A Phex Mutation in a Murine Model of X-linked Hypophosphatemia Alters Phosphate Responsiveness of Bone Cells

PubMed Central

Ichikawa, Shoji; Austin, Anthony M.; Gray, Amie K.; Econs, Michael J.

2011-01-01

Mutations in the PHEX gene cause X-linked hypophosphatemia (XLH). Hypophosphatemia in XLH results from increased circulating levels of a phosphaturic hormone, fibroblast growth factor 23 (FGF23), which inhibits renal phosphate reabsorption and 1,25-dihydroxyvitamin D (calcitriol) synthesis. The current standard therapy for XLH – high dose phosphate and calcitriol – further increases FGF23 concentrations, suggesting that patients with XLH may have an altered response to extracellular phosphate. To test for the presence of abnormal phosphate responsiveness, we compared serum biochemistries and femoral Fgf23 mRNA expression between wild-type mice, murine models of XLH (PhexK496X) and hyperphosphatemic tumoral calcinosis (Galnt3 -/-), and Galnt3/Phex double mutant mice. Phex mutant mice had not only increased Fgf23 expression, but also reduced proteolytic cleavage of intact Fgf23 protein, resulting in markedly elevated intact Fgf23 levels and consequent hypophosphatemia. In contrast, despite markedly increased Fgf23 expression, Galnt3 knockout mice had significantly high proteolytic cleavage of Fgf23 protein, leading to low intact Fgf23 concentrations and hyperphosphatemia. Galnt3/Phex double mutant mice had an intermediate biochemical phenotype between wild-type and Phex mutant mice, including slightly elevated intact Fgf23 concentrations with milder hypophosphatemia. Despite the hypophosphatemia, double mutant mice attempted to reduce serum phosphate back to the level of Phex mutant mice by up-regulating Fgf23 expression as much as 24 fold higher than Phex mutant mice. These data suggest that Phex mutations alter the responsiveness of bone cells to extracellular phosphate concentrations and may create a lower set point for “normal” phosphate levels. PMID:22006791

A Phex mutation in a murine model of X-linked hypophosphatemia alters phosphate responsiveness of bone cells.

PubMed

Ichikawa, Shoji; Austin, Anthony M; Gray, Amie K; Econs, Michael J

2012-02-01

Mutations in the PHEX gene cause X-linked hypophosphatemia (XLH). Hypophosphatemia in XLH results from increased circulating levels of a phosphaturic hormone, fibroblast growth factor 23 (FGF23), which inhibits renal phosphate reabsorption and 1,25-dihydroxyvitamin D (calcitriol) synthesis. The current standard therapy for XLH--high-dose phosphate and calcitriol--further increases FGF23 concentrations, suggesting that patients with XLH may have an altered response to extracellular phosphate. To test for the presence of abnormal phosphate responsiveness, we compared serum biochemistries and femoral Fgf23 mRNA expression between wild-type mice, murine models of XLH (Phex(K496X)) and hyperphosphatemic tumoral calcinosis (Galnt3(-/-)), and Galnt3/Phex double-mutant mice. Phex mutant mice had not only increased Fgf23 expression but also reduced proteolytic cleavage of intact Fgf23 protein, resulting in markedly elevated intact Fgf23 levels and consequent hypophosphatemia. In contrast, despite markedly increased Fgf23 expression, Galnt3 knockout mice had significantly high proteolytic cleavage of Fgf23 protein, leading to low intact Fgf23 concentrations and hyperphosphatemia. Galnt3/Phex double-mutant mice had an intermediate biochemical phenotype between wild-type and Phex mutant mice, including slightly elevated intact Fgf23 concentrations with milder hypophosphatemia. Despite the hypophosphatemia, double-mutant mice attempted to reduce serum phosphate back to the level of Phex mutant mice by upregulating Fgf23 expression as much as 24-fold higher than Phex mutant mice. These data suggest that Phex mutations alter the responsiveness of bone cells to extracellular phosphate concentrations and may create a lower set point for "normal" phosphate levels.

Mechanism for generation of left isomerism in Ccdc40 mutant embryos

PubMed Central

Sugrue, Kelsey F.

2017-01-01

Leftward fluid flow in the mouse node is generated by cilia and is critical for initiating asymmetry of the left-right axis. Coiled-coil domain containing-40 (Ccdc40) plays an evolutionarily conserved role in the assembly of motile cilia and establishment of the left-right axis. Approximately one-third of Ccdc40lnks mutant embryos display situs defects and here we investigate the underlying mechanism. Ccdc40lnks mutants show delayed induction of markers of the left-lateral plate mesoderm (L-LPM) including Lefty1, Lefty2 and Nodal. Consistent with defective cilia motility compromising fluid flow across the node, initiation of asymmetric perinodal Cerberus like-2 (Cerl2) expression is delayed and then randomized. This is followed by delayed and then randomized asymmetric Nodal expression around the node. We propose a model to explain how left isomerism arises in a proportion of Ccdc40lnks mutants. We postulate that with defective motile cilia, Cerl2 expression remains symmetric and Nodal is antagonized equally on both sides of the node. This effectively reduces Nodal activation bilaterally, leading to reduced and delayed activation of Nodal and its antagonists in the LPM. This model is further supported by the failure to establish Nodal expression in the left-LPM with reduced Nodal gene dosage in Ccdc40lnks/lnks;NodalLacZ/+ mutants causing a predominance of right not left isomerism. Together these results suggest a model where cilia generated fluid flow in the node functions to ensure robust Nodal activation and a timely left-sided developmental program in the LPM. PMID:28182636

ATF3 plays a protective role against toxicity by N-terminal fragment of mutant huntingtin in stable PC12 cell line

PubMed Central

Liang, Yideng; Jiang, Haibing; Ratovitski, Tamara; Jie, Chunfa; Nakamura, Masayuki; Hirschhorn, Ricky R.; Wang, Xiaofang; Smith, Wanli W.; Hai, Tsonwin; Poirier, Michelle A.; Ross, Christopher A.

2009-01-01

Huntington's disease is a progressive neurodegenerative disorder caused by a polyglutamine expansion near the N-terminus of huntingtin. The mechanisms of polyglutamine neurotoxicity, and cellular responses are not fully understood. We have studied gene expression profiles by cDNA array using an inducible PC12 cell model expressing an N-terminal huntingtin fragment with expanded polyglutamine (Htt-N63-148Q). Mutant huntingtin Htt-N63 induced cell death and increased the mRNA and protein levels of activating transcription factor 3 (ATF3). Mutant Htt-N63 also significantly enhanced ATF3 transcriptional activity by a promoter-based reporter assay. Overexpression of ATF3 protects against mutant Htt-N63 toxicity and knocking down ATF3 expression reduced Htt-N63 toxicity in a stable PC12 cell line. These results indicated that ATF3 plays a critical role in toxicity induced by mutant Htt-N63 and may lead to a useful therapeutic target. PMID:19559011

Expression of Mutant Human DISC1 in Mice Supports Abnormalities in Differentiation of Oligodendrocytes

PubMed Central

Katsel, Pavel; Tan, Weilun; Abazyan, Bagrat; Davis, Kenneth L; Ross, Christopher; Pletnikov, Mikhail V; Haroutunian, Vahram

2011-01-01

Abnormalities in oligodendrocyte (OLG) differentiation and OLG gene expression deficit have been described in schizophrenia (SZ). Recent studies revealed a critical requirement for Disrupted-in-Schizophrenia 1 (DISC1) in neural development. Transgenic mice with forebrain restricted expression of mutant human DISC1 (ΔhDISC1) are characterized by neuroanatomical and behavioral abnormalities reminiscent of some features of SZ. We sought to determine whether the expression of ΔhDISC1 may influence the development of OLGs in this mouse model. OLG- and cell cycle-associated gene and protein expression were characterized in the forebrain of ΔhDISC1 mice during different stages of neurodevelopment (E15 and P1 days) and in adulthood. The results suggest that the expression of ΔhDISC1 exerts a significant influence on oligodendrocyte differentiation and function, evidenced by premature OLG differentiation and increased proliferation of their progenitors. Additional findings showed that neuregulin 1 and its receptors may be contributing factors to the observed upregulation of OLG genes. Thus, OLG function may be perturbed by mutant hDISC1 in a model system that provides new avenues for studying aspects of the pathogenesis of SZ. PMID:21605958

Establishment and characterization of Roberts syndrome and SC phocomelia model medaka (Oryzias latipes).

PubMed

Morita, Akihiro; Nakahira, Kumiko; Hasegawa, Taeko; Uchida, Kaoru; Taniguchi, Yoshihito; Takeda, Shunichi; Toyoda, Atsushi; Sakaki, Yoshiyuki; Shimada, Atsuko; Takeda, Hiroyuki; Yanagihara, Itaru

2012-06-01

Roberts syndrome and SC phocomelia (RBS/SC) are genetic autosomal recessive syndromes caused by establishment of cohesion 1 homolog 2 ( ESCO 2) mutation. RBS/SC appear to have a variety of clinical features, even with the same mutation of the ESCO2 gene. Here, we established and genetically characterized a medaka model of RBS/SC by reverse genetics. The RBS/SC model was screened from a mutant medaka library produced by the Targeting Induced Local Lesions in Genomes method. The medaka mutant carrying the homozygous mutation at R80S in the conserved region of ESCO2 exhibited clinical variety (i.e. developmental arrest with craniofacial and chromosomal abnormalities and embryonic lethality) as characterized in RBS/SC. Moreover, widespread apoptosis and downregulation of some gene expression, including notch1a, were detected in the R80S mutant. The R80S mutant is the animal model for RBS/SC and a valuable resource that provides the opportunity to extend knowledge of ESCO2. Downregulation of some gene expression in the R80S mutant is an important clue explaining non-correlation between genotype and phenotype in RBS/SC. © 2012 The Authors Development, Growth & Differentiation © 2012 Japanese Society of Developmental Biologists.

Efficacy of BET bromodomain inhibition in Kras-mutant non-small cell lung cancer

PubMed Central

Shimamura, Takeshi; Chen, Zhao; Soucheray, Margaret; Carretero, Julian; Kikuchi, Eiki; Tchaicha, Jeremy H.; Gao, Yandi; Cheng, Katherine A.; Cohoon, Travis J.; Qi, Jun; Akbay, Esra; Kimmelman, Alec C.; Kung, Andrew L.; Bradner, James E.; Wong, Kwok-Kin

2013-01-01

Purpose Amplification of MYC is one of the most common genetic alterations in lung cancer, contributing to a myriad of phenotypes associated with growth, invasion and drug resistance. Murine genetics has established both the centrality of somatic alterations of Kras in lung cancer, as well as the dependency of mutant Kras tumors on MYC function. Unfortunately, drug-like small-molecule inhibitors of KRAS and MYC have yet to be realized. The recent discovery, in hematologic malignancies, that BET bromodomain inhibition impairs MYC expression and MYC transcriptional function established the rationale of targeting KRAS-driven NSCLC with BET inhibition. Experimental Design We performed functional assays to evaluate the effects of JQ1 in genetically defined NSCLC cells lines harboring KRAS and/or LKB1 mutations. Furthermore, we evaluated JQ1 in transgenic mouse lung cancer models expressing mutant kras or concurrent mutant kras and lkb1. Effects of bromodomain inhibition on transcriptional pathways were explored and validated by expression analysis. Results While JQ1 is broadly active in NSCLC cells, activity of JQ1 in mutant KRAS NSCLC is abrogated by concurrent alteration or genetic knock-down of LKB1. In sensitive NSCLC models, JQ1 treatment results in the coordinate downregulation of the MYC-dependent transcriptional program. We found that JQ1 treatment produces significant tumor regression in mutant kras mice. As predicted, tumors from mutant kras and lkb1 mice did not respond to JQ1. Conclusion Bromodomain inhibition comprises a promising therapeutic strategy for KRAS mutant NSCLC with wild-type LKB1, via inhibition of MYC function. Clinical studies of BET bromodomain inhibitors in aggressive NSCLC will be actively pursued. PMID:24045185

Elastase inhibitors as potential therapies for ELANE-associated neutropenia.

PubMed

Makaryan, Vahagn; Kelley, Merideth L; Fletcher, Breanna; Bolyard, Audrey Anna; Aprikyan, A Andrew; Dale, David C

2017-10-01

Mutations in ELANE , the gene for neutrophil elastase (NE), a protease expressed early in neutrophil development, are the most frequent cause of cyclic (CyN) and severe congenital neutropenia (SCN). We hypothesized that inhibitors of NE, acting either by directly inhibiting enzymatic activity or as chaperones for the mutant protein, might be effective as therapy for CyN and SCN. We investigated β-lactam-based inhibitors of human NE (Merck Research Laboratories, Kenilworth, NJ, USA), focusing on 1 inhibitor called MK0339, a potent, orally absorbed agent that had been tested in clinical trials and shown to have a favorable safety profile. Because fresh, primary bone marrow cells are rarely available in sufficient quantities for research studies, we used 3 cellular models: patient-derived, induced pluripotent stem cells (iPSCs); HL60 cells transiently expressing mutant NE; and HL60 cells with regulated expression of the mutant enzyme. In all 3 models, the cells expressing the mutant enzyme had reduced survival as measured with annexin V and FACS. Coincubation with the inhibitors, particularly MK0339, promoted cell survival and increased formation of mature neutrophils. These studies suggest that cell-permeable inhibitors of neutrophil elastase show promise as novel therapies for ELANE -associated neutropenia. © Society for Leukocyte Biology.

Inhibition of Excessive Monoamine Oxidase A/B Activity Protects Against Stress-induced Neuronal Death in Huntington Disease.

PubMed

Ooi, Jolene; Hayden, Michael R; Pouladi, Mahmoud A

2015-12-01

Monoamine oxidases (MAO) are important components of the homeostatic machinery that maintains the levels of monoamine neurotransmitters, including dopamine, in balance. Given the imbalance in dopamine levels observed in Huntington disease (HD), the aim of this study was to examine MAO activity in a mouse striatal cell model of HD and in human neural cells differentiated from control and HD patient-derived induced pluripotent stem cell (hiPSC) lines. We show that mouse striatal neural cells expressing mutant huntingtin (HTT) exhibit increased MAO expression and activity. We demonstrate using luciferase promoter assays that the increased MAO expression reflects enhanced epigenetic activation in striatal neural cells expressing mutant HTT. Using cellular stress paradigms, we further demonstrate that the increase in MAO activity in mutant striatal neural cells is accompanied by enhanced susceptibility to oxidative stress and impaired viability. Treatment of mutant striatal neural cells with MAO inhibitors ameliorated oxidative stress and improved cellular viability. Finally, we demonstrate that human HD neural cells exhibit increased MAO-A and MAO-B expression and activity. Altogether, this study demonstrates abnormal MAO expression and activity and suggests a potential use for MAO inhibitors in HD.

Heart-specific expression of laminopathic mutations in transgenic zebrafish.

PubMed

Verma, Ajay D; Parnaik, Veena K

2017-07-01

Lamins are key determinants of nuclear organization and function in the metazoan nucleus. Mutations in human lamin A cause a spectrum of genetic diseases that affect cardiac muscle and skeletal muscle as well as other tissues. A few laminopathies have been modeled using the mouse. As zebrafish is a well established model for the study of cardiac development and disease, we have investigated the effects of heart-specific lamin A mutations in transgenic zebrafish. We have developed transgenic lines of zebrafish expressing conserved lamin A mutations that cause cardiac dysfunction in humans. Expression of zlamin A mutations Q291P and M368K in the heart was driven by the zebrafish cardiac troponin T2 promoter. Homozygous mutant embryos displayed nuclear abnormalities in cardiomyocyte nuclei. Expression analysis showed the upregulation of genes involved in heart regeneration in transgenic mutant embryos and a cell proliferation marker was increased in adult heart tissue. At the physiological level, there was deviation of up to 20% from normal heart rate in transgenic embryos expressing mutant lamins. Adult homozygous zebrafish were fertile and did not show signs of early mortality. Our results suggest that transgenic zebrafish models of heart-specific laminopathies show cardiac regeneration and moderate deviations in heart rate during embryonic development. © 2017 International Federation for Cell Biology.

The MCK mouse heart model of Friedreich's ataxia: Alterations in iron-regulated proteins and cardiac hypertrophy are limited by iron chelation

PubMed Central

Whitnall, Megan; Rahmanto, Yohan Suryo; Sutak, Robert; Xu, Xiangcong; Becker, Erika M.; Mikhael, Marc R.; Ponka, Prem; Richardson, Des R.

2008-01-01

There is no effective treatment for the cardiomyopathy of the most common autosomal recessive ataxia, Friedreich's ataxia (FA). The identification of potentially toxic mitochondrial (MIT) iron (Fe) deposits in FA suggests that Fe plays a role in its pathogenesis. This study used the muscle creatine kinase conditional frataxin (Fxn) knockout (mutant) mouse model that reproduces the classical traits associated with cardiomyopathy in FA. We examined the mechanisms responsible for the increased cardiac MIT Fe loading in mutants. Moreover, we explored the effect of Fe chelation on the pathogenesis of the cardiomyopathy. Our investigation showed that increased MIT Fe in the myocardium of mutants was due to marked transferrin Fe uptake, which was the result of enhanced transferrin receptor 1 expression. In contrast to the mitochondrion, cytosolic ferritin expression and the proportion of cytosolic Fe were decreased in mutant mice, indicating cytosolic Fe deprivation and markedly increased MIT Fe targeting. These studies demonstrated that loss of Fxn alters cardiac Fe metabolism due to pronounced changes in Fe trafficking away from the cytosol to the mitochondrion. Further work showed that combining the MIT-permeable ligand pyridoxal isonicotinoyl hydrazone with the hydrophilic chelator desferrioxamine prevented cardiac Fe loading and limited cardiac hypertrophy in mutants but did not lead to overt cardiac Fe depletion or toxicity. Fe chelation did not prevent decreased succinate dehydrogenase expression in the mutants or loss of cardiac function. In summary, we show that loss of Fxn markedly alters cellular Fe trafficking and that Fe chelation limits myocardial hypertrophy in the mutant. PMID:18621680

Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

PubMed Central

Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

2015-01-01

Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

Identification of dietary alanine toxicity and trafficking dysfunction in a Drosophila model of hereditary sensory and autonomic neuropathy type 1

PubMed Central

Oswald, Matthew C. W.; West, Ryan J. H.; Lloyd-Evans, Emyr; Sweeney, Sean T.

2015-01-01

Hereditary sensory and autonomic neuropathy type 1 (HSAN1) is characterized by a loss of distal peripheral sensory and motorneuronal function, neuropathic pain and tissue necrosis. The most common cause of HSAN1 is due to dominant mutations in serine palmitoyl-transferase subunit 1 (SPT1). SPT catalyses the condensation of serine with palmitoyl-CoA, the initial step in sphingolipid biogenesis. Identified mutations in SPT1 are known to both reduce sphingolipid synthesis and generate catalytic promiscuity, incorporating alanine or glycine into the precursor sphingolipid to generate a deoxysphingoid base (DSB). Why either loss of function in SPT1, or generation of DSBs should generate deficits in distal sensory function remains unclear. To address these questions, we generated a Drosophila model of HSAN1. Expression of dSpt1 bearing a disease-related mutation induced morphological deficits in synapse growth at the larval neuromuscular junction consistent with a dominant-negative action. Expression of mutant dSpt1 globally was found to be mildly toxic, but was completely toxic when the diet was supplemented with alanine, when DSBs were observed in abundance. Expression of mutant dSpt1 in sensory neurons generated developmental deficits in dendritic arborization with concomitant sensory deficits. A membrane trafficking defect was observed in soma of sensory neurons expressing mutant dSpt1, consistent with endoplasmic reticulum (ER) to Golgi block. We found that we could rescue sensory function in neurons expressing mutant dSpt1 by co-expressing an effector of ER–Golgi function, Rab1 suggesting compromised ER function in HSAN1 affected dendritic neurons. Our Drosophila model identifies a novel strategy to explore the pathological mechanisms of HSAN1. PMID:26395456

Essential roles for Cdx in murine primitive hematopoiesis.

PubMed

Brooke-Bisschop, Travis; Savory, Joanne G A; Foley, Tanya; Ringuette, Randy; Lohnes, David

2017-02-15

The Cdx transcription factors play essential roles in primitive hematopoiesis in the zebrafish where they exert their effects, in part, through regulation of hox genes. Defects in hematopoiesis have also been reported in Cdx mutant murine embryonic stem cell models, however, to date no mouse model reflecting the zebrafish Cdx mutant hematopoietic phenotype has been described. This is likely due, in part, to functional redundancy among Cdx members and the early lethality of Cdx2 null mutants. To circumvent these limitations, we used Cre-mediated conditional deletion to assess the impact of concomitant loss of Cdx1 and Cdx2 on murine primitive hematopoiesis. We found that Cdx1/Cdx2 double mutants exhibited defects in primitive hematopoiesis and yolk sac vasculature concomitant with reduced expression of several genes encoding hematopoietic transcription factors including Scl/Tal1. Chromatin immunoprecipitation analysis revealed that Scl was occupied by Cdx2 in vivo, and Cdx mutant hematopoietic yolk sac differentiation defects could be rescued by expression of exogenous Scl. These findings demonstrate critical roles for Cdx members in murine primitive hematopoiesis upstream of Scl. Copyright © 2017 Elsevier Inc. All rights reserved.

A Simulation Study of Mutations in the Genetic Regulatory Hierarchy for Butterfly Eyespot Focus Determination

PubMed Central

Marcus, Jeffrey M.; Evans, Travis M.

2008-01-01

The color patterns on the wings of butterflies have been an important model system in evolutionary developmental biology. A recent computational model tested genetic regulatory hierarchies hypothesized to underlie the formation of butterfly eyespot foci (Evans and Marcus, 2006). The computational model demonstrated that one proposed hierarchy was incapable of reproducing the known patterns of gene expression associated with eyespot focus determination in wild-type butterflies, but that two slightly modified alternative hierarchies were capable of reproducing all of the known gene expressions patterns. Here we extend the computational models previously implemented in Delphi 2.0 to two mutants derived from the squinting bush brown butterfly (Bicyclus anynana). These two mutants, comet and Cyclops, have aberrantly shaped eyespot foci that are produced by different mechanisms. The comet mutation appears to produce a modified interaction between the wing margin and the eyespot focus that results in a series of comet-shaped eyespot foci. The Cyclops mutation causes the failure of wing vein formation between two adjacent wing-cells and the fusion of two adjacent eyespot foci to form a single large elongated focus in their place. The computational approach to modeling pattern formation in these mutants allows us to make predictions about patterns of gene expression, which are largely unstudied in butterfly mutants. It also suggests a critical experiment that will allow us to distinguish between two hypothesized genetic regulatory hierarchies that may underlie all butterfly eyespot foci. PMID:18586070

Theoretical Analysis of Allosteric and Operator Binding for Cyclic-AMP Receptor Protein Mutants

NASA Astrophysics Data System (ADS)

Einav, Tal; Duque, Julia; Phillips, Rob

2018-02-01

Allosteric transcription factors undergo binding events both at their inducer binding sites as well as at distinct DNA binding domains, and it is often difficult to disentangle the structural and functional consequences of these two classes of interactions. In this work, we compare the ability of two statistical mechanical models - the Monod-Wyman-Changeux (MWC) and the Koshland-N\\'emethy-Filmer (KNF) models of protein conformational change - to characterize the multi-step activation mechanism of the broadly acting cyclic-AMP receptor protein (CRP). We first consider the allosteric transition resulting from cyclic-AMP binding to CRP, then analyze how CRP binds to its operator, and finally investigate the ability of CRP to activate gene expression. In light of these models, we examine data from a beautiful recent experiment that created a single-chain version of the CRP homodimer, thereby enabling each subunit to be mutated separately. Using this construct, six mutants were created using all possible combinations of the wild type subunit, a D53H mutant subunit, and an S62F mutant subunit. We demonstrate that both the MWC and KNF models can explain the behavior of all six mutants using a small, self-consistent set of parameters. In comparing the results, we find that the MWC model slightly outperforms the KNF model in the quality of its fits, but more importantly the parameters inferred by the MWC model are more in line with structural knowledge of CRP. In addition, we discuss how the conceptual framework developed here for CRP enables us to not merely analyze data retrospectively, but has the predictive power to determine how combinations of mutations will interact, how double mutants will behave, and how each construct would regulate gene expression.

Comprehensive Gene Expression Analysis of Rice Aleurone Cells: Probing the Existence of an Alternative Gibberellin Receptor1

PubMed Central

Yano, Kenji; Aya, Koichiro; Hirano, Ko; Ordonio, Reynante Lacsamana; Ueguchi-Tanaka, Miyako; Matsuoka, Makoto

2015-01-01

Current gibberellin (GA) research indicates that GA must be perceived in plant nuclei by its cognate receptor, GIBBERELLIN INSENSITIVE DWARF1 (GID1). Recognition of GA by GID1 relieves the repression mediated by the DELLA protein, a model known as the GID1-DELLA GA perception system. There have been reports of potential GA-binding proteins in the plasma membrane that perceive GA and induce α-amylase expression in cereal aleurone cells, which is mechanistically different from the GID1-DELLA system. Therefore, we examined the expression of the rice (Oryza sativa) α-amylase genes in rice mutants impaired in the GA receptor (gid1) and the DELLA repressor (slender rice1; slr1) and confirmed their lack of response to GA in gid1 mutants and constitutive expression in slr1 mutants. We also examined the expression of GA-regulated genes by genome-wide microarray and quantitative reverse transcription-polymerase chain reaction analyses and confirmed that all GA-regulated genes are modulated by the GID1-DELLA system. Furthermore, we studied the regulatory network involved in GA signaling by using a set of mutants defective in genes involved in GA perception and gene expression, namely gid1, slr1, gid2 (a GA-related F-box protein mutant), and gamyb (a GA-related trans-acting factor mutant). Almost all GA up-regulated genes were regulated by the four named GA-signaling components. On the other hand, GA down-regulated genes showed different expression patterns with respect to GID2 and GAMYB (e.g. a considerable number of genes are not controlled by GAMYB or GID2 and GAMYB). Based on these observations, we present a comprehensive discussion of the intricate network of GA-regulated genes in rice aleurone cells. PMID:25511432

The Zebrafish Model Organism Database: new support for human disease models, mutation details, gene expression phenotypes and searching

PubMed Central

Howe, Douglas G.; Bradford, Yvonne M.; Eagle, Anne; Fashena, David; Frazer, Ken; Kalita, Patrick; Mani, Prita; Martin, Ryan; Moxon, Sierra Taylor; Paddock, Holly; Pich, Christian; Ramachandran, Sridhar; Ruzicka, Leyla; Schaper, Kevin; Shao, Xiang; Singer, Amy; Toro, Sabrina; Van Slyke, Ceri; Westerfield, Monte

2017-01-01

The Zebrafish Model Organism Database (ZFIN; http://zfin.org) is the central resource for zebrafish (Danio rerio) genetic, genomic, phenotypic and developmental data. ZFIN curators provide expert manual curation and integration of comprehensive data involving zebrafish genes, mutants, transgenic constructs and lines, phenotypes, genotypes, gene expressions, morpholinos, TALENs, CRISPRs, antibodies, anatomical structures, models of human disease and publications. We integrate curated, directly submitted, and collaboratively generated data, making these available to zebrafish research community. Among the vertebrate model organisms, zebrafish are superbly suited for rapid generation of sequence-targeted mutant lines, characterization of phenotypes including gene expression patterns, and generation of human disease models. The recent rapid adoption of zebrafish as human disease models is making management of these data particularly important to both the research and clinical communities. Here, we describe recent enhancements to ZFIN including use of the zebrafish experimental conditions ontology, ‘Fish’ records in the ZFIN database, support for gene expression phenotypes, models of human disease, mutation details at the DNA, RNA and protein levels, and updates to the ZFIN single box search. PMID:27899582

Probing the changes in gene expression due to α-crystallin mutations in mouse models of hereditary human cataract.

PubMed

Andley, Usha P; Tycksen, Eric; McGlasson-Naumann, Brittney N; Hamilton, Paul D

2018-01-01

The mammalian eye lens expresses a high concentration of crystallins (α, β and γ-crystallins) to maintain the refractive index essential for lens transparency. Crystallins are long-lived proteins that do not turnover throughout life. The structural destabilization of crystallins by UV exposure, glycation, oxidative stress and mutations in crystallin genes leads to protein aggregation and development of cataracts. Several destabilizing mutations in crystallin genes are linked with human autosomal dominant hereditary cataracts. To investigate the mechanism by which the α-crystallin mutations Cryaa-R49C and Cryab-R120G lead to cataract formation, we determined whether these mutations cause an altered expression of specific transcripts in the lens at an early postnatal age by RNA-seq analysis. Using knock-in mouse models previously generated in our laboratory, in the present work, we identified genes that exhibited altered abundance in the mutant lenses, including decreased transcripts for Clic5, an intracellular water channel in Cryaa-R49C heterozygous mutant lenses, and increased transcripts for Eno1b in Cryab-R120G heterozygous mutant lenses. In addition, RNA-seq analysis revealed increased histones H2B, H2A, and H4 gene expression in Cryaa-R49C mutant lenses, suggesting that the αA-crystallin mutation regulates histone expression via a transcriptional mechanism. Additionally, these studies confirmed the increased expression of histones H2B, H2A, and H4 by proteomic analysis of Cryaa-R49C knock-in and Cryaa;Cryab gene knockout lenses reported previously. Taken together, these findings offer additional insight into the early transcriptional changes caused by Cryaa and Cryab mutations associated with autosomal dominant human cataracts, and indicate that the transcript levels of certain genes are affected by the expression of mutant α-crystallin in vivo.

Mutant p53-associated myosin-X upregulation promotes breast cancer invasion and metastasis.

PubMed

Arjonen, Antti; Kaukonen, Riina; Mattila, Elina; Rouhi, Pegah; Högnäs, Gunilla; Sihto, Harri; Miller, Bryan W; Morton, Jennifer P; Bucher, Elmar; Taimen, Pekka; Virtakoivu, Reetta; Cao, Yihai; Sansom, Owen J; Joensuu, Heikki; Ivaska, Johanna

2014-03-01

Mutations of the tumor suppressor TP53 are present in many forms of human cancer and are associated with increased tumor cell invasion and metastasis. Several mechanisms have been identified for promoting dissemination of cancer cells with TP53 mutations, including increased targeting of integrins to the plasma membrane. Here, we demonstrate a role for the filopodia-inducing motor protein Myosin-X (Myo10) in mutant p53-driven cancer invasion. Analysis of gene expression profiles from 2 breast cancer data sets revealed that MYO10 was highly expressed in aggressive cancer subtypes. Myo10 was required for breast cancer cell invasion and dissemination in multiple cancer cell lines and murine models of cancer metastasis. Evaluation of a Myo10 mutant without the integrin-binding domain revealed that the ability of Myo10 to transport β₁ integrins to the filopodia tip is required for invasion. Introduction of mutant p53 promoted Myo10 expression in cancer cells and pancreatic ductal adenocarcinoma in mice, whereas suppression of endogenous mutant p53 attenuated Myo10 levels and cell invasion. In clinical breast carcinomas, Myo10 was predominantly expressed at the invasive edges and correlated with the presence of TP53 mutations and poor prognosis. These data indicate that Myo10 upregulation in mutant p53-driven cancers is necessary for invasion and that plasma-membrane protrusions, such as filopodia, may serve as specialized metastatic engines.

A zebrafish model for Waardenburg syndrome type IV reveals diverse roles for Sox10 in the otic vesicle.

PubMed

Dutton, Kirsten; Abbas, Leila; Spencer, Joanne; Brannon, Claire; Mowbray, Catriona; Nikaido, Masataka; Kelsh, Robert N; Whitfield, Tanya T

2009-01-01

In humans, mutations in the SOX10 gene are a cause of the auditory-pigmentary disorder Waardenburg syndrome type IV (WS4) and related variants. SOX10 encodes an Sry-related HMG box protein essential for the development of the neural crest; deafness in WS4 and other Waardenburg syndromes is usually attributed to loss of neural-crest-derived melanocytes in the stria vascularis of the cochlea. However, SOX10 is strongly expressed in the developing otic vesicle and so direct roles for SOX10 in the otic epithelium might also be important. Here, we examine the otic phenotype of zebrafish sox10 mutants, a model for WS4. As a cochlea is not present in the fish ear, the severe otic phenotype in these mutants cannot be attributed to effects on this tissue. In zebrafish sox10 mutants, we see abnormalities in all otic placodal derivatives. Gene expression studies indicate deregulated expression of several otic genes, including fgf8, in sox10 mutants. Using a combination of mutant and morphant data, we show that the three sox genes belonging to group E (sox9a, sox9b and sox10) provide a link between otic induction pathways and subsequent otic patterning: they act redundantly to maintain sox10 expression throughout otic tissue and to restrict fgf8 expression to anterior macula regions. Single-cell labelling experiments indicate a small and transient neural crest contribution to the zebrafish ear during normal development, but this is unlikely to account for the strong defects seen in the sox10 mutant. We discuss the implication that the deafness in WS4 patients with SOX10 mutations might reflect a haploinsufficiency for SOX10 in the otic epithelium, resulting in patterning and functional abnormalities in the inner ear.

Maintenance of basal levels of autophagy in Huntington's disease mouse models displaying metabolic dysfunction.

PubMed

Baldo, Barbara; Soylu, Rana; Petersén, Asa

2013-01-01

Huntington's disease (HD) is a fatal neurodegenerative disorder caused by an expanded polyglutamine repeat in the huntingtin protein. Neuropathology in the basal ganglia and in the cerebral cortex has been linked to the motor and cognitive symptoms whereas recent work has suggested that the hypothalamus might be involved in the metabolic dysfunction. Several mouse models of HD that display metabolic dysfunction have hypothalamic pathology, and expression of mutant huntingtin in the hypothalamus has been causally linked to the development of metabolic dysfunction in mice. Although the pathogenic mechanisms by which mutant huntingtin exerts its toxic functions in the HD brain are not fully known, several studies have implicated a role for the lysososomal degradation pathway of autophagy. Interestingly, changes in autophagy in the hypothalamus have been associated with the development of metabolic dysfunction in wild-type mice. We hypothesized that expression of mutant huntingtin might lead to changes in the autophagy pathway in the hypothalamus in mice with metabolic dysfunction. We therefore investigated whether there were changes in basal levels of autophagy in a mouse model expressing a fragment of 853 amino acids of mutant huntingtin selectively in the hypothalamus using a recombinant adeno-associate viral vector approach as well as in the transgenic BACHD mice. We performed qRT-PCR and Western blot to investigate the mRNA and protein expression levels of selected autophagy markers. Our results show that basal levels of autophagy are maintained in the hypothalamus despite the presence of metabolic dysfunction in both mouse models. Furthermore, although there were no major changes in autophagy in the striatum and cortex of BACHD mice, we detected modest, but significant differences in levels of some markers in mice at 12 months of age. Taken together, our results indicate that overexpression of mutant huntingtin in mice do not significantly perturb basal levels of autophagy.

Fisetin Exerts Antioxidant and Neuroprotective Effects in Multiple Mutant hSOD1 Models of Amyotrophic Lateral Sclerosis by Activating ERK.

PubMed

Wang, T H; Wang, S Y; Wang, X D; Jiang, H Q; Yang, Y Q; Wang, Y; Cheng, J L; Zhang, C T; Liang, W W; Feng, H L

2018-05-21

Oxidative stress exhibits a central role in the course of amyotrophic lateral sclerosis (ALS), a progressive neurodegenerative disease commonly found to include a copper/zinc superoxide dismutase (SOD1) gene mutation. Fisetin, a natural antioxidant, has shown benefits in varied neurodegenerative diseases. The possible effect of fisetin in ALS has not been clarified as of yet. We investigated whether fisetin affected mutant hSOD1 ALS models. Three different hSOD1-related mutant models were used: Drosophila expressing mutant hSOD1 G85R , hSOD1 G93A NSC34 cells, and transgenic mice. Fisetin treatment provided neuroprotection as demonstrated by an improved survival rate, attenuated motor impairment, reduced ROS damage and regulated redox homeostasis compared with those in controls. Furthermore, fisetin increased the expression of phosphorylated ERK and upregulated antioxidant factors, which were reversed by MEK/ERK inhibition. Finally, fisetin reduced the levels of both mutant and wild-type hSOD1 in vivo and in vitro, as well as the levels of detergent-insoluble hSOD1 proteins. The results indicate that fisetin protects cells from ROS damage and improves the pathological behaviors caused by oxidative stress in disease models related to SOD1 gene mutations probably by activating ERK, thereby providing a potential treatment for ALS. Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.

Drosophila Torsin Protein Regulates Motor Control and Stress Sensitivity and Forms a Complex with Fragile-X Mental Retardation Protein

PubMed Central

Ahn, Hyo-Min; Koh, Young Ho

2016-01-01

We investigated unknown in vivo functions of Torsin by using Drosophila as a model. Downregulation of Drosophila Torsin (DTor) by DTor-specific inhibitory double-stranded RNA (RNAi) induced abnormal locomotor behavior and increased susceptibility to H2O2. In addition, altered expression of DTor significantly increased the numbers of synaptic boutons. One important biochemical consequence of DTor-RNAi expression in fly brains was upregulation of alcohol dehydrogenase (ADH). Altered expression of ADH has also been reported in Drosophila Fragile-X mental retardation protein (DFMRP) mutant flies. Interestingly, expression of DFMRP was altered in DTor mutant flies, and DTor and DFMRP were present in the same protein complexes. In addition, DTor and DFMRP immunoreactivities were partially colocalized in several cellular organelles in larval muscles. Furthermore, there were no significant differences between synaptic morphologies of dfmrp null mutants and dfmrp mutants expressing DTor-RNAi. Taken together, our evidences suggested that DTor and DFMRP might be present in the same signaling pathway regulating synaptic plasticity. In addition, we also found that human Torsin1A and human FMRP were present in the same protein complexes, suggesting that this phenomenon is evolutionarily conserved. PMID:27313903

From model to crop: functional analysis of a STAY-GREEN gene in the model legume Medicago truncatula and effective use of the gene for alfalfa improvement.

PubMed

Zhou, Chuanen; Han, Lu; Pislariu, Catalina; Nakashima, Jin; Fu, Chunxiang; Jiang, Qingzhen; Quan, Li; Blancaflor, Elison B; Tang, Yuhong; Bouton, Joseph H; Udvardi, Michael; Xia, Guangmin; Wang, Zeng-Yu

2011-11-01

Medicago truncatula has been developed into a model legume. Its close relative alfalfa (Medicago sativa) is the most widely grown forage legume crop in the United States. By screening a large population of M. truncatula mutants tagged with the transposable element of tobacco (Nicotiana tabacum) cell type1 (Tnt1), we identified a mutant line (NF2089) that maintained green leaves and showed green anthers, central carpels, mature pods, and seeds during senescence. Genetic and molecular analyses revealed that the mutation was caused by Tnt1 insertion in a STAY-GREEN (MtSGR) gene. Transcript profiling analysis of the mutant showed that loss of the MtSGR function affected the expression of a large number of genes involved in different biological processes. Further analyses revealed that SGR is implicated in nodule development and senescence. MtSGR expression was detected across all nodule developmental zones and was higher in the senescence zone. The number of young nodules on the mutant roots was higher than in the wild type. Expression levels of several nodule senescence markers were reduced in the sgr mutant. Based on the MtSGR sequence, an alfalfa SGR gene (MsSGR) was cloned, and transgenic alfalfa lines were produced by RNA interference. Silencing of MsSGR led to the production of stay-green transgenic alfalfa. This beneficial trait offers the opportunity to produce premium alfalfa hay with a more greenish appearance. In addition, most of the transgenic alfalfa lines retained more than 50% of chlorophylls during senescence and had increased crude protein content. This study illustrates the effective use of knowledge gained from a model system for the genetic improvement of an important commercial crop.

From Model to Crop: Functional Analysis of a STAY-GREEN Gene in the Model Legume Medicago truncatula and Effective Use of the Gene for Alfalfa Improvement1[W][OA

PubMed Central

Zhou, Chuanen; Han, Lu; Pislariu, Catalina; Nakashima, Jin; Fu, Chunxiang; Jiang, Qingzhen; Quan, Li; Blancaflor, Elison B.; Tang, Yuhong; Bouton, Joseph H.; Udvardi, Michael; Xia, Guangmin; Wang, Zeng-Yu

2011-01-01

Medicago truncatula has been developed into a model legume. Its close relative alfalfa (Medicago sativa) is the most widely grown forage legume crop in the United States. By screening a large population of M. truncatula mutants tagged with the transposable element of tobacco (Nicotiana tabacum) cell type1 (Tnt1), we identified a mutant line (NF2089) that maintained green leaves and showed green anthers, central carpels, mature pods, and seeds during senescence. Genetic and molecular analyses revealed that the mutation was caused by Tnt1 insertion in a STAY-GREEN (MtSGR) gene. Transcript profiling analysis of the mutant showed that loss of the MtSGR function affected the expression of a large number of genes involved in different biological processes. Further analyses revealed that SGR is implicated in nodule development and senescence. MtSGR expression was detected across all nodule developmental zones and was higher in the senescence zone. The number of young nodules on the mutant roots was higher than in the wild type. Expression levels of several nodule senescence markers were reduced in the sgr mutant. Based on the MtSGR sequence, an alfalfa SGR gene (MsSGR) was cloned, and transgenic alfalfa lines were produced by RNA interference. Silencing of MsSGR led to the production of stay-green transgenic alfalfa. This beneficial trait offers the opportunity to produce premium alfalfa hay with a more greenish appearance. In addition, most of the transgenic alfalfa lines retained more than 50% of chlorophylls during senescence and had increased crude protein content. This study illustrates the effective use of knowledge gained from a model system for the genetic improvement of an important commercial crop. PMID:21957014

KRAS-G12C mutation is associated with poor outcome in surgically resected lung adenocarcinoma.

PubMed

Nadal, Ernest; Chen, Guoan; Prensner, John R; Shiratsuchi, Hiroe; Sam, Christine; Zhao, Lili; Kalemkerian, Gregory P; Brenner, Dean; Lin, Jules; Reddy, Rishindra M; Chang, Andrew C; Capellà, Gabriel; Cardenal, Felipe; Beer, David G; Ramnath, Nithya

2014-10-01

The aim of this study was to examine the effects of KRAS mutant subtypes on the outcome of patients with resected lung adenocarcinoma (AC). Using clinical and sequencing data, we identified 179 patients with resected lung AC for whom KRAS mutational status was determined. A multivariate Cox model was used to identify factors associated with disease-free survival (DFS) and overall survival (OS). Publicly available mutation and gene-expression data from lung cancer cell lines and lung AC were used to assess whether distinct KRAS mutant variants have a different profile. Patients with KRAS mutation had a significantly shorter DFS compared with those with KRAS wild-type (p = 0.009). Patients with KRAS-G12C mutant tumors had significantly shorter DFS compared with other KRAS mutants and KRAS wild-type tumors (p < 0.001). In the multivariate Cox model, KRAS-G12C remained as an independent prognostic marker for DFS (Hazard ratio = 2.46, 95% confidence interval 1.51-4.00, p < 0.001) and for OS (Hazard ratio = 2.35, 95% confidence interval 1.35-4.10, p = 0.003). No genes were statistically significant when comparing the mutational or transcriptional profile of lung cancer cell lines and lung AC harboring KRAS-G12C with other KRAS mutant subtypes. Gene set enrichment analysis revealed that KRAS-G12C mutants overexpressed epithelial to mesenchymal transition genes and expressed lower levels of genes predicting KRAS dependency. KRAS-G12C mutation is associated with worse DFS and OS in resected lung AC. Gene-expression profiles in lung cancer cell lines and surgically resected lung AC revealed that KRAS-G12C mutants had an epithelial to mesenchymal transition and a KRAS-independent phenotype.

The Drosophila Neurally Altered Carbohydrate Mutant Has a Defective Golgi GDP-fucose Transporter*

PubMed Central

Geisler, Christoph; Kotu, Varshika; Sharrow, Mary; Rendić, Dubravko; Pöltl, Gerald; Tiemeyer, Michael; Wilson, Iain B. H.; Jarvis, Donald L.

2012-01-01

Studying genetic disorders in model organisms can provide insights into heritable human diseases. The Drosophila neurally altered carbohydrate (nac) mutant is deficient for neural expression of the HRP epitope, which consists of N-glycans with core α1,3-linked fucose residues. Here, we show that a conserved serine residue in the Golgi GDP-fucose transporter (GFR) is substituted by leucine in nac1 flies, which abolishes GDP-fucose transport in vivo and in vitro. This loss of function is due to a biochemical defect, not to destabilization or mistargeting of the mutant GFR protein. Mass spectrometry and HPLC analysis showed that nac1 mutants lack not only core α1,3-linked, but also core α1,6-linked fucose residues on their N-glycans. Thus, the nac1 Gfr mutation produces a previously unrecognized general defect in N-glycan core fucosylation. Transgenic expression of a wild-type Gfr gene restored the HRP epitope in neural tissues, directly demonstrating that the Gfr mutation is solely responsible for the neural HRP epitope deficiency in the nac1 mutant. These results validate the Drosophila nac1 mutant as a model for the human congenital disorder of glycosylation, CDG-IIc (also known as LAD-II), which is also the result of a GFR deficiency. PMID:22745127

KRAS-mutation status dependent effect of zoledronic acid in human non-small cell cancer preclinical models

PubMed Central

Kenessey, István; Kói, Krisztina; Horváth, Orsolya; Cserepes, Mihály; Molnár, Dávid; Izsák, Vera; Dobos, Judit; Hegedűs, Balázs

2016-01-01

Background In non-small cell lung cancer (NSCLC) KRAS-mutant status is a negative prognostic and predictive factor. Nitrogen-containing bisphosphonates inhibit prenylation of small G-proteins (e.g. Ras, Rac, Rho) and thus may affect proliferation and migration. In our preclinical work, we investigated the effect of an aminobisphosphonate compound (zoledronic acid) on mutant and wild type KRAS-expressing human NSCLC cell lines. Results We confirmed that zoledronic acid was unable to inhibit the prenylation of mutant K-Ras unlike in the case of wild type K-Ras. In case of in vitro proliferation, the KRAS-mutant human NSCLC cell lines showed resistance to zoledronic acid wild-type KRAS-cells proved to be sensitive. Combinatory application of zoledronic acid enhanced the cytostatic effect of cisplatin. Zoledronic acid did not induce significant apoptosis. In xenograft model, zoledronic acid significantly reduced the weight of wild type KRAS-EGFR-expressing xenograft tumor by decreasing the proliferative capacity. Futhermore, zoledronic acid induced VEGF expression and improved in vivo tumor vascularization. Materials and methods Membrane association of K-Ras was examined by Western-blot. In vitro cell viability, apoptotic cell death and migration were measured in NSCLC lines with different molecular background. The in vivo effect of zoledronic acid was investigated in a SCID mouse subcutaneous xenograft model. Conclusions The in vitro and in vivo inhibitory effect of zoledronic acid was based on the blockade of cell cycle in wild type KRAS-expressing human NSCLC cells. The zoledronic acid induced vascularization supported in vivo cytostatic effect. Our preclinical investigation suggests that patients with wild type KRAS-expressing NSCLC could potentially benefit from aminobisphosphonate therapy. PMID:27780929

Metabolic pathway profiling of mitochondrial respiratory chain mutants in C. elegans

PubMed Central

MJ, Falk; Z, Zhang; Rosenjack; Nissim; E, Daikhin; Nissim; MM, Sedensky; M, Yudkoff; PG, Morgan

2008-01-01

C. elegans affords a model of primary mitochondrial dysfunction that provides insight into cellular adaptations which accompany mutations in nuclear gene that encode mitochondrial proteins. To this end, we characterized genome-wide expression profiles of C. elegans strains with mutations in nuclear-encoded subunits of respiratory chain complexes. Our goal was to detect concordant changes among clusters of genes that comprise defined metabolic pathways. Results indicate that respiratory chain mutants significantly upregulate a variety of basic cellular metabolic pathways involved in carbohydrate, amino acid, and fatty acid metabolism, as well as cellular defense pathways such as the metabolism of P450 and glutathione. To further confirm and extend expression analysis findings, quantitation of whole worm free amino acid levels was performed in C. elegans mitochondrial mutants for subunits of complexes I, II, and III. Significant differences were seen for 13 of 16 amino acid levels in complex I mutants compared with controls, as well as overarching similarities among profiles of complex I, II, and III mutants compared with controls. The specific pattern of amino acid alterations observed provides novel evidence to suggest that an increase in glutamate-linked transamination reactions caused by the failure of NAD+ dependent oxidation of ketoacids occurs in primary mitochondrial respiratory chain mutants. Recognition of consistent alterations among patterns of nuclear gene expression for multiple biochemical pathways and in quantitative amino acid profiles in a translational genetic model of mitochondrial dysfunction allows insight into the complex pathogenesis underlying primary mitochondrial disease. Such knowledge may enable the development of a metabolomic profiling diagnostic tool applicable to human mitochondrial disease. PMID:18178500

Protective Role of the Capsule and Impact of Serotype 4 Switching on Streptococcus mitis

PubMed Central

Rukke, Håkon V.; Kalluru, Raja Sab; Repnik, Urska; Gerlini, Alice; José, Ricardo J.; Periselneris, Jimstan; Marshall, Helina; Griffiths, Gareth; Oggioni, Marco Rinaldo; Brown, Jeremy S.

2014-01-01

The polysaccharide capsule surrounding Streptococcus pneumoniae is essential for virulence. Recently, Streptococcus mitis, a human commensal and a close relative of S. pneumoniae, was also shown to have a capsule. In this study, the S. mitis type strain switched capsule by acquisition of the serotype 4 capsule locus of S. pneumoniae TIGR4, following induction of competence for natural transformation. Comparison of the wild type with the capsule-switching mutant and with a capsule deletion mutant showed that the capsule protected S. mitis against phagocytosis by RAW 264.7 macrophages. This effect was enhanced in the S. mitis strain expressing the S. pneumoniae capsule, which showed, in addition, increased resistance against early clearance in a mouse model of lung infection. Expression of both capsules also favored survival in human blood, and the effect was again more pronounced for the capsule-switching mutant. S. mitis survival in horse blood or in a mouse model of bacteremia was not significantly different between the wild type and the mutant strains. In all models, S. pneumoniae TIGR4 showed higher rates of survival than the S. mitis type strain or the capsule-switching mutant, except in the lung model, in which significant differences between S. pneumoniae TIGR4 and the capsule-switching mutant were not observed. Thus, we identified conditions that showed a protective function for the capsule in S. mitis. Under such conditions, S. mitis resistance to clearance could be enhanced by capsule switching to serotype 4, but it was enhanced to levels lower than those for the virulent strain S. pneumoniae TIGR4. PMID:24958712

Differential transcriptional activation by human T-cell leukemia virus type 1 Tax mutants is mediated by distinct interactions with CREB binding protein and p300.

PubMed

Bex, F; Yin, M J; Burny, A; Gaynor, R B

1998-04-01

The human T-cell leukemia virus type 1 Tax protein transforms human T lymphocytes, which can lead to the development of adult T-cell leukemia. Tax transformation is related to its ability to activate gene expression via the ATF/CREB and the NF-kappaB pathways. Transcriptional activation of these pathways is mediated by the actions of the related coactivators CREB binding protein (CBP) and p300. In this study, immunocytochemistry and confocal microscopy were used to localize CBP and p300 in cells expressing wild-type Tax or Tax mutants that are able to selectively activate gene expression from either the NF-kappaB or ATF/CREB pathway. Wild-type Tax colocalized with both CBP and p300 in nuclear bodies which also contained ATF-1 and the RelA subunit of NF-kappaB. However, a Tax mutant that selectively activates gene expression from only the ATF/CREB pathway colocalized with CBP but not p300, while a Tax mutant that selectively activates gene expression from only the NF-kappaB pathway colocalized with p300 but not CBP. In vitro and in vivo protein interaction studies indicated that the integrity of two independent domains of Tax delineated by these mutants was involved in the direct interaction of Tax with either CBP or p300. These studies are consistent with a model in which activation of either the NF-kappaB or the ATF/CREB pathway by specific Tax mutants is mediated by distinct interactions with related coactivator proteins.

Mutations in CIC and IDH1 cooperatively regulate 2-hydroxyglutarate levels and cell clonogenicity

PubMed Central

Chittaranjan, Suganthi; Chan, Susanna; Yang, Cindy; Yang, Kevin C.; Chen, Vincent; Moradian, Annie; Firme, Marlo; Song, Jungeun; Go, Nancy E.; Blough, Michael D.; Chan, Jennifer A.; Cairncross, J. Gregory; Gorski, Sharon M.; Morin, Gregg B.; Yip, Stephen; Marra, Marco A.

2014-01-01

The majority of oligodendrogliomas (ODGs) exhibit combined losses of chromosomes 1p and 19q and mutations of isocitrate dehydrogenase (IDH1-R132H or IDH2-R172K). Approximately 70% of ODGs with 1p19q co-deletions harbor somatic mutations in the Capicua Transcriptional Repressor (CIC) gene on chromosome 19q13.2. Here we show that endogenous long (CIC-L) and short (CIC-S) CIC proteins are predominantly localized to the nucleus or cytoplasm, respectively. Cytoplasmic CIC-S is found in close proximity to the mitochondria. To study wild type and mutant CIC function and motivated by the paucity of 1p19q co-deleted ODG lines, we created HEK293 and HOG stable cell lines ectopically co-expressing CIC and IDH1. Non-mutant lines displayed increased clonogenicity, but cells co-expressing the mutant IDH1-R132H with either CIC-S-R201W or -R1515H showed reduced clonogenicity in an additive manner, demonstrating cooperative effects in our assays. Expression of mutant CIC-R1515H increased cellular 2-Hydroxyglutarate (2HG) levels compared to wild type CIC in IDH1-R132H background. Levels of phosphorylated ATP-citrate Lyase (ACLY) were lower in cell lines expressing mutant CIC-S proteins compared to cells expressing wild type CIC-S, supporting a cytosolic citrate metabolism-related mechanism of reduced clonogenicity in our in vitro model systems. ACLY or phospho-ACLY were similarly reduced in CIC-mutant 1p19q co-deleted oligodendroglioma patient samples. PMID:25277207

Modulation of mutant Huntingtin aggregates and toxicity by human myeloid leukemia factors.

PubMed

Banerjee, Manisha; Datta, Moumita; Bhattacharyya, Nitai P

2017-01-01

Increased poly glutamine (polyQ) stretch at N-terminal of Huntingtin (HTT) causes Huntington's disease. HTT interacts with large number of proteins, although the preference for such interactions with wild type or mutated HTT protein remains largely unknown. HYPK, an intrinsically unstructured protein chaperone and interactor of mutant HTT was found to interact with myeloid leukemia factor 1 (MLF1) and 2 (MLF2). To identify the role of these two proteins in mutant HTT mediated aggregate formation and toxicity in a cell model, both the proteins were found to preferentially interact with the mutated N-terminal HTT. They significantly reduced the number of cells containing mutant HTT aggregates and subsequent apoptosis in Neuro2A cells. Additionally, in FRAP assay, mobile fraction of mutant HTT aggregates was increased in the presence of MLF1 or MLF2. Further, MLF1 could release transcription factors like p53, CBP and CREB from mutant HTT aggregates. Moreover, in HeLa cell co-expressing mutant HTT exon1 and full length MLF1, p53 was released from the aggregates, leading to the recovery of the expression of the GADD45A transcript, a p53 regulated gene. Taking together, these results showed that MLF1 and MLF2 modulated the formation of aggregates and induction of apoptosis as well as the expressions of genes indirectly. Copyright © 2016 Elsevier Ltd. All rights reserved.

A simulation study of mutations in the genetic regulatory hierarchy for butterfly eyespot focus determination.

PubMed

Marcus, Jeffrey M; Evans, Travis M

2008-09-01

The color patterns on the wings of butterflies have been an important model system in evolutionary developmental biology. A recent computational model tested genetic regulatory hierarchies hypothesized to underlie the formation of butterfly eyespot foci [Evans, T.M., Marcus, J.M., 2006. A simulation study of the genetic regulatory hierarchy for butterfly eyespot focus determination. Evol. Dev. 8, 273-283]. The computational model demonstrated that one proposed hierarchy was incapable of reproducing the known patterns of gene expression associated with eyespot focus determination in wild-type butterflies, but that two slightly modified alternative hierarchies were capable of reproducing all of the known gene expressions patterns. Here we extend the computational models previously implemented in Delphi 2.0 to two mutants derived from the squinting bush brown butterfly (Bicyclus anynana). These two mutants, comet and Cyclops, have aberrantly shaped eyespot foci that are produced by different mechanisms. The comet mutation appears to produce a modified interaction between the wing margin and the eyespot focus that results in a series of comet-shaped eyespot foci. The Cyclops mutation causes the failure of wing vein formation between two adjacent wing-cells and the fusion of two adjacent eyespot foci to form a single large elongated focus in their place. The computational approach to modeling pattern formation in these mutants allows us to make predictions about patterns of gene expression, which are largely unstudied in butterfly mutants. It also suggests a critical experiment that will allow us to distinguish between two hypothesized genetic regulatory hierarchies that may underlie all butterfly eyespot foci.

Arabidopsis thaliana gonidialess A/Zuotin related factors (GlsA/ZRF) are essential for maintenance of meristem integrity.

PubMed

Guzmán-López, José Alfredo; Abraham-Juárez, María Jazmín; Lozano-Sotomayor, Paulina; de Folter, Stefan; Simpson, June

2016-05-01

Observation of a differential expression pattern, including strong expression in meristematic tissue of an Agave tequilana GlsA/ZRF ortholog suggested an important role for this gene during bulbil formation and developmental changes in this species. In order to better understand this role, the two GlsA/ZFR orthologs present in the genome of Arabidopsis thaliana were functionally characterized by analyzing expression patterns, double mutant phenotypes, promoter-GUS fusions and expression of hormone related or meristem marker genes. Patterns of expression for A. thaliana show that GlsA/ZFR genes are strongly expressed in SAMs and RAMs in mature plants and developing embryos and double mutants showed multiple changes in morphology related to both SAM and RAM tissues. Typical double mutants showed stunted growth of aerial and root tissue, formation of multiple ectopic meristems and effects on cotyledons, leaves and flowers. The KNOX genes STM and BP were overexpressed in double mutants whereas CLV3, WUSCHEL and AS1 were repressed and lack of AtGlsA expression was also associated with changes in localization of auxin and cytokinin. These results suggest that GlsA/ZFR is an essential component of the machinery that maintains the integrity of SAM and RAM tissue and underline the potential to identify new genes or gene functions based on observations in non-model plants.

MiR-142-3p is downregulated in aggressive p53 mutant mouse models of pancreatic ductal adenocarcinoma by hypermethylation of its locus.

PubMed

Godfrey, Jack D; Morton, Jennifer P; Wilczynska, Ania; Sansom, Owen J; Bushell, Martin D

2018-05-29

Pancreatic ductal adenocarcinoma (PDAC) is an extremely aggressive disease with poor prognostic implications. This is partly due to a large proportion of PDACs carrying mutations in TP53, which impart gain-of-function characteristics that promote metastasis. There is evidence that microRNAs (miRNAs) may play a role in both gain-of-function TP53 mutations and metastasis, but this has not been fully explored in PDAC. Here we set out to identify miRNAs which are specifically dysregulated in metastatic PDAC. To achieve this, we utilised established mouse models of PDAC to profile miRNA expression in primary tumours expressing the metastasis-inducing mutant p53 R172H and compared these to two control models carrying mutations, which promote tumour progression but do not induce metastasis. We show that a subset of miRNAs are dysregulated in mouse PDAC tumour tissues expressing mutant p53 R172H , primary cell lines derived from mice with the same mutations and in TP53 null cells with ectopic expression of the orthologous human mutation, p53 R175H . Specifically, miR-142-3p is downregulated in all of these experimental models. We found that DNA methyltransferase 1 (Dnmt1) is upregulated in tumour tissue and cell lines, which express p53 R172H . Inhibition or depletion of Dnmt1 restores miR-142-3p expression. Overexpression of miR-142-3p attenuates the invasive capacity of p53 R172H -expressing tumour cells. MiR-142-3p dysregulation is known to be associated with cancer progression, metastasis and the miRNA is downregulated in patients with PDAC. Here we link TP53 gain-of-function mutations to Dnmt1 expression and in turn miR-142-3p expression. Additionally, we show a correlation between expression of these genes and patient survival, suggesting that they may have potential to be therapeutic targets.

Disruption of DNA methylation-dependent long gene repression in Rett syndrome

PubMed Central

Gabel, Harrison W.; Kinde, Benyam Z.; Stroud, Hume; Gilbert, Caitlin S.; Harmin, David A.; Kastan, Nathaniel R.; Hemberg, Martin; Ebert, Daniel H.; Greenberg, Michael E.

2015-01-01

Disruption of the MECP2 gene leads to Rett syndrome (RTT), a severe neurological disorder with features of autism1. MECP2 encodes a methyl-DNA-binding protein2 that has been proposed to function as a transcriptional repressor, but despite numerous studies examining neuronal gene expression in Mecp2 mutants, no clear model has emerged for how MeCP2 regulates transcription3–9. Here we identify a genome-wide length-dependent increase in gene expression in MeCP2 mutant mouse models and human RTT brains. We present evidence that MeCP2 represses gene expression by binding to methylated CA sites within long genes, and that in neurons lacking MeCP2, decreasing the expression of long genes attenuates RTT-associated cellular deficits. In addition, we find that long genes as a population are enriched for neuronal functions and selectively expressed in the brain. These findings suggest that mutations in MeCP2 may cause neurological dysfunction by specifically disrupting long gene expression in the brain. PMID:25762136

TDP-43 causes differential pathology in neuronal versus glial cells in the mouse brain

PubMed Central

Yan, Sen; Wang, Chuan-En; Wei, Wenjie; Gaertig, Marta A.; Lai, Liangxue; Li, Shihua; Li, Xiao-Jiang

2014-01-01

Mutations in TAR DNA-binding protein 43 (TDP-43) are associated with familial forms of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Although recent studies have revealed that mutant TDP-43 in neuronal and glial cells is toxic, how mutant TDP-43 causes primarily neuronal degeneration in an age-dependent manner remains unclear. Using adeno-associated virus (AAV) that expresses mutant TDP-43 (M337V) ubiquitously, we found that mutant TDP-43 accumulates preferentially in neuronal cells in the postnatal mouse brain. We then ubiquitously or selectively expressed mutant TDP-43 in neuronal and glial cells in the striatum of adult mouse brains via stereotaxic injection of AAV vectors and found that it also preferentially accumulates in neuronal cells. Expression of mutant TDP-43 in neurons in the striatum causes more severe degeneration, earlier death and more robust symptoms in mice than expression of mutant TDP-43 in glial cells; however, aging increases the expression of mutant TDP-43 in glial cells, and expression of mutant TDP-43 in older mice caused earlier onset of phenotypes and more severe neuropathology than that in younger mice. Although expression of mutant TDP-43 in glial cells via stereotaxic injection does not lead to robust neurological phenotypes, systemic inhibition of the proteasome activity via MG132 in postnatal mice could exacerbate glial TDP-43-mediated toxicity and cause mice to die earlier. Consistently, this inhibition increases the expression of mutant TDP-43 in glial cells in mouse brains. Thus, the differential accumulation of mutant TDP-43 in neuronal versus glial cells contributes to the preferential toxicity of mutant TDP-43 in neuronal cells and age-dependent pathology. PMID:24381309

TDP-43 causes differential pathology in neuronal versus glial cells in the mouse brain.

PubMed

Yan, Sen; Wang, Chuan-En; Wei, Wenjie; Gaertig, Marta A; Lai, Liangxue; Li, Shihua; Li, Xiao-Jiang

2014-05-15

Mutations in TAR DNA-binding protein 43 (TDP-43) are associated with familial forms of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Although recent studies have revealed that mutant TDP-43 in neuronal and glial cells is toxic, how mutant TDP-43 causes primarily neuronal degeneration in an age-dependent manner remains unclear. Using adeno-associated virus (AAV) that expresses mutant TDP-43 (M337V) ubiquitously, we found that mutant TDP-43 accumulates preferentially in neuronal cells in the postnatal mouse brain. We then ubiquitously or selectively expressed mutant TDP-43 in neuronal and glial cells in the striatum of adult mouse brains via stereotaxic injection of AAV vectors and found that it also preferentially accumulates in neuronal cells. Expression of mutant TDP-43 in neurons in the striatum causes more severe degeneration, earlier death and more robust symptoms in mice than expression of mutant TDP-43 in glial cells; however, aging increases the expression of mutant TDP-43 in glial cells, and expression of mutant TDP-43 in older mice caused earlier onset of phenotypes and more severe neuropathology than that in younger mice. Although expression of mutant TDP-43 in glial cells via stereotaxic injection does not lead to robust neurological phenotypes, systemic inhibition of the proteasome activity via MG132 in postnatal mice could exacerbate glial TDP-43-mediated toxicity and cause mice to die earlier. Consistently, this inhibition increases the expression of mutant TDP-43 in glial cells in mouse brains. Thus, the differential accumulation of mutant TDP-43 in neuronal versus glial cells contributes to the preferential toxicity of mutant TDP-43 in neuronal cells and age-dependent pathology.

Selective Transgenic Expression of Mutant Ubiquitin in Purkinje Cell Stripes in the Cerebellum.

PubMed

Verheijen, Bert M; Gentier, Romina J G; Hermes, Denise J H P; van Leeuwen, Fred W; Hopkins, David A

2017-06-01

The ubiquitin-proteasome system (UPS) is one of the major mechanisms for protein breakdown in cells, targeting proteins for degradation by enzymatically conjugating them to ubiquitin molecules. Intracellular accumulation of ubiquitin-B +1 (UBB +1 ), a frameshift mutant of ubiquitin-B, is indicative of a dysfunctional UPS and has been implicated in several disorders, including neurodegenerative disease. UBB +1 -expressing transgenic mice display widespread labeling for UBB +1 in brain and exhibit behavioral deficits. Here, we show that UBB +1 is specifically expressed in a subset of parasagittal stripes of Purkinje cells in the cerebellar cortex of a UBB +1 -expressing mouse model. This expression pattern is reminiscent of that of the constitutively expressed Purkinje cell antigen HSP25, a small heat shock protein with neuroprotective properties.

Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jandova, Jana; Janda, Jaroslav; Sligh, James E, E-mail: jsligh@azcc.arizona.edu

We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarraymore » analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear genes associated with tumorigenesis. Black-Right-Pointing-Pointer MMP-9 is up-regulated and Col1a1 is down-regulated in mutant cybrids. Black-Right-Pointing-Pointer GM6001 reduced the enhanced motility of mutant cybrids caused by up-regulated MMP-9. Black-Right-Pointing-Pointer The MMP-9 expression and invasiveness of mutant cybrids were reduced by Bay 11-7802.« less

Reduced expression of the NMDA receptor-interacting protein SynGAP causes behavioral abnormalities that model symptoms of Schizophrenia.

PubMed

Guo, Xiaochuan; Hamilton, Peter J; Reish, Nicholas J; Sweatt, J David; Miller, Courtney A; Rumbaugh, Gavin

2009-06-01

Abnormal function of NMDA receptors is believed to be a contributing factor to the pathophysiology of schizophrenia. NMDAR subunits and postsynaptic-interacting proteins of these channels are abnormally expressed in some patients with this illness. In mice, reduced NMDAR expression leads to behaviors analogous to symptoms of schizophrenia, but reports of animals with mutations in core postsynaptic density proteins having similar a phenotype have yet to be reported. Here we show that reduced expression of the neuronal RasGAP and NMDAR-associated protein, SynGAP, results in abnormal behaviors strikingly similar to that reported in mice with reduced NMDAR function. SynGAP mutant mice exhibited nonhabituating and persistent hyperactivity that was ameliorated by the antipsychotic clozapine. An NMDAR antagonist, MK-801, induced hyperactivity in normal mice but SynGAP mutants were less responsive, suggesting that NMDAR hypofunction contributes to this behavioral abnormality. SynGAP mutants exhibited enhanced startle reactivity and impaired sensory-motor gating. These mice also displayed a complete lack of social memory and a propensity toward social isolation. Finally, SynGAP mutants had deficits in cued fear conditioning and working memory, indicating abnormal function of circuits that control emotion and choice. Our results demonstrate that SynGAP mutant mice have gross neurological deficits similar to other mouse models of schizophrenia. Because SynGAP interacts with NMDARs, and the signaling activity of this protein is regulated by these channels, our data in dicate that SynGAP lies downstream of NMDARs and is a required intermediate for normal neural circuit function and behavior. Taken together, these data support the idea that schizophrenia may arise from abnormal signaling pathways that are mediated by NMDA receptors.

Mice expressing a “hyper-sensitive” form of the CB1 cannabinoid receptor (CB1) show modestly enhanced alcohol preference and consumption

PubMed Central

Gonek, Maciej; Zee, Michael L.; Farnsworth, Jill C.; Amin, Randa A.; Andrews, Mary-Jeanette; Davis, Brian J.; Mackie, Ken; Morgan, Daniel J.

2017-01-01

We recently characterized S426A/S430A mutant mice expressing a desensitization-resistant form of the CB1 receptor. These mice display an enhanced response to endocannabinoids and ∆9-THC. In this study, S426A/S430A mutants were used as a novel model to test whether ethanol consumption, morphine dependence, and reward for these drugs are potentiated in mice with a “hyper-sensitive” form of CB1. Using an unlimited-access, two-bottle choice, voluntary drinking paradigm, S426A/S430A mutants exhibit modestly increased intake and preference for low (6%) but not higher concentrations of ethanol. S426A/S430A mutants and wild-type mice show similar taste preference for sucrose and quinine, exhibit normal sensitivity to the hypothermic and ataxic effects of ethanol, and have normal blood ethanol concentrations following administration of ethanol. S426A/S430A mutants develop robust conditioned place preference for ethanol (2 g/kg), morphine (10 mg/kg), and cocaine (10 mg/kg), demonstrating that drug reward is not changed in S426A/S430A mutants. Precipitated morphine withdrawal is also unchanged in opioid-dependent S426A/S430A mutant mice. Although ethanol consumption is modestly changed by enhanced CB1 signaling, reward, tolerance, and acute sensitivity to ethanol and morphine are normal in this model. PMID:28426670

The Streptococcus iniae transcriptional regulator CpsY is required for protection from neutrophil-mediated killing and proper growth in vitro.

PubMed

Allen, Jonathan P; Neely, Melody N

2011-11-01

The ability of a pathogen to metabolically adapt to the local environment for optimal expression of virulence determinants is a continued area of research. Orthologs of the Streptococcus iniae LysR family regulator CpsY have been shown to regulate methionine biosynthesis and uptake pathways but appear to influence expression of several virulence genes as well. An S. iniae mutant with an in-frame deletion of cpsY (ΔcpsY mutant) is highly attenuated in a zebrafish infection model. The ΔcpsY mutant displays a methionine-independent growth defect in serum, which differs from the methionine-dependent defect observed for orthologous mutants of Streptococcus mutans and Streptococcus agalactiae. On the contrary, the ΔcpsY mutant can grow in excess of the wild type (WT) when supplemented with proteose peptone, suggesting an inability to properly regulate growth. CpsY is critical for protection of S. iniae from clearance by neutrophils in whole blood but is dispensable for intracellular survival in macrophages. Susceptibility of the ΔcpsY mutant to killing in whole blood is not due to a growth defect, because inhibition of neutrophil phagocytosis rescues the mutant to WT levels. Thus, CpsY appears to have a pleiotropic regulatory role for S. iniae, integrating metabolism and virulence. Furthermore, S. iniae provides a unique model to investigate the paradigm of CpsY-dependent regulation during systemic streptococcal infection.

The Streptococcus iniae Transcriptional Regulator CpsY Is Required for Protection from Neutrophil-Mediated Killing and Proper Growth In Vitro ▿

PubMed Central

Allen, Jonathan P.; Neely, Melody N.

2011-01-01

The ability of a pathogen to metabolically adapt to the local environment for optimal expression of virulence determinants is a continued area of research. Orthologs of the Streptococcus iniae LysR family regulator CpsY have been shown to regulate methionine biosynthesis and uptake pathways but appear to influence expression of several virulence genes as well. An S. iniae mutant with an in-frame deletion of cpsY (ΔcpsY mutant) is highly attenuated in a zebrafish infection model. The ΔcpsY mutant displays a methionine-independent growth defect in serum, which differs from the methionine-dependent defect observed for orthologous mutants of Streptococcus mutans and Streptococcus agalactiae. On the contrary, the ΔcpsY mutant can grow in excess of the wild type (WT) when supplemented with proteose peptone, suggesting an inability to properly regulate growth. CpsY is critical for protection of S. iniae from clearance by neutrophils in whole blood but is dispensable for intracellular survival in macrophages. Susceptibility of the ΔcpsY mutant to killing in whole blood is not due to a growth defect, because inhibition of neutrophil phagocytosis rescues the mutant to WT levels. Thus, CpsY appears to have a pleiotropic regulatory role for S. iniae, integrating metabolism and virulence. Furthermore, S. iniae provides a unique model to investigate the paradigm of CpsY-dependent regulation during systemic streptococcal infection. PMID:21911465

Susceptibility of Glucokinase-MODY Mutants to Inactivation by Oxidative Stress in Pancreatic β-Cells

PubMed Central

Cullen, Kirsty S.; Matschinsky, Franz M.; Agius, Loranne; Arden, Catherine

2011-01-01

OBJECTIVE The posttranslational regulation of glucokinase (GK) differs in hepatocytes and pancreatic β-cells. We tested the hypothesis that GK mutants that cause maturity-onset diabetes of the young (GK-MODY) show compromised activity and posttranslational regulation in β-cells. RESEARCH DESIGN AND METHODS Activity and protein expression of GK-MODY and persistent hyperinsulinemic hypoglycemia of infancy (PHHI) mutants were studied in β-cell (MIN6) and non–β-cell (H4IIE) models. Binding of GK to phosphofructo-2-kinase, fructose-2,6-bisphosphatase (PFK2/FBPase2) was studied by bimolecular fluorescence complementation in cell-based models. RESULTS Nine of 11 GK-MODY mutants that have minimal effect on enzyme kinetics in vitro showed decreased specific activity relative to wild type when expressed in β-cells. A subset of these were stable in non–β-cells but showed increased inactivation in conditions of oxidative stress and partial reversal of inactivation by dithiothreitol. Unlike the GK-MODY mutants, four of five GK-PHHI mutants had similar specific activity to wild type and Y214C had higher activity than wild type. The GK-binding protein PFK2/FBPase2 protected wild-type GK from oxidative inactivation and the decreased stability of GK-MODY mutants correlated with decreased interaction with PFK2/FBPase2. CONCLUSIONS Several GK-MODY mutants show posttranslational defects in β-cells characterized by increased susceptibility to oxidative stress and/or protein instability. Regulation of GK activity through modulation of thiol status may be a physiological regulatory mechanism for the control of GK activity in β-cells. PMID:22028181

Susceptibility of glucokinase-MODY mutants to inactivation by oxidative stress in pancreatic β-cells.

PubMed

Cullen, Kirsty S; Matschinsky, Franz M; Agius, Loranne; Arden, Catherine

2011-12-01

The posttranslational regulation of glucokinase (GK) differs in hepatocytes and pancreatic β-cells. We tested the hypothesis that GK mutants that cause maturity-onset diabetes of the young (GK-MODY) show compromised activity and posttranslational regulation in β-cells. Activity and protein expression of GK-MODY and persistent hyperinsulinemic hypoglycemia of infancy (PHHI) mutants were studied in β-cell (MIN6) and non-β-cell (H4IIE) models. Binding of GK to phosphofructo-2-kinase, fructose-2,6-bisphosphatase (PFK2/FBPase2) was studied by bimolecular fluorescence complementation in cell-based models. Nine of 11 GK-MODY mutants that have minimal effect on enzyme kinetics in vitro showed decreased specific activity relative to wild type when expressed in β-cells. A subset of these were stable in non-β-cells but showed increased inactivation in conditions of oxidative stress and partial reversal of inactivation by dithiothreitol. Unlike the GK-MODY mutants, four of five GK-PHHI mutants had similar specific activity to wild type and Y214C had higher activity than wild type. The GK-binding protein PFK2/FBPase2 protected wild-type GK from oxidative inactivation and the decreased stability of GK-MODY mutants correlated with decreased interaction with PFK2/FBPase2. Several GK-MODY mutants show posttranslational defects in β-cells characterized by increased susceptibility to oxidative stress and/or protein instability. Regulation of GK activity through modulation of thiol status may be a physiological regulatory mechanism for the control of GK activity in β-cells.

Comprehensive gene expression analysis of rice aleurone cells: probing the existence of an alternative gibberellin receptor.

PubMed

Yano, Kenji; Aya, Koichiro; Hirano, Ko; Ordonio, Reynante Lacsamana; Ueguchi-Tanaka, Miyako; Matsuoka, Makoto

2015-02-01

Current gibberellin (GA) research indicates that GA must be perceived in plant nuclei by its cognate receptor, GIBBERELLIN INSENSITIVE DWARF1 (GID1). Recognition of GA by GID1 relieves the repression mediated by the DELLA protein, a model known as the GID1-DELLA GA perception system. There have been reports of potential GA-binding proteins in the plasma membrane that perceive GA and induce α-amylase expression in cereal aleurone cells, which is mechanistically different from the GID1-DELLA system. Therefore, we examined the expression of the rice (Oryza sativa) α-amylase genes in rice mutants impaired in the GA receptor (gid1) and the DELLA repressor (slender rice1; slr1) and confirmed their lack of response to GA in gid1 mutants and constitutive expression in slr1 mutants. We also examined the expression of GA-regulated genes by genome-wide microarray and quantitative reverse transcription-polymerase chain reaction analyses and confirmed that all GA-regulated genes are modulated by the GID1-DELLA system. Furthermore, we studied the regulatory network involved in GA signaling by using a set of mutants defective in genes involved in GA perception and gene expression, namely gid1, slr1, gid2 (a GA-related F-box protein mutant), and gamyb (a GA-related trans-acting factor mutant). Almost all GA up-regulated genes were regulated by the four named GA-signaling components. On the other hand, GA down-regulated genes showed different expression patterns with respect to GID2 and GAMYB (e.g. a considerable number of genes are not controlled by GAMYB or GID2 and GAMYB). Based on these observations, we present a comprehensive discussion of the intricate network of GA-regulated genes in rice aleurone cells. © 2015 American Society of Plant Biologists. All Rights Reserved.

Characterization of neuronal cell death in the spiral ganglia of a mouse model of endolymphatic hydrops.

PubMed

Semaan, Maroun T; Zheng, Qing Y; Han, Fengchan; Zheng, Yuxi; Yu, Heping; Heaphy, John C; Megerian, Cliff A

2013-04-01

Spiral ganglion neurons (SGN) in the Phex male mouse, a murine model of postnatal endolymphatic hydrops (ELH) undergo progressive deterioration reminiscent of human and other animal models of ELH with features suggesting apoptosis as an important mechanism. Histologic analysis of the mutant's cochlea demonstrates ELH by postnatal Day (P) 21 and SGN loss by P90. The SGN loss seems to occur in a consistent topographic pattern beginning at the cochlear apex. SGN were counted at P60, P90, and P120. Semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR), quantitative PCR, and immunohistochemical analyses of activated caspase-3, caspase-8, and caspase-9 were performed on cochlear sections obtained from mutants and controls. Terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick-end labeling assay (TUNEL) was carried out on 2 mutants and 2 controls. Corrected SGN counts in control mice were greater in the apical turn of the cochleae at P90 and P120, respectively (p < 0.01). Increased expression of activated caspase-3, caspase-8, and caspase-9 was seen in the mutant. At later time points, activated caspase expression gradually declined in the apical turns and increased in basal turns of the cochlea. Quantitative and semiquantitative PCR analysis confirmed increased expression of caspase-3, caspase-8, and caspase-9 at P21 and P40. TUNEL staining demonstrated apoptosis at P90 in the apical and basal turns of the mutant cochleae. SGN degeneration in the Phex /Y mouse seems to mimic patterns observed in other animals with ELH. Apoptosis plays an important role in the degeneration of the SGN in the Phex male mouse.

The influence of mutant lactobacilli on serum creatinine and urea nitrogen concentrations and renal pathology in 5/6 nephrectomized rats.

PubMed

Wang, Fang; Jiang, Yun-Sheng; Liu, Fang

2016-10-01

To explore the capacity of mutant lactobacilli to remove creatinine (Cr) and urea nitrogen (UN) via the gastrointestinal tract and its effects on renal pathology in the 5/6 nephrectomized rat model of chronic renal failure. Sixty Sprague-Dawley rats were randomly divided into a Sham group, a Model group, a wide-type Lactobacilli group (L.B group), and a Mutant Lactobacilli group (Mut-L.B group). The rats in the Model, LB and Mut-L.B groups underwent 5/6 nephrectomy. Eight weeks after administration, 24-h urine, orbital blood and digestive secretions were collected to analyze Cr and UN levels. Pathological changes in nephridial tissues were observed by hematoxylin and eosin and Masson trichrome staining, and the expression of TGF-β1 and FN was detected by immunohistochemistry. There were no significant differences in urinary Cr and UN levels among the Sham, L.B and Mut-L.B groups (p > .05), while serum and digestive Cr and UN levels were significantly decreased in the Mut-L.B group (p < .01). Furthermore, renal tubular injury and interstitial fibrosis were significantly reduced and TGF-β1 and FN expression was decreased (p < .05) in the Mut-L.B group. Mutant lactobacilli decreased serum Cr and UN levels, reduced the expression of TGF-β1 and FN in renal tissues and alleviated renal interstitial injury and fibrosis in a rat model of chronic renal failure in a mechanism that may involve decomposition and not just excretion of small molecule toxins in the gastrointestinal tract.

Mutational analysis of P-glycoprotein: suppression of caspase activation in the absence of ATP-dependent drug efflux.

PubMed

Tainton, K M; Smyth, M J; Jackson, J T; Tanner, J E; Cerruti, L; Jane, S M; Darcy, P K; Johnstone, R W

2004-09-01

P-glycoprotein (P-gp) can induce multidrug resistance (MDR) through the ATP-dependent efflux of chemotherapeutic agents. We have previously shown that P-gp can inhibit nondrug apoptotic stimuli by suppressing the activation of caspases. To determine if this additional activity is functionally linked to ATP hydrolysis, we expressed wild-type and ATPase-mutant P-gp and showed that cells expressing mutant P-gp could not efflux chemotherapeutic drugs but remained relatively resistant to apoptosis. CEM lymphoma cells expressing mutant P-gp treated with vincristine showed a decrease in the fraction of cells with apoptotic morphology, cytochrome c release from the mitochondria and suppression of caspase activation, yet still accumulated in mitosis and showed a loss of clonogenic potential. The loss of clonogenicity in vincristine-treated cells expressing mutant P-gp was associated with accumulation of cells in mitosis and the presence of multinucleated cells consistent with mitotic catastrophe. The antiapoptotic effect of mutant P-gp was not affected by antibodies that inhibit the efflux function of the protein. These data are consistent with a dual activity model for P-gp-induced MDR involving both ATPase-dependent drug efflux and ATPase-independent inhibition of apoptosis. The structure-function analyses described herein provide novel insight into the mechanisms of action of P-gp in mediating MDR.

Characterization of Haemophilus ducreyi cdtA, cdtB, and cdtC Mutants in In Vitro and In Vivo Systems

PubMed Central

Lewis, David A.; Stevens, Marla K.; Latimer, Jo L.; Ward, Christine K.; Deng, Kaiping; Blick, Robert; Lumbley, Sheryl R.; Ison, Catherine A.; Hansen, Eric J.

2001-01-01

Haemophilus ducreyi expresses a soluble cytolethal distending toxin (CDT) that is encoded by the cdtABC gene cluster and can be detected in culture supernatant fluid by its ability to kill HeLa cells. The cdtA, cdtB, and cdtC genes of H. ducreyi were cloned independently into plasmid vectors, and their encoded proteins expressed singly or in various combinations in an Escherichia coli background. All three gene products had to be expressed in order for E. coli-derived culture supernatant fluids to demonstrate cytotoxicity for HeLa cells. Isogenic H. ducreyi cdtA and cdtB mutants were constructed and used in combination with the wild-type parent strain and a previously described H. ducreyi cdtC mutant (M. K. Stevens, J. L. Latimer, S. R. Lumbley, C. K. Ward, L. D. Cope, T. Lagergard, and E. J. Hansen, Infect. Immun. 67:3900–3908, 1999) to determine the relative contributions of the CdtA, CdtB, and CdtC proteins to CDT activity. Expression of CdtA, CdtB, and CdtC appeared necessary for H. ducreyi-derived culture supernatant fluid to exhibit cytotoxicity for HeLa cells. Whole-cell sonicates and periplasmic extracts from the cdtB and cdtC mutants had no effect on HeLa cells, whereas these same fractions from a cdtA mutant had a very modest cytotoxic effect on these same human cells. CdtA appeared to be primarily associated with the H. ducreyi cell envelope, whereas both CdtB and CdtC were present primarily in the soluble fraction from sonicated cells. Both the cdtA mutant and the cdtB mutant were found to be fully virulent in the temperature-dependent rabbit model for experimental chancroid. PMID:11500438

Superoxide overproduction and kidney fibrosis: a new animal model

PubMed Central

Guimarães-Souza, Nadia Karina; Yamaleyeva, Liliya Marsovna; Lu, Baisong; Ramos, Ana Claudia Mallet de Souza; Bishop, Colin Edward; Andersson, Karl Erik

2015-01-01

Objective To establish whether the mutation in the Immp2L gene induces renal fibrosis and whether aging exacerbates renal morphology in mice. Methods Female mutant mice with mutation in the inner mitochondrial membrane peptidase 2-like protein at 3 and 18 months of age were used. Renal fibrosis was analyzed using classic fibrosis score, Masson’s trichrome staining, and analysis of profibrotic markers using real time polymerase chain reaction (superoxide dismutase 1, metalloproteinase-9, erythropoietin, transforming growth factor beta), and immunostaining (fibroblasts and Type IV collagen). Oxidative stress markers were determined by immunohistochemistry. The number of renal apoptotic cells was determined. Renal function was estimated by serum creatinine. Results Young mutant mice had significantly more glomerulosclerosis than age-matched mice (p=0.034). Mutant mice had more tubular casts (p=0.025), collagen deposition (p=0.019), and collagen type IV expression (p<0.001). Superoxide dismutase 1 expression was significantly higher in young mutants (p=0.038). Old mutants exhibited significantly higher expression of the fibroblast marker and macrophage marker (p=0.007 and p=0.012, respectively). The real time polymerase chain reaction of metalloproteinase-9 and erythropoietin were enhanced 2.5- and 6-fold, respectively, in old mutants. Serum creatinine was significantly higher in old mutants (p<0.001). Conclusion This mutation altered renal architecture by increasing the deposition of extracellular matrix, oxidative stress, and inflammation, suggesting a protective role of Immp2L against renal fibrosis. PMID:25993073

Functional Analysis of Human NF1 in Drosophila

DTIC Science & Technology

2008-12-01

also have learning problem. Such learning phenotypes have been recapitulated in animal models, including in mouse and Drosophila mutants. This proposal...by examining the phenotypes of mutated human genes expressed in Drosophila NF1 null mutants. We also propose that Gsα/NF1 activated AC pathway...in both Drosophila and mouse NF1 models. Our previous work has shown that defective cAMP signaling leads to the learning phenotype in Drosophila Nf1

Region of Herpes Simplex Virus Type 1 Latency-Associated Transcript Sufficient for Wild-Type Spontaneous Reactivation Promotes Cell Survival in Tissue Culture

PubMed Central

Inman, Melissa; Perng, Guey-Chuen; Henderson, Gail; Ghiasi, Homayon; Nesburn, Anthony B.; Wechsler, Steven L.; Jones, Clinton

2001-01-01

The latency-associated transcript (LAT) is the only abundant herpes simplex virus type 1 (HSV-1) transcript expressed during latency. In the rabbit eye model, LAT null mutants do not reactivate efficiently from latency. We recently demonstrated that the LAT null mutant dLAT2903 induces increased levels of apoptosis in trigeminal ganglia of infected rabbits compared to LAT+ strains (G.-C. Perng, C. Jones, J. Ciacci-Zarella, M. Stone, G. Henderson, A. Yokht, S. M. Slanina, F. M. Hoffman, H. Ghiasi, A. B. Nesburn, and C. S. Wechsler, Science 287:1500–1503, 2000).The same study also demonstrated that a plasmid expressing LAT nucleotides 301 to 2659 enhanced cell survival of transfected cells after induction of apoptosis. Consequently, we hypothesized that LAT enhances spontaneous reactivation in part, because it promotes survival of infected neurons. Here we report on the ability of plasmids expressing different portions of the 5′ end of LAT to promote cell survival after induction of apoptosis. A plasmid expressing the first 1.5 kb of LAT (LAT nucleotides 1 to 1499) promoted cell survival in neuro-2A (mouse neuronal) and CV-1 (monkey fibroblast) cells. A plasmid expressing just the first 811 nucleotides of LAT promoted cell survival less efficiently. Plasmids expressing the first 661 nucleotides or less of LAT did not promote cell survival. We previously showed that a mutant expressing just the first 1.5 kb of LAT has wild-type spontaneous reactivation in rabbits, and a mutant expressing just the first 811 nucleotides of LAT has a reactivation frequency higher than that of dLAT2903 but lower than that of wild-type virus. In addition, mutants reported here for the first time, expressing just the first 661 or 76 nucleotides of LAT, had spontaneous reactivation indistinguishable from that of the LAT null mutant dLAT2903. In summary, these studies provide evidence that there is a functional relationship between the ability of LAT to promote cell survival and its ability to enhance spontaneous reactivation. PMID:11264353

Reversal of a full-length mutant huntingtin neuronal cell phenotype by chemical inhibitors of polyglutamine-mediated aggregation

PubMed Central

Wang, Jin; Gines, Silvia; MacDonald, Marcy E; Gusella, James F

2005-01-01

Background Huntington's disease (HD) is an inherited neurodegenerative disorder triggered by an expanded polyglutamine tract in huntingtin that is thought to confer a new conformational property on this large protein. The propensity of small amino-terminal fragments with mutant, but not wild-type, glutamine tracts to self-aggregate is consistent with an altered conformation but such fragments occur relatively late in the disease process in human patients and mouse models expressing full-length mutant protein. This suggests that the altered conformational property may act within the full-length mutant huntingtin to initially trigger pathogenesis. Indeed, genotype-phenotype studies in HD have defined genetic criteria for the disease initiating mechanism, and these are all fulfilled by phenotypes associated with expression of full-length mutant huntingtin, but not amino-terminal fragment, in mouse models. As the in vitro aggregation of amino-terminal mutant huntingtin fragment offers a ready assay to identify small compounds that interfere with the conformation of the polyglutamine tract, we have identified a number of aggregation inhibitors, and tested whether these are also capable of reversing a phenotype caused by endogenous expression of mutant huntingtin in a striatal cell line from the HdhQ111/Q111 knock-in mouse. Results We screened the NINDS Custom Collection of 1,040 FDA approved drugs and bioactive compounds for their ability to prevent in vitro aggregation of Q58-htn 1–171 amino terminal fragment. Ten compounds were identified that inhibited aggregation with IC50 < 15 μM, including gossypol, gambogic acid, juglone, celastrol, sanguinarine and anthralin. Of these, both juglone and celastrol were effective in reversing the abnormal cellular localization of full-length mutant huntingtin observed in mutant HdhQ111/Q111 striatal cells. Conclusions At least some compounds identified as aggregation inhibitors also prevent a neuronal cellular phenotype caused by full-length mutant huntingtin, suggesting that in vitro fragment aggregation can act as a proxy for monitoring the disease-producing conformational property in HD. Thus, identification and testing of compounds that alter in vitro aggregation is a viable approach for defining potential therapeutic compounds that may act on the deleterious conformational property of full-length mutant huntingtin. PMID:15649316

[MicroRNA in neurodegenerative disorders].

