences from inoculum and infected animals demonstrated very limited changes after long-term infection in the heterologous host, clearly less than those found in BFV field isolates. The persistence of BFV infection in both hosts suggests full replication competence of the BFV(100) isolate with no requirement of genetic adaptation for productive replication in the authentic and even in a heterologous host.
Guernet, Alexis; Mungamuri, Sathish Kumar; Cartier, Dorthe; Sachidanandam, Ravi; Jayaprakash, Anitha; Adriouch, Sahil; Vezain, Myriam; Charbonnier, Françoise; Rohkin, Guy; Coutant, Sophie; Yao, Shen; Ainani, Hassan; Alexandre, David; Tournier, Isabelle; Boyer, Olivier; Aaronson, Stuart A; Anouar, Youssef; Grumolato, Luca
2016-08-04
Intratumor genetic heterogeneity underlies the ability of tumors to evolve and adapt to different environmental conditions. Using CRISPR/Cas9 technology and specific DNA barcodes, we devised a strategy to recapitulate and trace the emergence of subpopulations of cancer cells containing a mutation of interest. We used this approach to model different mechanisms of lung cancer cell resistance to EGFR inhibitors and to assess effects of combined drug therapies. By overcoming intrinsic limitations of current approaches, CRISPR-barcoding also enables investigation of most types of genetic modifications, including repair of oncogenic driver mutations. Finally, we used highly complex barcodes inserted at a specific genome location as a means of simultaneously tracing the fates of many thousands of genetically labeled cancer cells. CRISPR-barcoding is a straightforward and highly flexible method that should greatly facilitate the functional investigation of specific mutations, in a context that closely mimics the complexity of cancer. Copyright © 2016 Elsevier Inc. All rights reserved.
BIOMECHANICAL EVALUATION OF THE INFLUENCE OF CERVICAL SCREWS TAPPING AND DESIGN.
Silva, Patricia; Rosa, Rodrigo César; Shimano, Antonio Carlos; Albuquerque de Paula, Francisco José; Volpon, José Batista; Aparecido Defino, Helton Luiz
2009-01-01
To assess if the screw design (self-drilling/self-tapping) and the pilot hole tapping could affect the insertion torque and screw pullout strength of the screw used in anterior fixation of the cervical spine. Forty self-tapping screws and 20 self-drilling screws were inserted into 10 models of artificial bone and 10 cervical vertebrae of sheep. The studied parameters were the insertion torque and pullout strength. The following groups were created: Group I-self-tapping screw insertion after pilot hole drilling and tapping; Group II-self-tapping screw insertion after pilot hole drilling without tapping; Group III-self-drilling screw insertion without drilling and tapping. In Groups I and II, the pilot hole had 14.0 mm in depth and was made with a 3mmn drill, while tapping was made with a 4mm tap. The insertion torque was measured and the pullout test was performed. The comparison between groups was made considering the mean insertion torque and the maximum mean pullout strength with the variance analysis (ANOVA; p≤ 0.05). Previous drilling and tapping of pilot hole significantly decreased the insertion torque and the pullout strength. The insertion torque and pullout strength of self-drilling screws were significantly higher when compared to self-tapping screws inserted after pilot hole tapping.
Deng, Ting; Jiang, Minghui; Lei, Qing; Cai, Lihong; Chen, Li
2016-12-01
Clinical trial for cervical screw insertion by using individualized 3-dimensional (3D) printing screw insertion templates device. The objective of this study is to evaluate the safety and accuracy of the individualized 3D printing screw insertion template in the cervical spine. Ten patients who underwent posterior cervical fusion surgery with cervical pedicle screws, laminar screws or lateral mass screws between December 2014 and December 2015 were involved in this study. The patients were examined by CT scan before operation. The individualized 3D printing templates were made with photosensitive resin by a 3D printing system to ensure the screw shafts entered the vertebral body without breaking the pedicle or lamina cortex. The templates were sterilized by a plasma sterilizer and used during the operation. The accuracy and the safety of the templates were evaluated by CT scans at the screw insertion levels after operation. The accuracy of this patient-specific template technique was demonstrated. Only one screw axis greatly deviated from the planned track and breached the cortex of the pedicle because the template was split by rough handling and then we inserted the screws under the fluoroscopy. The remaining screws were inserted in the track as preoperative design and the screw axis deviated by less than 2 mm. Vascular or neurologic complications or injuries did not happen. And no infection, broken nails, fracture of bone structure, or screw pullout occurred. This study verified the safety and the accuracy of the individualized 3D printing screw insertion templates in the cervical spine as a kind of intraoperative screw navigation. This individualized 3D printing screw insertion template was user-friendly, moderate cost, and enabled a radiation-free cervical screw insertion.
Dynamic soft tissue deformation estimation based on energy analysis
NASA Astrophysics Data System (ADS)
Gao, Dedong; Lei, Yong; Yao, Bin
2016-10-01
The needle placement accuracy of millimeters is required in many needle-based surgeries. The tissue deformation, especially that occurring on the surface of organ tissue, affects the needle-targeting accuracy of both manual and robotic needle insertions. It is necessary to understand the mechanism of tissue deformation during needle insertion into soft tissue. In this paper, soft tissue surface deformation is investigated on the basis of continuum mechanics, where a geometry model is presented to quantitatively approximate the volume of tissue deformation. The energy-based method is presented to the dynamic process of needle insertion into soft tissue based on continuum mechanics, and the volume of the cone is exploited to quantitatively approximate the deformation on the surface of soft tissue. The external work is converted into potential, kinetic, dissipated, and strain energies during the dynamic rigid needle-tissue interactive process. The needle insertion experimental setup, consisting of a linear actuator, force sensor, needle, tissue container, and a light, is constructed while an image-based method for measuring the depth and radius of the soft tissue surface deformations is introduced to obtain the experimental data. The relationship between the changed volume of tissue deformation and the insertion parameters is created based on the law of conservation of energy, with the volume of tissue deformation having been obtained using image-based measurements. The experiments are performed on phantom specimens, and an energy-based analytical fitted model is presented to estimate the volume of tissue deformation. The experimental results show that the energy-based analytical fitted model can predict the volume of soft tissue deformation, and the root mean squared errors of the fitting model and experimental data are 0.61 and 0.25 at the velocities 2.50 mm/s and 5.00 mm/s. The estimating parameters of the soft tissue surface deformations are proven to be useful for compensating the needle-targeting error in the rigid needle insertion procedure, especially for percutaneous needle insertion into organs.
Landscape of Insertion Polymorphisms in the Human Genome
Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.