PubMed

Sobue, Gen

2013-01-01

MicroRNAs (miRNAs) bind to the 3'-untranslated region of mRNA, and thereby suppress the gene expression. Recent studies suggest that miRNAs modify the pathogenesis of cancer and neurodegeneration. Our study demonstrated that the expression levels of miR-196a is increased in a mouse model of spinal and bulbar muscular atrophy (SBMA), a neurodegenerative disease caused by the expansion of polyglutamine in androgen receptor (AR). In cultured neuronal cells, miR-196a decayed the mutant AR mRNA via silencing CUG triplet repeat RNA binding protein 2, a potent miR-196a targeting mRNA, which contributed to stabilize the mutant AR mRNA. Adeno-associated virus vector-mediated delivery of this miRNA attenuates the expression of the mutant AR, resulting in the mitigation of motor neuron degeneration in the SBMA mice. Introduction of miRNA appears to be a novel therapeutic strategy for devastating neurodegenerative diseases.

Functional redundancy and/or ongoing pseudogenization among F-box protein genes expressed in Arabidopsis male gametophyte.

PubMed

Ikram, Sobia; Durandet, Monique; Vesa, Simona; Pereira, Serge; Guerche, Philippe; Bonhomme, Sandrine

2014-06-01

F-box protein genes family is one of the largest gene families in plants, with almost 700 predicted genes in the model plant Arabidopsis. F-box proteins are key components of the ubiquitin proteasome system that allows targeted protein degradation. Transcriptome analyses indicate that half of these F-box protein genes are found expressed in microspore and/or pollen, i.e., during male gametogenesis. To assess the role of F-box protein genes during this crucial developmental step, we selected 34 F-box protein genes recorded as highly and specifically expressed in pollen and isolated corresponding insertion mutants. We checked the expression level of each selected gene by RT-PCR and confirmed pollen expression for 25 genes, but specific expression for only 10 of the 34 F-box protein genes. In addition, we tested the expression level of selected F-box protein genes in 24 mutant lines and showed that 11 of them were null mutants. Transmission analysis of the mutations to the progeny showed that none of the single mutations was gametophytic lethal. These unaffected transmission efficiencies suggested leaky mutations or functional redundancy among F-box protein genes. Cytological observation of the gametophytes in the mutants confirmed these results. Combinations of mutations in F-box protein genes from the same subfamily did not lead to transmission defect either, further highlighting functional redundancy and/or a high proportion of pseudogenes among these F-box protein genes.

Rapid Conversion of Mutant IDH1 from Driver to Passenger in a Model of Human Gliomagenesis

PubMed Central

Johannessen, Tor-Christian Aase; Mukherjee, Joydeep; Viswanath, Pavithra; Ohba, Shigeo; Ronen, Sabrina M.; Bjerkvig, Rolf; Pieper, Russell O.

2016-01-01

Missense mutations in the active site of isocitrate dehydrogenase 1 (IDH1) biologically and diagnostically distinguish low-grade gliomas and secondary glioblastomas from primary glioblastomas. IDH1 mutations lead to the formation of the oncometabolite 2-hydroxyglutarate (2-HG) from the reduction of α-ketoglutarate (α-KG), which in turn facilitates tumorigenesis by modifying DNA and histone methylation as well blocking differentiation processes. While mutant IDH1 expression is thought to drive the gliomagenesis process, the extent to which it remains a viable therapeutic target remains unknown. To address this question we exposed immortalized (p53/pRb-deficient), untransformed human astrocytes to the mutant IDH1 inhibitor AGI-5198 prior to, concomitant with, or at intervals after, introduction of transforming mutant IDH1, then measured effects on 2-HG levels, histone methylation (H3K4me3, H3K9me2, H3K9me3 or H3K27me3) and growth in soft-agar. Addition of AGI-5198 prior to, or concomitant with, introduction of mutant IDH1 blocked all mutant IDH1-driven changes including cellular transformation. Addition at time intervals as short as 4 days following introduction of mutant IDH1 also suppressed 2-HG levels, but had minimal effects on histone methylation, and lost the ability to suppress clonogenicity in a time-dependent manner. Furthermore, in two different models of mutant IDH1-driven gliomagenesis, AGI-5198 exposures that abolished production of 2-HG also failed to decrease histone methylation, adherent cell growth, or anchorage-independent growth in soft-agar over a prolonged period. These studies show although mutant IDH1 expression drives gliomagenesis, mutant IDH1 itself rapidly converts from driver to passenger. Implications Agents that target mutant IDH may be effective for a narrow time and may require further optimization or additional therapeutics in glioma. PMID:27430238

Restoration of mutant bestrophin-1 expression, localisation and function in a polarised epithelial cell model

PubMed Central

Briant, Kit; Streit, Anne-Kathrin; Thomson, Steven; Koay, Yee Hui

2016-01-01

ABSTRACT Autosomal recessive bestrophinopathy (ARB) is a retinopathy caused by mutations in the bestrophin-1 protein, which is thought to function as a Ca2+-gated Cl− channel in the basolateral surface of the retinal pigment epithelium (RPE). Using a stably transfected polarised epithelial cell model, we show that four ARB mutant bestrophin-1 proteins were mislocalised and subjected to proteasomal degradation. In contrast to the wild-type bestrophin-1, each of the four mutant proteins also failed to conduct Cl− ions in transiently transfected cells as determined by whole-cell patch clamp. We demonstrate that a combination of two clinically approved drugs, bortezomib and 4-phenylbutyrate (4PBA), successfully restored the expression and localisation of all four ARB mutant bestrophin-1 proteins. Importantly, the Cl− conductance function of each of the mutant bestrophin-1 proteins was fully restored to that of wild-type bestrophin-1 by treatment of cells with 4PBA alone. The functional rescue achieved with 4PBA is significant because it suggests that this drug, which is already approved for long-term use in infants and adults, might represent a promising therapy for the treatment of ARB and other bestrophinopathies resulting from missense mutations in BEST1. PMID:27519691

Restoration of mutant bestrophin-1 expression, localisation and function in a polarised epithelial cell model.

PubMed

Uggenti, Carolina; Briant, Kit; Streit, Anne-Kathrin; Thomson, Steven; Koay, Yee Hui; Baines, Richard A; Swanton, Eileithyia; Manson, Forbes D

2016-11-01

Autosomal recessive bestrophinopathy (ARB) is a retinopathy caused by mutations in the bestrophin-1 protein, which is thought to function as a Ca 2+ -gated Cl - channel in the basolateral surface of the retinal pigment epithelium (RPE). Using a stably transfected polarised epithelial cell model, we show that four ARB mutant bestrophin-1 proteins were mislocalised and subjected to proteasomal degradation. In contrast to the wild-type bestrophin-1, each of the four mutant proteins also failed to conduct Cl - ions in transiently transfected cells as determined by whole-cell patch clamp. We demonstrate that a combination of two clinically approved drugs, bortezomib and 4-phenylbutyrate (4PBA), successfully restored the expression and localisation of all four ARB mutant bestrophin-1 proteins. Importantly, the Cl - conductance function of each of the mutant bestrophin-1 proteins was fully restored to that of wild-type bestrophin-1 by treatment of cells with 4PBA alone. The functional rescue achieved with 4PBA is significant because it suggests that this drug, which is already approved for long-term use in infants and adults, might represent a promising therapy for the treatment of ARB and other bestrophinopathies resulting from missense mutations in BEST1. © 2016. Published by The Company of Biologists Ltd.

Two-Pore Channels: Lessons from Mutant Mouse Models

PubMed Central

Ruas, Margarida; Galione, Antony; Parrington, John

2016-01-01

Recent interest in two-pore channels (TPCs) has resulted in a variety of studies dealing with the functional role and mechanism of action of these endo-lysosomal proteins in diverse physiological processes. With the availability of mouse lines harbouring mutant alleles for Tpcnl and/or Tpcn2 genes, several studies have made use of them to validate, consolidate and discover new roles for these channels not only at the cellular level but, importantly, also at the level of the whole organism. The different mutant mouse lines that have been used were derived from distinct genetic manipulation strategies, with the aim of knocking out expression of TPC proteins. However, the expression of different residual TPC sequences predicted to occur in these mutant mouse lines, together with the varied degree to which the effects on Tpcn expression have been studied, makes it important to assess the true knockout status of some of the lines. In this review we summarize these Tpcn mutant mouse lines with regard to their predicted effect on Tpcn expression and the extent to which they have been characterized. Additionally, we discuss how results derived from studies using these Tpcn mutant mouse lines have consolidated previously proposed roles for TPCs, such as mediators of NAADP signalling, endo-lysosomal functions, and pancreatic β cell physiology. We will also review how they have been instrumental in the assignment of new physiological roles for these cation channels in processes such as membrane electrical excitability, neoangiogenesis, viral infection and brown adipose tissue and heart function, revealing, in some cases, a specific contribution of a particular TPC isoform. PMID:27330869

Linking a compound-heterozygous Parkin mutant (Q311R and A371T) to Parkinson's disease by using proteomic and molecular approaches.

PubMed

Ozgul, Sinem; Kasap, Murat; Akpinar, Gurler; Kanli, Aylin; Güzel, Nil; Karaosmanoglu, Kübra; Baykal, Ahmet Tarik; Iseri, Pervin

2015-01-01

Parkin is an E3-protein ubiquitin ligase, which plays an important role as a scavenger in cell metabolism. Since the discovery of the link between Parkin and Parkinson's disease, Parkin was placed in the center of Parkinson's disease research. Previously, we isolated a mutant form of the Parkin protein (Q311R and A371T) from a Parkinson's disease patient. In this study, we aimed at characterizing this mutant Parkin protein by using biochemical and proteomic approaches. We used neuroblastoma cells (SH-SY5Y) as our model and created two inducible cell lines that expressed the wild type and the mutant Parkin proteins. We first investigated the effect of expressing both the wild type and the mutant Parkin proteins on the overall proteome by using 2D-DIGE approach. The experiments yielded the identification of 22 differentially regulated proteins, of which 13 were regulated in the mutant Parkin expressing cells. Classification of the identified proteins based on biological process and molecular function revealed that the majority of the regulated proteins belonged to protein folding and energy metabolism. Ingenuity Pathway Analysis predicted the presence of a link between the regulated proteins of the mutant Parkin expressing cells and Parkinson's disease. We also performed biochemical characterization studies on the wild type and the mutant Parkin proteins to make sense out of the differences observed at the proteome level. Both proteins displayed biological activity, had similar stabilities and localized similarly to the cytoplasm and the nucleus in SH-SY5Y cells. The mutant protein, however, was cut by a protease and subjected to a post-translational modification. The observed differences at the proteome level might be due to the differences in processing of the mutant Parkin protein. Overall, we were able to create a possible link between a pair of Parkin mutations to its pertinent disease by using 2D-DIGE in combination with biochemical and molecular approaches. Copyright © 2015 Elsevier Ltd. All rights reserved.

Differentially expressed genes in the ovary of the sixth day of pupal "Ming" lethal egg mutant of silkworm, Bombyx mori.

PubMed

Gao, Peng; Chen, An-Li; Zhao, Qiao-Ling; Shen, Xing-Jia; Qiu, Zhi-Yong; Xia, Ding-Guo; Tang, Shun-Ming; Zhang, Guo-Zheng

2013-09-15

The "Ming" lethal egg mutant (l-em) is a vitelline membrane mutant in silkworm, Bombyx mori. The eggs laid by the l-em mutant lose water, ultimately causing death within an hour. Previous studies have shown that the deletion of BmEP80 is responsible for the l-em mutation in silkworm, B. mori. In the current study, digital gene expression (DGE) was performed to investigate the difference of gene expression in ovaries between wild type and l-em mutant on the sixth day of the pupal stage to obtain a global view of gene expression profiles using the ovaries of three l-em mutants and three wild types. The results showed a total of 3,463,495 and 3,607,936 clean tags in the wild type and the l-em mutant libraries, respectively. Compared with those of wild type, 239 differentially expressed genes were detected in the l-em mutant, wherein 181 genes are up-regulated and 58 genes are down-regulated in the mutant strain. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis results showed that no pathway was significantly enriched and three pathways are tightly related to protein synthesis among the five leading pathways. Moreover, the expression profiles of eight important differentially expressed genes related to oogenesis changed. These results provide a comprehensive gene expression analysis of oogenesis and vitellogenesis in B. mori which facilitates understanding of both the specific molecular mechanism of the 1-em mutant and Lepidopteran oogenesis in general. Copyright © 2013 Elsevier B.V. All rights reserved.

Phylogenetic distribution and expression of a penicillin-binding protein homologue, Ear and its significance in virulence of Staphylococcus aureus.

PubMed

Singh, Vineet K; Ring, Robert P; Aswani, Vijay; Stemper, Mary E; Kislow, Jennifer; Ye, Zhan; Shukla, Sanjay K

2017-12-01

Staphylococcus aureus is an opportunistic human pathogen that can cause serious infections in humans. A plethora of known and putative virulence factors are produced by staphylococci that collectively orchestrate pathogenesis. Ear protein (Escherichia coli ampicillin resistance) in S. aureus is an exoprotein in COL strain, predicted to be a superantigen, and speculated to play roles in antibiotic resistance and virulence. The goal of this study was to determine if expression of ear is modulated by single nucleotide polymorphisms in its promoter and coding sequences and whether this gene plays roles in antibiotic resistance and virulence. Promoter, coding sequences and expression of the ear gene in clinical and carriage S. aureus strains with distinct genetic backgrounds were analysed. The JE2 strain and its isogenic ear mutant were used in a systemic infection mouse model to determine the competiveness of the ear mutant.Results/Key findings. The ear gene showed a variable expression, with USA300FPR3757 showing a high-level expression compared to many of the other strains tested including some showing negligible expression. Higher expression was associated with agr type 1 but not correlated with phylogenetic relatedness of the ear gene based upon single nucleotide polymorphisms in the promoter or coding regions suggesting a complex regulation. An isogenic JE2 (USA300 background) ear mutant showed no significant difference in its growth, antibiotic susceptibility or virulence in a mouse model. Our data suggests that despite being highly expressed in a USA300 genetic background, Ear is not a significant contributor to virulence in that strain.

Feedback inhibition by thiols outranks glutathione depletion: a luciferase-based screen reveals glutathione-deficient γ -ECS and glutathione synthetase mutants impaired in cadmium-induced sulfate assimilation

PubMed Central

Jobe, Timothy O.; Sung, Dong-Yul; Akmakjian, Garo; Pham, Allis; Komives, Elizabeth A.; Mendoza-Cózatl, David G.; Schroeder, Julian I.

2015-01-01

Summary Plants exposed to heavy metals rapidly induce changes in gene expression that activate and enhance detoxification mechanisms, including toxic-metal chelation and the scavenging of reactive oxygen species. However, the mechanisms mediating toxic heavy metal-induced gene expression remain largely unknown. To genetically elucidate cadmium-specific transcriptional responses in Arabidopsis, we designed a genetic screen based on the activation of a cadmium-inducible reporter gene. Microarray studies identified a high-affinity sulfate transporter (SULTR1;2) among the most robust and rapid cadmium-inducible transcripts. The SULTR1;2 promoter (2.2 kb) was fused with the firefly luciferase reporter gene to quantitatively report the transcriptional response of plants exposed to cadmium. Stably transformed luciferase reporter lines were ethyl methanesulfonate (EMS) mutagenized, and stable M2 seedlings were screened for an abnormal luciferase response during exposure to cadmium. The screen identified non-allelic mutant lines that fell into one of three categories: (i) super response to cadmium (SRC) mutants; (ii) constitutive response to cadmium (CRC) mutants; or (iii) non-response and reduced response to cadmium (NRC) mutants. Two nrc mutants, nrc1 and nrc2, were mapped, cloned and further characterized. The nrc1 mutation was mapped to the γ-glutamylcysteine synthetase gene and the nrc2 mutation was identified as the first viable recessive mutant allele in the glutathione synthetase gene. Moreover, genetic, HPLC mass spectrometry, and gene expression analysis of the nrc1 and nrc2 mutants, revealed that intracellular glutathione depletion alone would be insufficient to induce gene expression of sulfate uptake and assimilation mechanisms. Our results modify the glutathione-depletion driven model for sulfate assimilation gene induction during cadmium stress, and suggest that an enhanced oxidative state and depletion of upstream thiols, in addition to glutathione depletion, are necessary to induce the transcription of sulfate assimilation genes during early cadmium stress. PMID:22283708

Development and translational imaging of a TP53 porcine tumorigenesis model

PubMed Central

Sieren, Jessica C.; Meyerholz, David K.; Wang, Xiao-Jun; Davis, Bryan T.; Newell, John D.; Hammond, Emily; Rohret, Judy A.; Rohret, Frank A.; Struzynski, Jason T.; Goeken, J. Adam; Naumann, Paul W.; Leidinger, Mariah R.; Taghiyev, Agshin; Van Rheeden, Richard; Hagen, Jussara; Darbro, Benjamin W.; Quelle, Dawn E.; Rogers, Christopher S.

2014-01-01

Cancer is the second deadliest disease in the United States, necessitating improvements in tumor diagnosis and treatment. Current model systems of cancer are informative, but translating promising imaging approaches and therapies to clinical practice has been challenging. In particular, the lack of a large-animal model that accurately mimics human cancer has been a major barrier to the development of effective diagnostic tools along with surgical and therapeutic interventions. Here, we developed a genetically modified porcine model of cancer in which animals express a mutation in TP53 (which encodes p53) that is orthologous to one commonly found in humans (R175H in people, R167H in pigs). TP53R167H/R167H mutant pigs primarily developed lymphomas and osteogenic tumors, recapitulating the tumor types observed in mice and humans expressing orthologous TP53 mutant alleles. CT and MRI imaging data effectively detected developing tumors, which were validated by histopathological evaluation after necropsy. Molecular genetic analyses confirmed that these animals expressed the R167H mutant p53, and evaluation of tumors revealed characteristic chromosomal instability. Together, these results demonstrated that TP53R167H/R167H pigs represent a large-animal tumor model that replicates the human condition. Our data further suggest that this model will be uniquely suited for developing clinically relevant, noninvasive imaging approaches to facilitate earlier detection, diagnosis, and treatment of human cancers. PMID:25105366

Pharmacogenetic Features of Inhibitors to Cathepsin B that Improve Memory Deficit and Reduce Beta-Amyloid Related to Alzheimer’s Disease

PubMed Central

Hook, Vivian; Hook, Gregory; Kindy, Mark

2015-01-01

Beta-amyloid (Aβ) in brain is a major factor involved in Alzheimer’s disease (AD) that results in severe memory deficit. Our recent studies demonstrate pharmacogenetic differences in the effects of inhibitors of cathepsin B to improve memory and reduce Aβ in different mouse models of AD. The inhibitors improve memory and reduce brain Aβ in mice expressing the wild-type (WT) β-secretase site of human APP, expressed in most AD patients. However, these inhibitors have no effect in mice expressing the rare Swedish (Swe) mutant APP. Knockout of the cathepsin B decreased brain Aβ in mice expressing WT APP, validating cathepsin B as the target. The specificity of cathepsin B to cleave the WT β-secretase site, but not the Swe mutant site, of APP for Aβ production explains the distinct inhibitor responses in the different AD mouse models. In contrast to cathepsin B, the BACE1 β-secretase prefers to cleave the Swe mutant site. Discussion of BACE1 data in the field indicate that they do not preclude cathepsin B as also being a β-secretase. Cathepsin B and BACE1 may participate jointly as β-secretases. Significantly, the majority of AD patients express WT APP and, therefore, inhibitors of cathepsin B represent candidate drugs for AD. PMID:20536395

The Loss of Vacuolar Protein Sorting 11 (vps11) Causes Retinal Pathogenesis in a Vertebrate Model of Syndromic Albinism

PubMed Central

Thomas, Jennifer L.; Vihtelic, Thomas S.; denDekker, Aaron D.; Willer, Gregory; Luo, Xixia; Murphy, Taylor R.; Gregg, Ronald G.; Hyde, David R.

2011-01-01

Purpose. To establish the zebrafish platinum mutant as a model for studying vision defects caused by syndromic albinism diseases such as Chediak-Higashi syndrome, Griscelli syndrome, and Hermansky-Pudlak syndrome (HPS). Methods. Bulked segregant analysis and candidate gene sequencing revealed that the zebrafish platinum mutation is a single-nucleotide insertion in the vps11 (vacuolar protein sorting 11) gene. Expression of vps11 was determined by RT-PCR and in situ hybridization. Mutants were analyzed for pigmentation defects and retinal disease by histology, immunohistochemistry, and transmission electron microscopy. Results. Phenocopy and rescue experiments determined that a loss of Vps11 results in the platinum phenotype. Expression of vps11 appeared ubiquitous during zebrafish development, with stronger expression in the developing retina and retinal pigmented epithelium (RPE). Zebrafish platinum mutants exhibited reduced pigmentation in the body and RPE; however, melanophore development, migration, and dispersion occurred normally. RPE, photoreceptors, and inner retinal neurons formed normally in zebrafish platinum mutants. However, a gradual loss of RPE, an absence of mature melanosomes, and the subsequent degradation of RPE/photoreceptor interdigitation was observed. Conclusions. These data show that Vps11 is not necessary for normal retinal development or initiation of melanin biosynthesis, but is essential for melanosome maturation and healthy maintenance of the RPE and photoreceptors. PMID:21330665

Mistargeting of a truncated Na-K-2Cl cotransporter in epithelial cells.

PubMed

Koumangoye, Rainelli; Omer, Salma; Delpire, Eric

2018-05-02

We recently reported the case of a young patient with multi-system failure carrying a de novo mutation in SLC12A2, the gene encoding the Na-K-2Cl cotransporter-1. Heterologous expression studies in non-epithelial cells failed to demonstrate dominant-negative effects. In this study, we examined expression of the mutant cotransporter in epithelial cells. Using MDCK cells grown on glass coverslips, permeabilized support, and matrigel, we show that the fluorescently-tagged mutant cotransporter is expressed in cytoplasm and at the apical membrane and affects epithelium integrity. Expression of the mutant transporter at the apical membrane also results in the mislocalization of some of the wild-type transporter to the apical membrane. This mistargeting is specific to NKCC1 as the Na + /K + -ATPase remains localized on the basolateral membrane. To assess transporter localization in vivo, we created a mouse model using CRISPR/cas9 that reproduces the 11 bp deletion in exon 22 of Slc12a2. While the mice do not display an overt phenotype, we show that the colon and salivary gland expresses wild-type NKCC1 abundantly at the apical pole, confirming the data obtained in cultured epithelial cells. Enough cotransporter must remain, however, on the basolateral membrane to participate in saliva secretion, as no significant decrease in saliva production was observed in the mutant mice.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Mutant PFN1 causes ALS phenotypes and progressive motor neuron degeneration in mice by a gain of toxicity

PubMed Central

Yang, Chunxing; Danielson, Eric W.; Qiao, Tao; Metterville, Jake; Brown, Robert H.; Landers, John E.; Xu, Zuoshang

2016-01-01

Mutations in the profilin 1 (PFN1) gene cause amyotrophic lateral sclerosis (ALS), a neurodegenerative disease caused by the loss of motor neurons leading to paralysis and eventually death. PFN1 is a small actin-binding protein that promotes formin-based actin polymerization and regulates numerous cellular functions, but how the mutations in PFN1 cause ALS is unclear. To investigate this problem, we have generated transgenic mice expressing either the ALS-associated mutant (C71G) or wild-type protein. Here, we report that mice expressing the mutant, but not the wild-type, protein had relentless progression of motor neuron loss with concomitant progressive muscle weakness ending in paralysis and death. Furthermore, mutant, but not wild-type, PFN1 forms insoluble aggregates, disrupts cytoskeletal structure, and elevates ubiquitin and p62/SQSTM levels in motor neurons. Unexpectedly, the acceleration of motor neuron degeneration precedes the accumulation of mutant PFN1 aggregates. These results suggest that although mutant PFN1 aggregation may contribute to neurodegeneration, it does not trigger its onset. Importantly, these experiments establish a progressive disease model that can contribute toward identifying the mechanisms of ALS pathogenesis and the development of therapeutic treatments. PMID:27681617

The RNA Chaperone Hfq Is Involved in Stress Tolerance and Virulence in Uropathogenic Proteus mirabilis

PubMed Central

Wang, Min-Cheng; Liaw, Shwu-Jen

2014-01-01

Hfq is a bacterial RNA chaperone involved in the riboregulation of diverse genes via small noncoding RNAs. Here, we show that Hfq is critical for the uropathogenic Proteus mirabilis to effectively colonize the bladder and kidneys in a murine urinary tract infection (UTI) model and to establish burned wound infection of the rats. In this regard, we found the hfq mutant induced higher IL-8 and MIF levels of uroepithelial cells and displayed reduced intra-macrophage survival. The loss of hfq affected bacterial abilities to handle H2O2 and osmotic pressures and to grow at 50°C. Relative to wild-type, the hfq mutant had reduced motility, fewer flagella and less hemolysin expression and was less prone to form biofilm and to adhere to and invade uroepithelial cells. The MR/P fimbrial operon was almost switched to the off phase in the hfq mutant. In addition, we found the hfq mutant exhibited an altered outer membrane profile and had higher RpoE expression, which indicates the hfq mutant may encounter increased envelope stress. With the notion of envelope disturbance in the hfq mutant, we found increased membrane permeability and antibiotic susceptibilities in the hfq mutant. Finally, we showed that Hfq positively regulated the RpoS level and tolerance to H2O2 in the stationary phase seemed largely mediated through the Hfq-dependent RpoS expression. Together, our data indicate that Hfq plays a critical role in P. mirabilis to establish UTIs by modulating stress responses, surface structures and virulence factors. This study suggests Hfq may serve as a scaffold molecule for development of novel anti-P. mirabilis drugs and P. mirabilis hfq mutant is a vaccine candidate for preventing UTIs. PMID:24454905

Production of MPS VII mouse (Gustm(hE540A·mE536A)Sly) doubly tolerant to human and mouse β-glucuronidase

PubMed Central

Tomatsu, Shunji; Orii, Koji O.; Vogler, Carole; Grubb, Jeffrey H.; Snella, Elizabeth M.; Gutierrez, Monica; Dieter, Tatiana; Holden, Christopher C.; Sukegawa, Kazuko; Orii, Tadao; Kondo, Naomi; Sly, William S.

2006-01-01

Mucopolysaccharidosis VII (MPS VII, Sly syndrome) is an autosomal recessive lysosomal storage disease caused by β-glucuronidase (GUS) deficiency. A naturally occurring mouse model of that disease has been very useful for studying experimental approaches to therapy. However, immune responses can complicate evaluation of the long-term benefits of enzyme replacement or gene therapy delivered to adult MPS VII mice. To make this model useful for studying the long-term effectiveness and side effects of experimental therapies delivered to adult mice, we developed a new MPS VII mouse model, which is tolerant to both human and murine GUS. To achieve this, we used homologous recombination to introduce simultaneously a human cDNA transgene expressing inactive human GUS into intron 9 of the murine Gus gene and a targeted active site mutation (E536A) into the adjacent exon 10. When the heterozygote products of germline transmission were bred to homozygosity, the homozygous mice expressed no GUS enzyme activity but expressed inactive human GUS protein highly and were tolerant to immune challenge with human enzyme. Expression of the mutant murine Gus gene was reduced to about 10% of normal levels, but the inactive murine GUS enzyme also conferred tolerance to murine GUS. This MPS VII mouse model should be useful to evaluate therapeutic responses in adult mice receiving repetitive doses of enzyme or mice receiving gene therapy as adults. Heterozygotes expressed only 9.5–26% of wild-type levels of murine GUS instead of the expected 50%, indicating a dominant-negative effect of the mutant enzyme monomers on the activity of GUS tetramers in different tissues. Corrective gene therapy in this model should provide high enough levels of expression of normal GUS monomers to overcome the dominant negative effect of mutant monomers on newly synthesized GUS tetramers in most tissues. PMID:12700165

Resistance to collagen-induced arthritis in SHPS-1 mutant mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Okuzawa, Chie; Kaneko, Yoriaki; Murata, Yoji

SHPS-1 is a transmembrane protein that binds the protein tyrosine phosphatases SHP-1 and SHP-2 through its cytoplasmic region and is abundantly expressed on dendritic cells and macrophages. Here we show that mice expressing a mutant form of SHPS-1 fail to develop type-II collagen (CII)-induced arthritis (CIA), a model for rheumatoid arthritis in humans. Histological examinations of the arthritic paws from immunized wild-type mice revealed that cartilage was destroyed in association with marked mononuclear cell infiltration, while only mild cell infiltration was observed in immunized SHPS-1 mutant mice. Consistently, the serum levels of both IgG and IgG2a specific to CII andmore » of IL-1{beta} in immunized SHPS-1 mutant mice were markedly reduced compared with those apparent for wild-type mice. The CII-induced proliferation of, and production of cytokines by, T cells from immunized SHPS-1 mutant mice were reduced compared to wild-type cells. These results suggest that SHPS-1 is essential for development of CIA.« less

Nav1.7-A1632G Mutation from a Family with Inherited Erythromelalgia: Enhanced Firing of Dorsal Root Ganglia Neurons Evoked by Thermal Stimuli.

PubMed

Yang, Yang; Huang, Jianying; Mis, Malgorzata A; Estacion, Mark; Macala, Lawrence; Shah, Palak; Schulman, Betsy R; Horton, Daniel B; Dib-Hajj, Sulayman D; Waxman, Stephen G

2016-07-13

Voltage-gated sodium channel Nav1.7 is a central player in human pain. Mutations in Nav1.7 produce several pain syndromes, including inherited erythromelalgia (IEM), a disorder in which gain-of-function mutations render dorsal root ganglia (DRG) neurons hyperexcitable. Although patients with IEM suffer from episodes of intense burning pain triggered by warmth, the effects of increased temperature on DRG neurons expressing mutant Nav1.7 channels have not been well documented. Here, using structural modeling, voltage-clamp, current-clamp, and multielectrode array recordings, we have studied a newly identified Nav1.7 mutation, Ala1632Gly, from a multigeneration family with IEM. Structural modeling suggests that Ala1632 is a molecular hinge and that the Ala1632Gly mutation may affect channel gating. Voltage-clamp recordings revealed that the Nav1.7-A1632G mutation hyperpolarizes activation and depolarizes fast-inactivation, both gain-of-function attributes at the channel level. Whole-cell current-clamp recordings demonstrated increased spontaneous firing, lower current threshold, and enhanced evoked firing in rat DRG neurons expressing Nav1.7-A1632G mutant channels. Multielectrode array recordings further revealed that intact rat DRG neurons expressing Nav1.7-A1632G mutant channels are more active than those expressing Nav1.7 WT channels. We also showed that physiologically relevant thermal stimuli markedly increase the mean firing frequencies and the number of active rat DRG neurons expressing Nav1.7-A1632G mutant channels, whereas the same thermal stimuli only increase these parameters slightly in rat DRG neurons expressing Nav1.7 WT channels. The response of DRG neurons expressing Nav1.7-A1632G mutant channels upon increase in temperature suggests a cellular basis for warmth-triggered pain in IEM. Inherited erythromelalgia (IEM), a severe pain syndrome characterized by episodes of intense burning pain triggered by warmth, is caused by mutations in sodium channel Nav1.7, which are preferentially expressed in sensory and sympathetic neurons. More than 20 gain-of-function Nav1.7 mutations have been identified from IEM patients, but the question of how warmth triggers episodes of pain in IEM has not been well addressed. Combining multielectrode array, voltage-clamp, and current-clamp recordings, we assessed a newly identified IEM mutation (Nav1.7-A1632G) from a multigeneration family. Our data demonstrate gain-of-function attributes at the channel level and differential effects of physiologically relevant thermal stimuli on the excitability of DRG neurons expressing mutant and WT Nav1.7 channels, suggesting a cellular mechanism for warmth-triggered pain episodes in IEM patients. Copyright © 2016 the authors 0270-6474/16/367512-12$15.00/0.

Modelling Delta-Notch perturbations during zebrafish somitogenesis.

PubMed

Murray, Philip J; Maini, Philip K; Baker, Ruth E

2013-01-15

The discovery over the last 15 years of molecular clocks and gradients in the pre-somitic mesoderm of numerous vertebrate species has added significant weight to Cooke and Zeeman's 'clock and wavefront' model of somitogenesis, in which a travelling wavefront determines the spatial position of somite formation and the somitogenesis clock controls periodicity (Cooke and Zeeman, 1976). However, recent high-throughput measurements of spatiotemporal patterns of gene expression in different zebrafish mutant backgrounds allow further quantitative evaluation of the clock and wavefront hypothesis. In this study we describe how our recently proposed model, in which oscillator coupling drives the propagation of an emergent wavefront, can be used to provide mechanistic and testable explanations for the following observed phenomena in zebrafish embryos: (a) the variation in somite measurements across a number of zebrafish mutants; (b) the delayed formation of somites and the formation of 'salt and pepper' patterns of gene expression upon disruption of oscillator coupling; and (c) spatial correlations in the 'salt and pepper' patterns in Delta-Notch mutants. In light of our results, we propose a number of plausible experiments that could be used to further test the model. Copyright © 2012 Elsevier Inc. All rights reserved.

Heterozygous inactivation of tsc2 enhances tumorigenesis in p53 mutant zebrafish

PubMed Central

Kim, Seok-Hyung; Kowalski, Marie L.; Carson, Robert P.; Bridges, L. Richard; Ess, Kevin C.

2013-01-01

SUMMARY Tuberous sclerosis complex (TSC) is a multi-organ disorder caused by mutations of the TSC1 or TSC2 genes. A key function of these genes is to inhibit mTORC1 (mechanistic target of rapamycin complex 1) kinase signaling. Cells deficient for TSC1 or TSC2 have increased mTORC1 signaling and give rise to benign tumors, although, as a rule, true malignancies are rarely seen. In contrast, other disorders with increased mTOR signaling typically have overt malignancies. A better understanding of genetic mechanisms that govern the transformation of benign cells to malignant ones is crucial to understand cancer pathogenesis. We generated a zebrafish model of TSC and cancer progression by placing a heterozygous mutation of the tsc2 gene in a p53 mutant background. Unlike tsc2 heterozygous mutant zebrafish, which never exhibited cancers, compound tsc2;p53 mutants had malignant tumors in multiple organs. Tumorigenesis was enhanced compared with p53 mutant zebrafish. p53 mutants also had increased mTORC1 signaling that was further enhanced in tsc2;p53 compound mutants. We found increased expression of Hif1-α, Hif2-α and Vegf-c in tsc2;p53 compound mutant zebrafish compared with p53 mutant zebrafish. Expression of these proteins probably underlies the increased angiogenesis seen in compound mutant zebrafish compared with p53 mutants and might further drive cancer progression. Treatment of p53 and compound mutant zebrafish with the mTORC1 inhibitor rapamycin caused rapid shrinkage of tumor size and decreased caliber of tumor-associated blood vessels. This is the first report using an animal model to show interactions between tsc2, mTORC1 and p53 during tumorigenesis. These results might explain why individuals with TSC rarely have malignant tumors, but also suggest that cancer arising in individuals without TSC might be influenced by the status of TSC1 and/or TSC2 mutations and be potentially treatable with mTORC1 inhibitors. PMID:23580196

A Factor Linking Floral Organ Identity and Growth Revealed by Characterization of the Tomato Mutant unfinished flower development (ufd).

PubMed

Poyatos-Pertíñez, Sandra; Quinet, Muriel; Ortíz-Atienza, Ana; Yuste-Lisbona, Fernando J; Pons, Clara; Giménez, Estela; Angosto, Trinidad; Granell, Antonio; Capel, Juan; Lozano, Rafael

2016-01-01

Floral organogenesis requires coordinated interactions between genes specifying floral organ identity and those regulating growth and size of developing floral organs. With the aim to isolate regulatory genes linking both developmental processes (i.e., floral organ identity and growth) in the tomato model species, a novel mutant altered in the formation of floral organs was further characterized. Under normal growth conditions, floral organ primordia of mutant plants were correctly initiated, however, they were unable to complete their development impeding the formation of mature and fertile flowers. Thus, the growth of floral buds was blocked at an early stage of development; therefore, we named this mutant as unfinished flower development ( ufd ). Genetic analysis performed in a segregating population of 543 plants showed that the abnormal phenotype was controlled by a single recessive mutation. Global gene expression analysis confirmed that several MADS-box genes regulating floral identity as well as other genes participating in cell division and different hormonal pathways were affected in their expression patterns in ufd mutant plants. Moreover, ufd mutant inflorescences showed higher hormone contents, particularly ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) and strigol compared to wild type. Such results indicate that UFD may have a key function as positive regulator of the development of floral primordia once they have been initiated in the four floral whorls. This function should be performed by affecting the expression of floral organ identity and growth genes, together with hormonal signaling pathways.

Suppression of calbindin-D28k expression exacerbates SCA1 phenotype in a disease mouse model.

PubMed

Vig, Parminder J S; Wei, Jinrong; Shao, Qingmei; Lopez, Maripar E; Halperin, Rebecca; Gerber, Jill

2012-09-01

Spinocerebellar ataxia type 1 (SCA1) is an autosomal dominant neurological disorder caused by the expansion of a polyglutamine tract in the mutant protein ataxin-1. The cerebellar Purkinje cells (PCs) are the major targets of mutant ataxin-1. The mechanism of PC death in SCA1 is not known; however, previous work indicates that downregulation of specific proteins involved in calcium homeostasis and signaling by mutant ataxin-1 is the probable cause of PC degeneration in SCA1. In this study, we explored if targeted deprivation of PC specific calcium-binding protein calbindin-D28k (CaB) exacerbates ataxin-1 mediated toxicity in SCA1 transgenic (Tg) mice. Using behavioral tests, we found that though both SCA1/+ and SCA1/+: CaB null (-/+) double mutants exhibited progressive impaired performance on the rotating rod, a simultaneous enhancement of exploratory activity, and absence of deficits in coordination, the double mutants were more severely impaired than SCA1/+ mice. With increasing age, SCA1/+ mice showed a progressive loss in the expression and localization of CaB and other PC specific calcium-binding and signaling proteins. In double mutants, these changes were more pronounced and had an earlier onset. Gene expression profiling of young mice exhibiting no behavior or biochemical deficits revealed a differential expression of many genes common to SCA1/+ and CaB-/+ lines, and unique to SCA1/+: CaB-/+ phenotype. Our study provides further evidence for a critical role of CaB in SCA1 pathogenesis, which may help identify new therapeutic targets to treat SCA1 or other cerebellar ataxias.

Pharmacochaperoning in a Drosophila model system rescues human dopamine transporter variants associated with infantile/juvenile parkinsonism

PubMed Central

Asjad, H. M. Mazhar; Kasture, Ameya; El-Kasaby, Ali; Sackel, Michael; Hummel, Thomas; Freissmuth, Michael; Sucic, Sonja

2017-01-01

Point mutations in the gene encoding the human dopamine transporter (hDAT, SLC6A3) cause a syndrome of infantile/juvenile dystonia and parkinsonism. To unravel the molecular mechanism underlying these disorders and investigate possible pharmacological therapies, here we examined 13 disease-causing DAT mutants that were retained in the endoplasmic reticulum when heterologously expressed in HEK293 cells. In three of these mutants, i.e. hDAT-V158F, hDAT-G327R, and hDAT-L368Q, the folding deficit was remedied with the pharmacochaperone noribogaine or the heat shock protein 70 (HSP70) inhibitor pifithrin-μ such that endoplasmic reticulum export of and radioligand binding and substrate uptake by these DAT mutants were restored. In Drosophila melanogaster, DAT deficiency results in reduced sleep. We therefore exploited the power of targeted transgene expression of mutant hDAT in Drosophila to explore whether these hDAT mutants could also be pharmacologically rescued in an intact organism. Noribogaine or pifithrin-μ treatment supported hDAT delivery to the presynaptic terminals of dopaminergic neurons and restored sleep to normal length in DAT-deficient (fumin) Drosophila lines expressing hDAT-V158F or hDAT-G327R. In contrast, expression of hDAT-L368Q in the Drosophila DAT mutant background caused developmental lethality, indicating a toxic action not remedied by pharmacochaperoning. Our observations identified those mutations most likely amenable to pharmacological rescue in the affected children. In addition, our findings also highlight the challenges of translating insights from pharmacochaperoning in cell culture to the clinical situation. Because of the evolutionary conservation in dopaminergic neurotransmission between Drosophila and people, pharmacochaperoning of DAT in D. melanogaster may allow us to bridge that gap. PMID:28972153

Candidate genes for panhypopituitarism identified by gene expression profiling

PubMed Central

Mortensen, Amanda H.; MacDonald, James W.; Ghosh, Debashis

2011-01-01

Mutations in the transcription factors PROP1 and PIT1 (POU1F1) lead to pituitary hormone deficiency and hypopituitarism in mice and humans. The dysmorphology of developing Prop1 mutant pituitaries readily distinguishes them from those of Pit1 mutants and normal mice. This and other features suggest that Prop1 controls the expression of genes besides Pit1 that are important for pituitary cell migration, survival, and differentiation. To identify genes involved in these processes we used microarray analysis of gene expression to compare pituitary RNA from newborn Prop1 and Pit1 mutants and wild-type littermates. Significant differences in gene expression were noted between each mutant and their normal littermates, as well as between Prop1 and Pit1 mutants. Otx2, a gene critical for normal eye and pituitary development in humans and mice, exhibited elevated expression specifically in Prop1 mutant pituitaries. We report the spatial and temporal regulation of Otx2 in normal mice and Prop1 mutants, and the results suggest Otx2 could influence pituitary development by affecting signaling from the ventral diencephalon and regulation of gene expression in Rathke's pouch. The discovery that Otx2 expression is affected by Prop1 deficiency provides support for our hypothesis that identifying molecular differences in mutants will contribute to understanding the molecular mechanisms that control pituitary organogenesis and lead to human pituitary disease. PMID:21828248

MtPAR MYB transcription factor acts as an on switch for proanthocyanidin biosynthesis in Medicago truncatula

PubMed Central

Verdier, Jerome; Zhao, Jian; Torres-Jerez, Ivone; Ge, Shujun; Liu, Chenggang; He, Xianzhi; Mysore, Kirankumar S.; Dixon, Richard A.; Udvardi, Michael K.

2012-01-01

MtPAR (Medicago truncatula proanthocyanidin regulator) is an MYB family transcription factor that functions as a key regulator of proanthocyanidin (PA) biosynthesis in the model legume Medicago truncatula. MtPAR expression is confined to the seed coat, the site of PA accumulation. Loss-of-function par mutants contained substantially less PA in the seed coat than the wild type, whereas levels of anthocyanin and other specialized metabolites were normal in the mutants. In contrast, massive accumulation of PAs occurred when MtPAR was expressed ectopically in transformed hairy roots of Medicago. Transcriptome analysis of par mutants and MtPAR-expressing hairy roots, coupled with yeast one-hybrid analysis, revealed that MtPAR positively regulates genes encoding enzymes of the flavonoid–PA pathway via a probable activation of WD40-1. Expression of MtPAR in the forage legume alfalfa (Medicago sativa) resulted in detectable levels of PA in shoots, highlighting the potential of this gene for biotechnological strategies to increase PAs in forage legumes for reduction of pasture bloat in ruminant animals. PMID:22307644

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Mutant HNF-1{alpha} and mutant HNF-1{beta} identified in MODY3 and MODY5 downregulate DPP-IV gene expression in Caco-2 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gu Ning; Laboratory of Neurochemistry, Graduate School of Human and Environmental Studies, Kyoto University, Kyoto; Adachi, Tetsuya

2006-08-04

Dipeptidylpeptidase IV (DPP-IV) is a well-documented drug target for the treatment of type 2 diabetes. Hepatocyte nuclear factors (HNF)-1{alpha} and HNF-1{beta}, known as the causal genes of MODY3 and MODY5, respectively, have been reported to be involved in regulation of DPP-IV gene expression. But, it is not completely clear (i) that they play roles in regulation of DPP-IV gene expression, and (ii) whether DPP-IV gene activity is changed by mutant HNF-1{alpha} and mutant HNF-1{beta} in MODY3 and MODY5. To explore these questions, we investigated transactivation effects of wild HNF-1{alpha} and 13 mutant HNF-1{alpha}, as well as wild HNF-1{beta} and 2more » mutant HNF-1{beta}, on DPP-IV promoter luciferase gene in Caco-2 cells by means of a transient experiment. Both wild HNF-1{alpha} and wild HNF-1{beta} significantly transactivated DPP-IV promoter, but mutant HNF-1{alpha} and mutant HNF-1{beta} exhibited low transactivation activity. Moreover, to study whether mutant HNF-1{alpha} and mutant HNF-1{beta} change endogenous DPP-IV enzyme activity, we produced four stable cell lines from Caco-2 cells, in which wild HNF-1{alpha} or wild HNF-1{beta}, or else respective dominant-negative mutant HNF-1{alpha}T539fsdelC or dominant-negative mutant HNF-1{beta}R177X, was stably expressed. We found that DPP-IV gene expression and enzyme activity were significantly increased in wild HNF-1{alpha} cells and wild HNF-1{beta} cells, whereas they decreased in HNF-1{alpha}T539fsdelC cells and HNF-1{beta}R177X cells, compared with DPP-IV gene expression and enzyme activity in Caco-2 cells. These results suggest that both wild HNF-1{alpha} and wild HNF-1{beta} have a stimulatory effect on DPP-IV gene expression, but that mutant HNF-1{alpha} and mutant HNF-1{beta} attenuate the stimulatory effect.« less

σK of Clostridium acetobutylicum Is the First Known Sporulation-Specific Sigma Factor with Two Developmentally Separated Roles, One Early and One Late in Sporulation

PubMed Central

Al-Hinai, Mohab A.; Jones, Shawn W.

2014-01-01

Sporulation in the model endospore-forming organism Bacillus subtilis proceeds via the sequential and stage-specific activation of the sporulation-specific sigma factors, σH (early), σF, σE, σG, and σK (late). Here we show that the Clostridium acetobutylicum σK acts both early, prior to Spo0A expression, and late, past σG activation, thus departing from the B. subtilis model. The C. acetobutylicum sigK deletion (ΔsigK) mutant was unable to sporulate, and solventogenesis, the characteristic stationary-phase phenomenon for this organism, was severely diminished. Transmission electron microscopy demonstrated that the ΔsigK mutant does not develop an asymmetric septum and produces no granulose. Complementation of sigK restored sporulation and solventogenesis to wild-type levels. Spo0A and σG proteins were not detectable by Western analysis, while σF protein levels were significantly reduced in the ΔsigK mutant. spo0A, sigF, sigE, sigG, spoIIE, and adhE1 transcript levels were all downregulated in the ΔsigK mutant, while those of the sigH transcript were unaffected during the exponential and transitional phases of culture. These data show that σK is necessary for sporulation prior to spo0A expression. Plasmid-based expression of spo0A in the ΔsigK mutant from a nonnative promoter restored solventogenesis and the production of Spo0A, σF, σE, and σG, but not sporulation, which was blocked past the σG stage of development, thus demonstrating that σK is also necessary in late sporulation. sigK is expressed very early at low levels in exponential phase but is strongly upregulated during the middle to late stationary phase. This is the first sporulation-specific sigma factor shown to have two developmentally separated roles. PMID:24187083

σK of Clostridium acetobutylicum is the first known sporulation-specific sigma factor with two developmentally separated roles, one early and one late in sporulation.

PubMed

Al-Hinai, Mohab A; Jones, Shawn W; Papoutsakis, Eleftherios T

2014-01-01

Sporulation in the model endospore-forming organism Bacillus subtilis proceeds via the sequential and stage-specific activation of the sporulation-specific sigma factors, σ(H) (early), σ(F), σ(E), σ(G), and σ(K) (late). Here we show that the Clostridium acetobutylicum σ(K) acts both early, prior to Spo0A expression, and late, past σ(G) activation, thus departing from the B. subtilis model. The C. acetobutylicum sigK deletion (ΔsigK) mutant was unable to sporulate, and solventogenesis, the characteristic stationary-phase phenomenon for this organism, was severely diminished. Transmission electron microscopy demonstrated that the ΔsigK mutant does not develop an asymmetric septum and produces no granulose. Complementation of sigK restored sporulation and solventogenesis to wild-type levels. Spo0A and σ(G) proteins were not detectable by Western analysis, while σ(F) protein levels were significantly reduced in the ΔsigK mutant. spo0A, sigF, sigE, sigG, spoIIE, and adhE1 transcript levels were all downregulated in the ΔsigK mutant, while those of the sigH transcript were unaffected during the exponential and transitional phases of culture. These data show that σ(K) is necessary for sporulation prior to spo0A expression. Plasmid-based expression of spo0A in the ΔsigK mutant from a nonnative promoter restored solventogenesis and the production of Spo0A, σ(F), σ(E), and σ(G), but not sporulation, which was blocked past the σ(G) stage of development, thus demonstrating that σ(K) is also necessary in late sporulation. sigK is expressed very early at low levels in exponential phase but is strongly upregulated during the middle to late stationary phase. This is the first sporulation-specific sigma factor shown to have two developmentally separated roles.

Interferon β induces clearance of mutant ataxin 7 and improves locomotion in SCA7 knock-in mice.

PubMed

Chort, Alice; Alves, Sandro; Marinello, Martina; Dufresnois, Béatrice; Dornbierer, Jean-Gabriel; Tesson, Christelle; Latouche, Morwena; Baker, Darren P; Barkats, Martine; El Hachimi, Khalid H; Ruberg, Merle; Janer, Alexandre; Stevanin, Giovanni; Brice, Alexis; Sittler, Annie

2013-06-01

We showed previously, in a cell model of spinocerebellar ataxia 7, that interferon beta induces the expression of PML protein and the formation of PML protein nuclear bodies that degrade mutant ataxin 7, suggesting that the cytokine, used to treat multiple sclerosis, might have therapeutic value in spinocerebellar ataxia 7. We now show that interferon beta also induces PML-dependent clearance of ataxin 7 in a preclinical model, SCA7(266Q/5Q) knock-in mice, and improves motor function. Interestingly, the presence of mutant ataxin 7 in the mice induces itself the expression of endogenous interferon beta and its receptor. Immunohistological studies in brains from two patients with spinocerebellar ataxia 7 confirmed that these modifications are also caused by the disease in humans. Interferon beta, administered intraperitoneally three times a week in the knock-in mice, was internalized with its receptor in Purkinje and other cells and translocated to the nucleus. The treatment induced PML protein expression and the formation of PML protein nuclear bodies and decreased mutant ataxin 7 in neuronal intranuclear inclusions, the hallmark of the disease. No reactive gliosis or other signs of toxicity were observed in the brain or internal organs. The performance of the SCA7(266Q/5Q) knock-in mice was significantly improved on two behavioural tests sensitive to cerebellar function: the Locotronic® Test of locomotor function and the Beam Walking Test of balance, motor coordination and fine movements, which are affected in patients with spinocerebellar ataxia 7. In addition to motor dysfunction, SCA7(266Q/5Q) mice present abnormalities in the retina as in patients: ataxin 7-positive neuronal intranuclear inclusions that were reduced by interferon beta treatment. Finally, since neuronal death does not occur in the cerebellum of SCA7(266Q/5Q) mice, we showed in primary cell cultures expressing mutant ataxin 7 that interferon beta treatment improves Purkinje cell survival.

Characterization of Staphylococcus aureus mutants expressing reduced susceptibility to common house-cleaners

PubMed Central

Davis, A.O.; O’Leary, J.O.; Muthaiyan, A.; Langevin, M.J.; Delgado, A.; Abalos, A.T.; Fajardo, A.R.; Marek, J.; Wilkinson, B.J.; Gustafson, J.E.

2013-01-01

Aims To characterize mutants of Staphylococcus aureus expressing reduced susceptibility to house cleaners (HC), assess the impact of the alternative sigma factor SigB on HC susceptibility, and determine the MIC of clinical methicillin-resistant S. aureus (MRSA) to a HC. Methods and Results Susceptibility to HC, HC components, H2O2, vancomycin and oxacillin and physiological parameters were determined for HC-reduced susceptibility (HCRS) mutants, parent strain COL and COLsigB::kan. HCRS mutants selected with three HC expressed reduced susceptibility to multiple HC, HC components, H2O2 and vancomycin. Two unique HCRS mutants also lost the methicillin resistance determinant. In addition, all HCRS mutants exhibited better growth at two temperatures, and one HCRS mutant expressed reduced carotenoid production. COLsigB::kan demonstrated increased susceptibility to all HC and many HC components. sigB operon mutations were not detected in one HCRS mutant background. Of 76 clinical MRSA, 20 exhibited reduced susceptibility to a HC. Conclusions HCRS mutants demonstrate altered susceptibility to multiple antimicrobials. While sigB is required for full HC resistance, one HCRS mechanism does not involve sigB operon mutations. Clinical MRSA expressing reduced susceptibility to a common HC were detected. Significance and Impact of the Study This study suggests that HCRS mutants are not protected against, nor selected by, practical HC concentrations. PMID:15659191

The two-component system GrvRS (EtaRS) regulates ace expression in Enterococcus faecalis OG1RF.

PubMed

Roh, Jung Hyeob; Singh, Kavindra V; La Rosa, Sabina Leanti; Cohen, Ana Luisa V; Murray, Barbara E

2015-01-01

Expression of ace (adhesin to collagen of Enterococcus faecalis), encoding a virulence factor in endocarditis and urinary tract infection models, has been shown to increase under certain conditions, such as in the presence of serum, bile salts, urine, and collagen and at 46 °C. However, the mechanism of ace/Ace regulation under different conditions is still unknown. In this study, we identified a two-component regulatory system GrvRS as the main regulator of ace expression under these stress conditions. Using Northern hybridization and β-galactosidase assays of an ace promoter-lacZ fusion, we found transcription of ace to be virtually absent in a grvR deletion mutant under the conditions that increase ace expression in wild-type OG1RF and in the complemented strain. Moreover, a grvR mutant revealed decreased collagen binding and biofilm formation as well as attenuation in a murine urinary tract infection model. Here we show that GrvR plays a major role in control of ace expression and E. faecalis virulence. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Nppa and Nppb act redundantly during zebrafish cardiac development to confine AVC marker expression and reduce cardiac jelly volume.

PubMed

Grassini, Daniela R; Lagendijk, Anne K; De Angelis, Jessica E; Da Silva, Jason; Jeanes, Angela; Zettler, Nicole; Bower, Neil I; Hogan, Benjamin M; Smith, Kelly A

2018-05-11

Atrial natriuretic peptide ( nppa/anf ) and brain natriuretic peptide ( nppb/bnp ) form a gene cluster with expression in the chambers of the developing heart. Despite restricted expression, a function in cardiac development has not been demonstrated by mutant analysis. This is attributed to functional redundancy however their genomic location in cis has impeded formal analysis. Using genome-editing, we generated mutants for nppa and nppb and found single mutants indistinguishable from wildtype whereas nppa / nppb double mutants display heart morphogenesis defects and pericardial oedema. Analysis of atrioventricular canal (AVC) markers show expansion of bmp4 , tbx2b, has2 and versican expression into the atrium of double mutants. This expanded expression correlates with increased extracellular matrix in the atrium. Using a biosensor for Hyaluronic acid to measure the cardiac jelly (cardiac extracellular matrix), we confirm cardiac jelly expansion in nppa / nppb double mutants. Finally, bmp4 knockdown rescues the expansion of has2 expression and cardiac jelly in double mutants. This definitively shows that nppa and nppb function redundantly during cardiac development to restrict gene expression to the AVC, preventing excessive cardiac jelly synthesis in the atrial chamber. © 2018. Published by The Company of Biologists Ltd.

Immunogenicity of a meningococcal native outer membrane vesicle vaccine with attenuated endotoxin and over-expressed factor H binding protein in infant rhesus monkeys

PubMed Central

Koeberling, Oliver; Seubert, Anja; Santos, George; Colaprico, Annalisa; Ugozzoli, Mildred; Donnelly, John; Granoff, Dan M.

2011-01-01

We previously investigated immunogenicity of meningococcal native outer membrane vesicle (NOMV) vaccines prepared from recombinant strains with attenuated endotoxin (ΔLpxL1) and over-expressed factor H binding protein (fHbp) in a mouse model. The vaccines elicited broad serum bactericidal antibody responses. While human toll-like receptor 4 (TLR-4) is mainly stimulated by wildtype meningococcal endotoxin, mouse TLR-4 is stimulated by both the wildtype and mutant endotoxin. An adjuvant effect in mice of the mutant endotoxin would be expected to be much less in humans, and may have contributed to the broad mouse bactericidal responses. Here we show that as previously reported for humans, rhesus primate peripheral blood mononuclear cells incubated with a NOMV vaccine from ΔLpxL1 recombinant strains had lower proinflammatory cytokine responses than with a control wildtype NOMV vaccine. The cytokine responses to the mutant vaccine were similar to those elicited by a detergent-treated, wildtype outer membrane vesicle vaccine that had been safely administered to humans. Monkeys (N=4) were immunized beginning at ages 2 to 3 months with three doses of a NOMV vaccine prepared from ΔLpxL1 recombinant strains with over-expressed fHbp in the variant 1 and 2 groups. The mutant NOMV vaccine elicited serum bactericidal titers ≥1:4 against all 10 genetically diverse strains tested, including 9 with heterologous PorA to those in the vaccine. Negative-control animals had serum bactericidal titers <1:4. Thus, the mutant NOMV vaccine elicited broadly protective serum antibodies in a non-human infant primate model that is more relevant for predicting human antibody responses than mice. PMID:21571025

Gene mapping and functional analysis of the novel leaf color gene SiYGL1 in foxtail millet [Setaria italica (L.) P. Beauv].

PubMed

Li, Wen; Tang, Sha; Zhang, Shuo; Shan, Jianguo; Tang, Chanjuan; Chen, Qiannan; Jia, Guanqing; Han, Yuanhuai; Zhi, Hui; Diao, Xianmin

2016-05-01

Setaria italica and its wild ancestor Setaria viridis are emerging as model systems for genetics and functional genomics research. However, few systematic gene mapping or functional analyses have been reported in these promising C4 models. We herein isolated the yellow-green leaf mutant (siygl1) in S. italica using forward genetics approaches. Map-based cloning revealed that SiYGL1, which is a recessive nuclear gene encoding a magnesium-chelatase D subunit (CHLD), is responsible for the mutant phenotype. A single Phe to Leu amino acid change occurring near the ATPase-conserved domain resulted in decreased chlorophyll (Chl) accumulation and modified chloroplast ultrastructure. However, the mutation enhanced the light-use efficiency of the siygl1 mutant, suggesting that the mutated CHLD protein does not completely lose its original activity, but instead, gains novel features. A transcriptional analysis of Chl a oxygenase revealed that there is a strong negative feedback control of Chl b biosynthesis in S. italica. The SiYGL1 mRNA was expressed in all examined tissues, with higher expression observed in the leaves. Comparison of gene expression profiles in wild-type and siygl1 mutant plants indicated that SiYGL1 regulates a subset of genes involved in photosynthesis (rbcL and LHCB1), thylakoid development (DEG2) and chloroplast signaling (SRP54CP). These results provide information regarding the mutant phenotype at the transcriptional level. This study demonstrated that the genetic material of a Setaria species could be ideal for gene discovery investigations using forward genetics approaches and may help to explain the molecular mechanisms associated with leaf color variation. © 2015 Scandinavian Plant Physiology Society.

Involvement of Clostridium botulinum ATCC 3502 Sigma Factor K in Early-Stage Sporulation

PubMed Central

Kirk, David G.; Dahlsten, Elias; Zhang, Zhen; Korkeala, Hannu

2012-01-01

A key survival mechanism of Clostridium botulinum, the notorious neurotoxic food pathogen, is the ability to form heat-resistant spores. While the genetic mechanisms of sporulation are well understood in the model organism Bacillus subtilis, nothing is known about these mechanisms in C. botulinum. Using the ClosTron gene-knockout tool, sigK, encoding late-stage (stage IV) sporulation sigma factor K in B. subtilis, was disrupted in C. botulinum ATCC 3502 to produce two different mutants with distinct insertion sites and orientations. Both mutants were unable to form spores, and their elongated cell morphology suggested that the sporulation pathway was blocked at an early stage. In contrast, sigK-complemented mutants sporulated successfully. Quantitative real-time PCR analysis of sigK in the parent strain revealed expression at the late log growth phase in the parent strain. Analysis of spo0A, encoding the sporulation master switch, in the sigK mutant and the parent showed significantly reduced relative levels of spo0A expression in the sigK mutant compared to the parent strain. Similarly, sigF showed significantly lower relative transcription levels in the sigK mutant than the parent strain, suggesting that the sporulation pathway was blocked in the sigK mutant at an early stage. We conclude that σK is essential for early-stage sporulation in C. botulinum ATCC 3502, rather than being involved in late-stage sporulation, as reported for the sporulation model organism B. subtilis. Understanding the sporulation mechanism of C. botulinum provides keys to control the public health risks that the spores of this dangerous pathogen cause through foods. PMID:22544236

Involvement of Clostridium botulinum ATCC 3502 sigma factor K in early-stage sporulation.

PubMed

Kirk, David G; Dahlsten, Elias; Zhang, Zhen; Korkeala, Hannu; Lindström, Miia

2012-07-01

A key survival mechanism of Clostridium botulinum, the notorious neurotoxic food pathogen, is the ability to form heat-resistant spores. While the genetic mechanisms of sporulation are well understood in the model organism Bacillus subtilis, nothing is known about these mechanisms in C. botulinum. Using the ClosTron gene-knockout tool, sigK, encoding late-stage (stage IV) sporulation sigma factor K in B. subtilis, was disrupted in C. botulinum ATCC 3502 to produce two different mutants with distinct insertion sites and orientations. Both mutants were unable to form spores, and their elongated cell morphology suggested that the sporulation pathway was blocked at an early stage. In contrast, sigK-complemented mutants sporulated successfully. Quantitative real-time PCR analysis of sigK in the parent strain revealed expression at the late log growth phase in the parent strain. Analysis of spo0A, encoding the sporulation master switch, in the sigK mutant and the parent showed significantly reduced relative levels of spo0A expression in the sigK mutant compared to the parent strain. Similarly, sigF showed significantly lower relative transcription levels in the sigK mutant than the parent strain, suggesting that the sporulation pathway was blocked in the sigK mutant at an early stage. We conclude that σ(K) is essential for early-stage sporulation in C. botulinum ATCC 3502, rather than being involved in late-stage sporulation, as reported for the sporulation model organism B. subtilis. Understanding the sporulation mechanism of C. botulinum provides keys to control the public health risks that the spores of this dangerous pathogen cause through foods.

Role of Iron Uptake Systems in Pseudomonas aeruginosa Virulence and Airway Infection

PubMed Central

Minandri, Fabrizia; Imperi, Francesco; Frangipani, Emanuela; Bonchi, Carlo; Visaggio, Daniela; Facchini, Marcella; Pasquali, Paolo; Bragonzi, Alessandra

2016-01-01

Pseudomonas aeruginosa is a leading cause of hospital-acquired pneumonia and chronic lung infections in cystic fibrosis patients. Iron is essential for bacterial growth, and P. aeruginosa expresses multiple iron uptake systems, whose role in lung infection deserves further investigation. P. aeruginosa Fe3+ uptake systems include the pyoverdine and pyochelin siderophores and two systems for heme uptake, all of which are dependent on the TonB energy transducer. P. aeruginosa also has the FeoB transporter for Fe2+ acquisition. To assess the roles of individual iron uptake systems in P. aeruginosa lung infection, single and double deletion mutants were generated in P. aeruginosa PAO1 and characterized in vitro, using iron-poor media and human serum, and in vivo, using a mouse model of lung infection. The iron uptake-null mutant (tonB1 feoB) and the Fe3+ transport mutant (tonB1) did not grow aerobically under low-iron conditions and were avirulent in the mouse model. Conversely, the wild type and the feoB, hasR phuR (heme uptake), and pchD (pyochelin) mutants grew in vitro and caused 60 to 90% mortality in mice. The pyoverdine mutant (pvdA) and the siderophore-null mutant (pvdA pchD) grew aerobically in iron-poor media but not in human serum, and they caused low mortality in mice (10 to 20%). To differentiate the roles of pyoverdine in iron uptake and virulence regulation, a pvdA fpvR double mutant defective in pyoverdine production but expressing wild-type levels of pyoverdine-regulated virulence factors was generated. Deletion of fpvR in the pvdA background partially restored the lethal phenotype, indicating that pyoverdine contributes to the pathogenesis of P. aeruginosa lung infection by combining iron transport and virulence-inducing capabilities. PMID:27271740

Contactin‑associated protein‑like 2 expression in SH‑SY5Y cells is upregulated by a FOXP2 mutant with a shortened poly‑glutamine tract.

PubMed

Zhao, Yunjing; Liu, Xiaoliang; Sun, Hongwei; Wang, Yueping; Yang, Wenzhu; Ma, Hongwei

2015-12-01

The forkhead box protein P2 (FOXP2) gene encodes an important transcription factor that contains a polyglutamine (poly‑Q) tract and a forkhead DNA binding domain. It has been observed that FOXP2 is associated with speech sound disorder (SSD), and mutations that decrease the length of the poly‑Q tract were identified in the FOXP2 gene of SSD patients. However, the exact role of poly‑Q reduction is not well understood. In the present study, constructs expressing wild‑type and poly‑Q reduction mutants of FOXP2 were generated by polymerase chain reaction (PCR) using lentiviral vectors and transfected into the SH‑SY5Y neuronal cell line. Quantitative reverse transcription (qRT)‑PCR and western blotting indicated that infected cells stably expressed high levels of FOXP2. Using this cell model, the impact of FOXP2 on the expression of contactin‑associated protein‑like 2 (CNTNAP2) were investigated, and CNTNAP2 mRNA expression levels were observed to be significantly higher in cells expressing poly‑Q‑reduced FOXP2. In addition, the expression level of CASPR2, a mammalian homolog of Drosophila Neurexin IV, was increased in cells expressing the FOXP2 mutant. Demonstration of regulation by FOXP2 indicates that CNTNAP2 may also be involved in SSD.

Ectopic expression of a polyalanine expansion mutant of poly(A)-binding protein N1 in muscle cells in culture inhibits myogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Qishan; Bag, Jnanankur

2006-02-17

Oculopharyngeal muscular dystrophy (OPMD) is an adult-onset dominant genetic disease caused by the expansion of a GCG trinucleotide repeat that encodes the polyalanine tract at the N-terminus of the nuclear poly(A)-binding protein (PABPN1). Presence of intranuclear inclusions (INIs) containing PABPN1 aggregates in the skeletal muscles is the hallmark of OPMD. Here, we show that ectopic expression of the mutant PABPN1 produced INIs in a muscle cell culture model and reduced expression of several muscle-specific proteins including {alpha}-actin, slow troponin C, muscle creatine kinase, and two myogenic transcription factors, myogenin and MyoD. However, the levels of two upstream regulators of themore » MyoD gene, the Myf-5 and Pax3/7, were not affected, but both proteins co-localized with the PABPN1 aggregates in the mutant PABPN1 overexpressing cells. In these cells, although myogenin and MyoD levels were reduced, these two transcription factors did not co-localize with the mutant PABPN1 aggregates. Therefore, sequestration of Myf5 and Pax3/7 by the mutant PABPN1 aggregates was a specific effect on these factors. Our results suggest that trapping of these two important myogenic determinants may interfere with an early step in myogenesis.« less

Epithelial-to-Mesenchymal Transition Antagonizes Response to Targeted Therapies in Lung Cancer by Suppressing BIM.

PubMed

Song, Kyung-A; Niederst, Matthew J; Lochmann, Timothy L; Hata, Aaron N; Kitai, Hidenori; Ham, Jungoh; Floros, Konstantinos V; Hicks, Mark A; Hu, Haichuan; Mulvey, Hillary E; Drier, Yotam; Heisey, Daniel A R; Hughes, Mark T; Patel, Neha U; Lockerman, Elizabeth L; Garcia, Angel; Gillepsie, Shawn; Archibald, Hannah L; Gomez-Caraballo, Maria; Nulton, Tara J; Windle, Brad E; Piotrowska, Zofia; Sahingur, Sinem E; Taylor, Shirley M; Dozmorov, Mikhail; Sequist, Lecia V; Bernstein, Bradley; Ebi, Hiromichi; Engelman, Jeffrey A; Faber, Anthony C

2018-01-01

Purpose: Epithelial-to-mesenchymal transition (EMT) confers resistance to a number of targeted therapies and chemotherapies. However, it has been unclear why EMT promotes resistance, thereby impairing progress to overcome it. Experimental Design: We have developed several models of EMT-mediated resistance to EGFR inhibitors (EGFRi) in EGFR -mutant lung cancers to evaluate a novel mechanism of EMT-mediated resistance. Results: We observed that mesenchymal EGFR -mutant lung cancers are resistant to EGFRi-induced apoptosis via insufficient expression of BIM, preventing cell death despite potent suppression of oncogenic signaling following EGFRi treatment. Mechanistically, we observed that the EMT transcription factor ZEB1 inhibits BIM expression by binding directly to the BIM promoter and repressing transcription. Derepression of BIM expression by depletion of ZEB1 or treatment with the BH3 mimetic ABT-263 to enhance "free" cellular BIM levels both led to resensitization of mesenchymal EGFR -mutant cancers to EGFRi. This relationship between EMT and loss of BIM is not restricted to EGFR -mutant lung cancers, as it was also observed in KRAS -mutant lung cancers and large datasets, including different cancer subtypes. Conclusions: Altogether, these data reveal a novel mechanistic link between EMT and resistance to lung cancer targeted therapies. Clin Cancer Res; 24(1); 197-208. ©2017 AACR . ©2017 American Association for Cancer Research.

Overexpression of mutant ataxin-3 in mouse cerebellum induces ataxia and cerebellar neuropathology.

PubMed

Nóbrega, Clévio; Nascimento-Ferreira, Isabel; Onofre, Isabel; Albuquerque, David; Conceição, Mariana; Déglon, Nicole; de Almeida, Luís Pereira

2013-08-01

Machado-Joseph disease (MJD), also known as spinocerebellar ataxia type 3 (SCA3), is a fatal, dominant neurodegenerative disorder caused by the polyglutamine-expanded protein ataxin-3. Clinical manifestations include cerebellar ataxia and pyramidal signs culminating in severe neuronal degeneration. Currently, there is no therapy able to modify disease progression. In the present study, we aimed at investigating one of the most severely affected brain regions in the disorder--the cerebellum--and the behavioral defects associated with the neuropathology in this region. For this purpose, we injected lentiviral vectors encoding full-length human mutant ataxin-3 in the mouse cerebellum of 3-week-old C57/BL6 mice. We show that circumscribed expression of human mutant ataxin-3 in the cerebellum mediates within a short time frame--6 weeks, the development of a behavioral phenotype including reduced motor coordination, wide-based ataxic gait, and hyperactivity. Furthermore, the expression of mutant ataxin-3 resulted in the accumulation of intranuclear inclusions, neuropathological abnormalities, and neuronal death. These data show that lentiviral-based expression of mutant ataxin-3 in the mouse cerebellum induces localized neuropathology, which is sufficient to generate a behavioral ataxic phenotype. Moreover, this approach provides a physiologically relevant, cost-effective and time-effective animal model to gain further insights into the pathogenesis of MJD and for the evaluation of experimental therapeutics of MJD.

Understanding the role of argininosuccinate lyase transcript variants in the clinical and biochemical variability of the urea cycle disorder argininosuccinic aciduria.

PubMed

Hu, Liyan; Pandey, Amit V; Eggimann, Sandra; Rüfenacht, Véronique; Möslinger, Dorothea; Nuoffer, Jean-Marc; Häberle, Johannes

2013-11-29

Argininosuccinic aciduria (ASA) is an autosomal recessive urea cycle disorder caused by deficiency of argininosuccinate lyase (ASL) with a wide clinical spectrum from asymptomatic to severe hyperammonemic neonatal onset life-threatening courses. We investigated the role of ASL transcript variants in the clinical and biochemical variability of ASA. Recombinant proteins for ASL wild type, mutant p.E189G, and the frequently occurring transcript variants with exon 2 or 7 deletions were (co-)expressed in human embryonic kidney 293T cells. We found that exon 2-deleted ASL forms a stable truncated protein with no relevant activity but a dose-dependent dominant negative effect on enzymatic activity after co-expression with wild type or mutant ASL, whereas exon 7-deleted ASL is unstable but seems to have, nevertheless, a dominant negative effect on mutant ASL. These findings were supported by structural modeling predictions for ASL heterotetramer/homotetramer formation. Illustrating the physiological relevance, the predominant occurrence of exon 7-deleted ASL was found in two patients who were both heterozygous for the ASL mutant p.E189G. Our results suggest that ASL transcripts can contribute to the highly variable phenotype in ASA patients if expressed at high levels. Especially, the exon 2-deleted ASL variant may form a heterotetramer with wild type or mutant ASL, causing markedly reduced ASL activity.

Interplay Between Capsule Expression and Uracil Metabolism in Streptococcus pneumoniae D39

PubMed Central

Carvalho, Sandra M.; Kloosterman, Tomas G.; Manzoor, Irfan; Caldas, José; Vinga, Susana; Martinussen, Jan; Saraiva, Lígia M.; Kuipers, Oscar P.; Neves, Ana R.

2018-01-01

Pyrimidine nucleotides play an important role in the biosynthesis of activated nucleotide sugars (NDP-sugars). NDP-sugars are the precursors of structural polysaccharides in bacteria, including capsule, which is a major virulence factor of the human pathogen S. pneumoniae. In this work, we identified a spontaneous non-reversible mutant of strain D39 that displayed a non-producing capsule phenotype. Whole-genome sequencing analysis of this mutant revealed several non-synonymous single base modifications, including in genes of the de novo synthesis of pyrimidines and in the −10 box of capsule operon promoter (Pcps). By directed mutagenesis we showed that the point mutation in Pcps was solely responsible for the drastic decrease in capsule expression. We also demonstrated that D39 subjected to uracil deprivation shows increased biomass and decreased Pcps activity and capsule amounts. Importantly, Pcps expression is further decreased by mutating the first gene of the de novo synthesis of pyrimidines, carA. In contrast, the absence of uracil from the culture medium showed no effect on the spontaneous mutant strain. Co-cultivation of the wild-type and the mutant strain indicated a competitive advantage of the spontaneous mutant (non-producing capsule) in medium devoid of uracil. We propose a model in that uracil may act as a signal for the production of different capsule amounts in S. pneumoniae. PMID:29599757

Interplay Between Capsule Expression and Uracil Metabolism in Streptococcus pneumoniae D39.

PubMed

Carvalho, Sandra M; Kloosterman, Tomas G; Manzoor, Irfan; Caldas, José; Vinga, Susana; Martinussen, Jan; Saraiva, Lígia M; Kuipers, Oscar P; Neves, Ana R

2018-01-01

Pyrimidine nucleotides play an important role in the biosynthesis of activated nucleotide sugars (NDP-sugars). NDP-sugars are the precursors of structural polysaccharides in bacteria, including capsule, which is a major virulence factor of the human pathogen S. pneumoniae . In this work, we identified a spontaneous non-reversible mutant of strain D39 that displayed a non-producing capsule phenotype. Whole-genome sequencing analysis of this mutant revealed several non-synonymous single base modifications, including in genes of the de novo synthesis of pyrimidines and in the -10 box of capsule operon promoter (P cps ). By directed mutagenesis we showed that the point mutation in P cps was solely responsible for the drastic decrease in capsule expression. We also demonstrated that D39 subjected to uracil deprivation shows increased biomass and decreased P cps activity and capsule amounts. Importantly, P cps expression is further decreased by mutating the first gene of the de novo synthesis of pyrimidines, carA . In contrast, the absence of uracil from the culture medium showed no effect on the spontaneous mutant strain. Co-cultivation of the wild-type and the mutant strain indicated a competitive advantage of the spontaneous mutant (non-producing capsule) in medium devoid of uracil. We propose a model in that uracil may act as a signal for the production of different capsule amounts in S. pneumoniae .

The Campylobacter jejuni MarR-like transcriptional regulators RrpA and RrpB both influence bacterial responses to oxidative and aerobic stresses.

PubMed

Gundogdu, Ozan; da Silva, Daiani T; Mohammad, Banaz; Elmi, Abdi; Mills, Dominic C; Wren, Brendan W; Dorrell, Nick

2015-01-01

The ability of the human intestinal pathogen Campylobacter jejuni to respond to oxidative stress is central to bacterial survival both in vivo during infection and in the environment. Re-annotation of the C. jejuni NCTC11168 genome revealed the presence of two MarR-type transcriptional regulators Cj1546 and Cj1556, originally annotated as hypothetical proteins, which we have designated RrpA and RrpB (regulator of response to peroxide) respectively. Previously we demonstrated a role for RrpB in both oxidative and aerobic (O2) stress and that RrpB was a DNA binding protein with auto-regulatory activity, typical of MarR-type transcriptional regulators. In this study, we show that RrpA is also a DNA binding protein and that a rrpA mutant in strain 11168H exhibits increased sensitivity to hydrogen peroxide oxidative stress. Mutation of either rrpA or rrpB reduces catalase (KatA) expression. However, a rrpAB double mutant exhibits higher levels of resistance to hydrogen peroxide oxidative stress, with levels of KatA expression similar to the wild-type strain. Mutation of either rrpA or rrpB also results in a reduction in the level of katA expression, but this reduction was not observed in the rrpAB double mutant. Neither the rrpA nor rrpB mutant exhibits any significant difference in sensitivity to either cumene hydroperoxide or menadione oxidative stresses, but both mutants exhibit a reduced ability to survive aerobic (O2) stress, enhanced biofilm formation and reduced virulence in the Galleria mellonella infection model. The rrpAB double mutant exhibits wild-type levels of biofilm formation and wild-type levels of virulence in the G mellonella infection model. Together these data indicate a role for both RrpA and RrpB in the C. jejuni peroxide oxidative and aerobic (O2) stress responses, enhancing bacterial survival in vivo and in the environment.

A novel triple repeat mutant tau transgenic model that mimics aspects of pick's disease and fronto-temporal tauopathies.

PubMed

Rockenstein, Edward; Overk, Cassia R; Ubhi, Kiren; Mante, Michael; Patrick, Christina; Adame, Anthony; Bisquert, Alejandro; Trejo-Morales, Margarita; Spencer, Brian; Masliah, Eliezer

2015-01-01

Tauopathies are a group of disorders leading to cognitive and behavioral impairment in the aging population. While four-repeat (4R) Tau is more abundant in corticobasal degeneration, progressive supranuclear palsy, and Alzheimer's disease, three-repeat (3R) Tau is the most abundant splice, in Pick's disease. A number of transgenic models expressing wild-type and mutant forms of the 4R Tau have been developed. However, few models of three-repeat Tau are available. A transgenic mouse model expressing three-repeat Tau was developed bearing the mutations associated with familial forms of Pick's disease (L266V and G272V mutations). Two lines expressing high (Line 13) and low (Line 2) levels of the three-repeat mutant Tau were analyzed. By Western blot, using antibodies specific to three-repeat Tau, Line 13 expressed 5-times more Tau than Line 2. The Tau expressed by these mice was most abundant in the frontal-temporal cortex and limbic system and was phosphorylated at residues detected by the PHF-1, AT8, CP9 and CP13 antibodies. The higher-expressing mice displayed hyperactivity, memory deficits in the water maze and alterations in the round beam. The behavioral deficits started at 6-8 months of age and were associated with a progressive increase in the accumulation of 3R Tau. By immunocytochemistry, mice from Line 13 displayed extensive accumulation of 3R Tau in neuronal cells bodies in the pyramidal neurons of the neocortex, CA1-3 regions, and dentate gyrus of the hippocampus. Aggregates in the granular cells had a globus appearance and mimic Pick's-like inclusions. There were abundant dystrophic neurites, astrogliosis and synapto-dendritic damage in the neocortex and hippocampus of the higher expresser line. The hippocampal lesions were moderately argyrophilic and Thioflavin-S negative. By electron microscopy, discrete straight filament aggregates were detected in some neurons in the hippocampus. This model holds promise for better understanding the natural history and progression of 3R tauopathies and their relationship with mitochondrial alterations and might be suitable for therapeutical testing.

Host range and cell cycle activation properties of polyomavirus large T-antigen mutants defective in pRB binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Freund, R.; Bauer, P.H.; Benjamin, T.L.

1994-11-01

The authors have examined the growth properties of polyomavirus large T-antigen mutants that ar unable to bind pRB, the product of the retinoblastoma tumor suppressor gene. These mutants grow poorly on primary mouse cells yet grow well on NIH 3T3 and other established mouse cell lines. Preinfection of primary baby mouse kidney (BMK) epithelial cells with wild-type simian virus 40 renders these cells permissive to growth of pRB-binding polyomavirus mutants. Conversely, NIH 3T3 cells transfected by and expressing wild-type human pRB become nonpermissive. Primary fibroblasts for mouse embryos that carry a homozygous knockout of the RB gene are permissive, whilemore » those from normal littermates are nonpermissive. The host range of polyomavirus pRB-binding mutants is thus determined by expression or lack of expression of functional pRB by the host. These results demonstrate the importance of pRB binding by large T antigen for productive viral infection in primary cells. Failure of pRB-binding mutants to grow well in BMK cells correlates with their failure to induce progression from G{sub 0} or G{sub 1} through the S phase of the cell cycle. Time course studies show delayed synthesis and lower levels of accumulation of large T antigen, viral DNA, and VP1 in mutant compared with wild-type virus-infected BMK cells. These results support a model in which productive infection by polyomavirus in normal mouse cells is tightly coupled to the induction and progression of the cell cycle. 48 refs., 6 figs., 5 tabs.« less

Inactivation of JAK2/STAT3 Signaling Axis and Downregulation of M1 mAChR Cause Cognitive Impairment in klotho Mutant Mice, a Genetic Model of Aging

PubMed Central

Park, Seok-Joo; Shin, Eun-Joo; Min, Sun Seek; An, Jihua; Li, Zhengyi; Hee Chung, Yoon; Hoon Jeong, Ji; Bach, Jae-Hyung; Nah, Seung-Yeol; Kim, Won-Ki; Jang, Choon-Gon; Kim, Yong-Sun; Nabeshima, Yo-ichi; Nabeshima, Toshitaka; Kim, Hyoung-Chun

2013-01-01

We previously reported cognitive dysfunction in klotho mutant mice. In the present study, we further examined novel mechanisms involved in cognitive impairment in these mice. Significantly decreased janus kinase 2 (JAK2) and signal transducer and activator of transcription3 (STAT3) phosphorylation were observed in the hippocampus of klotho mutant mice. A selective decrease in protein expression and binding density of the M1 muscarinic cholinergic receptor (M1 mAChR) was observed in these mice. Cholinergic parameters (ie, acetylcholine (ACh), choline acetyltransferase (ChAT), and acetylcholinesterase (AChE)) and NMDAR-dependent long-term potentiation (LTP) were significantly impaired in klotho mutant mice. McN-A-343 (McN), an M1 mAChR agonist, significantly attenuated these impairments. AG490 (AG), a JAK2 inhibitor, counteracted the attenuating effects of McN, although AG did not significantly alter the McN-induced effect on AChE. Furthermore, AG significantly inhibited the attenuating effects of McN on decreased NMDAR-dependent LTP, protein kinase C βII, p-ERK, p-CREB, BDNF, and p-JAK2/p-STAT3-expression in klotho mutant mice. In addition, k252a, a BDNF receptor tyrosine kinase B (TrkB) inhibitor, significantly counteracted McN effects on decreased ChAT, ACh, and M1 mAChR and p-JAK2/p-STAT3 expression. McN-induced effects on cognitive impairment in klotho mutant mice were consistently counteracted by either AG or k252a. Our results suggest that inactivation of the JAK2/STAT3 signaling axis and M1 mAChR downregulation play a critical role in cognitive impairment observed in klotho mutant mice. PMID:23389690

Partial Müllerian Duct Retention in Smad4 Conditional Mutant Male Mice.

PubMed

Petit, Fabrice G; Deng, Chuxia; Jamin, Soazik P

2016-01-01

Müllerian duct regression is a complex process which involves the AMH signalling pathway. We have previously demonstrated that besides AMH and its specific type II receptor (AMHRII), BMPR-IA and Smad5 are two essential factors implicated in this mechanism. Mothers against decapentaplegic homolog 4 (Smad4) is a transcription factor and the common Smad (co-Smad) involved in transforming growth factor beta (TGF-β) signalling pathway superfamily. Since Smad4 null mutants die early during gastrulation, we have inactivated Smad4 in the Müllerian duct mesenchyme. Specific inactivation of Smad4 in the urogenital ridge leads to the partial persistence of the Müllerian duct in adult male mice. Careful examination of the urogenital tract reveals that the Müllerian duct retention is randomly distributed either on one side or both sides. Histological analysis shows a uterus-like structure, which is confirmed by the expression of estrogen receptor α. As previously described in a β-catenin conditional mutant mouse model, β-catenin contributes to Müllerian duct regression. In our mutant male embryos, it appears that β-catenin expression is locally reduced along the urogenital ridge as compared to control mice. Moreover, the expression pattern is similar to those observed in control female mice. This study shows that reduced Smad4 expression disrupts the Wnt/β-catenin signalling leading to the partial persistence of Müllerian duct.