2015-01-01
Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018
Symbolic Capital in a Virtual Heterosexual Market: Abbreviation and Insertion in Italian iTV SMS
ERIC Educational Resources Information Center
Herring, Susan C.; Zelenkauskaite, Asta
2009-01-01
This study analyzes gender variation in nonstandard typography--specifically, abbreviations and insertions--in mobile phone text messages (SMS) posted to a public Italian interactive television (iTV) program. All broadcast SMS were collected for a period of 2 days from the Web archive for the iTV program, and the frequency and distribution of…
Matsunaga, Taichi; Yamashita, Jun K
2014-02-07
Specific gene knockout and rescue experiments are powerful tools in developmental and stem cell biology. Nevertheless, the experiments require multiple steps of molecular manipulation for gene knockout and subsequent rescue procedures. Here we report an efficient and single step strategy to generate gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9 genome editing technology. We inserted a tetracycline-regulated inducible gene promoter (tet-OFF/TRE-CMV) upstream of the endogenous promoter region of vascular endothelial growth factor receptor 2 (VEGFR2/Flk1) gene, an essential gene for endothelial cell (EC) differentiation, in mouse embryonic stem cells (ESCs) with homologous recombination. Both homo- and hetero-inserted clones were efficiently obtained through a simple selection with a drug-resistant gene. The insertion of TRE-CMV promoter disrupted endogenous Flk1 expression, resulting in null mutation in homo-inserted clones. When the inserted TRE-CMV promoter was activated with doxycycline (Dox) depletion, Flk1 expression was sufficiently recovered from the downstream genomic Flk1 gene. Whereas EC differentiation was almost completely perturbed in homo-inserted clones, Flk1 rescue with TRE-CMV promoter activation restored EC appearance, indicating that phenotypic changes in EC differentiation can be successfully reproduced with this knockout-rescue system. Thus, this promoter insertion strategy with CRISPR/Cas9 would be a novel attractive method for knockout-rescue experiments. Copyright © 2014 Elsevier Inc. All rights reserved.
Thrasher, James F; Osman, Amira; Abad-Vivero, Erika N; Hammond, David; Bansal-Travers, Maansi; Cummings, K Michael; Hardin, James W; Moodie, Crawford
2015-07-01
Canada is the first country in the world to require cigarette manufacturers to enclose package inserts to supplement the exterior pictorial health warning label (HWL). In June 2012, Canada implemented new HWL package inserts that include cessation tips accompanied by a pictorial image. This study aims to assess the extent to which adult smokers report reading the newly mandated HWL inserts and to see whether reading them is associated with making a quit attempt. Data were analyzed from an online consumer panel of Canadian adult smokers, aged 18-64 years. Five waves of data were collected between September 2012 and January 2014, separated by 4-months intervals (n = 1,000 at each wave). Logistic generalized estimating equation (GEE) models were estimated to assess correlates of reading inserts and whether doing so is associated with making a quit attempt by the subsequent wave. At each wave, between 26% and 31% of the sample reported having read HWL package inserts at least once in the prior month. Smokers who read them were more likely to be younger, female, have higher income, intend to quit, have recently tried to quit, and thought more frequently about health risks because of warning labels. In models that adjusted for these and other potential confounders, smokers who read the inserts a few times or more in the past month were more likely to make a quit attempt at the subsequent wave compared to smokers who did not read the inserts. HWL package inserts with cessation-related tips and messages appear to increase quit attempts made by smokers. © The Author 2014. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Nevler, Avinoam; Har-Zahav, Gil; Rosin, Danny; Gutman, Mordechai
2016-02-01
Laparoscopic surgery is widely practiced surgical technique in the modern surgical toolbox. The Veress needle insertion technique, while faster and easier, is associated with higher rates of iatrogenic complications (injury to internal organs, major blood vessels, etc.), morbidity and even mortality with a reported overall risk of 0.32% during surgical interventions. In order to increase the safety and ease of closed insertion technique, we designed and tested an improved prototype of the Veress needle. The new Veress needle includes a distal expandable portion that allows elevation of the abdominal wall and safe insertion of the first trocar over it. The needle was assessed by measurement of ease of insertion, ease of trocar advancement, associated tissue damage, device integrity and weight-bearing capacity on an ex vivo Gallus domesticus animal model: The prototype was tested over 20 times using different traction forces. The experiment was qualitatively repeated on an ex vivo porcine model. In the G. domesticus model, the improved needle supported forces of up to 5.75 kg F. No damage or mechanical malfunction was seen at any stage of the experiment. Needle penetration, ease of trocar insertion, system anchoring and weight-bearing capacity were rated (1-5) by four raters--mean 4.9 ± 0.31. Inter-rater agreement was high (free marginal κ 0.75). The porcine experiment revealed similar ease of use with neither complication nor damage to the abdominal wall. We believe that the new Veress system is easy to use, requires no additional training, non-inferior in its capabilities compared to the traditional Veress needle, with the advantage of improving the safety of the first trocar insertion phase of the operation.
Hamilton, Preci; Soryal, Imad; Dhahri, Prince; Wimalachandra, Welege; Leat, Anna; Hughes, Denise; Toghill, Nicole; Hodson, James; Sawlani, Vijay; Hayton, Tom; Samarasekera, Shanika; Bagary, Manny; McCorry, Dougall; Chelvarajah, Ramesh
2018-05-01
To compare the efficacy of AspireSR ® to preceding VNS battery models for battery replacements, and to determine the efficacy of the AspireSR ® for new implants. Data were collected retrospectively from patients with epilepsy who had VNS AspireSR ® implanted over a three-year period between June 2014 and June 2017 by a single surgeon. Cases were divided into two cohorts, those in whom the VNS was a new insertion, and those in whom the VNS battery was changed from a previous model to AspireSR ® . Within each group, the seizure burden was compared between the periods before and after insertion of AspireSR ® . Fifty-one patients with a newly inserted AspireSR ® VNS model had a significant reduction in seizure frequency (p < 0.001), with 59% (n = 30) reporting ≥50% reduction. Of the 62 patients who had an existing VNS, 53% (n = 33) reported ≥50% reduction in seizure burden when the original VNS was inserted. After the battery was changed to the AspireSR ® , 71% (n = 44) reported a further reduction of ≥50% in their seizure burden. The size of this reduction was at least as large as that resulting from the insertion of their existing VNS in 98% (61/62) of patients. The results suggest that approximately 70% of patients with existing VNS insertions could have significant additional benefit from cardiac based seizure detection and closed loop stimulation from the AspireSR ® device. For new insertions, the AspireSR ® device has efficacy in 59% of patients. The 'rule of thirds' used in counseling patients may need to be modified accordingly. Crown Copyright © 2018. Published by Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Yamazaki, Takaharu; Futai, Kazuma; Tomita, Tetsuya; Sato, Yoshinobu; Yoshikawa, Hideki; Tamura, Shinichi; Sugamoto, Kazuomi
2011-03-01
To achieve 3D kinematic analysis of total knee arthroplasty (TKA), 2D/3D registration techniques, which use X-ray fluoroscopic images and computer-aided design (CAD) model of the knee implant, have attracted attention in recent years. These techniques could provide information regarding the movement of radiopaque femoral and tibial components but could not provide information of radiolucent polyethylene insert, because the insert silhouette on X-ray image did not appear clearly. Therefore, it was difficult to obtain 3D kinemaitcs of polyethylene insert, particularly mobile-bearing insert that move on the tibial component. This study presents a technique and the accuracy for 3D kinematic analysis of mobile-bearing insert in TKA using X-ray fluoroscopy, and finally performs clinical applications. For a 3D pose estimation technique of the mobile-bearing insert in TKA using X-ray fluoroscopy, tantalum beads and CAD model with its beads are utilized, and the 3D pose of the insert model is estimated using a feature-based 2D/3D registration technique. In order to validate the accuracy of the present technique, experiments including computer simulation test were performed. The results showed the pose estimation accuracy was sufficient for analyzing mobile-bearing TKA kinematics (the RMS error: about 1.0 mm, 1.0 degree). In the clinical applications, seven patients with mobile-bearing TKA in deep knee bending motion were studied and analyzed. Consequently, present technique enables us to better understand mobile-bearing TKA kinematics, and this type of evaluation was thought to be helpful for improving implant design and optimizing TKA surgical techniques.
NASA Astrophysics Data System (ADS)
Mironov, S. G.; Poplavskaya, T. V.; Kirilovskiy, S. V.; Maslov, A. A.