Biological effects of CCS in the absence of SOD1 enzyme activation: implications for disease in a mouse model for ALS.

PubMed

Proescher, Jody B; Son, Marjatta; Elliott, Jeffrey L; Culotta, Valeria C

2008-06-15

The CCS copper chaperone is critical for maturation of Cu, Zn-superoxide dismutase (SOD1) through insertion of the copper co-factor and oxidization of an intra-subunit disulfide. The disulfide helps stabilize the SOD1 polypeptide, which can be particularly important in cases of amyotrophic lateral sclerosis (ALS) linked to misfolding of mutant SOD1. Surprisingly, however, over-expressed CCS was recently shown to greatly accelerate disease in a G93A SOD1 mouse model for ALS. Herein we show that disease in these G93A/CCS mice correlates with incomplete oxidation of the SOD1 disulfide. In the brain and spinal cord, CCS over-expression failed to enhance oxidation of the G93A SOD1 disulfide and if anything, effected some accumulation of disulfide-reduced SOD1. This effect was mirrored in culture with a C244,246S mutant of CCS that has the capacity to interact with SOD1 but can neither insert copper nor oxidize the disulfide. In spite of disulfide effects, there was no evidence for increased SOD1 aggregation. If anything, CCS over-expression prevented SOD1 misfolding in culture as monitored by detergent insolubility. This protection against SOD1 misfolding does not require SOD1 enzyme activation as the same effect was obtained with the C244,246S allele of CCS. In the G93A SOD1 mouse, CCS over-expression was likewise associated with a lack of obvious SOD1 misfolding marked by detergent insolubility. CCS over-expression accelerates SOD1-linked disease without the hallmarks of misfolding and aggregation seen in other mutant SOD1 models. These studies are the first to indicate biological effects of CCS in the absence of SOD1 enzymatic activation.

Melatonin attenuates memory impairment induced by Klotho gene deficiency via interactive signaling between MT2 receptor, ERK, and Nrf2-related antioxidant potential.

PubMed

Shin, Eun-Joo; Chung, Yoon Hee; Le, Hoang-Lan Thi; Jeong, Ji Hoon; Dang, Duy-Khanh; Nam, Yunsung; Wie, Myung Bok; Nah, Seung-Yeol; Nabeshima, Yo-Ichi; Nabeshima, Toshitaka; Kim, Hyoung-Chun

2014-12-30

We demonstrated that oxidative stress plays a crucial role in cognitive impairment in klotho mutant mice, a genetic model of aging. Since down-regulation of melatonin due to aging is well documented, we used this genetic model to determine whether the antioxidant property of melatonin affects memory impairment. First, we examined the effects of melatonin on hippocampal oxidative parameters and the glutathione/oxidized glutathione (GSH/GSSG) ratio and memory dysfunction of klotho mutant mice. Second, we investigated whether a specific melatonin receptor is involved in the melatonin-mediated pharmacological response by application with melatonin receptor antagonists. Third, we examined phospho-extracellular-signal-regulated kinase (ERK) expression, nuclear factor erythroid 2-related factor 2 (Nrf2) nuclear translocation, Nrf2 DNA binding activity, and glutamate-cysteine ligase (GCL) mRNA expression. Finally, we examined effects of the ERK inhibitor SL327 in response to antioxidant efficacy and memory enhancement mediated by melatonin. Treatment with melatonin resulted in significant attenuations of oxidative damage, a decrease in the GSH/GSSG ratio, and a significant amelioration of memory impairment in this aging model. These effects of melatonin were significantly counteracted by the selective MT2 receptor antagonist 4-P-PDOT. Importantly, 4-P-PDOT or SL327 also counteracted melatonin-mediated attenuation in response to the decreases in phospho-ERK expression, Nrf2 nuclear translocation, Nrf2 DNA-binding activity, and GCL mRNA expression in the hippocampi of klotho mutant mice. SL327 also counteracted the up-regulation of the GSH/GSSG ratio and the memory enhancement mediated by melatonin in klotho mutant mice. Melatonin attenuates oxidative stress and the associated memory impairment induced by klotho deficiency via signaling interaction between the MT2 receptor and ERK- and Nrf2-related antioxidant potential. © The Author 2015. Published by Oxford University Press on behalf of CINP.

Melatonin Attenuates Memory Impairment Induced by Klotho Gene Deficiency Via Interactive Signaling Between MT2 Receptor, ERK, and Nrf2-Related Antioxidant Potential

PubMed Central

Shin, Eun-Joo; Chung, Yoon Hee; Le, Hoang-Lan Thi; Jeong, Ji Hoon; Dang, Duy-Khanh; Nam, Yunsung; Wie, Myung Bok; Nah, Seung-Yeol; Nabeshima, Yo-Ichi; Nabeshima, Toshitaka; Kim, Hyoung-Chun

2015-01-01

Background: We demonstrated that oxidative stress plays a crucial role in cognitive impairment in klotho mutant mice, a genetic model of aging. Since down-regulation of melatonin due to aging is well documented, we used this genetic model to determine whether the antioxidant property of melatonin affects memory impairment. Methods: First, we examined the effects of melatonin on hippocampal oxidative parameters and the glutathione/oxidized glutathione (GSH/GSSG) ratio and memory dysfunction of klotho mutant mice. Second, we investigated whether a specific melatonin receptor is involved in the melatonin-mediated pharmacological response by application with melatonin receptor antagonists. Third, we examined phospho-extracellular-signal-regulated kinase (ERK) expression, nuclear factor erythroid 2-related factor 2 (Nrf2) nuclear translocation, Nrf2 DNA binding activity, and glutamate-cysteine ligase (GCL) mRNA expression. Finally, we examined effects of the ERK inhibitor SL327 in response to antioxidant efficacy and memory enhancement mediated by melatonin. Results: Treatment with melatonin resulted in significant attenuations of oxidative damage, a decrease in the GSH/GSSG ratio, and a significant amelioration of memory impairment in this aging model. These effects of melatonin were significantly counteracted by the selective MT2 receptor antagonist 4-P-PDOT. Importantly, 4-P-PDOT or SL327 also counteracted melatonin-mediated attenuation in response to the decreases in phospho-ERK expression, Nrf2 nuclear translocation, Nrf2 DNA-binding activity, and GCL mRNA expression in the hippocampi of klotho mutant mice. SL327 also counteracted the up-regulation of the GSH/GSSG ratio and the memory enhancement mediated by melatonin in klotho mutant mice. Conclusions: Melatonin attenuates oxidative stress and the associated memory impairment induced by klotho deficiency via signaling interaction between the MT2 receptor and ERK- and Nrf2-related antioxidant potential. PMID:25550330

Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

PubMed

Loging, W T; Reisman, D

1999-11-01

The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

Human mutant huntingtin disrupts vocal learning in transgenic songbirds.

PubMed

Liu, Wan-Chun; Kohn, Jessica; Szwed, Sarah K; Pariser, Eben; Sepe, Sharon; Haripal, Bhagwattie; Oshimori, Naoki; Marsala, Martin; Miyanohara, Atsushi; Lee, Ramee

2015-11-01

Speech and vocal impairments characterize many neurological disorders. However, the neurogenetic mechanisms of these disorders are not well understood, and current animal models do not have the necessary circuitry to recapitulate vocal learning deficits. We developed germline transgenic songbirds, zebra finches (Taneiopygia guttata) expressing human mutant huntingtin (mHTT), a protein responsible for the progressive deterioration of motor and cognitive function in Huntington's disease (HD). Although generally healthy, the mutant songbirds had severe vocal disorders, including poor vocal imitation, stuttering, and progressive syntax and syllable degradation. Their song abnormalities were associated with HD-related neuropathology and dysfunction of the cortical-basal ganglia (CBG) song circuit. These transgenics are, to the best of our knowledge, the first experimentally created, functional mutant songbirds. Their progressive and quantifiable vocal disorder, combined with circuit dysfunction in the CBG song system, offers a model for genetic manipulation and the development of therapeutic strategies for CBG-related vocal and motor disorders.

Feedback inhibition by thiols outranks glutathione depletion: a luciferase-based screen reveals glutathione-deficient γ-ECS and glutathione synthetase mutants impaired in cadmium-induced sulfate assimilation.

PubMed

Jobe, Timothy O; Sung, Dong-Yul; Akmakjian, Garo; Pham, Allis; Komives, Elizabeth A; Mendoza-Cózatl, David G; Schroeder, Julian I

2012-06-01

Plants exposed to heavy metals rapidly induce changes in gene expression that activate and enhance detoxification mechanisms, including toxic-metal chelation and the scavenging of reactive oxygen species. However, the mechanisms mediating toxic heavy metal-induced gene expression remain largely unknown. To genetically elucidate cadmium-specific transcriptional responses in Arabidopsis, we designed a genetic screen based on the activation of a cadmium-inducible reporter gene. Microarray studies identified a high-affinity sulfate transporter (SULTR1;2) among the most robust and rapid cadmium-inducible transcripts. The SULTR1;2 promoter (2.2 kb) was fused with the firefly luciferase reporter gene to quantitatively report the transcriptional response of plants exposed to cadmium. Stably transformed luciferase reporter lines were ethyl methanesulfonate (EMS) mutagenized, and stable M(2) seedlings were screened for an abnormal luciferase response during exposure to cadmium. The screen identified non-allelic mutant lines that fell into one of three categories: (i) super response to cadmium (SRC) mutants; (ii) constitutive response to cadmium (CRC) mutants; or (iii) non-response and reduced response to cadmium (NRC) mutants. Two nrc mutants, nrc1 and nrc2, were mapped, cloned and further characterized. The nrc1 mutation was mapped to the γ-glutamylcysteine synthetase gene and the nrc2 mutation was identified as the first viable recessive mutant allele in the glutathione synthetase gene. Moreover, genetic, HPLC mass spectrometry, and gene expression analysis of the nrc1 and nrc2 mutants, revealed that intracellular glutathione depletion alone would be insufficient to induce gene expression of sulfate uptake and assimilation mechanisms. Our results modify the glutathione-depletion driven model for sulfate assimilation gene induction during cadmium stress, and suggest that an enhanced oxidative state and depletion of upstream thiols, in addition to glutathione depletion, are necessary to induce the transcription of sulfate assimilation genes during early cadmium stress. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

Gravity persistent signal 1 reveals a novel cytochrome P450 involved in gravitropic signal transduction

NASA Astrophysics Data System (ADS)

Wyatt, Sarah

Understanding gene expression that occurs during gravitopism is important for studying the processes that link the perception of gravity to the growth response. Arabidopsis plants with a mutation in the GRAVITY PERSISTENT SIGNAL (GPS)1 locus show a "no response" phenotype during gravistimulation experiments. Basepital auxin transport in gps1 mutant was unaffected by the mutation, but auxin was not laterally redistributed after gravistimulation. GPS1 encodes CYP705A22, a cytochrome P450 protein (P450) of unknown function. The wild type CYP705A22 gene was transformed into the gps1 mutant background and successfully rescued the mutant phenotype. Data mining of microarray data collected from gravistimulated root tips of Arabidopsis indicated that although CYP705A22 was not expressed in roots, a family member CYP705A5 was up-regulated within 3 minutes after gravistimulation. Expression profiling of CYP705A5, using real-time quantitative PCR, showed that CYP705A5 was up-regulated nearly five fold within minutes of gravity stimulation. And reporter gene fusions that link the CYP705A5 gene to the green fluorescent protein showed that CYP705A5 was expressed in the root zones of elongation and maturation. Computer modeling of the catalytic domain of CYP705A22 and CYP705A5 and in silico substrate docking simulations generated a list of 130 compounds that are potential substrates of the P450s. Many of the compounds are phenylpropanoid derivatives. Heterologous expression of CYP705A5 in baculovirus and Type 1 binding studies indicate the substrate of the P450 may be quercitin or myricetin. A mutation affecting CYP705A5 expression resulted in a delayed gravity response in roots. The mutant phenotype could be chemically complemented, and DPBA staining in the CYP705A5 mutant indicated a 1.5 fold accumulation of quercetin in mutant roots as compared to WT. These data, taken together, may indicate that we have identified a flavonoid pathway that regulates auxin distribution and thus is involved in gravitropic signal transduction. (Partially support by NSF: 0618506 to SEW)

A murine model of autosomal dominant neurohypophyseal diabetes insipidus reveals progressive loss of vasopressin-producing neurons

PubMed Central

Russell, Theron A.; Ito, Masafumi; Ito, Mika; Yu, Richard N.; Martinson, Fred A.; Weiss, Jeffrey; Jameson, J. Larry

2003-01-01

Familial neurohypophyseal diabetes insipidus (FNDI) is an autosomal dominant disorder caused by mutations in the arginine vasopressin (AVP) precursor. The pathogenesis of FNDI is proposed to involve mutant protein–induced loss of AVP-producing neurons. We established murine knock-in models of two different naturally occurring human mutations that cause FNDI. A mutation in the AVP signal sequence [A(–1)T] is associated with a relatively mild phenotype or delayed presentation in humans. This mutation caused no apparent phenotype in mice. In contrast, heterozygous mice expressing a mutation that truncates the AVP precursor (C67X) exhibited polyuria and polydipsia by 2 months of age and these features of DI progressively worsened with age. Studies of the paraventricular and supraoptic nuclei revealed induction of the chaperone protein BiP and progressive loss of AVP-producing neurons relative to oxytocin-producing neurons. In addition, Avp gene products were not detected in the neuronal projections, suggesting retention of WT and mutant AVP precursors within the cell bodies. In summary, this murine model of FNDI recapitulates many features of the human disorder and demonstrates that expression of the mutant AVP precursor leads to progressive neuronal cell loss. PMID:14660745

Genetic abolishment of hepatocyte proliferation activates hepatic stem cells.

PubMed

Endo, Yoko; Zhang, Mingjun; Yamaji, Sachie; Cang, Yong

2012-01-01

Quiescent hepatic stem cells (HSCs) can be activated when hepatocyte proliferation is compromised. Chemical injury rodent models have been widely used to study the localization, biomarkers, and signaling pathways in HSCs, but these models usually exhibit severe promiscuous toxicity and fail to distinguish damaged and non-damaged cells. Our goal is to establish new animal models to overcome these limitations, thereby providing new insights into HSC biology and application. We generated mutant mice with constitutive or inducible deletion of Damaged DNA Binding protein 1 (DDB1), an E3 ubiquitin ligase, in hepatocytes. We characterized the molecular mechanism underlying the compensatory activation and the properties of oval cells (OCs) by methods of mouse genetics, immuno-staining, cell transplantation and gene expression profiling. We show that deletion of DDB1 abolishes self-renewal capacity of mouse hepatocytes in vivo, leading to compensatory activation and proliferation of DDB1-expressing OCs. Partially restoring proliferation of DDB1-deficient hepatocytes by ablation of p21, a substrate of DDB1 E3 ligase, alleviates OC proliferation. Purified OCs express both hepatocyte and cholangiocyte markers, form colonies in vitro, and differentiate to hepatocytes after transplantation. Importantly, the DDB1 mutant mice exhibit very minor liver damage, compared to a chemical injury model. Microarray analysis reveals several previously unrecognized markers, including Reelin, enriched in oval cells. Here we report a genetic model in which irreversible inhibition of hepatocyte duplication results in HSC-driven liver regeneration. The DDB1 mutant mice can be broadly applied to studies of HSC differentiation, HSC niche and HSCs as origin of liver cancer.

Genetic Abolishment of Hepatocyte Proliferation Activates Hepatic Stem Cells

PubMed Central

Endo, Yoko; Zhang, Mingjun; Yamaji, Sachie; Cang, Yong

2012-01-01

Quiescent hepatic stem cells (HSCs) can be activated when hepatocyte proliferation is compromised. Chemical injury rodent models have been widely used to study the localization, biomarkers, and signaling pathways in HSCs, but these models usually exhibit severe promiscuous toxicity and fail to distinguish damaged and non-damaged cells. Our goal is to establish new animal models to overcome these limitations, thereby providing new insights into HSC biology and application. We generated mutant mice with constitutive or inducible deletion of Damaged DNA Binding protein 1 (DDB1), an E3 ubiquitin ligase, in hepatocytes. We characterized the molecular mechanism underlying the compensatory activation and the properties of oval cells (OCs) by methods of mouse genetics, immuno-staining, cell transplantation and gene expression profiling. We show that deletion of DDB1 abolishes self-renewal capacity of mouse hepatocytes in vivo, leading to compensatory activation and proliferation of DDB1-expressing OCs. Partially restoring proliferation of DDB1-deficient hepatocytes by ablation of p21, a substrate of DDB1 E3 ligase, alleviates OC proliferation. Purified OCs express both hepatocyte and cholangiocyte markers, form colonies in vitro, and differentiate to hepatocytes after transplantation. Importantly, the DDB1 mutant mice exhibit very minor liver damage, compared to a chemical injury model. Microarray analysis reveals several previously unrecognized markers, including Reelin, enriched in oval cells. Here we report a genetic model in which irreversible inhibition of hepatocyte duplication results in HSC-driven liver regeneration. The DDB1 mutant mice can be broadly applied to studies of HSC differentiation, HSC niche and HSCs as origin of liver cancer. PMID:22384083

Effect of single point mutations of the human tachykinin NK1 receptor on antagonist affinity.

PubMed

Lundstrom, K; Hawcock, A B; Vargas, A; Ward, P; Thomas, P; Naylor, A

1997-10-15

Molecular modelling and site-directed mutagenesis were used to identify eleven amino acid residues which may be involved in antagonist binding of the human tachykinin NK1 receptor. Recombinant receptors were expressed in mammalian cells using the Semliki Forest virus system. Wild type and mutant receptors showed similar expression levels in BHK and CHO cells, verified by metabolic labelling. Binding affinities were determined for a variety of tachykinin NK1 receptor antagonists in SFV-infected CHO cells. The binding affinity for GR203040, CP 99,994 and CP 96,345 was significantly reduced by mutant Q165A. The mutant F268A significantly reduced the affinity for GR203040 and CP 99,994 and the mutant H197A had reduced affinity for CP 96,345. All antagonists seemed to bind in a similar region of the receptor, but do not all rely on the same binding site interactions. Functional coupling to G-proteins was assayed by intracellular Ca2+ release in SFV-infected CHO cells. The wild type receptor and all mutants except A162L and F268A responded to substance P stimulation.

Reduced mycorrhizal colonization (rmc) tomato mutant lacks expression of SymRK signaling pathway genes

PubMed Central

Nair, Aswathy; Bhargava, Sujata

2012-01-01

Comparison of the expression of 13 genes involved in arbuscular mycorrhizal (AM) symbiosis was performed in a wild type tomato (Solanum lycopersicum cv 76R) and its reduced mycorrhizal colonization mutant rmc in response to colonization with Glomus fasiculatum. Four defense-related genes were induced to a similar extent in the mutant and wild type AM colonized plants, indicating a systemic response to AM colonization. Genes related to nutrient exchange between the symbiont partners showed higher expression in the AM roots of wild type plants than the mutant plants, which correlated with their arbuscular frequency. A symbiosis receptor kinase that is involved in both nodulation and AM symbiosis was not expressed in the rmc mutant. The fact that some colonization was observed in rmc was suggestive of the existence of an alternate colonization signaling pathway for AM symbiosis in this mutant. PMID:23221680

Research on homology modeling, molecular docking of the cellulase and highly expression of the key enzyme (Bgl) in Pichia pastoris.

PubMed

Tang, Zizhong; Jin, Weiqiong; Tang, Yujia; Wang, Yinsheng; Wang, Chang; Zheng, Xi; Sun, Wenjun; Liu, Moyang; Zheng, Tianrun; Chen, Hui; Wu, Qi; Shan, Zhi; Bu, Tongliang; Li, Chenglei

2018-08-01

Cellulose is the most abundant and renewable biological resource on earth. As nonrenewable resources are becoming scarce, cellulose is expected to become a major raw material for food, energy, fuel and other products. 1,4-β-glucosidase (Bgl), as a kind of cellulose, can be degraded cellulose into industrial available glucose. In this study, we constructed mutants of Bgl with enhanced activity based on homology modeling, molecular docking, and the site-directed mutagenesis of target residues to modify spatial positions, steric hindrances, or hydrophilicity/hydrophobicity. On the basis of the high-activity mutations were got (N347S and G235 M) by using site-directed mutagenesis and screening methods and introduced in the Pichia pastoris expression system, the enzymatic properties of mutant enzymes were analysed. Assays of the activity of the purified Bgl revealed that the two mutants exhibited increased activity. The pPICZαA-G235 M and pPICZαA-N347S mutants exhibited a >33.4% and 44.8% increase in specific activity respectively, with similar pH, temperature and metal ion requirements, compared to wild-type Bgl. These findings would be good foundation for improving production properties of Bgl in the future. Copyright © 2018 Elsevier B.V. All rights reserved.

Endoplasmic reticulum polymers impair luminal protein mobility and sensitise to cellular stress in α1-antitrypsin deficiency

PubMed Central

Ordóñez, Adriana; Snapp, Erik L; Tan, Lu; Miranda, Elena; Marciniak, Stefan J; Lomas, David A

2013-01-01

Point mutants of α1-antitrypsin form ordered polymers that are retained as inclusions within the endoplasmic reticulum (ER) of hepatocytes in association with neonatal hepatitis, cirrhosis and hepatocellular carcinoma. These inclusions cause cell damage and predispose to ER stress in the absence of the classical unfolded protein response (UPR). The pathophysiology underlying this ER stress was explored by generating cell models that conditionally express wildtype α1-antitrypsin, two mutants that cause polymer-mediated inclusions and liver disease (E342K [the Z allele] and H334D) and a truncated mutant (Null Hong Kong, NHK) that induces classical ER stress and is removed by ER associated degradation. Expression of the polymeric mutants resulted in gross changes in the ER luminal environment that recapitulated the changes seen in liver sections from individuals with PI*ZZ α1-antitrypsin deficiency. In contrast expression of NHK α1-antitrypsin caused electron lucent dilatation and expansion of the ER throughout the cell. Photobleaching microscopy in live cells demonstrated a decrease in the mobility of soluble luminal proteins in cells that express E342K and H334D α1-antitrypsin when compared to those that express wildtype and NHK α1-antitrypsin (0.34±0.05, 0.22±0.03, 2.83±0.30 and 2.84±0.55 μm2/s respectively). There was no effect on protein mobility within ER membranes indicating that cisternal connectivity was not disrupted. Polymer expression alone was insufficient to induce the UPR but the resulting protein overload rendered cells hypersensitive to ER stress induced by either tunicamycin or glucose depletion. Conclusion Changes in protein diffusion provide an explanation for the cellular consequences of ER protein overload in mutants that cause inclusion body formation and α1-antitrypsin deficiency. PMID:23197448

Human Papillomavirus E6E7-Mediated Adenovirus Cell Killing: Selectivity of Mutant Adenovirus Replication in Organotypic Cultures of Human Keratinocytes

PubMed Central

Balagué, Cristina; Noya, Francisco; Alemany, Ramon; Chow, Louise T.; Curiel, David T.

2001-01-01

Replication-competent adenoviruses are being investigated as potential anticancer agents. Exclusive virus replication in cancer cells has been proposed as a safety trait to be considered in the design of oncolytic adenoviruses. From this perspective, we have investigated several adenovirus mutants for their potential to conditionally replicate and promote the killing of cells expressing human papillomavirus (HPV) E6 and E7 oncoproteins, which are present in a high percentage of anogenital cancers. For this purpose, we have employed an organotypic model of human stratified squamous epithelium derived from primary keratinocytes that have been engineered to express HPV-18 oncoproteins stably. We show that, whereas wild-type adenovirus promotes a widespread cytopathic effect in all infected cells, E1A- and E1A/E1B-deleted adenoviruses cause no deleterious effect regardless of the coexpression of HPV18 E6E7. An adenovirus deleted in the CR2 domain of E1A, necessary for binding to the pRB family of pocket proteins, shows no selectivity of replication as it efficiently kills all normal and E6E7-expressing keratinocytes. Finally, an adenovirus mutant deleted in the CR1 and CR2 domains of E1A exhibits preferential replication and cell killing in HPV E6E7-expressing cultures. We conclude that the organotypic keratinocyte culture represents a distinct model to evaluate adenovirus selectivity and that, based on this model, further modifications of the adenovirus genome are required to restrict adenovirus replication to tumor cells. PMID:11462032

Type 1 fimbriae contribute to catheter-associated urinary tract infections caused by Escherichia coli.

PubMed

Reisner, Andreas; Maierl, Mario; Jörger, Michael; Krause, Robert; Berger, Daniela; Haid, Andrea; Tesic, Dijana; Zechner, Ellen L

2014-03-01

Biofilm formation on catheters is thought to contribute to persistence of catheter-associated urinary tract infections (CAUTI), which represent the most frequent nosocomial infections. Knowledge of genetic factors for catheter colonization is limited, since their role has not been assessed using physicochemical conditions prevailing in a catheterized human bladder. The current study aimed to combine data from a dynamic catheterized bladder model in vitro with in vivo expression analysis for understanding molecular factors relevant for CAUTI caused by Escherichia coli. By application of the in vitro model that mirrors the physicochemical environment during human infection, we found that an E. coli K-12 mutant defective in type 1 fimbriae, but not isogenic mutants lacking flagella or antigen 43, was outcompeted by the wild-type strain during prolonged catheter colonization. The importance of type 1 fimbriae for catheter colonization was verified using a fimA mutant of uropathogenic E. coli strain CFT073 with human and artificial urine. Orientation of the invertible element (IE) controlling type 1 fimbrial expression in bacterial populations harvested from the colonized catheterized bladder in vitro suggested that the vast majority of catheter-colonizing cells (up to 88%) express type 1 fimbriae. Analysis of IE orientation in E. coli populations harvested from patient catheters revealed that a median level of ∼73% of cells from nine samples have switched on type 1 fimbrial expression. This study supports the utility of the dynamic catheterized bladder model for analyzing catheter colonization factors and highlights a role for type 1 fimbriae during CAUTI.

Genetic analysis of tachyzoite to bradyzoite differentiation mutants in Toxoplasma gondii reveals a hierarchy of gene induction.

PubMed

Singh, Upinder; Brewer, Jeremy L; Boothroyd, John C

2002-05-01

Developmental switching in Toxoplasma gondii, from the virulent tachyzoite to the relatively quiescent bradyzoite stage, is responsible for disease propagation and reactivation. We have generated tachyzoite to bradyzoite differentiation (Tbd-) mutants in T. gondii and used these in combination with a cDNA microarray to identify developmental pathways in bradyzoite formation. Four independently generated Tbd- mutants were analysed and had defects in bradyzoite development in response to multiple bradyzoite-inducing conditions, a stable phenotype after in vivo passages and a markedly reduced brain cyst burden in a murine model of chronic infection. Transcriptional profiles of mutant and wild-type parasites, growing under bradyzoite conditions, revealed a hierarchy of developmentally regulated genes, including many bradyzoite-induced genes whose transcripts were reduced in all mutants. A set of non-developmentally regulated genes whose transcripts were less abundant in Tbd- mutants were also identified. These may represent genes that mediate downstream effects and/or whose expression is dependent on the same transcription factors as the bradyzoite-induced set. Using these data, we have generated a model of transcription regulation during bradyzoite development in T. gondii. Our approach shows the utility of this system as a model to study developmental biology in single-celled eukaryotes including protozoa and fungi.

Calreticulin mutants in mice induce an MPL-dependent thrombocytosis with frequent progression to myelofibrosis.

PubMed

Marty, Caroline; Pecquet, Christian; Nivarthi, Harini; El-Khoury, Mira; Chachoua, Ilyas; Tulliez, Micheline; Villeval, Jean-Luc; Raslova, Hana; Kralovics, Robert; Constantinescu, Stefan N; Plo, Isabelle; Vainchenker, William

2016-03-10

Frameshift mutations in the calreticulin (CALR) gene are seen in about 30% of essential thrombocythemia and myelofibrosis patients. To address the contribution of the CALR mutants to the pathogenesis of myeloproliferative neoplasms, we engrafted lethally irradiated recipient mice with bone marrow cells transduced with retroviruses expressing these mutants. In contrast to wild-type CALR, CALRdel52 (type I) and, to a lesser extent, CALRins5 (type II) induced thrombocytosis due to a megakaryocyte (MK) hyperplasia. Disease was transplantable into secondary recipients. After 6 months, CALRdel52-, in contrast to rare CALRins5-, transduced mice developed a myelofibrosis associated with a splenomegaly and a marked osteosclerosis. Monitoring of virus-transduced populations indicated that CALRdel52 leads to expansion at earlier stages of hematopoiesis than CALRins5. However, both mutants still specifically amplified the MK lineage and platelet production. Moreover, a mutant deleted of the entire exon 9 (CALRdelex9) did not induce a disease, suggesting that the oncogenic property of CALR mutants was related to the new C-terminus peptide. To understand how the CALR mutants target the MK lineage, we used a cell-line model and demonstrated that the CALR mutants, but not CALRdelex9, specifically activate the thrombopoietin (TPO) receptor (MPL) to induce constitutive activation of Janus kinase 2 and signal transducer and activator of transcription 5/3/1. We confirmed in c-mpl- and tpo-deficient mice that expression of Mpl, but not of Tpo, was essential for the CALR mutants to induce thrombocytosis in vivo, although Tpo contributes to disease penetrance. Thus, CALR mutants are sufficient to induce thrombocytosis through MPL activation. © 2016 by The American Society of Hematology.

Expression of a Mutant kcnj2 Gene Transcript in Zebrafish

PubMed Central

Leong, Ivone U. S.; Skinner, Jonathan R.; Shelling, Andrew N.; Love, Donald R.

2013-01-01

Long QT 7 syndrome (LQT7, also known as Andersen-Tawil syndrome) is a rare autosomal-dominant disorder that causes cardiac arrhythmias, periodic paralysis, and dysmorphic features. Mutations in the human KCNJ2 gene, which encodes for the subunit of the potassium inwardly-rectifying channel (IK1), have been associated with the disorder. The majority of mutations are considered to be dominant-negative as mutant proteins interact to limit the function of wild type KCNJ2 proteins. Several LQT7 syndrome mouse models have been created that vary in the physiological similarity to the human disease. To complement the LQT7 mouse models, we investigated the usefulness of the zebrafish as an alternative model via a transient approach. Initial bioinformatic analysis identified the zebrafish orthologue of the human KCNJ2 gene, together with a spatial expression profile that was similar to that of human. The expression of a kcnj2-12 transcript carrying an in-frame deletion of critical amino acids identified in human studies resulted in embryos that exhibited defects in muscle development, thereby affecting movement, a decrease in jaw size, pupil-pupil distance, and signs of scoliosis. These defects correspond to some phenotypes expressed by human LQT7 patients. PMID:27335675

Expression of the Flp proteins by Haemophilus ducreyi is necessary for virulence in human volunteers.

PubMed

Janowicz, Diane M; Cooney, Sean A; Walsh, Jessica; Baker, Beth; Katz, Barry P; Fortney, Kate R; Zwickl, Beth W; Ellinger, Sheila; Munson, Robert S

2011-09-22

Haemophilus ducreyi, the causative agent of the sexually transmitted disease chancroid, contains a flp (fimbria like protein) operon that encodes proteins predicted to contribute to adherence and pathogenesis. H. ducreyi mutants that lack expression of Flp1 and Flp2 or TadA, which has homology to NTPases of type IV secretion systems, have decreased abilities to attach to and form microcolonies on human foreskin fibroblasts (HFF). A tadA mutant is attenuated in its ability to cause disease in human volunteers and in the temperature dependent rabbit model, but a flp1flp2 mutant is virulent in rabbits. Whether a flp deletion mutant would cause disease in humans is not clear. We constructed 35000HPΔflp1-3, a deletion mutant that lacks expression of all three Flp proteins but has an intact tad secretion system. 35000HPΔflp1-3 was impaired in its ability to form microcolonies and to attach to HFF in vitro when compared to its parent (35000HP). Complementation of the mutant with flp1-3 in trans restored the parental phenotype. To test whether expression of Flp1-3 was necessary for virulence in humans, ten healthy adult volunteers were experimentally infected with a fixed dose of 35000HP (ranging from 54 to 67 CFU) on one arm and three doses of 35000HPΔflp1-3 (ranging from 63 to 961 CFU) on the other arm. The overall papule formation rate for the parent was 80% (95% confidence interval, CI, 55.2%-99.9%) and for the mutant was 70.0% (95% CI, 50.5%-89.5%) (P = 0.52). Mutant papules were significantly smaller (mean, 11.2 mm2) than were parent papules (21.8 mm2) 24 h after inoculation (P = 0.018). The overall pustule formation rates were 46.7% (95% CI 23.7-69.7%) at 30 parent sites and 6.7% (95% CI, 0.1-19.1%) at 30 mutant sites (P = 0.001). These data suggest that production and secretion of the Flp proteins contributes to microcolony formation and attachment to HFF cells in vitro. Expression of flp1-3 is also necessary for H. ducreyi to initiate disease and progress to pustule formation in humans. Future studies will focus on how Flp proteins contribute to microcolony formation and attachment in vivo. © 2011 Janowicz et al; licensee BioMed Central Ltd.

Rapid degeneration of rod photoreceptors expressing self-association-deficient arrestin-1 mutant

PubMed Central

Song, Xiufeng; Seo, Jungwon; Baameur, Faiza; Vishnivetskiy, Sergey A.; Chen, Qiuyan; Kook, Seunghyi; Kim, Miyeon; Brooks, Evan K.; Altenbach, Christian; Hong, Yuan; Hanson, Susan M.; Palazzo, Maria C.; Chen, Jeannie; Hubbell, Wayne L.; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

2013-01-01

Arrestin-1 binds light-activated phosphorhodopsin and ensures timely signal shutoff. We show that high transgenic expression of an arrestin-1 mutant with enhanced rhodopsin binding and impaired oligomerization causes apoptotic rod death in mice. Dark rearing does not prevent mutant-induced cell death, ruling out the role of arrestin complexes with light-activated rhodopsin. Similar expression of WT arrestin-1 that robustly oligomerizes, which leads to only modest increase in the monomer concentration, does not affect rod survival. Moreover, WT arrestin-1 co-expressed with the mutant delays retinal degeneration. Thus, arrestin-1 mutant directly affects cell survival via binding partner(s) other than light-activated rhodopsin. Due to impaired self-association of the mutant its high expression dramatically increases the concentration of the monomer. The data suggest that monomeric arrestin-1 is cytotoxic and WT arrestin-1 protects rods by forming mixed oligomers with the mutant and/or competing with it for the binding to non-receptor partners. Thus, arrestin-1 self-association likely serves to keep low concentration of the toxic monomer. The reduction of the concentration of harmful monomer is an earlier unappreciated biological function of protein oligomerization. PMID:24012956

Rapid degeneration of rod photoreceptors expressing self-association-deficient arrestin-1 mutant.

PubMed

Song, Xiufeng; Seo, Jungwon; Baameur, Faiza; Vishnivetskiy, Sergey A; Chen, Qiuyan; Kook, Seunghyi; Kim, Miyeon; Brooks, Evan K; Altenbach, Christian; Hong, Yuan; Hanson, Susan M; Palazzo, Maria C; Chen, Jeannie; Hubbell, Wayne L; Gurevich, Eugenia V; Gurevich, Vsevolod V

2013-12-01

Arrestin-1 binds light-activated phosphorhodopsin and ensures timely signal shutoff. We show that high transgenic expression of an arrestin-1 mutant with enhanced rhodopsin binding and impaired oligomerization causes apoptotic rod death in mice. Dark rearing does not prevent mutant-induced cell death, ruling out the role of arrestin complexes with light-activated rhodopsin. Similar expression of WT arrestin-1 that robustly oligomerizes, which leads to only modest increase in the monomer concentration, does not affect rod survival. Moreover, WT arrestin-1 co-expressed with the mutant delays retinal degeneration. Thus, arrestin-1 mutant directly affects cell survival via binding partner(s) other than light-activated rhodopsin. Due to impaired self-association of the mutant its high expression dramatically increases the concentration of the monomer. The data suggest that monomeric arrestin-1 is cytotoxic and WT arrestin-1 protects rods by forming mixed oligomers with the mutant and/or competing with it for the binding to non-receptor partners. Thus, arrestin-1 self-association likely serves to keep low concentration of the toxic monomer. The reduction of the concentration of harmful monomer is an earlier unappreciated biological function of protein oligomerization. © 2013.

Neoplasia Driven by Mutant c-KIT Is Mediated by Intracellular, Not Plasma Membrane, Receptor Signaling▿

PubMed Central

Xiang, Zhifu; Kreisel, Frederike; Cain, Jennifer; Colson, AnnaLynn; Tomasson, Michael H.

2007-01-01

Activating mutations in c-KIT are associated with gastrointestinal stromal tumors, mastocytosis, and acute myeloid leukemia. In attempting to establish a murine model of human KITD816V (hKITD816V)-mediated leukemia, we uncovered an unexpected relationship between cellular transformation and intracellular trafficking. We found that transport of hKITD816V protein was blocked at the endoplasmic reticulum in a species-specific fashion. We exploited these species-specific trafficking differences and a set of localization domain-tagged KIT mutants to explore the relationship between subcellular localization of mutant KIT and cellular transformation. The protein products of fully transforming KIT mutants localized to the Golgi apparatus and to a lesser extent the plasma membrane. Domain-tagged KITD816V targeted to the Golgi apparatus remained constitutively active and transforming. Chemical inhibition of intracellular transport demonstrated that Golgi localization is sufficient, but plasma membrane localization is dispensable, for downstream signaling mediated by KIT mutation. When expressed in murine bone marrow, endoplasmic reticulum-localized hKITD816V failed to induce disease in mice, while expression of either Golgi-localized HyKITD816V or cytosol-localized, ectodomain-deleted KITD816V uniformly caused fatal myeloproliferative diseases. Taken together, these data demonstrate that intracellular, non-plasma membrane receptor signaling is sufficient to drive neoplasia caused by mutant c-KIT and provide the first animal model of myelomonocytic neoplasia initiated by human KITD816V. PMID:17060458

Dynamic nuclear envelope phenotype in rats overexpressing mutated human torsinA protein.

PubMed

Yu-Taeger, Libo; Gaiser, Viktoria; Lotzer, Larissa; Roenisch, Tina; Fabry, Benedikt Timo; Stricker-Shaver, Janice; Casadei, Nicolas; Walter, Michael; Schaller, Martin; Riess, Olaf; Nguyen, Huu Phuc; Ott, Thomas; Grundmann-Hauser, Kathrin

2018-05-08

A three-base-pair deletion in the human TOR1A gene is causative for the most common form of primary dystonia, the early-onset dystonia type 1 (DYT1 dystonia). The pathophysiological consequences of this mutation are still unknown.To study the pathology of the mutant torsinA (TOR1A) protein, we have generated a transgenic rat line that overexpresses the human mutant protein under the control of the human TOR1A promoter. This new animal model was phenotyped with several approaches, including behavioral tests and neuropathological analyses. A motor phenotype and cellular and ultrastructural key features of torsinA pathology were found in this new transgenic rat line supporting that it can be used as a model system for investigating the disease development. Analyses of mutant TOR1A protein expression in various brain regions also showed a dynamic expression pattern and a reversible nuclear envelope pathology. These findings suggest the differential vulnerabilities of distinct neuronal subpopulations. Furthermore the reversibility of the nuclear envelope pathology might be a therapeutic target to treat the disease. © 2018. Published by The Company of Biologists Ltd.

Mutant Huntingtin Causes a Selective Decrease in the Expression of Synaptic Vesicle Protein 2C.

PubMed

Peng, Chaohua; Zhu, Gaochun; Liu, Xiangqian; Li, He

2018-04-30

Huntington's disease (HD) is a neurodegenerative disease caused by a polyglutamine expansion in the huntingtin (Htt) protein. Mutant Htt causes synaptic transmission dysfunctions by interfering in the expression of synaptic proteins, leading to early HD symptoms. Synaptic vesicle proteins 2 (SV2s), a family of synaptic vesicle proteins including 3 members, SV2A, SV2B, and SV2C, plays important roles in synaptic physiology. Here, we investigated whether the expression of SV2s is affected by mutant Htt in the brains of HD transgenic (TG) mice and Neuro2a mouse neuroblastoma cells (N2a cells) expressing mutant Htt. Western blot analysis showed that the protein levels of SV2A and SV2B were not significantly changed in the brains of HD TG mice expressing mutant Htt with 82 glutamine repeats. However, in the TG mouse brain there was a dramatic decrease in the protein level of SV2C, which has a restricted distribution pattern in regions particularly vulnerable in HD. Immunostaining revealed that the immunoreactivity of SV2C was progressively weakened in the basal ganglia and hippocampus of TG mice. RT-PCR demonstrated that the mRNA level of SV2C progressively declined in the TG mouse brain without detectable changes in the mRNA levels of SV2A and SV2B, indicating that mutant Htt selectively inhibits the transcriptional expression of SV2C. Furthermore, we found that only SV2C expression was progressively inhibited in N2a cells expressing a mutant Htt containing 120 glutamine repeats. These findings suggest that the synaptic dysfunction in HD results from the mutant Htt-mediated inhibition of SV2C transcriptional expression. These data also imply that the restricted distribution and decreased expression of SV2C contribute to the brain region-selective pathology of HD.

Comparative analysis of the integument transcriptomes of the black dilute mutant and the wild-type silkworm Bombyx mori

PubMed Central

Wu, Songyuan; Tong, Xiaoling; Peng, Chenxing; Xiong, Gao; Lu, Kunpeng; hu, Hai; Tan, Duan; Li, Chunlin; Han, Minjin; Lu, Cheng; Dai, Fangyin

2016-01-01

The insect cuticle is a critical protective shell that is composed predominantly of chitin and various cuticular proteins and pigments. Indeed, insects often change their surface pigment patterns in response to selective pressures, such as threats from predators, sexual selection and environmental changes. However, the molecular mechanisms underlying the construction of the epidermis and its pigmentation patterns are not fully understood. Among Lepidoptera, the silkworm is a favorable model for color pattern research. The black dilute (bd) mutant of silkworm is the result of a spontaneous mutation; the larval body color is notably melanized. We performed integument transcriptome sequencing of the wild-type strain Dazao and the mutant strains +/bd and bd/bd. In these experiments, during an early stage of the fourth molt, a stage at which approximately 51% of genes were expressed genome wide (RPKM ≥1) in each strain. A total of 254 novel transcripts were characterized using Cuffcompare and BLAST analyses. Comparison of the transcriptome data revealed 28 differentially expressed genes (DEGs) that may contribute to bd larval melanism, including 15 cuticular protein genes that were remarkably highly expressed in the bd/bd mutant. We suggest that these significantly up-regulated cuticular proteins may promote melanism in silkworm larvae. PMID:27193628

Nodal patterning without Lefty inhibitory feedback is functional but fragile

PubMed Central

Gagnon, James A; Pauli, Andrea; Zimmerman, Steven; Aksel, Deniz C; Reyon, Deepak; Tsai, Shengdar Q; Joung, J Keith

2017-01-01

Developmental signaling pathways often activate their own inhibitors. Such inhibitory feedback has been suggested to restrict the spatial and temporal extent of signaling or mitigate signaling fluctuations, but these models are difficult to rigorously test. Here, we determine whether the ability of the mesendoderm inducer Nodal to activate its inhibitor Lefty is required for development. We find that zebrafish lefty mutants exhibit excess Nodal signaling and increased specification of mesendoderm, resulting in embryonic lethality. Strikingly, development can be fully restored without feedback: Lethal patterning defects in lefty mutants can be rescued by ectopic expression of lefty far from its normal expression domain or by spatially and temporally uniform exposure to a Nodal inhibitor drug. While drug-treated mutants are less tolerant of mild perturbations to Nodal signaling levels than wild type embryos, they can develop into healthy adults. These results indicate that patterning without inhibitory feedback is functional but fragile. PMID:29215332

Sonic hedgehog: restricted expression and limb dysmorphologies

PubMed Central

Hill, Robert E; Heaney, Simon JH; Lettice, Laura A

2003-01-01

Sonic hedgehog, SHH, is required for patterning the limb. The array of skeletal elements that compose the hands and feet, and the ordered arrangement of these bones to form the pattern of fingers and toes are dependent on SHH. The mechanism of action of SHH in the limb is not fully understood; however, an aspect that appears to be important is the localized, asymmetric expression of Shh. Shh is expressed in the posterior margin of the limb bud in a region defined as the zone of polarizing activity (ZPA). Analysis of mouse mutants which have polydactyly (extra toes) shows that asymmetric expression of Shh is lost due to the appearance of an ectopic domain of expression in the anterior limb margin. One such polydactylous mouse mutant, sasquatch (Ssq), maps to the corresponding chromosomal region of the human condition pre-axial polydactyly (PPD) and thus represents a model for this condition. The mutation responsible for Ssq is located 1 Mb away from the Shh gene; however, the mutation disrupts a long-range cis-acting regulator of Shh expression. By inference, human pre-axial polydactyly results from a similar disruption of Shh expression. Other human congenital abnormalities also map near the pre-axial polydactyly locus, suggesting a major chromosomal region for limb dysmorphologies. The distinct phenotypes range from loss of all bones of the hands and feet to syndactyly of the soft tissue and fusion of the digits. We discuss the role played by Shh expression in mouse mutant phenotypes and the human limb dysmorphologies. PMID:12587915

Small-molecule RETRA suppresses mutant p53-bearing cancer cells through a p73-dependent salvage pathway

PubMed Central

Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.

2008-01-01

Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558

The role of primary myogenic regulatory factors in the developing diaphragmatic muscle in the nitrofen-induced diaphragmatic hernia.

PubMed

Dingemann, Jens; Doi, Takashi; Ruttenstock, Elke; Puri, Prem

2011-06-01

The nitrofen model of congenital diaphragmatic hernia (CDH) is widely used to investigate the pathogenesis of CDH. However, the exact pathomechanism of the diaphragmatic defect is still unclear. Diaphragmatic muscularization represents the last stage of diaphragmatic development. Myogenic differentiation 1 (MyoD) and myogenic factor 5 (Myf5) play a crucial role in muscularization. MyoD(-/-) : Myf5(+/-) mutant mice show reduced diaphragmatic size, whereas MyoD(+/-) : Myf5(-/-) mutants have normal diaphragms. We designed this study to investigate diaphragmatic gene expression of MyoD and Myf5 in the nitrofen CDH model. Pregnant rats received nitrofen or vehicle on day 9 of gestation (D9), followed by cesarean section on D18 and D21. Fetal diaphragms (n = 40) were micro-dissected and divided into CDH group and controls. MyoD and Myf5 mRNA-expression were determined using Real-time PCR. Immunohistochemistry was performed to evaluate protein expression of MyoD and Myf5. Relative diaphragmatic mRNA expression levels and immunoreactivity of MyoD were decreased in the CDH group on D18 and D21. Myf 5 mRNA and protein expression were not altered in the CDH group. This is the first study showing that MyoD expression is selectively decreased in the diaphragm muscle in the nitrofen model of CDH.

Conflicting Selection Pressures Will Constrain Viral Escape from Interfering Particles: Principles for Designing Resistance-Proof Antivirals.

PubMed

Rast, Luke I; Rouzine, Igor M; Rozhnova, Ganna; Bishop, Lisa; Weinberger, Ariel D; Weinberger, Leor S

2016-05-01

The rapid evolution of RNA-encoded viruses such as HIV presents a major barrier to infectious disease control using conventional pharmaceuticals and vaccines. Previously, it was proposed that defective interfering particles could be developed to indefinitely control the HIV/AIDS pandemic; in individual patients, these engineered molecular parasites were further predicted to be refractory to HIV's mutational escape (i.e., be 'resistance-proof'). However, an outstanding question has been whether these engineered interfering particles-termed Therapeutic Interfering Particles (TIPs)-would remain resistance-proof at the population-scale, where TIP-resistant HIV mutants may transmit more efficiently by reaching higher viral loads in the TIP-treated subpopulation. Here, we develop a multi-scale model to test whether TIPs will maintain indefinite control of HIV at the population-scale, as HIV ('unilaterally') evolves toward TIP resistance by limiting the production of viral proteins available for TIPs to parasitize. Model results capture the existence of two intrinsic evolutionary tradeoffs that collectively prevent the spread of TIP-resistant HIV mutants in a population. First, despite their increased transmission rates in TIP-treated sub-populations, unilateral TIP-resistant mutants are shown to have reduced transmission rates in TIP-untreated sub-populations. Second, these TIP-resistant mutants are shown to have reduced growth rates (i.e., replicative fitness) in both TIP-treated and TIP-untreated individuals. As a result of these tradeoffs, the model finds that TIP-susceptible HIV strains continually outcompete TIP-resistant HIV mutants at both patient and population scales when TIPs are engineered to express >3-fold more genomic RNA than HIV expresses. Thus, the results provide design constraints for engineering population-scale therapies that may be refractory to the acquisition of antiviral resistance.

Down regulation of miR-124 in both Werner syndrome DNA helicase mutant mice and mutant Caenorhabditis elegans wrn-1 reveals the importance of this microRNA in accelerated aging

PubMed Central

Dallaire, Alexandra; Garand, Chantal; Paquet, Eric R.; Mitchell, Sarah J.; de Cabo, Rafael; Simard, Martin J.

2012-01-01

Small non-coding microRNAs are believed to be involved in the mechanism of aging but nothing is known on the impact of microRNAs in the progeroid disorder Werner syndrome (WS). WS is a premature aging disorder caused by mutations in a RecQ-like DNA helicase. Mice lacking the helicase domain of the WRN ortholog exhibit many phenotypic features of WS, including a pro-oxidant status and a shorter mean life span. Caenorhabditis elegans (C. elegans) with a nonfunctional wrn-1 DNA helicase also exhibit a shorter life span. Thus, both models are relevant to study the expression of microRNAs involved in WS. In this study, we show that miR-124 expression is lost in the liver of Wrn helicase mutant mice. Interestingly, the expression of this conserved miR-124 in whole wrn-1 mutant worms is also significantly reduced. The loss of mir-124 in C. elegans increases reactive oxygen species formation and accumulation of the aging marker lipofuscin, reduces whole body ATP levels and results in a reduction in life span. Finally, supplementation of vitamin C normalizes the median life span of wrn-1 and mir-124 mutant worms. These results suggest that biological pathways involving WRN and miR-124 are conserved in the aging process across different species. PMID:23075628

The distribution and functional properties of Pelizaeus-Merzbacher-like disease-linked Cx47 mutations on Cx47/Cx47 homotypic and Cx47/Cx43 heterotypic gap junctions.

PubMed

Kim, Mi Seong; Gloor, Gregory B; Bai, Donglin

2013-06-01

GJs (gap junctions) allow direct intercellular communication, and consist of Cxs (connexins). In the mammalian central nervous system, oligodendrocytes express Cx47, Cx32 and Cx29, whereas astrocytes express Cx43, Cx30 and Cx26. Homotypic Cx47/Cx47 GJs couple oligodendrocytes, and heterotypic Cx47/Cx43 channels are the primary GJs at oligodendrocyte/astrocyte junctions. Interestingly, autosomal recessive mutations in the gene GJC2 encoding Cx47 have been linked to a central hypomyelinating disease termed PMLD (Pelizaeus-Merzbacher-like disease). The aim of the present study was to determine the cellular distribution and functional properties of PMLD-associated Cx47 mutants (I46M, G149S, G236R, G236S, M286T and T398I). Expressing GFP (green fluorescent protein)-tagged mutant versions of Cx47 in gap-junction-deficient model cells revealed that these mutants were detected at the cell-cell interface similar to that observed for wild-type Cx47. Furthermore, four of the six mutants showed no electrical coupling in both Cx47/Cx47 and Cx47/Cx43 GJ channels. These results suggest that most of the PMLD-linked Cx47 mutants disrupt Cx47/Cx47 and Cx47/Cx43 GJ function in the glial network, which may play a role in leading to PMLD symptoms.

Human COQ9 Rescues a coq9 Yeast Mutant by Enhancing Coenzyme Q Biosynthesis from 4-Hydroxybenzoic Acid and Stabilizing the CoQ-Synthome

PubMed Central

He, Cuiwen H.; Black, Dylan S.; Allan, Christopher M.; Meunier, Brigitte; Rahman, Shamima; Clarke, Catherine F.

2017-01-01

Coq9 is required for the stability of a mitochondrial multi-subunit complex, termed the CoQ-synthome, and the deamination step of Q intermediates that derive from para-aminobenzoic acid (pABA) in yeast. In human, mutations in the COQ9 gene cause neonatal-onset primary Q10 deficiency. In this study, we determined whether expression of human COQ9 could complement yeast coq9 point or null mutants. We found that expression of human COQ9 rescues the growth of the temperature-sensitive yeast mutant, coq9-ts19, on a non-fermentable carbon source and increases the content of Q6, by enhancing Q biosynthesis from 4-hydroxybenzoic acid (4HB). To study the mechanism for the rescue by human COQ9, we determined the steady-state levels of yeast Coq polypeptides in the mitochondria of the temperature-sensitive yeast coq9 mutant expressing human COQ9. We show that the expression of human COQ9 significantly increased steady-state levels of yeast Coq4, Coq6, Coq7, and Coq9 at permissive temperature. Human COQ9 polypeptide levels persisted at non-permissive temperature. A small amount of the human COQ9 co-purified with tagged Coq6, Coq6-CNAP, indicating that human COQ9 interacts with the yeast Q-biosynthetic complex. These findings suggest that human COQ9 rescues the yeast coq9 temperature-sensitive mutant by stabilizing the CoQ-synthome and increasing Q biosynthesis from 4HB. This finding provides a powerful approach to studying the function of human COQ9 using yeast as a model. PMID:28736527

Leucine-Rich Repeat Kinase 2 interacts with Parkin, DJ-1 and PINK-1 in a Drosophila melanogaster model of Parkinson's disease.

PubMed

Venderova, Katerina; Kabbach, Ghassan; Abdel-Messih, Elizabeth; Zhang, Yi; Parks, Robin J; Imai, Yuzuru; Gehrke, Stephan; Ngsee, Johnny; Lavoie, Matthew J; Slack, Ruth S; Rao, Yong; Zhang, Zhuohua; Lu, Bingwei; Haque, M Emdadul; Park, David S

2009-11-15

Mutations in the LRRK2 gene are the most common genetic cause of familial Parkinson's disease (PD). However, its physiological and pathological functions are unknown. Therefore, we generated several independent Drosophila lines carrying WT or mutant human LRRK2 (mutations in kinase, COR or LRR domains, resp.). Ectopic expression of WT or mutant LRRK2 in dopaminergic neurons caused their significant loss accompanied by complex age-dependent changes in locomotor activity. Overall, the ubiquitous expression of LRRK2 increased lifespan and fertility of the flies. However, these flies were more sensitive to rotenone. LRRK2 expression in the eye exacerbated retinal degeneration. Importantly, in double transgenic flies, various indices of the eye and dopaminergic survival were modified in a complex fashion by a concomitant expression of PINK1, DJ-1 or Parkin. This evidence suggests a genetic interaction between these PD-relevant genes.

Neuronal matrix metalloproteinase-9 is a determinant of selective neurodegeneration

PubMed Central

Kaplan, Artem; Spiller, Krista J.; Towne, Christopher; Kanning, Kevin C.; Choe, Ginn T.; Geber, Adam; Akay, Turgay; Aebischer, Patrick; Henderson, Christopher E.

2018-01-01

SUMMARY Selective neuronal loss is the hallmark of neurodegenerative diseases. In patients with amyotrophic lateral sclerosis (ALS), most motor neurons die but those innervating extraocular, pelvic sphincter and slow limb muscles exhibit selective resistance. We identified 18 genes that show >10-fold differential expression between resistant and vulnerable motor neurons. One of these, matrix metalloproteinase-9 (MMP-9), is expressed only by fast motor neurons, which are selectively vulnerable. In ALS model mice expressing mutant SOD1, reduction of MMP-9 function using gene ablation, viral gene therapy or pharmacological inhibition significantly delayed muscle denervation. In the presence of mutant SOD1, MMP-9 expressed by fast motor neurons themselves enhances activation of ER stress and is sufficient to trigger axonal die-back. These findings define MMP-9 as a candidate therapeutic target for ALS. The molecular basis of neuronal diversity thus provides novel insights into mechanisms of selective vulnerability to neurodegeneration. PMID:24462097

Genetic Correction of SOD1 Mutant iPSCs Reveals ERK and JNK Activated AP1 as a Driver of Neurodegeneration in Amyotrophic Lateral Sclerosis.

PubMed

Bhinge, Akshay; Namboori, Seema C; Zhang, Xiaoyu; VanDongen, Antonius M J; Stanton, Lawrence W

2017-04-11

Although mutations in several genes with diverse functions have been known to cause amyotrophic lateral sclerosis (ALS), it is unknown to what extent causal mutations impinge on common pathways that drive motor neuron (MN)-specific neurodegeneration. In this study, we combined induced pluripotent stem cells-based disease modeling with genome engineering and deep RNA sequencing to identify pathways dysregulated by mutant SOD1 in human MNs. Gene expression profiling and pathway analysis followed by pharmacological screening identified activated ERK and JNK signaling as key drivers of neurodegeneration in mutant SOD1 MNs. The AP1 complex member JUN, an ERK/JNK downstream target, was observed to be highly expressed in MNs compared with non-MNs, providing a mechanistic insight into the specific degeneration of MNs. Importantly, investigations of mutant FUS MNs identified activated p38 and ERK, indicating that network perturbations induced by ALS-causing mutations converge partly on a few specific pathways that are drug responsive and provide immense therapeutic potential. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Mutant p53-R273H mediates cancer cell survival and anoikis resistance through AKT-dependent suppression of BCL2-modifying factor (BMF).

PubMed

Tan, B S; Tiong, K H; Choo, H L; Chung, F Fei-Lei; Hii, L-W; Tan, S H; Yap, I K S; Pani, S; Khor, N T W; Wong, S F; Rosli, R; Cheong, S-K; Leong, C-O

2015-07-16

p53 is the most frequently mutated tumor-suppressor gene in human cancers. Unlike other tumor-suppressor genes, p53 mutations mainly occur as missense mutations within the DNA-binding domain, leading to the expression of full-length mutant p53 protein. Mutant p53 proteins not only lose their tumor-suppressor function, but may also gain new oncogenic functions and promote tumorigenesis. Here, we showed that silencing of endogenous p53-R273H contact mutant, but not p53-R175H conformational mutant, reduced AKT phosphorylation, induced BCL2-modifying factor (BMF) expression, sensitized BIM dissociation from BCL-XL and induced mitochondria-dependent apoptosis in cancer cells. Importantly, cancer cells harboring endogenous p53-R273H mutant were also found to be inherently resistant to anoikis and lack BMF induction following culture in suspension. Underlying these activities is the ability of p53-R273H mutant to suppress BMF expression that is dependent on constitutively active PI3K/AKT signaling. Collectively, these findings suggest that p53-R273H can specifically drive AKT signaling and suppress BMF expression, resulting in enhanced cell survivability and anoikis resistance. These findings open the possibility that blocking of PI3K/AKT will have therapeutic benefit in mutant p53-R273H expressing cancers.

Mutational Analysis of Influenza A Virus Nucleoprotein: Identification of Mutations That Affect RNA Replication

PubMed Central

Mena, Ignacio; Jambrina, Enrique; Albo, Carmen; Perales, Beatriz; Ortín, Juan; Arrese, Marta; Vallejo, Dolores; Portela, Agustín

1999-01-01

The influenza A virus nucleoprotein (NP) is a multifunctional polypeptide which plays a pivotal role in virus replication. To get information on the domains and specific residues involved in the different NP activities, we describe here the preparation and characterization of 20 influenza A virus mutant NPs. The mutations, mostly single-amino-acid substitutions, were introduced in a cDNA copy of the A/Victoria/3/75 NP gene and, in most cases, affected residues located in regions that were highly conserved across the NPs of influenza A, B, and C viruses. The mutant NPs were characterized (i) in vivo (cell culture) by analyzing their intracellular localization and their functionality in replication, transcription, and expression of model RNA templates; and (ii) in vitro by analyzing their RNA-binding and sedimentation properties. The results obtained allowed us to identify both a mutant protein that accumulated in the cytoplasm and mutations that altered the functionality and/or the oligomerization state of the NP polypeptide. Among the mutations that reduced the NP capability to express chloramphenicol acetyltransferase protein from a model viral RNA (vRNA) template, some displayed a temperature-sensitive phenotype. Interestingly, four mutant NPs, which showed a reduced functionality in synthesizing cRNA molecules from a vRNA template, were fully competent to reconstitute complementary ribonucleoproteins (cRNPs) capable of synthesizing vRNAs, which in turn yielded mRNA molecules. Based on the phenotype of these mutants and on previously published observations, it is proposed that these mutant NPs have a reduced capability to interact with the polymerase complex and that this NP-polymerase interaction is responsible for making vRNPs switch from mRNA to cRNA synthesis. PMID:9882320

A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus.

PubMed

Coleman, Stewart; Choi, K Yeon; Root, Matthew; McGregor, Alistair

2016-07-01

In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107-179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model.

A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus

PubMed Central

McGregor, Alistair

2016-01-01

In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107–179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model. PMID:27387220

Sequential, Divergent, and Cooperative Requirements of Foxl2a and Foxl2b in Ovary Development and Maintenance of Zebrafish

PubMed Central

Yang, Yan-Jing; Wang, Yang; Li, Zhi; Zhou, Li; Gui, Jian-Fang

2017-01-01

Foxl2 is essential for mammalian ovary maintenance. Although sexually dimorphic expression of foxl2 was observed in many teleosts, its role and regulative mechanism in fish remained largely unclear. In this study, we first identified two transcript variants of foxl2a and its homologous gene foxl2b in zebrafish, and revealed their specific expression in follicular layer cells in a sequential and divergent fashion during ovary differentiation, maturation, and maintenance. Then, homozygous foxl2a mutants (foxl2a−/−) and foxl2b mutants (foxl2b−/−) were constructed and detailed comparisons, such as sex ratio, gonadal histological structure, transcriptome profiling, and dynamic expression of gonadal development-related genes, were carried out. Initial ovarian differentiation and oocyte development occur normally both in foxl2a−/− and foxl2b−/− mutants, but foxl2a and foxl2b disruptions result in premature ovarian failure and partial sex reversal, respectively, in adult females. In foxl2a−/− female mutants, sox9a-amh/cyp19a1a signaling was upregulated at 150 days postfertilization (dpf) and subsequently oocyte apoptosis was triggered after 180 dpf. In contrast, dmrt1 expression was greater at 105 dpf and increased several 100-fold in foxl2b−/− mutated ovaries at 270 dpf, along with other testis-related genes. Finally, homozygous foxl2a−/−/foxl2b−/− double mutants were constructed in which complete sex reversal occurs early and testis-differentiation genes robustly increase at 60 dpf. Given mutual compensation between foxl2a and foxl2b in foxl2b−/− and foxl2a−/− mutants, we proposed a model in which foxl2a and foxl2b cooperate to regulate zebrafish ovary development and maintenance, with foxl2b potentially having a dominant role in preventing the ovary from differentiating as testis, as compared to foxl2a. PMID:28193729

Dominant negative DISC1 mutant mice display specific social behaviour deficits and aberration in BDNF and cannabinoid receptor expression.

PubMed

Kaminitz, Ayelet; Barzilay, Ran; Segal, Hadar; Taler, Michal; Offen, Daniel; Gil-Ad, Irit; Mechoulam, Raphael; Weizman, Abraham

2014-01-01

OBJECTIVES. Disrupted in schizophrenia 1 (DISC1) is considered the most prominent candidate gene for schizophrenia. In this study, we aimed to characterize behavioural and brain biochemical traits in a mouse expressing a dominant negative DISC1mutant (DN-DISC1). DN-DISC1 mice underwent behavioural tests to evaluate object recognition, social preference and social novelty seeking. ELISA was conducted on brain tissue to evaluate BDNF levels. Western blot was employed to measure BDNF receptor (TrkB) and cannabinoid receptor CB1. The mutant DISC1 mice displayed deficits in preference to social novelty while both social preference and object recognition were intact. Biochemical analysis of prefrontal cortex and hippocampus revealed a modest reduction in cortical TrkB protein levels of male mice while no differences in BDNF levels were observed. We found sex dependent differences in the expression of cannabinoid-1 receptors. We describe novel behavioural and biochemical abnormalities in the DN-DISC1 mouse model of schizophrenia. The data shows for the first time a possible link between DISC1 mutation and the cannabinoid system.

Capsicum annuum S (CaS) promotes reproductive transition and is required for flower formation in pepper (Capsicum annuum).

PubMed

Cohen, Oded; Borovsky, Yelena; David-Schwartz, Rakefet; Paran, Ilan

2014-05-01

The genetic control of the transition to flowering has mainly been studied in model species, while few data are available in crop species such as pepper (Capsicum spp.). To elucidate the genetic control of the transition to flowering in pepper, mutants that lack flowers were isolated and characterized. Genetic mapping and sequencing allowed the identification of the gene disrupted in the mutants. Double mutants and expression analyses were used to characterize the relationships between the mutated gene and other genes controlling the transition to flowering and flower differentiation. The mutants were characterized by a delay in the initiation of sympodial growth, a delay in the termination of sympodial meristems and complete inhibition of flower formation. Capsicum annuum S (CaS), the pepper (Capsicum annuum) ortholog of tomato (Solanum lycopersicum) COMPOUND INFLORESCENCE and petunia (Petunia hybrida) EVERGREEN, was found to govern the mutant phenotype. CaS is required for the activity of the flower meristem identity gene Ca-ANANTHA and does not affect the expression of CaLEAFY. CaS is epistatic over other genes controlling the transition to flowering with respect to flower formation. Comparative homologous mutants in the Solanaceae indicate that CaS has uniquely evolved to have a critical role in flower formation, while its role in meristem maturation is conserved in pepper, tomato and petunia. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

Absence of cell surface expression of human ACE leads to perinatal death

PubMed Central

Michaud, Annie; Acharya, K. Ravi; Masuyer, Geoffrey; Quenech'du, Nicole; Gribouval, Olivier; Morinière, Vincent; Gubler, Marie-Claire; Corvol, Pierre

2014-01-01

Renal tubular dysgenesis (RTD) is a recessive autosomal disease characterized most often by perinatal death. It is due to the inactivation of any of the major genes of the renin-angiotensin system (RAS), one of which is the angiotensin I-converting enzyme (ACE). ACE is present as a tissue-bound enzyme and circulates in plasma after its solubilization. In this report, we present the effect of different ACE mutations associated with RTD on ACE intracellular trafficking, secretion and enzymatic activity. One truncated mutant, R762X, responsible for neonatal death was found to be an enzymatically active, secreted form, not inserted in the plasma membrane. In contrast, another mutant, R1180P, was compatible with life after transient neonatal renal insufficiency. This mutant was located at the plasma membrane and rapidly secreted. These results highlight the importance of tissue-bound ACE versus circulating ACE and show that the total absence of cell surface expression of ACE is incompatible with life. In addition, two missense mutants (W594R and R828H) and two truncated mutants (Q1136X and G1145AX) were also studied. These mutants were neither inserted in the plasma membrane nor secreted. Finally, the structural implications of these ACE mutations were examined by molecular modelling, which suggested some important structural alterations such as disruption of intra-molecular non-covalent interactions (e.g. salt bridges). PMID:24163131

The cleft lip and palate defects in Dancer mutant mice result from gain of function of the Tbx10 gene

PubMed Central

Bush, Jeffrey O.; Lan, Yu; Jiang, Rulang

2004-01-01

Cleft lip and palate (CL/P) is a common disfiguring birth defect with complex, poorly understood etiology. Mice carrying a spontaneous mutation, Dancer (Dc), exhibit CL/P in homozygotes and show significantly increased susceptibility to CL/P in heterozygotes [Deol, M. S. & Lane, P. W. (1966) J. Embryol. Exp. Morphol. 16, 543–558 and Trasler, D. G., Kemp, D. & Trasler, T. A. (1984) Teratology 29, 101–104], providing an animal model for understanding the molecular pathogenesis of CL/P. We genetically mapped Dc to within a 1-cM region near the centromere of chromosome 19. In situ hybridization analysis showed that one positional candidate gene, Tbx10, is ectopically expressed in Dc mutant embryos. Positional cloning of the Dc locus revealed an insertion of a 3.3-kb sequence containing the 5′ region of the p23 gene into the first intron of Tbx10, which causes ectopic expression of a p23-Tbx10 chimeric transcript encoding a protein product identical to a normal variant of the Tbx10 protein. Furthermore, we show that ectopic expression of Tbx10 in transgenic mice recapitulates the Dc mutant phenotype, indicating that CL/Pin Dc mutant mice results from the p23 insertion-induced ectopic Tbx10 expression. These results identify gain of function of a T-box transcription factor gene as a mechanism underlying CL/P pathogenesis. PMID:15118109

Mutant SOD1 in cell types other than motor neurons and oligodendrocytes accelerates onset of disease in ALS mice

PubMed Central

Yamanaka, Koji; Boillee, Severine; Roberts, Elizabeth A.; Garcia, Michael L.; McAlonis-Downes, Melissa; Mikse, Oliver R.; Cleveland, Don W.; Goldstein, Lawrence S. B.

2008-01-01

Dominant mutations in ubiquitously expressed superoxide dismutase (SOD1) cause familial ALS by provoking premature death of adult motor neurons. To test whether mutant damage to cell types beyond motor neurons is required for the onset of motor neuron disease, we generated chimeric mice in which all motor neurons and oligodendrocytes expressed mutant SOD1 at a level sufficient to cause fatal, early-onset motor neuron disease when expressed ubiquitously, but did so in a cellular environment containing variable numbers of non-mutant, non-motor neurons. Despite high-level mutant expression within 100% of motor neurons and oligodendrocytes, in most of these chimeras, the presence of WT non-motor neurons substantially delayed onset of motor neuron degeneration, increasing disease-free life by 50%. Disease onset is therefore non-cell autonomous, and mutant SOD1 damage within cell types other than motor neurons and oligodendrocytes is a central contributor to initiation of motor neuron degeneration. PMID:18492803

Using Answer Set Programming to Integrate RNA Expression with Signalling Pathway Information to Infer How Mutations Affect Ageing

PubMed Central

Papatheodorou, Irene; Ziehm, Matthias; Wieser, Daniela; Alic, Nazif; Partridge, Linda; Thornton, Janet M.

2012-01-01

A challenge of systems biology is to integrate incomplete knowledge on pathways with existing experimental data sets and relate these to measured phenotypes. Research on ageing often generates such incomplete data, creating difficulties in integrating RNA expression with information about biological processes and the phenotypes of ageing, including longevity. Here, we develop a logic-based method that employs Answer Set Programming, and use it to infer signalling effects of genetic perturbations, based on a model of the insulin signalling pathway. We apply our method to RNA expression data from Drosophila mutants in the insulin pathway that alter lifespan, in a foxo dependent fashion. We use this information to deduce how the pathway influences lifespan in the mutant animals. We also develop a method for inferring the largest common sub-paths within each of our signalling predictions. Our comparisons reveal consistent homeostatic mechanisms across both long- and short-lived mutants. The transcriptional changes observed in each mutation usually provide negative feedback to signalling predicted for that mutation. We also identify an S6K-mediated feedback in two long-lived mutants that suggests a crosstalk between these pathways in mutants of the insulin pathway, in vivo. By formulating the problem as a logic-based theory in a qualitative fashion, we are able to use the efficient search facilities of Answer Set Programming, allowing us to explore larger pathways, combine molecular changes with pathways and phenotype and infer effects on signalling in in vivo, whole-organism, mutants, where direct signalling stimulation assays are difficult to perform. Our methods are available in the web-service NetEffects: http://www.ebi.ac.uk/thornton-srv/software/NetEffects. PMID:23251396

Using answer set programming to integrate RNA expression with signalling pathway information to infer how mutations affect ageing.

PubMed

Papatheodorou, Irene; Ziehm, Matthias; Wieser, Daniela; Alic, Nazif; Partridge, Linda; Thornton, Janet M

2012-01-01

A challenge of systems biology is to integrate incomplete knowledge on pathways with existing experimental data sets and relate these to measured phenotypes. Research on ageing often generates such incomplete data, creating difficulties in integrating RNA expression with information about biological processes and the phenotypes of ageing, including longevity. Here, we develop a logic-based method that employs Answer Set Programming, and use it to infer signalling effects of genetic perturbations, based on a model of the insulin signalling pathway. We apply our method to RNA expression data from Drosophila mutants in the insulin pathway that alter lifespan, in a foxo dependent fashion. We use this information to deduce how the pathway influences lifespan in the mutant animals. We also develop a method for inferring the largest common sub-paths within each of our signalling predictions. Our comparisons reveal consistent homeostatic mechanisms across both long- and short-lived mutants. The transcriptional changes observed in each mutation usually provide negative feedback to signalling predicted for that mutation. We also identify an S6K-mediated feedback in two long-lived mutants that suggests a crosstalk between these pathways in mutants of the insulin pathway, in vivo. By formulating the problem as a logic-based theory in a qualitative fashion, we are able to use the efficient search facilities of Answer Set Programming, allowing us to explore larger pathways, combine molecular changes with pathways and phenotype and infer effects on signalling in in vivo, whole-organism, mutants, where direct signalling stimulation assays are difficult to perform. Our methods are available in the web-service NetEffects: http://www.ebi.ac.uk/thornton-srv/software/NetEffects.

The additive effects of the TM6SF2 E167K and PNPLA3 I148M polymorphisms on lipid metabolism

PubMed Central

Chen, Lizhen; Du, Shuixian; Lu, Linlin; Lin, Zhonghua; Jin, Wenwen; Hu, Doudou; Jiang, Xiangjun; Xin, Yongning; Xuan, Shiying

2017-01-01

There is a genetic susceptibility for nonalcoholic fatty liver disease (NAFLD). To examine the role of genetic factors in the disease, a Bayesian analysis was performed to model gene relationships in NAFLD pathogenesis. The Bayesian analysis indicated a potential gene interaction between the TM6SF2 and PNPLA3 genes. Next, to explore the underlying mechanism at the cellular level, we evaluated the additive effects between the TM6SF2 E167K and PNPLA3 I148M polymorphisms on lipid metabolism. Hepa 1-6 cells were transfected with a control vector or with overexpression vectors for TM6SF2/PNPLA3-wild type, TM6SF2-mutant type, PNPLA3-mutant type, or TM6SF2/PNPLA3-mutant type. Commercial kits were used to measure triglyceride and total cholesterol levels in each of the five groups. The mRNA and protein expression levels of sterol regulatory element-binding transcription factor 1c and fatty acid synthase were analyzed using real-time PCR and western blotting. The triglyceride and total cholesterol contents were significantly different among the groups. The triglyceride and total cholesterol contents and the sterol regulatory element-binding transcription factor 1c and fatty acid synthase mRNA and protein expression levels were significantly higher in the TM6SF2/PNPLA3-mutant type group than in the TM6SF2-mutant type group or the PNPLA3-mutant type group. The TM6SF2 E167K and PNPLA3 I148M polymorphisms may have additive effects on lipid metabolism by increasing the expression of sterol regulatory element-binding transcription factor 1c and fatty acid synthase. PMID:29088779

The additive effects of the TM6SF2 E167K and PNPLA3 I148M polymorphisms on lipid metabolism.

PubMed

Chen, Lizhen; Du, Shuixian; Lu, Linlin; Lin, Zhonghua; Jin, Wenwen; Hu, Doudou; Jiang, Xiangjun; Xin, Yongning; Xuan, Shiying

2017-09-26

There is a genetic susceptibility for nonalcoholic fatty liver disease (NAFLD). To examine the role of genetic factors in the disease, a Bayesian analysis was performed to model gene relationships in NAFLD pathogenesis. The Bayesian analysis indicated a potential gene interaction between the TM6SF2 and PNPLA3 genes. Next, to explore the underlying mechanism at the cellular level, we evaluated the additive effects between the TM6SF2 E167K and PNPLA3 I148M polymorphisms on lipid metabolism. Hepa 1-6 cells were transfected with a control vector or with overexpression vectors for TM6SF2/PNPLA3-wild type, TM6SF2-mutant type, PNPLA3-mutant type, or TM6SF2/PNPLA3-mutant type. Commercial kits were used to measure triglyceride and total cholesterol levels in each of the five groups. The mRNA and protein expression levels of sterol regulatory element-binding transcription factor 1c and fatty acid synthase were analyzed using real-time PCR and western blotting. The triglyceride and total cholesterol contents were significantly different among the groups. The triglyceride and total cholesterol contents and the sterol regulatory element-binding transcription factor 1c and fatty acid synthase mRNA and protein expression levels were significantly higher in the TM6SF2/PNPLA3-mutant type group than in the TM6SF2-mutant type group or the PNPLA3-mutant type group. The TM6SF2 E167K and PNPLA3 I148M polymorphisms may have additive effects on lipid metabolism by increasing the expression of sterol regulatory element-binding transcription factor 1c and fatty acid synthase.

Compensatory changes in CYP expression in three different toxicology mouse models: CAR-null, Cyp3a-null, and Cyp2b9/10/13-null mice

EPA Science Inventory

Targeted mutant models are common in mechanistic toxicology experiments investigating the absorption, metabolism, distribution, or elimination (ADME) of chemicals from individuals. Key models include those for xenosensing transcription factors and cytochrome P450s (CYP). Here we ...

Purkinje Cell Compartmentation in the Cerebellum of the Lysosomal Acid Phosphatase 2 Mutant Mouse (Nax - Naked-Ataxia Mutant Mouse)

PubMed Central

Bailey, Karen; Rahimi Balaei, Maryam; Mannan, Ashraf; Del Bigio, Marc R.; Marzban, Hassan

2014-01-01

The Acp2 gene encodes the beta subunit of lysosomal acid phosphatase, which is an isoenzyme that hydrolyzes orthophosphoric monoesters. In mice, a spontaneous mutation in Acp2 results in severe cerebellar defects. These include a reduced size, abnormal lobulation, and an apparent anterior cerebellar disorder with an absent or hypoplastic vermis. Based on differential gene expression in the cerebellum, the mouse cerebellar cortex can normally be compartmentalized anteroposteriorly into four transverse zones and mediolaterally into parasagittal stripes. In this study, immunohistochemistry was performed using various Purkinje cell compartmentation markers to examine their expression patterns in the Acp2 mutant. Despite the abnormal lobulation and anterior cerebellar defects, zebrin II and PLCβ4 showed similar expression patterns in the nax mutant and wild type cerebellum. However, fewer stripes were found in the anterior zone of the nax mutant, which could be due to a lack of Purkinje cells or altered expression of the stripe markers. HSP25 expression was uniform in the central zone of the nax mutant cerebellum at around postnatal day (P) 18–19, suggesting that HSP25 immunonegative Purkinje cells are absent or delayed in stripe pattern expression compared to the wild type. HSP25 expression became heterogeneous around P22–23, with twice the number of parasagittal stripes in the nax mutant compared to the wild type. Aside from reduced size and cortical disorganization, both the posterior zone and nodular zone in the nax mutant appeared less abnormal than the rest of the cerebellum. From these results, it is evident that the anterior zone of the nax mutant cerebellum is the most severely affected, and this extends beyond the primary fissure into the rostral central zone/vermis. This suggests that ACP2 has critical roles in the development of the anterior cerebellum and it may regulate anterior and central zone compartmentation. PMID:24722417

notch3 is essential for oligodendrocyte development and vascular integrity in zebrafish

PubMed Central

Zaucker, Andreas; Mercurio, Sara; Sternheim, Nitzan; Talbot, William S.; Marlow, Florence L.

2013-01-01

SUMMARY Mutations in the human NOTCH3 gene cause CADASIL syndrome (cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy). CADASIL is an inherited small vessel disease characterized by diverse clinical manifestations including vasculopathy, neurodegeneration and dementia. Here we report two mutations in the zebrafish notch3 gene, one identified in a previous screen for mutations with reduced expression of myelin basic protein (mbp) and another caused by a retroviral insertion. Reduced mbp expression in notch3 mutant embryos is associated with fewer oligodendrocyte precursor cells (OPCs). Despite an early neurogenic phenotype, mbp expression recovered at later developmental stages and some notch3 homozygous mutants survived to adulthood. These mutants, as well as adult zebrafish carrying both mutant alleles together, displayed a striking stress-associated accumulation of blood in the head and fins. Histological analysis of mutant vessels revealed vasculopathy, including: an enlargement (dilation) of vessels in the telencephalon and fin, disorganization of the normal stereotyped arrangement of vessels in the fin, and an apparent loss of arterial morphological structure. Expression of hey1, a well-known transcriptional target of Notch signaling, was greatly reduced in notch3 mutant fins, suggesting that Notch3 acts via a canonical Notch signaling pathway to promote normal vessel structure. Ultrastructural analysis confirmed the presence of dilated vessels in notch3 mutant fins and revealed that the vessel walls of presumed arteries showed signs of deterioration. Gaps in the arterial wall and the presence of blood cells outside of vessels in mutants indicated that compromised vessel structure led to hemorrhage. In notch3 heterozygotes, we found elevated expression of both notch3 itself and target genes, indicating that specific alterations in gene expression due to partial loss of Notch3 function might contribute to the abnormalities observed in heterozygous larvae and adults. Our analysis of zebrafish notch3 mutants indicates that Notch3 regulates OPC development and mbp gene expression in larvae, and maintains vascular integrity in adults. PMID:23720232

Novel cell-cell signaling by microglial transmembrane TNFα with implications for neuropathic pain

PubMed Central

Zhou, Zhigang; Peng, Xiangmin; Hagshenas, Jafar; Insolera, Ryan; Fink, David J.; Mata, Marina

2010-01-01

Neuropathic pain is accompanied by neuroimmune activation in dorsal horn of spinal cord. We have observed that in animal models this activation is characterized by increased expression of transmembrane tumor necrosis factor α (mTNFα) without release of soluble (sTNFα). Here we report that the pain-related neurotransmitter peptide substance P (SP) increases expression of mTNFα without release of sTNFα from primary microglial cells. We modeled this interaction using an immortalized microglial cell line; exposure of these cells to SP also resulted in increased expression of mTNFα but without any increase in expression of the TNF-cleaving enzyme (TACE) and no release of sTNFα. In order to evaluate the biological function of uncleaved mTNFα, we transfected COS-7 cells with a mutant full length TNFα construct resistant to cleavage by TACE. Co-culture of COS-7 cells expressing the mutant TNFα with microglial cells led to microglial cell activation indicated by increased OX-42 immunoreactivity and release of macrophage chemoattractant peptide 1 (CCL2) by direct cell-cell contact. These results suggest a novel pathway through which release of SP by primary afferents activates microglial expression of mTNFα, establishing a feed-forward loop that may contribute to the establishment of chronic pain. PMID:20609516

Coenzyme Q supplementation or over-expression of the yeast Coq8 putative kinase stabilizes multi-subunit Coq polypeptide complexes in yeast coq null mutants.

PubMed

He, Cuiwen H; Xie, Letian X; Allan, Christopher M; Tran, Uyenphuong C; Clarke, Catherine F

2014-04-04

Coenzyme Q biosynthesis in yeast requires a multi-subunit Coq polypeptide complex. Deletion of any one of the COQ genes leads to respiratory deficiency and decreased levels of the Coq4, Coq6, Coq7, and Coq9 polypeptides, suggesting that their association in a high molecular mass complex is required for stability. Over-expression of the putative Coq8 kinase in certain coq null mutants restores steady-state levels of the sensitive Coq polypeptides and promotes the synthesis of late-stage Q-intermediates. Here we show that over-expression of Coq8 in yeast coq null mutants profoundly affects the association of several of the Coq polypeptides in high molecular mass complexes, as assayed by separation of digitonin extracts of mitochondria by two-dimensional blue-native/SDS PAGE. The Coq4 polypeptide persists at high molecular mass with over-expression of Coq8 in coq3, coq5, coq6, coq7, coq9, and coq10 mutants, indicating that Coq4 is a central organizer of the Coq complex. Supplementation with exogenous Q6 increased the steady-state levels of Coq4, Coq7, and Coq9, and several other mitochondrial polypeptides in select coq null mutants, and also promoted the formation of late-stage Q-intermediates. Q supplementation may stabilize this complex by interacting with one or more of the Coq polypeptides. The stabilizing effects of exogenously added Q6 or over-expression of Coq8 depend on Coq1 and Coq2 production of a polyisoprenyl intermediate. Based on the observed interdependence of the Coq polypeptides, the effect of exogenous Q6, and the requirement for an endogenously produced polyisoprenyl intermediate, we propose a new model for the Q-biosynthetic complex, termed the CoQ-synthome. Copyright © 2014 Elsevier B.V. All rights reserved.

Coenzyme Q supplementation or over-expression of the yeast Coq8 putative kinase stabilizes multi-subunit Coq polypeptide complexes in yeast coq null mutants*

PubMed Central

He, Cuiwen H.; Xie, Letian X.; Allan, Christopher M.; Tran, UyenPhuong C.; Clarke, Catherine F.

2014-01-01

Coenzyme Q biosynthesis in yeast requires a multi-subunit Coq polypeptide complex. Deletion of any one of the COQ genes leads to respiratory deficiency and decreased levels of the Coq4, Coq6, Coq7, and Coq9 polypeptides, suggesting that their association in a high molecular mass complex is required for stability. Over-expression of the putative Coq8 kinase in certain coq null mutants restores steady-state levels of the sensitive Coq polypeptides and promotes the synthesis of late-stage Q-intermediates. Here we show that over-expression of Coq8 in yeast coq null mutants profoundly affects the association of several of the Coq polypeptides in high molecular mass complexes, as assayed by separation of digitonin extracts of mitochondria by two-dimensional blue-native/SDS PAGE. The Coq4 polypeptide persists at high molecular mass with over-expression of Coq8 in coq3, coq5, coq6, coq7, coq9, and coq10 mutants, indicating that Coq4 is a central organizer of the Coq complex. Supplementation with exogenous Q6 increased the steady-state levels of Coq4, Coq7, Coq9, and several other mitochondrial polypeptides in select coq null mutants, and also promoted the formation of late-stage Q-intermediates. Q supplementation may stabilize this complex by interacting with one or more of the Coq polypeptides. The stabilizing effects of exogenously added Q6 or over-expression of Coq8 depend on Coq1 and Coq2 production of a polyisoprenyl intermediate. Based on the observed interdependence of the Coq polypeptides, the effect of exogenous Q6, and the requirement for an endogenously produced polyisoprenyl intermediate, we propose a new model for the Q-biosynthetic complex, termed the CoQ-synthome. PMID:24406904

Restoring de novo Coenzyme Q biosynthesis in Caenorhabditis elegans coq-3 mutants yields profound rescue compared to exogenous Coenzyme Q supplementation

PubMed Central

Gomez, Fernando; Saiki, Ryoichi; Chin, Randall; Srinivasan, Chandra; Clarke, Catherine F.

2012-01-01

Coenzyme Q (ubiquinone or Q) is an essential lipid component of the mitochondrial electron transport chain. In Caenorhabditis elegans Q biosynthesis involves at least nine steps, including the hydroxylation of the hydroquinone ring by CLK-1 and two O-methylation steps mediated by COQ-3. We characterize two C. elegans coq-3 deletion mutants, and show that while each has defects in Q synthesis, their phenotypes are distinct. First generation homozygous coq-3(ok506) mutants are fertile when fed the standard lab diet of Q-replete OP50 E. coli, but their second generation homozygous progeny do not reproduce. In contrast, the coq-3(qm188) deletion mutant remains sterile when fed Q-replete OP50. Quantitative PCR analyses suggest that the longer qm188 deletion may alter expression of the flanking nuo-3 and gdi-1 genes, located 5′ and 3′, respectively of coq-3 within an operon. We surmise that variable expression of nuo-3, a subunit of complex I, or of gdi-1, a guanine nucleotide dissociation inhibitor, may act in combination with defects in Q biosynthesis to produce a more severe phenotype. The phenotypes of both coq-3 mutants are more drastic as compared to the C. elegans clk-1 mutants. When fed OP50, clk-1 mutants reproduce for many generations, but show reduced fertility, slow behaviors, and enhanced life span. The coq-3 and clk-1 mutants all show arrested development and are sterile when fed the Q-deficient E. coli strain GD1 (harboring a mutation in the ubiG gene). However, unlike clk-1 mutant worms, neither coq-3 mutant strain responded to dietary supplementation with purified exogenous Q10. Here we show that the Q9 content can be determined in lipid extracts from just 200 individual worms, enabling the determination of Q content in the coq-3 mutants unable to reproduce. An extra-chromosomal array expressing wild-type C. elegans coq-3 rescued fertility of both coq-3 mutants and partially restored steady-state levels of COQ-3 polypeptide and Q9 content, indicating that primary defect in both is limited to coq-3. The limited response of the coq-3 mutants to dietary supplementation with Q provides a powerful model to probe the effectiveness of exogenous Q supplementation as compared to restoration of de novo Q biosynthesis. PMID:22735617

Restoring de novo coenzyme Q biosynthesis in Caenorhabditis elegans coq-3 mutants yields profound rescue compared to exogenous coenzyme Q supplementation.