2018-03-01
We have experimentally and numerically studied the influence of the ratio of the diameter of a cylinder with a frontal gas-permeable porous insert made of nickel sponge to the average pore diameter in the insert on the aerodynamic drag of this model body in supersonic airflow ( M ∞ = 4.85, 7, and 21). The analytical dependence of the normalized drag coefficient on a parameter involving the Mach number and the ratio of cylinder radius to average pore radius in the insert is obtained. It is suggested to use this parameter as a similarity criterion in the problem of supersonic airflow past a cylinder with a frontal high-porosity cellular insert.
NASA Astrophysics Data System (ADS)
Qiu, Liming; Vaughn, Mark; Cheng, Kelvin
2013-03-01
Beta-amyloid (Abeta) interactions with neurons are linked to Alzheimer's. Using a multiscale MD simulation strategy that combines the high efficiency of phase space sampling of coarse-grained MD (CGD) and the high spatial resolution of Atomistic MD (AMD) simulations, we studied the Abeta insertion dynamics in cholesterol-enriched and -depleted lipid bilayers that mimic the neuronal membranes domains. Forward (AMD-CGD) and reverse (CGD-AMD) mappings were used. At the atomistic level, cholesterol promoted insertion of Abeta with high (folded) or low (unfolded) helical contents of the lipid insertion domain (Lys28-Ala42), and the insertions were stabilized by the Lys28 snorkeling and Ala42-anchoring to the polar lipid groups of the bilayer up to 200ns. After the forward mapping, the folded inserted state switched to a new extended inserted state with the Lys28 descended to the middle of the bilayer while the unfolded inserted state migrated to the membrane surface up to 4000ns. The two new states remained stable for 200ns at the atomistic scale after the reverse mapping. Our results suggested that different Abeta membrane-orientation states separated by free energy barriers can be explored by the multiscale MD more effectively than by Atomistic MD simulations alone. NIH RC1-GM090897-02
Huang, Hairong; Wismeijer, Daniel; Shao, Xianhong; Wu, Gang
2016-01-01
Objectives The objective of this study is to mathematically evaluate the influence of multiple factors on implant stability quotient values in clinical practice. Patients and methods Resonance frequency analysis was performed at T1 (measured immediately at the time of implant placement) and at T2 (measured before dental restoration) in 177 patients (329 implants). Using a multivariate linear regression model, we analyzed the influence of the following eleven candidate factors: sex, age, maxillary/mandibular location, bone type, immediate/delayed implantation, bone grafting (presence or absence), insertion torque, I-/II-stage healing pattern, implant diameter, implant length, and T1–T2 time interval. Results The following factors were identified to significantly influence the implant stability quotient (ISQ) values at T1: insertion torque, bone grafting, I-/II-stage healing pattern, immediate/delayed implantation, maxillary/mandibular location, implant diameter, and sex. In contrast, the ISQ values at T2 were significantly influenced only by three factors: implant diameter, T1–T2 time interval, and insertion torque. Conclusion Among the eleven candidate factors, seven key factors were found to influence the T1-ISQ values, while only three key factors influenced the T2-ISQ values. Both T1 and T2-ISQ values were found to be influenced by implant diameter and insertion torque. T1 was influenced specifically by the sex of the patient, the location (maxillary or mandibular), the implantation mode (immediate/delayed implantation), the healing stage, and the absence or presence of bone graft materials. PMID:27785040
Yang, Yunpeng; Jiang, Shan; Yang, Zhiyong; Yuan, Wei; Dou, Huaisu; Wang, Wei; Zhang, Daguang; Bian, Yuan
2017-04-01
Nowadays, biopsy is a decisive method of lung cancer diagnosis, whereas lung biopsy is time-consuming, complex and inaccurate. So a computed tomography-compatible robot for rapid and precise lung biopsy is developed in this article. According to the actual operation process, the robot is divided into two modules: 4-degree-of-freedom position module for location of puncture point is appropriate for patient's almost all positions and 3-degree-of-freedom tendon-based orientation module with remote center of motion is compact and computed tomography-compatible to orientate and insert needle automatically inside computed tomography bore. The workspace of the robot surrounds patient's thorax, and the needle tip forms a cone under patient's skin. A new error model of the robot based on screw theory is proposed in view of structure error and actuation error, which are regarded as screw motions. Simulation is carried out to verify the precision of the error model contrasted with compensation via inverse kinematics. The results of insertion experiment on specific phantom prove the feasibility of the robot with mean error of 1.373 mm in laboratory environment, which is accurate enough to replace manual operation.
Modelling Human Performance in Maritime Interdiction Operations
2010-10-01
tire relatively quickly compared to the legs. However, the arms and legs may be fatigued from the HSC insertion phase where muscular work will be...MI personnel include: • HSC Coxswain • Insertion/On-Target/Exfiltration phases – coping with Repeated Shock (RS), ( eccentric muscle contractions...and maintaining postural stability (isometric muscle contractions). • Boarding Team • Insertion – coping with RS ( eccentric muscle contractions), and
Toward modeling locomotion using electromyography-informed 3D models: application to cerebral palsy.
Sartori, M; Fernandez, J W; Modenese, L; Carty, C P; Barber, L A; Oberhofer, K; Zhang, J; Handsfield, G G; Stott, N S; Besier, T F; Farina, D; Lloyd, D G
2017-03-01
This position paper proposes a modeling pipeline to develop clinically relevant neuromusculoskeletal models to understand and treat complex neurological disorders. Although applicable to a variety of neurological conditions, we provide direct pipeline applicative examples in the context of cerebral palsy (CP). This paper highlights technologies in: (1) patient-specific segmental rigid body models developed from magnetic resonance imaging for use in inverse kinematics and inverse dynamics pipelines; (2) efficient population-based approaches to derive skeletal models and muscle origins/insertions that are useful for population statistics and consistent creation of continuum models; (3) continuum muscle descriptions to account for complex muscle architecture including spatially varying material properties with muscle wrapping; (4) muscle and tendon properties specific to CP; and (5) neural-based electromyography-informed methods for muscle force prediction. This represents a novel modeling pipeline that couples for the first time electromyography extracted features of disrupted neuromuscular behavior with advanced numerical methods for modeling CP-specific musculoskeletal morphology and function. The translation of such pipeline to the clinical level will provide a new class of biomarkers that objectively describe the neuromusculoskeletal determinants of pathological locomotion and complement current clinical assessment techniques, which often rely on subjective judgment. WIREs Syst Biol Med 2017, 9:e1368. doi: 10.1002/wsbm.1368 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.
CRISPR/Cas9-Advancing Orthopoxvirus Genome Editing for Vaccine and Vector Development.
Okoli, Arinze; Okeke, Malachy I; Tryland, Morten; Moens, Ugo
2018-01-22
The clustered regularly interspaced short palindromic repeat (CRISPR)/associated protein 9 (Cas9) technology is revolutionizing genome editing approaches. Its high efficiency, specificity, versatility, flexibility, simplicity and low cost have made the CRISPR/Cas9 system preferable to other guided site-specific nuclease-based systems such as TALENs (Transcription Activator-like Effector Nucleases) and ZFNs (Zinc Finger Nucleases) in genome editing of viruses. CRISPR/Cas9 is presently being applied in constructing viral mutants, preventing virus infections, eradicating proviral DNA, and inhibiting viral replication in infected cells. The successful adaptation of CRISPR/Cas9 to editing the genome of Vaccinia virus paves the way for its application in editing other vaccine/vector-relevant orthopoxvirus (OPXV) strains. Thus, CRISPR/Cas9 can be used to resolve some of the major hindrances to the development of OPXV-based recombinant vaccines and vectors, including sub-optimal immunogenicity; transgene and genome instability; reversion of attenuation; potential of spread of transgenes to wildtype strains and close contacts, which are important biosafety and risk assessment considerations. In this article, we review the published literature on the application of CRISPR/Cas9 in virus genome editing and discuss the potentials of CRISPR/Cas9 in advancing OPXV-based recombinant vaccines and vectors. We also discuss the application of CRISPR/Cas9 in combating viruses of clinical relevance, the limitations of CRISPR/Cas9 and the current strategies to overcome them.
Shimoyama, M; Minato, K; Tobinai, K; Nagai, M; Setoya, T; Watanabe, S; Hoshino, H; Miwa, M; Nagoshi, H; Ichiki, N; Fukushima, N; Sugiura, K; Funaki, N
1983-01-01
Five cases of adult T-cell leukemia-lymphoma (ATL) having typical clinicohematologic and morphologic features but negative for anti-ATLA [antibody to ATL virus (ATLV)-associated antigen (ATLA)] are presented. Some differences in immunologic, epidemiologic, and serologic data between anti-ATLA-positive and -negative ATLs are also described. Expression of ATLA in early primary cultured leukemic cells was found to be negative in three patients tested (Cases 1, 2 and 4), however, a long-term cultured cell line, ATL-6A, derived from peripheral blood leukemia cells from Case 1, was found to express ATLA. Mother of Case 1 and a daughter of Case 2 were anti-ATLA negative. These results indicate that ATLV was involved in certain anti-ATLA-negative ATL patients, at least in Case 1, and that the patient had no detectable immune response against ATLV and ATLA. However, in other cases in which no ATLA reactivity of serum and no ATLA expression in cultured leukemic cells were observed, another possibility such as activation of an unknown cellular oncogene specific for ATL without ATLV involvement may be considered. In order to prove these possibilities definitely, it is necessary to elucidate whether or not proviral DNA of ATLV is integrated into chromosomal DNA of ATL cells and to find a cellular oncogene specific for ATL in the future.
Hyper- and viscoelastic modeling of needle and brain tissue interaction.
Lehocky, Craig A; Yixing Shi; Riviere, Cameron N
2014-01-01
Deep needle insertion into brain is important for both diagnostic and therapeutic clinical interventions. We have developed an automated system for robotically steering flexible needles within the brain to improve targeting accuracy. In this work, we have developed a finite element needle-tissue interaction model that allows for the investigation of safe parameters for needle steering. The tissue model implemented contains both hyperelastic and viscoelastic properties to simulate the instantaneous and time-dependent responses of brain tissue. Several needle models were developed with varying parameters to study the effects of the parameters on tissue stress, strain and strain rate during needle insertion and rotation. The parameters varied include needle radius, bevel angle, bevel tip fillet radius, insertion speed, and rotation speed. The results will guide the design of safe needle tips and control systems for intracerebral needle steering.
48 CFR 1252.211-70 - Index for specifications.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Index for specifications... Index for specifications. As prescribed in (TAR) 48 CFR 1211.204-70, insert the following clause: Index for Specifications (APR 2005) If an index or table of contents is furnished in connection with...
48 CFR 3052.211-70 - Index for specifications.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Index for specifications... CLAUSES Text of Provisions and Clauses 3052.211-70 Index for specifications. As prescribed in (HSAR) 48 CFR 3011.204-70 insert the following clause: Index for Specifications (DEC 2003) If an index or table...
Bahr, George M.; Darcissac, Edith C. A.; Castéran, Nathalie; Amiel, Corinne; Cocude, Cécile; Truong, Marie-José; Dewulf, Joëlle; Capron, André; Mouton, Yves
2001-01-01
We have previously observed that the synthetic immunomodulator Murabutide inhibits human immunodeficiency virus type 1 (HIV-1) replication at multiple levels in macrophages and dendritic cells. The present study was designed to profile the activity of Murabutide on CD8-depleted phytohemagglutinin-activated lymphocytes from HIV-1-infected subjects and on the outcome of HIV-1 infection in severe combined immunodeficiency mice reconstituted with human peripheral blood leukocytes (hu-PBL-SCID mice). Maintaining cultures of CD8-depleted blasts from 36 patients in the presence of Murabutide produced dramatically reduced levels of viral p24 protein in the supernatants. This activity correlated with reduced viral transcripts and proviral DNA, was evident in cultures harboring R5, X4-R5, or X4 HIV-1 isolates, was not linked to inhibition of cellular DNA synthesis, and did not correlate with β-chemokine release. Moreover, c-myc mRNA expression was down-regulated in Murabutide-treated cells, suggesting potential interference of the immunomodulator with the nuclear transport of viral preintegration complexes. On the other hand, daily treatment of HIV-1-infected hu-PBL-SCID mice with Murabutide significantly reduced the viral loads in plasma and the proviral DNA content in human peritoneal cells. These results are the first to demonstrate that a clinically acceptable synthetic immunomodulator with an ability to enhance the host's nonspecific immune defense mechanisms against infections can directly regulate cellular factors in infected lymphocytes, leading to controlled HIV-1 replication. PMID:11435574
Evaluation of the role of TAX, HBZ, and HTLV-1 proviral load on the survival of ATLL patients.
Akbarin, Mohammad Mehdi; Shirdel, Abbas; Bari, Alireza; Mohaddes, Seyedeh Tahereh; Rafatpanah, Houshang; Karimani, Ehsan Ghayour; Etminani, Kobra; Golabpour, Amin; Torshizi, Reza
2017-06-01
Adult T-cell leukemia/lymphoma (ATLL) is an aggressive malignancy with very poor prognosis and short survival, caused by the human T-lymphotropic virus type-1 (HTLV-1). The HTLV-1 biomarkers trans-activator x (TAX) and HTLV-1 basic leucine zipper factor (HBZ) are main oncogenes and life-threatening elements. This study aimed to assess the role of the TAX and HBZ genes and HTLV-1 proviral load (PVL) in the survival of patients with ATLL. Forty-three HTLV-1-infected individuals, including 18 asymptomatic carriers (AC) and 25 ATLL patients (ATLL), were evaluated between 2011 and 2015. The mRNA expression of TAX and HBZ and the HTLV-1 PVL were measured by quantitative PCR. Significant differences in the mean expression levels of TAX and HBZ were observed between the two study groups (ATLL and AC, P =0.014 and P =0.000, respectively). In addition, the ATLL group showed a significantly higher PVL than AC ( P =0.000). There was a significant negative relationship between PVL and survival among all study groups ( P =0.047). The HTLV-1 PVL and expression of TAX and HBZ were higher in the ATLL group than in the AC group. Moreover, a higher PVL was associated with shorter survival time among all ATLL subjects. Therefore, measurement of PVL, TAX , and HBZ may be beneficial for monitoring and predicting HTLV-1-infection outcomes, and PVL may be useful for prognosis assessment of ATLL patients. This research demonstrates the possible correlation between these virological markers and survival in ATLL patients.
Molecular characterization of a novel gammaretrovirus in killer whales (Orcinus orca).