PubMed

Gomez, Fernando; Saiki, Ryoichi; Chin, Randall; Srinivasan, Chandra; Clarke, Catherine F

2012-09-10

Coenzyme Q (ubiquinone or Q) is an essential lipid component of the mitochondrial electron transport chain. In Caenorhabditis elegans Q biosynthesis involves at least nine steps, including the hydroxylation of the hydroquinone ring by CLK-1 and two O-methylation steps mediated by COQ-3. We characterize two C. elegans coq-3 deletion mutants, and show that while each has defects in Q synthesis, their phenotypes are distinct. First generation homozygous coq-3(ok506) mutants are fertile when fed the standard lab diet of Q-replete OP50 Escherichia coli, but their second generation homozygous progeny does not reproduce. In contrast, the coq-3(qm188) deletion mutant remains sterile when fed Q-replete OP50. Quantitative PCR analyses suggest that the longer qm188 deletion may alter expression of the flanking nuo-3 and gdi-1 genes, located 5' and 3', respectively of coq-3 within an operon. We surmise that variable expression of nuo-3, a subunit of complex I, or of gdi-1, a guanine nucleotide dissociation inhibitor, may act in combination with defects in Q biosynthesis to produce a more severe phenotype. The phenotypes of both coq-3 mutants are more drastic as compared to the C. elegans clk-1 mutants. When fed OP50, clk-1 mutants reproduce for many generations, but show reduced fertility, slow behaviors, and enhanced life span. The coq-3 and clk-1 mutants all show arrested development and are sterile when fed the Q-deficient E. coli strain GD1 (harboring a mutation in the ubiG gene). However, unlike clk-1 mutant worms, neither coq-3 mutant strain responded to dietary supplementation with purified exogenous Q(10). Here we show that the Q(9) content can be determined in lipid extracts from just 200 individual worms, enabling the determination of Q content in the coq-3 mutants unable to reproduce. An extra-chromosomal array expressing wild-type C. elegans coq-3 rescued fertility of both coq-3 mutants and partially restored steady-state levels of COQ-3 polypeptide and Q(9) content, indicating that primary defect in both is limited to coq-3. The limited response of the coq-3 mutants to dietary supplementation with Q provides a powerful model to probe the effectiveness of exogenous Q supplementation as compared to restoration of de novo Q biosynthesis. Copyright © 2012 Elsevier B.V. All rights reserved.

A missense mutation in Grm6 reduces but does not eliminate mGluR6 expression or rod depolarizing bipolar cell function.

PubMed

Peachey, Neal S; Hasan, Nazarul; FitzMaurice, Bernard; Burrill, Samantha; Pangeni, Gobinda; Karst, Son Yong; Reinholdt, Laura; Berry, Melissa L; Strobel, Marge; Gregg, Ronald G; McCall, Maureen A; Chang, Bo

2017-08-01

GRM6 encodes the metabotropic glutamate receptor 6 (mGluR6) used by retinal depolarizing bipolar cells (DBCs). Mutations in GRM6 lead to DBC dysfunction and underlie the human condition autosomal recessive complete congenital stationary night blindness. Mouse mutants for Grm6 are important models for this condition. Here we report a new Grm6 mutant, identified in an electroretinogram (ERG) screen of mice maintained at The Jackson Laboratory. The Grm6 nob8 mouse has a reduced-amplitude b-wave component of the ERG, which reflects light-evoked DBC activity. Sequencing identified a missense mutation that converts a highly conserved methionine within the ligand binding domain to leucine (p.Met66Leu). Consistent with prior studies of Grm6 mutant mice, the laminar size and structure in the Grm6 nob8 retina were comparable to control. The Grm6 nob8 phenotype is distinguished from other Grm6 mutants that carry a null allele by a reduced but not absent ERG b-wave, decreased but present expression of mGluR6 at DBC dendritic tips, and mislocalization of mGluR6 to DBC somas. Consistent with a reduced but not absent b-wave, there were a subset of retinal ganglion cells whose responses to light onset have times to peak within the range of those in control retinas. These data indicate that the p.Met66Leu mutant mGluR6 is trafficked less than control. However, the mGluR6 that is localized to the DBC dendritic tips is able to initiate DBC signal transduction. The Grm6 nob8 mouse extends the Grm6 allelic series and will be useful for elucidating the role of mGluR6 in DBC signal transduction and in human disease. NEW & NOTEWORTHY This article describes a mouse model of the human disease complete congenital stationary night blindness in which the mutation reduces but does not eliminate GRM6 expression and bipolar cell function, a distinct phenotype from that seen in other Grm6 mouse models.

Impairment of O-antigen production confers resistance to grazing in a model amoeba-cyanobacterium predator-prey system.

PubMed

Simkovsky, Ryan; Daniels, Emy F; Tang, Karen; Huynh, Stacey C; Golden, Susan S; Brahamsha, Bianca

2012-10-09

The grazing activity of predators on photosynthetic organisms is a major mechanism of mortality and population restructuring in natural environments. Grazing is also one of the primary difficulties in growing cyanobacteria and other microalgae in large, open ponds for the production of biofuels, as contaminants destroy valuable biomass and prevent stable, continuous production of biofuel crops. To address this problem, we have isolated a heterolobosean amoeba, HGG1, that grazes upon unicellular and filamentous freshwater cyanobacterial species. We have established a model predator-prey system using this amoeba and Synechococcus elongatus PCC 7942. Application of amoebae to a library of mutants of S. elongatus led to the identification of a grazer-resistant knockout mutant of the wzm ABC O-antigen transporter gene, SynPCC7942_1126. Mutations in three other genes involved in O-antigen synthesis and transport also prevented the expression of O-antigen and conferred resistance to HGG1. Complementation of these rough mutants returned O-antigen expression and susceptibility to amoebae. Rough mutants are easily identifiable by appearance, are capable of autoflocculation, and do not display growth defects under standard laboratory growth conditions, all of which are desired traits for a biofuel production strain. Thus, preventing the production of O-antigen is a pathway for producing resistance to grazing by certain amoebae.

Impairment of O-antigen production confers resistance to grazing in a model amoeba–cyanobacterium predator–prey system

PubMed Central

Simkovsky, Ryan; Daniels, Emy F.; Tang, Karen; Huynh, Stacey C.; Golden, Susan S.; Brahamsha, Bianca

2012-01-01

The grazing activity of predators on photosynthetic organisms is a major mechanism of mortality and population restructuring in natural environments. Grazing is also one of the primary difficulties in growing cyanobacteria and other microalgae in large, open ponds for the production of biofuels, as contaminants destroy valuable biomass and prevent stable, continuous production of biofuel crops. To address this problem, we have isolated a heterolobosean amoeba, HGG1, that grazes upon unicellular and filamentous freshwater cyanobacterial species. We have established a model predator–prey system using this amoeba and Synechococcus elongatus PCC 7942. Application of amoebae to a library of mutants of S. elongatus led to the identification of a grazer-resistant knockout mutant of the wzm ABC O-antigen transporter gene, SynPCC7942_1126. Mutations in three other genes involved in O-antigen synthesis and transport also prevented the expression of O-antigen and conferred resistance to HGG1. Complementation of these rough mutants returned O-antigen expression and susceptibility to amoebae. Rough mutants are easily identifiable by appearance, are capable of autoflocculation, and do not display growth defects under standard laboratory growth conditions, all of which are desired traits for a biofuel production strain. Thus, preventing the production of O-antigen is a pathway for producing resistance to grazing by certain amoebae. PMID:23012457

A gain-of-function mutation of plastidic invertase alters nuclear gene expression with sucrose treatment partially via GENOMES UNCOUPLED1-mediated signaling.

PubMed

Maruta, Takanori; Miyazaki, Nozomi; Nosaka, Ryota; Tanaka, Hiroyuki; Padilla-Chacon, Daniel; Otori, Kumi; Kimura, Ayako; Tanabe, Noriaki; Yoshimura, Kazuya; Tamoi, Masahiro; Shigeoka, Shigeru

2015-05-01

Plastid gene expression (PGE) is one of the signals that regulate the expression of photosynthesis-associated nuclear genes (PhANGs) via GENOMES UNCOUPLED1 (GUN1)-dependent retrograde signaling. We recently isolated Arabidopsis sugar-inducible cotyledon yellow-192 (sicy-192), a gain-of-function mutant of plastidic invertase, and showed that following the treatment of this mutant with sucrose, the expression of PhANGs as well as PGE decreased, suggesting that the sicy-192 mutation activates a PGE-evoked and GUN1-mediated retrograde pathway. To clarify the relationship between the sicy-192 mutation, PGE, and GUN1-mediated pathway, plastid and nuclear gene expression in a double mutant of sicy-192 and gun1-101, a null mutant of GUN1 was studied. Plastid-encoded RNA polymerase (PEP)-dependent PGE was markedly suppressed in the sicy-192 mutant by the sucrose treatment, but the suppression as well as cotyledon yellow phenotype was not mitigated by GUN1 disruption. Microarray analysis revealed that the altered expression of nuclear genes such as PhANG in the sucrose-treated sicy-192 mutant was largely dependent on GUN1. The present findings demonstrated that the sicy-192 mutation alters nuclear gene expression with sucrose treatment via GUN1, which is possibly followed by inhibiting PEP-dependent PGE, providing a new insight into the role of plastid sugar metabolism in nuclear gene expression. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Nonlinear effects of hyperpolarizing shifts in activation of mutant Nav1.7 channels on resting membrane potential

PubMed Central

Estacion, Mark

2017-01-01

The Nav1.7 sodium channel is preferentially expressed within dorsal root ganglion (DRG) and sympathetic ganglion neurons. Gain-of-function mutations that cause the painful disorder inherited erythromelalgia (IEM) shift channel activation in a hyperpolarizing direction. When expressed within DRG neurons, these mutations produce a depolarization of resting membrane potential (RMP). The biophysical basis for the depolarized RMP has to date not been established. To explore the effect on RMP of the shift in activation associated with a prototypical IEM mutation (L858H), we used dynamic-clamp models that represent graded shifts that fractionate the effect of the mutation on activation voltage dependence. Dynamic-clamp recording from DRG neurons using a before-and-after protocol for each cell made it possible, even in the presence of cell-to-cell variation in starting RMP, to assess the effects of these graded mutant models. Our results demonstrate a nonlinear, progressively larger effect on RMP as the shift in activation voltage dependence becomes more hyperpolarized. The observed differences in RMP were predicted by the “late” current of each mutant model. Since the depolarization of RMP imposed by IEM mutant channels is known, in itself, to produce hyperexcitability of DRG neurons, the development of pharmacological agents that normalize or partially normalize activation voltage dependence of IEM mutant channels merits further study. NEW & NOTEWORTHY Inherited erythromelalgia (IEM), the first human pain disorder linked to a sodium channel, is widely regarded as a genetic model of neuropathic pain. IEM is produced by Nav1.7 mutations that hyperpolarize activation. These mutations produce a depolarization of resting membrane potential (RMP) in dorsal root ganglion neurons. Using dynamic clamp to explore the effect on RMP of the shift in activation, we demonstrate a nonlinear effect on RMP as the shift in activation voltage dependence becomes more hyperpolarized. PMID:28148645

A multiscale computational approach to dissect early events in the Erb family receptor mediated activation, differential signaling, and relevance to oncogenic transformations.

PubMed

Liu, Yingting; Purvis, Jeremy; Shih, Andrew; Weinstein, Joshua; Agrawal, Neeraj; Radhakrishnan, Ravi

2007-06-01

We describe a hierarchical multiscale computational approach based on molecular dynamics simulations, free energy-based molecular docking simulations, deterministic network-based kinetic modeling, and hybrid discrete/continuum stochastic dynamics protocols to study the dimer-mediated receptor activation characteristics of the Erb family receptors, specifically the epidermal growth factor receptor (EGFR). Through these modeling approaches, we are able to extend the prior modeling of EGF-mediated signal transduction by considering specific EGFR tyrosine kinase (EGFRTK) docking interactions mediated by differential binding and phosphorylation of different C-terminal peptide tyrosines on the RTK tail. By modeling signal flows through branching pathways of the EGFRTK resolved on a molecular basis, we are able to transcribe the effects of molecular alterations in the receptor (e.g., mutant forms of the receptor) to differing kinetic behavior and downstream signaling response. Our molecular dynamics simulations show that the drug sensitizing mutation (L834R) of EGFR stabilizes the active conformation to make the system constitutively active. Docking simulations show preferential characteristics (for wildtype vs. mutant receptors) in inhibitor binding as well as preferential enhancement of phosphorylation of particular substrate tyrosines over others. We find that in comparison to the wildtype system, the L834R mutant RTK preferentially binds the inhibitor erlotinib, as well as preferentially phosphorylates the substrate tyrosine Y1068 but not Y1173. We predict that these molecular level changes result in preferential activation of the Akt signaling pathway in comparison to the Erk signaling pathway for cells with normal EGFR expression. For cells with EGFR over expression, the mutant over activates both Erk and Akt pathways, in comparison to wildtype. These results are consistent with qualitative experimental measurements reported in the literature. We discuss these consequences in light of how the network topology and signaling characteristics of altered (mutant) cell lines are shaped differently in relationship to native cell lines.

Biochemical analyses and molecular modeling explain the functional loss of 17β-hydroxysteroid dehydrogenase 3 mutant G133R in three Tunisian patients with 46, XY Disorders of Sex Development.

PubMed

Engeli, Roger T; Rhouma, Bochra Ben; Sager, Christoph P; Tsachaki, Maria; Birk, Julia; Fakhfakh, Faiza; Keskes, Leila; Belguith, Neila; Odermatt, Alex

2016-01-01

Mutations in the HSD17B3 gene resulting in 17β-hydroxysteroid dehydrogenase type 3 (17β-HSD3) deficiency cause 46, XY Disorders of Sex Development (46, XY DSD). Approximately 40 different mutations in HSD17B3 have been reported; only few mutant enzymes have been mechanistically investigated. Here, we report novel compound heterozygous mutations in HSD17B3, composed of the nonsense mutation C206X and the missense mutation G133R, in three Tunisian patients from two non-consanguineous families. Mutants C206X and G133R were constructed by site-directed mutagenesis and expressed in HEK-293 cells. The truncated C206X enzyme, lacking part of the substrate binding pocket, was moderately expressed and completely lost its enzymatic activity. Wild-type 17β-HSD3 and mutant G133R showed comparable expression levels and intracellular localization. The conversion of Δ4-androstene-3,17-dione (androstenedione) to testosterone was almost completely abolished for mutant G133R compared with wild-type 17β-HSD3. To obtain further mechanistic insight, G133 was mutated to alanine, phenylalanine and glutamine. G133Q and G133F were almost completely inactive, whereas G133A displayed about 70% of wild-type activity. Sequence analysis revealed that G133 on 17β-HSD3 is located in a motif highly conserved in 17β-HSDs and other short-chain dehydrogenase/reductase (SDR) enzymes. A homology model of 17β-HSD3 predicted that arginine or any other bulky residue at position 133 causes steric hindrance of cofactor NADPH binding, whereas substrate binding seems to be unaffected. The results indicate an essential role of G133 in the arrangement of the cofactor binding pocket, thus explaining the loss-of-function of 17β-HSD3 mutant G133R in the patients investigated. Copyright © 2015 Elsevier Ltd. All rights reserved.

Fixation probability in a two-locus intersexual selection model.

PubMed

Durand, Guillermo; Lessard, Sabin

2016-06-01

We study a two-locus model of intersexual selection in a finite haploid population reproducing according to a discrete-time Moran model with a trait locus expressed in males and a preference locus expressed in females. We show that the probability of ultimate fixation of a single mutant allele for a male ornament introduced at random at the trait locus given any initial frequency state at the preference locus is increased by weak intersexual selection and recombination, weak or strong. Moreover, this probability exceeds the initial frequency of the mutant allele even in the case of a costly male ornament if intersexual selection is not too weak. On the other hand, the probability of ultimate fixation of a single mutant allele for a female preference towards a male ornament introduced at random at the preference locus is increased by weak intersexual selection and weak recombination if the female preference is not costly, and is strong enough in the case of a costly male ornament. The analysis relies on an extension of the ancestral recombination-selection graph for samples of haplotypes to take into account events of intersexual selection, while the symbolic calculation of the fixation probabilities is made possible in a reasonable time by an optimizing algorithm. Copyright © 2016 Elsevier Inc. All rights reserved.

Evaluation of the effects of sdiA, a luxR homologue, on adherence and motility of Escherichia coli O157 : H7.

PubMed

Sharma, Vijay K; Bearson, Shawn M D; Bearson, Bradley L

2010-05-01

Quorum-sensing (QS) signalling pathways are important regulatory networks for controlling the expression of genes promoting adherence of enterohaemorrhagic Escherichia coli (EHEC) O157 : H7 to epithelial cells. A recent study has shown that EHEC O157 : H7 encodes a luxR homologue, called sdiA, which upon overexpression reduces the expression of genes encoding flagellar and locus of enterocyte effacement (LEE) proteins, thus negatively impacting on the motility and intimate adherence phenotypes, respectively. Here, we show that the deletion of sdiA from EHEC O157 : H7 strain 86-24, and from a hha (a negative regulator of ler) mutant of this strain, enhanced bacterial adherence to HEp-2 epithelial cells of the sdiA mutant strains relative to the strains containing a wild-type copy of sdiA. Quantitative reverse transcription PCR showed that the expression of LEE-encoded genes ler, espA and eae in strains with the sdiA deletions was not significantly different from that of the strains wild-type for sdiA. Similarly, no additional increases in the expression of LEE genes were observed in a sdiA hha double mutant strain relative to that observed in the hha deletion mutant. While the expression of fliC, which encodes flagellin, was enhanced in the sdiA mutant strain, the expression of fliC was reduced by several fold in the hha mutant strain, irrespective of the presence or absence of sdiA, indicating that the genes sdiA and hha exert opposing effects on the expression of fliC. The strains with deletions in sdiA or hha showed enhanced expression of csgA, encoding curlin of the curli fimbriae, with the expression of csgA highest in the sdiA hha double mutant, suggesting an additive effect of these two gene deletions on the expression of csgA. No significant differences were observed in the expression of the genes lpfA and fimA of the operons encoding long polar and type 1 fimbriae in the sdiA mutant strain. These data indicate that SdiA has no significant effect on the expression of LEE genes, but that it appears to act as a strong repressor of genes encoding flagella and curli fimbriae, and the alleviation of the SdiA-mediated repression of these genes in an EHEC O157 : H7 sdiA mutant strain contributes to enhanced bacterial motility and increased adherence to HEp-2 epithelial cells.

Mutants in the mouse NuRD/Mi2 component P66alpha are embryonic lethal.

PubMed

Marino, Susan; Nusse, Roel

2007-06-13

The NuRD/Mi2 chromatin complex is involved in histone modifications and contains a large number of subunits, including the p66 protein. There are two mouse and human p66 paralogs, p66alpha and p66beta. The functions of these genes are not clear, in part because there are no mutants available, except in invertebrate model systems. We made loss of function mutants in the mouse p66alpha gene (mp66alpha, official name Gatad2a, MGI:2384585). We found that mp66alpha is essential for development, as mutant embryos die around day 10 of embryogenesis. The gene is not required for normal blastocyst development or for implantation. The phenotype of mutant embryos and the pattern of gene expression in mutants are consistent with a role of mp66alpha in gene silencing. mp66alpha is an essential gene, required for early mouse development. The lethal phenotype supports a role in execution of methylated DNA silencing.

nip, a Symbiotic Medicago truncatula Mutant That Forms Root Nodules with Aberrant Infection Threads and Plant Defense-Like Response1

PubMed Central

Veereshlingam, Harita; Haynes, Janine G.; Penmetsa, R. Varma; Cook, Douglas R.; Sherrier, D. Janine; Dickstein, Rebecca

2004-01-01

To investigate the legume-Rhizobium symbiosis, we isolated and studied a novel symbiotic mutant of the model legume Medicago truncatula, designated nip (numerous infections and polyphenolics). When grown on nitrogen-free media in the presence of the compatible bacterium Sinorhizobium meliloti, the nip mutant showed nitrogen deficiency symptoms. The mutant failed to form pink nitrogen-fixing nodules that occur in the wild-type symbiosis, but instead developed small bump-like nodules on its roots that were blocked at an early stage of development. Examination of the nip nodules by light microscopy after staining with X-Gal for S. meliloti expressing a constitutive GUS gene, by confocal microscopy following staining with SYTO-13, and by electron microscopy revealed that nip initiated symbiotic interactions and formed nodule primordia and infection threads. The infection threads in nip proliferated abnormally and very rarely deposited rhizobia into plant host cells; rhizobia failed to differentiate further in these cases. nip nodules contained autofluorescent cells and accumulated a brown pigment. Histochemical staining of nip nodules revealed this pigment to be polyphenolic accumulation. RNA blot analyses demonstrated that nip nodules expressed only a subset of genes associated with nodule organogenesis, as well as elevated expression of a host defense-associated phenylalanine ammonia lyase gene. nip plants were observed to have abnormal lateral roots. nip plant root growth and nodulation responded normally to ethylene inhibitors and precursors. Allelism tests showed that nip complements 14 other M. truncatula nodulation mutants but not latd, a mutant with a more severe nodulation phenotype as well as primary and lateral root defects. Thus, the nip mutant defines a new locus, NIP, required for appropriate infection thread development during invasion of the nascent nodule by rhizobia, normal lateral root elongation, and normal regulation of host defense-like responses during symbiotic interactions. PMID:15516506

Gene Circuit Analysis of the Terminal Gap Gene huckebein

PubMed Central

Ashyraliyev, Maksat; Siggens, Ken; Janssens, Hilde; Blom, Joke; Akam, Michael; Jaeger, Johannes

2009-01-01

The early embryo of Drosophila melanogaster provides a powerful model system to study the role of genes in pattern formation. The gap gene network constitutes the first zygotic regulatory tier in the hierarchy of the segmentation genes involved in specifying the position of body segments. Here, we use an integrative, systems-level approach to investigate the regulatory effect of the terminal gap gene huckebein (hkb) on gap gene expression. We present quantitative expression data for the Hkb protein, which enable us to include hkb in gap gene circuit models. Gap gene circuits are mathematical models of gene networks used as computational tools to extract regulatory information from spatial expression data. This is achieved by fitting the model to gap gene expression patterns, in order to obtain estimates for regulatory parameters which predict a specific network topology. We show how considering variability in the data combined with analysis of parameter determinability significantly improves the biological relevance and consistency of the approach. Our models are in agreement with earlier results, which they extend in two important respects: First, we show that Hkb is involved in the regulation of the posterior hunchback (hb) domain, but does not have any other essential function. Specifically, Hkb is required for the anterior shift in the posterior border of this domain, which is now reproduced correctly in our models. Second, gap gene circuits presented here are able to reproduce mutants of terminal gap genes, while previously published models were unable to reproduce any null mutants correctly. As a consequence, our models now capture the expression dynamics of all posterior gap genes and some variational properties of the system correctly. This is an important step towards a better, quantitative understanding of the developmental and evolutionary dynamics of the gap gene network. PMID:19876378

Gene circuit analysis of the terminal gap gene huckebein.

PubMed

Ashyraliyev, Maksat; Siggens, Ken; Janssens, Hilde; Blom, Joke; Akam, Michael; Jaeger, Johannes

2009-10-01

The early embryo of Drosophila melanogaster provides a powerful model system to study the role of genes in pattern formation. The gap gene network constitutes the first zygotic regulatory tier in the hierarchy of the segmentation genes involved in specifying the position of body segments. Here, we use an integrative, systems-level approach to investigate the regulatory effect of the terminal gap gene huckebein (hkb) on gap gene expression. We present quantitative expression data for the Hkb protein, which enable us to include hkb in gap gene circuit models. Gap gene circuits are mathematical models of gene networks used as computational tools to extract regulatory information from spatial expression data. This is achieved by fitting the model to gap gene expression patterns, in order to obtain estimates for regulatory parameters which predict a specific network topology. We show how considering variability in the data combined with analysis of parameter determinability significantly improves the biological relevance and consistency of the approach. Our models are in agreement with earlier results, which they extend in two important respects: First, we show that Hkb is involved in the regulation of the posterior hunchback (hb) domain, but does not have any other essential function. Specifically, Hkb is required for the anterior shift in the posterior border of this domain, which is now reproduced correctly in our models. Second, gap gene circuits presented here are able to reproduce mutants of terminal gap genes, while previously published models were unable to reproduce any null mutants correctly. As a consequence, our models now capture the expression dynamics of all posterior gap genes and some variational properties of the system correctly. This is an important step towards a better, quantitative understanding of the developmental and evolutionary dynamics of the gap gene network.

Soma size and Cav1.3 channel expression in vulnerable and resistant motoneuron populations of the SOD1G93A mouse model of ALS

PubMed Central

Shoenfeld, Liza; Westenbroek, Ruth E.; Fisher, Erika; Quinlan, Katharina A.; Tysseling, Vicki M.; Powers, Randall K.; Heckman, Charles J.; Binder, Marc D.

2014-01-01

Abstract Although the loss of motoneurons is an undisputed feature of amyotrophic lateral sclerosis (ALS) in man and in its animal models (SOD1 mutant mice), how the disease affects the size and excitability of motoneurons prior to their degeneration is not well understood. This study was designed to test the hypothesis that motoneurons in mutant SOD1G93A mice exhibit an enlargement of soma size (i.e., cross‐sectional area) and an increase in Cav1.3 channel expression at postnatal day 30, well before the manifestation of physiological symptoms that typically occur at p90 (Chiu et al. 1995). We made measurements of spinal and hypoglossal motoneurons vulnerable to degeneration, as well as motoneurons in the oculomotor nucleus that are resistant to degeneration. Overall, we found that the somata of motoneurons in male SOD1G93A mutants were larger than those in wild‐type transgenic males. When females were included in the two groups, significance was lost. Expression levels of the Cav1.3 channels were not differentiated by genotype, sex, or any interaction of the two. These results raise the intriguing possibility of an interaction between male sex steroid hormones and the SOD1 mutation in the etiopathogenesis of ALS. PMID:25107988

Root-expressed maize lipoxygenase 3 negatively regulates induced systemic resistance to Colletotrichum graminicola in shoots

PubMed Central

Constantino, Nasie N.; Mastouri, Fatemeh; Damarwinasis, Ramadhika; Borrego, Eli J.; Moran-Diez, Maria E.; Kenerley, Charley M.; Gao, Xiquan; Kolomiets, Michael V.

2013-01-01

We have previously reported that disruption of a maize root-expressed 9-lipoxygenase (9-LOX) gene, ZmLOX3, results in dramatic increase in resistance to diverse leaf and stalk pathogens. Despite evident economic significance of these findings, the mechanism behind this increased resistance remained elusive. In this study, we found that increased resistance of the lox3-4 mutants is due to constitutive activation of induced systemic resistance (ISR) signaling. We showed that ZmLOX3 lacked expression in leaves in response to anthracnose leaf blight pathogen Colletotrichum graminicola, but was expressed constitutively in the roots, thus, prompting our hypothesis: the roots of lox3-4 mutants are the source of increased resistance in leaves. Supporting this hypothesis, treatment of wild-type plants (WT) with xylem sap of lox3-4 mutant induced resistance to C. graminicola to the levels comparable to those observed in lox3-4 mutant. Moreover, treating mutants with the sap collected from WT plants partially restored the susceptibility to C. graminicola. lox3-4 mutants showed primed defense responses upon infection, which included earlier and greater induction of defense-related PAL and GST genes compared to WT. In addition to the greater expression of the octadecanoid pathway genes, lox3-4 mutant responded earlier and with a greater accumulation of H2O2 in response to C. graminicola infection or treatment with alamethicin. These findings suggest that lox3-4 mutants display constitutive ISR-like signaling. In support of this idea, root colonization by Trichoderma virens strain GV29-8 induced the same level of disease resistance in WT as the treatment with the mutant sap, but had no additional resistance effect in lox3-4 mutant. While treatment with T. virens GV29 strongly and rapidly suppressed ZmLOX3 expression in hydroponically grown WT roots, T. virens Δsml mutant, which is deficient in ISR induction, was unable to suppress expression of ZmLOX3, thus, providing genetic evidence that SM1 function in ISR, at least in part, by suppressing host ZmLOX3 gene. This study and the genetic tools generated herein will allow the identification of the signals regulating the induction of resistance to aboveground attackers by beneficial soil microorganisms in the future. PMID:24391653

Cellular and molecular mechanisms of autosomal dominant form of progressive hearing loss, DFNA2.

PubMed

Kim, Hyo Jeong; Lv, Ping; Sihn, Choong-Ryoul; Yamoah, Ebenezer N

2011-01-14

Despite advances in identifying deafness genes, determination of the underlying cellular and functional mechanisms for auditory diseases remains a challenge. Mutations of the human K(+) channel hKv7.4 lead to post-lingual progressive hearing loss (DFNA2), which affects world-wide population with diverse racial backgrounds. Here, we have generated the spectrum of point mutations in the hKv7.4 that have been identified as diseased mutants. We report that expression of five point mutations in the pore region, namely L274H, W276S, L281S, G285C, and G296S, as well as the C-terminal mutant G321S in the heterologous expression system, yielded non-functional channels because of endoplasmic reticulum retention of the mutant channels. We mimicked the dominant diseased conditions by co-expressing the wild-type and mutant channels. As compared with expression of wild-type channel alone, the blend of wild-type and mutant channel subunits resulted in reduced currents. Moreover, the combinatorial ratios of wild type:mutant and the ensuing current magnitude could not be explained by the predictions of a tetrameric channel and a dominant negative effect of the mutant subunits. The results can be explained by the dependence of cell surface expression of the mutant on the wild-type subunit. Surprisingly, a transmembrane mutation F182L, which has been identified in a pre-lingual progressive hearing loss patient in Taiwan, yielded cell surface expression and functional features that were similar to that of the wild type, suggesting that this mutation may represent redundant polymorphism. Collectively, these findings provide traces of the cellular mechanisms for DFNA2.

Transgenic mice expressing mutant Pinin exhibit muscular dystrophy, nebulin deficiency and elevated expression of slow-type muscle fiber genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Hsu-Pin; Hsu, Shu-Yuan; Wu, Wen-Ai

Highlights: •Pnn CCD domain functions as a dominant negative mutant regulating Pnn expression and function. •Pnn CCD mutant Tg mice have a muscle wasting phenotype during development and show dystrophic histological features. •Pnn mutant muscles are susceptible to slow fiber type gene transition and NEB reduction. •The Tg mouse generated by overexpression of the Pnn CCD domain displays many characteristics resembling NEB{sup +/−} mice. -- Abstract: Pinin (Pnn) is a nuclear speckle-associated SR-like protein. The N-terminal region of the Pnn protein sequence is highly conserved from mammals to insects, but the C-terminal RS domain-containing region is absent in lower species.more » The N-terminal coiled-coil domain (CCD) is, therefore, of interest not only from a functional point of view, but also from an evolutionarily standpoint. To explore the biological role of the Pnn CCD in a physiological context, we generated transgenic mice overexpressing Pnn mutant in skeletal muscle. We found that overexpression of the CCD reduces endogenous Pnn expression in cultured cell lines as well as in transgenic skeletal muscle fibers. Pnn mutant mice exhibited reduced body mass and impaired muscle function during development. Mutant skeletal muscles show dystrophic histological features with muscle fibers heavily loaded with centrally located myonuclei. Expression profiling and pathway analysis identified over-representation of genes in gene categories associated with muscle contraction, specifically those related to slow type fiber. In addition nebulin (NEB) expression level is repressed in Pnn mutant skeletal muscle. We conclude that Pnn downregulation in skeletal muscle causes a muscular dystrophic phenotype associated with NEB deficiency and the CCD domain is incapable of replacing full length Pnn in terms of functional capacity.« less

A LEAFY co-regulator encoded by UNUSUAL FLORAL ORGANS.

PubMed

Lee, I; Wolfe, D S; Nilsson, O; Weigel, D

1997-02-01

. Development of petals and stamens in Arabidopsis flowers requires the function of the organ-identity gene APETALA3 (AP3), whose RNA is expressed specifically in petal and stamen primordia. AP3 expression is positively regulated by the meristem-identity gene LEAFY (LFY), which is expressed ubiquitously in young flowers. It is unknown how the transition from ubiquitous expression of LFY to region-specific expression of AP3 is made. It has previously been proposed for Antirrhinum that another gene, FIMBRIATA (FIM), mediates between the LFY and AP3 orthologs, with the three genes acting in a simple regulatory hierarchy. FIM is activated later than the LFY ortholog, and its expression is more restricted than that of the LFY ortholog. . We have tested whether the model proposed for Antirrhinum applies to Arabidopsis, by creating transgenic plants in which the FIM ortholog UNUSUAL FLORAL ORGANS (UFO) was expressed constitutively from the promoter of the cauliflower mosaic virus 35S gene. In 35S::UFO flowers, AP3 was expressed precociously and ectopically, confirming that UFO is an upstream regulator of AP3. However, 35S::UFO could not restore petal and stamen development in lfy mutants, indicating that UFO can only function in the presence of LFY activity. The failure of 35S::UFO to rescue lfy mutants is consistent with our observation that UFO expression levels are not markedly changed in lfy mutants. . We conclude that UFO is not a simple mediator between meristem- and organ-identity genes, but is likely to be a partially dispensable co-regulator that acts together with LFY. The interplay between LFY and UFO provides a paradigm for how a global regulator such as LFY activates selected target genes only in restricted regions within its expression domain.

HDM2 promotes WIP1-mediated medulloblastoma growth

PubMed Central

Buss, Meghan C.; Read, Tracy-Ann; Schniederjan, Matthew J.; Gandhi, Khanjan; Castellino, Robert C.

2012-01-01

Medulloblastoma is the most common malignant childhood brain tumor. The protein phosphatase and oncogene WIP1 is over-expressed or amplified in a significant number of primary human medulloblastomas and cell lines. In the present study, we examine an important mechanism by which WIP1 promotes medulloblastoma growth using in vitro and in vivo models. Human cell lines and intracerebellar xenografted animal models were used to study the role of WIP1 and the major TP53 regulator, HDM2, in medulloblastoma growth. Stable expression of WIP1 enhances growth of TP53 wild-type medulloblastoma cells, compared with cells with stable expression of an empty-vector or mutant WIP1. In an animal model, WIP1 enhances proliferation and reduces the survival of immunodeficient mice bearing intracerebellar xenografted human medulloblastoma cells. Cells with increased WIP1 expression also exhibit increased expression of HDM2. HDM2 knockdown or treatment with the HDM2 inhibitor Nutlin-3a, the active enantomer of Nutlin-3, specifically inhibits the growth of medulloblastoma cells with increased WIP1 expression. Nutlin-3a does not affect growth of medulloblastoma cells with stable expression of an empty vector or of mutant WIP1. Knockdown of WIP1 or treatment with the WIP1 inhibitor CCT007093 results in increased phosphorylation of known WIP1 targets, reduced HDM2 expression, and reduced growth specifically in WIP1 wild-type and high-expressing medulloblastoma cells. Combined WIP1 and HDM2 inhibition is more effective than WIP1 inhibition alone in blocking growth of WIP1 high-expressing medulloblastoma cells. Our preclinical study supports a role for therapies that target WIP1 and HDM2 in the treatment of medulloblastoma. PMID:22379189

Serotonin hyperinnervation and upregulated 5-HT2A receptor expression and motor-stimulating function in nigrostriatal dopamine-deficient Pitx3 mutant mice.

PubMed

Li, Li; Qiu, Guozhen; Ding, Shengyuan; Zhou, Fu-Ming

2013-01-23

The striatum receives serotonin (5-hydroxytryptamine, 5-HT) innervation and expresses 5-HT2A receptors (5-HT2ARs) and other 5-HT receptors, raising the possibility that the striatal 5-HT system may undergo adaptive changes after chronic severe dopamine (DA) loss and contribute to the function and dysfunction of the striatum. Here we show that in transcription factor Pitx3 gene mutant mice with a selective, severe DA loss in the dorsal striatum mimicking the DA denervation in late Parkinson's disease (PD), both the 5-HT innervation and the 5-HT2AR mRNA expression were increased in the dorsal striatum. Functionally, while having no detectable motor effect in wild type mice, the 5-HT2R agonist 2,5-dimethoxy-4-iodoamphetamine increased both the baseline and l-dopa-induced normal ambulatory and dyskinetic movements in Pitx3 mutant mice, whereas the selective 5-HT2AR blocker volinanserin had the opposite effects. These results demonstrate that Pitx3 mutant mice are a convenient and valid mouse model to study the compensatory 5-HT upregulation following the loss of the nigrostriatal DA projection and that the upregulated 5-HT2AR function in the DA deficient dorsal striatum may enhance both normal and dyskinetic movements. Copyright © 2012 Elsevier B.V. All rights reserved.

Pathogenesis of listeria-infected Drosophila wntD mutants is associated with elevated levels of the novel immunity gene edin.

PubMed

Gordon, Michael D; Ayres, Janelle S; Schneider, David S; Nusse, Roel

2008-07-25

Drosophila melanogaster mount an effective innate immune response against invading microorganisms, but can eventually succumb to persistent pathogenic infections. Understanding of this pathogenesis is limited, but it appears that host factors, induced by microbes, can have a direct cost to the host organism. Mutations in wntD cause susceptibility to Listeria monocytogenes infection, apparently through the derepression of Toll-Dorsal target genes, some of which are deleterious to survival. Here, we use gene expression profiling to identify genes that may mediate the observed susceptibility of wntD mutants to lethal infection. These genes include the TNF family member eiger and the novel immunity gene edin (elevated during infection; synonym CG32185), both of which are more strongly induced by infection of wntD mutants compared to controls. edin is also expressed more highly during infection of wild-type flies with wild-type Salmonella typhimurium than with a less pathogenic mutant strain, and its expression is regulated in part by the Imd pathway. Furthermore, overexpression of edin can induce age-dependent lethality, while loss of function in edin renders flies more susceptible to Listeria infection. These results are consistent with a model in which the regulation of host factors, including edin, must be tightly controlled to avoid the detrimental consequences of having too much or too little activity.

Factors Supporting Cysteine Tolerance and Sulfite Production in Candida albicans

PubMed Central

Hennicke, Florian; Grumbt, Maria; Lermann, Ulrich; Ueberschaar, Nico; Palige, Katja; Böttcher, Bettina; Jacobsen, Ilse D.; Staib, Claudia; Morschhäuser, Joachim; Monod, Michel; Hube, Bernhard; Hertweck, Christian

2013-01-01

The amino acid cysteine has long been known to be toxic at elevated levels for bacteria, fungi, and humans. However, mechanisms of cysteine tolerance in microbes remain largely obscure. Here we show that the human pathogenic yeast Candida albicans excretes sulfite when confronted with increasing cysteine concentrations. Mutant construction and phenotypic analysis revealed that sulfite formation from cysteine in C. albicans relies on cysteine dioxygenase Cdg1, an enzyme with similar functions in humans. Environmental cysteine induced not only the expression of the CDG1 gene in C. albicans, but also the expression of SSU1, encoding a putative sulfite efflux pump. Accordingly, the deletion of SSU1 resulted in enhanced sensitivity of the fungal cells to both cysteine and sulfite. To study the regulation of sulfite/cysteine tolerance in more detail, we screened a C. albicans library of transcription factor mutants in the presence of sulfite. This approach and subsequent independent mutant analysis identified the zinc cluster transcription factor Zcf2 to govern sulfite/cysteine tolerance, as well as cysteine-inducible SSU1 and CDG1 gene expression. cdg1Δ and ssu1Δ mutants displayed reduced hypha formation in the presence of cysteine, indicating a possible role of the newly proposed mechanisms of cysteine tolerance and sulfite secretion in the pathogenicity of C. albicans. Moreover, cdg1Δ mutants induced delayed mortality in a mouse model of disseminated infection. Since sulfite is toxic and a potent reducing agent, its production by C. albicans suggests diverse roles during host adaptation and pathogenicity. PMID:23417561

A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis

PubMed Central

Subramanian, M; Francis, P; Bilke, S; Li, XL; Hara, T; Lu, X; Jones, MF; Walker, RL; Zhu, Y; Pineda, M; Lee, C; Varanasi, L; Yang, Y; Martinez, LA; Luo, J; Ambs, S; Sharma, S; Wakefield, LM; Meltzer, PS; Lal, A

2015-01-01

Most p53 mutations in human cancers are missense mutations resulting in a full-length mutant p53 protein. Besides losing tumor suppressor activity, some hotspot p53 mutants gain oncogenic functions. This effect is mediated in part, through gene expression changes due to inhibition of p63 and p73 by mutant p53 at their target gene promoters. Here, we report that the tumor suppressor microRNA let-7i is downregulated by mutant p53 in multiple cell lines expressing endogenous mutant p53. In breast cancer patients, significantly decreased let-7i levels were associated with missense mutations in p53. Chromatin immunoprecipitation and promoter luciferase assays established let-7i as a transcriptional target of mutant p53 through p63. Introduction of let-7i to mutant p53 cells significantly inhibited migration, invasion and metastasis by repressing a network of oncogenes including E2F5, LIN28B, MYC and NRAS. Our findings demonstrate that repression of let-7i expression by mutant p53 has a key role in enhancing migration, invasion and metastasis. PMID:24662829

Deficient BIM Expression as a Mechanism of Intrinsic and Acquired Resistance to Targeted Therapies in EGFR-Mutant and ALK-Positive Lung Cancers

DTIC Science & Technology

2014-08-01

AWARD NUMBER: W81XWH-13-1-0227 TITLE: Deficient BIM Expression as a Mechanism of Intrinsic and...1Aug2013-31July2014 4. TITLE AND SUBTITLE Deficient BIM Expression as a Mechanism of Intrinsic and Acquired Resistance to 5a. CONTRACT NUMBER...clinic. We had not had this capability when we applied for this award. We can now use these clinically relevant models to assess the expression of BIM

Respiratory-deficient mutants of the unicellular green alga Chlamydomonas: a review.

PubMed

Salinas, Thalia; Larosa, Véronique; Cardol, Pierre; Maréchal-Drouard, Laurence; Remacle, Claire

2014-05-01

Genetic manipulation of the unicellular green alga Chlamydomonas reinhardtii is straightforward. Nuclear genes can be interrupted by insertional mutagenesis or targeted by RNA interference whereas random or site-directed mutagenesis allows the introduction of mutations in the mitochondrial genome. This, combined with a screen that easily allows discriminating respiratory-deficient mutants, makes Chlamydomonas a model system of choice to study mitochondria biology in photosynthetic organisms. Since the first description of Chlamydomonas respiratory-deficient mutants in 1977 by random mutagenesis, many other mutants affected in mitochondrial components have been characterized. These respiratory-deficient mutants increased our knowledge on function and assembly of the respiratory enzyme complexes. More recently some of these mutants allowed the study of mitochondrial gene expression processes poorly understood in Chlamydomonas. In this review, we update the data concerning the respiratory components with a special focus on the assembly factors identified on other organisms. In addition, we make an inventory of different mitochondrial respiratory mutants that are inactivated either on mitochondrial or nuclear genes. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Autism-associated R451C mutation in neuroligin3 leads to activation of the unfolded protein response in a PC12 Tet-On inducible system

PubMed Central

Ulbrich, Lisa; Favaloro, Flores Lietta; Trobiani, Laura; Marchetti, Valentina; Patel, Vruti; Pascucci, Tiziana; Comoletti, Davide; Marciniak, Stefan J.; De Jaco, Antonella

2015-01-01

Several forms of monogenic heritable autism spectrum disorders are associated with mutations in the neuroligin genes. The autism-linked substitution R451C in neuroligin3 induces local misfolding of its extracellular domain, causing partial retention in the ER (endoplasmic reticulum) of expressing cells. We have generated a PC12 Tet-On cell model system with inducible expression of wild-type or R451C neuroligin3 to investigate whether there is activation of the UPR (unfolded protein response) as a result of misfolded protein retention. As a positive control for protein misfolding, we also expressed the mutant G221R neuroligin3, which is known to be completely retained within the ER. Our data show that overexpression of either R451C or G221R mutant proteins leads to the activation of all three signalling branches of the UPR downstream of the stress sensors ATF6 (activating transcription factor 6), IRE1 (inositol-requiring enzyme 1) and PERK [PKR (dsRNA-dependent protein kinase)-like endoplasmic reticulum kinase]. Each branch displayed different activation profiles that partially correlated with the degree of misfolding caused by each mutation. We also show that up-regulation of BiP (immunoglobulin heavy-chain-binding protein) and CHOP [C/EBP (CCAAT/enhancer-binding protein)-homologous protein] was induced by both mutant proteins but not by wild-type neuroligin3, both in proliferative cells and cells differentiated to a neuron-like phenotype. Collectively, our data show that mutant R451C neuroligin3 activates the UPR in a novel cell model system, suggesting that this cellular response may have a role in monogenic forms of autism characterized by misfolding mutations. PMID:26621873

Expression of ALS/FTD-linked mutant CCNF in zebrafish leads to increased cell death in the spinal cord and an aberrant motor phenotype.

PubMed

Hogan, Alison L; Don, Emily K; Rayner, Stephanie L; Lee, Albert; Laird, Angela S; Watchon, Maxinne; Winnick, Claire; Tarr, Ingrid S; Morsch, Marco; Fifita, Jennifer A; Gwee, Serene S L; Formella, Isabel; Hortle, Elinor; Yuan, Kristy C; Molloy, Mark P; Williams, Kelly L; Nicholson, Garth A; Chung, Roger S; Blair, Ian P; Cole, Nicholas J

2017-07-15

Amyotrophic lateral sclerosis (ALS) is a rapidly progressive, fatal neurodegenerative disease characterised by the death of upper and lower motor neurons. Approximately 10% of cases have a known family history of ALS and disease-linked mutations in multiple genes have been identified. ALS-linked mutations in CCNF were recently reported, however the pathogenic mechanisms associated with these mutations are yet to be established. To investigate possible disease mechanisms, we developed in vitro and in vivo models based on an ALS-linked missense mutation in CCNF. Proteomic analysis of the in vitro models identified the disruption of several cellular pathways in the mutant model, including caspase-3 mediated cell death. Transient overexpression of human CCNF in zebrafish embryos supported this finding, with fish expressing the mutant protein found to have increased levels of cleaved (activated) caspase-3 and increased cell death in the spinal cord. The mutant CCNF fish also developed a motor neuron axonopathy consisting of shortened primary motor axons and increased frequency of aberrant axonal branching. Importantly, we demonstrated a significant correlation between the severity of the CCNF-induced axonopathy and a reduced motor response to a light stimulus (photomotor response). This is the first report of an ALS-linked CCNF mutation in vivo and taken together with the in vitro model identifies the disruption of cell death pathways as a significant consequence of this mutation. Additionally, this study presents a valuable new tool for use in ongoing studies investigating the pathobiology of ALS-linked CCNF mutations. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A pathogenic S250F missense mutation results in a mouse model of mild aromatic l-amino acid decarboxylase (AADC) deficiency.

PubMed

Caine, Charlotte; Shohat, Meytal; Kim, Jeong-Ki; Nakanishi, Koki; Homma, Shunichi; Mosharov, Eugene V; Monani, Umrao R

2017-11-15

Homozygous mutations in the aromatic l-amino acid decarboxylase (AADC) gene result in a severe depletion of its namesake protein, triggering a debilitating and often fatal form of infantile Parkinsonism known as AADC deficiency. AADC deficient patients fail to produce normal levels of the monoamine neurotransmitters dopamine and serotonin, and suffer a multi-systemic disorder characterized by movement abnormalities, developmental delay and autonomic dysfunction; an absolute loss of dopamine is generally considered incompatible with life. There is no optimal treatment for AADC deficiency and few truly good models in which to investigate disease mechanisms or develop and refine therapeutic strategies. In this study, we introduced a relatively frequently reported but mildly pathogenic S250F missense mutation into the murine Aadc gene. We show that mutants homozygous for the mutation are viable and express a stable but minimally active form of the AADC protein. Although the low enzymatic activity of the protein resulted in only modestly reduced concentrations of brain dopamine, serotonin levels were markedly diminished, and this perturbed behavior as well as autonomic function in mutant mice. Still, we found no evidence of morphologic abnormalities of the dopaminergic cells in mutant brains. The striatum as well as substantia nigra appeared normal and no loss of dopamine expressing cells in the latter was detected. We conclude that even minute levels of active AADC are sufficient to allow for substantial amounts of dopamine to be produced in model mice harboring the S250F mutation. Such mutants represent a novel, mild model of human AADC deficiency. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Prominent dominant negative effect of a mutant Fas molecule lacking death domain on cell-mediated induction of apoptosis.

PubMed

Yokota, Aya; Takeuchi, Emiko; Iizuka, Misao; Ikegami, Yuko; Takayama, Hajime; Shinohara, Nobukata

2005-01-01

Using a panel of transfectant B lymphoma cells expressing varying amounts of the mutant Fas together with the endogenous wild type Fas, semi-quantitative studies on the dominant negative effect of a murine mutant Fas molecule lacking death domain were carried out. In anti-Fas antibody-mediated induction of apoptosis, the mutant molecules exerted significant dominant-negative effect only when their expression level was comparable to or higher than that of wild type molecules, or when exposed to low amounts of the antibody. The inhibitory effect was accompanied by the failure in DISC formation in spite of Fas aggregation. When they were subjected to T cell-mediated Fas-based induction of apoptosis, however, the dominant negative effect was prominent such that the expression of even a small amount of the mutant molecules resulted in significant inhibition. Such a strong inhibitory effect explains the dominant phenotype of this type of mutant Fas molecules in ALPS heterozygous patients and also implies that the physiological effectors for Fas in vivo are cells, i.e., FasL-expressing activated T cells.

Modeling familial British and Danish dementia.

PubMed

Garringer, Holly J; Murrell, Jill; D'Adamio, Luciano; Ghetti, Bernardino; Vidal, Ruben

2010-03-01

Familial British dementia (FBD) and familial Danish dementia (FDD) are two autosomal dominant neurodegenerative diseases caused by mutations in the BRI ( 2 ) gene. FBD and FDD are characterized by widespread cerebral amyloid angiopathy (CAA), parenchymal amyloid deposition, and neurofibrillary tangles. Transgenic mice expressing wild-type and mutant forms of the BRI(2) protein, Bri ( 2 ) knock-in mutant mice, and Bri ( 2 ) gene knock-out mice have been developed. Transgenic mice expressing a human FDD-mutated form of the BRI ( 2 ) gene have partially reproduced the neuropathological lesions observed in FDD. These mice develop extensive CAA, parenchymal amyloid deposition, and neuroinflammation in the central nervous system. These animal models allow the study of the molecular mechanism(s) underlying the neuronal dysfunction in these diseases and allow the development of potential therapeutic approaches for these and related neurodegenerative conditions. In this review, a comprehensive account of the advances in the development of animal models for FBD and FDD and of their relevance to the study of Alzheimer disease is presented.

Impaired Sense of Smell in a Drosophila Parkinson’s Model

PubMed Central

Poddighe, Simone; Bhat, Krishna Moorthi; Setzu, Maria Dolores; Solla, Paolo; Angioy, Anna Maria; Marotta, Roberto; Ruffilli, Roberta; Marrosu, Francesco; Liscia, Anna

2013-01-01

Parkinson’s disease (PD) is one of the most common neurodegenerative disease characterized by the clinical triad: tremor, akinesia and rigidity. Several studies have suggested that PD patients show disturbances in olfaction at the earliest onset of the disease. The fruit fly Drosophila melanogaster is becoming a powerful model organism to study neurodegenerative diseases. We sought to use this system to explore olfactory dysfunction, if any, in PINK1 mutants, which is a model for PD. PINK1 mutants display many important diagnostic symptoms of the disease such as akinetic motor behavior. In the present study, we describe for the first time, to the best of our knowledge, neurophysiological and neuroanatomical results concerning the olfactory function in PINK1 mutant flies. Electroantennograms were recorded in response to synthetic and natural volatiles (essential oils) from groups of PINK1 mutant adults at three different time points in their life cycle: one from 3–5 day-old flies, from 15–20 and from 27–30 days. The results obtained were compared with the same age-groups of wild type flies. We found that mutant adults showed a decrease in the olfactory response to 1-hexanol, α-pinene and essential oil volatiles. This olfactory response in mutant adults decreased even more as the flies aged. Immunohistological analysis of the antennal lobes in these mutants revealed structural abnormalities, especially in the expression of Bruchpilot protein, a marker for synaptic active zones. The combination of electrophysiological and morphological results suggests that the altered synaptic organization may be due to a neurodegenerative process. Our results indicate that this model can be used as a tool for understanding PD pathogensis and pathophysiology. These results help to explore the potential of using olfaction as a means of monitoring PD progression and developing new treatments. PMID:24009736

Expression in Bacillus subtilis of the Bacillus thuringiensis cryIIIA toxin gene is not dependent on a sporulation-specific sigma factor and is increased in a spo0A mutant.

PubMed

Agaisse, H; Lereclus, D

1994-08-01

Expression of the Bacillus thuringiensis cryIIIA gene encoding a Coleoptera-specific toxin is weak during vegetative growth and is activated at the onset of the stationary phase. cryIIIA'-'lacZ fusions and primer extension analysis show that the regulation of cryIIIA expression is similar in Bacillus subtilis and in B. thuringiensis. Activation of cryIIIA expression was not altered in B. subtilis mutant strains deficient for the sigma H and sigma E sporulation-specific sigma factors or for minor sigma factors such as sigma B, sigma D, or sigma L. This result and the nucleotide sequence of the -35 and -10 regions of the cryIIIA promoter suggest that cryIIIA expression might be directed by the E sigma A form of RNA polymerase. Expression of the cryIIIA'-'lacZ fusion is shut off after t2 (2 h after time zero) of sporulation in the B. subtilis wild-type strain grown on nutrient broth sporulation medium. However, no decrease in cryIIIA-directed beta-galactosidase activity occurred in sigma H, kinA, or spo0A mutant strains. Moreover, beta-galactosidase activity was higher and remained elevated after t2 in the spo0A mutant strain. beta-Galactosidase activity was weak in abrB and spo0A abrB mutant strains, suggesting that AbrB is responsible for the higher level of cryIIIA expression observed in a spo0A mutant. However, both in spo0A and spo0A abrB mutant strains, beta-galactosidase activity remained elevated after t2, suggesting that even in the absence of AbrB, cryIIIA expression is controlled through modulation of the phosphorylated form of Spo0A. When the cryIIIA gene is expressed in a B. subtilis spo0A mutant strain or in the 168 wild-type strain, large amounts of toxins are produced and accumulate to form a flat rectangular crystal characteristic of the coleopteran-specific B. thuringiensis strains.

Characterization of intravitreally delivered capsid mutant AAV2-Cre vector to induce tissue-specific mutations in murine retinal ganglion cells.

PubMed

Langouet-Astrie, Christophe J; Yang, Zhiyong; Polisetti, Sraavya M; Welsbie, Derek S; Hauswirth, William W; Zack, Donald J; Merbs, Shannath L; Enke, Raymond A

2016-10-01

Targeted expression of Cre recombinase in murine retinal ganglion cells (RGCs) by viral vector is an effective strategy for creating tissue-specific gene knockouts for investigation of genetic contribution to RGC degeneration associated with optic neuropathies. Here we characterize dosage, efficacy and toxicity for sufficient intravitreal delivery of a capsid mutant Adeno-associated virus 2 (AAV2) vector encoding Cre recombinase. Wild type and Rosa26 (R26) LacZ mice were intravitreally injected with capsid mutant AAV2 viral vectors. Murine eyes were harvested at intervals ranging from 2 weeks to 15 weeks post-injection and were assayed for viral transduction, transgene expression and RGC survival. 10(9) vector genomes (vg) were sufficient for effective in vivo targeting of murine ganglion cell layer (GCL) retinal neurons. Transgene expression was observed as early as 2 weeks post-injection of viral vectors and persisted to 11 weeks. Early expression of Cre had no significant effect on RGC survival, while significant RGC loss was detected beginning 5 weeks post-injection. Early expression of viral Cre recombinase was robust, well-tolerated and predominantly found in GCL neurons suggesting this strategy can be effective in short-term RGC-specific mutation studies in experimental glaucoma models such as optic nerve crush and transection experiments. RGC degeneration with Cre expression for more than 4 weeks suggests that Cre toxicity is a limiting factor for targeted mutation strategies in RGCs. Copyright © 2016 Elsevier Ltd. All rights reserved.

Calcium Regulates FGF-23 Expression in Bone

PubMed Central

David, Valentin; Dai, Bing; Martin, Aline; Huang, Jinsong; Han, Xiaobin

2013-01-01

Calcium has recently been shown to regulate fibroblast growth factor 23 (FGF-23), a bone-derived phosphate and vitamin D-regulating hormone. To better understand the regulation of FGF-23 by calcium, phosphorus, 1,25 dihydroxyvitamin D3 [1,25(OH)2D], and PTH, we examined FGF-23 expression under basal conditions and in response to PTH, doxercalciferol, or high-calcium diet treatment in Gcm2−/− and Cyp27b1−/− mutant mice. Gcm2−/− mice exhibited low serum PTH and 1,25(OH)2D concentrations, hypocalcemia, and hyperphosphatemia, whereas Cyp27b1−/− mice had high PTH, undetectable 1,25(OH)2D, hypocalcemia, and hypophosphatemia. Serum FGF-23 levels were decreased in both mutant models. Doxercalciferol administration increased serum FGF-23 levels in both mutant models. PTH administration to Gcm2−/− mice also increased serum FGF-23 levels, in association with an increase in both 1,25(OH)2D and calcium concentrations. Multiple regression analysis of pooled data indicated that changes in FGF-23 were positively correlated with serum calcium and 1,25(OH)2D but not related to changes in serum phosphate concentrations. A high-calcium diet also increased serum FGF-23 concentrations in Cyp27b1−/− mice in the absence of 1,25(OH)2D and in Gcm2−/− mice with low PTH. The addition of calcium to the culture media also stimulated FGF-23 message expression in MC3T3-E1 osteoblasts. In addition, FGF-23 promoter activity in cultured osteoblasts was inhibited by the L-calcium-channel inhibitor nifedipine and stimulated by calcium ionophores. The effects of chronic low calcium to prevent 1,25(OH)2D and PTH stimulation of FGF-23 in these mutant mouse models suggest that suppression of FGF-23 plays an important physiological adaptive response to hypocalcemia. PMID:24140714

Calcium regulates FGF-23 expression in bone.

PubMed

David, Valentin; Dai, Bing; Martin, Aline; Huang, Jinsong; Han, Xiaobin; Quarles, L Darryl

2013-12-01

Calcium has recently been shown to regulate fibroblast growth factor 23 (FGF-23), a bone-derived phosphate and vitamin D-regulating hormone. To better understand the regulation of FGF-23 by calcium, phosphorus, 1,25 dihydroxyvitamin D3 [1,25(OH)2D], and PTH, we examined FGF-23 expression under basal conditions and in response to PTH, doxercalciferol, or high-calcium diet treatment in Gcm2(-/-) and Cyp27b1(-/-) mutant mice. Gcm2(-/-) mice exhibited low serum PTH and 1,25(OH)2D concentrations, hypocalcemia, and hyperphosphatemia, whereas Cyp27b1(-/-) mice had high PTH, undetectable 1,25(OH)2D, hypocalcemia, and hypophosphatemia. Serum FGF-23 levels were decreased in both mutant models. Doxercalciferol administration increased serum FGF-23 levels in both mutant models. PTH administration to Gcm2(-/-) mice also increased serum FGF-23 levels, in association with an increase in both 1,25(OH)2D and calcium concentrations. Multiple regression analysis of pooled data indicated that changes in FGF-23 were positively correlated with serum calcium and 1,25(OH)2D but not related to changes in serum phosphate concentrations. A high-calcium diet also increased serum FGF-23 concentrations in Cyp27b1(-/-) mice in the absence of 1,25(OH)2D and in Gcm2(-/-) mice with low PTH. The addition of calcium to the culture media also stimulated FGF-23 message expression in MC3T3-E1 osteoblasts. In addition, FGF-23 promoter activity in cultured osteoblasts was inhibited by the L-calcium-channel inhibitor nifedipine and stimulated by calcium ionophores. The effects of chronic low calcium to prevent 1,25(OH)2D and PTH stimulation of FGF-23 in these mutant mouse models suggest that suppression of FGF-23 plays an important physiological adaptive response to hypocalcemia.

Molecular synergy underlies the co-occurrence patterns and phenotype of NPM1-mutant acute myeloid leukemia

PubMed Central

Dovey, Oliver M.; Cooper, Jonathan L.; Mupo, Annalisa; Grove, Carolyn S.; Lynn, Claire; Conte, Nathalie; Andrews, Robert M.; Pacharne, Suruchi; Tzelepis, Konstantinos; Vijayabaskar, M. S.; Green, Paul; Rad, Roland; Arends, Mark; Wright, Penny; Yusa, Kosuke; Bradley, Allan; Varela, Ignacio

2017-01-01

NPM1 mutations define the commonest subgroup of acute myeloid leukemia (AML) and frequently co-occur with FLT3 internal tandem duplications (ITD) or, less commonly, NRAS or KRAS mutations. Co-occurrence of mutant NPM1 with FLT3-ITD carries a significantly worse prognosis than NPM1-RAS combinations. To understand the molecular basis of these observations, we compare the effects of the 2 combinations on hematopoiesis and leukemogenesis in knock-in mice. Early effects of these mutations on hematopoiesis show that compound Npm1cA/+;NrasG12D/+ or Npm1cA;Flt3ITD share a number of features: Hox gene overexpression, enhanced self-renewal, expansion of hematopoietic progenitors, and myeloid differentiation bias. However, Npm1cA;Flt3ITD mutants displayed significantly higher peripheral leukocyte counts, early depletion of common lymphoid progenitors, and a monocytic bias in comparison with the granulocytic bias in Npm1cA/+;NrasG12D/+ mutants. Underlying this was a striking molecular synergy manifested as a dramatically altered gene expression profile in Npm1cA;Flt3ITD, but not Npm1cA/+;NrasG12D/+, progenitors compared with wild-type. Both double-mutant models developed high-penetrance AML, although latency was significantly longer with Npm1cA/+;NrasG12D/+. During AML evolution, both models acquired additional copies of the mutant Flt3 or Nras alleles, but only Npm1cA/+;NrasG12D/+ mice showed acquisition of other human AML mutations, including IDH1 R132Q. We also find, using primary Cas9-expressing AMLs, that Hoxa genes and selected interactors or downstream targets are required for survival of both types of double-mutant AML. Our results show that molecular complementarity underlies the higher frequency and significantly worse prognosis associated with NPM1c/FLT3-ITD vs NPM1/NRAS-G12D-mutant AML and functionally confirm the role of HOXA genes in NPM1c-driven AML. PMID:28835438

The Drosophila TRPA channel, Painless, regulates sexual receptivity in virgin females

PubMed Central

Sakai, Takaomi; Kasuya, Junko; Kitamoto, Toshihiro; Aigaki, Toshiro

2009-01-01

Transient receptor potential (TRP) channels play crucial roles in sensory perception. Expression of the Drosophila painless (pain) gene, a homolog of the mammalian TRPA1/ANKTM1 gene, in the peripheral nervous system is required for avoidance behavior of noxious heat or wasabi. Here we report a novel role of the Pain TRP channel expressed in the nervous system in the sexual receptivity in Drosophila virgin females. Compared with wild-type females, pain mutant females copulated with wild-type males significantly earlier. Wild-type males showed comparable courtship latency and courtship index toward wild-type and pain mutant females. Therefore, the early copulation observed in wild-type male and pain mutant female pairs is the result of enhanced sexual receptivity in pain mutant females. Involvement of pain in enhanced female sexual receptivity was confirmed by rescue experiments in which expression of a pain transgene in a pain mutant background restored the female sexual receptivity to the wild-type level. Targeted expression of pain RNAi in putative cholinergic or GABAergic neurons phenocopied the mutant phenotype of pain females. On the other hand, target expression of pain RNAi in dopaminergic neurons did not affect female sexual receptivity. In addition, conditional suppression of neurotransmission in putative GABAergic neurons resulted in a similar enhanced sexual receptivity. Our results suggest that Pain TRP channels expressed in cholinergic and/or GABAergic neurons are involved in female sexual receptivity. PMID:19531155

The Drosophila TRPA channel, Painless, regulates sexual receptivity in virgin females.

PubMed

Sakai, T; Kasuya, J; Kitamoto, T; Aigaki, T

2009-07-01

Transient receptor potential (TRP) channels play crucial roles in sensory perception. Expression of the Drosophila painless (pain) gene, a homolog of the mammalian TRPA1/ANKTM1 gene, in the peripheral nervous system is required for avoidance behavior of noxious heat or wasabi. In this study, we report a novel role of the Pain TRP channel expressed in the nervous system in the sexual receptivity in Drosophila virgin females. Compared with wild-type females, pain mutant females copulated with wild-type males significantly earlier. Wild-type males showed comparable courtship latency and courtship index toward wild-type and pain mutant females. Therefore, the early copulation observed in wild-type male and pain mutant female pairs is the result of enhanced sexual receptivity in pain mutant females. Involvement of pain in enhanced female sexual receptivity was confirmed by rescue experiments in which expression of a pain transgene in a pain mutant background restored the female sexual receptivity to the wild-type level. Targeted expression of pain RNA interference (RNAi) in putative cholinergic or GABAergic neurons phenocopied the mutant phenotype of pain females. However, target expression of pain RNAi in dopaminergic neurons did not affect female sexual receptivity. In addition, conditional suppression of neurotransmission in putative GABAergic neurons resulted in a similar enhanced sexual receptivity. Our results suggest that Pain TRP channels expressed in cholinergic and/or GABAergic neurons are involved in female sexual receptivity.

Identification of Novel Glycosyltransferases Required for Assembly of the Pasteurella multocida A:1 Lipopolysaccharide and Their Involvement in Virulence▿ †

PubMed Central

Boyce, John D.; Harper, Marina; St. Michael, Frank; John, Marietta; Aubry, Annie; Parnas, Henrietta; Logan, Susan M.; Wilkie, Ian W.; Ford, Mark; Cox, Andrew D.; Adler, Ben

2009-01-01

We previously determined the structure of the Pasteurella multocida Heddleston type 1 lipopolysaccharide (LPS) molecule and characterized some of the transferases essential for LPS biosynthesis. We also showed that P. multocida strains expressing truncated LPS display reduced virulence. Here, we have identified all of the remaining glycosyltransferases required for synthesis of the oligosaccharide extension of the P. multocida Heddleston type 1 LPS, including a novel α-1,6 glucosyltransferase, a β-1,4 glucosyltransferase, a putative bifunctional galactosyltransferase, and two heptosyltransferases. In addition, we identified a novel oligosaccharide extension expressed only in a heptosyltransferase (hptE) mutant background. All of the analyzed mutants expressing LPS with a truncated main oligosaccharide extension displayed reduced virulence, but those expressing LPS with an intact heptose side chain were able to persist for long periods in muscle tissue. The hptC mutant, which expressed LPS with the shortest oligosaccharide extension and no heptose side chain, was unable to persist on the muscle or cause any disease. Furthermore, all of the mutants displayed increased sensitivity to the chicken antimicrobial peptide fowlicidin 1, with mutants expressing highly truncated LPS being the most sensitive. PMID:19168738

Determining the Advantages, Costs, and Trade-Offs of a Novel Sodium Channel Mutation in the Copepod Acartia hudsonica to Paralytic Shellfish Toxins (PST)

PubMed Central

Finiguerra, Michael; Avery, David E.; Dam, Hans G.

2015-01-01

The marine copepod Acartia hudsonica was shown to be adapted to dinoflagellate prey, Alexandrium fundyense, which produce paralytic shellfish toxins (PST). Adaptation to PSTs in other organisms is caused by a mutation in the sodium channel. Recently, a mutation in the sodium channel in A. hudsonica was found. In this study, we rigorously tested for advantages, costs, and trade-offs associated with the mutant isoform of A. hudsonica under toxic and non-toxic conditions. We combined fitness with wild-type: mutant isoform ratio measurements on the same individual copepod to test our hypotheses. All A. hudsonica copepods express both the wild-type and mutant sodium channel isoforms, but in different proportions; some individuals express predominantly mutant (PMI) or wild-type isoforms (PWI), while most individuals express relatively equal amounts of each (EI). There was no consistent pattern of improved performance as a function of toxin dose for egg production rate (EPR), ingestion rate (I), and gross growth efficiency (GGE) for individuals in the PMI group relative to individuals in the PWI expression group. Neither was there any evidence to indicate a fitness benefit to the mutant isoform at intermediate toxin doses. No clear advantage under toxic conditions was associated with the mutation. Using a mixed-diet approach, there was also no observed relationship between individual wild-type: mutant isoform ratios and among expression groups, on both toxic and non-toxic diets, for eggs produced over three days. Lastly, expression of the mutant isoform did not mitigate the negative effects of the toxin. That is, the reductions in EPR from a toxic to non-toxic diet for copepods were independent of expression groups. Overall, the results did not support our hypotheses; the mutant sodium channel isoform does not appear to be related to adaptation to PST in A. hudsonica. Other potential mechanisms responsible for the adaptation are discussed. PMID:26075900

Genetic requirements for high constitutive SOS expression in recA730 mutants of Escherichia coli.

PubMed

Vlašić, Ignacija; Šimatović, Ana; Brčić-Kostić, Krunoslav

2011-09-01

The RecA protein in its functional state is in complex with single-stranded DNA, i.e., in the form of a RecA filament. In SOS induction, the RecA filament functions as a coprotease, enabling the autodigestion of the LexA repressor. The RecA filament can be formed by different mechanisms, but all of them require three enzymatic activities essential for the processing of DNA double-stranded ends. These are helicase, 5'-3' exonuclease, and RecA loading onto single-stranded DNA (ssDNA). In some mutants, the SOS response can be expressed constitutively during the process of normal DNA metabolism. The RecA730 mutant protein is able to form the RecA filament without the help of RecBCD and RecFOR mediators since it better competes with the single-strand binding (SSB) protein for ssDNA. As a consequence, the recA730 mutants show high constitutive SOS expression. In the study described in this paper, we studied the genetic requirements for constitutive SOS expression in recA730 mutants. Using a β-galactosidase assay, we showed that the constitutive SOS response in recA730 mutants exhibits different requirements in different backgrounds. In a wild-type background, the constitutive SOS response is partially dependent on RecBCD function. In a recB1080 background (the recB1080 mutation retains only helicase), constitutive SOS expression is partially dependent on RecBCD helicase function and is strongly dependent on RecJ nuclease. Finally, in a recB-null background, the constitutive SOS expression of the recA730 mutant is dependent on the RecJ nuclease. Our results emphasize the importance of the 5'-3' exonuclease for high constitutive SOS expression in recA730 mutants and show that RecBCD function can further enhance the excellent intrinsic abilities of the RecA730 protein in vivo. Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Recessive Loci Pps-1 and OM Differentially Regulate PISTILLATA-1 and APETALA3-1 Expression for Sepal and Petal Development in Papaver somniferum

PubMed Central

Singh, Sharad K.; Shukla, Ashutosh K.; Dhawan, Om P.; Shasany, Ajit K.

2014-01-01

The involvement of PISTILLATA (PI) and APETALA (AP) transcription factors in the development of floral organs has previously been elucidated but little is known about their upstream regulation. In this investigation, two novel mutants generated in Papaver somniferum were analyzed - one with partially petaloid sepals and another having sepaloid petals. Progeny from reciprocal crosses of respective mutant parent genotypes showed a good fit to the monogenic Mendelian inheritance model, indicating that the mutant traits are likely controlled by the single, recessive nuclear genes named “Pps-1” and “OM” in the partially petaloid sepal and sepaloid petal phenotypes, respectively. Both paralogs of PISTILLATA (PapsPI-1 and PapsPI-3) were obtained from the sepals and petals of P. somniferum. Ectopic expression of PapsPI-1 in tobacco resulted in a partially petaloid sepal phenotype at a low frequency. Upregulation of PapsPI-1 and PapsAP3-1 in the petal and the petal part of partially petaloid sepal mutant and down-regulation of the same in sepaloid petal mutant indicates a differential pattern of regulation for flowering-related genes in various whorls. Similarly, it was found that the recessive mutation OM in sepaloid petal mutant downregulates PapsPI-1 and PapsAP3-1 transcripts. The recessive nature of the mutations was confirmed by the segregation ratios obtained in this analysis. PMID:24979593

Induction of expression and co-localization of heat shock polypeptides with the polyalanine expansion mutant of poly(A)-binding protein N1 after chemical stress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Qishan; Bag, Jnanankur

Formation of nuclear inclusions consisting of aggregates of a polyalanine expansion mutant of nuclear poly(A)-binding protein (PABPN1) is the hallmark of oculopharyngeal muscular dystrophy (OPMD). OPMD is a late onset autosomal dominant disease. Patients with this disorder exhibit progressive swallowing difficulty and drooping of their eye lids, which starts around the age of 50. Previously we have shown that treatment of cells expressing the mutant PABPN1 with a number of chemicals such as ibuprofen, indomethacin, ZnSO{sub 4}, and 8-hydroxy-quinoline induces HSP70 expression and reduces PABPN1 aggregation. In these studies we have shown that expression of additional HSPs including HSP27, HSP40,more » and HSP105 were induced in mutant PABPN1 expressing cells following exposure to the chemicals mentioned above. Furthermore, all three additional HSPs were translocated to the nucleus and probably helped to properly fold the mutant PABPN1 by co-localizing with this protein.« less

Functional Heterologous Protein Expression by Genetically Engineered Probiotic Yeast Saccharomyces boulardii

PubMed Central

Hudson, Lauren E.; Fasken, Milo B.; McDermott, Courtney D.; McBride, Shonna M.; Kuiper, Emily G.; Guiliano, David B.; Corbett, Anita H.; Lamb, Tracey J.

2014-01-01

Recent studies have suggested the potential of probiotic organisms to be adapted for the synthesis and delivery of oral therapeutics. The probiotic yeast Saccharomyces boulardii would be especially well suited for this purpose due to its ability, in contrast to probiotic prokaryotes, to perform eukaryotic post translational modifications. This probiotic yeast thus has the potential to express a broad array of therapeutic proteins. Currently, however, use of wild type (WT) S. boulardii relies on antibiotic resistance for the selection of transformed yeast. Here we report the creation of auxotrophic mutant strains of S. boulardii that can be selected without antibiotics and demonstrate that these yeast can express functional recombinant protein even when recovered from gastrointestinal immune tissues in mice. A UV mutagenesis approach was employed to generate three uracil auxotrophic S. boulardii mutants that show a low rate of reversion to wild type growth. These mutants can express recombinant protein and are resistant in vitro to low pH, bile acid salts, and anaerobic conditions. Critically, oral gavage experiments using C57BL/6 mice demonstrate that mutant S. boulardii survive and are taken up into gastrointestinal immune tissues on a similar level as WT S. boulardii. Mutant yeast recovered from gastrointestinal immune tissues furthermore retain expression of functional recombinant protein. These data show that auxotrophic mutant S. boulardii can safely express recombinant protein without antibiotic selection and can deliver recombinant protein to gastrointestinal immune tissues. These auxotrophic mutants of S. boulardii pave the way for future experiments to test the ability of S. boulardii to deliver therapeutics and mediate protection against gastrointestinal disorders. PMID:25391025

Functional heterologous protein expression by genetically engineered probiotic yeast Saccharomyces boulardii.

PubMed

Hudson, Lauren E; Fasken, Milo B; McDermott, Courtney D; McBride, Shonna M; Kuiper, Emily G; Guiliano, David B; Corbett, Anita H; Lamb, Tracey J

2014-01-01

Recent studies have suggested the potential of probiotic organisms to be adapted for the synthesis and delivery of oral therapeutics. The probiotic yeast Saccharomyces boulardii would be especially well suited for this purpose due to its ability, in contrast to probiotic prokaryotes, to perform eukaryotic post translational modifications. This probiotic yeast thus has the potential to express a broad array of therapeutic proteins. Currently, however, use of wild type (WT) S. boulardii relies on antibiotic resistance for the selection of transformed yeast. Here we report the creation of auxotrophic mutant strains of S. boulardii that can be selected without antibiotics and demonstrate that these yeast can express functional recombinant protein even when recovered from gastrointestinal immune tissues in mice. A UV mutagenesis approach was employed to generate three uracil auxotrophic S. boulardii mutants that show a low rate of reversion to wild type growth. These mutants can express recombinant protein and are resistant in vitro to low pH, bile acid salts, and anaerobic conditions. Critically, oral gavage experiments using C57BL/6 mice demonstrate that mutant S. boulardii survive and are taken up into gastrointestinal immune tissues on a similar level as WT S. boulardii. Mutant yeast recovered from gastrointestinal immune tissues furthermore retain expression of functional recombinant protein. These data show that auxotrophic mutant S. boulardii can safely express recombinant protein without antibiotic selection and can deliver recombinant protein to gastrointestinal immune tissues. These auxotrophic mutants of S. boulardii pave the way for future experiments to test the ability of S. boulardii to deliver therapeutics and mediate protection against gastrointestinal disorders.

Study the Expression of ompf Gene in Esherichia coli Mutants.

PubMed

Jaktaji, R Pourahmad; Heidari, F

2013-09-01

The outer membrane porin proteins are the major factors in controlling the permeability of cell membrane. OmpF is an example of porin proteins in Esherichia coli. In normal growth condition a large amount of this protein is synthesised, but under stress condition, such as the presence of antibiotics in environment its expression is decreased inhibiting the entrance of antibiotics into cell. The expression of ompF is inhibited by antisense RNA transcribed from micF. In normal condition the expression of micF is low, but in the presence of antibiotics its expression is increased and causes multiple resistances to irrelevant antibiotics. The aims of this research were to study first, the intactness of micF and then quantify the expression of ompF in ciprofloxacin and tetracycline resistant mutants of E. coli. For this purpose the 5' end of micF was amplified and then sequenced. None of these mutants except one and its clone has a mutation in this gene. Then the relative expression of ompF in these mutants was quantified by real time PCR. There was no significant difference between ompF transcription of mutants and wild type strain. Based on this study and previous study it is concluded that low to intermediate levels of resistance to ciprofloxacin and tetracycline does not decrease ompF transcription.

Stress Marker Signatures in Lesion Mimic Single and Double Mutants Identify a Crucial Leaf Age-Dependent Salicylic Acid Related Defense Signal.

PubMed

Kaurilind, Eve; Brosché, Mikael

2017-01-01

Plants are exposed to abiotic and biotic stress conditions throughout their lifespans that activates various defense programs. Programmed cell death (PCD) is an extreme defense strategy the plant uses to manage unfavorable environments as well as during developmentally induced senescence. Here we investigated the role of leaf age on the regulation of defense gene expression in Arabidopsis thaliana. Two lesion mimic mutants with misregulated cell death, catalase2 (cat2) and defense no death1 (dnd1) were used together with several double mutants to dissect signaling pathways regulating defense gene expression associated with cell death and leaf age. PCD marker genes showed leaf age dependent expression, with the highest expression in old leaves. The salicylic acid (SA) biosynthesis mutant salicylic acid induction deficient2 (sid2) had reduced expression of PCD marker genes in the cat2 sid2 double mutant demonstrating the importance of SA biosynthesis in regulation of defense gene expression. While the auxin- and jasmonic acid (JA)- insensitive auxin resistant1 (axr1) double mutant cat2 axr1 also led to decreased expression of PCD markers; the expression of several marker genes for SA signaling (ISOCHORISMATE SYNTHASE 1, PR1 and PR2) were additionally decreased in cat2 axr1 compared to cat2. The reduced expression of these SA markers genes in cat2 axr1 implicates AXR1 as a regulator of SA signaling in addition to its known role in auxin and JA signaling. Overall, the current study reinforces the important role of SA signaling in regulation of leaf age-related transcript signatures.

Alanine–glyoxylate aminotransferase-deficient mice, a model for primary hyperoxaluria that responds to adenoviral gene transfer

PubMed Central

Salido, Eduardo C.; Li, Xiao M.; Lu, Yang; Wang, Xia; Santana, Alfredo; Roy-Chowdhury, Namita; Torres, Armando; Shapiro, Larry J.; Roy-Chowdhury, Jayanta

2006-01-01

Mutations in the alanine–glyoxylate amino transferase gene (AGXT) are responsible for primary hyperoxaluria type I, a rare disease characterized by excessive hepatic oxalate production that leads to renal failure. We generated a null mutant mouse by targeted mutagenesis of the homologous gene, Agxt, in embryonic stem cells. Mutant mice developed normally, and they exhibited hyperoxaluria and crystalluria. Approximately half of the male mice in mixed genetic background developed calcium oxalate urinary stones. Severe nephrocalcinosis and renal failure developed after enhancement of oxalate production by ethylene glycol administration. Hepatic expression of human AGT1, the protein encoded by AGXT, by adenoviral vector-mediated gene transfer in Agxt−/− mice normalized urinary oxalate excretion and prevented oxalate crystalluria. Subcellular fractionation and immunofluorescence studies revealed that, as in the human liver, the expressed wild-type human AGT1 was predominantly localized in mouse hepatocellular peroxisomes, whereas the most common mutant form of AGT1 (G170R) was localized predominantly in the mitochondria. PMID:17110443

Schwann cell hyperplasia and tumors in transgenic mice expressing a naturally occurring mutant NF2 protein

PubMed Central

Giovannini, Marco; Robanus-Maandag, Els; Niwa-Kawakita, Michiko; van der Valk, Martin; Woodruff, James M.; Goutebroze, Laurence; Mérel, Philippe; Berns, Anton; Thomas, Gilles

1999-01-01

Specific mutations in some tumor suppressor genes such as p53 can act in a dominant fashion. We tested whether this mechanism may also apply for the neurofibromatosis type-2 gene (NF2) which, when mutated, leads to schwannoma development. Transgenic mice were generated that express, in Schwann cells, mutant NF2 proteins prototypic of natural mutants observed in humans. Mice expressing a NF2 protein with an interstitial deletion in the amino-terminal domain showed high prevalence of Schwann cell-derived tumors and Schwann cell hyperplasia, whereas those expressing a carboxy-terminally truncated protein were normal. Our results indicate that a subset of mutant NF2 alleles observed in patients may encode products with dominant properties when overexpressed in specific cell lineages. PMID:10215625

FlyBase: genes and gene models

PubMed Central

Drysdale, Rachel A.; Crosby, Madeline A.

2005-01-01

FlyBase (http://flybase.org) is the primary repository of genetic and molecular data of the insect family Drosophilidae. For the most extensively studied species, Drosophila melanogaster, a wide range of data are presented in integrated formats. Data types include mutant phenotypes, molecular characterization of mutant alleles and aberrations, cytological maps, wild-type expression patterns, anatomical images, transgenic constructs and insertions, sequence-level gene models and molecular classification of gene product functions. There is a growing body of data for other Drosophila species; this is expected to increase dramatically over the next year, with the completion of draft-quality genomic sequences of an additional 11 Drosphila species. PMID:15608223

Finding gene clusters for a replicated time course study

PubMed Central

2014-01-01

Background Finding genes that share similar expression patterns across samples is an important question that is frequently asked in high-throughput microarray studies. Traditional clustering algorithms such as K-means clustering and hierarchical clustering base gene clustering directly on the observed measurements and do not take into account the specific experimental design under which the microarray data were collected. A new model-based clustering method, the clustering of regression models method, takes into account the specific design of the microarray study and bases the clustering on how genes are related to sample covariates. It can find useful gene clusters for studies from complicated study designs such as replicated time course studies. Findings In this paper, we applied the clustering of regression models method to data from a time course study of yeast on two genotypes, wild type and YOX1 mutant, each with two technical replicates, and compared the clustering results with K-means clustering. We identified gene clusters that have similar expression patterns in wild type yeast, two of which were missed by K-means clustering. We further identified gene clusters whose expression patterns were changed in YOX1 mutant yeast compared to wild type yeast. Conclusions The clustering of regression models method can be a valuable tool for identifying genes that are coordinately transcribed by a common mechanism. PMID:24460656

Therapeutic targeting of tumors with imageable GFP-expressing Salmonella typhimurium auxotrophic mutants

NASA Astrophysics Data System (ADS)

Hoffman, Robert M.; Hayashi, Katsuhiro; Zhao, Ming

2008-02-01

Tumor targeting Salmonella typhimurium has been developed. These bacteria were mutagenized and a strain auxotrophic for leucine and arguine was selected. This strain was also engineered to express GFP. This train, termed A1, could target prostate tumors in nude mouse models and inhibit their growth. A1 was passaged through a tumor and re-isolated and termed A1-R. A1-R had greater antitumor efficacy and could cure breast, prostate, pancreatic, and lung tumors in nude mouse models.

A New F131V Mutation in Chlamydomonas Phytoene Desaturase Locates a Cluster of Norflurazon Resistance Mutations near the FAD-Binding Site in 3D Protein Models

PubMed Central

Suarez, Julio V.; Banks, Stephen; Thomas, Paul G.; Day, Anil

2014-01-01

The green alga Chlamydomonas reinhardtii provides a tractable genetic model to study herbicide mode of action using forward genetics. The herbicide norflurazon inhibits phytoene desaturase, which is required for carotenoid synthesis. Locating amino acid substitutions in mutant phytoene desaturases conferring norflurazon resistance provides a genetic approach to map the herbicide binding site. We isolated a UV-induced mutant able to grow in very high concentrations of norflurazon (150 µM). The phytoene desaturase gene in the mutant strain contained the first resistance mutation to be localised to the dinucleotide-binding Rossmann-likedomain. A highly conserved phenylalanine amino acid at position 131 of the 564 amino acid precursor protein was changed to a valine in the mutant protein. F131, and two other amino acids whose substitution confers norflurazon resistance in homologous phytoene desaturase proteins, map to distant regions in the primary sequence of the C. reinhardtii protein (V472, L505) but in tertiary models these residues cluster together to a region close to the predicted FAD binding site. The mutant gene allowed direct 5 µM norflurazon based selection of transformants, which were tolerant to other bleaching herbicides including fluridone, flurtamone, and diflufenican but were more sensitive to beflubutamid than wild type cells. Norflurazon resistance and beflubutamid sensitivity allow either positive or negative selection against transformants expressing the mutant phytoene desaturase gene. PMID:24936791

Dopamine induces soluble α-synuclein oligomers and nigrostriatal degeneration

PubMed Central

Mor, Danielle E.; Tsika, Elpida; Mazzulli, Joseph R.; Gould, Neal S.; Kim, Hanna; Daniels, Malcolm J.; Doshi, Shachee; Gupta, Preetika; Grossman, Jennifer L.; Tan, Victor X.; Kalb, Robert G.; Caldwell, Kim A.; Caldwell, Guy A.; Wolfe, John H.; Ischiropoulos, Harry

2018-01-01

Parkinson’s disease is defined by the loss of dopaminergic neurons in the substantia nigra and formation of Lewy body inclusions containing aggregated α-synuclein. Efforts to explain dopamine neuron vulnerability are hindered by the lack of dopaminergic cell death in α-synuclein transgenic mice. To address this, we manipulated dopamine levels in addition to α-synuclein expression. Nigra-targeted expression of mutant tyrosine hydroxylase with enhanced catalytic activity increased dopamine without damaging neurons in non-transgenic mice. In contrast, raising dopamine in mice expressing human A53T mutant α-synuclein induced progressive nigrostriatal degeneration and reduced locomotion. Dopamine elevation in A53T mice increased levels of potentially toxic α-synuclein oligomers, resulting in conformationally and functionally modified species. Moreover, in genetically tractable C. elegans models expression of α-synuclein mutated at the site of interaction with dopamine prevented dopamine-induced toxicity. The data suggest a unique mechanism linking two cardinal features of Parkinson’s disease, dopaminergic cell death and α-synuclein aggregation. PMID:28920936

Dopamine induces soluble α-synuclein oligomers and nigrostriatal degeneration.