Lamere, Sarah A; St Leger, Judy A; Schrenzel, Mark D; Anthony, Simon J; Rideout, Bruce A; Salomon, Daniel R
2009-12-01
There are currently no published data documenting the presence of retroviruses in cetaceans, though the occurrences of cancers and immunodeficiency states suggest the potential. We examined tissues from adult killer whales and detected a novel gammaretrovirus by degenerate PCR. Reverse transcription-PCR also demonstrated tissue and serum expression of retroviral mRNA. The full-length sequence of the provirus was obtained by PCR, and a TaqMan-based copy number assay did not demonstrate evidence of productive infection. PCR on blood samples from 11 healthy captive killer whales and tissues from 3 free-ranging animals detected the proviral DNA in all tissues examined from all animals. A survey of multiple cetacean species by PCR for gag, pol, and env sequences showed homologs of this virus in the DNA of eight species of delphinids, pygmy and dwarf sperm whales, and harbor porpoises, but not in beluga or fin whales. Analysis of the bottlenose dolphin genome revealed two full-length proviral sequences with 97.4% and 96.9% nucleotide identity to the killer whale gammaretrovirus. The results of single-cell PCR on killer whale sperm and Southern blotting are also consistent with the conclusion that the provirus is endogenous. We suggest that this gammaretrovirus entered the delphinoid ancestor's genome before the divergence of modern dolphins or that an exogenous variant existed following divergence that was ultimately endogenized. However, the transcriptional activity demonstrated in tissues and the nearly intact viral genome suggest a more recent integration into the killer whale genome, favoring the latter hypothesis. The proposed name for this retrovirus is killer whale endogenous retrovirus.
Reexamination of human T cell lymphotropic virus (HTLV-I/II) prevalence.
Zucker-Franklin, D; Pancake, B A; Marmor, M; Legler, P M
1997-06-10
In the United States, blood donors are being screened for infection with human T cell lymphotropic viruses I and II (HTLV-I/II) by serologic means, which detect antibodies to the structural proteins of these viruses. Because patients with mycosis fungoides (MF) usually do not have such antibodies even though their cells harbor HTLV-I Tax and/or pol proviral sequences, it was questioned whether the prevalence of HTLV infection among healthy blood donors may also be underestimated by current means of testing. To examine this possibility, a study on specimens of relatives of mycosis fungoides patients (MFR) was begun. In addition, to collect data more expeditiously, a cohort of former injection drug users (IDUs) was tested by routine serologic methods, as well as by PCR/Southern blot analysis for Tax, pol, and gag proviral sequences and Western blot analysis for antibodies to the Tax gene product. To date, 6/8 MFRs and 42/81 (51.8%) of HIV-negative IDUs proved to be positive for HTLV, whereas routine serology identified none of the MFR and only 18/81 (22.2%) of the IDUs. Among the latter test subjects, the incidence of HTLV-I also proved to be 10 times higher than expected. Therefore, it is likely that among healthy blood donors infection with HTLV-I/II is more prevalent than is currently assumed. Since Tax is the transforming sequence of HTLV-I/II, testing for Tax sequences and antibodies to its gene product may be desirable in blood transfusion and tissue donor facilities.
Reexamination of human T cell lymphotropic virus (HTLV-I/II) prevalence
Zucker-Franklin, Dorothea; Pancake, Bette A.; Marmor, Michael; Legler, Patricia M.
1997-01-01
In the United States, blood donors are being screened for infection with human T cell lymphotropic viruses I and II (HTLV-I/II) by serologic means, which detect antibodies to the structural proteins of these viruses. Because patients with mycosis fungoides (MF) usually do not have such antibodies even though their cells harbor HTLV-I Tax and/or pol proviral sequences, it was questioned whether the prevalence of HTLV infection among healthy blood donors may also be underestimated by current means of testing. To examine this possibility, a study on specimens of relatives of mycosis fungoides patients (MFR) was begun. In addition, to collect data more expeditiously, a cohort of former injection drug users (IDUs) was tested by routine serologic methods, as well as by PCR/Southern blot analysis for Tax, pol, and gag proviral sequences and Western blot analysis for antibodies to the Tax gene product. To date, 6/8 MFRs and 42/81 (51.8%) of HIV-negative IDUs proved to be positive for HTLV, whereas routine serology identified none of the MFR and only 18/81 (22.2%) of the IDUs. Among the latter test subjects, the incidence of HTLV-I also proved to be 10 times higher than expected. Therefore, it is likely that among healthy blood donors infection with HTLV-I/II is more prevalent than is currently assumed. Since Tax is the transforming sequence of HTLV-I/II, testing for Tax sequences and antibodies to its gene product may be desirable in blood transfusion and tissue donor facilities. PMID:9177230
2014-01-01
Background Previously, we suggested prototypal models that describe some clinical states based on group postulates. Here, we demonstrate a group/category theory-like model for molecular/genetic biology as an alternative application of our previous model. Specifically, we focus on deoxyribonucleic acid (DNA) base sequences. Results We construct a wallpaper pattern based on a five-letter cruciform motif with letters C, A, T, G, and E. Whereas the first four letters represent the standard DNA bases, the fifth is introduced for ease in formulating group operations that reproduce insertions and deletions of DNA base sequences. A basic group Z5 = {r, u, d, l, n} of operations is defined for the wallpaper pattern, with which a sequence of points can be generated corresponding to changes of a base in a DNA sequence by following the orbit of a point of the pattern under operations in group Z5. Other manipulations of DNA sequence can be treated using a vector-like notation ‘Dj’ corresponding to a DNA sequence but based on the five-letter base set; also, ‘Dj’s are expressed graphically. Insertions and deletions of a series of letters ‘E’ are admitted to assist in describing DNA recombination. Likewise, a vector-like notation Rj can be constructed for sequences of ribonucleic acid (RNA). The wallpaper group B = {Z5×∞, ●} (an ∞-fold Cartesian product of Z5) acts on Dj (or Rj) yielding changes to Dj (or Rj) denoted by ‘Dj◦B(j→k) = Dk’ (or ‘Rj◦B(j→k) = Rk’). Based on the operations of this group, two types of groups—a modulo 5 linear group and a rotational group over the Gaussian plane, acting on the five bases—are linked as parts of the wallpaper group for broader applications. As a result, changes, insertions/deletions and DNA (RNA) recombination (partial/total conversion) are described. As an exploratory study, a notation for the canonical “central dogma” via a category theory-like way is presented for future developments. Conclusions Despite the large incompleteness of our methodology, there is fertile ground to consider a symmetry model for genetic coding based on our specific wallpaper group. A more integrated formulation containing “central dogma” for future molecular/genetic biology remains to be explored. PMID:24885369
48 CFR 1536.521 - Specifications and drawings for construction.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Specifications and drawings for construction. 1536.521 Section 1536.521 Federal Acquisition Regulations System ENVIRONMENTAL... Clauses 1536.521 Specifications and drawings for construction. The Contracting Officer shall insert the...
Derepression of the Plant Chromovirus LORE1 Induces Germline Transposition in Regenerated Plants
Fukai, Eigo; Umehara, Yosuke; Sato, Shusei; Endo, Makoto; Kouchi, Hiroshi; Hayashi, Makoto; Stougaard, Jens; Hirochika, Hirohiko
2010-01-01
Transposable elements represent a large proportion of the eukaryotic genomes. Long Terminal Repeat (LTR) retrotransposons are very abundant and constitute the predominant family of transposable elements in plants. Recent studies have identified chromoviruses to be a widely distributed lineage of Gypsy elements. These elements contain chromodomains in their integrases, which suggests a preference for insertion into heterochromatin. In turn, this preference might have contributed to the patterning of heterochromatin observed in host genomes. Despite their potential importance for our understanding of plant genome dynamics and evolution, the regulatory mechanisms governing the behavior of chromoviruses and their activities remain largely uncharacterized. Here, we report a detailed analysis of the spatio-temporal activity of a plant chromovirus in the endogenous host. We examined LORE1a, a member of the endogenous chromovirus LORE1 family from the model legume Lotus japonicus. We found that this chromovirus is stochastically de-repressed in plant populations regenerated from de-differentiated cells and that LORE1a transposes in the male germline. Bisulfite sequencing of the 5′ LTR and its surrounding region suggests that tissue culture induces a loss of epigenetic silencing of LORE1a. Since LTR promoter activity is pollen specific, as shown by the analysis of transgenic plants containing an LTR::GUS fusion, we conclude that male germline-specific LORE1a transposition in pollen grains is controlled transcriptionally by its own cis-elements. New insertion sites of LORE1a copies were frequently found in genic regions and show no strong insertional preferences. These distinctive novel features of LORE1 indicate that this chromovirus has considerable potential for generating genetic and epigenetic diversity in the host plant population. Our results also define conditions for the use of LORE1a as a genetic tool. PMID:20221264
A versatile strategy for grafting polymers to wood cell walls.
Keplinger, T; Cabane, E; Chanana, M; Hass, P; Merk, V; Gierlinger, N; Burgert, I
2015-01-01
The hierarchical structure of wood is composed of a cellulose skeleton of high structural order at various length scales. At the nanoscale and microscale the specific structural features of the cells and cell walls result in a lightweight structure with an anisotropic material profile of excellent mechanical performance. By being able to specifically functionalize wood at the level of cell and cell walls one can insert new properties and inevitably upscale them along the intrinsic hierarchical structure, to a level of large-scale engineering materials applications. For this purpose, however, precise control of the spatial distribution of the modifying substances in the complex wood structure is needed. Here we demonstrate a method to insert methacryl groups into wood cell walls using two different chemistry routes. By using these methacryl groups as the anchor points for grafting, various polymers can be inserted into the wood structure. Strikingly, depending on the methacryl precursor, the spatial distribution of the polymer differs strongly. As a proof of concept we grafted polystyrene as a model compound in the second modification step. In the case of methacryloyl chloride the polymer was located mainly at the interface between the cell lumina and the cell wall covering the inner surface of the cells and being traceable up to 2-3 μm in the cell wall, whereas in the case of methacrylic anhydride the polymer was located inside the whole cell wall. Scanning electron microscopy, Fourier transform infrared spectroscopy and especially Raman spectroscopy were used for an in-depth analysis of the modified wood at the cell wall level. Copyright © 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
Mission Advantages of Constant Power, Variable Isp Electrostatic Thrusters
NASA Technical Reports Server (NTRS)
Oleson, Steven R.
2000-01-01
Electric propulsion has moved from station-keeping capability for spacecraft to primary propulsion with the advent of both the Deep Space One asteroid flyby and geosynchronous spacecraft orbit insertion. In both cases notably more payload was delivered than would have been possible with chemical propulsion. To provide even greater improvements electrostatic thruster performance could be varied in specific impulse, but kept at constant power to provide better payload or trip time performance for different mission phases. Such variable specific impulse mission applications include geosynchronous and low earth orbit spacecraft stationkeeping and orbit insertion, geosynchronous reusable tug missions, and interplanetary probes. The application of variable specific impulse devices is shown to add from 5 to 15% payload for these missions. The challenges to building such devices include variable voltage power supplies and extending fuel throughput capabilities across the specific impulse range.
Watanabe, S M; Goodman, M F
1982-01-01
Enzyme kinetic measurements are presented showing that Km rather than maximum velocity (Vmax) discrimination governs the frequency of forming 2-aminopurine X cytosine base mispairs by DNA polymerase alpha. An in vitro system is used in which incorporation of dTMP or dCMP occurs opposite a template 2-aminopurine, and values for Km and Vmax are obtained. Results from a previous study in which dTTP and dCTP were competing simultaneously for insertion opposite 2-aminopurine indicated that dTMP is inserted 22 times more frequently than dCMP. We now report that the ratio of Km values KCm/KTm = 25 +/- 6, which agrees quantitatively with the dTMP/dCMP incorporation ratio obtained previously. We also report that VCmax is indistinguishable from VTmax. These Km and Vmax data are consistent with predictions from a model, the Km discrimination model, in which replication fidelity is determined by free energy differences between matched and mismatched base pairs. Central to this model is the prediction that the ratio of Km values for insertion of correct and incorrect nucleotides specifies the insertion fidelity, and the maximum velocities of insertion are the same for both nucleotides. PMID:6959128
Computerized planning of prostate cryosurgery using variable cryoprobe insertion depth.
Rossi, Michael R; Tanaka, Daigo; Shimada, Kenji; Rabin, Yoed
2010-02-01
The current study presents a computerized planning scheme for prostate cryosurgery using a variable insertion depth strategy. This study is a part of an ongoing effort to develop computerized tools for cryosurgery. Based on typical clinical practices, previous automated planning schemes have required that all cryoprobes be aligned at a single insertion depth. The current study investigates the benefit of removing this constraint, in comparison with results based on uniform insertion depth planning as well as the so-called "pullback procedure". Planning is based on the so-called "bubble-packing method", and its quality is evaluated with bioheat transfer simulations. This study is based on five 3D prostate models, reconstructed from ultrasound imaging, and cryoprobe active length in the range of 15-35 mm. The variable insertion depth technique is found to consistently provide superior results when compared to the other placement methods. Furthermore, it is shown that both the optimal active length and the optimal number of cryoprobes vary among prostate models, based on the size and shape of the target region. Due to its low computational cost, the new scheme can be used to determine the optimal cryoprobe layout for a given prostate model in real time. Copyright 2008 Elsevier Inc. All rights reserved.
Quadros, Rolen M; Miura, Hiromi; Harms, Donald W; Akatsuka, Hisako; Sato, Takehito; Aida, Tomomi; Redder, Ronald; Richardson, Guy P; Inagaki, Yutaka; Sakai, Daisuke; Buckley, Shannon M; Seshacharyulu, Parthasarathy; Batra, Surinder K; Behlke, Mark A; Zeiner, Sarah A; Jacobi, Ashley M; Izu, Yayoi; Thoreson, Wallace B; Urness, Lisa D; Mansour, Suzanne L; Ohtsuka, Masato; Gurumurthy, Channabasavaiah B
2017-05-17
Conditional knockout mice and transgenic mice expressing recombinases, reporters, and inducible transcriptional activators are key for many genetic studies and comprise over 90% of mouse models created. Conditional knockout mice are generated using labor-intensive methods of homologous recombination in embryonic stem cells and are available for only ~25% of all mouse genes. Transgenic mice generated by random genomic insertion approaches pose problems of unreliable expression, and thus there is a need for targeted-insertion models. Although CRISPR-based strategies were reported to create conditional and targeted-insertion alleles via one-step delivery of targeting components directly to zygotes, these strategies are quite inefficient. Here we describe Easi-CRISPR (Efficient additions with ssDNA inserts-CRISPR), a targeting strategy in which long single-stranded DNA donors are injected with pre-assembled crRNA + tracrRNA + Cas9 ribonucleoprotein (ctRNP) complexes into mouse zygotes. We show for over a dozen loci that Easi-CRISPR generates correctly targeted conditional and insertion alleles in 8.5-100% of the resulting live offspring. Easi-CRISPR solves the major problem of animal genome engineering, namely the inefficiency of targeted DNA cassette insertion. The approach is robust, succeeding for all tested loci. It is versatile, generating both conditional and targeted insertion alleles. Finally, it is highly efficient, as treating an average of only 50 zygotes is sufficient to produce a correctly targeted allele in up to 100% of live offspring. Thus, Easi-CRISPR offers a comprehensive means of building large-scale Cre-LoxP animal resources.