PubMed

Mor, Danielle E; Tsika, Elpida; Mazzulli, Joseph R; Gould, Neal S; Kim, Hanna; Daniels, Malcolm J; Doshi, Shachee; Gupta, Preetika; Grossman, Jennifer L; Tan, Victor X; Kalb, Robert G; Caldwell, Kim A; Caldwell, Guy A; Wolfe, John H; Ischiropoulos, Harry

2017-11-01

Parkinson's disease (PD) is defined by the loss of dopaminergic neurons in the substantia nigra and the formation of Lewy body inclusions containing aggregated α-synuclein. Efforts to explain dopamine neuron vulnerability are hindered by the lack of dopaminergic cell death in α-synuclein transgenic mice. To address this, we manipulated both dopamine levels and α-synuclein expression. Nigrally targeted expression of mutant tyrosine hydroxylase with enhanced catalytic activity increased dopamine levels without damaging neurons in non-transgenic mice. In contrast, raising dopamine levels in mice expressing human A53T mutant α-synuclein induced progressive nigrostriatal degeneration and reduced locomotion. Dopamine elevation in A53T mice increased levels of potentially toxic α-synuclein oligomers, resulting in conformationally and functionally modified species. Moreover, in genetically tractable Caenorhabditis elegans models, expression of α-synuclein mutated at the site of interaction with dopamine prevented dopamine-induced toxicity. These data suggest that a unique mechanism links two cardinal features of PD: dopaminergic cell death and α-synuclein aggregation.

Neuronal matrix metalloproteinase-9 is a determinant of selective neurodegeneration.

PubMed

Kaplan, Artem; Spiller, Krista J; Towne, Christopher; Kanning, Kevin C; Choe, Ginn T; Geber, Adam; Akay, Turgay; Aebischer, Patrick; Henderson, Christopher E

2014-01-22

Selective neuronal loss is the hallmark of neurodegenerative diseases. In patients with amyotrophic lateral sclerosis (ALS), most motor neurons die but those innervating extraocular, pelvic sphincter, and slow limb muscles exhibit selective resistance. We identified 18 genes that show >10-fold differential expression between resistant and vulnerable motor neurons. One of these, matrix metalloproteinase-9 (MMP-9), is expressed only by fast motor neurons, which are selectively vulnerable. In ALS model mice expressing mutant superoxide dismutase (SOD1), reduction of MMP-9 function using gene ablation, viral gene therapy, or pharmacological inhibition significantly delayed muscle denervation. In the presence of mutant SOD1, MMP-9 expressed by fast motor neurons themselves enhances activation of ER stress and is sufficient to trigger axonal die-back. These findings define MMP-9 as a candidate therapeutic target for ALS. The molecular basis of neuronal diversity thus provides significant insights into mechanisms of selective vulnerability to neurodegeneration. Copyright © 2014 Elsevier Inc. All rights reserved.

Andrographolide induces degradation of mutant p53 via activation of Hsp70.

PubMed

Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

2018-05-22

The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

Mutant TDP-43 within motor neurons drives disease onset but not progression in amyotrophic lateral sclerosis.

PubMed

Ditsworth, Dara; Maldonado, Marcus; McAlonis-Downes, Melissa; Sun, Shuying; Seelman, Amanda; Drenner, Kevin; Arnold, Eveline; Ling, Shuo-Chien; Pizzo, Donald; Ravits, John; Cleveland, Don W; Da Cruz, Sandrine

2017-06-01

Mutations in TDP-43 cause amyotrophic lateral sclerosis (ALS), a fatal paralytic disease characterized by degeneration and premature death of motor neurons. The contribution of mutant TDP-43-mediated damage within motor neurons was evaluated using mice expressing a conditional allele of an ALS-causing TDP-43 mutant (Q331K) whose broad expression throughout the central nervous system mimics endogenous TDP-43. TDP-43 Q331K mice develop age- and mutant-dependent motor deficits from degeneration and death of motor neurons. Cre-recombinase-mediated excision of the TDP-43 Q331K gene from motor neurons is shown to delay onset of motor symptoms and appearance of TDP-43-mediated aberrant nuclear morphology, and abrogate subsequent death of motor neurons. However, reduction of mutant TDP-43 selectively in motor neurons did not prevent age-dependent degeneration of axons and neuromuscular junction loss, nor did it attenuate astrogliosis or microgliosis. Thus, disease mechanism is non-cell autonomous with mutant TDP-43 expressed in motor neurons determining disease onset but progression defined by mutant acting within other cell types.

Zebrafish aussicht mutant embryos exhibit widespread overexpression of ace (fgf8) and coincident defects in CNS development.

PubMed

Heisenberg, C P; Brennan, C; Wilson, S W

1999-05-01

During the development of the zebrafish nervous system both noi, a zebrafish pax2 homolog, and ace, a zebrafish fgf8 homolog, are required for development of the midbrain and cerebellum. Here we describe a dominant mutation, aussicht (aus), in which the expression of noi and ace is upregulated. In aus mutant embryos, ace is upregulated at many sites in the embryo, while noi expression is only upregulated in regions of the forebrain and midbrain which also express ace. Subsequent to the alterations in noi and ace expression, aus mutants exhibit defects in the differentiation of the forebrain, midbrain and eyes. Within the forebrain, the formation of the anterior and postoptic commissures is delayed and the expression of markers within the pretectal area is reduced. Within the midbrain, En and wnt1 expression is expanded. In heterozygous aus embryos, there is ectopic outgrowth of neural retina in the temporal half of the eyes, whereas in putative homozygous aus embryos, the ventral retina is reduced and the pigmented retinal epithelium is expanded towards the midline. The observation that aus mutant embryos exhibit widespread upregulation of ace raised the possibility that aus might represent an allele of the ace gene itself. However, by crossing carriers for both aus and ace, we were able to generate homozygous ace mutant embryos that also exhibited the aus phenotype. This indicated that aus is not tightly linked to ace and is unlikely to be a mutation directly affecting the ace locus. However, increased Ace activity may underly many aspects of the aus phenotype and we show that the upregulation of noi in the forebrain of aus mutants is partially dependent upon functional Ace activity. Conversely, increased ace expression in the forebrain of aus mutants is not dependent upon functional Noi activity. We conclude that aus represents a mutation involving a locus normally required for the regulation of ace expression during embryogenesis.

The RING finger/B-box factor TAM-1 and a retinoblastoma-like protein LIN-35 modulate context-dependent gene silencing in Caenorhabditis elegans.

PubMed

Hsieh, J; Liu, J; Kostas, S A; Chang, C; Sternberg, P W; Fire, A

1999-11-15

Context-dependent gene silencing is used by many organisms to stably modulate gene activity for large chromosomal regions. We have used tandem array transgenes as a model substrate in a screen for Caenorhabditis elegans mutants that affect context-dependent gene silencing in somatic tissues. This screen yielded multiple alleles of a previously uncharacterized gene, designated tam-1 (for tandem-array-modifier). Loss-of-function mutations in tam-1 led to a dramatic reduction in the activity of numerous highly repeated transgenes. These effects were apparently context dependent, as nonrepetitive transgenes retained activity in a tam-1 mutant background. In addition to the dramatic alterations in transgene activity, tam-1 mutants showed modest alterations in expression of a subset of endogenous cellular genes. These effects include genetic interactions that place tam-1 into a group called the class B synMuv genes (for a Synthetic Multivulva phenotype); this family plays a negative role in the regulation of RAS pathway activity in C. elegans. Loss-of-function mutants in other members of the class-B synMuv family, including lin-35, which encodes a protein similar to the tumor suppressor Rb, exhibit a hypersilencing in somatic transgenes similar to that of tam-1 mutants. Molecular analysis reveals that tam-1 encodes a broadly expressed nuclear protein with RING finger and B-box motifs.

SpxA1 Involved in Hydrogen Peroxide Production, Stress Tolerance and Endocarditis Virulence in Streptococcus sanguinis

PubMed Central

Chen, Lei; Ge, Xiuchun; Wang, Xiaojing; Patel, Jenishkumar R.; Xu, Ping

2012-01-01

Streptococcus sanguinis is one of the most common agents of infective endocarditis. Spx proteins are a group of global regulators that negatively or positively control global transcription initiation. In this study, we characterized the spxA1 gene in S. sanguinis SK36. The spxA1 null mutant displayed opaque colony morphology, reduced hydrogen peroxide (H2O2) production, and reduced antagonistic activity against Streptococcus mutans UA159 relative to the wild type strain. The ΔspxA1 mutant also demonstrated decreased tolerance to high temperature, acidic and oxidative stresses. Further analysis revealed that ΔspxA1 also exhibited a ∼5-fold reduction in competitiveness in an animal model of endocarditis. Microarray studies indicated that expression of several oxidative stress genes was downregulated in the ΔspxA1 mutant. The expression of spxB and nox was significantly decreased in the ΔspxA1 mutant compared with the wild type. These results indicate that spxA1 plays a major role in H2O2 production, stress tolerance and endocarditis virulence in S. sanguinis SK36. The second spx gene, spxA2, was also found in S. sanguinis SK36. The spxA2 null mutant was found to be defective for growth under normal conditions and showed sensitivity to high temperature, acidic and oxidative stresses. PMID:22768210

SpxA1 involved in hydrogen peroxide production, stress tolerance and endocarditis virulence in Streptococcus sanguinis.

PubMed

Chen, Lei; Ge, Xiuchun; Wang, Xiaojing; Patel, Jenishkumar R; Xu, Ping

2012-01-01

Streptococcus sanguinis is one of the most common agents of infective endocarditis. Spx proteins are a group of global regulators that negatively or positively control global transcription initiation. In this study, we characterized the spxA1 gene in S. sanguinis SK36. The spxA1 null mutant displayed opaque colony morphology, reduced hydrogen peroxide (H(2)O(2)) production, and reduced antagonistic activity against Streptococcus mutans UA159 relative to the wild type strain. The ΔspxA1 mutant also demonstrated decreased tolerance to high temperature, acidic and oxidative stresses. Further analysis revealed that ΔspxA1 also exhibited a ∼5-fold reduction in competitiveness in an animal model of endocarditis. Microarray studies indicated that expression of several oxidative stress genes was downregulated in the ΔspxA1 mutant. The expression of spxB and nox was significantly decreased in the ΔspxA1 mutant compared with the wild type. These results indicate that spxA1 plays a major role in H(2)O(2) production, stress tolerance and endocarditis virulence in S. sanguinis SK36. The second spx gene, spxA2, was also found in S. sanguinis SK36. The spxA2 null mutant was found to be defective for growth under normal conditions and showed sensitivity to high temperature, acidic and oxidative stresses.

Campylobacter jejuni CsrA Regulates Metabolic and Virulence Associated Proteins and Is Necessary for Mouse Colonization.

PubMed

Fields, Joshua A; Li, Jiaqi; Gulbronson, Connor J; Hendrixson, David R; Thompson, Stuart A

2016-01-01

Campylobacter jejuni infection is a leading bacterial cause of gastroenteritis and a common antecedent leading to Gullian-Barré syndrome. Our previous data suggested that the RNA-binding protein CsrA plays an important role in regulating several important phenotypes including motility, biofilm formation, and oxidative stress resistance. In this study, we compared the proteomes of wild type, csrA mutant, and complemented csrA mutant C. jejuni strains in an effort to elucidate the mechanisms by which CsrA affects virulence phenotypes. The putative CsrA regulon was more pronounced at stationary phase (111 regulated proteins) than at mid-log phase (25 regulated proteins). Proteins displaying altered expression in the csrA mutant included diverse metabolic functions, with roles in amino acid metabolism, TCA cycle, acetate metabolism, and various other cell processes, as well as pathogenesis-associated characteristics such as motility, chemotaxis, oxidative stress resistance, and fibronectin binding. The csrA mutant strain also showed altered autoagglutination kinetics when compared to the wild type. CsrA specifically bound the 5' end of flaA mRNA, and we demonstrated that CsrA is a growth-phase dependent repressor of FlaA expression. Finally, the csrA mutant exhibited reduced ability to colonize in a mouse model when in competition with the wild type, further underscoring the role of CsrA in C. jejuni colonization and pathogenesis.

Campylobacter jejuni CsrA Regulates Metabolic and Virulence Associated Proteins and Is Necessary for Mouse Colonization

PubMed Central

Fields, Joshua A.; Li, Jiaqi; Gulbronson, Connor J.; Hendrixson, David R.

2016-01-01

Campylobacter jejuni infection is a leading bacterial cause of gastroenteritis and a common antecedent leading to Gullian-Barré syndrome. Our previous data suggested that the RNA-binding protein CsrA plays an important role in regulating several important phenotypes including motility, biofilm formation, and oxidative stress resistance. In this study, we compared the proteomes of wild type, csrA mutant, and complemented csrA mutant C. jejuni strains in an effort to elucidate the mechanisms by which CsrA affects virulence phenotypes. The putative CsrA regulon was more pronounced at stationary phase (111 regulated proteins) than at mid-log phase (25 regulated proteins). Proteins displaying altered expression in the csrA mutant included diverse metabolic functions, with roles in amino acid metabolism, TCA cycle, acetate metabolism, and various other cell processes, as well as pathogenesis-associated characteristics such as motility, chemotaxis, oxidative stress resistance, and fibronectin binding. The csrA mutant strain also showed altered autoagglutination kinetics when compared to the wild type. CsrA specifically bound the 5’ end of flaA mRNA, and we demonstrated that CsrA is a growth-phase dependent repressor of FlaA expression. Finally, the csrA mutant exhibited reduced ability to colonize in a mouse model when in competition with the wild type, further underscoring the role of CsrA in C. jejuni colonization and pathogenesis. PMID:27257952

Dominant negative mutant of ionotropic glutamate receptor subunit GluR3: implications for the role of a cysteine residue for its channel activity and pharmacological properties.

PubMed Central

Watase, K; Sekiguchi, M; Matsui, T A; Tagawa, Y; Wada, K

1997-01-01

We reported that a 33-amino-acid deletion (from tyrosine-715 to glycine-747) in a putative extracellular loop of GluR3 produced a mutant that exhibited dominant negative effects upon the functional expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors [Sekiguchi et al. (1994) J. Biol. Chem. 269, 14559-14565]. In this study, we searched for a key residue in the dominant negative effects to explore the mechanism and examined the role of the residue in the function of the AMPA receptor. We prepared 20 GluR3 mutants with amino acid substitutions within the 33-amino-acid-region, and dominant negative effects were tested electrophysiologically in Xenopus oocytes co-expressing the mutant and normal subunits. Among the mutants, only a GluR3 mutant in which an original cysteine (Cys)-722 was replaced by alanine exhibited a dominant negative effect comparable with that of the original mutant in which the entire 33-amino-acid segment is deleted. The co-expression of the Cys-722 mutant did not inhibit the translation of normal subunits in oocytes. The Cys-722 mutant formed a functional homomeric receptor with significantly higher affinity for glutamate or kainate than a homomeric GluR3 receptor. The Cys-722 mutation greatly enhanced the sensitivity of GluR3 for aniracetam, which alters kinetic properties of AMPA receptors. The kainate-induced currents in oocytes expressing the Cys-722 mutant alone showed strong inward rectification. These results suggest that the Cys-722 in GluR3 is important for dominant negative effects and plays a crucial role in the determination of pharmacological properties in AMPA receptor function. PMID:9065754

A eukaryotic-type signalling system of Pseudomonas aeruginosa contributes to oxidative stress resistance, intracellular survival and virulence

PubMed Central

2011-01-01

Background The genome of Pseudomonas aeruginosa contains at least three genes encoding eukaryotic-type Ser/Thr protein kinases, one of which, ppkA, has been implicated in P. aeruginosa virulence. Together with the adjacent pppA phosphatase gene, they belong to the type VI secretion system (H1-T6SS) locus, which is important for bacterial pathogenesis. To determine the biological function of this protein pair, we prepared a pppA-ppkA double mutant and characterised its phenotype and transcriptomic profiles. Results Phenotypic studies revealed that the mutant grew slower than the wild-type strain in minimal media and exhibited reduced secretion of pyoverdine. In addition, the mutant had altered sensitivity to oxidative and hyperosmotic stress conditions. Consequently, mutant cells had an impaired ability to survive in murine macrophages and an attenuated virulence in the plant model of infection. Whole-genome transcriptome analysis revealed that pppA-ppkA deletion affects the expression of oxidative stress-responsive genes, stationary phase σ-factor RpoS-regulated genes, and quorum-sensing regulons. The transcriptome of the pppA-ppkA mutant was also analysed under conditions of oxidative stress and showed an impaired response to the stress, manifested by a weaker induction of stress adaptation genes as well as the genes of the SOS regulon. In addition, expression of either RpoS-regulated genes or quorum-sensing-dependent genes was also affected. Complementation analysis confirmed that the transcription levels of the differentially expressed genes were specifically restored when the pppA and ppkA genes were expressed ectopically. Conclusions Our results suggest that in addition to its crucial role in controlling the activity of P. aeruginosa H1-T6SS at the post-translational level, the PppA-PpkA pair also affects the transcription of stress-responsive genes. Based on these data, it is likely that the reduced virulence of the mutant strain results from an impaired ability to survive in the host due to the limited response to stress conditions. PMID:21880152

Role of adipokinetic hormone and adenosine in the anti-stress response in Drosophila melanogaster.

PubMed

Zemanová, Milada; Stašková, Tereza; Kodrík, Dalibor

2016-01-01

The role of adipokinetic hormone (AKH) and adenosine in the anti-stress response was studied in Drosophila melanogaster larvae and adults carrying a mutation in the Akh gene (Akh(1)), the adenosine receptor gene (AdoR(1)), or in both of these genes (Akh(1) AdoR(1) double mutant). Stress was induced by starvation or by the addition of an oxidative stressor paraquat (PQ) to food. Mortality tests revealed that the Akh(1) mutant was the most resistant to starvation, while the AdoR(1) mutant was the most sensitive. Conversely, the Akh(1) AdoR(1) double mutant was more sensitive to PQ toxicity than either of the single mutants. Administration of PQ significantly increased the Drome-AKH level in w(1118) and AdoR(1) larvae; however, this was not accompanied by a simultaneous increase in Akh gene expression. In contrast, PQ significantly increased the expression of the glutathione S-transferase D1 (GstD1) gene. The presence of both a functional adenosine receptor and AKH seem to be important for the proper control of GstD1 gene expression under oxidative stress, however, the latter appears to play more dominant role. On the other hand, differences in glutathione S-transferase (GST) activity among the strains, and between untreated and PQ-treated groups were minimal. In addition, the glutathione level was significantly lower in all untreated AKH- or AdoR-deficient mutant flies as compared with the untreated control w(1118) flies and further declined following treatment with PQ. All oxidative stress characteristics modified by mutations in Akh gene were restored or even improved by 'rescue' mutation in flies which ectopically express Akh. Thus, the results of the present study demonstrate the important roles of AKH and adenosine in the anti-stress response elicited by PQ in a D. melanogaster model, and provide the first evidence for the involvement of adenosine in the anti-oxidative stress response in insects. Copyright © 2016 Elsevier Ltd. All rights reserved.

A eukaryotic-type signalling system of Pseudomonas aeruginosa contributes to oxidative stress resistance, intracellular survival and virulence.

PubMed

Goldová, Jana; Ulrych, Aleš; Hercík, Kamil; Branny, Pavel

2011-08-31

The genome of Pseudomonas aeruginosa contains at least three genes encoding eukaryotic-type Ser/Thr protein kinases, one of which, ppkA, has been implicated in P. aeruginosa virulence. Together with the adjacent pppA phosphatase gene, they belong to the type VI secretion system (H1-T6SS) locus, which is important for bacterial pathogenesis. To determine the biological function of this protein pair, we prepared a pppA-ppkA double mutant and characterised its phenotype and transcriptomic profiles. Phenotypic studies revealed that the mutant grew slower than the wild-type strain in minimal media and exhibited reduced secretion of pyoverdine. In addition, the mutant had altered sensitivity to oxidative and hyperosmotic stress conditions. Consequently, mutant cells had an impaired ability to survive in murine macrophages and an attenuated virulence in the plant model of infection. Whole-genome transcriptome analysis revealed that pppA-ppkA deletion affects the expression of oxidative stress-responsive genes, stationary phase σ-factor RpoS-regulated genes, and quorum-sensing regulons. The transcriptome of the pppA-ppkA mutant was also analysed under conditions of oxidative stress and showed an impaired response to the stress, manifested by a weaker induction of stress adaptation genes as well as the genes of the SOS regulon. In addition, expression of either RpoS-regulated genes or quorum-sensing-dependent genes was also affected. Complementation analysis confirmed that the transcription levels of the differentially expressed genes were specifically restored when the pppA and ppkA genes were expressed ectopically. Our results suggest that in addition to its crucial role in controlling the activity of P. aeruginosa H1-T6SS at the post-translational level, the PppA-PpkA pair also affects the transcription of stress-responsive genes. Based on these data, it is likely that the reduced virulence of the mutant strain results from an impaired ability to survive in the host due to the limited response to stress conditions.

Astrocytes expressing mutant SOD1 and TDP43 trigger motoneuron death that is mediated via sodium channels and nitroxidative stress

PubMed Central

Rojas, Fabiola; Cortes, Nicole; Abarzua, Sebastian; Dyrda, Agnieszka; van Zundert, Brigitte

2013-01-01

Amyotrophic lateral sclerosis (ALS) is a fatal paralytic disorder caused by dysfunction and degeneration of motor neurons. Multiple disease-causing mutations, including in the genes for SOD1 and TDP-43, have been identified in ALS. Astrocytes expressing mutant SOD1 are strongly implicated in the pathogenesis of ALS: we have shown that media conditioned by astrocytes carrying mutant SOD1G93A contains toxic factor(s) that kill motoneurons by activating voltage-sensitive sodium (Nav) channels. In contrast, a recent study suggests that astrocytes expressing mutated TDP43 contribute to ALS pathology, but do so via cell-autonomous processes and lack non-cell-autonomous toxicity. Here we investigate whether astrocytes that express diverse ALS-causing mutations release toxic factor(s) that induce motoneuron death, and if so, whether they do so via a common pathogenic pathway. We exposed primary cultures of wild-type spinal cord cells to conditioned medium derived from astrocytes (ACM) that express SOD1 (ACM-SOD1G93A and ACM-SOD1G86R) or TDP43 (ACM-TDP43A315T) mutants; we show that such exposure rapidly (within 30–60 min) increases dichlorofluorescein (DCF) fluorescence (indicative of nitroxidative stress) and leads to extensive motoneuron-specific death within a few days. Co-application of the diverse ACMs with anti-oxidants Trolox or esculetin (but not with resveratrol) strongly improves motoneuron survival. We also find that co-incubation of the cultures in the ACMs with Nav channel blockers (including mexiletine, spermidine, or riluzole) prevents both intracellular nitroxidative stress and motoneuron death. Together, our data document that two completely unrelated ALS models lead to the death of motoneuron via non-cell-autonomous processes, and show that astrocytes expressing mutations in SOD1 and TDP43 trigger such cell death through a common pathogenic pathway that involves nitroxidative stress, induced at least in part by Nav channel activity. PMID:24570655

On the cellular site of two-pore channel TPC1 action in the Poaceae.

PubMed

Dadacz-Narloch, Beata; Kimura, Sachie; Kurusu, Takamitsu; Farmer, Edward E; Becker, Dirk; Kuchitsu, Kazuyuki; Hedrich, Rainer

2013-11-01

The slow vacuolar (SV) channel has been characterized in different dicots by patch-clamp recordings. This channel represents the major cation conductance of the largest organelle in most plant cells. Studies with the tpc1-2 mutant of the model dicot plant Arabidopsis thaliana identified the SV channel as the product of the TPC1 gene. By contrast, research on rice and wheat TPC1 suggested that the monocot gene encodes a plasma membrane calcium-permeable channel. To explore the site of action of grass TPC1 channels, we expressed OsTPC1 from rice (Oryza sativa) and TaTPC1 from wheat (Triticum aestivum) in the background of the Arabidopsis tpc1-2 mutant. Cross-species tpc1 complementation and patch-clamping of vacuoles using Arabidopsis and rice tpc1 null mutants documented that both monocot TPC1 genes were capable of rescuing the SV channel deficit. Vacuoles from wild-type rice but not the tpc1 loss-of-function mutant harbor SV channels exhibiting the hallmark properties of dicot TPC1/SV channels. When expressed in human embryonic kidney (HEK293) cells OsTPC1 was targeted to Lysotracker-Red-positive organelles. The finding that the rice TPC1, just like those from the model plant Arabidopsis and even animal cells, is localized and active in lyso-vacuolar membranes associates this cation channel species with endomembrane function. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

Uromodulin retention in thick ascending limb of Henle's loop affects SCD1 in neighboring proximal tubule: renal transcriptome studies in mouse models of uromodulin-associated kidney disease.

PubMed

Horsch, Marion; Beckers, Johannes; Fuchs, Helmut; Gailus-Durner, Valérie; Hrabě de Angelis, Martin; Rathkolb, Birgit; Wolf, Eckhard; Aigner, Bernhard; Kemter, Elisabeth

2014-01-01

Uromodulin-associated kidney disease (UAKD) is a hereditary progressive renal disease which can lead to renal failure and requires renal replacement therapy. UAKD belongs to the endoplasmic reticulum storage diseases due to maturation defect of mutant uromodulin and its retention in the enlarged endoplasmic reticulum in the cells of the thick ascending limb of Henle's loop (TALH). Dysfunction of TALH represents the key pathogenic mechanism of UAKD causing the clinical symptoms of this disease. However, the molecular alterations underlying UAKD are not well understood. In this study, transcriptome profiling of whole kidneys of two mouse models of UAKD, UmodA227T and UmodC93F, was performed. Genes differentially abundant in UAKD affected kidneys of both Umod mutant lines at different disease stages were identified and verified by RT-qPCR. Additionally, differential protein abundances of SCD1 and ANGPTL7 were validated by immunohistochemistry and Western blot analysis. ANGPTL7 expression was down-regulated in TALH cells of Umod mutant mice which is the site of the mutant uromodulin maturation defect. SCD1 was expressed selectively in the S3 segment of proximal tubule cells, and SCD1 abundance was increased in UAKD affected kidneys. This finding demonstrates that a cross talk between two functionally distinct tubular segments of the kidney, the TALH segment and the S3 segment of proximal tubule, exists.

No amelioration of uromodulin maturation and trafficking defect by sodium 4-phenylbutyrate in vivo: studies in mouse models of uromodulin-associated kidney disease.

PubMed

Kemter, Elisabeth; Sklenak, Stefanie; Rathkolb, Birgit; Hrabě de Angelis, Martin; Wolf, Eckhard; Aigner, Bernhard; Wanke, Ruediger

2014-04-11

Uromodulin (UMOD)-associated kidney disease (UAKD) belongs to the hereditary progressive ER storage diseases caused by maturation defects of mutant UMOD protein. Current treatments of UAKD patients are symptomatic and cannot prevent disease progression. Two in vitro studies reported a positive effect of the chemical chaperone sodium 4-phenylbutyrate (4-PBA) on mutant UMOD maturation. Thus, 4-PBA was suggested as a potential treatment for UAKD. This study evaluated the effects of 4-PBA in two mouse models of UAKD. In contrast to previous in vitro studies, treatment with 4-PBA did not increase HSP70 expression or improve maturation and trafficking of mutant UMOD in vivo. Kidney function of UAKD mice was actually deteriorated by 4-PBA treatment. In transfected tubular epithelial cells, 4-PBA did not improve maturation but increased the expression level of both mutant and wild-type UMOD protein. Activation of NF-κB pathway in thick ascending limb of Henle's loop cells of UAKD mice was detected by increased abundance of RelB and phospho-IκB kinase α/β, an indirect activator of NF-κB. Furthermore, the abundance of NF-κB1 p105/p50, NF-κB2 p100/p52, and TRAF2 was increased in UAKD. NF-κB activation was identified as a novel disease mechanism of UAKD and might be a target for therapeutic intervention.

Mutant mouse models and their contribution to our knowledge of corpus luteum development, function and regression.

PubMed

Henkes, Luiz E; Davis, John S; Rueda, Bo R

2003-11-10

The corpus luteum is a unique organ, which is transitory in nature. The development, maintenance and regression of the corpus luteum are regulated by endocrine, paracrine and autocrine signaling events. Defining the specific mediators of luteal development, maintenance and regression has been difficult and often perplexing due to the complexity that stems from the variety of cell types that make up the luteal tissue. Moreover, some regulators may serve dual functions as a luteotropic and luteolytic agent depending on the temporal and spatial environment in which they are expressed. As a result, some confusion is present in the interpretation of in vitro and in vivo studies. More recently investigators have utilized mutant mouse models to define the functional significance of specific gene products. The goal of this mini-review is to identify and discuss mutant mouse models that have luteal anomalies, which may provide some clues as to the significance of specific regulators of corpus luteum function.

Virulence gene regulation by CvfA, a putative RNase: the CvfA-enolase complex in Streptococcus pyogenes links nutritional stress, growth-phase control, and virulence gene expression.

PubMed

Kang, Song Ok; Caparon, Michael G; Cho, Kyu Hong

2010-06-01

Streptococcus pyogenes, a multiple-auxotrophic human pathogen, regulates virulence gene expression according to nutritional availability during various stages in the infection process or in different infection sites. We discovered that CvfA influenced the expression of virulence genes according to growth phase and nutritional status. The influence of CvfA in C medium, rich in peptides and poor in carbohydrates, was most pronounced at the stationary phase. Under these conditions, up to 30% of the transcriptome exhibited altered expression; the levels of expression of multiple virulence genes were altered, including the genes encoding streptokinase, CAMP factor, streptolysin O, M protein (more abundant in the CvfA(-) mutant), SpeB, mitogenic factor, and streptolysin S (less abundant). The increase of carbohydrates or peptides in media restored the levels of expression of the virulence genes in the CvfA(-) mutant to wild-type levels (emm, ska, and cfa by carbohydrates; speB by peptides). Even though the regulation of gene expression dependent on nutritional stress is commonly linked to the stringent response, the levels of ppGpp were not altered by deletion of cvfA. Instead, CvfA interacted with enolase, implying that CvfA, a putative RNase, controls the transcript decay rates of virulence factors or their regulators according to nutritional status. The virulence of CvfA(-) mutants was highly attenuated in murine models, indicating that CvfA-mediated gene regulation is necessary for the pathogenesis of S. pyogenes. Taken together, the CvfA-enolase complex in S. pyogenes is involved in the regulation of virulence gene expression by controlling RNA degradation according to nutritional stress.

Integration of multiple stimuli-sensing systems to regulate HrpS and type III secretion system in Erwinia amylovora.

PubMed

Lee, Jae Hoon; Zhao, Youfu

2018-02-01

The bacterial enhancer binding protein (bEBP) HrpS is essential for Erwinia amylovora virulence by activating the type III secretion system (T3SS). However, how the hrpS gene is regulated remains poorly understood in E. amylovora. In this study, 5' rapid amplification of cDNA ends and promoter deletion analyses showed that the hrpS gene contains two promoters driven by HrpX/HrpY and the Rcs phosphorelay system, respectively. Electrophoretic mobility shift and gene expression assays demonstrated that integration host factor IHF positively regulates hrpS expression through directly binding the hrpX promoter and positively regulating hrpX/hrpY expression. Moreover, hrpX expression was down-regulated in the relA/spoT ((p)ppGpp-deficient) mutant and the dksA mutant, but up-regulated when the wild-type strain was treated with serine hydroxamate, which induced (p)ppGpp-mediated stringent response. Furthermore, the csrA mutant showed significantly reduced transcripts of major hrpS activators, including the hrpX/hrpY, rcsA and rcsB genes, indicating that CsrA is required for full hrpS expression. On the other hand, the csrB mutant exhibited up-regulation of the rcsA and rcsB genes, and hrpS expression was largely diminished in the csrB/rcsB mutant, indicating that the Rcs system is mainly responsible for the increased hrpS expression in the csrB mutant. These findings suggest that E. amylovora recruits multiple stimuli-sensing systems, including HrpX/HrpY, the Rcs phosphorelay system and the Gac-Csr system, to regulate hrpS and T3SS gene expression.

Upregulation of IRS1 Enhances IGF1 Response in Y537S and D538G ESR1 Mutant Breast Cancer Cells.

PubMed

Li, Zheqi; Levine, Kevin M; Bahreini, Amir; Wang, Peilu; Chu, David; Park, Ben Ho; Oesterreich, Steffi; Lee, Adrian V

2018-01-01

Increased evidence suggests that somatic mutations in the ligand-binding domain of estrogen receptor [ER (ERα/ESR1)] are critical mediators of endocrine-resistant breast cancer progression. Insulinlike growth factor-1 (IGF1) is an essential regulator of breast development and tumorigenesis and also has a role in endocrine resistance. A recent study showed enhanced crosstalk between IGF1 and ERα in ESR1 mutant cells, but detailed mechanisms are incompletely understood. Using genome-edited MCF-7 and T47D cell lines harboring Y537S and D538G ESR1 mutations, we characterized altered IGF1 signaling. RNA sequencing revealed upregulation of multiple genes in the IGF1 pathway, including insulin receptor substrate-1 (IRS1), consistent in both Y537S and D538G ESR1 mutant cell line models. Higher IRS1 expression was confirmed by quantitative reverse transcription polymerase chain reaction and immunoblotting. ESR1 mutant cells also showed increased levels of IGF-regulated genes, reflected by activation of an IGF signature. IGF1 showed increased sensitivity and potency in growth stimulation of ESR1 mutant cells. Analysis of downstream signaling revealed the phosphoinositide 3-kinase (PI3K)-Akt axis as a major pathway mediating the enhanced IGF1 response in ESR1 mutant cells. Decreasing IRS1 expression by small interfering RNA diminished the increased sensitivity to IGF1. Combination treatment with inhibitors against IGF1 receptor (IGF1R; OSI-906) and ER (fulvestrant) showed synergistic growth inhibition in ESR1 mutant cells, particularly at lower effective concentrations. Our study supports a critical role of enhanced IGF1 signaling in ESR1 mutant cell lines, pointing toward a potential for cotargeting IGF1R and ERα in endocrine-resistant breast tumors with mutant ESR1. Copyright © 2018 Endocrine Society.

Acidithiobacillus caldus Sulfur Oxidation Model Based on Transcriptome Analysis between the Wild Type and Sulfur Oxygenase Reductase Defective Mutant

PubMed Central

Chen, Linxu; Ren, Yilin; Lin, Jianqun; Liu, Xiangmei; Pang, Xin; Lin, Jianqiang

2012-01-01

Background Acidithiobacillus caldus (A. caldus) is widely used in bio-leaching. It gains energy and electrons from oxidation of elemental sulfur and reduced inorganic sulfur compounds (RISCs) for carbon dioxide fixation and growth. Genomic analyses suggest that its sulfur oxidation system involves a truncated sulfur oxidation (Sox) system (omitting SoxCD), non-Sox sulfur oxidation system similar to the sulfur oxidation in A. ferrooxidans, and sulfur oxygenase reductase (SOR). The complexity of the sulfur oxidation system of A. caldus generates a big obstacle on the research of its sulfur oxidation mechanism. However, the development of genetic manipulation method for A. caldus in recent years provides powerful tools for constructing genetic mutants to study the sulfur oxidation system. Results An A. caldus mutant lacking the sulfur oxygenase reductase gene (sor) was created and its growth abilities were measured in media using elemental sulfur (S0) and tetrathionate (K2S4O6) as the substrates, respectively. Then, comparative transcriptome analysis (microarrays and real-time quantitative PCR) of the wild type and the Δsor mutant in S0 and K2S4O6 media were employed to detect the differentially expressed genes involved in sulfur oxidation. SOR was concluded to oxidize the cytoplasmic elemental sulfur, but could not couple the sulfur oxidation with the electron transfer chain or substrate-level phosphorylation. Other elemental sulfur oxidation pathways including sulfur diooxygenase (SDO) and heterodisulfide reductase (HDR), the truncated Sox pathway, and the S4I pathway for hydrolysis of tetrathionate and oxidation of thiosulfate in A. caldus are proposed according to expression patterns of sulfur oxidation genes and growth abilities of the wild type and the mutant in different substrates media. Conclusion An integrated sulfur oxidation model with various sulfur oxidation pathways of A. caldus is proposed and the features of this model are summarized. PMID:22984393

Synchrotron Infrared Microspectroscopy Detecting the Evolution of Huntingtons Disease Neuropathology and Suggesting Unique Correlates of Dysfunction in White versus Gray Brain Matter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bonda M.; Miller L.; Perrin V.

Huntington's disease (HD), caused by a mutation of the corresponding gene encoding the protein huntingtin (htt), is characterized by progressive deterioration of cognitive and motor functions, paralleled by extensive loss of striatal neurons. At the cellular level, pathogenesis involves an early and prolonged period of neuronal dysfunction followed by neuronal death. Understanding the molecular events driving these deleterious processes is critical to the successful development of therapies to slow down or halt the progression of the disease. Here, we examined biochemical processes in a HD ex vivo rat model, as well as in a HD model for cultured neurons usingmore » synchrotron-assisted Fourier transform infrared microspectroscopy (S-FTIRM). The model, based on lentiviral-mediated delivery of a fragment of the HD gene, expresses a mutant htt fragment in one brain hemisphere and a wild-type htt fragment in the control hemisphere. S-FTIRM allowed for high spatial resolution and distinction between spectral features occurring in gray and white matter. We measured a higher content of {beta}-sheet protein in the striatal gray matter exposed to mutant htt as early as 4 weeks following the initiation of mutant htt exposure. In contrast, white matter tracts did not exhibit any changes in protein structure but surprisingly showed reduced content of unsaturated lipids and a significant increase in spectral features associated with phosphorylation. The former is reminiscent of changes consistent with a myelination deficiency, while the latter is characteristic of early pro-apoptotic events. These findings point to the utility of the label-free FTIRM method to follow mutant htt's {beta}-sheet-rich transformation in striatal neurons ex vivo, provide further evidence for mutant htt amyloidogenesis in vivo, and demonstrate novel chemical features indicative of white matter changes in HD. Parallel studies in cultured neurons expressing the same htt fragments showed similar changes.« less

Long noncoding RNA Hoxb3os is dysregulated in autosomal dominant polycystic kidney disease and regulates mTOR signaling.

PubMed

Aboudehen, Karam; Farahani, Shayan; Kanchwala, Mohammed; Chan, Siu Chiu; Avdulov, Svetlana; Mickelson, Alan; Lee, Dayeon; Gearhart, Micah D; Patel, Vishal; Xing, Chao; Igarashi, Peter

2018-06-15

Autosomal dominant polycystic kidney disease (ADPKD) is a debilitating disease that is characterized by the accumulation of numerous fluid-filled cysts in the kidney. ADPKD is primarily caused by mutations in two genes, PKD1 and PKD2 Long noncoding RNAs (lncRNA), defined by a length >200 nucleotides and absence of a long ORF, have recently emerged as epigenetic regulators of development and disease; however, their involvement in PKD has not been explored previously. Here, we performed deep RNA-Seq to identify lncRNAs that are dysregulated in two orthologous mouse models of ADPKD (kidney-specific Pkd1 and Pkd2 mutant mice). We identified a kidney-specific, evolutionarily conserved lncRNA called Hoxb3os that was down-regulated in cystic kidneys from Pkd1 and Pkd2 mutant mice. The human ortholog HOXB3-AS1 was down-regulated in cystic kidneys from ADPKD patients. Hoxb3os was highly expressed in renal tubules in adult WT mice, whereas its expression was lost in the cyst epithelium of mutant mice. To investigate the function of Hoxb3os , we utilized CRISPR/Cas9 to knock out its expression in mIMCD3 cells. Deletion of Hoxb3os resulted in increased phosphorylation of mTOR and its downstream targets, including p70 S6 kinase, ribosomal protein S6, and the translation repressor 4E-BP1. Consistent with activation of mTORC1 signaling, Hoxb3os mutant cells displayed increased mitochondrial respiration. The Hoxb3os mutant phenotype was partially rescued upon re-expression of Hoxb3os in knockout cells. These findings identify Hoxb3os as a novel lncRNA that is down-regulated in ADPKD and regulates mTOR signaling and mitochondrial respiration. © 2018 Aboudehen et al.

FUS and TARDBP but Not SOD1 Interact in Genetic Models of Amyotrophic Lateral Sclerosis

PubMed Central

Kabashi, Edor; Bercier, Valérie; Lissouba, Alexandra; Liao, Meijiang; Brustein, Edna; Rouleau, Guy A.; Drapeau, Pierre

2011-01-01

Mutations in the SOD1 and TARDBP genes have been commonly identified in Amyotrophic Lateral Sclerosis (ALS). Recently, mutations in the Fused in sarcoma gene (FUS) were identified in familial (FALS) ALS cases and sporadic (SALS) patients. Similarly to TDP-43 (coded by TARDBP gene), FUS is an RNA binding protein. Using the zebrafish (Danio rerio), we examined the consequences of expressing human wild-type (WT) FUS and three ALS–related mutations, as well as their interactions with TARDBP and SOD1. Knockdown of zebrafish Fus yielded a motor phenotype that could be rescued upon co-expression of wild-type human FUS. In contrast, the two most frequent ALS–related FUS mutations, R521H and R521C, unlike S57Δ, failed to rescue the knockdown phenotype, indicating loss of function. The R521H mutation caused a toxic gain of function when expressed alone, similar to the phenotype observed upon knockdown of zebrafish Fus. This phenotype was not aggravated by co-expression of both mutant human TARDBP (G348C) and FUS (R521H) or by knockdown of both zebrafish Tardbp and Fus, consistent with a common pathogenic mechanism. We also observed that WT FUS rescued the Tardbp knockdown phenotype, but not vice versa, suggesting that TARDBP acts upstream of FUS in this pathway. In addition we observed that WT SOD1 failed to rescue the phenotype observed upon overexpression of mutant TARDBP or FUS or upon knockdown of Tardbp or Fus; similarly, WT TARDBP or FUS also failed to rescue the phenotype induced by mutant SOD1 (G93A). Finally, overexpression of mutant SOD1 exacerbated the motor phenotype caused by overexpression of mutant FUS. Together our results indicate that TARDBP and FUS act in a pathogenic pathway that is independent of SOD1. PMID:21829392

FUS and TARDBP but not SOD1 interact in genetic models of amyotrophic lateral sclerosis.

PubMed

Kabashi, Edor; Bercier, Valérie; Lissouba, Alexandra; Liao, Meijiang; Brustein, Edna; Rouleau, Guy A; Drapeau, Pierre

2011-08-01

Mutations in the SOD1 and TARDBP genes have been commonly identified in Amyotrophic Lateral Sclerosis (ALS). Recently, mutations in the Fused in sarcoma gene (FUS) were identified in familial (FALS) ALS cases and sporadic (SALS) patients. Similarly to TDP-43 (coded by TARDBP gene), FUS is an RNA binding protein. Using the zebrafish (Danio rerio), we examined the consequences of expressing human wild-type (WT) FUS and three ALS-related mutations, as well as their interactions with TARDBP and SOD1. Knockdown of zebrafish Fus yielded a motor phenotype that could be rescued upon co-expression of wild-type human FUS. In contrast, the two most frequent ALS-related FUS mutations, R521H and R521C, unlike S57Δ, failed to rescue the knockdown phenotype, indicating loss of function. The R521H mutation caused a toxic gain of function when expressed alone, similar to the phenotype observed upon knockdown of zebrafish Fus. This phenotype was not aggravated by co-expression of both mutant human TARDBP (G348C) and FUS (R521H) or by knockdown of both zebrafish Tardbp and Fus, consistent with a common pathogenic mechanism. We also observed that WT FUS rescued the Tardbp knockdown phenotype, but not vice versa, suggesting that TARDBP acts upstream of FUS in this pathway. In addition we observed that WT SOD1 failed to rescue the phenotype observed upon overexpression of mutant TARDBP or FUS or upon knockdown of Tardbp or Fus; similarly, WT TARDBP or FUS also failed to rescue the phenotype induced by mutant SOD1 (G93A). Finally, overexpression of mutant SOD1 exacerbated the motor phenotype caused by overexpression of mutant FUS. Together our results indicate that TARDBP and FUS act in a pathogenic pathway that is independent of SOD1.

Mutants with Enhanced Nitrogenase Activity in Hydroponic Azospirillum brasilense-Wheat Associations

PubMed Central

Pereg Gerk, Lily; Gilchrist, Kate; Kennedy, Ivan R.

2000-01-01

The effect of a mutation affecting flocculation, differentiation into cyst-like forms, and root colonization on nitrogenase expression by Azospirillum brasilense is described. The gene flcA of strain Sp7 restored these phenotypes in spontaneous mutants of both strains Sp7 and Sp245. Employing both constitutive pLA-lacZ and nifH-lacZ reporter fusions expressed in situ, the colony morphology, colonization pattern, and potential for nitrogenase activity of spontaneous mutants and flcA Tn5-induced mutants were established. The results of this study show that the ability of Sp7 and Sp245 mutant strains to remain in a vegetative form improved their ability to express nitrogenase activity in association with wheat in a hydroponic system. Restoring the cyst formation and colonization pattern to the spontaneous mutant Sp7-S reduced nitrogenase activity rates in association with plants to that of the wild-type Sp7. Although Tn5-induced flcA mutants showed higher potentials for nitrogenase expression than Sp7, their potentials were lower than that of Sp7-S, indicating that other factors in this strain contribute to its exceptional nitrogenase activity rates on plants. The lack of lateral flagella is not one of these factors, as Sp7-PM23, a spontaneous mutant impaired in swarming and lateral-flagellum production but not in flocculation, showed wild-type nitrogenase activity and expression. The results also suggest factors of importance in evolving an effective symbiosis between Azospirillum and wheat, such as increasing the availability of microaerobic niches along the root, increased supply of carbon sources by the plant, and the retention of the bacterial cells in vegetative form for faster metabolism. PMID:10788397

Detection of receptor ligands by monitoring selective stabilization of a Renilla luciferase-tagged, constitutively active mutant, G-protein-coupled receptor

PubMed Central

Ramsay, Douglas; Bevan, Nicola; Rees, Stephen; Milligan, Graeme

2001-01-01

The wild-type β2-adrenoceptor and a constitutively active mutant of this receptor were C-terminally tagged with luciferase from the sea pansy Renilla reniformis. C-terminal addition of Renilla luciferase did not substantially alter the levels of expression of either form of the receptor, the elevated constitutive activity of the mutant β2-adrenoceptor nor the capacity of isoprenaline to elevate cyclic AMP levels in intact cells expressing these constructs. Treatment of cells expressing constitutively active mutant β2-adrenoceptor-Renilla luciferase with antagonist/inverse agonist ligands resulted in upregulation of levels of this polypeptide which could be monitored by the elevated luciferase activity. The pEC50 for ligand-induced luciferase upregulation and ligand affinity to bind the receptor were highly correlated. Similar upregulation could be observed following sustained treatment with agonist ligands. These effects were only observed at a constitutively active mutant of the β2-adrenoceptor. Co-expression of the wild-type β2-adrenoceptor C-terminally tagged with the luciferase from Photinus pyralis did not result in ligand-induced upregulation of the levels of activity of this luciferase. Co-expression of the constitutively active mutant β2-adrenoceptor-Renilla luciferase and an equivalent mutant of the α1b-adrenoceptor C-terminally tagged with green fluorescent protein allowed pharmacological selectivity of adrenoceptor antagonists to be demonstrated. This approach offers a sensitive and convenient means, which is amenable to high throughput analysis, to monitor ligand binding to a constitutively active mutant receptor. As no prior knowledge of receptor ligands is required this approach may be suitable to identify ligands at orphan G protein-coupled receptors. PMID:11350868

Absence of Nrf2 or Its Selective Overexpression in Neurons and Muscle Does Not Affect Survival in ALS-Linked Mutant hSOD1 Mouse Models

PubMed Central

Vargas, Marcelo R.; Burton, Neal C.; Gan, Li; Johnson, Delinda A.; Schäfer, Matthias; Werner, Sabine; Johnson, Jeffrey A.

2013-01-01

The nuclear factor erythroid 2-related factor 2 (Nrf2) governs the expression of antioxidant and phase II detoxifying enzymes. Nrf2 activation can prevent or reduce cellular damage associated with several types of injury in many different tissues and organs. Dominant mutations in Cu/Zn-superoxide dismutase (SOD1) cause familial forms of amyotrophic lateral sclerosis (ALS), a fatal disorder characterized by the progressive loss of motor neurons and subsequent muscular atrophy. We have previously shown that Nrf2 activation in astrocytes delays neurodegeneration in ALS mouse models. To further investigate the role of Nrf2 in ALS we determined the effect of absence of Nrf2 or its restricted overexpression in neurons or type II skeletal muscle fibers on symptoms onset and survival in mutant hSOD1 expressing mice. We did not observe any detrimental effect associated with the lack of Nrf2 in two different mutant hSOD1 animal models of ALS. However, restricted Nrf2 overexpression in neurons or type II skeletal muscle fibers delayed disease onset but failed to extend survival in hSOD1G93A mice. These results highlight the concept that not only the pharmacological target but also the cell type targeted may be relevant when considering a Nrf2-mediated therapeutic approach for ALS. PMID:23418589

Absence of Nrf2 or its selective overexpression in neurons and muscle does not affect survival in ALS-linked mutant hSOD1 mouse models.

PubMed

Vargas, Marcelo R; Burton, Neal C; Kutzke, Jennifer; Gan, Li; Johnson, Delinda A; Schäfer, Matthias; Werner, Sabine; Johnson, Jeffrey A

2013-01-01

The nuclear factor erythroid 2-related factor 2 (Nrf2) governs the expression of antioxidant and phase II detoxifying enzymes. Nrf2 activation can prevent or reduce cellular damage associated with several types of injury in many different tissues and organs. Dominant mutations in Cu/Zn-superoxide dismutase (SOD1) cause familial forms of amyotrophic lateral sclerosis (ALS), a fatal disorder characterized by the progressive loss of motor neurons and subsequent muscular atrophy. We have previously shown that Nrf2 activation in astrocytes delays neurodegeneration in ALS mouse models. To further investigate the role of Nrf2 in ALS we determined the effect of absence of Nrf2 or its restricted overexpression in neurons or type II skeletal muscle fibers on symptoms onset and survival in mutant hSOD1 expressing mice. We did not observe any detrimental effect associated with the lack of Nrf2 in two different mutant hSOD1 animal models of ALS. However, restricted Nrf2 overexpression in neurons or type II skeletal muscle fibers delayed disease onset but failed to extend survival in hSOD1(G93A) mice. These results highlight the concept that not only the pharmacological target but also the cell type targeted may be relevant when considering a Nrf2-mediated therapeutic approach for ALS.

Insulin signaling misregulation underlies circadian and cognitive deficits in a Drosophila fragile X model.

PubMed

Monyak, R E; Emerson, D; Schoenfeld, B P; Zheng, X; Chambers, D B; Rosenfelt, C; Langer, S; Hinchey, P; Choi, C H; McDonald, T V; Bolduc, F V; Sehgal, A; McBride, S M J; Jongens, T A

2017-08-01

Fragile X syndrome (FXS) is an undertreated neurodevelopmental disorder characterized by low intelligence quotent and a wide range of other symptoms including disordered sleep and autism. Although FXS is the most prevalent inherited cause of intellectual disability, its mechanistic underpinnings are not well understood. Using Drosophila as a model of FXS, we showed that select expression of dfmr1 in the insulin-producing cells (IPCs) of the brain was sufficient to restore normal circadian behavior and to rescue the memory deficits in the fragile X mutant fly. Examination of the insulin signaling (IS) pathway revealed elevated levels of Drosophila insulin-like peptide 2 (Dilp2) in the IPCs and elevated IS in the dfmr1 mutant brain. Consistent with a causal role for elevated IS in dfmr1 mutant phenotypes, the expression of dfmr1 specifically in the IPCs reduced IS, and genetic reduction of the insulin pathway also led to amelioration of circadian and memory defects. Furthermore, we showed that treatment with the FDA-approved drug metformin also rescued memory. Finally, we showed that reduction of IS is required at different time points to rescue circadian behavior and memory. Our results indicate that insulin misregulation underlies the circadian and cognitive phenotypes displayed by the Drosophila fragile X model, and thus reveal a metabolic pathway that can be targeted by new and already approved drugs to treat fragile X patients.

SpxA1 and SpxA2 Act Coordinately To Fine-Tune Stress Responses and Virulence in Streptococcus pyogenes.

PubMed

Port, Gary C; Cusumano, Zachary T; Tumminello, Paul R; Caparon, Michael G

2017-03-28

SpxA is a unique transcriptional regulator highly conserved among members of the phylum Firmicutes that binds RNA polymerase and can act as an antiactivator. Why some Firmicutes members have two highly similar SpxA paralogs is not understood. Here, we show that the SpxA paralogs of the pathogen Streptococcus pyogenes , SpxA1 and SpxA2, act coordinately to regulate virulence by fine-tuning toxin expression and stress resistance. Construction and analysis of mutants revealed that SpxA1 - mutants were defective for growth under aerobic conditions, while SpxA2 - mutants had severely attenuated responses to multiple stresses, including thermal and oxidative stresses. SpxA1 - mutants had enhanced resistance to the cationic antimicrobial molecule polymyxin B, while SpxA2 - mutants were more sensitive. In a murine model of soft tissue infection, a SpxA1 - mutant was highly attenuated. In contrast, the highly stress-sensitive SpxA2 - mutant was hypervirulent, exhibiting more extensive tissue damage and a greater bacterial burden than the wild-type strain. SpxA1 - attenuation was associated with reduced expression of several toxins, including the SpeB cysteine protease. In contrast, SpxA2 - hypervirulence correlated with toxin overexpression and could be suppressed to wild-type levels by deletion of speB These data show that SpxA1 and SpxA2 have opposing roles in virulence and stress resistance, suggesting that they act coordinately to fine-tune toxin expression in response to stress. SpxA2 - hypervirulence also shows that stress resistance is not always essential for S. pyogenes pathogenesis in soft tissue. IMPORTANCE For many pathogens, it is generally assumed that stress resistance is essential for pathogenesis. For Streptococcus pyogenes , environmental stress is also used as a signal to alter toxin expression. The amount of stress likely informs the bacterium of the strength of the host's defense response, allowing it to adjust its toxin expression to produce the ideal amount of tissue damage, balancing between too little damage, which will result in its elimination, and too much damage, which will debilitate the host. Here we identify components of a genetic circuit involved in stress resistance and toxin expression that has a fine-tuning function in tissue damage. The circuit consists of two versions of the protein SpxA that regulate transcription and are highly similar but have opposing effects on the severity of soft tissue damage. These results will help us understand how virulence is fine-tuned in other pathogens that have two SpxA proteins. Copyright © 2017 Port et al.

Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning

2016-04-22

The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatinmore » immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.« less

Implications of fALS Mutations on Sod1 Function and Oligomerization in Cell Models.

PubMed

Brasil, Aline A; Magalhães, Rayne S S; De Carvalho, Mariana D C; Paiva, Isabel; Gerhardt, Ellen; Pereira, Marcos D; Outeiro, Tiago F; Eleutherio, Elis C A

2018-06-01

Among the familial forms of amyotrophic lateral sclerosis (fALS), 20% are associated with the Cu,Zn-superoxide dismutase (Sod1). fALS is characterized by the accumulation of aggregated proteins and the increase in oxidative stress markers. Here, we used the non-invasive bimolecular fluorescence complementation (BiFC) assay in human H4 cells to investigate the kinetics of aggregation and subcellular localization of Sod1 mutants. We also studied the effect of the different Sod1 mutants to respond against oxidative stress by following the levels of reactive oxygen species (ROS) after treatment with hydrogen peroxide. Our results showed that only 30% of cells transfected with A4VSod1 showed no inclusions while for the other Sod1 mutants tested (L38V, G93A and G93C), this percentage was at least 70%. In addition, we found that 10% of cells transfected with A4VSod1 displayed more than five inclusions per cell and that A4V and G93A Sod1 formed inclusions more rapidly than L38V and G93C Sod1. Expression of WTSod1 significantly decreased the intracellular oxidation levels in comparison with expression of fALS Sod1 mutants, suggesting the mutations induce a functional impairment. All fALS mutations impaired nuclear localization of Sod1, which is important for maintaining genomic stability. Consistently, expression of WTSod1, but not of fALS Sod1 mutants, reduced DNA damage, as measured by the comet assay. Altogether, our study sheds light into the effects of fALS Sod1 mutations on inclusion formation, dynamics, and localization as well as on antioxidant response, opening novel avenues for investigating the role of fALS Sod1 mutations in pathogenesis.

Oral treatment with Cu(II)(atsm) increases mutant SOD1 in vivo but protects motor neurons and improves the phenotype of a transgenic mouse model of amyotrophic lateral sclerosis.

PubMed

Roberts, Blaine R; Lim, Nastasia K H; McAllum, Erin J; Donnelly, Paul S; Hare, Dominic J; Doble, Philip A; Turner, Bradley J; Price, Katherine A; Lim, Sin Chun; Paterson, Brett M; Hickey, James L; Rhoads, Timothy W; Williams, Jared R; Kanninen, Katja M; Hung, Lin W; Liddell, Jeffrey R; Grubman, Alexandra; Monty, Jean-Francois; Llanos, Roxana M; Kramer, David R; Mercer, Julian F B; Bush, Ashley I; Masters, Colin L; Duce, James A; Li, Qiao-Xin; Beckman, Joseph S; Barnham, Kevin J; White, Anthony R; Crouch, Peter J

2014-06-04

Mutations in the metallo-protein Cu/Zn-superoxide dismutase (SOD1) cause amyotrophic lateral sclerosis (ALS) in humans and an expression level-dependent phenotype in transgenic rodents. We show that oral treatment with the therapeutic agent diacetyl-bis(4-methylthiosemicarbazonato)copper(II) [Cu(II)(atsm)] increased the concentration of mutant SOD1 (SOD1G37R) in ALS model mice, but paradoxically improved locomotor function and survival of the mice. To determine why the mice with increased levels of mutant SOD1 had an improved phenotype, we analyzed tissues by mass spectrometry. These analyses revealed most SOD1 in the spinal cord tissue of the SOD1G37R mice was Cu deficient. Treating with Cu(II)(atsm) decreased the pool of Cu-deficient SOD1 and increased the pool of fully metallated (holo) SOD1. Tracking isotopically enriched (65)Cu(II)(atsm) confirmed the increase in holo-SOD1 involved transfer of Cu from Cu(II)(atsm) to SOD1, suggesting the improved locomotor function and survival of the Cu(II)(atsm)-treated SOD1G37R mice involved, at least in part, the ability of the compound to improve the Cu content of the mutant SOD1. This was supported by improved survival of SOD1G37R mice that expressed the human gene for the Cu uptake protein CTR1. Improving the metal content of mutant SOD1 in vivo with Cu(II)(atsm) did not decrease levels of misfolded SOD1. These outcomes indicate the metal content of SOD1 may be a greater determinant of the toxicity of the protein in mutant SOD1-associated forms of ALS than the mutations themselves. Improving the metal content of SOD1 therefore represents a valid therapeutic strategy for treating ALS caused by SOD1. Copyright © 2014 the authors 0270-6474/14/348021-11$15.00/0.

Herpes Simplex Virus 2 Latency-Associated Transcript (LAT) region mutations do not identify a role for LAT-Associated Micro RNAs in viral reactivation in the Guinea Pig Genital Model.

PubMed

Kawamura, Yoshiki; Bosch-Marce, Marta; Tang, Shuang; Patel, Amita; Krause, Philip R

2018-05-02

Despite the long-standing observation that herpes simplex virus (HSV) Latency-Associated Transcript (LAT) promoter-deletion viruses show impaired recurrence phenotypes in relevant animal models, the mechanism by which these sequences exert this phenotypic effect is unknown. We constructed and evaluated four mutant HSV-2 viruses with targeted mutations in the LAT promoter and LAT-associated miRNAs affecting (1) the LAT TATA box, (2) the LAT ICP4-binding site, (3) miR-I and miR-II (miR-I/II), which both target ICP34.5, and (4) miR-III, which targets ICP0. While the LAT-TATA box mutant caused milder acute infections than wild-type (WT), there was no difference in recurrence phenotype between these viruses. LAT and miRNA expression during latency were not impaired by this mutation, suggesting that other promoter elements may be more important for latent HSV-2 LAT expression. Mutation of the LAT ICP4-binding site also did not cause an in vivo phenotypic difference between mutant and WT viruses. Acute infection and reactivation from latency of the miR-I/II mutant was similar to that of its rescuant, although slightly reduced in severity relative to the wild-type virus. The miR-III mutant also exhibited WT phenotypes in acute and recurrent phases of infection. While not ruling out an effect of these elements in human latency or reactivation, these findings do not identify a specific role for LAT or LAT-associated miRNAs in the HSV-2 LAT promoter deletion phenotype in guinea pigs. Thus, other sequences in this region may play a more important role in the long-studied LAT-associated phenotype in animals. IMPORTANCE While it has been known for several decades that specific HSV-1 and HSV-2 sequences near the LAT promoter are required for efficient viral reactivation in animal models, the mechanism is still not known. We constructed four mutant viruses with the goal of identifying critical sequence elements and of specifically testing the hypothesis that microRNAs that are expressed during latency play a role. Determination that specific LAT promoter sequences and miRNA sequences do not influence viral reactivation of HSV-2 helps to narrow down the search for the mechanism by which the virus controls its latency and recurrence phenotype. This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.

Mutants in the Mouse NuRD/Mi2 Component P66α Are Embryonic Lethal

PubMed Central

Marino, Susan; Nusse, Roel

2007-01-01

Background The NuRD/Mi2 chromatin complex is involved in histone modifications and contains a large number of subunits, including the p66 protein. There are two mouse and human p66 paralogs, p66α and p66β. The functions of these genes are not clear, in part because there are no mutants available, except in invertebrate model systems. Methodology We made loss of function mutants in the mouse p66α gene (mp66α, official name Gatad2a, MGI:2384585). We found that mp66α is essential for development, as mutant embryos die around day 10 of embryogenesis. The gene is not required for normal blastocyst development or for implantation. The phenotype of mutant embryos and the pattern of gene expression in mutants are consistent with a role of mp66α in gene silencing. Conclusion mp66α is an essential gene, required for early mouse development. The lethal phenotype supports a role in execution of methylated DNA silencing. PMID:17565372

Temperature-responsive genetic loci in the plant pathogen Pseudomonas syringae pv. glycinea.

PubMed

Ullrich, M S; Schergaut, M; Boch, J; Ullrich, B

2000-10-01

Plant-pathogenic bacteria may sense variations in environmental factors, such as temperature, to adapt to plant-associated habitats during pathogenesis or epiphytic growth. The bacterial blight pathogen of soybean, Pseudomonas syringae pv. glycinea PG4180, preferentially produces the phytotoxin coronatine at 18 degrees C and infects the host plant under conditions of low temperature and high humidity. A miniTn5-based promoterless glucuronidase (uidA) reporter gene was used to identify genetic loci of PG4180 preferentially expressed at 18 or 28 degrees C. Out of 7500 transposon mutants, 61 showed thermoregulated uidA expression as determined by a three-step screening procedure. Two-thirds of these mutants showed an increased reporter gene expression at 18 degrees C whilst the remainder exhibited higher uidA expression at 28 degrees C. MiniTn5-uidA insertion loci from these mutants were subcloned and their nucleotide sequences were determined. Several of the mutants induced at 18 degrees C contained the miniTn5-uidA insertion within the 32.8 kb coronatine biosynthetic gene cluster. Among the other mutants with increased uidA expression at 18 degrees C, insertions were found in genes encoding formaldehyde dehydrogenase, short-chain dehydrogenase and mannuronan C-5-epimerase, in a plasmid-borne replication protein, and in the hrpT locus, involved in pathogenicity of P. syringae. Among the mutants induced at 28 degrees C, insertions disrupted loci with similarities to a repressor of conjugal plasmid transfer, UV resistance determinants, an isoflavanoid-degrading enzyme, a HU-like DNA-binding protein, two additional regulatory proteins, a homologue of bacterial adhesins, transport proteins, LPS synthesis enzymes and two proteases. Genetic loci from 13 mutants did not show significant similarities to any database entries. Results of plant inoculations showed that three of the mutants tested were inhibited in symptom development and in planta multiplication rates. Temperature-shift experiments suggested that all of the identified loci showed a rather slow induction of expression upon change of temperature.

Study the Expression of ompf Gene in Esherichia coli Mutants

PubMed Central

Jaktaji, R. Pourahmad; Heidari, F.

2013-01-01

The outer membrane porin proteins are the major factors in controlling the permeability of cell membrane. OmpF is an example of porin proteins in Esherichia coli. In normal growth condition a large amount of this protein is synthesised, but under stress condition, such as the presence of antibiotics in environment its expression is decreased inhibiting the entrance of antibiotics into cell. The expression of ompF is inhibited by antisense RNA transcribed from micF. In normal condition the expression of micF is low, but in the presence of antibiotics its expression is increased and causes multiple resistances to irrelevant antibiotics. The aims of this research were to study first, the intactness of micF and then quantify the expression of ompF in ciprofloxacin and tetracycline resistant mutants of E. coli. For this purpose the 5’ end of micF was amplified and then sequenced. None of these mutants except one and its clone has a mutation in this gene. Then the relative expression of ompF in these mutants was quantified by real time PCR. There was no significant difference between ompF transcription of mutants and wild type strain. Based on this study and previous study it is concluded that low to intermediate levels of resistance to ciprofloxacin and tetracycline does not decrease ompF transcription. PMID:24403654

Streptococcus pyogenes Arginine and Citrulline Catabolism Promotes Infection and Modulates Innate Immunity

PubMed Central

Cusumano, Zachary T.; Watson, Michael E.

2014-01-01

A bacterium's ability to acquire nutrients from its host during infection is an essential component of pathogenesis. For the Gram-positive pathogen Streptococcus pyogenes, catabolism of the amino acid arginine via the arginine deiminase (ADI) pathway supplements energy production and provides protection against acid stress in vitro. Its expression is enhanced in murine models of infection, suggesting an important role in vivo. To gain insight into the function of the ADI pathway in pathogenesis, the virulence of mutants defective in each of its enzymes was examined. Mutants unable to use arginine (ΔArcA) or citrulline (ΔArcB) were attenuated for carriage in a murine model of asymptomatic mucosal colonization. However, in a murine model of inflammatory infection of cutaneous tissue, the ΔArcA mutant was attenuated but the ΔArcB mutant was hyperattenuated, revealing an unexpected tissue-specific role for citrulline metabolism in pathogenesis. When mice defective for the arginine-dependent production of nitric oxide (iNOS−/−) were infected with the ΔArcA mutant, cutaneous virulence was rescued, demonstrating that the ability of S. pyogenes to utilize arginine was dispensable in the absence of nitric oxide-mediated innate immunity. This work demonstrates the importance of arginine and citrulline catabolism and suggests a novel mechanism of virulence by which S. pyogenes uses its metabolism to modulate innate immunity through depletion of an essential host nutrient. PMID:24144727

Zebrafish mab21l2 is specifically expressed in the presumptive eye and tectum from early somitogenesis onwards.

PubMed

Kudoh, T; Dawid, I B

2001-11-01

Random screening for tissue specific genes in zebrafish by in situ hybridization led us to isolate a gene which showed highly restricted expression in the developing eyes and midbrain at somitogenesis stages. This gene was very similar to mouse and human mab21l2. The characteristic expression pattern of mab21l2 facilitates a detailed description of the morphogenesis of the eyes and midbrain in the zebrafish. In the eye field, mab21l2 expression illustrates the transformation of the eye field to form two separate eyes in the anterior neural plate. Mab21l2 staining in the cyclopic mutants, cyc and oep, exhibited incomplete splitting of the eye primodium. In the midbrain, mab21l2 is expressed in the tectum, and its expression follows the expansion of the tectal region. In mutants affecting the mid-hindbrain boundary (MHB), mab21l2 expression is affected differentially. In the noi/pax2.1 mutant, mab21l2 is down-regulated and the size of the tectum remains small, whereas in the ace/fgf8 mutant, mab21l2 expression persists although the shape of the tectum is altered.

Establishment of a tissue-specific RNAi system in C. elegans.

PubMed

Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D; Amano, Mutsuki; Moerman, Donald G; Kaibuchi, Kozo

2007-10-01

In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal-and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues.

Establishment of a tissue-specific RNAi system in C. elegans

PubMed Central

Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D.; Amano, Mutsuki; Moerman, Donald G.; Kaibuchi, Kozo

2011-01-01

In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal- and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues. PMID:17681718

Tlx and Pax6 co-operate genetically to establish the pallio-subpallial boundary in the embryonic mouse telencephalon.

PubMed

Stenman, Jan; Yu, Ruth T; Evans, Ronald M; Campbell, Kenneth

2003-03-01

We have examined the role of Tlx, an orphan nuclear receptor, in dorsal-ventral patterning of the mouse telencephalon. Tlx is expressed broadly in the ventricular zone, with the exception of the dorsomedial and ventromedial regions. The expression spans the pallio-subpallial boundary, which separates the dorsal (i.e. pallium) and ventral (i.e. subpallium) telencephalon. Despite being expressed on both sides of the pallio-subpallial boundary, Tlx homozygous mutants display alterations in the development of this boundary. These alterations include a dorsal shift in the expression limits of certain genes that abut at the pallio-subpallial boundary as well as the abnormal formation of the radial glial palisade that normally marks this boundary. The Tlx mutant phenotype is similar to, but less severe than, that seen in Small eye (i.e. Pax6) mutants. Interestingly, removal of one allele of Pax6 on the homozygous Tlx mutant background significantly worsens the phenotype. Thus Tlx and Pax6 cooperate genetically to regulate the establishment of the pallio-subpallial boundary. The patterning defects in the Tlx mutant telencephalon result in a loss of region-specific gene expression in the ventral-most pallial region. This correlates well with the malformation of the lateral and basolateral amygdala in Tlx mutants, both of which have been suggested to derive from ventral portions of the pallium.

Diabetes and exocrine pancreatic insufficiency in E2F1/E2F2 double-mutant mice.

PubMed

Iglesias, Ainhoa; Murga, Matilde; Laresgoiti, Usua; Skoudy, Anouchka; Bernales, Irantzu; Fullaondo, Asier; Moreno, Bernardino; Lloreta, José; Field, Seth J; Real, Francisco X; Zubiaga, Ana M

2004-05-01

E2F transcription factors are thought to be key regulators of cell growth control. Here we use mutant mouse strains to investigate the function of E2F1 and E2F2 in vivo. E2F1/E2F2 compound-mutant mice develop nonautoimmune insulin-deficient diabetes and exocrine pancreatic dysfunction characterized by endocrine and exocrine cell dysplasia, a reduction in the number and size of acini and islets, and their replacement by ductal structures and adipose tissue. Mutant pancreatic cells exhibit increased rates of DNA replication but also of apoptosis, resulting in severe pancreatic atrophy. The expression of genes involved in DNA replication and cell cycle control was upregulated in the E2F1/E2F2 compound-mutant pancreas, suggesting that their expression is repressed by E2F1/E2F2 activities and that the inappropriate cell cycle found in the mutant pancreas is likely the result of the deregulated expression of these genes. Interestingly, the expression of ductal cell and adipocyte differentiation marker genes was also upregulated, whereas expression of pancreatic cell marker genes were downregulated. These results suggest that E2F1/E2F2 activity negatively controls growth of mature pancreatic cells and is necessary for the maintenance of differentiated pancreatic phenotypes in the adult.

BIM and mTOR expression levels predict outcome to erlotinib in EGFR-mutant non-small-cell lung cancer.

PubMed

Karachaliou, Niki; Codony-Servat, Jordi; Teixidó, Cristina; Pilotto, Sara; Drozdowskyj, Ana; Codony-Servat, Carles; Giménez-Capitán, Ana; Molina-Vila, Miguel Angel; Bertrán-Alamillo, Jordi; Gervais, Radj; Massuti, Bartomeu; Morán, Teresa; Majem, Margarita; Felip, Enriqueta; Carcereny, Enric; García-Campelo, Rosario; Viteri, Santiago; González-Cao, María; Morales-Espinosa, Daniela; Verlicchi, Alberto; Crisetti, Elisabetta; Chaib, Imane; Santarpia, Mariacarmela; Luis Ramírez, José; Bosch-Barrera, Joaquim; Felipe Cardona, Andrés; de Marinis, Filippo; López-Vivanco, Guillermo; Miguel Sánchez, José; Vergnenegre, Alain; Sánchez Hernández, José Javier; Sperduti, Isabella; Bria, Emilio; Rosell, Rafael

2015-12-07

BIM is a proapoptotic protein that initiates apoptosis triggered by EGFR tyrosine kinase inhibitors (TKI). mTOR negatively regulates apoptosis and may influence response to EGFR TKI. We examined mRNA expression of BIM and MTOR in 57 patients with EGFR-mutant NSCLC from the EURTAC trial. Risk of mortality and disease progression was lower in patients with high BIM compared with low/intermediate BIM mRNA levels. Analysis of MTOR further divided patients with high BIM expression into two groups, with those having both high BIM and MTOR experiencing shorter overall and progression-free survival to erlotinib. Validation of our results was performed in an independent cohort of 19 patients with EGFR-mutant NSCLC treated with EGFR TKIs. In EGFR-mutant lung adenocarcinoma cell lines with high BIM expression, concomitant high mTOR expression increased IC50 of gefitinib for cell proliferation. We next sought to analyse the signalling pattern in cell lines with strong activation of mTOR and its substrate P-S6. We showed that mTOR and phosphodiesterase 4D (PDE4D) strongly correlate in resistant EGFR-mutant cancer cell lines. These data suggest that the combination of EGFR TKI with mTOR or PDE4 inhibitors could be adequate therapy for EGFR-mutant NSCLC patients with high pretreatment levels of BIM and mTOR.

The Thiamine Biosynthesis Gene THI1 Promotes Nodule Growth and Seed Maturation1

PubMed Central

Nagae, Miwa; Kawaguchi, Masayoshi; Takeda, Naoya

2016-01-01

Thiamine (vitamin B1) is essential for living organisms. Unlike animals, plants can synthesize thiamine. In Lotus japonicus, the expression of two thiamine biosynthesis genes, THI1 and THIC, was enhanced by inoculation with rhizobia but not by inoculation with arbuscular mycorrhizal fungi. THIC and THI2 (a THI1 paralog) were expressed in uninoculated leaves. THI2-knockdown plants and the transposon insertion mutant thiC had chlorotic leaves. This typical phenotype of thiamine deficiency was rescued by an exogenous supply of thiamine. In wild-type plants, THI1 was expressed mainly in roots and nodules, and the thi1 mutant had green leaves even in the absence of exogenous thiamine. THI1 was highly expressed in actively dividing cells of nodule primordia. The thi1 mutant had small nodules, and this phenotype was rescued by exogenous thiamine and by THI1 complementation. Exogenous thiamine increased nodule diameter, but the level of arbuscular mycorrhizal colonization was unaffected in the thi1 mutant or by exogenous thiamine. Expression of symbiotic marker genes was induced normally, implying that mainly nodule growth was delayed in the thi1 mutant. Furthermore, this mutant formed many immature seeds with reduced seed weight. These results indicate that thiamine biosynthesis mediated by THI1 enhances nodule enlargement and is required for seed development in L. japonicus. PMID:27702844

A Yeast Model of FUS/TLS-Dependent Cytotoxicity

PubMed Central

Ju, Shulin; Tardiff, Daniel F.; Han, Haesun; Divya, Kanneganti; Zhong, Quan; Maquat, Lynne E.; Bosco, Daryl A.; Hayward, Lawrence J.; Brown, Robert H.; Lindquist, Susan; Ringe, Dagmar; Petsko, Gregory A.

2011-01-01

FUS/TLS is a nucleic acid binding protein that, when mutated, can cause a subset of familial amyotrophic lateral sclerosis (fALS). Although FUS/TLS is normally located predominantly in the nucleus, the pathogenic mutant forms of FUS/TLS traffic to, and form inclusions in, the cytoplasm of affected spinal motor neurons or glia. Here we report a yeast model of human FUS/TLS expression that recapitulates multiple salient features of the pathology of the disease-causing mutant proteins, including nuclear to cytoplasmic translocation, inclusion formation, and cytotoxicity. Protein domain analysis indicates that the carboxyl-terminus of FUS/TLS, where most of the ALS-associated mutations are clustered, is required but not sufficient for the toxicity of the protein. A genome-wide genetic screen using a yeast over-expression library identified five yeast DNA/RNA binding proteins, encoded by the yeast genes ECM32, NAM8, SBP1, SKO1, and VHR1, that rescue the toxicity of human FUS/TLS without changing its expression level, cytoplasmic translocation, or inclusion formation. Furthermore, hUPF1, a human homologue of ECM32, also rescues the toxicity of FUS/TLS in this model, validating the yeast model and implicating a possible insufficiency in RNA processing or the RNA quality control machinery in the mechanism of FUS/TLS mediated toxicity. Examination of the effect of FUS/TLS expression on the decay of selected mRNAs in yeast indicates that the nonsense-mediated decay pathway is probably not the major determinant of either toxicity or suppression. PMID:21541368

ALS mutations in FUS cause neuronal dysfunction and death in Caenorhabditis elegans by a dominant gain-of-function mechanism

PubMed Central

Murakami, Tetsuro; Yang, Seung-Pil; Xie, Lin; Kawano, Taizo; Fu, Donald; Mukai, Asuka; Bohm, Christopher; Chen, Fusheng; Robertson, Janice; Suzuki, Hiroshi; Tartaglia, Gian Gaetano; Vendruscolo, Michele; Kaminski Schierle, Gabriele S.; Chan, Fiona T.S.; Moloney, Aileen; Crowther, Damian; Kaminski, Clemens F.; Zhen, Mei; St George-Hyslop, Peter

2012-01-01

It is unclear whether mutations in fused in sarcoma (FUS) cause familial amyotrophic lateral sclerosis via a loss-of-function effect due to titrating FUS from the nucleus or a gain-of-function effect from cytoplasmic overabundance. To investigate this question, we generated a series of independent Caenorhabditis elegans lines expressing mutant or wild-type (WT) human FUS. We show that mutant FUS, but not WT-FUS, causes cytoplasmic mislocalization associated with progressive motor dysfunction and reduced lifespan. The severity of the mutant phenotype in C. elegans was directly correlated with the severity of the illness caused by the same mutation in humans, arguing that this model closely replicates key features of the human illness. Importantly, the mutant phenotype could not be rescued by overexpression of WT-FUS, even though WT-FUS had physiological intracellular localization, and was not recruited to the cytoplasmic mutant FUS aggregates. Our data suggest that FUS mutants cause neuronal dysfunction by a dominant gain-of-function effect related either to neurotoxic aggregates of mutant FUS in the cytoplasm or to dysfunction in its RNA-binding functions. PMID:21949354

ALS mutations in FUS cause neuronal dysfunction and death in Caenorhabditis elegans by a dominant gain-of-function mechanism.

PubMed

Murakami, Tetsuro; Yang, Seung-Pil; Xie, Lin; Kawano, Taizo; Fu, Donald; Mukai, Asuka; Bohm, Christopher; Chen, Fusheng; Robertson, Janice; Suzuki, Hiroshi; Tartaglia, Gian Gaetano; Vendruscolo, Michele; Kaminski Schierle, Gabriele S; Chan, Fiona T S; Moloney, Aileen; Crowther, Damian; Kaminski, Clemens F; Zhen, Mei; St George-Hyslop, Peter

2012-01-01

It is unclear whether mutations in fused in sarcoma (FUS) cause familial amyotrophic lateral sclerosis via a loss-of-function effect due to titrating FUS from the nucleus or a gain-of-function effect from cytoplasmic overabundance. To investigate this question, we generated a series of independent Caenorhabditis elegans lines expressing mutant or wild-type (WT) human FUS. We show that mutant FUS, but not WT-FUS, causes cytoplasmic mislocalization associated with progressive motor dysfunction and reduced lifespan. The severity of the mutant phenotype in C. elegans was directly correlated with the severity of the illness caused by the same mutation in humans, arguing that this model closely replicates key features of the human illness. Importantly, the mutant phenotype could not be rescued by overexpression of WT-FUS, even though WT-FUS had physiological intracellular localization, and was not recruited to the cytoplasmic mutant FUS aggregates. Our data suggest that FUS mutants cause neuronal dysfunction by a dominant gain-of-function effect related either to neurotoxic aggregates of mutant FUS in the cytoplasm or to dysfunction in its RNA-binding functions.

Constitutive activation of MEK1 in chondrocytes causes Stat1-independent achondroplasia-like dwarfism and rescues the Fgfr3-deficient mouse phenotype

PubMed Central

Murakami, Shunichi; Balmes, Gener; McKinney, Sandra; Zhang, Zhaoping; Givol, David; de Crombrugghe, Benoit

2004-01-01

We generated transgenic mice that express a constitutively active mutant of MEK1 in chondrocytes. These mice showed a dwarf phenotype similar to achondroplasia, the most common human dwarfism, caused by activating mutations in FGFR3. These mice displayed incomplete hypertrophy of chondrocytes in the growth plates and a general delay in endochondral ossification, whereas chondrocyte proliferation was unaffected. Immunohistochemical analysis of the cranial base in transgenic embryos showed reduced staining for collagen type X and persistent expression of Sox9 in chondrocytes. These observations indicate that the MAPK pathway inhibits hypertrophic differentiation of chondrocytes and negatively regulates bone growth without inhibiting chondrocyte proliferation. Expression of a constitutively active mutant of MEK1 in chondrocytes of Fgfr3-deficient mice inhibited skeletal overgrowth, strongly suggesting that regulation of bone growth by FGFR3 is mediated at least in part by the MAPK pathway. Although loss of Stat1 restored the reduced chondrocyte proliferation in mice expressing an achondroplasia mutant of Fgfr3, it did not rescue the reduced hypertrophic zone, the delay in formation of secondary ossification centers, and the achondroplasia-like phenotype. These observations suggest a model in which Fgfr3 signaling inhibits bone growth by inhibiting chondrocyte differentiation through the MAPK pathway and by inhibiting chondrocyte proliferation through Stat1. PMID:14871928

The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence.

PubMed

Ren, Jun; Prescott, John F

2004-11-15

An 81 kb virulence plasmid containing a pathogenicity island (PI) plays a crucial role in the pathogenesis of Rhodococcus equi pneumonia in foals but its specific function in virulence and regulation of plasmid-encoded virulence genes is unclear. Using a LacZ selection marker developed for R. equi in this study, in combination with an apramycin resistance gene, an efficient two-stage homologous recombination targeted gene mutation procedure was used to mutate three virulence plasmid genes, a LysR regulatory gene homologue (ORF4), a ResD-like two-component response regulator homologue (ORF8), and a gene (ORF10) of unknown function that is highly expressed by R. equi inside macrophages, as well as the chromosomal gene operon, phoPR. Virulence testing by liver clearance after intravenous injection in mice showed that the ORF4 and ORF8 mutants were fully attenuated, that the phoPR mutant was hypervirulent, and that virulence of the ORF10 mutant remained unchanged. A virulence plasmid DNA microarray was used to compare the plasmid gene expression profile of each of the four gene-targeted mutants against the parental R. equi strain. Changes were limited to PI genes and gene induction was observed for all mutants, suggesting that expression of virulence plasmid genes is dominated by a negative regulatory network. The finding of attenuation of ORF4 and ORF8 mutants despite enhanced transcription of vapA suggests that factors other than VapA are important for full expression of virulence. ORF1, a putative Lsr antigen gene, was strongly and similarly induced in all mutants, implying a common regulatory pathway affecting this gene for all four mutated genes. ORF8 is apparently the centre of this common pathway. Two distinct highly correlated gene induction patterns were observed, that of the ORF4 and ORF8 mutants, and that of the ORF10 and phoPR mutants. The gene induction pattern distinguishing these two groups paralleled their virulence in mice.

Maize Opaque Endosperm Mutations Create Extensive Changes in Patterns of Gene ExpressionW⃞

PubMed Central

Hunter, Brenda G.; Beatty, Mary K.; Singletary, George W.; Hamaker, Bruce R.; Dilkes, Brian P.; Larkins, Brian A.; Jung, Rudolf

2002-01-01

Maize starchy endosperm mutants have kernel phenotypes that include a brittle texture, susceptibility to insect pests, and inferior functional characteristics of products made from their flour. At least 18 such mutants have been identified, but only in the cases of opaque2 (o2) and floury2 (fl2), which affect different aspects of storage protein synthesis, is the molecular basis of the mutation known. To better understand the relationship between the phenotypes of these mutants and their biochemical bases, we characterized the protein and amino acid composition, as well as the mRNA transcript profiles, of nearly isogenic inbred lines of W64A o1, o2, o5, o9, o11, Mucuronate (Mc), Defective endosperm B30 (DeB30), and fl2. The largest reductions in zein protein synthesis occur in the W64A o2, DeB30, and fl2 mutants, which have ∼35 to 55% of the wild-type level of storage proteins. Zeins in W64A o5, o9, o11, and Mc are within 80 to 90% of the amount found in the wild type. Only in the cases of o5 and Mc were significant qualitative changes in zein synthesis observed. The pattern of gene expression in normal and mutant genotypes was assayed by profiling endosperm mRNA transcripts at 18 days after pollination with an Affymetrix GeneChip containing >1400 selected maize gene sequences. Compared with W64A sugary1, a mutant defective in starch synthesis, alterations in the gene expression patterns of the opaque mutants are very pleiotropic. Increased expression of genes associated with physiological stress, and the unfolded protein response, are common features of the opaque mutants. Based on global patterns of gene expression, these mutants were categorized in four phenotypic groups as follows: W64A+ and o1; o2; o5/o9/o11; and Mc and fl2. PMID:12368507

The flagella of F18ab Escherichia coli is a virulence factor that contributes to infection in a IPEC-J2 cell model in vitro.

PubMed

Duan, Qiangde; Zhou, Mingxu; Zhu, Xiaofang; Bao, Wenbin; Wu, Shenglong; Ruan, Xiaosai; Zhang, Weiping; Yang, Yang; Zhu, Jun; Zhu, Guoqiang

2012-11-09

Bacterial flagella contribute to pathogen virulence; however, the role of flagella in the pathogenesis of F18ab E. coli-mediated swine edema disease (ED) is not currently known. We therefore evaluated the role of flagella in F18ab E. coli adhesion, invasion, biofilm formation, and IL-8 production using an in vitro cell infection model approach with gene-deletion mutant and complemented bacterial strains. We demonstrated that the flagellin-deficient fliC mutant had a marked decrease in the ability to adhere to and invade porcine epithelial IPEC-J2 cells. Surprisingly, there was no difference in adhesion between the F18 fimbriae-deficient ΔfedA mutant and its parent strain. In addition, both the ΔfedA and double ΔfliCΔfedA mutants exhibited an increased ability to invade IPEC-J2 cells compared to the wild-type strain, although this may be due to increased expression of other adhesins following the loss of F18ab fimbriae and flagella. Compared to the wild-type strain, the ΔfliC mutant showed significantly reduced ability to form biofilm, whereas the ΔfedA mutant increased biofilm formation. Although ΔfliC, ΔfedA, and ΔfliCΔfedA mutants had a reduced ability to stimulate IL-8 production from infected Caco-2 cells, the ΔfliC mutant impaired this ability to a greater extent than the ΔfedA mutant. The results from this study clearly demonstrate that flagella are required for efficient F18ab E. coli adhesion, invasion, biofilm formation, and IL-8 production in vitro. Copyright © 2012 Elsevier B.V. All rights reserved.

Rescue of protein expression defects may not be enough to abolish the pro-arrhythmic phenotype of long QT type 2 mutations.