External Tank (ET) Bipod Fitting Bolted Attachment Locking Insert Performance
NASA Technical Reports Server (NTRS)
Larsen, Curtis E.; Wilson, Tim R.; Elliott, Kenny B.; Raju, Ivatury S.; McManamen, John
2008-01-01
Following STS-107, the External Tank (ET) Project implemented corrective actions and configuration changes at the ET bipod fitting. Among the corrective actions, the existing bolt lock wire which provided resistance to potential bolt rotation was removed. The lock wire removal was because of concerns with creating voids during foam application and potential for lock wire to become debris. The bolts had been previously lubricated to facilitate assembly but, because of elimination of the lock wire, the ET Project wanted to enable the locking feature of the insert. Thus, the lubrication was removed from bolt threads and instead applied to the washer under the bolt head. Lubrication is necessary to maximize joint pre-load while remaining within the bolt torque specification. The locking feature is implemented by thread crimping in at four places in the insert. As the bolt is torqued into the insert the bolt threads its way past the crimped parts of the insert. This provides the locking of the bolt, as torque is required to loosen the joint after clamping.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Sanchez-Luque, Francisco J; Richardson, Sandra R; Faulkner, Geoffrey J
2016-01-01
Mobile genetic elements (MGEs) are of critical importance in genomics and developmental biology. Polymorphic and somatic MGE insertions have the potential to impact the phenotype of an individual, depending on their genomic locations and functional consequences. However, the identification of polymorphic and somatic insertions among the plethora of copies residing in the genome presents a formidable technical challenge. Whole genome sequencing has the potential to address this problem; however, its efficacy depends on the abundance of cells carrying the new insertion. Robust detection of somatic insertions present in only a subset of cells within a given sample can also be prohibitively expensive due to a requirement for high sequencing depth. Here, we describe retrotransposon capture sequencing (RC-seq), a sequence capture approach in which Illumina libraries are enriched for fragments containing the 5' and 3' termini of specific MGEs. RC-seq allows the detection of known polymorphic insertions present in an individual, as well as the identification of rare or private germline insertions not previously described. Furthermore, RC-seq can be used to detect and characterize somatic insertions, providing a valuable tool to elucidate the extent and characteristics of MGE activity in healthy tissues and in various disease states.
Keller, Marla J.; Buckley, Niall; Katzen, Lauren L.; Walsh, Jennifer; Friedland, Barbara; Littlefield, Sarah; Lin, Juan; Xue, Xiaonan; Cornelison, Terri; Herold, Betsy C.; Einstein, Mark H.
2014-01-01
Background Applicator dye staining and ultraviolet (UV) light have been used in trials to measure adherence, but not in the setting of before and after sex gel dosing (BAT-24). This study was designed to determine if semen or pre-sex gel dosing impacts the sensitivity and specificity of a dye stain assay (DSA) for measuring vaginal insertion of placebo-filled applicators with BAT-24 dosing. Methods Healthy monogamous couples received Microlax®-type applicators filled with hydroxyethylcelluose placebo gel. Women were instructed to vaginally insert one dose of gel before and a second dose after sex and to return applicators within 48 hours after sex. Applicators were stained to detect semen followed by UV then DSA and scored by two readers. Positive and negative controls were randomly included in applicator batches. Results Fifteen couples completed the study. Each female returned at least six applicators over a 30-day period. The sensitivity for insertion of post-sex applicators was higher for UV (97%) compared to DSA (90%) and the specificity was similar (≥96%). For pre-sex applicators, the sensitivity and specificity were higher for DSA (100%) compared to UV testing (87% sensitivity, 96% specificity). Among returned post-sex applicators, 95% tested positive by UV compared to 87% by DSA. Agreement between readers was significantly better on the pre-sex applicators for DSA than for UV and for post-sex readings agreement was less than half that for UV, although the results were not statistically significant. Conclusions Applicator tests are feasible for measuring adherence in trials with gel dosing before and after sex. PMID:24220355
Wang, Guorong; Guo, Ling; Jiang, Bin; Huang, Min; Zhang, Jian; Qin, Ying
2015-01-01
Amplitude changes in the P-wave of intracavitary electrocardiography have been used to assess the tip placement of central venous catheters. The research assessed the sensitivity and specificity of this sign in comparison with standard radiographic techniques for tip location, focusing on factors influencing its clinical utility. Both intracavitary electrocardiography guided tip location and X-ray positioning were used to verify catheter tip locations in patients undergoing central venous catheter insertion. Intracavitary electrocardiograms from 1119 patients (of a total 1160 subjects) showed specific amplitude changes in the P-wave. As the results show, compared with X-ray positioning, the sensitivity of electrocardiography-guided tip location was 97.3%, with false negative rate of 2.7%; the specificity was 1, with false positive rate of zero. Univariate analyses indicated that features including age, gender, height, body weight, and heart rate have no statistically significant influence on P-wave amplitude changes (P>0.05). Multivariate logistic regression revealed that catheter insertion routes (OR = 2.280, P = 0.003) and basal P-wave amplitude (OR = 0.553, P = 0.003) have statistically significant impacts on P-wave amplitude changes. As a reliable indicator of tip location, amplitude change in the P-wave has proved of good sensitivity and excellent specificity, and the minor, zero, false positive rate supports the clinical utility of this technique in early recognition of malpositioned tips. A better sensitivity was achieved in placement of centrally inserted central catheters (CICCs) than that of peripherally inserted central catheters (PICCs). In clinical practice, a combination of intracavitary electrocardiography, ultrasonic inspection and the anthropometric measurement method would further improve the accuracy. PMID:25915758
Discriminative Dissolution Method for Benzoyl Metronidazole Oral Suspension.
da Silva, Aline Santos; da Rosa Silva, Carlos Eduardo; Paula, Fávero Reisdorfer; da Silva, Fabiana Ernestina Barcellos
2016-06-01
A dissolution method for benzoyl metronidazole (BMZ) oral suspensions was developed and validated using a high-performance liquid chromatography (HPLC) method. After determination of sink conditions, dissolution profiles were evaluated using different dissolution media and agitation speeds. The sample insertion mode in dissolution media was also evaluated. The best conditions were obtained using a paddle, 50 rpm stirring speed, simulated gastric fluid (without pepsin) as the dissolution medium, and sample insertion by a syringe. These conditions were suitable for providing sink conditions and discriminatory power between different formulations. Through the tested conditions, the results can be considered specific, linear, precise, accurate, and robust. The dissolution profiles of five samples were compared using the similarity factor (f 2) and dissolution efficiency. The dissolution kinetics were evaluated and described by the Weibull model. Whereas there is no monograph for this pharmaceutical formulation, the dissolution method proposed can be considered suitable for quality control and dissolution profile comparison of different commercial formulations.
Simulated thought insertion: Influencing the sense of agency using deception and magic.
Olson, Jay A; Landry, Mathieu; Appourchaux, Krystèle; Raz, Amir
2016-07-01
In order to study the feeling of control over decisions, we told 60 participants that a neuroimaging machine could read and influence their thoughts. While inside a mock brain scanner, participants chose arbitrary numbers in two similar tasks. In the Mind-Reading Task, the scanner appeared to guess the participants' numbers; in the Mind-Influencing Task, it appeared to influence their choice of numbers. We predicted that participants would feel less voluntary control over their decisions when they believed that the scanner was influencing their choices. As predicted, participants felt less control and made slower decisions in the Mind-Influencing Task compared to the Mind-Reading Task. A second study replicated these findings. Participants' experience of the ostensible influence varied, with some reporting an unknown source directing them towards specific numbers. This simulated thought insertion paradigm can therefore influence feelings of voluntary control and may help model symptoms of mental disorders. Copyright © 2016 Elsevier Inc. All rights reserved.
Katalinic, Andrej; Trinajstic Zrinski, Magda; Roksandic Vrancic, Zlatka; Spalj, Stjepan
2017-02-01
The study focused on the influence of screwdriver design in combination with and without predrilling a pilot hole of inner implant diameter on insertion torque of orthodontic mini-implants, controlling for cortical thickness and vertical insertion force as cofactors. One hundred twenty mini-implants (Forestadent) of 1.7 mm in diameter and 6 and 8 mm in length were manually inserted into 120 swine rib bone samples. Maximal insertion torque as a measure of primary stability and vertical force were measured. The study included procedures with and without pilot hole and different screwdriver handles and shaft length and 2 implant lengths. Design of manual screwdriver does not modify insertion torque to a significant extent. In multiple linear regression model, significant predictors of insertion torque are thicker cortical bone (explaining 16.6% of variability), higher vertical force at maximal torque (13.5%), 6-mm implant length (2.5%), and the presence of pilot hole (2.3%). Handle type and shaft length of manual screwdriver do not significantly influence insertion torque, whereas predrilling a pilot hole has low impact on torque values of manually inserted self-drilling orthodontic mini-implants.
Evaluation of the hybrid-L24 electrode using microcomputed tomography.
Driscoll, Colin L W; Carlson, Matthew L; Fama, Anthony F; Lane, John I
2011-07-01
To compare electrode array position, and depth of insertion of the Cochlear Hybrid-L24 electrode array following traditional cochleostomy and round window (RW) insertion. Prospective cadaveric temporal bone study. Ten cadaveric temporal bones were implanted with the Hybrid-L24 electrode array; half were introduced through a RW approach, whereas the other half were inserted through a traditional scala tympani cochleostomy. A micro-CT scanner was then used to evaluate electrode position, intracochlear trauma, and depth of insertion. All electrodes were inserted into the scala tympani without significant resistance. No electrodes demonstrated tip fold-over or through-fracturing of the osseous spiral lamina, basilar membrane, or spiral ligament. The average angular depth of insertion for all 10 electrodes was 252.4°. Compared to cochleostomy insertions, electrodes inserted through the RW more commonly acquired a proximal perimodiolar orientation, followed a more predictable course, and less commonly contacted critical soft tissue structures. The results of this study demonstrate that the Hybrid-L24 electrode can be successfully inserted using a RW or traditional cochleostomy technique with minimal intracochlear trauma. Our data also suggests that with this model, RW insertions may provide particular advantages with respect to hearing preservation over the traditional cochleostomy approach. Copyright © 2011 The American Laryngological, Rhinological, and Otological Society, Inc.
Identifying transposon insertions and their effects from RNA-sequencing data.
de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos
2017-07-07
Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Osvaldo and Isis retrotransposons as markers of the Drosophila buzzatii colonisation in Australia.
Guerreiro, María Pilar García; Fontdevila, Antonio
2011-04-24
Transposable elements (TEs) constitute an important source of genetic variability owing to their jumping and regulatory properties, and are considered to drive species evolution. Several factors that are able to induce TE transposition in genomes have been documented (for example environmental stress and inter- and intra-specific crosses) but in many instances the reasons for TE mobilisation have yet to be elucidated. Colonising populations constitute an ideal model for studying TE behaviour and distribution as they are exposed to different environmental and new demographic conditions. In this study, the distribution of two TEs, Osvaldo and Isis, was examined in two colonising populations of D. buzzatii from Australia. Comparing Osvaldo copy numbers between Australian and Old World (reported in previous studies) colonisations provides a valuable tool for elucidating the colonisation process and the effect of new conditions encountered by colonisers on TEs. The chromosomal distributions of Osvaldo and Isis retrotransposons in two colonising populations of D. buzzatii from Australia revealed sites of high insertion frequency (>10%) and low frequency sites. Comparisons between Osvaldo insertion profiles in colonising populations from the Old World and Australia demonstrate a tendency towards a higher number of highly occupied sites with higher insertion frequency in the Old World than in Australian populations. Tests concerning selection against deleterious TE insertions indicate that Isis is more controlled by purifying selection than Osvaldo. The distribution of both elements on chromosomal arms follows a Poisson distribution and there are non-significant positive correlations between highly occupied sites and chromosomal inversions. The occupancy profile of Osvaldo and Isis retrotransposons is characterised by the existence of high and low insertion frequency sites in the populations. These results demonstrate that Australian D. buzzatii populations were subjected to a founder effect during the colonisation process. Moreover, there are more sites with high insertion frequency in the Old World colonisation than in the Australian colonisation, indicating a probable stronger bottleneck effect in Australia. The results suggest that selection does not seem to play a major role, compared to demography, in the distribution of transposable elements in the Australian populations.
Osvaldo and Isis retrotransposons as markers of the Drosophila buzzatii colonisation in Australia
2011-01-01
Background Transposable elements (TEs) constitute an important source of genetic variability owing to their jumping and regulatory properties, and are considered to drive species evolution. Several factors that are able to induce TE transposition in genomes have been documented (for example environmental stress and inter- and intra-specific crosses) but in many instances the reasons for TE mobilisation have yet to be elucidated. Colonising populations constitute an ideal model for studying TE behaviour and distribution as they are exposed to different environmental and new demographic conditions. In this study, the distribution of two TEs, Osvaldo and Isis, was examined in two colonising populations of D. buzzatii from Australia. Comparing Osvaldo copy numbers between Australian and Old World (reported in previous studies) colonisations provides a valuable tool for elucidating the colonisation process and the effect of new conditions encountered by colonisers on TEs. Results The chromosomal distributions of Osvaldo and Isis retrotransposons in two colonising populations of D. buzzatii from Australia revealed sites of high insertion frequency (>10%) and low frequency sites. Comparisons between Osvaldo insertion profiles in colonising populations from the Old World and Australia demonstrate a tendency towards a higher number of highly occupied sites with higher insertion frequency in the Old World than in Australian populations. Tests concerning selection against deleterious TE insertions indicate that Isis is more controlled by purifying selection than Osvaldo. The distribution of both elements on chromosomal arms follows a Poisson distribution and there are non-significant positive correlations between highly occupied sites and chromosomal inversions. Conclusions The occupancy profile of Osvaldo and Isis retrotransposons is characterised by the existence of high and low insertion frequency sites in the populations. These results demonstrate that Australian D. buzzatii populations were subjected to a founder effect during the colonisation process. Moreover, there are more sites with high insertion frequency in the Old World colonisation than in the Australian colonisation, indicating a probable stronger bottleneck effect in Australia. The results suggest that selection does not seem to play a major role, compared to demography, in the distribution of transposable elements in the Australian populations. PMID:21513573