PubMed

Perry, Matthew D; Ng, Chai Ann; Phan, Kevin; David, Erikka; Steer, Kieran; Hunter, Mark J; Mann, Stefan A; Imtiaz, Mohammad; Hill, Adam P; Ke, Ying; Vandenberg, Jamie I

2016-07-15

Most missense long QT syndrome type 2 (LQTS2) mutations result in Kv11.1 channels that show reduced levels of membrane expression. Pharmacological chaperones that rescue mutant channel expression could have therapeutic potential to reduce the risk of LQTS2-associated arrhythmias and sudden cardiac death, but only if the mutant Kv11.1 channels function normally (i.e. like WT channels) after membrane expression is restored. Fewer than half of mutant channels exhibit relatively normal function after rescue by low temperature. The remaining rescued missense mutant Kv11.1 channels have perturbed gating and/or ion selectivity characteristics. Co-expression of WT subunits with gating defective missense mutations ameliorates but does not eliminate the functional abnormalities observed for most mutant channels. For patients with mutations that affect gating in addition to expression, it may be necessary to use a combination therapy to restore both normal function and normal expression of the channel protein. In the heart, Kv11.1 channels pass the rapid delayed rectifier current (IKr ) which plays critical roles in repolarization of the cardiac action potential and in the suppression of arrhythmias caused by premature stimuli. Over 500 inherited mutations in Kv11.1 are known to cause long QT syndrome type 2 (LQTS2), a cardiac electrical disorder associated with an increased risk of life threatening arrhythmias. Most missense mutations in Kv11.1 reduce the amount of channel protein expressed at the membrane and, as a consequence, there has been considerable interest in developing pharmacological agents to rescue the expression of these channels. However, pharmacological chaperones will only have clinical utility if the mutant Kv11.1 channels function normally after membrane expression is restored. The aim of this study was to characterize the gating phenotype for a subset of LQTS2 mutations to assess what proportion of mutations may be suitable for rescue. As an initial screen we used reduced temperature to rescue expression defects of mutant channels expressed in Xenopus laevis oocytes. Over half (∼56%) of Kv11.1 mutants exhibited functional gating defects that either dramatically reduced the amount of current contributing to cardiac action potential repolarization and/or reduced the amount of protective current elicited in response to premature depolarizations. Our data demonstrate that if pharmacological rescue of protein expression defects is going to have clinical utility in the treatment of LQTS2 then it will be important to assess the gating phenotype of LQTS2 mutations before attempting rescue. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.

VH gene expression and regulation in the mutant Alicia rabbit. Rescue of VHa2 allotype expression.

PubMed

Chen, H T; Alexander, C B; Young-Cooper, G O; Mage, R G

1993-04-01

Rabbits of the Alicia strain, derived from rabbits expressing the VHa2 allotype, have a mutation in the H chain locus that has a cis effect upon the expression of VHa2 and VHa- genes. A small deletion at the most J-proximal (3') end of the VH locus leads to low expression of all the genes on the entire chromosome in heterozygous ali mutants and altered relative expression of VH genes in homozygotes. To study VH gene expression and regulation, we used the polymerase chain reaction to amplify the VH genes expressed in spleens of young and adult wild-type and mutant Alicia rabbits. The cDNA from reverse transcription of splenic mRNA was amplified and polymerase chain reaction libraries were constructed and screened with oligonucleotides from framework regions 1 and 3, as well as JH. Thirty-three VH-positive clones were sequenced and analyzed. We found that in mutant Alicia rabbits, products of the first functional VH gene (VH4a2), (or VH4a2-like genes) were expressed in 2- to 8-wk-olds. Expression of both the VHx and VHy types of VHa- genes was also elevated but the relative proportions of VHx and VHy, especially VHx, decreased whereas the relative levels of expression of VH4a2 or VH4a2-like genes increased with age. Our results suggest that the appearance of sequences resembling that of the VH1a2, which is deleted in the mutant ali rabbits, could be caused by alterations of the sequences of the rearranged VH4a2 genes by gene conversions and/or rearrangement of upstream VH1a2-like genes later in development.

Lon Protease of Azorhizobium caulinodans ORS571 Is Required for Suppression of reb Gene Expression

PubMed Central

Nakajima, Azusa; Tsukada, Shuhei; Siarot, Lowela; Ogawa, Tetsuhiro; Oyaizu, Hiroshi

2012-01-01

Bacterial Lon proteases play important roles in a variety of biological processes in addition to housekeeping functions. In this study, we focused on the Lon protease of Azorhizobium caulinodans, which can fix nitrogen both during free-living growth and in stem nodules of the legume Sesbania rostrata. The nitrogen fixation activity of an A. caulinodans lon mutant in the free-living state was not significantly different from that of the wild-type strain. However, the stem nodules formed by the lon mutant showed little or no nitrogen fixation activity. By microscopic analyses, two kinds of host cells were observed in the stem nodules formed by the lon mutant. One type has shrunken host cells containing a high density of bacteria, and the other type has oval or elongated host cells containing a low density or no bacteria. This phenotype is similar to a praR mutant highly expressing the reb genes. Quantitative reverse transcription-PCR analyses revealed that reb genes were also highly expressed in the lon mutant. Furthermore, a lon reb double mutant formed stem nodules showing higher nitrogen fixation activity than the lon mutant, and shrunken host cells were not observed in these stem nodules. These results suggest that Lon protease is required to suppress the expression of the reb genes and that high expression of reb genes in part causes aberrance in the A. caulinodans-S. rostrata symbiosis. In addition to the suppression of reb genes, it was found that Lon protease was involved in the regulation of exopolysaccharide production and autoagglutination of bacterial cells. PMID:22752172

The Fate of Spermatogonial Stem Cells in the Cryptorchid Testes of RXFP2 Deficient Mice

PubMed Central

Ferguson, Lydia; How, Javier J.; Agoulnik, Alexander I.

2013-01-01

The environmental niche of the spermatogonial stem cell pool is critical to ensure the continued generation of the germ cell population. To study the consequences of an aberrant testicular environment in cryptorchidism we used a mouse model with a deletion of Rxfp2 gene resulting in a high intra-abdominal testicular position. Mutant males were infertile with the gross morphology of the cryptorchid testis progressively deteriorating with age. Few spermatogonia were identifiable in 12 month old cryptorchid testes. Gene expression analysis showed no difference between mutant and control testes at postnatal day 10. In three month old males a decrease in expression of spermatogonial stem cell (SSC) markers Id4, Nanos2, and Ret was shown. The direct counting of ID4+ cells supported a significant decrease of SSCs. In contrast, the expression of Plzf, a marker for undifferentiated and differentiating spermatogonia was not reduced, and the number of PLZF+ cells in the cryptorchid testis was higher in three month old testes, but equal to control in six month old mutants. The PLZF+ cells did not show a higher rate of apoptosis in cryptorchid testis. The expression of the Sertoli cell FGF2 gene required for SSC maintenance was significantly reduced in mutant testis. Based on these findings we propose that the deregulation of somatic and germ cell genes in the cryptorchid testis, directs the SSCs towards the differentiation pathway. This leads to a depletion of the SSC pool and an increase in the number of PLZF+ spermatogonial cells, which too, eventually decreases with the exhaustion of the stem cell pool. Such a dynamic suggests that an early correction of cryptorchidism is critical for the retention of the SSC pool. PMID:24098584

Alternative Sigma Factors SigF, SigE, and SigG Are Essential for Sporulation in Clostridium botulinum ATCC 3502

PubMed Central

Kirk, David G.; Zhang, Zhen; Korkeala, Hannu

2014-01-01

Clostridium botulinum produces heat-resistant endospores that may germinate and outgrow into neurotoxic cultures in foods. Sporulation is regulated by the transcription factor Spo0A and the alternative sigma factors SigF, SigE, SigG, and SigK in most spore formers studied to date. We constructed mutants of sigF, sigE, and sigG in C. botulinum ATCC 3502 and used quantitative reverse transcriptase PCR and electron microscopy to assess their expression of the sporulation pathway on transcriptional and morphological levels. In all three mutants the expression of spo0A was disrupted. The sigF and sigE mutants failed to induce sigG and sigK beyond exponential-phase levels and halted sporulation during asymmetric cell division. In the sigG mutant, peak transcription of sigE was delayed and sigK levels remained lower than that in the parent strain. The sigG mutant forespore was engulfed by the mother cell and possessed a spore coat but no peptidoglycan cortex. The findings suggest that SigF and SigE of C. botulinum ATCC 3502 are essential for early sporulation and late-stage induction of sigK, whereas SigG is essential for spore cortex formation but not for coat formation, as opposed to previous observations in B. subtilis sigG mutants. Our findings add to a growing body of evidence that regulation of sporulation in C. botulinum ATCC 3502, and among the clostridia, differs from the B. subtilis model. PMID:24928875

Identification and Phenotypic Characterization of ZEBRA LEAF16 Encoding a β-Hydroxyacyl-ACP Dehydratase in Rice

PubMed Central

Liu, Ziwen; Wang, Zhiyuan; Gu, Han; You, Jia; Hu, Manman; Zhang, Yujun; Zhu, Ze; Wang, Yihua; Liu, Shijia; Chen, Liangming; Liu, Xi; Tian, Yunlu; Zhou, Shirong; Jiang, Ling; Liu, Linglong; Wan, Jianmin

2018-01-01

The chloroplast is a self-independent organelle and contains its own transcription and translation systems. The establishment of genetic systems is vital for normal plant growth and development. We isolated a rice zebra leaf 16 (zl16) mutant derived from rice cultivar 9311. The zl16 mutant showed chlorotic abnormalities in the transverse sectors of the young leaves of seedlings. The use of transmission electron microscopy (TEM) demonstrated that dramatic defects occurred in variegated zl16 leaves during the early development of a chloroplast. Map-based cloning revealed that ZL16 encodes a β-hydroxyacyl-ACP dehydratase (HAD) involved in de novo fatty acid synthesis. Compared with the wild type, a missense mutation (Arg164Trp) in the zl16 mutant was identified, which significantly reduced enzymatic activity and altered the three-dimensional modeling structure of the putative protein. ZL16 was ubiquitously expressed in various plant organs, with a pronounced level in the young leaf. A subcellular localization experiment indicated that ZL16 was targeted in the chloroplast. Furthermore, we analyzed the expression of some nuclear genes involved in chloroplast development, and found they were altered in the zl16 mutant. RNA-Seq analysis indicated that some genes related to cell membrane constituents were downregulated in the mutant. An in vivo metabolic assay revealed that the total fatty acid content in the mutant was significantly decreased relative to the wild type. Our results indicate that HAD is essential for the development of chloroplasts by regulating the synthesis of fatty acids in rice. PMID:29946330

Lack of AcrB Efflux Function Confers Loss of Virulence on Salmonella enterica Serovar Typhimurium

PubMed Central

Wang-Kan, Xuan; Chirullo, Barbara; Betts, Jonathan; La Ragione, Roberto M.; Ivens, Alasdair; Ricci, Vito; Opperman, Timothy J.

2017-01-01

ABSTRACT AcrAB-TolC is the paradigm resistance-nodulation-division (RND) multidrug resistance efflux system in Gram-negative bacteria, with AcrB being the pump protein in this complex. We constructed a nonfunctional AcrB mutant by replacing D408, a highly conserved residue essential for proton translocation. Western blotting confirmed that the AcrB D408A mutant had the same native level of expression of AcrB as the parental strain. The mutant had no growth deficiencies in rich or minimal medium. However, compared with wild-type SL1344, the mutant had increased accumulation of Hoechst 33342 dye and decreased efflux of ethidium bromide and was multidrug hypersusceptible. The D408A mutant was attenuated in vivo in mouse and Galleria mellonella models and showed significantly reduced invasion into intestinal epithelial cells and macrophages in vitro. A dose-dependent inhibition of invasion was also observed when two different efflux pump inhibitors were added to the wild-type strain during infection of epithelial cells. RNA sequencing (RNA-seq) revealed downregulation of bacterial factors necessary for infection, including those in the Salmonella pathogenicity islands 1, 2, and 4; quorum sensing genes; and phoPQ. Several general stress response genes were upregulated, probably due to retention of noxious molecules inside the bacterium. Unlike loss of AcrB protein, loss of efflux function did not induce overexpression of other RND efflux pumps. Our data suggest that gene deletion mutants are unsuitable for studying membrane transporters and, importantly, that inhibitors of AcrB efflux function will not induce expression of other RND pumps. PMID:28720734

Protein expression profiling of the drosophila fragile X mutant brain reveals up-regulation of monoamine synthesis.

PubMed

Zhang, Yong Q; Friedman, David B; Wang, Zhe; Woodruff, Elvin; Pan, Luyuan; O'donnell, Janis; Broadie, Kendal

2005-03-01

Fragile X syndrome is the most common form of inherited mental retardation, associated with both cognitive and behavioral anomalies. The disease is caused by silencing of the fragile X mental retardation 1 (fmr1) gene, which encodes the mRNA-binding, translational regulator FMRP. Previously we established a disease model through mutation of Drosophila fmr1 (dfmr1) and showed that loss of dFMRP causes defects in neuronal structure, function, and behavioral output similar to the human disease state. To uncover molecular targets of dFMRP in the brain, we use here a proteomic approach involving two-dimensional difference gel electrophoresis analyses followed by mass spectrometry identification of proteins with significantly altered expression in dfmr1 null mutants. We then focus on two misregulated enzymes, phenylalanine hydroxylase (Henna) and GTP cyclohydrolase (Punch), both of which mediate in concert the synthetic pathways of two key monoamine neuromodulators, dopamine and serotonin. Brain enzymatic assays show a nearly 2-fold elevation of Punch activity in dfmr1 null mutants. Consistently brain neurochemical assays show that both dopamine and serotonin are significantly increased in dfmr1 null mutants. At a cellular level, dfmr1 null mutant neurons display a highly significant elevation of the dense core vesicles that package these monoamine neuromodulators for secretion. Taken together, these data indicate that dFMRP normally down-regulates the monoamine pathway, which is consequently up-regulated in the mutant condition. Elevated brain levels of dopamine and serotonin provide a plausible mechanistic explanation for aspects of cognitive and behavioral deficits in human patients.

Defective phagosome motility and degradation in cell nonautonomous RPE pathogenesis of a dominant macular degeneration.

PubMed

Esteve-Rudd, Julian; Hazim, Roni A; Diemer, Tanja; Paniagua, Antonio E; Volland, Stefanie; Umapathy, Ankita; Williams, David S

2018-05-22

Stargardt macular dystrophy 3 (STGD3) is caused by dominant mutations in the ELOVL4 gene. Like other macular degenerations, pathogenesis within the retinal pigment epithelium (RPE) appears to contribute to the loss of photoreceptors from the central retina. However, the RPE does not express ELOVL4 , suggesting photoreceptor cell loss in STGD3 occurs through two cell nonautonomous events: mutant photoreceptors first affect RPE cell pathogenesis, and then, second, RPE dysfunction leads to photoreceptor cell death. Here, we have investigated how the RPE pathology occurs, using a STGD3 mouse model in which mutant human ELOVL4 is expressed in the photoreceptors. We found that the mutant protein was aberrantly localized to the photoreceptor outer segment (POS), and that resulting POS phagosomes were degraded more slowly in the RPE. In cell culture, the mutant POSs are ingested by primary RPE cells normally, but the phagosomes are processed inefficiently, even by wild-type RPE. The mutant phagosomes excessively sequester RAB7A and dynein, and have impaired motility. We propose that the abnormal presence of ELOVL4 protein in POSs results in phagosomes that are defective in recruiting appropriate motor protein linkers, thus contributing to slower degradation because their altered motility results in slower basal migration and fewer productive encounters with endolysosomes. In the transgenic mouse retinas, the RPE accumulated abnormal-looking phagosomes and oxidative stress adducts; these pathological changes were followed by pathology in the neural retina. Our results indicate inefficient phagosome degradation as a key component of the first cell nonautonomous event underlying retinal degeneration due to mutant ELOVL4.

Pseudo-constitutivity of nitrate-responsive genes in nitrate reductase mutants

PubMed Central

Schinko, Thorsten; Gallmetzer, Andreas; Amillis, Sotiris; Strauss, Joseph

2013-01-01

In fungi, transcriptional activation of genes involved in NO3- assimilation requires the presence of an inducer (nitrate or nitrite) and low intracellular concentrations of the pathway products ammonium or glutamine. In Aspergillus nidulans, the two transcription factors NirA and AreA act synergistically to mediate nitrate/nitrite induction and nitrogen metabolite derepression, respectively. In all studied fungi and in plants, mutants lacking nitrate reductase (NR) activity express nitrate-metabolizing enzymes constitutively without the addition of inducer molecules. Based on their work in A. nidulans, Cove and Pateman proposed an “autoregulation control” model for the synthesis of nitrate metabolizing enzymes in which the functional nitrate reductase molecule would act as co-repressor in the absence and as co-inducer in the presence of nitrate. However, NR mutants could simply show “pseudo-constitutivity” due to induction by nitrate which accumulates over time in NR-deficient strains. Here we examined this possibility using strains which lack flavohemoglobins (fhbs), and are thus unable to generate nitrate internally, in combination with nitrate transporter mutations (nrtA, nrtB) and a GFP-labeled NirA protein. Using different combinations of genotypes we demonstrate that nitrate transporters are functional also in NR null mutants and show that the constitutive phenotype of NR mutants is not due to nitrate accumulation from intracellular sources but depends on the activity of nitrate transporters. However, these transporters are not required for nitrate signaling because addition of external nitrate (10 mM) leads to standard induction of nitrate assimilatory genes in the nitrate transporter double mutants. We finally show that NR does not regulate NirA localization and activity, and thus the autoregulation model, in which NR would act as a co-repressor of NirA in the absence of nitrate, is unlikely to be correct. Results from this study instead suggest that transporter-mediated NO3- accumulation in NR deficient mutants, originating from traces of nitrate in the media, is responsible for the constitutive expression of NirA-regulated genes, and the associated phenotype is thus termed “pseudo-constitutive”. PMID:23454548

[Correlation of chromosome 1p and 19q status and expression of R132H mutant IDH1 protein in oligodendroglial tumors].

PubMed

Yao, Kun; Duan, Zejun; Hu, Zeliang; Bian, Yu; Qi, Xueling

2014-10-01

To correlate the presence of chromosome 1p/19q deletion with the expression of R132H mutant IDH1 status in oligodendroglial tumors, and to explore molecular markers for predicting chemosensitivity of oligodendroglial tumors. The study included 75 oligodendroglial tumors (38 oligodendrogliomas and 37 oligoastrocytomas). Immunohistochemistry was used to detect the expression of R132H mutant IDH1 protein, and fluorescence in situ hybridization (FISH) was employed to detect 1p/19q deletion. Deletion of chromosome 1p and/or 19q was detected in 37 cases (37/75, 49.3%), among which co-deletion of 1p and 19q was seen in 34 cases (closely correlated, P < 0.01). Oligodendrogliomas WHOIIhad a slightly higher deletion rate than oligodendrogliomas WHO III, although without statistical significance. Oligodendrogliomas WHO IIand WHO III had a significantly higher deletion rate of chromosome 1p/19q than oligoastrocytomas WHO II and WHO III (P < 0.05). While combined loss of 1p/19q was always detected in oligodendrogliomas when FISH was positive, isolated 1p or 19q deletion was only found in oligoastrocytomas. The expression of R132H mutant IDH1 was detected in 51 of 75 cases (68.0%), in which oligodendrogliomas had a higher positive rate than oligoastrocytomas. Statistical analysis demonstrated a significant correlation between the expression of R132H mutant IDH1 protein and the presence of combined 1p/19q deletion in oligodendrogliomas (P < 0.05). A significant correlation was observed between the expression of R132H mutant protein and 1p/19q LOH.Expression of 132H mutant IDH1 protein is the potential biomarker for predicating the presence of 1p/19q deletion in oligodendrogliomas.

Muscarinic cholinergic receptor (M2) plays a crucial role in the development of myopia in mice

PubMed Central

Barathi, Veluchamy A.; Kwan, Jia Lin; Tan, Queenie S. W.; Weon, Sung Rhan; Seet, Li Fong; Goh, Liang Kee; Vithana, Eranga N.; Beuerman, Roger W.

2013-01-01

SUMMARY Myopia is a huge public health problem worldwide, reaching the highest incidence in Asia. Identification of susceptible genes is crucial for understanding the biological basis of myopia. In this paper, we have identified and characterized a functional myopia-associated gene using a specific mouse-knockout model. Mice lacking the muscarinic cholinergic receptor gene (M2; also known as Chrm2) were less susceptible to lens-induced myopia compared with wild-type mice, which showed significantly increased axial length and vitreous chamber depth when undergoing experimental induction of myopia. The key findings of this present study are that the sclera of M2 mutant mice has higher expression of collagen type I and lower expression of collagen type V than do wild-type mice and mice that are mutant for other muscarinic subtypes, and, therefore, M2 mutant mice were resistant to the development of experimental myopia. Pharmacological blockade of M2 muscarinic receptor proteins retarded myopia progression in the mouse. These results suggest for the first time a role of M2 in growth-related changes in extracellular matrix genes during myopia development in a mammalian model. M2 receptor antagonists might thus provide a targeted therapeutic approach to the management of this refractive error. PMID:23649821

Medicago truncatula natural resistance-associated macrophage Protein1 is required for iron uptake by rhizobia-infected nodule cells.

PubMed

Tejada-Jiménez, Manuel; Castro-Rodríguez, Rosario; Kryvoruchko, Igor; Lucas, M Mercedes; Udvardi, Michael; Imperial, Juan; González-Guerrero, Manuel

2015-05-01

Iron is critical for symbiotic nitrogen fixation (SNF) as a key component of multiple ferroproteins involved in this biological process. In the model legume Medicago truncatula, iron is delivered by the vasculature to the infection/maturation zone (zone II) of the nodule, where it is released to the apoplast. From there, plasma membrane iron transporters move it into rhizobia-containing cells, where iron is used as the cofactor of multiple plant and rhizobial proteins (e.g. plant leghemoglobin and bacterial nitrogenase). MtNramp1 (Medtr3g088460) is the M. truncatula Natural Resistance-Associated Macrophage Protein family member, with the highest expression levels in roots and nodules. Immunolocalization studies indicate that MtNramp1 is mainly targeted to the plasma membrane. A loss-of-function nramp1 mutant exhibited reduced growth compared with the wild type under symbiotic conditions, but not when fertilized with mineral nitrogen. Nitrogenase activity was low in the mutant, whereas exogenous iron and expression of wild-type MtNramp1 in mutant nodules increased nitrogen fixation to normal levels. These data are consistent with a model in which MtNramp1 is the main transporter responsible for apoplastic iron uptake by rhizobia-infected cells in zone II. © 2015 American Society of Plant Biologists. All Rights Reserved.

The Arabidopsis mutant cev1 links cell wall signaling to jasmonate and ethylene responses.

PubMed

Ellis, Christine; Karafyllidis, Ioannis; Wasternack, Claus; Turner, John G

2002-07-01

Biotic and abiotic stresses stimulate the synthesis of jasmonates and ethylene, which, in turn, induce the expression of genes involved in stress response and enhance defense responses. The cev1 mutant has constitutive expression of stress response genes and has enhanced resistance to fungal pathogens. Here, we show that cev1 plants have increased production of jasmonate and ethylene and that its phenotype is suppressed by mutations that interrupt jasmonate and ethylene signaling. Genetic mapping, complementation analysis, and sequence analysis revealed that CEV1 is the cellulose synthase CeSA3. CEV1 was expressed predominantly in root tissues, and cev1 roots contained less cellulose than wild-type roots. Significantly, the cev1 mutant phenotype could be reproduced by treating wild-type plants with cellulose biosynthesis inhibitors, and the cellulose synthase mutant rsw1 also had constitutive expression of VSP. We propose that the cell wall can signal stress responses in plants.

Loss of DDB1 Leads to Transcriptional p53 Pathway Activation in Proliferating Cells, Cell Cycle Deregulation, and Apoptosis in Zebrafish Embryos.

PubMed

Hu, Zhilian; Holzschuh, Jochen; Driever, Wolfgang

2015-01-01

DNA damage-binding protein 1 (DDB1) is a large subunit of the heterodimeric DDB complex that recognizes DNA lesions and initiates the nucleotide excision repair process. DDB1 is also a component of the CUL4 E3 ligase complex involved in a broad spectrum of cellular processes by targeted ubiquitination of key regulators. Functions of DDB1 in development have been addressed in several model organisms, however, are not fully understood so far. Here we report an ENU induced mutant ddb1 allele (ddb1m863) identified in zebrafish (Danio rerio), and analyze its effects on development. Zebrafish ddb1 is expressed broadly, both maternally and zygotically, with enhanced expression in proliferation zones. The (ddb1m863 mutant allele affects the splice acceptor site of exon 20, causing a splicing defect that results in truncation of the 1140 amino acid protein after residue 800, lacking part of the β-propeller domain BPC and the C-terminal helical domain CTD. ddb1m863 zygotic mutant embryos have a pleiotropic phenotype, including smaller and abnormally shaped brain, head skeleton, eyes, jaw, and branchial arches, as well as reduced dopaminergic neuron groups. However, early forming tissues develop normally in zygotic ddb1m863 mutant embryos, which may be due to maternal rescue. In ddb1m863 mutant embryos, pcna-expressing proliferating cell populations were reduced, concurrent with increased apoptosis. We also observed a concomitant strong up-regulation of transcripts of the tumor suppressor p53 (tp53) and the cell cycle inhibitor cdkn1a (p21a/bCIP1/WAF1) in proliferating tissues. In addition, transcription of cyclin genes ccna2 and ccnd1 was deregulated in ddb1m863 mutants. Reduction of p53 activity by anti-sense morpholinos alleviated the apoptotic phenotype in ddb1m863 mutants. These results imply that Ddb1 may be involved in maintaining proper cell cycle progression and viability of dividing cells during development through transcriptional mechanisms regulating genes involved in cell cycle control and cell survival.

Autophagy-linked FYVE protein (Alfy) promotes autophagic removal of misfolded proteins involved in amyotrophic lateral sclerosis (ALS).

PubMed

Han, Huihui; Wei, Wanyi; Duan, Weisong; Guo, Yansu; Li, Yi; Wang, Jie; Bi, Yue; Li, Chunyan

2015-03-01

Autophagy-linked FYVE (Alfy) is a protein implicated in the selective degradation of aggregated proteins. In our present study, we found that Alfy was recruited into the aggregated G93A-SOD1 in transgenic mice with amyotrophic lateral sclerosis (ALS). We demonstrated that Alfy overexpression could decrease the expression of mutant proteins via the autophagosome-lysosome pathway, and thereby, the toxicity of mutant proteins was reduced. The clearance of the mutant proteins in NSC34 cells was significantly inhibited in an Alfy knockdown cellular model. We therefore deduced that Alfy translocalization likely is involved in the pathogenesis of ALS. Alfy may be developed into a useful target for ALS therapy.

Csf3r mutations in mice confer a strong clonal HSC advantage via activation of Stat5

PubMed Central

Liu, Fulu; Kunter, Ghada; Krem, Maxwell M.; Eades, William C.; Cain, Jennifer A.; Tomasson, Michael H.; Hennighausen, Lothar; Link, Daniel C.

2008-01-01

A fundamental property of leukemic stem cells is clonal dominance of the bone marrow microenvironment. Truncation mutations of CSF3R, which encodes the G-CSF receptor (G-CSFR), are implicated in leukemic progression in patients with severe congenital neutropenia. Here we show that expression of a truncated mutant Csf3r in mice confers a strong clonal advantage at the HSC level that is dependent upon exogenous G-CSF. G-CSF–induced proliferation, phosphorylation of Stat5, and transcription of Stat5 target genes were increased in HSCs isolated from mice expressing the mutant Csf3r. Conversely, the proliferative advantage conferred by the mutant Csf3r was abrogated in myeloid progenitors lacking both Stat5A and Stat5B, and HSC function was reduced in mice expressing a truncated mutant Csf3r engineered to have impaired Stat5 activation. These data indicate that in mice, inappropriate Stat5 activation plays a key role in establishing clonal dominance by stem cells expressing mutant Csf3r. PMID:18292815

A novel Phex mutation in a new mouse model of hypophosphatemic rickets.

PubMed

Owen, Celeste; Chen, Frieda; Flenniken, Ann M; Osborne, Lucy R; Ichikawa, Shoji; Adamson, S Lee; Rossant, Janet; Aubin, Jane E

2012-07-01

X-linked hypophosphatemic rickets (XLH) is a dominantly inherited disease characterized by renal phosphate wasting, aberrant vitamin D metabolism, and defective bone mineralization. It is known that XLH in humans and in certain mouse models is caused by inactivating mutations in PHEX/Phex (phosphate-regulating gene with homologies to endopeptidases on the X chromosome). By a genome-wide N-ethyl-N-nitrosourea (ENU)-induced mutagenesis screen in mice, we identified a dominant mouse mutation that exhibits the classic clinical manifestations of XLH, including growth retardation, skeletal abnormalities (rickets/osteomalacia), hypophosphatemia, and increased serum alkaline phosphatase (ALP) levels. Mapping and sequencing revealed that these mice carry a point mutation in exon 14 of the Phex gene that introduces a stop codon at amino acid 496 of the coding sequence (Phex(Jrt) also published as Phex(K496X) [Ichikawa et al., 2012]). Fgf23 mRNA expression as well as that of osteocalcin, bone sialoprotein, and matrix extracellular phosphoglycoprotein was upregulated in male mutant long bone, but that of sclerostin was unaffected. Although Phex mRNA is expressed in bone from mutant hemizygous male mice (Phex(Jrt)/Y mice), no Phex protein was detected in immunoblots of femoral bone protein. Stromal cultures from mutant bone marrow were indistinguishable from those of wild-type mice with respect to differentiation and mineralization. The ability of Phex(Jrt)/Y osteoblasts to mineralize and the altered expression levels of matrix proteins compared with the well-studied Hyp mice makes it a unique model with which to further explore the clinical manifestations of XLH and its link to FGF23 as well as to evaluate potential new therapeutic strategies. Copyright © 2012 Wiley Periodicals, Inc.

Expression of a dominant allele of human ARF1 inhibits membrane traffic in vivo

PubMed Central

1994-01-01

ADP-ribosylation factor (ARF) proteins and inhibitory peptides derived from ARFs have demonstrated activities in a number of in vitro assays that measure ER-to-Golgi and intra-Golgi transport and endosome fusion. To better understand the roles of ARF proteins in vivo, stable cell lines were obtained from normal rat kidney (NRK) cells transfected with either wild-type or a dominant activating allele ([Q71L]) of the human ARF1 gene under the control of the interferon-inducible mouse Mx1 promoter. Upon addition of interferon, expression of ARF1 proteins increased with a half-time of 7-8 h, as determined by immunoblot analysis. Induction of mutant ARF1, but not wild-type ARF1, led to an inhibition of protein secretion with kinetics similar to that observed for induction of protein expression. Examination of the Golgi apparatus and the ER by indirect immunofluorescence or transmission electron microscopy revealed that expression of low levels of mutant ARF1 protein correlated with a dramatic increase in vesiculation of the Golgi apparatus and expansion of the ER lumen, while expression of substantially higher levels of wild-type ARF1 had no discernible effect. Endocytosis was also inhibited by expression of mutant ARF1, but not by the wild-type protein. Finally, the expression of [Q71L]ARF1, but not wild-type ARF1, antagonized the actions of brefeldin A, as determined by the delayed loss of ARF and beta-COP from Golgi membranes and disruption of the Golgi apparatus. General models for the actions of ARF1 in membrane traffic events are discussed. PMID:8294513

Analysis of Distinct Roles of CaMKK Isoforms Using STO-609-Resistant Mutants in Living Cells.

PubMed

Fujiwara, Yuya; Hiraoka, Yuri; Fujimoto, Tomohito; Kanayama, Naoki; Magari, Masaki; Tokumitsu, Hiroshi

2015-06-30

To assess the isoform specificity of the Ca(2+)/calmodulin-dependent protein kinase kinase (CaMKK)-mediated signaling pathway using a CaMKK inhibitor (STO-609) in living cells, we have established A549 cell lines expressing STO-609-resistant mutants of CaMKK isoforms. Following serial mutagenesis studies, we have succeeded in obtaining an STO-609-resistant CaMKKα mutant (Ala292Thr/Leu233Phe) and a CaMKKβ mutant (Ala328Thr/Val269Phe), which showed sensitivity to STO-609 that was 2-3 orders of magnitude lower without an appreciable effect on kinase activity or CaM requirement. These results are consistent with the results obtained for CaMKK activities in the extracts of A549 cells stably expressing the mutants of CaMKK isoforms. Ionomycin-induced 5'-AMP-activated protein kinase (AMPK) phosphorylation at Thr172 in A549 cells expressing either the wild-type or the STO-609-resistant mutant of CaMKKα was completely suppressed by STO-609 treatment but resistant to the inhibitor in the presence of the CaMKKβ mutant (Ala328Thr/Val269Phe). This result strongly suggested that CaMKKβ is responsible for ionomycin-induced AMPK activation, which supported previous reports. In contrast, ionomycin-induced CaMKIV phosphorylation at Thr196 was resistant to STO-609 treatment in A549 cells expressing STO-609-resistant mutants of both CaMKK isoforms, indicating that both CaMKK isoforms are capable of phosphorylating and activating CaMKIV in living cells. Considering these results together, STO-609-resistant CaMKK mutants developed in this study may be useful for distinguishing CaMKK isoform-mediated signaling pathways in combination with the use of an inhibitor compound.

AmyR Is a Novel Negative Regulator of Amylovoran Production in Erwinia amylovora

PubMed Central

Wang, Dongping; Korban, Schuyler S.; Pusey, P. Lawrence; Zhao, Youfu

2012-01-01

In this study, we attempted to understand the role of an orphan gene amyR in Erwinia amylovora, a functionally conserved ortholog of ybjN in Escherichia coli, which has recently been characterized. Amylovoran, a high molecular weight acidic heteropolymer exopolysaccharide, is a virulent factor of E. amylovora. As reported earlier, amylovoran production in an amyR knockout mutant was about eight-fold higher than that in the wild type (WT) strain of E. amylovora. When a multicopy plasmid containing the amyR gene was introduced into the amyR mutant or WT strains, amylovoran production was strongly inhibited. Furthermore, amylovoran production was also suppressed in various amylovoran-over-producing mutants, such as grrSA containing multicopies of the amyR gene. Consistent with amylovoran production, an inverse correlation was observed between in vitro expression of amyR and that of amylovoran biosynthetic genes. However, both the amyR knockout mutant and over-expression strains showed reduced levan production, another exopolysaccharide produced by E. amylovora. Virulence assays demonstrated that while the amyR mutant was capable of inducing slightly greater disease severity than that of the WT strain, strains over-expressing the amyR gene did not incite disease on apple shoots or leaves, and only caused reduced disease on immature pear fruits. Microarray studies revealed that amylovoran biosynthesis and related membrane protein-encoding genes were highly expressed in the amyR mutant, but down-regulated in the amyR over-expression strains in vitro. Down-regulation of amylovoran biosynthesis genes in the amyR over-expression strain partially explained why over-expression of amyR led to non-pathogenic or reduced virulence in vivo. These results suggest that AmyR plays an important role in regulating exopolysaccharide production, and thus virulence in E. amylovora. PMID:23028751

AmyR is a novel negative regulator of amylovoran production in Erwinia amylovora.

PubMed

Wang, Dongping; Korban, Schuyler S; Pusey, P Lawrence; Zhao, Youfu

2012-01-01

In this study, we attempted to understand the role of an orphan gene amyR in Erwinia amylovora, a functionally conserved ortholog of ybjN in Escherichia coli, which has recently been characterized. Amylovoran, a high molecular weight acidic heteropolymer exopolysaccharide, is a virulent factor of E. amylovora. As reported earlier, amylovoran production in an amyR knockout mutant was about eight-fold higher than that in the wild type (WT) strain of E. amylovora. When a multicopy plasmid containing the amyR gene was introduced into the amyR mutant or WT strains, amylovoran production was strongly inhibited. Furthermore, amylovoran production was also suppressed in various amylovoran-over-producing mutants, such as grrSA containing multicopies of the amyR gene. Consistent with amylovoran production, an inverse correlation was observed between in vitro expression of amyR and that of amylovoran biosynthetic genes. However, both the amyR knockout mutant and over-expression strains showed reduced levan production, another exopolysaccharide produced by E. amylovora. Virulence assays demonstrated that while the amyR mutant was capable of inducing slightly greater disease severity than that of the WT strain, strains over-expressing the amyR gene did not incite disease on apple shoots or leaves, and only caused reduced disease on immature pear fruits. Microarray studies revealed that amylovoran biosynthesis and related membrane protein-encoding genes were highly expressed in the amyR mutant, but down-regulated in the amyR over-expression strains in vitro. Down-regulation of amylovoran biosynthesis genes in the amyR over-expression strain partially explained why over-expression of amyR led to non-pathogenic or reduced virulence in vivo. These results suggest that AmyR plays an important role in regulating exopolysaccharide production, and thus virulence in E. amylovora.

The role of dileucine in the expression and function of human organic anion transporter 1 (hOAT1)

PubMed Central

Zhang, Qiang; Wu, Jinwei; Pan, Zui; You, Guofeng

2011-01-01

Human organic anion transporter hOAT1 plays a critical role in the body disposition of environmental toxins and clinically important drugs including anti-HIV therapeutics, anti-tumor drugs, antibiotics, anti-hypertensives, and anti-inflammatories. In the current study, we investigated the role of dileucine (L6L7) at the amino terminus of hOAT1 in the expression and function of the transporter. We substituted L6L7 with alanine (A) simultaneously. The resulting mutant transporter L6A/L7A showed no transport activity due to its complete loss of expression at the cell surface. Such loss of surface expression of L6A/L7A was consistent with a complete loss of an 80 kDa mature form and a dramatic decrease in a 60 kDa immature form of the mutant transporter in the total cell lysates. Treatment of L6A/L7A-expressing cells with proteasomal inhibitor resulted in a significant increase in the immature form of hOAT1, but not its mature form, whereas treatment of these cells with lysosomal inhibitor had no effect on the expression of the mutant transporters, suggesting that the mutant transporter was degraded through proteasomal pathway. The accumulation of mutant transporter in the endoplasmic reticulum (ER) was confirmed by coimmunolocalization of L6L7 with calnexin, an ER marker. Furthermore, treatment of L6A/L7A-expressing cells with sodium 4-phenylbutyrate (4PBA) and glycerol, two chemical chaperones, could not promote the exit of the immature form of the mutant transporter from the ER. Our data suggest that L6L7 are critical for the stability and ER export of hOAT1. PMID:21494320

The Role of Dileucine in the Expression and Function of Human Organic Anion Transporter 1 (hOAT1).

PubMed

Zhang, Qiang; Wu, Jinwei; Pan, Zui; You, Guofeng

2011-01-01

Human organic anion transporter hOAT1 plays a critical role in the body disposition of environmental toxins and clinically important drugs including anti-HIV therapeutics, anti-tumor drugs, antibiotics, anti-hypertensives, and anti-inflammatories. In the current study, we investigated the role of dileucine (L6L7) at the amino terminus of hOAT1 in the expression and function of the transporter. We substituted L6L7 with alanine (A) simultaneously. The resulting mutant transporter L6A/L7A showed no transport activity due to its complete loss of expression at the cell surface. Such loss of surface expression of L6A/L7A was consistent with a complete loss of an 80 kDa mature form and a dramatic decrease in a 60 kDa immature form of the mutant transporter in the total cell lysates. Treatment of L6A/L7A-expressing cells with proteasomal inhibitor resulted in a significant increase in the immature form of hOAT1, but not its mature form, whereas treatment of these cells with lysosomal inhibitor had no effect on the expression of the mutant transporters, suggesting that the mutant transporter was degraded through proteasomal pathway. The accumulation of mutant transporter in the endoplasmic reticulum (ER) was confirmed by coimmunolocalization of L6L7 with calnexin, an ER marker. Furthermore, treatment of L6A/L7A-expressing cells with sodium 4-phenylbutyrate (4PBA) and glycerol, two chemical chaperones, could not promote the exit of the immature form of the mutant transporter from the ER. Our data suggest that L6L7 are critical for the stability and ER export of hOAT1.

Reduced Activity of AMP-Activated Protein Kinase Protects against Genetic Models of Motor Neuron Disease

PubMed Central

Lim, M. A.; Selak, M. A.; Xiang, Z.; Krainc, D.; Neve, R. L.; Kraemer, B. C.; Watts, J. L.

2012-01-01

A growing body of research indicates that amyotrophic lateral sclerosis (ALS) patients and mouse models of ALS exhibit metabolic dysfunction. A subpopulation of ALS patients possesses higher levels of resting energy expenditure and lower fat-free mass compared to healthy controls. Similarly, two mutant copper zinc superoxide dismutase 1 (mSOD1) mouse models of familial ALS possess a hypermetabolic phenotype. The pathophysiological relevance of the bioenergetic defects observed in ALS remains largely elusive. AMP-activated protein kinase (AMPK) is a key sensor of cellular energy status and thus might be activated in various models of ALS. Here, we report that AMPK activity is increased in spinal cord cultures expressing mSOD1, as well as in spinal cord lysates from mSOD1 mice. Reducing AMPK activity either pharmacologically or genetically prevents mSOD1-induced motor neuron death in vitro. To investigate the role of AMPK in vivo, we used Caenorhabditis elegans models of motor neuron disease. C. elegans engineered to express human mSOD1 (G85R) in neurons develops locomotor dysfunction and severe fecundity defects when compared to transgenic worms expressing human wild-type SOD1. Genetic reduction of aak-2, the ortholog of the AMPK α2 catalytic subunit in nematodes, improved locomotor behavior and fecundity in G85R animals. Similar observations were made with nematodes engineered to express mutant tat-activating regulatory (TAR) DNA-binding protein of 43 kDa molecular weight. Altogether, these data suggest that bioenergetic abnormalities are likely to be pathophysiologically relevant to motor neuron disease. PMID:22262909

Misfolded rhodopsin mutants display variable aggregation properties.

PubMed

Gragg, Megan; Park, Paul S-H

2018-06-08

The largest class of rhodopsin mutations causing autosomal dominant retinitis pigmentosa (adRP) is mutations that lead to misfolding and aggregation of the receptor. The misfolding mutants have been characterized biochemically, and categorized as either partial or complete misfolding mutants. This classification is incomplete and does not provide sufficient information to fully understand the disease pathogenesis and evaluate therapeutic strategies. A Förster resonance energy transfer (FRET) method was utilized to directly assess the aggregation properties of misfolding rhodopsin mutants within the cell. Partial (P23H and P267L) and complete (G188R, H211P, and P267R) misfolding mutants were characterized to reveal variability in aggregation properties. The complete misfolding mutants all behaved similarly, forming aggregates when expressed alone, minimally interacting with the wild-type receptor when coexpressed, and were unresponsive to treatment with the pharmacological chaperone 9-cis retinal. In contrast, variability was observed between the partial misfolding mutants. In the opsin form, the P23H mutant behaved similarly as the complete misfolding mutants. In contrast, the opsin form of the P267L mutant existed as both aggregates and oligomers when expressed alone and formed mostly oligomers with the wild-type receptor when coexpressed. The partial misfolding mutants both reacted similarly to the pharmacological chaperone 9-cis retinal, displaying improved folding and oligomerization when expressed alone but aggregating with wild-type receptor when coexpressed. The observed differences in aggregation properties and effect of 9-cis retinal predict different outcomes in disease pathophysiology and suggest that retinoid-based chaperones will be ineffective or even detrimental. Copyright © 2018 Elsevier B.V. All rights reserved.

Selective targeting of KRAS-Mutant cells by miR-126 through repression of multiple genes essential for the survival of KRAS-Mutant cells

PubMed Central

Hara, Toshifumi; Jones, Matthew F.; Subramanian, Murugan; Li, Xiao Ling; Ou, Oliver; Zhu, Yuelin; Yang, Yuan; Wakefield, Lalage M.; Hussain, S. Perwez; Gaedcke, Jochen; Ried, Thomas; Luo, Ji; Caplen, Natasha J.; Lal, Ashish

2014-01-01

MicroRNAs (miRNAs) regulate the expression of hundreds of genes. However, identifying the critical targets within a miRNA-regulated gene network is challenging. One approach is to identify miRNAs that exert a context-dependent effect, followed by expression profiling to determine how specific targets contribute to this selective effect. In this study, we performed miRNA mimic screens in isogenic KRAS-Wild-type (WT) and KRAS-Mutant colorectal cancer (CRC) cell lines to identify miRNAs selectively targeting KRAS-Mutant cells. One of the miRNAs we identified as a selective inhibitor of the survival of multiple KRAS-Mutant CRC lines was miR-126. In KRAS-Mutant cells, miR-126 over-expression increased the G1 compartment, inhibited clonogenicity and tumorigenicity, while exerting no effect on KRAS-WT cells. Unexpectedly, the miR-126-regulated transcriptome of KRAS-WT and KRAS-Mutant cells showed no significant differences. However, by analyzing the overlap between miR-126 targets with the synthetic lethal genes identified by RNAi in KRAS-Mutant cells, we identified and validated a subset of miR-126-regulated genes selectively required for the survival and clonogenicity of KRAS-Mutant cells. Our strategy therefore identified critical target genes within the miR-126-regulated gene network. We propose that the selective effect of miR-126 on KRAS-Mutant cells could be utilized for the development of targeted therapy for KRAS mutant tumors. PMID:25245095

Characterization and proteomic analysis of the Pseudomonas sp. HK-6 xenB knockout mutant under RDX (hexahydro-1,3,5-trinitro-1,3,5-triazine) stress.

PubMed

Lee, Bheong-Uk; Choi, Moon-Seop; Oh, Kye-Heon

2015-01-01

Pseudomonas sp. HK-6 is able to utilize RDX (hexahydro-1,3,5-trinitro-1,3,5-triazine) as its sole nitrogen source. The role of the xenB gene, encoding xenobiotic reductase B, was investigated using HK-6 xenB knockout mutants. The xenB mutant degraded RDX to a level that was 10-fold less than that obtained with the wild-type HK-6 strain. After 60 days of culture with 25 or 50 μM RDX, no residual RDX was detected in the supernatants of the wild-type aerobically grown cultures, whereas approximately 90 % of the RDX remained in the xenB mutant cultures. The xenB mutant bacteria exhibited a 10(2)-10(4)-fold decrease in survival rate compared to the wild-type. The expression of DnaK and GroEL proteins, two typical stress shock proteins (SSPs), in the xenB mutant increased after immediate exposure to RDX, yet dramatically decreased after 4 h of exposure. In addition, DnaK and GroEL were more highly expressed in the cultures with 25 μM RDX in the medium but showed low expression in the cultures with 50 or 75 μM RDX. The expression levels of the dnaK and groEL genes measured by RT-qPCR were also much lower in the xenB genetic background. Analyses of the proteomes of the HK-6 and xenB mutant cells grown under conditions of RDX stress showed increased induction of several proteins, such as Alg8, alginate biosynthesis sensor histidine kinase, and OprH in the xenB mutants when compared to wild-type. However, many proteins, including two SSPs (DnaK and GroEL) and proteins involved in metabolism, exhibited lower expression levels in the xenB mutant than in the wild-type HK-6 strain. The xenB knockout mutation leads to reduced RDX degradation ability, which renders the mutant more sensitive to RDX stress and results in a lower survival rate and an altered proteomic profile under RDX stress.

Cortical Spreading Depression Causes Unique Dysregulation of Inflammatory Pathways in a Transgenic Mouse Model of Migraine.

PubMed

Eising, Else; Shyti, Reinald; 't Hoen, Peter A C; Vijfhuizen, Lisanne S; Huisman, Sjoerd M H; Broos, Ludo A M; Mahfouz, Ahmed; Reinders, Marcel J T; Ferrari, Michel D; Tolner, Else A; de Vries, Boukje; van den Maagdenberg, Arn M J M

2017-05-01

Familial hemiplegic migraine type 1 (FHM1) is a rare monogenic subtype of migraine with aura caused by mutations in CACNA1A that encodes the α 1A subunit of voltage-gated Ca V 2.1 calcium channels. Transgenic knock-in mice that carry the human FHM1 R192Q missense mutation ('FHM1 R192Q mice') exhibit an increased susceptibility to cortical spreading depression (CSD), the mechanism underlying migraine aura. Here, we analysed gene expression profiles from isolated cortical tissue of FHM1 R192Q mice 24 h after experimentally induced CSD in order to identify molecular pathways affected by CSD. Gene expression profiles were generated using deep serial analysis of gene expression sequencing. Our data reveal a signature of inflammatory signalling upon CSD in the cortex of both mutant and wild-type mice. However, only in the brains of FHM1 R192Q mice specific genes are up-regulated in response to CSD that are implicated in interferon-related inflammatory signalling. Our findings show that CSD modulates inflammatory processes in both wild-type and mutant brains, but that an additional unique inflammatory signature becomes expressed after CSD in a relevant mouse model of migraine.

tortuga refines Notch pathway gene expression in the zebrafish presomitic mesoderm at the post-transcriptional level.

PubMed

Dill, Kariena K; Amacher, Sharon L

2005-11-15

We have identified the zebrafish tortuga (tor) gene by an ENU-induced mutation that disrupts the presomitic mesoderm (PSM) expression of Notch pathway genes. In tor mutants, Notch pathway gene expression persists in regions of the PSM where expression is normally off in wild type embryos. The expression of hairy/Enhancer of split-related 1 (her1) is affected first, followed by the delta genes deltaC and deltaD, and finally, by another hairy/Enhancer of split-related gene, her7. In situ hybridization with intron-specific probes for her1 and deltaC indicates that transcriptional bursts of expression are normal in tor mutants, suggesting that tor normally functions to refine her1 and deltaC message levels downstream of transcription. Despite the striking defects in Notch pathway gene expression, somite boundaries form normally in tor mutant embryos, although somitic mesoderm defects are apparent later, when cells mature to form muscle fibers. Thus, while the function of Notch pathway genes is required for proper somite formation, the tor mutant phenotype suggests that precise oscillations of Notch pathway transcripts are not essential for establishing segmental pattern in the presomitic mesoderm.

Myostatin propeptide gene delivery by gene gun ameliorates muscle atrophy in a rat model of botulinum toxin-induced nerve denervation.

PubMed

Tsai, Sen-Wei; Tung, Yu-Tang; Chen, Hsiao-Ling; Yang, Shang-Hsun; Liu, Chia-Yi; Lu, Michelle; Pai, Hui-Jing; Lin, Chi-Chen; Chen, Chuan-Mu

2016-02-01

Muscle atrophy is a common symptom after nerve denervation. Myostatin propeptide, a precursor of myostatin, has been documented to improve muscle growth. However, the mechanism underlying the muscle atrophy attenuation effects of myostatin propeptide in muscles and the changes in gene expression are not well established. We investigated the possible underlying mechanisms associated with myostatin propeptide gene delivery by gene gun in a rat denervation muscle atrophy model, and evaluated gene expression patterns. In a rat botulinum toxin-induced nerve denervation muscle atrophy model, we evaluated the effects of wild-type (MSPP) and mutant-type (MSPPD75A) of myostatin propeptide gene delivery, and observed changes in gene activation associated with the neuromuscular junction, muscle and nerve. Muscle mass and muscle fiber size was moderately increased in myostatin propeptide treated muscles (p<0.05). And enhancement of the gene expression of the muscle regulatory factors, neurite outgrowth factors (IGF-1, GAP43) and acetylcholine receptors was observed. Our results demonstrate that myostatin propeptide gene delivery, especially the mutant-type of MSPPD75A, attenuates muscle atrophy through myogenic regulatory factors and acetylcholine receptor regulation. Our data concluded that myostatin propeptide gene therapy may be a promising treatment for nerve denervation induced muscle atrophy. Copyright © 2016 Elsevier Inc. All rights reserved.

Dominant-negative action of disease-causing gonadotropin-releasing hormone receptor (GnRHR) mutants: a trait that potentially coevolved with decreased plasma membrane expression of GnRHR in humans.

PubMed

Leaños-Miranda, Alfredo; Ulloa-Aguirre, Alfredo; Ji, Tae H; Janovick, Jo Ann; Conn, P Michael

2003-07-01

Loss of function by 11 of 13 naturally occurring mutations in the human GnRH receptor (hGnRHR) was thought to result from impaired ligand binding or effector coupling, but actually results from receptor misrouting. Homo- or heterodimerization of mutant receptors with wild-type (WT) receptors occurs for other G protein-coupled receptors and may result in dominant-negative or -positive effects on the WT receptor. We tested the hypothesis that WT hGnRHR function was affected by misfolded hGnRHR mutants. hGnRHR mutants were found to inhibit the function of WT GnRHR (measured by activation of effector and ligand binding). Inhibition varied depending on the particular hGnRHR mutant coexpressed and the ratio of hGnRHR mutant to WT hGnRHR cDNA cotransfected. The hGnRHR mutants did not interfere with the function of genetically modified hGnRHRs bearing either a deletion of primate-specific Lys(191) or the carboxyl-terminal tail of the catfish GnRHR; these show intrinsically enhanced expression. Moreover, a peptidomimetic antagonist of GnRH enhanced the expression of WT hGnRHR, but not of genetically modified hGnRHR species. The dominant-negative effect of the naturally occurring receptor mutants occurred only for the WT hGnRHR, which has intrinsic low maturation efficiency. The data suggest that this dominant negative effect accompanies the diminished plasma membrane expression as a recent evolutionary event.

The evolutionarily conserved interaction between LC3 and p62 selectively mediates autophagy-dependent degradation of mutant huntingtin.

PubMed

Tung, Ying-Tsen; Hsu, Wen-Ming; Lee, Hsinyu; Huang, Wei-Pang; Liao, Yung-Feng

2010-07-01

Mammalian p62/sequestosome-1 protein binds to both LC3, the mammalian homologue of yeast Atg8, and polyubiquitinated cargo proteins destined to undergo autophagy-mediated degradation. We previously identified a cargo receptor-binding domain in Atg8 that is essential for its interaction with the cargo receptor Atg19 in selective autophagic processes in yeast. We, thus, sought to determine whether this interaction is evolutionally conserved from yeast to mammals. Using an amino acid replacement approach, we demonstrate that cells expressing mutant LC3 (LC3-K30D, LC3-K51A, or LC3-L53A) all exhibit defective lipidation of LC3, a disrupted LC3-p62 interaction, and impaired autophagic degradation of p62, suggesting that the p62-binding site of LC3 is localized within an evolutionarily conserved domain. Importantly, whereas cells expressing these LC3 mutants exhibited similar overall autophagic activity comparable to that of cells expressing wild-type LC3, autophagy-mediated clearance of the aggregation-prone mutant Huntingtin was defective in the mutant-expressing cells. Together, these results suggest that p62 directly binds to the evolutionarily conserved cargo receptor-binding domain of Atg8/LC3 and selectively mediates the clearance of mutant Huntingtin.

Comparative Study on Different Expression Hosts for Alkaline Phytase Engineered in Escherichia coli.

PubMed

Chen, Weiwei; Yu, Hongwei; Ye, Lidan

2016-07-01

The application of alkaline phytase as a feed additive is restricted by the poor specific activity. Escherichia coli is a frequently used host for directed evolution of proteins including alkaline phytase towards improved activity. However, it is not suitable for production of food-grade products due to potential pathogenicity. To combine the advantages of different expression systems, mutants of the alkaline phytase originated from Bacillus subtilis 168 (phy168) were first generated via directed evolution in E. coli and then transformed to food-grade hosts B. subtilis and Pichia pastoris for secretory expression. In order to investigate the suitability of different expression systems, the phy168 mutants expressed in different hosts were characterized and compared in terms of specific activity, pH profile, pH stability, temperature profile, and thermostability. The specific activity of B. subtilis-expressed D24G/K70R/K111E/N121S mutant at pH 7.0 and 60 °C was 30.4 U/mg, obviously higher than those in P. pastoris (22.7 U/mg) and E. coli (19.7 U/mg). Moreover, after 10 min incubation at 80 °C, the B. subtilis-expressed D24G/K70R/K111E/N121S retained about 70 % of the activity at pH 7.0 and 37 °C, whereas the values were only about 25 and 50 % when expressed in P. pastoris and E. coli, respectively. These results suggested B. subtilis as an appropriate host for expression of phy168 mutants and that the strategy of creating mutants in one host and expressing them in another might be a new solution to industrial production of proteins with desired properties.

Gli function is essential for motor neuron induction in zebrafish.

PubMed

Vanderlaan, Gary; Tyurina, Oksana V; Karlstrom, Rolf O; Chandrasekhar, Anand

2005-06-15

The Gli family of zinc-finger transcription factors mediates Hedgehog (Hh) signaling in all vertebrates. However, their roles in ventral neural tube patterning, in particular motor neuron induction, appear to have diverged across species. For instance, cranial motor neurons are essentially lost in zebrafish detour (gli1(-)) mutants, whereas motor neuron development is unaffected in mouse single gli and some double gli knockouts. Interestingly, the expression of some Hh-regulated genes (ptc1, net1a, gli1) is mostly unaffected in the detour mutant hindbrain, suggesting that other Gli transcriptional activators may be involved. To better define the roles of the zebrafish gli genes in motor neuron induction and in Hh-regulated gene expression, we examined these processes in you-too (yot) mutants, which encode dominant repressor forms of Gli2 (Gli2(DR)), and following morpholino-mediated knockdown of gli1, gli2, and gli3 function. Motor neuron induction at all axial levels was reduced in yot (gli2(DR)) mutant embryos. In addition, Hh target gene expression at all axial levels except in rhombomere 4 was also reduced, suggesting an interference with the function of other Glis. Indeed, morpholino-mediated knockdown of Gli2(DR) protein in yot mutants led to a suppression of the defective motor neuron phenotype. However, gli2 knockdown in wild-type embryos generated no discernable motor neuron phenotype, while gli3 knockdown reduced motor neuron induction in the hindbrain and spinal cord. Significantly, gli2 or gli3 knockdown in detour (gli1(-)) mutants revealed roles for Gli2 and Gli3 activator functions in ptc1 expression and spinal motor neuron induction. Similarly, gli1 or gli3 knockdown in yot (gli2(DR)) mutants resulted in severe or complete loss of motor neurons, and of ptc1 and net1a expression, in the hindbrain and spinal cord. In addition, gli1 expression was greatly reduced in yot mutants following gli3, but not gli1, knockdown, suggesting that Gli3 activator function is specifically required for gli1 expression. These observations demonstrate that Gli activator function (encoded by gli1, gli2, and gli3) is essential for motor neuron induction and Hh-regulated gene expression in zebrafish.

Structure and Expression of Hybrid Dysgenesis-Induced Alleles of the Ovarian Tumor (Otu) Gene in Drosophila Melanogaster

PubMed Central

Sass, G. L.; Mohler, J. D.; Walsh, R. C.; Kalfayan, L. J.; Searles, L. L.

1993-01-01

Mutations at the ovarian tumor (otu) gene of Drosophila melanogaster cause female sterility and generate a range of ovarian phenotypes. Quiescent (QUI) mutants exhibit reduced germ cell proliferation; in oncogenic (ONC) mutants germ cells undergo uncontrolled proliferation generating excessive numbers of undifferentiated cells; the egg chambers of differentiated (DIF) mutants differentiate to variable degrees but fail to complete oogenesis. We have examined mutations caused by insertion and deletion of P elements at the otu gene. The P element insertion sites are upstream of the major otu transcription start sites. In deletion derivatives, the P element, regulatory regions and/or protein coding sequences have been removed. In both insertion and deletion mutants, the level of otu expression correlates directly with the severity of the phenotype: the absence of otu function produces the most severe QUI phenotype while the ONC mutants express lower levels of otu than those which are DIF. The results of this study demonstrate that the diverse mutant phenotypes of otu are the consequence of different levels of otu function. PMID:8436274

Hoxb3 negatively regulates Hoxb1 expression in mouse hindbrain patterning.

PubMed

Wong, Elaine Y M; Wang, Xing An; Mak, Siu Shan; Sae-Pang, Jearn Jang; Ling, Kam Wing; Fritzsch, Bernd; Sham, Mai Har

2011-04-15

The spatial regulation of combinatorial expression of Hox genes is critical for determining hindbrain rhombomere (r) identities. To address the cross-regulatory relationship between Hox genes in hindbrain neuronal specification, we have generated a gain-of-function transgenic mouse mutant Hoxb3(Tg) using the Hoxb2 r4-specific enhancer element. Interestingly, in r4 of the Hoxb3(Tg) mutant where Hoxb3 was ectopically expressed, the expression of Hoxb1 was specifically abolished. The hindbrain neuronal defects of the Hoxb3(Tg) mutant mice were similar to those of Hoxb1(-/-) mutants. Therefore, we hypothesized that Hoxb3 could directly suppress Hoxb1 expression. We first identified a novel Hoxb3 binding site S3 on the Hoxb1 locus and confirmed protein binding to this site by EMSA, and by in vivo ChIP analysis using P19 cells and hindbrain tissues from the Hoxb3(Tg) mutant. We further showed that Hoxb3 could suppress Hoxb1 transcriptional activity by chick in ovo luciferase reporter assay. Moreover, in E10.5 wildtype caudal hindbrain, where Hoxb1 is not expressed, we showed by in vivo ChIP that Hoxb3 was consistently bound to the S3 site on the Hoxb1 gene. This study reveals a novel negative regulatory mechanism by which Hoxb3 as a posterior gene serves to restrict Hoxb1 expression in r4 by direct transcriptional repression to maintain the rhombomere identity. Copyright © 2011 Elsevier Inc. All rights reserved.

Multiproteomic and Transcriptomic Analysis of Oncogenic β-Catenin Molecular Networks.

PubMed

Ewing, Rob M; Song, Jing; Gokulrangan, Giridharan; Bai, Sheldon; Bowler, Emily H; Bolton, Rachel; Skipp, Paul; Wang, Yihua; Wang, Zhenghe

2018-06-01

The dysregulation of Wnt signaling is a frequent occurrence in many different cancers. Oncogenic mutations of CTNNB1/β-catenin, the key nuclear effector of canonical Wnt signaling, lead to the accumulation and stabilization of β-catenin protein with diverse effects in cancer cells. Although the transcriptional response to Wnt/β-catenin signaling activation has been widely studied, an integrated understanding of the effects of oncogenic β-catenin on molecular networks is lacking. We used affinity-purification mass spectrometry (AP-MS), label-free liquid chromatography-tandem mass spectrometry, and RNA-Seq to compare protein-protein interactions, protein expression, and gene expression in colorectal cancer cells expressing mutant (oncogenic) or wild-type β-catenin. We generate an integrated molecular network and use it to identify novel protein modules that are associated with mutant or wild-type β-catenin. We identify a DNA methyltransferase I associated subnetwork that is enriched in cells with mutant β-catenin and a subnetwork enriched in wild-type cells associated with the CDKN2A tumor suppressor, linking these processes to the transformation of colorectal cancer cells through oncogenic β-catenin signaling. In summary, multiomics analysis of a defined colorectal cancer cell model provides a significantly more comprehensive identification of functional molecular networks associated with oncogenic β-catenin signaling.

The zebrafish gene cloche acts upstream of a flk-1 homologue to regulate endothelial cell differentiation.

PubMed

Liao, W; Bisgrove, B W; Sawyer, H; Hug, B; Bell, B; Peters, K; Grunwald, D J; Stainier, D Y

1997-01-01

The zebrafish cloche mutation affects both the endothelial and hematopoietic lineages at a very early stage (Stainier, D. Y. R., Weinstein, B. M., Detrich, H. W., Zon, L. I. and Fishman, M. C. (1995). Development 121, 3141-3150). The most striking vascular phenotype is the absence of endocardial cells from the heart. Microscopic examination of mutant embryos reveals the presence of endothelial-like cells in the lower trunk and tail regions while head vessels appear to be missing, indicating a molecular diversification of the endothelial lineage. Cell transplantation experiments show that cloche acts cell-autonomously within the endothelial lineage. To analyze further the role of cloche in regulating endothelial cell differentiation, we have examined the expression of flk-1 and tie, two receptor tyrosine kinase genes expressed early and sequentially in the endothelial lineage. In wild-type fish, flk-1-positive cells are found throughout the embryo and differentiate to form the nascent vasculature. In cloche mutants, flk-1-positive cells are found only in the lower trunk and tail regions, and this expression is delayed as compared to wild-type. Unlike the flk-1-positive cells in wild-type embryos, those in cloche mutants do not go on to express tie, suggesting that their differentiation is halted at an early stage. We also find that the cloche mutation is not linked to flk-1. These data indicate that cloche affects the differentiation of all endothelial cells and that it acts at a very early stage, either by directly regulating flk-1 expression or by controlling the differentiation of cells that normally develop to express flk-1. cloche mutants also have a blood deficit and their hematopoietic tissues show no expression of the hematopoietic transcription factor genes GATA-1 or GATA-2 at early stages. Because the appearance of distinct levels of flk-1 expression is delayed in cloche mutants, we examined GATA-1 expression at late embryonic stages and found some blood cell differentiation that appears to be limited to the region lined by the flk-1-expressing cells. The spatial restriction of blood in the ventroposterior-most region of cloche mutant embryos may be indicative of a ventral source of signal(s) controlling hematopoietic differentiation. In addition, the restricted colocalization of blood and endothelium in cloche mutants suggests that important interactions occur between these two lineages during normal development.

Tracing of her5 progeny in zebrafish transgenics reveals the dynamics of midbrain-hindbrain neurogenesis and maintenance.

PubMed

Tallafuss, Alexandra; Bally-Cuif, Laure

2003-09-01

The midbrain-hindbrain domain (MH) of the vertebrate embryonic neural tube develops in response to the isthmic organizer (IsO), located at the midbrain-hindbrain boundary (MHB). MH derivatives are largely missing in mutants affected in IsO activity; however, the potentialities and fate of MH precursors in these conditions have not been directly determined. To follow the dynamics of MH maintenance in vivo, we used artificial chromosome transgenesis in zebrafish to construct lines where egfp transcription is driven by the complete set of regulatory elements of her5, the first known gene expressed in the MH area. In these lines, egfp transcription faithfully recapitulates her5 expression from its induction phase onwards. Using the stability of GFP protein as lineage tracer, we first demonstrate that her5 expression at gastrulation is a selective marker of MH precursor fate. By comparing GFP protein and her5 transcription, we further reveal the spatiotemporal dynamics of her5 expression that conditions neurogenesis progression towards the MHB over time. Finally, we trace the molecular identity of GFP-positive cells in the acerebellar (ace) and no-isthmus (noi) mutant backgrounds to analyze directly fgf8 and pax2.1 mutant gene activities for their ultimate effect on cell fate. We demonstrate that most MH precursors are maintained in both mutants but express abnormal identities, in a manner that strikingly differs between the ace and noi contexts. Our observations directly support a role for Fgf8 in protecting anterior tectal and metencephalic precursors from acquiring anterior identities, while Pax2.1 controls the choice of MH identity as a whole. Together, our results suggest a model where an ordered MH pro-domain is identified at gastrulation, and where cell identity choices within this domain are subsequently differentially controlled by Fgf8 and Pax2.1 functions.

Oat consumption reduced intestinal fat deposition and improved health span in Caenorhabditis elegans model

PubMed Central

Gao, Chenfei; Gao, Zhanguo; Greenway, Frank L.; Burton, Jeffrey H.; Johnson, William D.; Keenan, Michael J.; Enright, Frederick M.; Martin, Roy J.; Chu, YiFang; Zheng, Jolene

2015-01-01

In addition to their fermentable dietary fiber and the soluble β-glucan fiber, oats have unique avenanthramides that have anti-inflammatory and antioxidant properties that reduce coronary heart disease in human clinical trials. We hypothesized that oat consumption will increase insulin sensitivity, reduce body fat, and improve health span in Caenorhabditis elegans through a mechanism involving the daf-2 gene, which codes for the insulin/insulin-like growth factor-1–like receptor, and that hyperglycemia will attenuate these changes. Caenorhabditis elegans wild type (N2) and the null strains sir-2.1, daf-16, and daf-16/daf-2 were fed Escherichia coli (OP50) and oat flakes (0.5%, 1.0%, or 3%) with and without 2% glucose. Oat feeding decreased intestinal fat deposition in N2, daf-16, or daf-16/daf-2 strains (P < .05); and glucose did not affect intestinal fat deposition response. The N2, daf-16, or sir-2.1 mutant increased the pharyngeal pumping rate (P < .05), a surrogate marker of life span, following oat consumption. Oat consumption increased ckr-1, gcy-8, cpt-1, and cpt-2 mRNA expression in both the N2 and the sir-2.1 mutant, with significantly higher expression in sir-2.1 than in N2 (P < .01). Additional glucose further increased expression 1.5-fold of the 4 genes in N2 (P < .01), decreased the expression of all except cpt-1 in the daf-16 mutant, and reduced mRNA expression of the 4 genes in the daf-16/daf-2 mutant (P < .01). These data suggest that oat consumption reduced fat storage and increased ckr-1, gcy-8, cpt-1, or cpt-2 through the sir-2.1 genetic pathway. Oat consumption may be a beneficial dietary intervention for reducing fat accumulation, augmenting health span, and improving hyperglycemia-impaired lipid metabolism. PMID:26253816

Retrospective Molecular Epidemiology Study of PD-L1 Expression in Patients with EGFR-Mutant Non-small Cell Lung Cancer.

PubMed

Cho, Jong Ho; Zhou, Wei; Choi, Yoon-La; Sun, Jong-Mu; Choi, Hyejoo; Kim, Tae-Eun; Dolled-Filhart, Marisa; Emancipator, Kenneth; Rutkowski, Mary Anne; Kim, Jhingook

2018-01-01

Data are limited on programmed death ligand 1 (PD-L1) expression in epidermal growth factor receptor ( EGFR )-mutant non-small cell lung cancer (NSCLC). We retrospectively evaluated the relationship between PD-L1 expression and recurrence-free survival (RFS) and overall survival in 319 patients with EGFR -mutant NSCLC who were treated at Samsung Medical Center from 2006 to 2014. Membranous PD-L1 expression on tumor cells was measured using the PD-L1 IHC 22C3 pharmDx antibody and reported as tumor proportion score (TPS). Kaplan-Meier methods, log-rank test, and Cox proportional hazards models were used for survival analysis. All patients had ≥1 EGFR mutation-54% in exon 19 and 39% in exon 21. Overall, 51% of patients had PD-L1-positive tumors. The prevalence of PD-L1 positivity was higher among patients with stages II-IV versus stage I disease (64% vs. 44%) and among patients with other EGFR mutations (75%) than with L858R mutation (39%) or exon 19 deletion (52%). PD-L1 positivity was associated with shorter RFS, with an adjusted hazard ratio of 1.52 (95% confidence interval [CI], 0.81 to 2.84; median, 18 months) for the PD-L1 TPS ≥ 50% group, 1.51 (95% CI, 1.02 to 2.21; median, 31 months) for the PD-L1 TPS 1%-49% group, and 1.51 (95% CI, 1.05 to 2.18) for the combined PD-L1-positive groups (TPS ≥ 1%) compared with the PD-L1-negative group (median, 35 months). PD-L1 expression is associated with disease stage and type of EGFR mutation. PD-L1 positivity might be associated with worse RFS among patients with surgically treated EGFR -mutant NSCLC.

Effect of mutant variants of the KRAS gene on PD-L1 expression and on the immune microenvironment and association with clinical outcome in lung adenocarcinoma patients.

PubMed

Falk, Alexander T; Yazbeck, Nathalie; Guibert, Nicolas; Chamorey, Emmanuel; Paquet, Agnès; Ribeyre, Lydia; Bence, Coraline; Zahaf, Katia; Leroy, Sylvie; Marquette, Charles-Hugo; Cohen, Charlotte; Mograbi, Baharia; Mazières, Julien; Hofman, Véronique; Brest, Patrick; Hofman, Paul; Ilié, Marius

2018-07-01

The effect of anti-PD-1/PD-L1 inhibitors on lung adenocarcinomas (LADCs) with KRAS mutations is debatable. We examined the association between specific mutant KRAS proteins and the immune infiltrates with the outcome of patients with LADCs. In 219 LADCs harboring either wild-type (WT) or mutated KRAS gene, we quantified the density of several immune markers by immunohistochemistry followed by automated digital image analysis. Data were correlated to clinicopathological parameters and outcome of patients. Tumors harboring mutant KRAS-G12 V had a significantly higher PD-L1 expression compared to other tumors (p = 0.044), while mutant KRAS-G12D tumors showed an increase in the density of CD66b+ cells (p = 0.001). High PD-L1 expression in tumor cells was associated to improved overall survival (OS) in KRAS mutant patients (p = 0.012), but not in the WT population (p = 0.385), whereas increased PD-L1 expression in immune cells correlated to poor OS of KRAS-WT patients (p = 0.025), with no difference in patients with KRAS mutations. KRAS mutational status can affect the immune microenvironment and survival of LADC patients in a heterogeneous way, implying that specific mutant KRAS variants expressed by the tumor should be considered when stratifying patients for immunotherapy. Copyright © 2018 Elsevier B.V. All rights reserved.

The HDAC Inhibitor TSA Ameliorates a Zebrafish Model of Duchenne Muscular Dystrophy.

PubMed

Johnson, Nathan M; Farr, Gist H; Maves, Lisa

2013-09-17

Zebrafish are an excellent model for Duchenne muscular dystrophy. In particular, zebrafish provide a system for rapid, easy, and low-cost screening of small molecules that can ameliorate muscle damage in dystrophic larvae. Here we identify an optimal anti-sense morpholino cocktail that robustly knocks down zebrafish Dystrophin (dmd-MO). We use two approaches, muscle birefringence and muscle actin expression, to quantify muscle damage and show that the dmd-MO dystrophic phenotype closely resembles the zebrafish dmd mutant phenotype. We then show that the histone deacetylase (HDAC) inhibitor TSA, which has been shown to ameliorate the mdx mouse Duchenne model, can rescue muscle fiber damage in both dmd-MO and dmd mutant larvae. Our study identifies optimal morpholino and phenotypic scoring approaches for dystrophic zebrafish, further enhancing the zebrafish dmd model for rapid and cost-effective small molecule screening.

A novel protein involved in heart development in Ambystoma mexicanum is localized in endoplasmic reticulum.

PubMed

Jia, P; Zhang, C; Huang, X P; Poda, M; Akbas, F; Lemanski, S L; Erginel-Unaltuna, N; Lemanski, L F

2008-11-01

The discovery of the naturally occurring cardiac non-function (c) animal strain in Ambystoma mexicanum (axolotl) provides a valuable animal model to study cardiomyocyte differentiation. In homozygous mutant animals (c/c), rhythmic contractions of the embryonic heart are absent due to a lack of organized myofibrils. We have previously cloned a partial sequence of a peptide cDNA (N1) from an anterior-endoderm-conditioned-medium RNA library that had been shown to be able to rescue the mutant phenotype. In the current studies we have fully cloned the N1 full length cDNA sequence from the library. N1 protein has been detected in both adult heart and skeletal muscle but not in any other adult tissues. GFP-tagged expression of the N1 protein has revealed localization of the N1 protein in the endoplasmic reticulum (ER). Results from in situ hybridization experiments have confirmed the dramatic decrease of expression of N1 mRNA in mutant (c/c) embryos indicating that the N1 gene is involved in heart development.

SAS-6 engineering reveals interdependence between cartwheel and microtubules in determining centriole architecture.

PubMed

Hilbert, Manuel; Noga, Akira; Frey, Daniel; Hamel, Virginie; Guichard, Paul; Kraatz, Sebastian H W; Pfreundschuh, Moritz; Hosner, Sarah; Flückiger, Isabelle; Jaussi, Rolf; Wieser, Mara M; Thieltges, Katherine M; Deupi, Xavier; Müller, Daniel J; Kammerer, Richard A; Gönczy, Pierre; Hirono, Masafumi; Steinmetz, Michel O

2016-04-01

Centrioles are critical for the formation of centrosomes, cilia and flagella in eukaryotes. They are thought to assemble around a nine-fold symmetric cartwheel structure established by SAS-6 proteins. Here, we have engineered Chlamydomonas reinhardtii SAS-6-based oligomers with symmetries ranging from five- to ten-fold. Expression of a SAS-6 mutant that forms six-fold symmetric cartwheel structures in vitro resulted in cartwheels and centrioles with eight- or nine-fold symmetries in vivo. In combination with Bld10 mutants that weaken cartwheel-microtubule interactions, this SAS-6 mutant produced six- to eight-fold symmetric cartwheels. Concurrently, the microtubule wall maintained eight- and nine-fold symmetries. Expressing SAS-6 with analogous mutations in human cells resulted in nine-fold symmetric centrioles that exhibited impaired length and organization. Together, our data suggest that the self-assembly properties of SAS-6 instruct cartwheel symmetry, and lead us to propose a model in which the cartwheel and the microtubule wall assemble in an interdependent manner to establish the native architecture of centrioles.

Can the silkworm (Bombyx mori) be used as a human disease model?

PubMed

Tabunoki, Hiroko; Bono, Hidemasa; Ito, Katsuhiko; Yokoyama, Takeshi

2016-02-01

Bombyx mori (silkworm) is the most famous lepidopteran in Japan. B. mori has long been used in the silk industry and also as a model insect for agricultural research. In recent years, B. mori has attracted interest in its potential for use in pathological analysis of model animals. For example, the human macular carotenoid transporter was discovered using information of B. mori carotenoid transporter derived from yellow-cocoon strain. The B. mori carotenoid transport system is useful in human studies. To develop a human disease model, we characterized the human homologs of B. mori, and by constructing KAIKO functional annotation pipeline, and to analyze gene expression profile of a unique B. mori mutant strain using microarray analysis. As a result, we identified a novel molecular network involved in Parkinson's disease. Here we describe the potential use of a spontaneous mutant silkworm strain as a human disease model. We also summarize recent progress in the application of genomic information for annotation of human homologs in B. mori. The B. mori mutant will provide a clue to pathological mechanisms, and the findings will be helpful for the development of therapies and for medical drug discovery.

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides.

PubMed

Nicolás, Francisco E; Vila, Ana; Moxon, Simon; Cascales, María D; Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M; Garre, Victoriano

2015-03-25

RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which they derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants. Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. This work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.

Mutant calreticulin-expressing cells induce monocyte hyperreactivity through a paracrine mechanism

PubMed Central

Garbati, Michael R.; Welgan, Catherine A.; Landefeld, Sally H.; Newell, Laura F.; Agarwal, Anupriya; Dunlap, Jennifer B.; Chourasia, Tapan K.; Lee, Hyunjung; Elferich, Johannes; Traer, Elie; Rattray, Rogan; Cascio, Michael J.; Press, Richard D.; Bagby, Grover C.; Tyner, Jeffrey W.; Druker, Brian J.; Dao, Kim-Hien T.

2016-01-01

Mutations in the calreticulin gene (CALR) were recently identified in approximately 70–80% of patients with JAK2-V617F-negative essential thrombocytosis and primary myelofibrosis. All frameshift mutations generate a recurring novel C-terminus. Here we provide evidence that mutant calreticulin does not accumulate efficiently in cells and is abnormally enriched in the nucleus and extracellular space compared to wildtype calreticulin. The main determinant of these findings is the loss of the calcium-binding and KDEL domains. Expression of type I mutant CALR in Ba/F3 cells confers minimal IL-3-independent growth. Interestingly, expression of type I and type II mutant CALR in a non-hematopoietic cell line does not directly activate JAK/STAT signaling compared to JAK2-V617F expression. These results led us to investigate paracrine mechanisms of JAK/STAT activation. Here we show that conditioned media from cells expressing type I mutant CALR exaggerate cytokine production from normal monocytes with or without treatment with a toll-like receptor agonist. These effects are not dependent on the novel C-terminus. These studies offer novel insights into the mechanism of JAK/STAT activation in patients with JAK2-V617F-negative essential thrombocytosis and primary myelofibrosis. PMID:26573090

Site-specific PEGylation of human thyroid stimulating hormone to prolong duration of action.

PubMed

Qiu, Huawei; Boudanova, Ekaterina; Park, Anna; Bird, Julie J; Honey, Denise M; Zarazinski, Christine; Greene, Ben; Kingsbury, Jonathan S; Boucher, Susan; Pollock, Julie; McPherson, John M; Pan, Clark Q

2013-03-20

Recombinant human thyroid stimulating hormone (rhTSH or Thyrogen) has been approved for thyroid cancer diagnostics and treatment under a multidose regimen due to its short circulating half-life. To reduce dosing frequency, PEGylation strategies were explored to increase the duration of action of rhTSH. Lysine and N-terminal PEGylation resulted in heterogeneous product profiles with 40% or lower reaction yields of monoPEGylated products. Eleven cysteine mutants were designed based on a structure model of the TSH-TSH receptor (TSHR) complex to create unique conjugation sites on both α and β subunits for site-specific conjugation. Sequential screening of mutant expression level, oligomerization tendency, and conjugation efficiency resulted in the identification of the αG22C rhTSH mutant for stable expression and scale-up PEGylation. The introduced cysteine in the αG22C rhTSH mutant was partially blocked when isolated from conditioned media and could only be effectively PEGylated after mild reduction with cysteine. This produced a higher reaction yield, ~85%, for the monoPEGylated product. Although the mutation had no effect on receptor binding, PEGylation of αG22C rhTSH led to a PEG size-dependent decrease in receptor binding. Nevertheless, the 40 kDa PEG αG22C rhTSH showed a prolonged duration of action compared to rhTSH in a rat pharmacodynamics model. Reverse-phase HPLC and N-terminal sequencing experiments confirmed site-specific modification at the engineered Cys 22 position on the α-subunit. This work is another demonstration of successful PEGylation of a cysteine-knot protein by an engineered cysteine mutation.

Electroacupuncture remediates glial dysfunction and ameliorates neurodegeneration in the astrocytic α-synuclein mutant mouse model.

PubMed

Deng, Jiahui; Lv, E; Yang, Jian; Gong, Xiaoli; Zhang, Wenzhong; Liang, Xibin; Wang, Jiazeng; Jia, Jun; Wang, Xiaomin

2015-05-28

The acupuncture or electroacupuncture (EA) shows the therapeutic effect on various neurodegenerative diseases. This effect was thought to be partially achieved by its ability to alleviate existing neuroinflammation and glial dysfunction. In this study, we systematically investigated the effect of EA on abnormal neurochemical changes and motor symptoms in a mouse neurodegenerative disease model. The transgenic mouse which expresses a mutant α-synuclein (α-syn) protein, A53T α-syn, in brain astrocytic cells was used. These mice exhibit extensive neuroinflammatory and motor phenotypes of neurodegenerative disorders. In this study, the effects of EA on these phenotypic changes were examined in these mice. EA improved the movement detected in multiple motor tests in A53T mutant mice. At the cellular level, EA significantly reduced the activation of microglia and prevented the loss of dopaminergic neurons in the midbrain and motor neurons in the spinal cord. At the molecular level, EA suppressed the abnormal elevation of proinflammatory factors (tumor necrosis factor-α and interleukin-1β) in the striatum and midbrain of A53T mice. In contrast, EA increased striatal and midbrain expression of a transcription factor, nuclear factor E2-related factor 2, and its downstream antioxidants (heme oxygenase-1 and glutamate-cysteine ligase modifier subunits). These results suggest that EA possesses the ability to ameliorate mutant α-syn-induced motor abnormalities. This ability may be due to that EA enhances both anti-inflammatory and antioxidant activities and suppresses aberrant glial activation in the diseased sites of brains.

Superoxide-Dismutase Deficient Mutants in Common Beans (Phaseolus vulgaris L.): Genetic Control, Differential Expressions of Isozymes, and Sensitivity to Arsenic

PubMed Central

Talukdar, Dibyendu; Talukdar, Tulika

2013-01-01

Two common bean (Phaseolus vulgaris L.) mutants, sodPv 1 and sodPv 2, exhibiting foliar superoxide dismutase (SOD) activity of only 25% and 40% of their mother control (MC) cv. VL 63 were isolated in EMS-mutagenized (0.15%, 8 h) M2 progeny. Native-PAGE analysis revealed occurrence of Mn SOD, Fe SOD, Cu/Zn SOD I and Cu/Zn SOD II isozymes in MC, while Fe SOD, and Mn SOD were not formed in sodPv 1 and sodPv 2 leaves, respectively. In-gel activity of individual isozymes differed significantly among the parents. SOD deficiency is inherited as recessive mutations, controlled by two different nonallelic loci. Gene expressions using qRT PCR confirmed higher expressions of Cu/Zn SOD transcripts in both mutants and the absence of Fe SOD in sodPv 1 and Mn SOD in sodPv 2. In 50 μM arsenic, Cu/Zn SODs genes were further upregulated but other isoforms downregulated in the two mutants, maintaining SOD activity in its control level. In an F2 double mutants of sodPv 1 × sodPv 2, no Fe SOD, and Mn SOD expressions were detectable, while both Cu/Zn SODs are down-regulated and arsenic-induced leaf necrosis appeared. In contrast to both mutants, ROS-imaging study revealed overaccumulation of both superoxides and H2O2 in leaves of double mutant. PMID:24078924

Gibberellin regulates pollen viability and pollen tube growth in rice.

PubMed

Chhun, Tory; Aya, Koichiro; Asano, Kenji; Yamamoto, Eiji; Morinaka, Yoichi; Watanabe, Masao; Kitano, Hidemi; Ashikari, Motoyuki; Matsuoka, Makoto; Ueguchi-Tanaka, Miyako

2007-12-01

Gibberellins (GAs) play many biological roles in higher plants. We collected and performed genetic analysis on rice (Oryza sativa) GA-related mutants, including GA-deficient and GA-insensitive mutants. Genetic analysis of the mutants revealed that rice GA-deficient mutations are not transmitted as Mendelian traits to the next generation following self-pollination of F1 heterozygous plants, although GA-insensitive mutations are transmitted normally. To understand these differences in transmission, we examined the effect of GA on microsporogenesis and pollen tube elongation in rice using new GA-deficient and GA-insensitive mutants that produce semifertile flowers. Phenotypic analysis revealed that the GA-deficient mutant reduced pollen elongation1 is defective in pollen tube elongation, resulting in a low fertilization frequency, whereas the GA-insensitive semidominant mutant Slr1-d3 is mainly defective in viable pollen production. Quantitative RT-PCR revealed that GA biosynthesis genes tested whose mutations are transmitted to the next generation at a lower frequency are preferentially expressed after meiosis during pollen development, but expression is absent or very low before the meiosis stage, whereas GA signal-related genes are actively expressed before meiosis. Based on these observations, we predict that the transmission of GA-signaling genes occurs in a sporophytic manner, since the protein products and/or mRNA transcripts of these genes may be introduced into pollen-carrying mutant alleles, whereas GA synthesis genes are transmitted in a gametophytic manner, since these genes are preferentially expressed after meiosis.

Zebrafish pit1 mutants lack three pituitary cell types and develop severe dwarfism.

PubMed

Nica, Gabriela; Herzog, Wiebke; Sonntag, Carmen; Hammerschmidt, Matthias

2004-05-01

The Pou domain transcription factor Pit-1 is required for lineage determination and cellular commitment processes during mammalian adenohypophysis development. Here we report the cloning and mutational analysis of a pit1 homolog from zebrafish. Compared with mouse, zebrafish pit1 starts to be expressed at a much earlier stage of adenohypophysis development. However, as in the mouse, expression is restricted to a subset of pituitary cell types, excluding proopiomelanocortin (pomc)-expressing cells (corticotropes, melanotropes) and possibly gonadotropes. We could identify two N-ethyl-N-nitrosourea-induced zebrafish pit1 null mutants. Most mutants die during larval stages, whereas survivors develop severe dwarfism. Mutant larvae lack lactotropes, somatotropes, and thyrotropes, although the adenohypophysis is of normal size, without any sign of increased apoptosis rates. Instead, mutant embryos initiate ectopic expression of pomc in pit1-positive cells, leading to an expansion of the Pomc lineage. Similarly, the number of gonadotropes seems increased, as indicated by the expression of gsualpha, a marker for thyrotropes and gonadotropes. In pit1 mutants, the total number of gsualpha-positive cells is normal despite the loss of gsualpha and tshbeta coexpressing cells. Together, these data suggest a transfating of the Pit1 lineage to the Pomc and possibly the gonadotroph lineages in the mutant, and a pomc- and gonadotropin-repressive role of Pit1 during normal zebrafish development. This is different from mouse, for which a repressive role of Pit-1 has only been reported for the gonadotropin Lhbeta, but not for Pomc. In sum, our data point to both conserved and class-specific aspects of Pit1 function during pituitary development in different vertebrate species.

Sustained Expression of Negative Regulators of Myelination Protects Schwann Cells from Dysmyelination in a Charcot-Marie-Tooth 1B Mouse Model.

PubMed

Florio, Francesca; Ferri, Cinzia; Scapin, Cristina; Feltri, M Laura; Wrabetz, Lawrence; D'Antonio, Maurizio

2018-05-02

Schwann cell differentiation and myelination in the PNS are the result of fine-tuning of positive and negative transcriptional regulators. As myelination starts, negative regulators are downregulated, whereas positive ones are upregulated. Fully differentiated Schwann cells maintain an extraordinary plasticity and can transdifferentiate into "repair" Schwann cells after nerve injury. Reactivation of negative regulators of myelination is essential to generate repair Schwann cells. Negative regulators have also been implicated in demyelinating neuropathies, although their role in disease remains elusive. Here, we used a mouse model of Charcot-Marie-Tooth neuropathy type 1B (CMT1B), the P0S63del mouse characterized by ER stress and the activation of the unfolded protein response, to show that adult Schwann cells are in a partial differentiation state because they overexpress transcription factors that are normally expressed only before myelination. We provide evidence that two of these factors, Sox2 and Id2, act as negative regulators of myelination in vivo However, their sustained expression in neuropathy is protective because ablation of Sox2 or/and Id2 from S63del mice of both sexes results in worsening of the dysmyelinating phenotype. This is accompanied by increased levels of mutant P0 expression and exacerbation of ER stress, suggesting that limited differentiation may represent a novel adaptive mechanism through which Schwann cells counter the toxic effect of a mutant terminal differentiation protein. SIGNIFICANCE STATEMENT In many neuropathies, Schwann cells express high levels of early differentiation genes, but the significance of these altered expression remained unclear. Because many of these factors may act as negative regulators of myelination, it was suggested that their misexpression could contribute to dysmyelination. Here, we show that the transcription factors Sox2 and Id2 act as negative regulators of myelination in vivo , but that their sustained expression in Charcot-Marie-Tooth type 1B (CMT1B) represents an adaptive response activated by the Schwann cells to reduce mutant protein toxicity and prevent demyelination. Copyright © 2018 the authors 0270-6474/18/384275-14$15.00/0.

ATRX induction by mutant huntingtin via Cdx2 modulates heterochromatin condensation and pathology in Huntington's disease

PubMed Central

Lee, J; Hong, Y K; Jeon, G S; Hwang, Y J; Kim, K Y; Seong, K H; Jung, M-K; Picketts, D J; Kowall, N W; Cho, K S; Ryu, H

2012-01-01

Aberrant chromatin remodeling is involved in the pathogenesis of Huntington's disease (HD) but the mechanism is not known. Herein, we report that mutant huntingtin (mtHtt) induces the transcription of alpha thalassemia/mental retardation X linked (ATRX), an ATPase/helicase and SWI/SNF-like chromatin remodeling protein via Cdx-2 activation. ATRX expression was elevated in both a cell line model and transgenic model of HD, and Cdx-2 occupancy of the ATRX promoter was increased in HD. Induction of ATRX expanded the size of promyelocytic leukemia nuclear body (PML-NB) and increased trimethylation of H3K9 (H3K9me3) and condensation of pericentromeric heterochromatin, while knockdown of ATRX decreased PML-NB and H3K9me3 levels. Knockdown of ATRX/dXNP improved the hatch rate of fly embryos expressing mtHtt (Q127). ATRX/dXNP overexpression exacerbated eye degeneration of eye-specific mtHtt (Q127) expressing flies. Our findings suggest that transcriptional alteration of ATRX by mtHtt is involved in pericentromeric heterochromatin condensation and contributes to the pathogenesis of HD. PMID:22240898

Chaperone-mediated autophagy degrades mutant p53

PubMed Central

Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

2013-01-01

Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

Transcription factors in melanocyte development: distinct roles for Pax-3 and Mitf.

PubMed

Hornyak, T J; Hayes, D J; Chiu, L Y; Ziff, E B

2001-03-01

A transgenic mouse model was used to examine the roles of the murine transcription factors Pax-3 and Mitf in melanocyte development. Transgenic mice expressing beta-galactosidase from the dopachrome tautomerase (Dct) promoter were generated and found to express the transgene in developing melanoblasts as early as embryonic day (E) 9.5. These mice express the transgene in a pattern characteristic of endogenous Dct expression. Transgenic mice were intercrossed with two murine coat color mutants, Splotch (Sp), containing a mutation in the murine Pax3 gene, and Mitf(mi), with a mutation in the basic-helix-loop-helix-leucine zipper gene Mitf. Transgenic heterozygous mutant animals were crossed to generate transgenic embryos for analysis. Examination of beta-galactosidase-expressing melanoblasts in mutant embryos reveals that Mitf is required in vivo for survival of melanoblasts up to the migration staging area in neural crest development. Examination of Mitf(mi)/+ embryos shows that there are diminished numbers of melanoblasts in the heterozygous state early in melanocyte development, consistent with a gene dosage-dependent effect upon cell survival. However, quantification and analysis of melanoblast growth during the migratory phase suggests that melanoblasts then increase in number more rapidly in the heterozygous embryo. In contrast to Mitf(mi)/Mitf(mi) embryos, Sp/Sp embryos exhibit melanoblasts that have migrated to characteristic locations along the melanoblast migratory pathway, but are greatly reduced in number compared to control littermates. Together, these results support a model for melanocyte development whereby Pax3 is required to expand a pool of committed melanoblasts or restricted progenitor cells early in development, whereas Mitf facilitates survival of the melanoblast in a gene dosage-dependent manner within and immediately after emigration from the dorsal neural tube, and may also directly or indirectly affect the rate at which melanoblast number increases during dorsolateral pathway migration.

The Human 343delT HSPB5 Chaperone Associated with Early-onset Skeletal Myopathy Causes Defects in Protein Solubility*

PubMed Central

Mitzelfelt, Katie A.; Limphong, Pattraranee; Choi, Melinda J.; Kondrat, Frances D. L.; Lai, Shuping; Kolander, Kurt D.; Kwok, Wai-Meng; Dai, Qiang; Grzybowski, Michael N.; Zhang, Huali; Taylor, Graydon M.; Lui, Qiang; Thao, Mai T.; Hudson, Judith A.; Barresi, Rita; Bushby, Kate; Jungbluth, Heinz; Wraige, Elizabeth; Geurts, Aron M.; Benesch, Justin L. P.; Riedel, Michael; Christians, Elisabeth S.; Minella, Alex C.; Benjamin, Ivor J.

2016-01-01

Mutations of HSPB5 (also known as CRYAB or αB-crystallin), a bona fide heat shock protein and molecular chaperone encoded by the HSPB5 (crystallin, alpha B) gene, are linked to multisystem disorders featuring variable combinations of cataracts, cardiomyopathy, and skeletal myopathy. This study aimed to investigate the pathological mechanisms involved in an early-onset myofibrillar myopathy manifesting in a child harboring a homozygous recessive mutation in HSPB5, 343delT. To study HSPB5 343delT protein dynamics, we utilize model cell culture systems including induced pluripotent stem cells derived from the 343delT patient (343delT/343delT) along with isogenic, heterozygous, gene-corrected control cells (WT KI/343delT) and BHK21 cells, a cell line lacking endogenous HSPB5 expression. 343delT/343delT and WT KI/343delT-induced pluripotent stem cell-derived skeletal myotubes and cardiomyocytes did not express detectable levels of 343delT protein, contributable to the extreme insolubility of the mutant protein. Overexpression of HSPB5 343delT resulted in insoluble mutant protein aggregates and induction of a cellular stress response. Co-expression of 343delT with WT prevented visible aggregation of 343delT and improved its solubility. Additionally, in vitro refolding of 343delT in the presence of WT rescued its solubility. We demonstrate an interaction between WT and 343delT both in vitro and within cells. These data support a loss-of-function model for the myopathy observed in the patient because the insoluble mutant would be unavailable to perform normal functions of HSPB5, although additional gain-of-function effects of the mutant protein cannot be excluded. Additionally, our data highlight the solubilization of 343delT by WT, concordant with the recessive inheritance of the disease and absence of symptoms in carrier individuals. PMID:27226619

Rice PLASTOCHRON genes regulate leaf maturation downstream of the gibberellin signal transduction pathway.

PubMed

Mimura, Manaki; Nagato, Yasuo; Itoh, Jun-Ichi

2012-05-01

Rice PLASTOCHRON 1 (PLA1) and PLA2 genes regulate leaf maturation and plastochron, and their loss-of-function mutants exhibit small organs and rapid leaf emergence. They encode a cytochrome P450 protein CYP78A11 and an RNA-binding protein, respectively. Their homologs in Arabidopsis and maize are also associated with plant development/organ size. Despite the importance of PLA genes in plant development, their molecular functions remain unknown. Here, we investigated how PLA1 and PLA2 genes are related to phytohormones. We found that gibberellin (GA) is the major phytohormone that promotes PLA1 and PLA2 expression. GA induced PLA1 and PLA2 expression, and conversely the GA-inhibitor uniconazole suppressed PLA1 and PLA2 expression. In pla1-4 and pla2-1 seedlings, expression levels of GA biosynthesis genes and the signal transduction gene were similar to those in wild-type seedlings. GA treatment slightly down-regulated the GA biosynthesis gene GA20ox2 and up-regulated the GA-catabolizing gene GA2ox4, whereas the GA biosynthesis inhibitor uniconazole up-regulated GA20ox2 and down-regulated GA2ox4 both in wild-type and pla mutants, suggesting that the GA feedback mechanism is not impaired in pla1 and pla2. To reveal how GA signal transduction affects the expression of PLA1 and PLA2, PLA expression in GA-signaling mutants was examined. In GA-insensitive mutant, gid1 and less-sensitive mutant, Slr1-d1, PLA1 and PLA2 expression was down-regulated. On the other hand, the expression levels of PLA1 and PLA2 were highly enhanced in a GA-constitutive-active mutant, slr1-1, causing ectopic overexpression. These results indicate that both PLA1 and PLA2 act downstream of the GA signal transduction pathway to regulate leaf development.

Comparative analysis of gene expression level by quantitative real-time PCR has limited application in objects with different morphology.

PubMed

Demidenko, Natalia V; Penin, Aleksey A

2012-01-01

qRT-PCR is a generally acknowledged method for gene expression analysis due to its precision and reproducibility. However, it is well known that the accuracy of qRT-PCR data varies greatly depending on the experimental design and data analysis. Recently, a set of guidelines has been proposed that aims to improve the reliability of qRT-PCR. However, there are additional factors that have not been taken into consideration in these guidelines that can seriously affect the data obtained using this method. In this study, we report the influence that object morphology can have on qRT-PCR data. We have used a number of Arabidopsis thaliana mutants with altered floral morphology as models for this study. These mutants have been well characterised (including in terms of gene expression levels and patterns) by other techniques. This allows us to compare the results from the qRT-PCR with the results inferred from other methods. We demonstrate that the comparison of gene expression levels in objects that differ greatly in their morphology can lead to erroneous results.

GExplore: a web server for integrated queries of protein domains, gene expression and mutant phenotypes

PubMed Central

2009-01-01

Background The majority of the genes even in well-studied multi-cellular model organisms have not been functionally characterized yet. Mining the numerous genome wide data sets related to protein function to retrieve potential candidate genes for a particular biological process remains a challenge. Description GExplore has been developed to provide a user-friendly database interface for data mining at the gene expression/protein function level to help in hypothesis development and experiment design. It supports combinatorial searches for proteins with certain domains, tissue- or developmental stage-specific expression patterns, and mutant phenotypes. GExplore operates on a stand-alone database and has fast response times, which is essential for exploratory searches. The interface is not only user-friendly, but also modular so that it accommodates additional data sets in the future. Conclusion GExplore is an online database for quick mining of data related to gene and protein function, providing a multi-gene display of data sets related to the domain composition of proteins as well as expression and phenotype data. GExplore is publicly available at: http://genome.sfu.ca/gexplore/ PMID:19917126

Characterization and Complementation of a Chlorophyll-Less Dominant Mutant GL1 in Lagerstroemia indica.

PubMed

Wang, Shu'an; Wang, Peng; Gao, Lulu; Yang, Rutong; Li, Linfang; Zhang, Enliang; Wang, Qing; Li, Ya; Yin, Zengfang

2017-05-01

Crape myrtle (Lagerstroemia indica) is a woody ornamental plant popularly grown because of its long-lasting, midsummer blooms and beautiful colors. The GL1 dominant mutant is the first chlorophyll-less mutant identified in crape myrtle. It was obtained from a natural yellow leaf bud mutation. We previously revealed that leaf color of the GL1 mutant is affected by light intensity. However, the mechanism of the GL1 mutant on light response remained unclear. The acclimation response of mutant and wild-type (WT) plants was assessed in a time series after transferring from low light (LL) to high light (HL) by analyzing chlorophyll synthesis precursor content, photosynthetic performance, and gene expression. In LL conditions, coproporphyrinogen III (Coprogen III) content had the greatest amount of accumulation in the mutant compared with WT, increasing by 100%. This suggested that the yellow leaf phenotype of the GL1 dominant mutant might be caused by disruption of coproporphyrinogen III oxidase (CPO) biosynthesis. Furthermore, the candidate gene, oxygen-independent CPO (HEMN), might only affect expression of upstream genes involved in chlorophyll metabolism in the mutant. Moreover, two genes, photosystem II (PSII) 10 kDa protein (psbR) and chlorophyll a/b binding protein gene (CAB1), had decreased mRNA levels in the GL1 mutant within the first 96 h following LL/HL transfer compared with the WT. Hierarchical clustering revealed that these two genes shared a similar expression trend as the oxygen-dependent CPO (HEMF). These findings provide evidence that GL1 is highly coordinated with PSII stability and chloroplast biogenesis.

Amino acids Thr56 and Thr58 are not essential for elongation factor 2 function in yeast.

PubMed

Bartish, Galyna; Moradi, Hossein; Nygård, Odd

2007-10-01

Yeast elongation factor 2 is an essential protein that contains two highly conserved threonine residues, T56 and T58, that could potentially be phosphorylated by the Rck2 kinase in response to environmental stress. The importance of residues T56 and T58 for elongation factor 2 function in yeast was studied using site directed mutagenesis and functional complementation. Mutations T56D, T56G, T56K, T56N and T56V resulted in nonfunctional elongation factor 2 whereas mutated factor carrying point mutations T56M, T56C, T56S, T58S and T58V was functional. Expression of mutants T56C, T56S and T58S was associated with reduced growth rate. The double mutants T56M/T58W and T56M/T58V were also functional but the latter mutant caused increased cell death and considerably reduced growth rate. The results suggest that the physiological role of T56 and T58 as phosphorylation targets is of little importance in yeast under standard growth conditions. Yeast cells expressing mutants T56C and T56S were less able to cope with environmental stress induced by increased growth temperatures. Similarly, cells expressing mutants T56M and T56M/T58W were less capable of adapting to increased osmolarity whereas cells expressing mutant T58V behaved normally. All mutants tested were retained their ability to bind to ribosomes in vivo. However, mutants T56D, T56G and T56K were under-represented on the ribosome, suggesting that these nonfunctional forms of elongation factor 2 were less capable of competing with wild-type elongation factor 2 in ribosome binding. The presence of nonfunctional but ribosome binding forms of elongation factor 2 did not affect the growth rate of yeast cells also expressing wild-type elongation factor 2.

A De Novo Floral Transcriptome Reveals Clues into Phalaenopsis Orchid Flower Development

PubMed Central

Huang, Jian-Zhi; Lin, Chih-Peng; Cheng, Ting-Chi; Chang, Bill Chia-Han; Cheng, Shu-Yu; Chen, Yi-Wen; Lee, Chen-Yu; Chin, Shih-Wen; Chen, Fure-Chyi

2015-01-01

Phalaenopsis has a zygomorphic floral structure, including three outer tepals, two lateral inner tepals and a highly modified inner median tepal called labellum or lip; however, the regulation of its organ development remains unelucidated. We generated RNA-seq reads with the Illumina platform for floral organs of the Phalaenopsis wild-type and peloric mutant with a lip-like petal. A total of 43,552 contigs were obtained after de novo assembly. We used differentially expressed gene profiling to compare the transcriptional changes in floral organs for both the wild-type and peloric mutant. Pair-wise comparison of sepals, petals and labellum between peloric mutant and its wild-type revealed 1,838, 758 and 1,147 contigs, respectively, with significant differential expression. PhAGL6a (CUFF.17763), PhAGL6b (CUFF.17763.1), PhMADS1 (CUFF.36625.1), PhMADS4 (CUFF.25909) and PhMADS5 (CUFF.39479.1) were significantly upregulated in the lip-like petal of the peloric mutant. We used real-time PCR analysis of lip-like petals, lip-like sepals and the big lip of peloric mutants to confirm the five genes’ expression patterns. PhAGL6a, PhAGL6b and PhMADS4 were strongly expressed in the labellum and significantly upregulated in lip-like petals and lip-like sepals of peloric-mutant flowers. In addition, PhAGL6b was significantly downregulated in the labellum of the big lip mutant, with no change in expression of PhAGL6a. We provide a comprehensive transcript profile and functional analysis of Phalaenopsis floral organs. PhAGL6a PhAGL6b, and PhMADS4 might play crucial roles in the development of the labellum in Phalaenopsis. Our study provides new insights into how the orchid labellum differs and why the petal or sepal converts to a labellum in Phalaenopsis floral mutants. PMID:25970572

Functions of transmembrane domain 3 of human melanocortin-4 receptor.

PubMed

Mo, Xiu-Lei; Yang, Rui; Tao, Ya-Xiong

2012-12-01

The melanocortin-4 receptor (MC4R) is a G protein-coupled receptor critical for maintaining energy homeostasis. Transmembrane domain 3 (TM3) of MC4R contains residues that were suggested to be essential in ligand binding and signaling. Several MC4R mutations in TM3 are associated with human obesity. To gain a better understanding of the functions of TM3, we analyzed the functions of 26 residues in TM3 using alanine-scanning mutagenesis. We showed that all mutants had normal cell-surface expression. Four mutants were defective in ligand binding and signaling and six mutants had normal ligand binding but impaired cAMP production. L140A had increased basal cAMP level. To further characterize the function of L140, we generated 17 additional L140 mutants. Fifteen L140 mutants had significantly decreased cell-surface expression, with L140R and L140V expressed normally. Ten L140 mutants had increased basal cAMP activities. Four L140 mutants were defective in ligand-stimulated cAMP generation. Interestingly, with the ERK1/2 pathway, we showed that nine constitutively active mutants had similar levels of basal pERK1/2 as that of WT, and two signaling defective mutants had similar levels of pERK1/2 as that of WT upon agonist stimulation, different from their cAMP signaling properties, suggesting biased signaling in these mutant receptors. In summary, we identified 13 residues in TM3 that were essential for ligand binding and/or signaling. Moreover, L140 was critical for locking MC4R in inactive conformation and several mutants showed biased signaling in cAMP and ERK1/2 signaling pathways.

Inactivation of thyA in Staphylococcus aureus Attenuates Virulence and Has a Strong Impact on Metabolism and Virulence Gene Expression

PubMed Central

Kriegeskorte, Andre; Block, Desiree; Drescher, Mike; Windmüller, Nadine; Mellmann, Alexander; Baum, Cathrin; Neumann, Claudia; Lorè, Nicola Ivan; Bragonzi, Alessandra; Liebau, Eva; Hertel, Patrick; Seggewiss, Jochen; Becker, Karsten; Proctor, Richard A.; Peters, Georg

2014-01-01

ABSTRACT Staphylococcus aureus thymidine-dependent small-colony variants (TD-SCVs) are frequently isolated from patients with chronic S. aureus infections after long-term treatment with trimethoprim-sulfamethoxazole (TMP-SMX). While it has been shown that TD-SCVs were associated with mutations in thymidylate synthase (TS; thyA), the impact of such mutations on protein function is lacking. In this study, we showed that mutations in thyA were leading to inactivity of TS proteins, and TS inactivity led to tremendous impact on S. aureus physiology and virulence. Whole DNA microarray analysis of the constructed ΔthyA mutant identified severe alterations compared to the wild type. Important virulence regulators (agr, arlRS, sarA) and major virulence determinants (hla, hlb, sspAB, and geh) were downregulated, while genes important for colonization (fnbA, fnbB, spa, clfB, sdrC, and sdrD) were upregulated. The expression of genes involved in pyrimidine and purine metabolism and nucleotide interconversion changed significantly. NupC was identified as a major nucleoside transporter, which supported growth of the mutant during TMP-SMX exposure by uptake of extracellular thymidine. The ΔthyA mutant was strongly attenuated in virulence models, including a Caenorhabditis elegans killing model and an acute pneumonia mouse model. This study identified inactivation of TS as the molecular basis of clinical TD-SCV and showed that thyA activity has a major role for S. aureus virulence and physiology. PMID:25073642

Hepatitis B virus core antigen determines viral persistence in a C57BL/6 mouse model.

PubMed

Lin, Yi-Jiun; Huang, Li-Rung; Yang, Hung-Chih; Tzeng, Horng-Tay; Hsu, Ping-Ning; Wu, Hui-Lin; Chen, Pei-Jer; Chen, Ding-Shinn

2010-05-18

We recently developed a mouse model of hepatitis B virus (HBV) persistence, in which a single i.v. hydrodynamic injection of HBV DNA to C57BL/6 mice allows HBV replication and induces a partial immune response, so that about 20-30% of the mice carry HBV for more than 6 months. The model was used to identify the viral antigen crucial for HBV persistence. We knocked out individual HBV genes by introducing a premature termination codon to the HBV core, HBeAg, HBx, and polymerase ORFs. The specific-gene-deficient HBV mutants were hydrodynamically injected into mice and the HBV profiles of the mice were monitored. About 90% of the mice that received the HBcAg-mutated HBV plasmid exhibited high levels of hepatitis B surface antigenemia and maintained HBsAg expression for more than 6 months after injection. To map the region of HBcAg essential for viral clearance, we constructed a set of serial HBcAg deletion mutants for hydrodynamic injection. We localized the essential region of HBcAg to the carboxyl terminus, specifically to the 10 terminal amino acids (HBcAg176-185). The majority of mice receiving this HBV mutant DNA did not elicit a proper HBcAg-specific IFN-gamma response and expressed HBV virions for 6 months. These results indicate that the immune response triggered in mice by HBcAg during exposure to HBV is important in determining HBV persistence.

Gene expression profile analysis of Ligon lintless-1 (Li1) mutant reveals important genes and pathways in cotton leaf and fiber development.

PubMed

Ding, Mingquan; Jiang, Yurong; Cao, Yuefen; Lin, Lifeng; He, Shae; Zhou, Wei; Rong, Junkang

2014-02-10

Ligon lintless-1 (Li1) is a monogenic dominant mutant of Gossypium hirsutum (upland cotton) with a phenotype of impaired vegetative growth and short lint fibers. Despite years of research involving genetic mapping and gene expression profile analysis of Li1 mutant ovule tissues, the gene remains uncloned and the underlying pathway of cotton fiber elongation is still unclear. In this study, we report the whole genome-level deep-sequencing analysis of leaf tissues of the Li1 mutant. Differentially expressed genes in leaf tissues of mutant versus wild-type (WT) plants are identified, and the underlying pathways and potential genes that control leaf and fiber development are inferred. The results show that transcription factors AS2, YABBY5, and KANDI-like are significantly differentially expressed in mutant tissues compared with WT ones. Interestingly, several fiber development-related genes are found in the downregulated gene list of the mutant leaf transcriptome. These genes include heat shock protein family, cytoskeleton arrangement, cell wall synthesis, energy, H2O2 metabolism-related genes, and WRKY transcription factors. This finding suggests that the genes are involved in leaf morphology determination and fiber elongation. The expression data are also compared with the previously published microarray data of Li1 ovule tissues. Comparative analysis of the ovule transcriptomes of Li1 and WT reveals that a number of pathways important for fiber elongation are enriched in the downregulated gene list at different fiber development stages (0, 6, 9, 12, 15, 18dpa). Differentially expressed genes identified in both leaf and fiber samples are aligned with cotton whole genome sequences and combined with the genetic fine mapping results to identify a list of candidate genes for Li1. Copyright © 2013 Elsevier B.V. All rights reserved.

Gravity Persistent Signal 1 (GPS1) reveals novel cytochrome P450s involved in gravitropism.

PubMed

Withers, John C; Shipp, Matthew J; Rupasinghe, Sanjeewa G; Sukumar, Poornima; Schuler, Mary A; Muday, Gloria K; Wyatt, Sarah E

2013-01-01

Gravity is an important environmental factor that affects growth and development of plants. In response to changes in gravity, directional growth occurs along the major axes and lateral branches of both shoots and roots. The gravity persistent signal (gps) mutants of Arabidopsis thaliana were previously identified as having an altered response to gravity when reoriented relative to the gravity vector in the cold, with the gps1 mutant exhibiting a complete loss of tropic response under these conditions. Thermal asymmetric interlaced (TAIL) PCR was used to identify the gene defective in gps1. Gene expression data, molecular modeling and computational substrate dockings, quantitative RT-PCR analyses, reporter gene fusions, and physiological analyses of knockout mutants were used to characterize the genes identified. Cloning of the gene defective in gps1 and genetic complementation revealed that GPS1 encodes CYP705A22, a cytochrome P450 monooxygenase (P450). CYP705A5, a closely related family member, was identified as expressed specifically in roots in response to gravistimulation, and a mutation affecting its expression resulted in a delayed gravity response, increased flavonol levels, and decreased basipetal auxin transport. Molecular modeling coupled with in silico substrate docking and diphenylboric acid 2-aminoethyl ester (DBPA) staining indicated that these P450s are involved in biosynthesis of flavonoids potentially involved in auxin transport. The characterization of two novel P450s (CYP705A22 and CYP705A5) and their role in the gravity response has offered new insights into the regulation of the genetic and physiological controls of plant gravitropism.

Mature middle and inner ears express Chd7 and exhibit distinctive pathologies in a mouse model of CHARGE syndrome.

PubMed

Hurd, Elizabeth A; Adams, Meredith E; Layman, Wanda S; Swiderski, Donald L; Beyer, Lisa A; Halsey, Karin E; Benson, Jennifer M; Gong, Tzy-Wen; Dolan, David F; Raphael, Yehoash; Martin, Donna M

2011-12-01

Heterozygous mutations in the gene encoding chromodomain-DNA-binding-protein 7 (CHD7) cause CHARGE syndrome, a multiple anomaly condition which includes vestibular dysfunction and hearing loss. Mice with heterozygous Chd7 mutations exhibit semicircular canal dysgenesis and abnormal inner ear neurogenesis, and are an excellent model of CHARGE syndrome. Here we characterized Chd7 expression in mature middle and inner ears, analyzed morphological features of mutant ears and tested whether Chd7 mutant mice have altered responses to noise exposure and correlated those responses to inner and middle ear structure. We found that Chd7 is highly expressed in mature inner and outer hair cells, spiral ganglion neurons, vestibular sensory epithelia and middle ear ossicles. There were no obvious defects in individual hair cell morphology by prestin immunostaining or scanning electron microscopy, and cochlear innervation appeared normal in Chd7(Gt)(/+) mice. Hearing thresholds by auditory brainstem response (ABR) testing were elevated at 4 and 16 kHz in Chd7(Gt)(/+) mice, and there were reduced distortion product otoacoustic emissions (DPOAE). Exposure of Chd7(Gt)(/+) mice to broadband noise resulted in variable degrees of hair cell loss which inversely correlated with severity of stapedial defects. The degrees of hair cell loss and threshold shifts after noise exposure were more severe in wild type mice than in mutants. Together, these data indicate that Chd7(Gt)(/+) mice have combined conductive and sensorineural hearing loss, correlating with changes in both middle and inner ears. Copyright © 2011 Elsevier B.V. All rights reserved.

Mature middle and inner ears express Chd7 and exhibit distinctive pathologies in a mouse model of CHARGE syndrome

PubMed Central

Hurd, Elizabeth A.; Adams, Meredith E.; Layman, Wanda S.; Swiderski, Donald L.; Beyer, Lisa A.; Halsey, Karin E.; Benson, Jennifer M.; Gong, Tzy-Wen; Dolan, David F.; Raphael, Yehoash; Martin, Donna M.

2011-01-01

Heterozygous mutations in the gene encoding chromodomain-DNA-binding-protein 7 (CHD7) cause CHARGE syndrome, a multiple anomaly condition which includes vestibular dysfunction and hearing loss. Mice with heterozygous Chd7 mutations exhibit semicircular canal dysgenesis and abnormal inner ear neurogenesis, and are an excellent model of CHARGE syndrome. Here we characterized Chd7 expression in mature middle and inner ears, analyzed morphological features of mutant ears and tested whether Chd7 mutant mice have altered responses to noise exposure and correlated those responses to inner and middle ear structure. We found that Chd7 is highly expressed in mature inner and outer hair cells, spiral ganglion neurons, vestibular sensory epithelia and middle ear ossicles. There were no obvious defects in individual hair cell morphology by Prestin immunostaining or scanning electron microscopy, and cochlear innervation appeared normal in Chd7Gt/+ mice. Hearing thresholds by auditory brainstem response (ABR) testing were elevated at 4 and 16 kHz in Chd7Gt/+ mice, and there were reduced distortion product otoacoustic emissions (DPOAE). Exposure of Chd7Gt/+ mice to broadband noise resulted in variable degrees of hair cell loss which inversely correlated with severity of stapedial defects. The degrees of hair cell loss and threshold shifts after noise exposure were more severe in wild type mice than in mutants. Together, these data indicate that Chd7Gt/+ mice have combined conductive and sensorineural hearing loss, correlating with changes in both middle and inner ears. PMID:21875659

Expression of Haemophilus ducreyi Collagen Binding Outer Membrane Protein NcaA Is Required for Virulence in Swine and Human Challenge Models of Chancroid

PubMed Central

Fulcher, Robert A.; Cole, Leah E.; Janowicz, Diane M.; Toffer, Kristen L.; Fortney, Kate R.; Katz, Barry P.; Orndorff, Paul E.; Spinola, Stanley M.; Kawula, Thomas H.

2006-01-01

Haemophilus ducreyi, the etiologic agent of the sexually transmitted genital ulcer disease chancroid, has been shown to associate with dermal collagen fibers within infected skin lesions. Here we describe NcaA, a previously uncharacterized outer membrane protein that is important for H. ducreyi collagen binding and host colonization. An H. ducreyi strain lacking the ncaA gene was impaired in adherence to type I collagen but not fibronectin (plasma or cellular form) or heparin. The mutation had no effect on serum resistance or binding to HaCaT keratinocytes or human foreskin fibroblasts in vitro. Escherichia coli expressing H. ducreyi NcaA bound to type I collagen, demonstrating that NcaA is sufficient to confer collagen attachment. The importance of NcaA in H. ducreyi pathogenesis was assessed using both swine and human experimental models of chancroid. In the swine model, 20% of lesions from sites inoculated with the ncaA mutant were culture positive for H. ducreyi 7 days after inoculation, compared to 73% of wild-type-inoculated sites. The average number of CFU recovered from mutant-inoculated lesions was also significantly reduced compared to that recovered from wild-type-inoculated sites at both 2 and 7 days after inoculation. In the human challenge model, 8 of 30 sites inoculated with wild-type H. ducreyi progressed to the pustular stage, compared to 0 of 30 sites inoculated with the ncaA mutant. Together these results demonstrate that the collagen binding protein NcaA is required for H. ducreyi infection. PMID:16622201

Expression of Haemophilus ducreyi collagen binding outer membrane protein NcaA is required for virulence in swine and human challenge models of chancroid.

PubMed

Fulcher, Robert A; Cole, Leah E; Janowicz, Diane M; Toffer, Kristen L; Fortney, Kate R; Katz, Barry P; Orndorff, Paul E; Spinola, Stanley M; Kawula, Thomas H

2006-05-01

Haemophilus ducreyi, the etiologic agent of the sexually transmitted genital ulcer disease chancroid, has been shown to associate with dermal collagen fibers within infected skin lesions. Here we describe NcaA, a previously uncharacterized outer membrane protein that is important for H. ducreyi collagen binding and host colonization. An H. ducreyi strain lacking the ncaA gene was impaired in adherence to type I collagen but not fibronectin (plasma or cellular form) or heparin. The mutation had no effect on serum resistance or binding to HaCaT keratinocytes or human foreskin fibroblasts in vitro. Escherichia coli expressing H. ducreyi NcaA bound to type I collagen, demonstrating that NcaA is sufficient to confer collagen attachment. The importance of NcaA in H. ducreyi pathogenesis was assessed using both swine and human experimental models of chancroid. In the swine model, 20% of lesions from sites inoculated with the ncaA mutant were culture positive for H. ducreyi 7 days after inoculation, compared to 73% of wild-type-inoculated sites. The average number of CFU recovered from mutant-inoculated lesions was also significantly reduced compared to that recovered from wild-type-inoculated sites at both 2 and 7 days after inoculation. In the human challenge model, 8 of 30 sites inoculated with wild-type H. ducreyi progressed to the pustular stage, compared to 0 of 30 sites inoculated with the ncaA mutant. Together these results demonstrate that the collagen binding protein NcaA is required for H. ducreyi infection.

Generation and characterization of a human-mouse chimeric antibody against the extracellular domain of claudin-1 for cancer therapy using a mouse model.

PubMed

Hashimoto, Yosuke; Tada, Minoru; Iida, Manami; Nagase, Shotaro; Hata, Tomoyuki; Watari, Akihiro; Okada, Yoshiaki; Doi, Takefumi; Fukasawa, Masayoshi; Yagi, Kiyohito; Kondoh, Masuo

2016-08-12

Claudin-1 (CLDN-1), an integral transmembrane protein, is an attractive target for drug absorption, prevention of infection, and cancer therapy. Previously, we generated mouse anti-CLDN-1 monoclonal antibodies (mAbs) and found that they enhanced epidermal absorption of a drug and prevented hepatitis C virus infection in human hepatocytes. Here, we investigated anti-tumor activity of a human-mouse chimeric IgG1, xi-3A2, from one of the anti-CLDN-1 mAbs, clone 3A2. Xi-3A2 accumulated in the tumor tissues in mice bearing with human CLDN-1-expressing tumor cells. Xi-3A2 activated Fcγ receptor IIIa-expressing reporter cells in the presence of human CLDN-1-expressing cells, suggesting xi-3A2 has a potential to exhibit antibody-dependent cellular cytotoxicity against CLDN-1 expressing tumor cells. We also constructed a mutant xi-3A2 antibody with Gly, Ser, and Ile substituted with Ala, Asp, and Arg at positions 236, 239, and 332 of the Fc domain. This mutant antibody showed greater activation of Fcγ receptor IIIa and in vivo anti-tumor activity in mice bearing human CLDN-1-expressing tumors than xi-3A2 did. These findings indicate that the G236A/S239D/I332E mutant of xi-3A2 might be a promising lead for tumor therapy. Copyright © 2016 Elsevier Inc. All rights reserved.

Silencing neuronal mutant androgen receptor in a mouse model of spinal and bulbar muscular atrophy.

PubMed

Sahashi, Kentaro; Katsuno, Masahisa; Hung, Gene; Adachi, Hiroaki; Kondo, Naohide; Nakatsuji, Hideaki; Tohnai, Genki; Iida, Madoka; Bennett, C Frank; Sobue, Gen

2015-11-01

Spinal and bulbar muscular atrophy (SBMA), an adult-onset neurodegenerative disease that affects males, results from a CAG triplet repeat/polyglutamine expansions in the androgen receptor (AR) gene. Patients develop progressive muscular weakness and atrophy, and no effective therapy is currently available. The tissue-specific pathogenesis, especially relative pathological contributions between degenerative motor neurons and muscles, remains inconclusive. Though peripheral pathology in skeletal muscle caused by toxic AR protein has been recently reported to play a pivotal role in the pathogenesis of SBMA using mouse models, the role of motor neuron degeneration in SBMA has not been rigorously investigated. Here, we exploited synthetic antisense oligonucleotides to inhibit the RNA levels of mutant AR in the central nervous system (CNS) and explore its therapeutic effects in our SBMA mouse model that harbors a mutant AR gene with 97 CAG expansions and characteristic SBMA-like neurogenic phenotypes. A single intracerebroventricular administration of the antisense oligonucleotides in the presymptomatic phase efficiently suppressed the mutant gene expression in the CNS, and delayed the onset and progression of motor dysfunction, improved body weight gain and survival with the amelioration of neuronal histopathology in motor units such as spinal motor neurons, neuromuscular junctions and skeletal muscle. These findings highlight the importance of the neurotoxicity of mutant AR protein in motor neurons as a therapeutic target. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Mutant Huntingtin Gene-Dose Impacts on Aggregate Deposition, DARPP32 Expression and Neuroinflammation in HdhQ150 Mice

PubMed Central

Young, Douglas; Mayer, Franziska; Vidotto, Nella; Schweizer, Tatjana; Berth, Ramon; Abramowski, Dorothee; Shimshek, Derya R.; van der Putten, P. Herman; Schmid, Peter

2013-01-01

Huntington's disease (HD) is an autosomal dominant, progressive and fatal neurological disorder caused by an expansion of CAG repeats in exon-1 of the huntingtin gene. The encoded poly-glutamine stretch renders mutant huntingtin prone to aggregation. HdhQ150 mice genocopy a pathogenic repeat (∼150 CAGs) in the endogenous mouse huntingtin gene and model predominantly pre-manifest HD. Treating early is likely important to prevent or delay HD, and HdhQ150 mice may be useful to assess therapeutic strategies targeting pre-manifest HD. This requires appropriate markers and here we demonstrate, that pre-symptomatic HdhQ150 mice show several dramatic mutant huntingtin gene-dose dependent pathological changes including: (i) an increase of neuronal intra-nuclear inclusions (NIIs) in brain, (ii) an increase of extra-nuclear aggregates in dentate gyrus, (iii) a decrease of DARPP32 protein and (iv) an increase in glial markers of neuroinflammation, which curiously did not correlate with local neuronal mutant huntingtin inclusion-burden. HdhQ150 mice developed NIIs also in all retinal neuron cell-types, demonstrating that retinal NIIs are not specific to human exon-1 R6 HD mouse models. Taken together, the striking and robust mutant huntingtin gene-dose related changes in aggregate-load, DARPP32 levels and glial activation markers should greatly facilitate future testing of therapeutic strategies in the HdhQ150 HD mouse model. PMID:24086450

Convergence of developmental mutants into a single tomato model system: 'Micro-Tom' as an effective toolkit for plant development research

PubMed Central

2011-01-01

Background The tomato (Solanum lycopersicum L.) plant is both an economically important food crop and an ideal dicot model to investigate various physiological phenomena not possible in Arabidopsis thaliana. Due to the great diversity of tomato cultivars used by the research community, it is often difficult to reliably compare phenotypes. The lack of tomato developmental mutants in a single genetic background prevents the stacking of mutations to facilitate analysis of double and multiple mutants, often required for elucidating developmental pathways. Results We took advantage of the small size and rapid life cycle of the tomato cultivar Micro-Tom (MT) to create near-isogenic lines (NILs) by introgressing a suite of hormonal and photomorphogenetic mutations (altered sensitivity or endogenous levels of auxin, ethylene, abscisic acid, gibberellin, brassinosteroid, and light response) into this genetic background. To demonstrate the usefulness of this collection, we compared developmental traits between the produced NILs. All expected mutant phenotypes were expressed in the NILs. We also created NILs harboring the wild type alleles for dwarf, self-pruning and uniform fruit, which are mutations characteristic of MT. This amplified both the applications of the mutant collection presented here and of MT as a genetic model system. Conclusions The community resource presented here is a useful toolkit for plant research, particularly for future studies in plant development, which will require the simultaneous observation of the effect of various hormones, signaling pathways and crosstalk. PMID:21714900

Different Expression Levels of Human Mutant Ubiquitin B+1 (UBB+1) Can Modify Chronological Lifespan or Stress Resistance of Saccharomyces cerevisiae

PubMed Central

Muñoz-Arellano, Ana Joyce; Chen, Xin; Molt, Andrea; Meza, Eugenio; Petranovic, Dina

2018-01-01

The ubiquitin-proteasome system (UPS) is the main pathway responsible for the degradation of misfolded proteins, and its dysregulation has been implicated in several neurodegenerative diseases, including Alzheimer’s disease (AD). UBB+1, a mutant variant of ubiquitin B, was found to accumulate in neurons of AD patients and it has been linked to UPS dysfunction and neuronal death. Using the yeast Saccharomyces cerevisiae as a model system, we constitutively expressed UBB+1 to evaluate its effects on proteasome function and cell death, particularly under conditions of chronological aging. We showed that the expression of UBB+1 caused inhibition of the three proteasomal proteolytic activities (caspase-like (β1), trypsin-like (β2) and chymotrypsin-like (β5) activities) in yeast. Interestingly, this inhibition did not alter cell viability of growing cells. Moreover, we showed that cells expressing UBB+1 at lower level displayed an increased capacity to degrade induced misfolded proteins. When we evaluated cells during chronological aging, UBB+1 expression at lower level, prevented cells to accumulate reactive oxygen species (ROS) and avert apoptosis, dramatically increasing yeast life span. Since proteasome inhibition by UBB+1 has previously been shown to induce chaperone expression and thus protect against stress, we evaluated our UBB+1 model under heat shock and oxidative stress. Higher expression of UBB+1 caused thermotolerance in yeast due to induction of chaperones, which occurred to a lesser extent at lower expression level of UBB+1 (where we observed the phenotype of extended life span). Altering UPS capacity by differential expression of UBB+1 protects cells against several stresses during chronological aging. This system can be valuable to study the effects of UBB+1 on misfolded proteins involved in neurodegeneration and aging.

Enhanced cellulase producing mutants developed from heterokaryotic Aspergillus strain.

PubMed

Kaur, Baljit; Oberoi, H S; Chadha, B S

2014-03-01

A heterokaryon 28, derived through protoplast fusion between Aspergillus nidulans and Aspergillus tubingensis (Dal8), was subjected cyclic mutagenesis followed by selection on increasing levels of 2-deoxy glucose (2-DG) as selection marker. The derived deregulated cellulase hyper producing mutant '64', when compared to fusant 28, produced 9.83, 7.8, 3.2, 4.2 and 19.74 folds higher endoglucanase, β-glucosidase, cellobiohydrolase, FPase and xylanase, respectively, under shake cultures. The sequence analysis of PCR amplified β-glucosidase gene from wild and mutant showed nucleotide deletion/substitution. The mutants showed highly catalytic efficient β-glucosidase as evident from low Km and high Vmax values. The expression profiling through zymogram analysis also indicated towards over-expression of cellulases. The up/down regulated expressed proteins observed through SDS-PAGE were identified by Peptide mass fingerprinting The cellulase produced by mutants in conjunction with cellulase free xylanase derived from Thermomyces lanuginosus was used for efficient utilization of alkali treated rice straw for obtaining xylo-oligosaccharides and ethanol. Copyright © 2014 Elsevier Ltd. All rights reserved.

Altered Regulation of the Diguanylate Cyclase YaiC Reduces Production of Type 1 Fimbriae in a Pst Mutant of Uropathogenic Escherichia coli CFT073

PubMed Central

Crépin, Sébastien; Porcheron, Gaëlle; Houle, Sébastien; Harel, Josée

2017-01-01

ABSTRACT The pst gene cluster encodes the phosphate-specific transport (Pst) system. Inactivation of the Pst system constitutively activates the two-component regulatory system PhoBR and attenuates the virulence of pathogenic bacteria. In uropathogenic Escherichia coli strain CFT073, attenuation by inactivation of pst is predominantly attributed to the decreased expression of type 1 fimbriae. However, the molecular mechanisms connecting the Pst system and type 1 fimbriae are unknown. To address this, a transposon library was constructed in the pst mutant, and clones were tested for a regain in type 1 fimbrial production. Among them, the diguanylate cyclase encoded by yaiC (adrA in Salmonella) was identified to connect the Pst system and type 1 fimbrial expression. In the pst mutant, the decreased expression of type 1 fimbriae is connected by the induction of yaiC. This is predominantly due to altered expression of the FimBE-like recombinase genes ipuA and ipbA, affecting at the same time the inversion of the fim promoter switch (fimS). In the pst mutant, inactivation of yaiC restored fim-dependent adhesion to bladder cells and virulence. Interestingly, the expression of yaiC was activated by PhoB, since transcription of yaiC was linked to the PhoB-dependent phoA-psiF operon. As YaiC is involved in cyclic di-GMP (c-di-GMP) biosynthesis, an increased accumulation of c-di-GMP was observed in the pst mutant. Hence, the results suggest that one mechanism by which deletion of the Pst system reduces the expression of type 1 fimbriae is through PhoBR-mediated activation of yaiC, which in turn increases the accumulation of c-di-GMP, represses the fim operon, and, consequently, attenuates virulence in the mouse urinary tract infection model. IMPORTANCE Urinary tract infections (UTIs) are common bacterial infections in humans. They are mainly caused by uropathogenic Escherichia coli (UPEC). We previously showed that interference with phosphate homeostasis decreases the expression of type 1 fimbriae and attenuates UPEC virulence. Herein, we identified that alteration of the phosphate metabolism increases production of the signaling molecule c-di-GMP, which in turn decreases the expression of type 1 fimbriae. We also determine the regulatory cascade leading to the accumulation of c-di-GMP and identify the Pho regulon as new players in c-di-GMP-mediated cell signaling. By understanding the molecular mechanisms leading to the expression of virulence factors, we will be in a better position to develop new therapeutics. PMID:28924030

Altered Regulation of the Diguanylate Cyclase YaiC Reduces Production of Type 1 Fimbriae in a Pst Mutant of Uropathogenic Escherichia coli CFT073.

PubMed

Crépin, Sébastien; Porcheron, Gaëlle; Houle, Sébastien; Harel, Josée; Dozois, Charles M

2017-12-15

The pst gene cluster encodes the phosphate-specific transport (Pst) system. Inactivation of the Pst system constitutively activates the two-component regulatory system PhoBR and attenuates the virulence of pathogenic bacteria. In uropathogenic Escherichia coli strain CFT073, attenuation by inactivation of pst is predominantly attributed to the decreased expression of type 1 fimbriae. However, the molecular mechanisms connecting the Pst system and type 1 fimbriae are unknown. To address this, a transposon library was constructed in the pst mutant, and clones were tested for a regain in type 1 fimbrial production. Among them, the diguanylate cyclase encoded by yaiC ( adrA in Salmonella ) was identified to connect the Pst system and type 1 fimbrial expression. In the pst mutant, the decreased expression of type 1 fimbriae is connected by the induction of yaiC This is predominantly due to altered expression of the FimBE-like recombinase genes ipuA and ipbA , affecting at the same time the inversion of the fim promoter switch ( fimS ). In the pst mutant, inactivation of yaiC restored fim -dependent adhesion to bladder cells and virulence. Interestingly, the expression of yaiC was activated by PhoB, since transcription of yaiC was linked to the PhoB-dependent phoA-psiF operon. As YaiC is involved in cyclic di-GMP (c-di-GMP) biosynthesis, an increased accumulation of c-di-GMP was observed in the pst mutant. Hence, the results suggest that one mechanism by which deletion of the Pst system reduces the expression of type 1 fimbriae is through PhoBR-mediated activation of yaiC , which in turn increases the accumulation of c-di-GMP, represses the fim operon, and, consequently, attenuates virulence in the mouse urinary tract infection model. IMPORTANCE Urinary tract infections (UTIs) are common bacterial infections in humans. They are mainly caused by uropathogenic Escherichia coli (UPEC). We previously showed that interference with phosphate homeostasis decreases the expression of type 1 fimbriae and attenuates UPEC virulence. Herein, we identified that alteration of the phosphate metabolism increases production of the signaling molecule c-di-GMP, which in turn decreases the expression of type 1 fimbriae. We also determine the regulatory cascade leading to the accumulation of c-di-GMP and identify the Pho regulon as new players in c-di-GMP-mediated cell signaling. By understanding the molecular mechanisms leading to the expression of virulence factors, we will be in a better position to develop new therapeutics. Copyright © 2017 American Society for Microbiology.

[Isolation and function of genes regulating aphB expression in Vibrio cholerae].

PubMed

Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao

2012-02-04

We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.

Unravelling the molecular basis for light modulated cellulase gene expression - the role of photoreceptors in Neurospora crassa

PubMed Central

2012-01-01

Background Light represents an important environmental cue, which exerts considerable influence on the metabolism of fungi. Studies with the biotechnological fungal workhorse Trichoderma reesei (Hypocrea jecorina) have revealed an interconnection between transcriptional regulation of cellulolytic enzymes and the light response. Neurospora crassa has been used as a model organism to study light and circadian rhythm biology. We therefore investigated whether light also regulates transcriptional regulation of cellulolytic enzymes in N. crassa. Results We show that the N. crassa photoreceptor genes wc-1, wc-2 and vvd are involved in regulation of cellulase gene expression, indicating that this phenomenon is conserved among filamentous fungi. The negative effect of VVD on production of cellulolytic enzymes is thereby accomplished by its role in photoadaptation and hence its function in White collar complex (WCC) formation. In contrast, the induction of vvd expression by the WCC does not seem to be crucial in this process. Additionally, we found that WC-1 and WC-2 not only act as a complex, but also have individual functions upon growth on cellulose. Conclusions Genome wide transcriptome analysis of photoreceptor mutants and evaluation of results by analysis of mutant strains identified several candidate genes likely to play a role in light modulated cellulase gene expression. Genes with functions in amino acid metabolism, glycogen metabolism, energy supply and protein folding are enriched among genes with decreased expression levels in the wc-1 and wc-2 mutants. The ability to properly respond to amino acid starvation, i. e. up-regulation of the cross pathway control protein cpc-1, was found to be beneficial for cellulase gene expression. Our results further suggest a contribution of oxidative depolymerization of cellulose to plant cell wall degradation in N. crassa. PMID:22462823

Haemophilus influenzae OxyR: Characterization of Its Regulation, Regulon and Role in Fitness

PubMed Central

Whitby, Paul W.; Morton, Daniel J.; VanWagoner, Timothy M.; Seale, Thomas W.; Cole, Brett K.; Mussa, Huda J.; McGhee, Phillip A.; Bauer, Chee Yoon S.; Springer, Jennifer M.; Stull, Terrence L.

2012-01-01

To prevent damage by reactive oxygen species, many bacteria have evolved rapid detection and response systems, including the OxyR regulon. The OxyR system detects reactive oxygen and coordinates the expression of numerous defensive antioxidants. In many bacterial species the coordinated OxyR-regulated response is crucial for in vivo survival. Regulation of the OxyR regulon of Haemophilus influenzae was examined in vitro, and significant variation in the regulated genes of the OxyR regulon among strains of H. influenzae was observed. Quantitative PCR studies demonstrated a role for the OxyR-regulated peroxiredoxin/glutaredoxin as a mediator of the OxyR response, and also indicated OxyR self-regulation through a negative feedback loop. Analysis of transcript levels in H. influenzae samples derived from an animal model of otitis media demonstrated that the members of the OxyR regulon were actively upregulated within the chinchilla middle ear. H. influenzae mutants lacking the oxyR gene exhibited increased sensitivity to challenge with various peroxides. The impact of mutations in oxyR was assessed in various animal models of H. influenzae disease. In paired comparisons with the corresponding wild-type strains, the oxyR mutants were unaffected in both the chinchilla model of otitis media and an infant model of bacteremia. However, in weanling rats the oxyR mutant was significantly impaired compared to the wild-type strain. In contrast, in all three animal models when infected with a mixture of equal numbers of both wild-type and mutant strains the mutant strain was significantly out competed by the wild-type strain. These findings clearly establish a crucial role for OxyR in bacterial fitness. PMID:23226321

Functional assessment of the Medicago truncatula NIP/LATD protein demonstrates that it is a high-affinity nitrate transporter.

PubMed

Bagchi, Rammyani; Salehin, Mohammad; Adeyemo, O Sarah; Salazar, Carolina; Shulaev, Vladimir; Sherrier, D Janine; Dickstein, Rebecca

2012-10-01

The Medicago truncatula NIP/LATD (for Numerous Infections and Polyphenolics/Lateral root-organ Defective) gene encodes a protein found in a clade of nitrate transporters within the large NRT1(PTR) family that also encodes transporters of dipeptides and tripeptides, dicarboxylates, auxin, and abscisic acid. Of the NRT1(PTR) members known to transport nitrate, most are low-affinity transporters. Here, we show that M. truncatula nip/latd mutants are more defective in their lateral root responses to nitrate provided at low (250 μm) concentrations than at higher (5 mm) concentrations; however, nitrate uptake experiments showed no discernible differences in uptake in the mutants. Heterologous expression experiments showed that MtNIP/LATD encodes a nitrate transporter: expression in Xenopus laevis oocytes conferred upon the oocytes the ability to take up nitrate from the medium with high affinity, and expression of MtNIP/LATD in an Arabidopsis chl1(nrt1.1) mutant rescued the chlorate susceptibility phenotype. X. laevis oocytes expressing mutant Mtnip-1 and Mtlatd were unable to take up nitrate from the medium, but oocytes expressing the less severe Mtnip-3 allele were proficient in nitrate transport. M. truncatula nip/latd mutants have pleiotropic defects in nodulation and root architecture. Expression of the Arabidopsis NRT1.1 gene in mutant Mtnip-1 roots partially rescued Mtnip-1 for root architecture defects but not for nodulation defects. This suggests that the spectrum of activities inherent in AtNRT1.1 is different from that possessed by MtNIP/LATD, but it could also reflect stability differences of each protein in M. truncatula. Collectively, the data show that MtNIP/LATD is a high-affinity nitrate transporter and suggest that it could have another function.

Functional Assessment of the Medicago truncatula NIP/LATD Protein Demonstrates That It Is a High-Affinity Nitrate Transporter1[W][OA

PubMed Central

Bagchi, Rammyani; Salehin, Mohammad; Adeyemo, O. Sarah; Salazar, Carolina; Shulaev, Vladimir; Sherrier, D. Janine; Dickstein, Rebecca

2012-01-01

The Medicago truncatula NIP/LATD (for Numerous Infections and Polyphenolics/Lateral root-organ Defective) gene encodes a protein found in a clade of nitrate transporters within the large NRT1(PTR) family that also encodes transporters of dipeptides and tripeptides, dicarboxylates, auxin, and abscisic acid. Of the NRT1(PTR) members known to transport nitrate, most are low-affinity transporters. Here, we show that M. truncatula nip/latd mutants are more defective in their lateral root responses to nitrate provided at low (250 μm) concentrations than at higher (5 mm) concentrations; however, nitrate uptake experiments showed no discernible differences in uptake in the mutants. Heterologous expression experiments showed that MtNIP/LATD encodes a nitrate transporter: expression in Xenopus laevis oocytes conferred upon the oocytes the ability to take up nitrate from the medium with high affinity, and expression of MtNIP/LATD in an Arabidopsis chl1(nrt1.1) mutant rescued the chlorate susceptibility phenotype. X. laevis oocytes expressing mutant Mtnip-1 and Mtlatd were unable to take up nitrate from the medium, but oocytes expressing the less severe Mtnip-3 allele were proficient in nitrate transport. M. truncatula nip/latd mutants have pleiotropic defects in nodulation and root architecture. Expression of the Arabidopsis NRT1.1 gene in mutant Mtnip-1 roots partially rescued Mtnip-1 for root architecture defects but not for nodulation defects. This suggests that the spectrum of activities inherent in AtNRT1.1 is different from that possessed by MtNIP/LATD, but it could also reflect stability differences of each protein in M. truncatula. Collectively, the data show that MtNIP/LATD is a high-affinity nitrate transporter and suggest that it could have another function. PMID:22858636

Effective non-denaturing purification method for improving the solubility of recombinant actin-binding proteins produced by bacterial expression.

PubMed

Chung, Jeong Min; Lee, Sangmin; Jung, Hyun Suk

2017-05-01

Bacterial expression is commonly used to produce recombinant and truncated mutant eukaryotic proteins. However, heterologous protein expression may render synthesized proteins insoluble. The conventional method used to express a poorly soluble protein, which involves denaturation and refolding, is time-consuming and inefficient. There are several non-denaturing approaches that can increase the solubility of recombinant proteins that include using different bacterial cell strains, altering the time of induction, lowering the incubation temperature, and employing different detergents for purification. In this study, we compared several non-denaturing protocols to express and purify two insoluble 34 kDa actin-bundling protein mutants. The solubility of the mutant proteins was not affected by any of the approaches except for treatment with the detergent sarkosyl. These results indicate that sarkosyl can effectively improve the solubility of insoluble proteins during bacterial expression. Copyright © 2016. Published by Elsevier Inc.

Amyloid protein-mediated differential DNA methylation status regulates gene expression in Alzheimer's disease model cell line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sung, Hye Youn; Choi, Eun Nam; Ahn Jo, Sangmee

2011-11-04

Highlights: Black-Right-Pointing-Pointer Genome-wide DNA methylation pattern in Alzheimer's disease model cell line. Black-Right-Pointing-Pointer Integrated analysis of CpG methylation and mRNA expression profiles. Black-Right-Pointing-Pointer Identify three Swedish mutant target genes; CTIF, NXT2 and DDR2 gene. Black-Right-Pointing-Pointer The effect of Swedish mutation on alteration of DNA methylation and gene expression. -- Abstract: The Swedish mutation of amyloid precursor protein (APP-sw) has been reported to dramatically increase beta amyloid production through aberrant cleavage at the beta secretase site, causing early-onset Alzheimer's disease (AD). DNA methylation has been reported to be associated with AD pathogenesis, but the underlying molecular mechanism of APP-sw-mediated epigenetic alterationsmore » in AD pathogenesis remains largely unknown. We analyzed genome-wide interplay between promoter CpG DNA methylation and gene expression in an APP-sw-expressing AD model cell line. To identify genes whose expression was regulated by DNA methylation status, we performed integrated analysis of CpG methylation and mRNA expression profiles, and identified three target genes of the APP-sw mutant; hypomethylated CTIF (CBP80/CBP20-dependent translation initiation factor) and NXT2 (nuclear exporting factor 2), and hypermethylated DDR2 (discoidin domain receptor 2). Treatment with the demethylating agent 5-aza-2 Prime -deoxycytidine restored mRNA expression of these three genes, implying methylation-dependent transcriptional regulation. The profound alteration in the methylation status was detected at the -435, -295, and -271 CpG sites of CTIF, and at the -505 to -341 region in the promoter of DDR2. In the promoter region of NXT2, only one CpG site located at -432 was differentially unmethylated in APP-sw cells. Thus, we demonstrated the effect of the APP-sw mutation on alteration of DNA methylation and subsequent gene expression. This epigenetic regulatory mechanism may contribute to the pathogenesis of AD.« less

Identification of Mutant Genes and Introgressed Tiger Salamander DNA in the Laboratory Axolotl, Ambystoma mexicanum.

PubMed

Woodcock, M Ryan; Vaughn-Wolfe, Jennifer; Elias, Alexandra; Kump, D Kevin; Kendall, Katharina Denise; Timoshevskaya, Nataliya; Timoshevskiy, Vladimir; Perry, Dustin W; Smith, Jeramiah J; Spiewak, Jessica E; Parichy, David M; Voss, S Randal

2017-01-31

The molecular genetic toolkit of the Mexican axolotl, a classic model organism, has matured to the point where it is now possible to identify genes for mutant phenotypes. We used a positional cloning-candidate gene approach to identify molecular bases for two historic axolotl pigment phenotypes: white and albino. White (d/d) mutants have defects in pigment cell morphogenesis and differentiation, whereas albino (a/a) mutants lack melanin. We identified in white mutants a transcriptional defect in endothelin 3 (edn3), encoding a peptide factor that promotes pigment cell migration and differentiation in other vertebrates. Transgenic restoration of Edn3 expression rescued the homozygous white mutant phenotype. We mapped the albino locus to tyrosinase (tyr) and identified polymorphisms shared between the albino allele (tyr a ) and tyr alleles in a Minnesota population of tiger salamanders from which the albino trait was introgressed. tyr a has a 142 bp deletion and similar engineered alleles recapitulated the albino phenotype. Finally, we show that historical introgression of tyr a significantly altered genomic composition of the laboratory axolotl, yielding a distinct, hybrid strain of ambystomatid salamander. Our results demonstrate the feasibility of identifying genes for traits in the laboratory Mexican axolotl.

Novel CLCNKB mutations causing Bartter syndrome affect channel surface expression.

PubMed

Keck, Mathilde; Andrini, Olga; Lahuna, Olivier; Burgos, Johanna; Cid, L Pablo; Sepúlveda, Francisco V; L'hoste, Sébastien; Blanchard, Anne; Vargas-Poussou, Rosa; Lourdel, Stéphane; Teulon, Jacques

2013-09-01

Mutations in the CLCNKB gene encoding the ClC-Kb Cl(-) channel cause Bartter syndrome, which is a salt-losing renal tubulopathy. Here, we investigate the functional consequences of seven mutations. When expressed in Xenopus laevis oocytes, four mutants carried no current (c.736G>C, p.Gly246Arg; c.1271G>A, p.Gly424Glu; c.1313G>A, p.Arg438His; c.1316T>C, p.Leu439Pro), whereas others displayed a 30%-60% reduction in conductance as compared with wild-type ClC-Kb (c.242T>C, p.Leu81Pro; c.274C>T, p.Arg92Trp; c.1052G>C, p.Arg351Pro). Anion selectivity and sensitivity to external Ca(2+) and H(+), typical of the ClC-Kb channel, were not modified in the partially active mutants. In oocytes, we found that all the mutations reduced surface expression with a profile similar to that observed for currents. In HEK293 cells, the currents in the mutants had similar profiles to those obtained in oocytes, except for p.Leu81Pro, which produced no current. Furthermore, p.Arg92Trp and p.Arg351Pro mutations did not modify the unit-conductance of closely related ClC-K1. Western blot analysis in HEK293 cells showed that ClC-Kb protein abundance was lower for the nonconducting mutants but similar to wild-type for other mutants. Overall, two classes of mutants can be distinguished: nonconducting mutants associated with low total protein expression, and partially conducting mutants with unaltered channel properties and ClC-Kb protein abundance. © 2013 WILEY PERIODICALS, INC.

Lovastatin synergizes with itraconazole against planktonic cells and biofilms of Candida albicans through the regulation on ergosterol biosynthesis pathway.

PubMed

Zhou, Yujie; Yang, Hong; Zhou, Xuedong; Luo, Hongke; Tang, Fan; Yang, Jin; Alterovitz, Gil; Cheng, Lei; Ren, Biao

2018-06-01

The increase of fungal infectious diseases and lack of safe and efficacious antifungal drugs result in the urgent need of new therapeutic strategies. Here, we repurposed the lovastatin (LOV) as a synergistic antifungal potentiator to itraconazole (ITZ) against Candida albicans planktonic cells and biofilms in vitro for the first time. Mutants from ergosterol biosynthesis pathway were employed and key gene expression profiles of ergosterol pathway were also measured. LOV single treatment was unable to inhibit C. albicans strains except the ERG3 and ERG11 double mutant. LOV and ITZ combination was capable of inhibiting the C. albicans planktonic cells and biofilms synergistically including the ITZ resistant mutants. The synergistic antifungal ability was stronger in either ERG11 or ERG3 dysfunctional mutants compared to wild type. The combination lost the synergistic activities in the ERG11 and ERG3 double mutant, while it was sensitive to LOV single treatment. The expression of HMG1, encoding HMG-CoA the target of LOV, was significantly upregulated in ERG11 and ERG3 double mutant strain by the treatment of the combination at 1.5 and 3 h. The combination also significantly increased the HMG1 expression in mutants from ergosterol pathway compared with wild type. The ERG11 and ERG3 gene expressions were upregulated by ITZ and its combination with LOV, but seemingly not by LOV single treatment after 1.5 and 3 h. The combination of LOV and ITZ on C. albicans planktonic cells and biofilms highlights its potential clinical practice especially against the azole drug-resistant mutants.

A Competitive Infection Model of Hematogenously Disseminated Candidiasis in Mice Redefines the Role of Candida albicans IRS4 in Pathogenesis

PubMed Central

Raman, Suresh B.; Nguyen, M. Hong; Cheng, Shaoji; Badrane, Hassan; Iczkowski, Kenneth A.; Wegener, Marilyn; Gaffen, Sarah L.; Mitchell, Aaron P.

2013-01-01

Candida albicans IRS4 encodes a protein that regulates phosphatidylinositol-(4,5)-bisphosphate, which was shown to contribute to hematogenously disseminated candidiasis (DC) after several days in the standard mouse model. Our objective was to more accurately define the temporal contributions of IRS4 to pathogenesis. During competition assays in vitro, an irs4-null (Δirs4) mutant exhibited wild-type fitness. In DC experiments, mice were infected intravenously with the Δirs4 mutant, strain CAI-12 (1 × 105 CFU), or a mixture of the strains (0.5 × 105 CFU each). In single-strain infections, quantitative PCR revealed reduced Δirs4 mutant burdens within kidneys at days 1, 4, and 7 but not 6 h. In competitive infections, the Δirs4 mutant was outcompeted by CAI-12 in each mouse at ≥6 h (competitive indices, P ≤ 0.0001). At 4 and 7 days, the Δirs4 mutant burdens during competitive infections were significantly lower than those during single-strain infections (P = 0.01 and P < 0.001, respectively), suggesting increased susceptibility to inflammatory responses. Phagocytic infiltration of kidneys in response to CAI-12 or competitive infections was significantly greater than that in response to Δirs4 mutant infection at days 1 and 4 (P < 0.001), and the Δirs4 mutant was more susceptible to phagocytosis and killing by human polymorphonuclear cells (P = 0.01 and P = 0.006, respectively) and mouse macrophages in vitro (P = 0.04 and P = 0.01, respectively). Therefore, IRS4 contributes to tissue invasion at early stages of DC and mediates resistance to phagocytosis as DC progresses. Microarray analysis revealed remarkably similar gene expression by the Δirs4 mutant and reference strain CAI-12 within blood, suggesting that IRS4 is not significantly involved in the hematogenous stage of disease. A competitive DC model detects attenuated virulence that is not evident with the standard model. PMID:23429534

Identification of the Staphylococcus aureus vfrAB operon, a novel virulence factor regulatory locus.

PubMed

Bose, Jeffrey L; Daly, Seth M; Hall, Pamela R; Bayles, Kenneth W

2014-05-01

During a screen of the Nebraska Transposon Mutant Library, we identified 71 mutations in the Staphylococcus aureus genome that altered hemolysis on blood agar medium. Although many of these mutations disrupted genes known to affect the production of alpha-hemolysin, two of them were associated with an apparent operon, designated vfrAB, that had not been characterized previously. Interestingly, a ΔvfrB mutant exhibited only minor effects on the transcription of the hla gene, encoding alpha-hemolysin, when grown in broth, as well as on RNAIII, a posttranscriptional regulatory RNA important for alpha-hemolysin translation, suggesting that VfrB may function at the posttranscriptional level. Indeed, a ΔvfrB mutant had increased aur and sspAB protease expression under these conditions. However, disruption of the known secreted proteases in the ΔvfrB mutant did not restore hemolytic activity in the ΔvfrB mutant on blood agar. Further analysis revealed that, in contrast to the minor effects of VfrB on hla transcription when strains were cultured in liquid media, the level of hla transcription was decreased 50-fold in the absence of VfrB on solid media. These results demonstrate that while VfrB represses protease expression when strains are grown in broth, hla regulation is highly responsive to factors associated with growth on solid media. Intriguingly, the ΔvfrB mutant displayed increased pathogenesis in a model of S. aureus dermonecrosis, further highlighting the complexity of VfrB-dependent virulence regulation. The results of this study describe a phenotype associated with a class of highly conserved yet uncharacterized proteins found in Gram-positive bacteria, and they shed new light on the regulation of virulence factors necessary for S. aureus pathogenesis.

Biochemical Characterization of Mutants in Chaperonin Proteins CCT4 and CCT5 Associated with Hereditary Sensory Neuropathy*

PubMed Central

Sergeeva, Oksana A.; Tran, Meme T.; Haase-Pettingell, Cameron; King, Jonathan A.

2014-01-01

Hereditary sensory neuropathies are a class of disorders marked by degeneration of the nerve fibers in the sensory periphery neurons. Recently, two mutations were identified in the subunits of the eukaryotic cytosolic chaperonin TRiC, a protein machine responsible for folding actin and tubulin in the cell. C450Y CCT4 was identified in a stock of Sprague-Dawley rats, whereas H147R CCT5 was found in a human Moroccan family. As with many genetically identified mutations associated with neuropathies, the underlying molecular basis of the mutants was not defined. We investigated the biochemical properties of these mutants using an expression system in Escherichia coli that produces homo-oligomeric rings of CCT4 and CCT5. Full-length versions of both mutant protein chains were expressed in E. coli at levels approaching that of the WT chains. Sucrose gradient centrifugation revealed chaperonin-sized complexes of both WT and mutant chaperonins, but with reduced recovery of C450Y CCT4 soluble subunits. Electron microscopy of negatively stained samples of C450Y CCT4 revealed few ring-shaped species, whereas WT CCT4, H147R CCT5, and WT CCT5 revealed similar ring structures. CCT5 complexes were assayed for their ability to suppress aggregation of and refold the model substrate γd-crystallin, suppress aggregation of mutant huntingtin, and refold the physiological substrate β-actin in vitro. H147R CCT5 was not as efficient in chaperoning these substrates as WT CCT5. The subtle effects of these mutations are consistent with the homozygous disease phenotype, in which most functions are carried out during development and adulthood, but some selective function is lost or reduced. PMID:25124038

Genetic interactions of the unfinished flower development (ufd) mutant support a significant role of the tomato UFD gene in regulating floral organogenesis.

PubMed

Poyatos-Pertíñez, Sandra; Quinet, Muriel; Ortíz-Atienza, Ana; Bretones, Sandra; Yuste-Lisbona, Fernando J; Lozano, Rafael

2016-09-01

Genetic interactions of UFD gene support its specific function during reproductive development of tomato; in this process, UFD could play a pivotal role between inflorescence architecture and flower initiation genes. Tomato (Solanum lycopersicum L.) is a major vegetable crop that also constitutes a model species for the study of plant developmental processes. To gain insight into the control of flowering and floral development, a novel tomato mutant, unfinished flower development (ufd), whose inflorescence and flowers were unable to complete their normal development was characterized using double mutant and gene expression analyses. Genetic interactions of ufd with mutations affecting inflorescence fate (uniflora, jointless and single flower truss) were additive and resulted in double mutants displaying the inflorescence structure of the non-ufd parental mutant and the flower phenotype of the ufd mutant. In addition, ufd mutation promotes an earlier inflorescence meristem termination. Taken together, both results indicated that UFD is not involved in the maintenance of inflorescence meristem identity, although it could participate in the regulatory system that modulates the rate of meristem maturation. Regarding the floral meristem identity, the falsiflora mutation was epistatic to the ufd mutation even though FALSIFLORA was upregulated in ufd inflorescences. In terms of floral organ identity, the ufd mutation was epistatic to macrocalyx, and MACROCALYX expression was differently regulated depending on the inflorescence developmental stage. These results suggest that the UFD gene may play a pivotal role between the genes required for flowering initiation and inflorescence development (such as UNIFLORA, FALSIFLORA, JOINTLESS and SINGLE FLOWER TRUSS) and those required for further floral organ development such as the floral organ identity genes.

O-Fucosylation of Thrombospondin Type 1 Repeats Restricts Epithelial to Mesenchymal Transition (EMT) and Maintains Epiblast Pluripotency During Mouse Gastrulation

PubMed Central

Du, Jianguang; Takeuchi, Hideyuki; Leonhard-Melief, Christina; Shroyer, Kenneth R.; Dlugosz, Malgosia; Haltiwanger, Robert S.; Holdener, Bernadette C.

2010-01-01

Thrombospondin type 1 repeat (TSR) superfamily members regulate diverse biological activities ranging from cell motility to inhibition of angiogenesis. In this study, we verified that mouse protein O-fucosyltransferase-2 (POFUT2) specifically adds O-fucose to TSRs. Using two Pofut2 gene trap lines, we demonstrated that O-fucosylation of TSRs was essential for restricting epithelial to mesenchymal transition in the primitive streak, correct patterning of mesoderm, and localization of the definitive endoderm. Although Pofut2 mutant embryos established anterior/posterior polarity, they underwent extensive mesoderm differentiation at the expense of maintaining epiblast pluripotency. Moreover, mesoderm differentiation was biased towards the vascular endothelial cell lineage. Localization of Foxa2 and Cer1 expressing cells within the interior of Pofut2 mutant embryos suggested that POFUT2 activity was also required for the displacement of the primitive endoderm by definitive endoderm. Notably, Nodal, BMP4, Fgf8, and Wnt3 expression were markedly elevated and expanded in Pofut2 mutants, providing evidence that O-fucose modification of TSRs was essential for modulation of growth factor signaling during gastrulation. The ability of Pofut2 mutant embryos to form teratomas comprised of tissues from all three germ layer origins suggested that defects in Pofut2 mutant embryos resulted from abnormalities in the extracellular environment. This prediction is consistent with the observation that POFUT2 targets are constitutive components of the extracellular matrix (ECM) or associate with the ECM. For this reason, the Pofut2 mutants represent a valuable tool for studying the role of O-fucosylation in ECM synthesis and remodeling, and will be a valuable model to study how post-translational modification of ECM components regulates the formation of tissue boundaries, cell movements, and signaling. PMID:20637190

Dominant negative Ras attenuates pathological ventricular remodeling in pressure overload cardiac hypertrophy

PubMed Central

Ramos-Kuri, Manuel; Rapti, Kleopatra; Mehel, Hind; Zhang, Shihong; Dhandapany, Perundurai S.; Liang, Lifan; García-Carrancá, Alejandro; Bobe, Regis; Fischmeister, Rodolphe; Adnot, Serge; Lebeche, Djamel; Hajjar, Roger J.; Lipskaia, Larissa; Chemaly, Elie R.

2015-01-01

The importance of the oncogene Ras in cardiac hypertrophy is well appreciated. The hypertrophic effects of the constitutively active mutant Ras-Val12 are revealed by clinical syndromes due to the Ras mutations and experimental studies. We examined the possible anti-hypertrophic effect of Ras inhibition in vitro using rat neonatal cardiomyocytes (NRCM) and in vivo in the setting of pressure-overload left ventricular (LV) hypertrophy (POH) in rats. Ras functions were modulated via adenovirus directed gene transfer of active mutant Ras-Val12 or dominant negative mutant N17-DN-Ras (DN-Ras). Ras-Val12 expression in vitro activates NFAT resulting in pro-hypertrophic and cardio-toxic effects on NRCM beating and Z-line organization. In contrast, the DN-Ras was antihypertrophic on NRCM, inhibited NFAT and exerted cardio-protective effects attested by preserved NRCM beating and Z line structure. Additional experiments with silencing H-Ras gene strategy corroborated the antihypertrophic effects of siRNA-H-Ras on NRCM. In vivo, with the POH model, both Ras mutants were associated with similar hypertrophy two weeks after simultaneous induction of POH and Ras-mutant gene transfer. However, LV diameters were higher and LV fractional shortening lower in the Ras-Val12 group compared to control and DN-Ras. Moreover, DN-Ras reduced the cross-sectional area of cardiomyocytes in vivo, and decreased the expression of markers of pathologic cardiac hypertrophy. In isolated adult cardiomyocytes after 2 weeks of POH and Ras-mutant gene transfer, DN-Ras improved sarcomere shortening and calcium transients compared to Ras-Val12. Overall, DN-Ras promotes a more physiological form of hypertrophy, suggesting an interesting therapeutic target for pathological cardiac hypertrophy. PMID:26260012

MLLT1 YEATS domain mutations in clinically distinctive Favourable Histology Wilms tumours

PubMed Central

Perlman, Elizabeth J.; Gadd, Samantha; Arold, Stefan T.; Radhakrishnan, Anand; Gerhard, Daniela S.; Jennings, Lawrence; Huff, Vicki; Guidry Auvil, Jaime M.; Davidsen, Tanja M.; Dome, Jeffrey S.; Meerzaman, Daoud; Hsu, Chih Hao; Nguyen, Cu; Anderson, James; Ma, Yussanne; Mungall, Andrew J.; Moore, Richard A.; Marra, Marco A.; Mullighan, Charles G.; Ma, Jing; Wheeler, David A.; Hampton, Oliver A.; Gastier-Foster, Julie M.; Ross, Nicole; Smith, Malcolm A.

2015-01-01

Wilms tumour is an embryonal tumour of childhood that closely resembles the developing kidney. Genomic changes responsible for the development of the majority of Wilms tumours remain largely unknown. Here we identify recurrent mutations within Wilms tumours that involve the highly conserved YEATS domain of MLLT1 (ENL), a gene known to be involved in transcriptional elongation during early development. The mutant MLLT1 protein shows altered binding to acetylated histone tails. Moreover, MLLT1-mutant tumours show an increase in MYC gene expression and HOX dysregulation. Patients with MLLT1-mutant tumours present at a younger age and have a high prevalence of precursor intralobar nephrogenic rests. These data support a model whereby activating MLLT1 mutations early in renal development result in the development of Wilms tumour. PMID:26635203

Nontransgenic Genome Modification in Plant Cells1[W][OA

PubMed Central

Marton, Ira; Zuker, Amir; Shklarman, Elena; Zeevi, Vardit; Tovkach, Andrey; Roffe, Suzy; Ovadis, Marianna; Tzfira, Tzvi; Vainstein, Alexander

2010-01-01

Zinc finger nucleases (ZFNs) are a powerful tool for genome editing in eukaryotic cells. ZFNs have been used for targeted mutagenesis in model and crop species. In animal and human cells, transient ZFN expression is often achieved by direct gene transfer into the target cells. Stable transformation, however, is the preferred method for gene expression in plant species, and ZFN-expressing transgenic plants have been used for recovery of mutants that are likely to be classified as transgenic due to the use of direct gene-transfer methods into the target cells. Here we present an alternative, nontransgenic approach for ZFN delivery and production of mutant plants using a novel Tobacco rattle virus (TRV)-based expression system for indirect transient delivery of ZFNs into a variety of tissues and cells of intact plants. TRV systemically infected its hosts and virus ZFN-mediated targeted mutagenesis could be clearly observed in newly developed infected tissues as measured by activation of a mutated reporter transgene in tobacco (Nicotiana tabacum) and petunia (Petunia hybrida) plants. The ability of TRV to move to developing buds and regenerating tissues enabled recovery of mutated tobacco and petunia plants. Sequence analysis and transmission of the mutations to the next generation confirmed the stability of the ZFN-induced genetic changes. Because TRV is an RNA virus that can infect a wide range of plant species, it provides a viable alternative to the production of ZFN-mediated mutants while avoiding the use of direct plant-transformation methods. PMID:20876340

The Arabidopsis Mutant cev1 Links Cell Wall Signaling to Jasmonate and Ethylene Responses

PubMed Central

Ellis, Christine; Karafyllidis, Ioannis; Wasternack, Claus; Turner, John G.

2002-01-01

Biotic and abiotic stresses stimulate the synthesis of jasmonates and ethylene, which, in turn, induce the expression of genes involved in stress response and enhance defense responses. The cev1 mutant has constitutive expression of stress response genes and has enhanced resistance to fungal pathogens. Here, we show that cev1 plants have increased production of jasmonate and ethylene and that its phenotype is suppressed by mutations that interrupt jasmonate and ethylene signaling. Genetic mapping, complementation analysis, and sequence analysis revealed that CEV1 is the cellulose synthase CeSA3. CEV1 was expressed predominantly in root tissues, and cev1 roots contained less cellulose than wild-type roots. Significantly, the cev1 mutant phenotype could be reproduced by treating wild-type plants with cellulose biosynthesis inhibitors, and the cellulose synthase mutant rsw1 also had constitutive expression of VSP. We propose that the cell wall can signal stress responses in plants. PMID:12119374

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu Xiaohong; Zhang Shuhui; Lin Jing

The role of the hepatitis B virus X protein (HBx) in hepatocarcinogenesis remains controversial. To investigate the biological impact of hepatitis B virus x gene (HBx) mutation on hepatoma cells, plasmids expressing the full-length HBx or HBx deletion mutants were constructed. The biological activities in these transfectants were analyzed by a series of assays. Results showed that HBx3'-20 and HBx3'-40 amino acid deletion mutants exhibited an increase in cellular proliferation, focus formation, tumorigenicity, and invasive growth and metastasis through promotion of the cell cycle from G0/G1 to the S phase, when compared with the full-length HBx. In contrast, HBx3'-30 aminomore » acid deletion mutant repressed cell proliferation by blocking in G1 phase. The expression of P53, p21{sup WAF1}, p14{sup ARF}, and MDM2 proteins was regulated by expression of HBx mutants. In conclusions, HBx variants showed different effects and functions on cell proliferation and invasion by regulation of the cell cycle progression and its associated proteins expression.« less

Role of CTGF in White Matter Development in Tuberous Sclerosis

DTIC Science & Technology

2015-02-01

previously shown to affect CTGF expression. Our preliminary results show that SRF is downregulated in Tsc1 mutant brains and this can be rescued by rapamycin ...expression. Our preliminary results show that SRF is downregulated in Tsc1 mutant brains and this can be rescued by rapamycin treatment suggesting a...on SRF pathway in our previous report, here we show that SRF levels are decreased in vivo in mutant mice, and this can be rescued by rapamycin

HSP90 Shapes the Consequences of Human Genetic Variation.

PubMed

Karras, Georgios I; Yi, Song; Sahni, Nidhi; Fischer, Máté; Xie, Jenny; Vidal, Marc; D'Andrea, Alan D; Whitesell, Luke; Lindquist, Susan

2017-02-23

HSP90 acts as a protein-folding buffer that shapes the manifestations of genetic variation in model organisms. Whether HSP90 influences the consequences of mutations in humans, potentially modifying the clinical course of genetic diseases, remains unknown. By mining data for >1,500 disease-causing mutants, we found a strong correlation between reduced phenotypic severity and a dominant (HSP90 ≥ HSP70) increase in mutant engagement by HSP90. Examining the cancer predisposition syndrome Fanconi anemia in depth revealed that mutant FANCA proteins engaged predominantly by HSP70 had severely compromised function. In contrast, the function of less severe mutants was preserved by a dominant increase in HSP90 binding. Reducing HSP90's buffering capacity with inhibitors or febrile temperatures destabilized HSP90-buffered mutants, exacerbating FA-related chemosensitivities. Strikingly, a compensatory FANCA somatic mutation from an "experiment of nature" in monozygotic twins both prevented anemia and reduced HSP90 binding. These findings provide one plausible mechanism for the variable expressivity and environmental sensitivity of genetic diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

Genes Required for Free Phage Production are Essential for Pseudomonas aeruginosa Chronic Lung Infections.

PubMed

Lemieux, Andrée-Ann; Jeukens, Julie; Kukavica-Ibrulj, Irena; Fothergill, Joanne L; Boyle, Brian; Laroche, Jérôme; Tucker, Nicholas P; Winstanley, Craig; Levesque, Roger C

2016-02-01

The opportunistic pathogen Pseudomonas aeruginosa causes chronic lung infection in patients with cystic fibrosis. The Liverpool Epidemic Strain LESB58 is highly resistant to antibiotics, transmissible, and associated with increased morbidity and mortality. Its genome contains 6 prophages and 5 genomic islands. We constructed a polymerase chain reaction (PCR)-based signature-tagged mutagenesis library of 9216 LESB58 mutants and screened the mutants in a rat model of chronic lung infection. A total of 162 mutants were identified as defective for in vivo maintenance, with 11 signature-tagged mutagenesis mutants having insertions in prophage and genomic island genes. Many of these mutants showed both diminished virulence and reduced phage production. Transcription profiling by quantitative PCR and RNA-Seq suggested that disruption of these prophages had a widespread trans-acting effect on the transcriptome. This study demonstrates that temperate phages play a pivotal role in the establishment of infection through modulation of bacterial host gene expression. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Transcription of the herpes simplex virus 1 genome during productive and quiescent infection of neuronal and nonneuronal cells.

PubMed

Harkness, Justine M; Kader, Muhamuda; DeLuca, Neal A

2014-06-01

Herpes simplex virus 1 (HSV-1) can undergo a productive infection in nonneuronal and neuronal cells such that the genes of the virus are transcribed in an ordered cascade. HSV-1 can also establish a more quiescent or latent infection in peripheral neurons, where gene expression is substantially reduced relative to that in productive infection. HSV mutants defective in multiple immediate early (IE) gene functions are highly defective for later gene expression and model some aspects of latency in vivo. We compared the expression of wild-type (wt) virus and IE gene mutants in nonneuronal cells (MRC5) and adult murine trigeminal ganglion (TG) neurons using the Illumina platform for cDNA sequencing (RNA-seq). RNA-seq analysis of wild-type virus revealed that expression of the genome mostly followed the previously established kinetics, validating the method, while highlighting variations in gene expression within individual kinetic classes. The accumulation of immediate early transcripts differed between MRC5 cells and neurons, with a greater abundance in neurons. Analysis of a mutant defective in all five IE genes (d109) showed dysregulated genome-wide low-level transcription that was more highly attenuated in MRC5 cells than in TG neurons. Furthermore, a subset of genes in d109 was more abundantly expressed over time in neurons. While the majority of the viral genome became relatively quiescent, the latency-associated transcript was specifically upregulated. Unexpectedly, other genes within repeat regions of the genome, as well as the unique genes just adjacent the repeat regions, also remained relatively active in neurons. The relative permissiveness of TG neurons to viral gene expression near the joint region is likely significant during the establishment and reactivation of latency. During productive infection, the genes of HSV-1 are transcribed in an ordered cascade. HSV can also establish a more quiescent or latent infection in peripheral neurons. HSV mutants defective in multiple immediate early (IE) genes establish a quiescent infection that models aspects of latency in vivo. We simultaneously quantified the expression of all the HSV genes in nonneuronal and neuronal cells by RNA-seq analysis. The results for productive infection shed further light on the nature of genes and promoters of different kinetic classes. In quiescent infection, there was greater transcription across the genome in neurons than in nonneuronal cells. In particular, the transcription of the latency-associated transcript (LAT), IE genes, and genes in the unique regions adjacent to the repeats persisted in neurons. The relative activity of this region of the genome in the absence of viral activators suggests a more dynamic state for quiescent genomes persisting in neurons. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Methylene blue protects against TDP-43 and FUS neuronal toxicity in C. elegans and D. rerio.

PubMed

Vaccaro, Alexandra; Patten, Shunmoogum A; Ciura, Sorana; Maios, Claudia; Therrien, Martine; Drapeau, Pierre; Kabashi, Edor; Parker, J Alex

2012-01-01

The DNA/RNA-binding proteins TDP-43 and FUS are found in protein aggregates in a growing number of neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) and related dementia, but little is known about the neurotoxic mechanisms. We have generated Caenorhabditis elegans and zebrafish animal models expressing mutant human TDP-43 (A315T or G348C) or FUS (S57Δ or R521H) that reflect certain aspects of ALS including motor neuron degeneration, axonal deficits, and progressive paralysis. To explore the potential of our humanized transgenic C. elegans and zebrafish in identifying chemical suppressors of mutant TDP-43 and FUS neuronal toxicity, we tested three compounds with potential neuroprotective properties: lithium chloride, methylene blue and riluzole. We identified methylene blue as a potent suppressor of TDP-43 and FUS toxicity in both our models. Our results indicate that methylene blue can rescue toxic phenotypes associated with mutant TDP-43 and FUS including neuronal dysfunction and oxidative stress.

Methylene Blue Protects against TDP-43 and FUS Neuronal Toxicity in C. elegans and D. rerio

PubMed Central

Vaccaro, Alexandra; Patten, Shunmoogum A.; Ciura, Sorana; Maios, Claudia; Therrien, Martine; Drapeau, Pierre; Kabashi, Edor; Parker, J. Alex

2012-01-01

The DNA/RNA-binding proteins TDP-43 and FUS are found in protein aggregates in a growing number of neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) and related dementia, but little is known about the neurotoxic mechanisms. We have generated Caenorhabditis elegans and zebrafish animal models expressing mutant human TDP-43 (A315T or G348C) or FUS (S57Δ or R521H) that reflect certain aspects of ALS including motor neuron degeneration, axonal deficits, and progressive paralysis. To explore the potential of our humanized transgenic C. elegans and zebrafish in identifying chemical suppressors of mutant TDP-43 and FUS neuronal toxicity, we tested three compounds with potential neuroprotective properties: lithium chloride, methylene blue and riluzole. We identified methylene blue as a potent suppressor of TDP-43 and FUS toxicity in both our models. Our results indicate that methylene blue can rescue toxic phenotypes associated with mutant TDP-43 and FUS including neuronal dysfunction and oxidative stress. PMID:22848727

Longitudinal brain MRI study in a mouse model of Rett Syndrome and the effects of choline.

PubMed

Ward, B C; Agarwal, S; Wang, K; Berger-Sweeney, J; Kolodny, N H

2008-07-01

Rett Syndrome (RTT), the second most common cause of mental retardation in girls, is associated with mutations of an X-linked gene encoding the transcriptional repressor protein MeCP2. Mecp2(1lox) mutant mice express no functional MeCP2 protein and exhibit behavioral abnormalities similar to those seen in RTT patients. Here we monitor the development of both whole brain and regional volumes between 21 and 42 days of age in this model of RTT using MRI. We see decreases in whole brain volumes in both male and female mutant mice. Cerebellar and ventricular volumes are also decreased in RTT males. Previous work has suggested that perinatal choline supplementation alleviates some of the behavioral deficits in both male and female Mecp2(1lox) mutant mice. Here we show that perinatal choline supplementation also positively affects whole brain volume in heterozygous females, and cerebellar volume in male RTT mice.

Mutants of Neurospora crassa that alter gene expression and conidia development.

PubMed Central

Madi, L; Ebbole, D J; White, B T; Yanofsky, C

1994-01-01

Several genes have been identified that are highly expressed during conidiation. Inactivation of these genes has no observable phenotypic effect. Transcripts of two such genes, con-6 and con-10, are normally absent from vegetative mycelia. To identify regulatory genes that affect con-6 and/or con-10 expression, strains were prepared in which the regulatory regions for these genes were fused to a gene conferring hygromycin resistance. Mutants were then selected that were resistant to the drug during mycelial growth. Mutations in several of the isolates had trans effects; they activated transcription of the corresponding intact gene and, in most isolates, one or more of the other con genes. Most interestingly, resistant mutants were obtained that were defective at different stages of conidiation. One mutant conidiated under conditions that do not permit conidiation in wild type. Images PMID:8016143

Interaction theory of mammalian mitochondria.

PubMed

Nakada, K; Inoue, K; Hayashi, J

2001-11-09

We generated mice with deletion mutant mtDNA by its introduction from somatic cells into mouse zygotes. Expressions of disease phenotypes are limited to tissues expressing mitochondrial dysfunction. Considering that all these mice share the same nuclear background, these observations suggest that accumulation of the mutant mtDNA and resultant expressions of mitochondrial dysfunction are responsible for expression of disease phenotypes. On the other hand, mitochondrial dysfunction and expression of clinical abnormalities were not observed until the mutant mtDNA accumulated predominantly. This protection is due to the presence of extensive and continuous interaction between exogenous mitochondria from cybrids and recipient mitochondria from embryos. Thus, we would like to propose a new hypothesis on mitochondrial biogenesis, interaction theory of mitochondria: mammalian mitochondria exchange genetic contents, and thus lost the individuality and function as a single dynamic cellular unit. Copyright 2001 Academic Press.

spiel ohne grenzen/pou2 is required during establishment of the zebrafish midbrain-hindbrain boundary organizer.

PubMed

Belting, H G; Hauptmann, G; Meyer, D; Abdelilah-Seyfried, S; Chitnis, A; Eschbach, C; Söll, I; Thisse, C; Thisse, B; Artinger, K B; Lunde, K; Driever, W

2001-11-01

The vertebrate midbrain-hindbrain boundary (MHB) organizes patterning and neuronal differentiation in the midbrain and anterior hindbrain. Formation of this organizing center involves multiple steps, including positioning of the MHB within the neural plate, establishment of the organizer and maintenance of its regional identity and signaling activities. Juxtaposition of the Otx2 and Gbx2 expression domains positions the MHB. How the positional information is translated into activation of Pax2, Wnt1 and Fgf8 expression during MHB establishment remains unclear. In zebrafish spiel ohne grenzen (spg) mutants, the MHB is not established, neither isthmus nor cerebellum form, the midbrain is reduced in size and patterning abnormalities develop within the hindbrain. In spg mutants, despite apparently normal expression of otx2, gbx1 and fgf8 during late gastrula stages, the initial expression of pax2.1, wnt1 and eng2, as well as later expression of fgf8 in the MHB primordium are reduced. We show that spg mutants have lesions in pou2, which encodes a POU-domain transcription factor. Maternal pou2 transcripts are distributed evenly in the blastula, and zygotic expression domains include the midbrain and hindbrain primordia during late gastrulation. Microinjection of pou2 mRNA can rescue pax2.1 and wnt1 expression in the MHB of spg/pou2 mutants without inducing ectopic expression. This indicates an essential but permissive role for pou2 during MHB establishment. pou2 is expressed normally in noi/pax2.1 and ace/fgf8 zebrafish mutants, which also form no MHB. Thus, expression of pou2 does not depend on fgf8 and pax2.1. Our data suggest that pou2 is required for the establishment of the normal expression domains of wnt1 and pax2.1 in the MHB primordium.

The thioredoxin TRX-1 regulates adult lifespan extension induced by dietary restriction in Caenorhabditis elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fierro-Gonzalez, Juan Carlos; Gonzalez-Barrios, Maria; Miranda-Vizuete, Antonio, E-mail: amirviz@upo.es

Highlights: {yields} First in vivo data for thioredoxin in dietary-restriction-(DR)-induced longevity. {yields} Thioredoxin (trx-1) loss suppresses longevity of eat-2 mutant, a genetic DR model. {yields} trx-1 overexpression extends wild-type longevity, but not that of eat-2 mutant. {yields} Longevity by dietary deprivation (DD), a non-genetic DR model, requires trx-1. {yields} trx-1 expression in ASJ neurons of aging adults is increased in response to DD. -- Abstract: Dietary restriction (DR) is the only environmental intervention known to extend adult lifespan in a wide variety of animal models. However, the genetic and cellular events that mediate the anti-aging programs induced by DR remainmore » elusive. Here, we used the nematode Caenorhabditis elegans to provide the first in vivo evidence that a thioredoxin (TRX-1) regulates adult lifespan extension induced by DR. We found that deletion of the gene trx-1 completely suppressed the lifespan extension caused by mutation of eat-2, a genetic surrogate of DR in the worm. However, trx-1 deletion only partially suppressed the long lifespan caused by mutation of the insulin-like receptor gene daf-2 or by mutation of the sensory cilia gene osm-5. A trx-1::GFP translational fusion expressed from its own promoter in ASJ neurons (Ptrx-1::trx-1::GFP) rescued the trx-1 deletion-mediated suppression of the lifespan extension caused by mutation of eat-2. This rescue was not observed when trx-1::GFP was expressed from the ges-1 promoter in the intestine. In addition, overexpression of Ptrx-1::trx-1::GFP extended lifespan in wild type, but not in eat-2 mutants. trx-1 deletion almost completely suppressed the lifespan extension induced by dietary deprivation (DD), a non-genetic, nutrient-based model of DR in the worm. Moreover, DD upregulated the expression of a trx-1 promoter-driven GFP reporter gene (Ptrx-1::GFP) in ASJ neurons of aging adults, but not that of control Pgpa-9::GFP (which is also expressed in ASJ neurons). We propose that DR activates TRX-1 in ASJ neurons during aging, which in turn triggers TRX-1-dependent mechanisms to extend adult lifespan in the worm.« less

Tyrosine Phosphorylation of the Human Serotonin Transporter: A Role in the Transporter Stability and Function

PubMed Central

Annamalai, Balasubramaniam; Mannangatti, Padmanabhan; Arapulisamy, Obulakshmi; Shippenberg, Toni S.; Jayanthi, Lankupalle D.

2012-01-01

The serotonin (5-HT) transporter (SERT) regulates serotoninergic neurotransmission by clearing 5-HT released into the synaptic space. Phosphorylation of SERT on serine and threonine mediates SERT regulation. Whether tyrosine phosphorylation regulates SERT is unknown. Here, we tested the hypothesis that tyrosine-phosphorylation of SERT regulates 5-HT transport. In support of this, alkali-resistant 32P-labeled SERT was found in rat platelets, and Src-tyrosine kinase inhibitor 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo [3,4,d]pyrimidine (PP2) decreased platelet SERT function and expression. In human placental trophoblast cells expressing SERT, PP2 reduced transporter function, expression, and stability. Although siRNA silencing of Src expression decreased SERT function and expression, coexpression of Src resulted in PP2-sensitive increases in SERT function and expression. PP2 treatment markedly decreased SERT protein stability. Compared with WT-SERT, SERT tyrosine mutants Y47F and Y142F exhibited reduced 5-HT transport despite their higher total and cell surface expression levels. Moreover, Src-coexpression increased total and cell surface expression of Y47F and Y142F SERT mutants without affecting their 5-HT transport capacity. It is noteworthy that Y47F and Y142F mutants exhibited higher protein stability compared with WT-SERT. However, similar to WT-SERT, PP2 treatment decreased the stability of Y47F and Y142F mutants. Furthermore, compared with WT-SERT, Y47F and Y142F mutants exhibited lower basal tyrosine phosphorylation and no further enhancement of tyrosine phosphorylation in response to Src coexpression. These results provide the first evidence that SERT tyrosine phosphorylation supports transporter protein stability and 5HT transport. PMID:21992875

Airways in smooth muscle α-actin null mice experience a compensatory mechanism that modulates their contractile response.

PubMed

Shardonofsky, Felix R; Moore, Joan; Schwartz, Robert J; Boriek, Aladin M

2012-03-01

We hypothesized that ablation of smooth muscle α-actin (SM α-A), a contractile-cytoskeletal protein expressed in airway smooth muscle (ASM) cells, abolishes ASM shortening capacity and decreases lung stiffness. In both SM α-A knockout and wild-type (WT) mice, airway resistance (Raw) determined by the forced oscillation technique rose in response to intravenous methacholine (Mch). However, the slope of Raw (cmH(2)O·ml(-1)·s) vs. log(2) Mch dose (μg·kg(-1)·min(-1)) was lower (P = 0.007) in mutant (0.54 ± 0.14) than in WT mice (1.23 ± 0.19). RT-PCR analysis performed on lung tissues confirmed that mutant mice lacked SM α-A mRNA and showed that these mice had robust expressions of both SM γ-A mRNA and skeletal muscle (SKM) α-A mRNA, which were not expressed in WT mice, and an enhanced SM22 mRNA expression relative to that in WT mice. Compared with corresponding spontaneously breathing mice, mechanical ventilation-induced lung mechanical strain increased the expression of SM α-A mRNA in WT lungs; in mutant mice, it augmented the expressions of SM γ-A mRNA and SM22 mRNA and did not alter that of SKM α-A mRNA. In mutant mice, the expression of SM γ-A mRNA in the lung during spontaneous breathing and its enhanced expression following mechanical ventilation are consistent with the likely possibility that in the absence of SM α-A, SM γ-A underwent polymerization and interacted with smooth muscle myosin to produce ASM shortening during cholinergic stimulation. Thus our data are consistent with ASM in mutant mice experiencing compensatory mechanisms that modulated its contractile muscle capacity.

Distinct functions of capsid protein in assembly and movement of tobacco etch potyvirus in plants.

PubMed Central

Dolja, V V; Haldeman, R; Robertson, N L; Dougherty, W G; Carrington, J C

1994-01-01

Tobacco etch potyvirus engineered to express the reporter protein beta-glucuronidase (TEV-GUS) was used for direct observation and quantitation of virus translocation in plants. Four TEV-GUS mutants were generated containing capsid proteins (CPs) with single amino acid substitutions (R154D and D198R), a double substitution (DR), or a deletion of part of the N-terminal domain (delta N). Each modified virus replicated as well as the parental virus in protoplasts, but was defective in cell-to-cell movement through inoculated leaves. The R154D, D198R and DR mutants were restricted essentially to single, initially infected cells. The delta N variant exhibited slow cell-to-cell movement in inoculated leaves, but was unable to move systemically due to a lack of entry into or replication in vascular-associated cells. Both cell-to-cell and systemic movement defects of each mutant were rescued in transgenic plants expressing wild-type TEV CP. Cell-to-cell movement, but not systemic movement, of the DR mutant was rescued partially in transgenic plants expressing TEV CP lacking the C-terminal domain, and in plants expressing CP from the heterologous potyvirus, potato virus Y. Despite comparable levels of accumulation of parental virus and each mutant in symptomatic tissue of TEV CP-expressing transgenic plants, virions were detected only in parental virus- and delta N mutant-infected plants, as revealed using three independent assays. These data suggest that the potyvirus CP possesses distinct, separable activities required for virion assembly, cell-to-cell movement and long-distance transport. Images PMID:7511101

Arabidopsis shaker pollen inward K+ channel SPIK functions in SnRK1 complex-regulated pollen hydration on the stigma.

PubMed

Li, Dan-Dan; Guan, Huan; Li, Fei; Liu, Chang-Zhen; Dong, Yu-Xiu; Zhang, Xian-Sheng; Gao, Xin-Qi

2017-09-01

Pollen hydration is a critical step that determines pollen germination on the stigma. KINβγ is a plant-specific subunit of the SNF1-related protein kinase 1 complex (SnRK1 complex). In pollen of the Arabidopsis kinβγ mutant, the levels of reactive oxygen species were decreased which lead to compromised hydration of the mutant pollen on the stigma. In this study, we analyzed gene expression in kinβγ mutant pollen by RNA-seq and found the expression of inward shaker K + channel SPIK was down-regulated in the kinβγ pollen. Furthermore, we showed that the pollen hydration of the Arabidopsis spik mutant was defective on the wild-type stigma, although the mutant pollen demonstrated normal hydration in vitro. Additionally, the defective hydration of spik mutant pollen could not be rescued by the wild-type pollen on the stigma, indicating that the spik mutation deprived the capability of pollen absorption on the stigma. Our results suggest that the Arabidopsis SnRK1 complex regulates SPIK expression, which functions in determining pollen hydration on the stigma. © 2017 Institute of Botany, Chinese Academy of Sciences.

The transcriptional response to the inactivation of the PaMpk1 and PaMpk2 MAP kinase pathways in Podospora anserina.

PubMed

Bidard, Frédérique; Coppin, Evelyne; Silar, Philippe

2012-08-01

Transcription pattern during mycelium growth of Podospora anserina was assayed by microarray analysis in wild type and in mutants affected in the MAP kinase genes PaMpk1 and PaMpk2 and in the NADPH oxidase gene PaNox1. 15% of the genes have their expression modified by a factor two or more as growth proceeds in wild type. The genes whose expression is modified during growth in P. anserina are either not conserved or differently regulated in Neurospora crassa and Aspergillus niger, two fungi for which transcriptome data during growth are available. The P. anserina mutants display a similar alteration of their transcriptome profile, with nearly 1000 genes affected similarly in the three mutants, accounting for their similar growth phenotypes. Yet, each mutant has its specific set of modified transcripts, in line with particular phenotypes exhibited by each mutant. Again, there is limited conservation during evolution of the genes regulated at the transcription level by MAP kinases, as indicated by the comparison the P. anserina data, with those of Aspergillus fumigatus and N. crassa, two fungi for which gene expression data are available for mutants of the MAPK pathways. Among the genes regulated in wild type and affected in the mutants, those involved in carbohydrate and secondary metabolisms appear prominent. The vast majority of the genes differentially expressed are of unknown function. Availability of their transcription profile at various stages of development should help to decipher their role in fungal physiology and development. Copyright © 2012 Elsevier Inc. All rights reserved.

Analysis of Induced Pluripotent Stem Cells from a BRCA1 Mutant Family

PubMed Central

Soyombo, Abigail A.; Wu, Yipin; Kolski, Lauren; Rios, Jonathan J.; Rakheja, Dinesh; Chen, Alice; Kehler, James; Hampel, Heather; Coughran, Alanna; Ross, Theodora S.

2013-01-01

Summary Understanding BRCA1 mutant cancers is hampered by difficulties in obtaining primary cells from patients. We therefore generated and characterized 24 induced pluripotent stem cell (iPSC) lines from fibroblasts of eight individuals from a BRCA1 5382insC mutant family. All BRCA1 5382insC heterozygous fibroblasts, iPSCs, and teratomas maintained equivalent expression of both wild-type and mutant BRCA1 transcripts. Although no difference in differentiation capacity was observed between BRCA1 wild-type and mutant iPSCs, there was elevated protein kinase C-theta (PKC-theta) in BRCA1 mutant iPSCs. Cancer cell lines with BRCA1 mutations and hormone-receptor-negative breast cancers also displayed elevated PKC-theta. Genome sequencing of the 24 iPSC lines showed a similar frequency of reprogramming-associated de novo mutations in BRCA1 mutant and wild-type iPSCs. These data indicate that iPSC lines can be derived from BRCA1 mutant fibroblasts to study the effects of the mutation on gene expression and genome stability. PMID:24319668

Genetic Analysis of Resistance to Benzimidazoles in Physarum: Differential Expression of β-Tubulin Genes

PubMed Central

Burland, Timothy G.; Schedl, Tim; Gull, Keith; Dove, William F.

1984-01-01

Physarum displays two vegetative cell types, uninucleate myxamoebae and multinucleate plasmodia. Mutant myxamoebae of Physarum resistant to the antitubulin drug methylbenzimidazole-2-yl-carbamate (MBC) were isolated. All mutants tested were cross-resistant to other benzimidazoles but not to cycloheximide or emetine. Genetic analysis showed that mutation to MBC resistance can occur at any one of four unlinked loci, benA, benB, benC or benD. MBC resistance of benB and benD mutants was expressed in plasmodia, but benA and benC mutant plasmodia were MBC sensitive, suggesting that benA and benC encode myxamoeba-specific products. Myxamoebae carrying the recessive benD210 mutation express a β-tubulin with noval electrophoretic mobility, in addition to a β-tubulin with wild-type mobility. This and other evidence indicates that benD is a structural gene for β-tubulin, and that at least two β-tubulin genes are expressed in myxamoebae. Comparisons of the β-tubulins of wildtype and benD210 strains by gel electrophoresis revealed that, of the three (or more) β-tubulin genes expressed in Physarum, one, benD, is expressed in both myxamoebae and plasmodia, one is expressed specifically in myxamoebae and one is expressed specifically in plasmodia. However, mutation in only one gene, benD, is sufficient to confer MBC resistance on both myxamoebae and plasmodia. PMID:6479584

Akt mediated ROS-dependent selective targeting of mutant KRAS tumors.

PubMed

Iskandar, Kartini; Rezlan, Majidah; Pervaiz, Shazib

2014-10-01

Reactive oxygen species (ROS) play a critical role in a variety of cellular processes, ranging from cell survival and proliferation to cell death. Previously, we reported the ability of a small molecule compound, C1, to induce ROS dependent autophagy associated apoptosis in human cancer cell lines and primary tumor cells (Wong C. et al. 2010). Our ongoing investigations have unraveled a hitherto undefined novel signaling network involving hyper-phosphorylation of Akt and Akt-mediated ROS production in cancer cell lines. Interestingly, drug-induced Akt activation is selectively seen in cell lines that carry mutant KRAS; HCT116 cells that carry the V13D KRAS mutation respond favorably to C1 while HT29 cells expressing wild type KRAS are relatively resistant. Of note, not only does the compound target mutant KRAS expressing cells but also induces RAS activation as evidenced by the PAK pull down assay. Corroborating this, pharmacological inhibition as well as siRNA mediated silencing of KRAS or Akt, blocked C1-induced ROS production and rescued tumor colony forming ability in HCT116 cells. To further confirm the involvement of KRAS, we made use of mutant KRAS transformed RWPE-1 prostate epithelial cells. Notably, drug-induced ROS generation and death sensitivity was significantly higher in RWPE-1-KRAS cells than the RWPE-1-vector cells, thus confirming the results obtained with mutant KRAS colorectal carcinoma cell line. Lastly, we made use of HCT116 mutant KRAS knockout cells (KO) where the mutant KRAS allele had been deleted, thus expressing a single wild-type KRAS allele. Exposure of the KO cells to C1 failed to induce Akt activation and mitochondrial ROS production. Taken together, results show the involvement of activated Akt in ROS-mediated selective targeting of mutant KRAS expressing tumors, which could have therapeutic implications given the paucity of chemotherapeutic strategies specifically targeting KRAS mutant cancers. Copyright © 2014. Published by Elsevier Inc.

AGO1 controls arabidopsis inflorescence architecture possibly by regulating TFL1 expression.

PubMed

Fernández-Nohales, P; Domenech, M J; Martínez de Alba, A E; Micol, J L; Ponce, M R; Madueño, F

2014-11-01

The TERMINAL FLOWER 1 (TFL1) gene is pivotal in the control of inflorescence architecture in arabidopsis. Thus, tfl1 mutants flower early and have a very short inflorescence phase, while TFL1-overexpressing plants have extended vegetative and inflorescence phases, producing many coflorescences. TFL1 is expressed in the shoot meristems, never in the flowers. In the inflorescence apex, TFL1 keeps the floral genes LEAFY (LFY) and APETALA1 (AP1) restricted to the flower, while LFY and AP1 restrict TFL1 to the inflorescence meristem. In spite of the central role of TFL1 in inflorescence architecture, regulation of its expression is poorly understood. This study aims to expand the understanding of inflorescence development by identifying and studying novel TFL1 regulators. Mutagenesis of an Arabidopsis thaliana line carrying a TFL1::GUS (β-glucuronidase) reporter construct was used to isolate a mutant with altered TFL1 expression. The mutated gene was identified by positional cloning. Expression of TFL1 and TFL1::GUS was analysed by real-time PCR and histochemical GUS detection. Double-mutant analysis was used to assess the contribution of TFL1 to the inflorescence mutant phenotype. A mutant with both an increased number of coflorescences and high and ectopic TFL1 expression was isolated. Cloning of the mutated gene showed that both phenotypes were caused by a mutation in the ARGONAUTE1 (AGO1) gene, which encodes a key component of the RNA silencing machinery. Analysis of another ago1 allele indicated that the proliferation of coflorescences and ectopic TFL1 expression phenotypes are not allele specific. The increased number of coflorescences is suppressed in ago1 tfl1 double mutants. The results identify AGO1 as a repressor of TFL1 expression. Moreover, they reveal a novel role for AGO1 in inflorescence development, controlling the production of coflorescences. AGO1 seems to play this role through regulating TFL1 expression. © The Author 2014. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Inhibition of Shp2 suppresses mutant EGFR-induced lung tumors in transgenic mouse model of lung adenocarcinoma

PubMed Central

Schneeberger, Valentina E.; Ren, Yuan; Luetteke, Noreen; Huang, Qingling; Chen, Liwei; Lawrence, Harshani R.; Lawrence, Nicholas J.; Haura, Eric B.; Koomen, John M.; Coppola, Domenico; Wu, Jie

2015-01-01

Epidermal growth factor receptor (EGFR) mutants drive lung tumorigenesis and are targeted for therapy. However, resistance to EGFR inhibitors has been observed, in which the mutant EGFR remains active. Thus, it is important to uncover mediators of EGFR mutant-driven lung tumors to develop new treatment strategies. The protein tyrosine phosphatase (PTP) Shp2 mediates EGF signaling. Nevertheless, it is unclear if Shp2 is activated by oncogenic EGFR mutants in lung carcinoma or if inhibiting the Shp2 PTP activity can suppress EGFR mutant-induced lung adenocarcinoma. Here, we generated transgenic mice containing a doxycycline (Dox)-inducible PTP-defective Shp2 mutant (tetO-Shp2CSDA). Using the rat Clara cell secretory protein (CCSP)-rtTA-directed transgene expression in the type II lung pneumocytes of transgenic mice, we found that the Gab1-Shp2 pathway was activated by EGFRL858R in the lungs of transgenic mice. Consistently, the Gab1-Shp2 pathway was activated in human lung adenocarcinoma cells containing mutant EGFR. Importantly, Shp2CSDA inhibited EGFRL858R-induced lung adenocarcinoma in transgenic animals. Analysis of lung tissues showed that Shp2CSDA suppressed Gab1 tyrosine phosphorylation and Gab1-Shp2 association, suggesting that Shp2 modulates a positive feedback loop to regulate its own activity. These results show that inhibition of the Shp2 PTP activity impairs mutant EGFR signaling and suppresses EGFRL858R-driven lung adenocarcinoma. PMID:25730908

PI3K Activation in Neural Stem Cells Drives Tumorigenesis which can be Ameliorated by Targeting the cAMP Response Element Binding (CREB) Protein.

PubMed

Daniel, Paul M; Filiz, Gulay; Brown, Daniel V; Christie, Michael; Waring, Paul M; Zhang, Yi; Haynes, John M; Pouton, Colin; Flanagan, Dustin; Vincan, Elizabeth; Johns, Terrance G; Montgomery, Karen; Phillips, Wayne A; Mantamadiotis, Theo

2018-04-30

Hyperactivation of PI3K signaling is common in cancers but the precise role of the pathway in glioma biology remains to be determined. Some understanding of PI3K signaling mechanisms in brain cancer comes from studies on neural stem/progenitor cells, where signals transmitted via the PI3K pathway cooperate with other intracellular pathways and downstream transcription factors to regulate critical cell functions. To investigate the role for the PI3K pathway in glioma initiation and development, we generated a mouse model targeting the inducible expression of a PIK3CAH1047A oncogenic mutant and deletion of the PI3K negative regulator, PTEN, to neural stem/progenitor cells (NSPCs). Expression of a Pik3caH1047A was sufficient to generate tumors with oligodendroglial features but simultaneous loss of PTEN was required for the development of invasive, high-grade glioma. Pik3caH1047A-PTEN mutant NSPCs exhibited enhanced neurosphere formation which correlated with increased WNT signaling, while loss of CREB in Pik3caH1047A-Pten mutant tumors led to longer symptom-free survival in mice. Taken together, our findings present a novel mouse model for glioma demonstrating that the PI3K pathway is important for initiation of tumorigenesis and that disruption of downstream CREB signaling attenuates tumor expansion.

Dysregulation of gene expression in the striatum of BACHD rats expressing full-length mutant huntingtin and associated abnormalities on molecular and protein levels.

PubMed

Yu-Taeger, Libo; Bonin, Michael; Stricker-Shaver, Janice; Riess, Olaf; Nguyen, Hoa Huu Phuc

2017-05-01

Huntington disease (HD) is an autosomal dominantly inherited neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for the huntingtin protein (HTT). Mutant HTT (mHTT) has been proposed to cause neuronal dysfunction and neuronal loss through multiple mechanisms. Transcriptional changes may be a core pathogenic feature of HD. Utilizing the Affymetrix platform we performed a genome-wide RNA expression analysis in two BACHD transgenic rat lines (TG5 and TG9) at 12 months of age, both of which carry full-length human mHTT but with different expression levels. By defining the threshold of significance at p < 0.01, we found 1608 genes and 871 genes differentially expressed in both TG5 and TG9 rats when compared to the wild type littermates, respectively. We only chose the highly up-/down-regulated genes for further analysis by setting an additional threshold of 1.5 fold change. Comparing gene expression profiles of human HD brains and BACHD rats revealed a high concordance in both functional and IPA (Ingenuity Pathway Analysis) canonical pathways relevant to HD. In addition, we investigated the causes leading to gene expression changes at molecular and protein levels in BACHD rats including the involvement of polyQ-containing transcription factors TATA box-binding protein (TBP), Sp1 and CBP as well as the chromatin structure. We demonstrate that the BACHD rat model recapitulates the gene expression changes of the human disease supporting its role as a preclinical research animal model. We also show for the first time that TFIID complex formation is reduced, while soluble TBP is increased in an HD model. This finding suggests that mHTT is a competitor instead of a recruiter of polyQ-containing transcription factors in the transcription process in HD. Copyright © 2017 Elsevier Ltd. All rights reserved.

The Proprotein Convertase Subtilisin/Kexin FurinA Regulates Zebrafish Host Response against Mycobacterium marinum

PubMed Central

Ojanen, Markus J. T.; Turpeinen, Hannu; Cordova, Zuzet M.; Hammarén, Milka M.; Harjula, Sanna-Kaisa E.; Parikka, Mataleena; Rämet, Mika

2015-01-01

Tuberculosis is a chronic bacterial disease with a complex pathogenesis. An effective immunity against Mycobacterium tuberculosis requires both the innate and adaptive immune responses, including proper T helper (Th) type 1 cell function. FURIN is a proprotein convertase subtilisin/kexin (PCSK) enzyme, which is highly expressed in Th1 type cells. FURIN expression in T cells is essential for maintaining peripheral immune tolerance, but its role in the innate immunity and infections has remained elusive. Here, we utilized Mycobacterium marinum infection models in zebrafish (Danio rerio) to investigate how furin regulates host responses against mycobacteria. In steady-state furinAtd204e/+ fish reduced furinA mRNA levels associated with low granulocyte counts and elevated Th cell transcription factor expressions. Silencing furin genes reduced the survival of M. marinum-infected zebrafish embryos. A mycobacterial infection upregulated furinA in adult zebrafish, and infected furinAtd204e/+ mutants exhibited a proinflammatory phenotype characterized by elevated tumor necrosis factor a (tnfa), lymphotoxin alpha (lta) and interleukin 17a/f3 (il17a/f3) expression levels. The enhanced innate immune response in the furinAtd204e/+ mutants correlated with a significantly decreased bacterial burden in a chronic M. marinum infection model. Our data show that upregulated furinA expression can serve as a marker for mycobacterial disease, since it inhibits early host responses and consequently promotes bacterial growth in a chronic infection. PMID:25624351

Oral Exposure to Paraquat Triggers Earlier Expression of Phosphorylated α-Synuclein in the Enteric Nervous System of A53T Mutant Human α-Synuclein Transgenic Mice

PubMed Central

Naudet, Nicolas; Antier, Emilie; Gaillard, Damien; Morignat, Eric; Lakhdar, Latifa; Baron, Thierry; Bencsik, Anna

2017-01-01

Abstract The misfolded α-synuclein protein, phosphorylated at serine 129 (pSer129 α-syn), is the hallmark of Parkinson disease (PD). Detected also in the enteric nervous system (ENS), it supports the recent theory that PD could start in the gut, rather than the brain. In a previous study, using a transgenic mouse model of human synucleinopathies expressing the A53T mutant α-synuclein (TgM83), in which a neurodegenerative process associated with α-synuclein occurs spontaneously in the brain, we have shown earlier onset of pSer129 α-syn in the ENS. Here, we used this model to study the impact of paraquat (PQ) a neurotoxic herbicide incriminated in PD in agricultural workers) on the enteric pSer129 α-syn expression in young mice. Orally delivered in the drinking water at 10 mg/kg/day for 6–8 weeks, the impact of PQ was measured in a time-dependent manner on weight, locomotor abilities, pSer129 α-syn, and glial fibrillary acidic protein (GFAP) expression levels in the ENS. Remarkably, pSer129 α-syn was detected in ENS earlier under PQ oral exposure and enteric GFAP expression was also increased. These findings bring additional support to the theory that neurotoxic agents such as PQ initiate idiopathic PD after oral delivery. PMID:29040593

Oral Exposure to Paraquat Triggers Earlier Expression of Phosphorylated α-Synuclein in the Enteric Nervous System of A53T Mutant Human α-Synuclein Transgenic Mice.

PubMed

Naudet, Nicolas; Antier, Emilie; Gaillard, Damien; Morignat, Eric; Lakhdar, Latifa; Baron, Thierry; Bencsik, Anna

2017-12-01

The misfolded α-synuclein protein, phosphorylated at serine 129 (pSer129 α-syn), is the hallmark of Parkinson disease (PD). Detected also in the enteric nervous system (ENS), it supports the recent theory that PD could start in the gut, rather than the brain. In a previous study, using a transgenic mouse model of human synucleinopathies expressing the A53T mutant α-synuclein (TgM83), in which a neurodegenerative process associated with α-synuclein occurs spontaneously in the brain, we have shown earlier onset of pSer129 α-syn in the ENS. Here, we used this model to study the impact of paraquat (PQ) a neurotoxic herbicide incriminated in PD in agricultural workers) on the enteric pSer129 α-syn expression in young mice. Orally delivered in the drinking water at 10 mg/kg/day for 6-8 weeks, the impact of PQ was measured in a time-dependent manner on weight, locomotor abilities, pSer129 α-syn, and glial fibrillary acidic protein (GFAP) expression levels in the ENS. Remarkably, pSer129 α-syn was detected in ENS earlier under PQ oral exposure and enteric GFAP expression was also increased. These findings bring additional support to the theory that neurotoxic agents such as PQ initiate idiopathic PD after oral delivery. © 2017 American Association of Neuropathologists, Inc.

Involvement of two glycoside hydrolase family 19 members in colony morphotype and virulence in Flavobacterium columnare

NASA Astrophysics Data System (ADS)

Zhang, Xiaolin; Li, Nan; Qin, Ting; Huang, Bei; Nie, Pin

2017-11-01

Flavobacterium columnare is the pathogenic agent of columnaris disease in aquaculture. Using a recently developed gene deletion strategy, two genes that encode the Glyco_hydro_19 domain (GH19 domain) containing proteins, ghd-1 and ghd-2, were deleted separately and together from the F. columnare G4 wild type strain. Surprisingly, the single-, Δ ghd-1 and Δ ghd-2, and double-gene mutants, Δ ghd-1 Δghd -2, all had rhizoid and non-rhizoid colony morphotypes, which we named Δ ghd-1, Δ ghd-2, Δ ghd-1 Δ ghd-2, and NΔ ghd-1, NΔ ghd-2, and NΔ ghd-1 Δ ghd-2. However, chitin utilization was not detected in either these mutants or in the wild type. Instead, skimmed milk degradation was observed for the mutants and the wild type; the non-rhizoid strain NΔ ghd-2 exhibited higher degradation activity as revealed by the larger transparent circle on the skimmed milk plate. Using zebrafish as the model organism, we found that non-rhizoid mutants had higher LD50 values and were less virulent because zebrafish infected with these survived longer. Transcriptome analysis between the non-rhizoid and rhizoid colony morphotypes of each mutant, i.e., NΔ ghd -1 versus (vs) Δ ghd-1, NΔ ghd-2 vs Δ ghd-2, and NΔ ghd-1 Δ ghd-2 vs Δ ghd-1 Δ ghd-2, revealed a large number of differentially expressed genes, among which 39 genes were common in three of the pairs compared. Although most of these genes encode hypothetical proteins, a few molecules such as phage tail protein, rhs element Vgr protein, thiol-activated cytolysin, and TonB-dependent outer membrane receptor precursor, expression of which was down-regulated in non-rhizoid mutants but up-regulated in rhizoid mutants, may play a role F. columnare virulence.

Barcode Sequencing Screen Identifies SUB1 as a Regulator of Yeast Pheromone Inducible Genes

PubMed Central

Sliva, Anna; Kuang, Zheng; Meluh, Pamela B.; Boeke, Jef D.

2016-01-01

The yeast pheromone response pathway serves as a valuable model of eukaryotic mitogen-activated protein kinase (MAPK) pathways, and transcription of their downstream targets. Here, we describe application of a screening method combining two technologies: fluorescence-activated cell sorting (FACS), and barcode analysis by sequencing (Bar-Seq). Using this screening method, and pFUS1-GFP as a reporter for MAPK pathway activation, we readily identified mutants in known mating pathway components. In this study, we also include a comprehensive analysis of the FUS1 induction properties of known mating pathway mutants by flow cytometry, featuring single cell analysis of each mutant population. We also characterized a new source of false positives resulting from the design of this screen. Additionally, we identified a deletion mutant, sub1Δ, with increased basal expression of pFUS1-GFP. Here, in the first ChIP-Seq of Sub1, our data shows that Sub1 binds to the promoters of about half the genes in the genome (tripling the 991 loci previously reported), including the promoters of several pheromone-inducible genes, some of which show an increase upon pheromone induction. Here, we also present the first RNA-Seq of a sub1Δ mutant; the majority of genes have no change in RNA, but, of the small subset that do, most show decreased expression, consistent with biochemical studies implicating Sub1 as a positive transcriptional regulator. The RNA-Seq data also show that certain pheromone-inducible genes are induced less in the sub1Δ mutant relative to the wild type, supporting a role for Sub1 in regulation of mating pathway genes. The sub1Δ mutant has increased basal levels of a small subset of other genes besides FUS1, including IMD2 and FIG1, a gene encoding an integral membrane protein necessary for efficient mating. PMID:26837954

Mimicking the BIM BH3 domain overcomes resistance to EGFR tyrosine kinase inhibitors in EGFR-mutant non-small cell lung cancer

PubMed Central

Xia, Jinjing; Bai, Hao; Yan, Bo; Li, Rong; Shao, Minhua; Xiong, Liwen; Han, Baohui

2017-01-01

Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR TKIs) are widely applied to treat EGFR-mutant non-small cell lung cancer (NSCLC). BIM is a BH3 domain-containing protein encoded by BCL2L11. Some EGFR-mutant NSCLC patients showing BIM deletion polymorphism are resistant to EGFR TKIs. We retrospectively investigated BIM deletion polymorphism in NSCLC patients, its correlation with EGFR TKI (erlotinib) resistance, and the mechanism underlying the drug resistance. Among 245 EGFR-mutant NSCLC patients examined, BIM deletion polymorphism was detected in 43 (12.24%). Median progression-free and overall survival was markedly shorter in patients with BIM deletion polymorphism than with BIM wide-type. Moreover, NSCLC cells expressing EGFR-mutant harboring BIM polymorphism were more resistant to erlotinib-induced apoptosis than BIM wide-type cells. However, combined use of erlotinib and the BH3-mimetic ABT-737 up-regulated BIM expression and overcame erlotinib resistance in EGFR-mutant NSCLC cells harboring BIM deletion polymorphism. In vivo, erlotinib suppressed growth of BIM wide-type NSCLC cell xenographs by inducing apoptosis. Combined with ABT-737, erlotinib also suppressed NSCLC xenographs expressing EGFR-mutant harboring BIM deletion polymorphism. These results indicate that BIM polymorphism is closely related to a poor clinical response to EGFR TKIs in EGFR-mutant NSCLC patients, and that the BH3-mimetic ABT-737 restores BIM functionality and EGFR-TKI sensitivity. PMID:29312548

Mimicking the BIM BH3 domain overcomes resistance to EGFR tyrosine kinase inhibitors in EGFR-mutant non-small cell lung cancer.

PubMed

Xia, Jinjing; Bai, Hao; Yan, Bo; Li, Rong; Shao, Minhua; Xiong, Liwen; Han, Baohui

2017-12-12

Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR TKIs) are widely applied to treat EGFR-mutant non-small cell lung cancer (NSCLC). BIM is a BH3 domain-containing protein encoded by BCL2L11. Some EGFR-mutant NSCLC patients showing BIM deletion polymorphism are resistant to EGFR TKIs. We retrospectively investigated BIM deletion polymorphism in NSCLC patients, its correlation with EGFR TKI (erlotinib) resistance, and the mechanism underlying the drug resistance. Among 245 EGFR-mutant NSCLC patients examined, BIM deletion polymorphism was detected in 43 (12.24%). Median progression-free and overall survival was markedly shorter in patients with BIM deletion polymorphism than with BIM wide-type. Moreover, NSCLC cells expressing EGFR-mutant harboring BIM polymorphism were more resistant to erlotinib-induced apoptosis than BIM wide-type cells. However, combined use of erlotinib and the BH3-mimetic ABT-737 up-regulated BIM expression and overcame erlotinib resistance in EGFR-mutant NSCLC cells harboring BIM deletion polymorphism. In vivo , erlotinib suppressed growth of BIM wide-type NSCLC cell xenographs by inducing apoptosis. Combined with ABT-737, erlotinib also suppressed NSCLC xenographs expressing EGFR-mutant harboring BIM deletion polymorphism. These results indicate that BIM polymorphism is closely related to a poor clinical response to EGFR TKIs in EGFR-mutant NSCLC patients, and that the BH3-mimetic ABT-737 restores BIM functionality and EGFR-TKI sensitivity.

Crenolanib is a type I tyrosine kinase inhibitor that inhibits mutant KIT D816 isoforms prevalent in systemic mastocytosis and core binding factor leukemia.

PubMed

Kampa-Schittenhelm, Kerstin Maria; Frey, Julia; Haeusser, Lara A; Illing, Barbara; Pavlovsky, Ashly A; Blumenstock, Gunnar; Schittenhelm, Marcus Matthias

2017-10-10

Activating D816 mutations of the class III receptor tyrosine kinase KIT are associated with the majority of patients with systemic mastocytosis (SM), but also core binding factor (CBF) AML, making KIT mutations attractive therapeutic targets for the treatment of these cancers. Crenolanib is a potent and selective inhibitor of wild-type as well as mutant isoforms of the class III receptor tyrosine kinases FLT3 and PDGFRα/β. Notably, crenolanib inhibits constitutively active mutant-FLT3 isoforms resulting from amino acid substitutions of aspartic acid at codon 835, which is homologous to codon 816 in the KIT gene - suggesting sensitivity against mutant-KIT D816 isoforms as well. Here we demonstrate that crenolanib targets KIT D816 in SM and CBF AML models: crenolanib inhibits cellular proliferation and initiates apoptosis of mastocytosis cell lines expressing these mutations. Target-specificity was confirmed using an isogenic cell model. In addition, we demonstrate that KIT D816 mutations are targetable with clinically achievable doses of crenolanib. Further, a rationale to combine cladribine (2-CDA), the therapeutic standard in SM, with crenolanib is provided. In conclusion, we demonstrate that crenolanib is an inhibitor of mutant-KIT D816 isoforms at clinically achievable concentrations, and thus may be a potential treatment for SM and CBF AML as a monotherapy or in combination approaches.

Induction of CD69 expression by cagPAI-positive Helicobacter pylori infection

PubMed Central

Mori, Naoki; Ishikawa, Chie; Senba, Masachika

2011-01-01

AIM: To investigate and elucidate the molecular mechanism that regulates inducible expression of CD69 by Helicobacter pylori (H. pylori) infection. METHODS: The expression levels of CD69 in a T-cell line, Jurkat, primary human peripheral blood mononuclear cells (PBMCs), and CD4+ T cells, were assessed by immunohistochemistry, reverse transcription polymerase chain reaction, and flow cytometry. Activation of CD69 promoter was detected by reporter gene. Nuclear factor (NF)-κB activation in Jurkat cells infected with H. pylori was evaluated by electrophoretic mobility shift assay. The role of NF-κB signaling in H. pylori-induced CD69 expression was analyzed using inhibitors of NF-κB and dominant-negative mutants. The isogenic mutants with disrupted cag pathogenicity island (cagPAI) and virD4 were used to elucidate the role of cagPAI-encoding type IV secretion system and CagA in CD69 expression. RESULTS: CD69 staining was detected in mucosal lymphocytes and macrophages in specimens of patients with H. pylori-positive gastritis. Although cagPAI-positive H. pylori and an isogenic mutant of virD4 induced CD69 expression, an isogenic mutant of cagPAI failed to induce this in Jurkat cells. H. pylori also induced CD69 expression in PBMCs and CD4+ T cells. The activation of the CD69 promoter by H. pylori was mediated through NF-κB. Transfection of dominant-negative mutants of IκBs, IκB kinases, and NF-κB-inducing kinase inhibited H. pylori-induced CD69 activation. Inhibitors of NF-κB suppressed H. pylori-induced CD69 mRNA expression. CONCLUSION: The results suggest that H. pylori induces CD69 expression through the activation of NF-κB. cagPAI might be relevant in the induction of CD69 expression in T cells. CD69 in T cells may play a role in H. pylori-induced gastritis. PMID:21990950

The Molybdenum Cofactor Biosynthetic Protein Cnx1 Complements Molybdate-Repairable Mutants, Transfers Molybdenum to the Metal Binding Pterin, and Is Associated with the Cytoskeleton

PubMed Central

Schwarz, Günter; Schulze, Jutta; Bittner, Florian; Eilers, Thomas; Kuper, Jochen; Bollmann, Gabriele; Nerlich, Andrea; Brinkmann, Henner; Mendel, Ralf R.

2000-01-01

Molybdenum (Mo) plays an essential role in the active site of all eukaryotic Mo-containing enzymes. In plants, Mo enzymes are important for nitrate assimilation, phytohormone synthesis, and purine catabolism. Mo is bound to a unique metal binding pterin (molybdopterin [MPT]), thereby forming the active Mo cofactor (Moco), which is highly conserved in eukaryotes, eubacteria, and archaebacteria. Here, we describe the function of the two-domain protein Cnx1 from Arabidopsis in the final step of Moco biosynthesis. Cnx1 is constitutively expressed in all organs and in plants grown on different nitrogen sources. Mo-repairable cnxA mutants from Nicotiana plumbaginifolia accumulate MPT and show altered Cnx1 expression. Transformation of cnxA mutants and the corresponding Arabidopsis chl-6 mutant with cnx1 cDNA resulted in functional reconstitution of their Moco deficiency. We also identified a point mutation in the Cnx1 E domain of Arabidopsis chl-6 that causes the molybdate-repairable phenotype. Recombinant Cnx1 protein is capable of synthesizing Moco. The G domain binds and activates MPT, whereas the E domain is essential for activating Mo. In addition, Cnx1 binds to the cytoskeleton in the same way that its mammalian homolog gephyrin does in neuronal cells, which suggests a hypothetical model for anchoring the Moco-synthetic machinery by Cnx1 in plant cells. PMID:11148290

Pleiotropic Alterations in Lipid Metabolism in Yeast sac1 Mutants: Relationship to “Bypass Sec14p” and Inositol Auxotrophy

PubMed Central

Rivas, Marcos P.; Kearns, Brian G.; Xie, Zhigang; Guo, Shuling; Sekar, M. Chandra; Hosaka, Kohei; Kagiwada, Satoshi; York, John D.; Bankaitis, Vytas A.

1999-01-01

SacIp dysfunction results in bypass of the requirement for phosphatidylinositol transfer protein (Sec14p) function in yeast Golgi processes. This effect is accompanied by alterations in inositol phospholipid metabolism and inositol auxotrophy. Elucidation of how sac1 mutants effect “bypass Sec14p” will provide insights into Sec14p function in vivo. We now report that, in addition to a dramatic accumulation of phosphatidylinositol-4-phosphate, sac1 mutants also exhibit a specific acceleration of phosphatidylcholine biosynthesis via the CDP-choline pathway. This phosphatidylcholine metabolic phenotype is sensitive to the two physiological challenges that abolish bypass Sec14p in sac1 strains; i.e. phospholipase D inactivation and expression of bacterial diacylglycerol (DAG) kinase. Moreover, we demonstrate that accumulation of phosphatidylinositol-4-phosphate in sac1 mutants is insufficient to effect bypass Sec14p. These data support a model in which phospholipase D activity contributes to generation of DAG that, in turn, effects bypass Sec14p. A significant fate for this DAG is consumption by the CDP-choline pathway. Finally, we determine that CDP-choline pathway activity contributes to the inositol auxotrophy of sac1 strains in a novel manner that does not involve obvious defects in transcriptional expression of the INO1 gene. PMID:10397762

Cytoplasmic mislocalization of TDP-43 is toxic to neurons and enhanced by a mutation associated with familial ALS

PubMed Central

Barmada, Sami J.; Skibinski, Gaia; Korb, Erica; Rao, Elizabeth J.; Wu, Jane Y.; Finkbeiner, Steven

2010-01-01

Mutations in the gene encoding TDP-43 — the major protein component of neuronal aggregates characteristic of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration with ubiquitin-positive inclusion bodies (FTLDu) — have been linked to familial forms of both disorders. Aggregates of TDP-43 in cortical and spinal motoneurons in ALS, or in neurons of the frontal and temporal cortices in FTLD, are closely linked to neuron loss and atrophy in these areas. However, the mechanism by which TDP-43 mutations lead to neurodegeneration is unclear. To investigate the pathogenic role of TDP-43 mutations, we established a model of TDP-43 proteinopathies by expressing fluorescently tagged wildtype and mutant TDP-43 in primary rat cortical neurons. Expression of mutant TDP-43 was toxic to neurons, and mutant-specific toxicity was associated with increased cytoplasmic mislocalization of TDP-43. Inclusion bodies were not necessary for the toxicity and did not affect the risk of cell death. Cellular survival was unaffected by the total amount of exogenous TDP-43 in the nucleus, but the amount of cytoplasmic TDP-43 was a strong and independent predictor of neuronal death. These results suggest that mutant TDP-43 is mislocalized to the cytoplasm, where it exhibits a toxic gain-of-function and induces cell death. PMID:20071528

No Amelioration of Uromodulin Maturation and Trafficking Defect by Sodium 4-Phenylbutyrate in Vivo

PubMed Central

Kemter, Elisabeth; Sklenak, Stefanie; Rathkolb, Birgit; Hrabě de Angelis, Martin; Wolf, Eckhard; Aigner, Bernhard; Wanke, Ruediger

2014-01-01

Uromodulin (UMOD)-associated kidney disease (UAKD) belongs to the hereditary progressive ER storage diseases caused by maturation defects of mutant UMOD protein. Current treatments of UAKD patients are symptomatic and cannot prevent disease progression. Two in vitro studies reported a positive effect of the chemical chaperone sodium 4-phenylbutyrate (4-PBA) on mutant UMOD maturation. Thus, 4-PBA was suggested as a potential treatment for UAKD. This study evaluated the effects of 4-PBA in two mouse models of UAKD. In contrast to previous in vitro studies, treatment with 4-PBA did not increase HSP70 expression or improve maturation and trafficking of mutant UMOD in vivo. Kidney function of UAKD mice was actually deteriorated by 4-PBA treatment. In transfected tubular epithelial cells, 4-PBA did not improve maturation but increased the expression level of both mutant and wild-type UMOD protein. Activation of NF-κB pathway in thick ascending limb of Henle's loop cells of UAKD mice was detected by increased abundance of RelB and phospho-IκB kinase α/β, an indirect activator of NF-κB. Furthermore, the abundance of NF-κB1 p105/p50, NF-κB2 p100/p52, and TRAF2 was increased in UAKD. NF-κB activation was identified as a novel disease mechanism of UAKD and might be a target for therapeutic intervention. PMID:24567330

CARD8 is a negative regulator for NLRP3 inflammasome, but mutant NLRP3 in cryopyrin-associated periodic syndromes escapes the restriction

PubMed Central

2014-01-01

Introduction NLRP3 plays a role in sensing various pathogen components or stresses in the innate immune system. Once activated, NLRP3 associates with apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) and procaspase-1 to form a large protein complex termed inflammasome. Although some investigators have proposed a model of NLRP3-inflammasome containing an adaptor protein caspase recruitment domain-containing protein 8 (CARD8), the role of this molecule remains obscure. This study aimed to clarify the interaction between CARD8 and wild-type NLRP3 as well as mutant forms of NLRP3 linked with cryopyrin-associated periodic syndromes (CAPS). Methods In here HEK293 expression system, cells were transfected with the cDNAs for inflammasome components. Also used were peripheral blood mononuclear cells (PBMCs) and human monocyte-derived macrophages (HMDMs) from healthy volunteers. The interaction of CARD8 and NLRP3 was studied by immunoprecipitation. The effect of CARD8 expression on IL-1β secretion was assessed by ELISA. CARD8 knockdown experiments were carried out by transfection of the specific siRNA into HMDMs. Results In HEK293 cells, CARD8 interacted with wild-type NLRP3, but not with CAPS-associated mutant NLRP3. CARD8 significantly reduced IL-1β secretion from cells transfected with wild-type NLRP3, but not if they were transfected with mutant NLRP3. In addition, association of endogenously expressed CARD8 with NLRP3 was confirmed in resting PBMCs, and CARD8 knockdown resulted in higher amount of IL-1β secretion from HMDMs. Conclusions Until specific stimuli activate NLRP3, CARD8 holds NLRP3, and is supposed to prevent activation by subtle stimuli. However, CAPS-associated mutant NLRP3 is unable to bind with CARD8, which might be relevant to the pathogenesis of CAPS. PMID:24517500

CARD8 is a negative regulator for NLRP3 inflammasome, but mutant NLRP3 in cryopyrin-associated periodic syndromes escapes the restriction.

PubMed

Ito, Sayaka; Hara, Yukichi; Kubota, Tetsuo

2014-02-12

NLRP3 plays a role in sensing various pathogen components or stresses in the innate immune system. Once activated, NLRP3 associates with apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) and procaspase-1 to form a large protein complex termed inflammasome. Although some investigators have proposed a model of NLRP3-inflammasome containing an adaptor protein caspase recruitment domain-containing protein 8 (CARD8), the role of this molecule remains obscure. This study aimed to clarify the interaction between CARD8 and wild-type NLRP3 as well as mutant forms of NLRP3 linked with cryopyrin-associated periodic syndromes (CAPS). In here HEK293 expression system, cells were transfected with the cDNAs for inflammasome components. Also used were peripheral blood mononuclear cells (PBMCs) and human monocyte-derived macrophages (HMDMs) from healthy volunteers. The interaction of CARD8 and NLRP3 was studied by immunoprecipitation. The effect of CARD8 expression on IL-1β secretion was assessed by ELISA. CARD8 knockdown experiments were carried out by transfection of the specific siRNA into HMDMs. In HEK293 cells, CARD8 interacted with wild-type NLRP3, but not with CAPS-associated mutant NLRP3. CARD8 significantly reduced IL-1β secretion from cells transfected with wild-type NLRP3, but not if they were transfected with mutant NLRP3. In addition, association of endogenously expressed CARD8 with NLRP3 was confirmed in resting PBMCs, and CARD8 knockdown resulted in higher amount of IL-1β secretion from HMDMs. Until specific stimuli activate NLRP3, CARD8 holds NLRP3, and is supposed to prevent activation by subtle stimuli. However, CAPS-associated mutant NLRP3 is unable to bind with CARD8, which might be relevant to the pathogenesis of CAPS.

Heterogeneity of signal transduction by Na-K-ATPase α-isoforms: role of Src interaction.

PubMed

Yu, Hui; Cui, Xiaoyu; Zhang, Jue; Xie, Joe X; Banerjee, Moumita; Pierre, Sandrine V; Xie, Zijian

2018-02-01

Of the four Na-K-ATPase α-isoforms, the ubiquitous α1 Na-K-ATPase possesses both ion transport and Src-dependent signaling functions. Mechanistically, we have identified two putative pairs of domain interactions between α1 Na-K-ATPase and Src that are critical for α1 signaling function. Our subsequent report that α2 Na-K-ATPase lacks these putative Src-binding sites and fails to carry on Src-dependent signaling further supported our proposed model of direct interaction between α1 Na-K-ATPase and Src but fell short of providing evidence for a causative role. This hypothesis was specifically tested here by introducing key residues of the two putative Src-interacting domains present on α1 but not α2 sequence into the α2 polypeptide, generating stable cell lines expressing this mutant, and comparing its signaling properties to those of α2-expressing cells. The mutant α2 was fully functional as a Na-K-ATPase. In contrast to wild-type α2, the mutant gained α1-like signaling function, capable of Src interaction and regulation. Consistently, the expression of mutant α2 redistributed Src into caveolin-1-enriched fractions and allowed ouabain to activate Src-mediated signaling cascades, unlike wild-type α2 cells. Finally, mutant α2 cells exhibited a growth phenotype similar to that of the α1 cells and proliferated much faster than wild-type α2 cells. These findings reveal the structural requirements for the Na-K-ATPase to function as a Src-dependent receptor and provide strong evidence of isoform-specific Src interaction involving the identified key amino acids. The sequences surrounding the putative Src-binding sites in α2 are highly conserved across species, suggesting that the lack of Src binding may play a physiologically important and isoform-specific role.

A Herpes Simplex Virus Type 1 Mutant Expressing a Baculovirus Inhibitor of Apoptosis Gene in Place of Latency-Associated Transcript Has a Wild-Type Reactivation Phenotype in the Mouse

PubMed Central

Jin, Ling; Perng, Guey-Chuen; Mott, Kevin R.; Osorio, Nelson; Naito, Julia; Brick, David J.; Carpenter, Dale; Jones, Clinton; Wechsler, Steven L.

2005-01-01

The latency-associated transcript (LAT) is essential for the wild-type herpes simplex virus type 1 (HSV-1) high-reactivation phenotype since LAT− mutants have a low-reactivation phenotype. We previously reported that LAT can decrease apoptosis and proposed that this activity is involved in LAT's ability to enhance the HSV-1 reactivation phenotype. The first 20% of the primary 8.3-kb LAT transcript is sufficient for enhancing the reactivation phenotype and for decreasing apoptosis, supporting this proposal. For this study, we constructed an HSV-1 LAT− mutant that expresses the baculovirus antiapoptosis gene product cpIAP under control of the LAT promoter and in place of the LAT region mentioned above. Mice were ocularly infected with this mutant, designated dLAT-cpIAP, and the reactivation phenotype was determined using the trigeminal ganglion explant model. dLAT-cpIAP had a reactivation phenotype similar to that of wild-type virus and significantly higher than that of (i) the LAT− mutant dLAT2903; (ii) dLAT1.5, a control virus containing the same LAT deletion as dLAT-cpIAP, but with no insertion of foreign DNA, thereby controlling for potential readthrough transcription past the cpIAP insert; and (iii) dLAT-EGFP, a control virus identical to dLAT-cpIAP except that it contained the enhanced green fluorescent protein open reading frame (ORF) in place of the cpIAP ORF, thereby controlling for expression of a random foreign gene instead of the cpIAP gene. These results show that an antiapoptosis gene with no sequence similarity to LAT can efficiently substitute for the LAT function involved in enhancing the in vitro-induced HSV-1 reactivation phenotype in the mouse. PMID:16160155

The Chemical Chaperone Phenylbutyrate Rescues MCT8 Mutations Associated With Milder Phenotypes in Patients With Allan-Herndon-Dudley Syndrome.

PubMed

Braun, Doreen; Schweizer, Ulrich

2017-03-01

Mutations in the thyroid hormone transporter monocarboxylate transporter 8 (MCT8) prevent appropriate entry of thyroid hormones into brain cells during development and cause severe mental retardation in affected patients. The current treatment options are thyromimetic compounds that enter the brain independently of MCT8. Some MCT8-deficient patients (e.g., those carrying MCT8delF501) will not be as severely affected as most others. We have shown that the MCT8delF501 protein has decreased protein stability but important residual function once it reaches the plasma membrane. We were able to rescue protein expression and the function of MCT8delF501 in a Madin-Darby canine kidney cell model by application of the chemical chaperone sodium phenylbutyrate (NaPB), a drug that has been used to treat patients with cystic fibrosis and urea cycle defects for extended periods of time. In the present study, we have extended our previous study and report on the NaPB-dependent rescue of a series of other pathogenic MCT8 mutants associated with milder patient phenotypes. We show that NaPB can functionally rescue the expression and activities of Ser194Phe, Ser290Phe, Leu434Trp, Arg445Cys, Leu492Pro, and Leu568Pro mutations in MCT8 in a dose-dependent manner. The soy isoflavone genistein, a dietary supplement, which was effective in MCT8delF501, was also effective in increasing the expression and transport of these MCT8 mutants; however, the effect size differed among mutants. Kinetic analyses revealed that the Michaelis constants of the mutants toward the primary substrate 3,3',5-triiodothyronine were not much different from the wild-type value, suggesting that these mutants are not impaired in their interaction with substrate but rather destabilized by the mutation and degraded. Copyright © 2017 by the Endocrine Society.

Sleep restores behavioral plasticity to Drosophila mutants

PubMed Central

Dissel, Stephane; Angadi, Veena; Kirszenblat, Leonie; Suzuki, Yasuko; Donlea, Jeff; Klose, Markus; Koch, Zachary; English, Denis; Winsky-Sommerer, Raphaelle; van Swinderen, Bruno; Shaw, Paul J.

2015-01-01

SUMMARY Given the role that sleep plays in modulating plasticity, we hypothesized that increasing sleep would restore memory to canonical memory mutants without specifically rescuing the causal molecular-lesion. Sleep was increased using three independent strategies: activating the dorsal Fan Shaped Body (FB), increasing the expression of Fatty acid binding protein (dFabp) or by administering the GABA-A agonist 4,5,6,7-tetrahydroisoxazolo-[5,4-c]pyridine-3-ol (THIP). Short-term memory (STM) or Long-term memory (LTM) was evaluated in rutabaga (rut) and dunce (dnc) mutants using Aversive Phototaxic Suppression (APS) and courtship conditioning. Each of the three independent strategies increased sleep and restored memory to rut and dnc mutants. Importantly, inducing sleep also reverses memory defects in a Drosophila model of Alzheimer’s disease. Together these data demonstrate that sleep plays a more fundamental role in modulating behavioral plasticity than previously appreciated and suggests that increasing sleep may benefit patients with certain neurological disorders. PMID:25913403

In Vitro Expansion of CAG, CAA, and Mixed CAG/CAA Repeats.

PubMed

Figura, Grzegorz; Koscianska, Edyta; Krzyzosiak, Wlodzimierz J

2015-08-11

Polyglutamine diseases, including Huntington's disease and a number of spinocerebellar ataxias, are caused by expanded CAG repeats that are located in translated sequences of individual, functionally-unrelated genes. Only mutant proteins containing polyglutamine expansions have long been thought to be pathogenic, but recent evidence has implicated mutant transcripts containing long CAG repeats in pathogenic processes. The presence of two pathogenic factors prompted us to attempt to distinguish the effects triggered by mutant protein from those caused by mutant RNA in cellular models of polyglutamine diseases. We used the SLIP (Synthesis of Long Iterative Polynucleotide) method to generate plasmids expressing long CAG repeats (forming a hairpin structure), CAA-interrupted CAG repeats (forming multiple unstable hairpins) or pure CAA repeats (not forming any secondary structure). We successfully modified the original SLIP protocol to generate repeats of desired length starting from constructs containing short repeat tracts. We demonstrated that the SLIP method is a time- and cost-effective approach to manipulate the lengths of expanded repeat sequences.

Intron retention and nuclear loss of SFPQ are molecular hallmarks of ALS.

PubMed

Luisier, Raphaelle; Tyzack, Giulia E; Hall, Claire E; Mitchell, Jamie S; Devine, Helen; Taha, Doaa M; Malik, Bilal; Meyer, Ione; Greensmith, Linda; Newcombe, Jia; Ule, Jernej; Luscombe, Nicholas M; Patani, Rickie

2018-05-22

Mutations causing amyotrophic lateral sclerosis (ALS) strongly implicate ubiquitously expressed regulators of RNA processing. To understand the molecular impact of ALS-causing mutations on neuronal development and disease, we analysed transcriptomes during in vitro differentiation of motor neurons (MNs) from human control and patient-specific VCP mutant induced-pluripotent stem cells (iPSCs). We identify increased intron retention (IR) as a dominant feature of the splicing programme during early neural differentiation. Importantly, IR occurs prematurely in VCP mutant cultures compared with control counterparts. These aberrant IR events are also seen in independent RNAseq data sets from SOD1- and FUS-mutant MNs. The most significant IR is seen in the SFPQ transcript. The SFPQ protein binds extensively to its retained intron, exhibits lower nuclear abundance in VCP mutant cultures and is lost from nuclei of MNs in mouse models and human sporadic ALS. Collectively, we demonstrate SFPQ IR and nuclear loss as molecular hallmarks of familial and sporadic ALS.

Pilot study of large-scale production of mutant pigs by ENU mutagenesis.

PubMed

Hai, Tang; Cao, Chunwei; Shang, Haitao; Guo, Weiwei; Mu, Yanshuang; Yang, Shulin; Zhang, Ying; Zheng, Qiantao; Zhang, Tao; Wang, Xianlong; Liu, Yu; Kong, Qingran; Li, Kui; Wang, Dayu; Qi, Meng; Hong, Qianlong; Zhang, Rui; Wang, Xiupeng; Jia, Qitao; Wang, Xiao; Qin, Guosong; Li, Yongshun; Luo, Ailing; Jin, Weiwu; Yao, Jing; Huang, Jiaojiao; Zhang, Hongyong; Li, Menghua; Xie, Xiangmo; Zheng, Xuejuan; Guo, Kenan; Wang, Qinghua; Zhang, Shibin; Li, Liang; Xie, Fei; Zhang, Yu; Weng, Xiaogang; Yin, Zhi; Hu, Kui; Cong, Yimei; Zheng, Peng; Zou, Hailong; Xin, Leilei; Xia, Jihan; Ruan, Jinxue; Li, Hegang; Zhao, Weiming; Yuan, Jing; Liu, Zizhan; Gu, Weiwang; Li, Ming; Wang, Yong; Wang, Hongmei; Yang, Shiming; Liu, Zhonghua; Wei, Hong; Zhao, Jianguo; Zhou, Qi; Meng, Anming

2017-06-22

N-ethyl-N-nitrosourea (ENU) mutagenesis is a powerful tool to generate mutants on a large scale efficiently, and to discover genes with novel functions at the whole-genome level in Caenorhabditis elegans, flies, zebrafish and mice, but it has never been tried in large model animals. We describe a successful systematic three-generation ENU mutagenesis screening in pigs with the establishment of the Chinese Swine Mutagenesis Consortium. A total of 6,770 G1 and 6,800 G3 pigs were screened, 36 dominant and 91 recessive novel pig families with various phenotypes were established. The causative mutations in 10 mutant families were further mapped. As examples, the mutation of SOX10 (R109W) in pig causes inner ear malfunctions and mimics human Mondini dysplasia, and upregulated expression of FBXO32 is associated with congenital splay legs. This study demonstrates the feasibility of artificial random mutagenesis in pigs and opens an avenue for generating a reservoir of mutants for agricultural production and biomedical research.

Complementation between polymerase- and exonuclease-deficient mitochondrial DNA polymerase mutants in genomically engineered flies

PubMed Central

Bratic, Ana; Kauppila, Timo E. S.; Macao, Bertil; Grönke, Sebastian; Siibak, Triinu; Stewart, James B.; Baggio, Francesca; Dols, Jacqueline; Partridge, Linda; Falkenberg, Maria; Wredenberg, Anna; Larsson, Nils-Göran

2015-01-01

Replication errors are the main cause of mitochondrial DNA (mtDNA) mutations and a compelling approach to decrease mutation levels would therefore be to increase the fidelity of the catalytic subunit (POLγA) of the mtDNA polymerase. Here we genomically engineer the tamas locus, encoding fly POLγA, and introduce alleles expressing exonuclease- (exo−) and polymerase-deficient (pol−) POLγA versions. The exo− mutant leads to accumulation of point mutations and linear deletions of mtDNA, whereas pol− mutants cause mtDNA depletion. The mutant tamas alleles are developmentally lethal but can complement each other in trans resulting in viable flies with clonally expanded mtDNA mutations. Reconstitution of human mtDNA replication in vitro confirms that replication is a highly dynamic process where POLγA goes on and off the template to allow complementation during proofreading and elongation. The created fly models are valuable tools to study germ line transmission of mtDNA and the pathophysiology of POLγA mutation disease. PMID:26554610

Preventing mutant huntingtin proteolysis and intermittent fasting promote autophagy in models of Huntington disease.

PubMed

Ehrnhoefer, Dagmar E; Martin, Dale D O; Schmidt, Mandi E; Qiu, Xiaofan; Ladha, Safia; Caron, Nicholas S; Skotte, Niels H; Nguyen, Yen T N; Vaid, Kuljeet; Southwell, Amber L; Engemann, Sabine; Franciosi, Sonia; Hayden, Michael R

2018-03-06

Huntington disease (HD) is caused by the expression of mutant huntingtin (mHTT) bearing a polyglutamine expansion. In HD, mHTT accumulation is accompanied by a dysfunction in basal autophagy, which manifests as specific defects in cargo loading during selective autophagy. Here we show that the expression of mHTT resistant to proteolysis at the caspase cleavage site D586 (C6R mHTT) increases autophagy, which may be due to its increased binding to the autophagy adapter p62. This is accompanied by faster degradation of C6R mHTT in vitro and a lack of mHTT accumulation the C6R mouse model with age. These findings may explain the previously observed neuroprotective properties of C6R mHTT. As the C6R mutation cannot be easily translated into a therapeutic approach, we show that a scheduled feeding paradigm is sufficient to lower mHTT levels in YAC128 mice expressing cleavable mHTT. This is consistent with a previous model, where the presence of cleavable mHTT impairs basal autophagy, while fasting-induced autophagy remains functional. In HD, mHTT clearance and autophagy may become increasingly impaired as a function of age and disease stage, because of gradually increased activity of mHTT-processing enzymes. Our findings imply that mHTT clearance could be enhanced by a regulated dietary schedule that promotes autophagy.

A porcine model of neurofibromatosis type 1 that mimics the human disease.

PubMed

White, Katherine A; Swier, Vicki J; Cain, Jacob T; Kohlmeyer, Jordan L; Meyerholz, David K; Tanas, Munir R; Uthoff, Johanna; Hammond, Emily; Li, Hua; Rohret, Frank A; Goeken, Adam; Chan, Chun-Hung; Leidinger, Mariah R; Umesalma, Shaikamjad; Wallace, Margaret R; Dodd, Rebecca D; Panzer, Karin; Tang, Amy H; Darbro, Benjamin W; Moutal, Aubin; Cai, Song; Li, Wennan; Bellampalli, Shreya S; Khanna, Rajesh; Rogers, Christopher S; Sieren, Jessica C; Quelle, Dawn E; Weimer, Jill M

2018-06-21

Loss of the NF1 tumor suppressor gene causes the autosomal dominant condition, neurofibromatosis type 1 (NF1). Children and adults with NF1 suffer from pathologies including benign and malignant tumors to cognitive deficits, seizures, growth abnormalities, and peripheral neuropathies. NF1 encodes neurofibromin, a Ras-GTPase activating protein, and NF1 mutations result in hyperactivated Ras signaling in patients. Existing NF1 mutant mice mimic individual aspects of NF1, but none comprehensively models the disease. We describe a potentially novel Yucatan miniswine model bearing a heterozygotic mutation in NF1 (exon 42 deletion) orthologous to a mutation found in NF1 patients. NF1+/ex42del miniswine phenocopy the wide range of manifestations seen in NF1 patients, including café au lait spots, neurofibromas, axillary freckling, and neurological defects in learning and memory. Molecular analyses verified reduced neurofibromin expression in swine NF1+/ex42del fibroblasts, as well as hyperactivation of Ras, as measured by increased expression of its downstream effectors, phosphorylated ERK1/2, SIAH, and the checkpoint regulators p53 and p21. Consistent with altered pain signaling in NF1, dysregulation of calcium and sodium channels was observed in dorsal root ganglia expressing mutant NF1. Thus, these NF1+/ex42del miniswine recapitulate the disease and provide a unique, much-needed tool to advance the study and treatment of NF1.

Rha1, a new mutant of Arabidopsis disturbed in root slanting, gravitropism and auxin physiology.

PubMed

Fortunati, Alessio; Piconese, Silvia; Tassone, Paola; Ferrari, Simone; Migliaccio, Fernando

2008-11-01

A new Arabidopsis mutant is characterized (rha1) that shows, in the roots, reduced right-handed slanting, reduced gravitropism and resistance to 2,4-D, TIBA, NPA and ethylene. It also shows reduced length in the shoot and root, reduced number of lateral roots and shorter siliques. The gene was cloned through TAIL-PCR and resulted in a HSF. Because none of the known gravitropic and auxinic mutants result from damage in a HSF, rha1 seems to belong to a new class of this group of mutants. Quantitative PCR analysis showed that the expression of the gene is increased by heat and cold shock, and by presence of 2,4-D in the media. Study of the expression through the GUS reporter gene revealed increased expression in clinostated and gravistimulated plants, but only in adult tissues, and not in the apical meristems of shoots and roots.

Rha1, a new mutant of Arabidopsis disturbed in root slanting, gravitropism and auxin physiology

PubMed Central

Fortunati, Alessio; Piconese, Silvia; Tassone, Paola; Ferrari, Simone

2008-01-01

A new Arabidopsis mutant is characterized (rha1) that shows, in the roots, reduced right-handed slanting, reduced gravitropism and resistance to 2,4-D, TIBA, NPA and ethylene. It also shows reduced length in the shoot and root, reduced number of lateral roots and shorter siliques. The gene was cloned through TAIL-PCR and resulted in a HSF. Because none of the known gravitropic and auxinic mutants result from damage in a HSF, rha1 seems to belong to a new class of this group of mutants. Quantitative PCR analysis showed that the expression of the gene is increased by heat and cold shock, and by presence of 2,4-D in the media. Study of the expression through the GUS reporter gene revealed increased expression in clinostated and gravistimulated plants, but only in adult tissues, and not in the apical meristems of shoots and roots. PMID:19704429

AAV-mediated delivery of the transcription factor XBP1s into the striatum reduces mutant Huntingtin aggregation in a mouse model of Huntington's disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zuleta, Amparo; Center for Molecular Studies of the Cell, Institute of Biomedical Sciences, University of Chile, Santiago; Vidal, Rene L.

2012-04-13

Highlights: Black-Right-Pointing-Pointer The contribution of ER stress to HD has not been directly addressed. Black-Right-Pointing-Pointer Expression of XBP1s using AAVs decreases Huntingtin aggregation in vivo. Black-Right-Pointing-Pointer We describe a new in vivo model of HD based on the expression of a large fragment of mHtt-RFP. -- Abstract: Huntington's disease (HD) is caused by mutations that expand a polyglutamine region in the amino-terminal domain of Huntingtin (Htt), leading to the accumulation of intracellular inclusions and progressive neurodegeneration. Recent reports indicate the engagement of endoplasmic reticulum (ER) stress responses in human HD post mortem samples and animal models of the disease. Adaptationmore » to ER stress is mediated by the activation of the unfolded protein response (UPR), an integrated signal transduction pathway that attenuates protein folding stress by controlling the expression of distinct transcription factors including X-Box binding protein 1 (XBP1). Here we targeted the expression of XBP1 on a novel viral-based model of HD. We delivered an active form of XBP1 locally into the striatum of adult mice using adeno-associated vectors (AAVs) and co-expressed this factor with a large fragment of mutant Htt as a fusion protein with RFP (Htt588{sup Q95}-mRFP) to directly visualize the accumulation of Htt inclusions in the brain. Using this approach, we observed a significant reduction in the accumulation of Htt588{sup Q95}-mRFP intracellular inclusion when XBP1 was co-expressed in the striatum. These results contrast with recent findings indicating a protective effect of XBP1 deficiency in neurodegeneration using knockout mice, and suggest a potential use of gene therapy strategies to manipulate the UPR in the context of HD.« less

Secisbp2 Is Essential for Embryonic Development and Enhances Selenoprotein Expression

PubMed Central

Seeher, Sandra; Atassi, Tarik; Mahdi, Yassin; Carlson, Bradley A.; Braun, Doreen; Wirth, Eva K.; Klein, Marc O.; Reix, Nathalie; Miniard, Angela C.; Schomburg, Lutz; Hatfield, Dolph L.; Driscoll, Donna M.

2014-01-01

Abstract Aims: The selenocysteine insertion sequence (SECIS)-binding protein 2 (Secisbp2) binds to SECIS elements located in the 3′-untranslated region of eukaryotic selenoprotein mRNAs. Selenoproteins contain the rare amino acid selenocysteine (Sec). Mutations in SECISBP2 in humans lead to reduced selenoprotein expression thereby affecting thyroid hormone-dependent growth and differentiation processes. The most severe cases also display myopathy, hearing impairment, male infertility, increased photosensitivity, mental retardation, and ataxia. Mouse models are needed to understand selenoprotein-dependent processes underlying the patients' pleiotropic phenotypes. Results: Unlike tRNA[Ser]Sec-deficient embryos, homozygous Secisbp2-deleted embryos implant, but fail before gastrulation. Heterozygous inactivation of Secisbp2 reduced the amount of selenoprotein expressed, but did not affect the thyroid hormone axis or growth. Conditional deletion of Secisbp2 in hepatocytes significantly decreased selenoprotein expression. Unexpectedly, the loss of Secisbp2 reduced the abundance of many, but not all, selenoprotein mRNAs. Transcript-specific and gender-selective effects on selenoprotein mRNA abundance were greater in Secisbp2-deficient hepatocytes than in tRNA[Ser]Sec-deficient cells. Despite the massive reduction of Dio1 and Sepp1 mRNAs, significantly more corresponding protein was detected in primary hepatocytes lacking Secisbp2 than in cells lacking tRNA[Ser]Sec. Regarding selenoprotein expression, compensatory nuclear factor, erythroid-derived, like 2 (Nrf2)-dependent gene expression, or embryonic development, phenotypes were always milder in Secisbp2-deficient than in tRNA[Ser]Sec-deficient mice. Innovation: We report the first Secisbp2 mutant mouse models. The conditional mutants provide a model for analyzing Secisbp2 function in organs not accessible in patients. Conclusion: In hepatocyte-specific conditional mouse models, Secisbp2 gene inactivation is less detrimental than tRNA[Ser]Sec inactivation. A role of Secisbp2 in stabilizing selenoprotein mRNAs in vivo was uncovered. Antioxid. Redox Signal. 21, 835–849. PMID:24274065

Cellular androgen content influences enzalutamide agonism of F877L mutant androgen receptor

PubMed Central

Coleman, Daniel J.; Van Hook, Kathryn; King, Carly J.; Schwartzman, Jacob; Lisac, Robert; Urrutia, Joshua; Sehrawat, Archana; Woodward, Josha; Wang, Nicholas J.; Gulati, Roman; Thomas, George V.; Beer, Tomasz M.; Gleave, Martin; Korkola, James E.; Gao, Lina; Heiser, Laura M.; Alumkal, Joshi J.

2016-01-01

Prostate cancer is the most commonly diagnosed and second-most lethal cancer among men in the United States. The vast majority of prostate cancer deaths are due to castration-resistant prostate cancer (CRPC) – the lethal form of the disease that has progressed despite therapies that interfere with activation of androgen receptor (AR) signaling. One emergent resistance mechanism to medical castration is synthesis of intratumoral androgens that activate the AR. This insight led to the development of the AR antagonist enzalutamide. However, resistance to enzalutamide invariably develops, and disease progression is nearly universal. One mechanism of resistance to enzalutamide is an F877L mutation in the AR ligand-binding domain that can convert enzalutamide to an agonist of AR activity. However, mechanisms that contribute to the agonist switch had not been fully clarified, and there were no therapies to block AR F877L. Using cell line models of castration-resistant prostate cancer (CRPC), we determined that cellular androgen content influences enzalutamide agonism of mutant F877L AR. Further, enzalutamide treatment of AR F877L-expressing cell lines recapitulated the effects of androgen activation of F877L AR or wild-type AR. Because the BET bromodomain inhibitor JQ-1 was previously shown to block androgen activation of wild-type AR, we tested JQ-1 in AR F877L-expressing CRPC models. We determined that JQ-1 suppressed androgen or enzalutamide activation of mutant F877L AR and suppressed growth of mutant F877L AR CRPC tumors in vivo, demonstrating a new strategy to treat tumors harboring this mutation. PMID:27276681

Inactivation of Cellobiose Dehydrogenases Modifies the Cellulose Degradation Mechanism of Podospora anserina.

PubMed

Tangthirasunun, Narumon; Navarro, David; Garajova, Sona; Chevret, Didier; Tong, Laetitia Chan Ho; Gautier, Valérie; Hyde, Kevin D; Silar, Philippe; Berrin, Jean-Guy

2017-01-15

Conversion of biomass into high-value products, including biofuels, is of great interest to developing sustainable biorefineries. Fungi are an inexhaustible source of enzymes to degrade plant biomass. Cellobiose dehydrogenases (CDHs) play an important role in the breakdown through synergistic action with fungal lytic polysaccharide monooxygenases (LPMOs). The three CDH genes of the model fungus Podospora anserina were inactivated, resulting in single and multiple CDH mutants. We detected almost no difference in growth and fertility of the mutants on various lignocellulose sources, except on crystalline cellulose, on which a 2-fold decrease in fertility of the mutants lacking P. anserina CDH1 (PaCDH1) and PaCDH2 was observed. A striking difference between wild-type and mutant secretomes was observed. The secretome of the mutant lacking all CDHs contained five beta-glucosidases, whereas the wild type had only one. P. anserina seems to compensate for the lack of CDH with secretion of beta-glucosidases. The addition of P. anserina LPMO to either the wild-type or mutant secretome resulted in improvement of cellulose degradation in both cases, suggesting that other redox partners present in the mutant secretome provided electrons to LPMOs. Overall, the data showed that oxidative degradation of cellulosic biomass relies on different types of mechanisms in fungi. Plant biomass degradation by fungi is a complex process involving dozens of enzymes. The roles of each enzyme or enzyme class are not fully understood, and utilization of a model amenable to genetic analysis should increase the comprehension of how fungi cope with highly recalcitrant biomass. Here, we report that the cellobiose dehydrogenases of the model fungus Podospora anserina enable it to consume crystalline cellulose yet seem to play a minor role on actual substrates, such as wood shavings or miscanthus. Analysis of secreted proteins suggests that Podospora anserina compensates for the lack of cellobiose dehydrogenase by increasing beta-glucosidase expression and using an alternate electron donor for LPMO. Copyright © 2016 American Society for Microbiology.

Inactivation of Cellobiose Dehydrogenases Modifies the Cellulose Degradation Mechanism of Podospora anserina

PubMed Central

Tangthirasunun, Narumon; Navarro, David; Garajova, Sona; Chevret, Didier; Tong, Laetitia Chan Ho; Gautier, Valérie; Hyde, Kevin D.

2016-01-01

ABSTRACT Conversion of biomass into high-value products, including biofuels, is of great interest to developing sustainable biorefineries. Fungi are an inexhaustible source of enzymes to degrade plant biomass. Cellobiose dehydrogenases (CDHs) play an important role in the breakdown through synergistic action with fungal lytic polysaccharide monooxygenases (LPMOs). The three CDH genes of the model fungus Podospora anserina were inactivated, resulting in single and multiple CDH mutants. We detected almost no difference in growth and fertility of the mutants on various lignocellulose sources, except on crystalline cellulose, on which a 2-fold decrease in fertility of the mutants lacking P. anserina CDH1 (PaCDH1) and PaCDH2 was observed. A striking difference between wild-type and mutant secretomes was observed. The secretome of the mutant lacking all CDHs contained five beta-glucosidases, whereas the wild type had only one. P. anserina seems to compensate for the lack of CDH with secretion of beta-glucosidases. The addition of P. anserina LPMO to either the wild-type or mutant secretome resulted in improvement of cellulose degradation in both cases, suggesting that other redox partners present in the mutant secretome provided electrons to LPMOs. Overall, the data showed that oxidative degradation of cellulosic biomass relies on different types of mechanisms in fungi. IMPORTANCE Plant biomass degradation by fungi is a complex process involving dozens of enzymes. The roles of each enzyme or enzyme class are not fully understood, and utilization of a model amenable to genetic analysis should increase the comprehension of how fungi cope with highly recalcitrant biomass. Here, we report that the cellobiose dehydrogenases of the model fungus Podospora anserina enable it to consume crystalline cellulose yet seem to play a minor role on actual substrates, such as wood shavings or miscanthus. Analysis of secreted proteins suggests that Podospora anserina compensates for the lack of cellobiose dehydrogenase by increasing beta-glucosidase expression and using an alternate electron donor for LPMO. PMID:27836848

Overexpression of p62/SQSTM1 promotes the degradations of abnormally accumulated PrP mutants in cytoplasm and relieves the associated cytotoxicities via autophagy-lysosome-dependent way.

PubMed

Xu, Yin; Zhang, Jin; Tian, Chan; Ren, Ke; Yan, Yu-E; Wang, Ke; Wang, Hui; Chen, Cao; Wang, Jing; Shi, Qi; Dong, Xiao-Ping

2014-04-01

The protein of p62/sequestosome 1 (SQSTM1), a key cargo adaptor protein involved in autophagy-lysosome degradation, exhibits inclusion bodies structure in cytoplasm and plays a protective role in some models of neurodegenerative diseases. Some PrP mutants, such as PrP-CYTO and PrP-PG14, also form cytosolic inclusion bodies and trigger neuronal apoptosis either in cultured cells or in transgenic mice. Here, we demonstrated that the cellular p62/SQSTM1 incorporated into the inclusion bodies formed by expressing the abnormal PrP mutants, PrP-CYTO and PrP-PG14, in human embryonic kidney 293 cells. Overexpression of p62/SQSTM1 efficiently relieved the cytosolic aggregations and cell apoptosis induced by the abnormal PrPs. Autophagy-lysosome inhibitors instead of proteasome inhibitor sufficiently blocked the p62/SQSTM1-mediated degradations of abnormal PrPs. Overexpression of p62/SQSTM1 did not alter the levels of light chain 3 (LC3) in the cells expressing various PrPs. However, more complexes of p62/SQSTM1 with LC3 were detected in the cells expressing the misfolded PrPs. These data imply that p62/SQSTM1 plays an important role in the homeostasis of abnormal PrPs via autophagy-lysosome-dependent way.

The Arabidopsis leaf transcriptome reveals distinct but also overlapping responses to colonization by phyllosphere commensals and pathogen infection with impact on plant health.

PubMed

Vogel, Christine; Bodenhausen, Natacha; Gruissem, Wilhelm; Vorholt, Julia A

2016-10-01

Plants are colonized by a variety of bacteria, most of which are not pathogenic. Currently, the plant responses to phyllosphere commensals or to pathogen infection in the presence of commensals are not well understood. Here, we examined the transcriptional response of Arabidopsis thaliana leaves to colonization by common commensal bacteria in a gnotobiotic system using RNA sequencing and conducted plant mutant assays. Arabidopsis responded differently to the model bacteria Sphingomonas melonis Fr1 (S.Fr1) and Methylobacterium extorquens PA1 (M.PA1). Whereas M.PA1 only marginally affected the expression of plant genes (< 10), S.Fr1 colonization changed the expression of almost 400 genes. For the latter, genes related to defense responses were activated and partly overlapped with those elicited by the pathogen Pseudomonas syringae DC3000 (Pst). As S.Fr1 is able to mediate plant protective activity against Pst, we tested plant immunity mutants and found that the pattern-recognition co-receptor mutant bak1/bkk1 showed attenuated S.Fr1-dependent plant protection. The experiments demonstrate that the plant responds differently to members of its natural phyllosphere microbiota. A subset of commensals trigger expression of defense-related genes and thereby may contribute to plant health upon pathogen encounter. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Isolation, characterization, and expression analyses of tryptophan aminotransferase genes in a maize dek18 mutant

USDA-ARS?s Scientific Manuscript database

The dek18 mutant of maize has decreased auxin content in kernels. Molecular and functional characterization of this mutant line offers the possibility to better understand auxin biology in maize seed development. Seeds of the dek18 mutants are smaller compared to wild type seeds and the vegetative d...

Problem-Solving Test: Tryptophan Operon Mutants

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2010-01-01

This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

Disruption of LACCASE4 and 17 Results in Tissue-Specific Alterations to Lignification of Arabidopsis thaliana Stems[W

PubMed Central

Berthet, Serge; Demont-Caulet, Nathalie; Pollet, Brigitte; Bidzinski, Przemyslaw; Cézard, Laurent; Le Bris, Phillipe; Borrega, Nero; Hervé, Jonathan; Blondet, Eddy; Balzergue, Sandrine; Lapierre, Catherine; Jouanin, Lise

2011-01-01

Peroxidases have been shown to be involved in the polymerization of lignin precursors, but it remains unclear whether laccases (EC 1.10.3.2) participate in constitutive lignification. We addressed this issue by studying laccase T-DNA insertion mutants in Arabidopsis thaliana. We identified two genes, LAC4 and LAC17, which are strongly expressed in stems. LAC17 was mainly expressed in the interfascicular fibers, whereas LAC4 was expressed in vascular bundles and interfascicular fibers. We produced two double mutants by crossing the LAC17 (lac17) mutant with two LAC4 mutants (lac4-1 and lac4-2). The single and double mutants grew normally in greenhouse conditions. The single mutants had moderately low lignin levels, whereas the stems of lac4-1 lac17 and lac4-2 lac17 mutants had lignin contents that were 20 and 40% lower than those of the control, respectively. These lower lignin levels resulted in higher saccharification yields. Thioacidolysis revealed that disrupting LAC17 principally affected the deposition of G lignin units in the interfascicular fibers and that complementation of lac17 with LAC17 restored a normal lignin profile. This study provides evidence that both LAC4 and LAC17 contribute to the constitutive lignification of Arabidopsis stems and that LAC17 is involved in the deposition of G lignin units in fibers. PMID:21447792

Leptin gene promoter DNA methylation in WNIN obese mutant rats

PubMed Central

2014-01-01

Background Obesity has become an epidemic in worldwide population. Leptin gene defect could be one of the causes for obesity. Two mutant obese rats WNIN/Ob and WNIN/GROb, isolated at National Centre for Laboratory Animal Sciences (NCLAS), Hyderabad, India, were found to be leptin resistant. The present study aims to understand the regulatory mechanisms underlying the resistance by promoter DNA methylation of leptin gene in these mutant obese rats. Methods Male obese mutant homozygous, carrier and heterozygous rats of WNIN/Ob and WNIN/GROb strain of 6 months old were studied to check the leptin gene expression (RT-PCR) and promoter DNA methylation (MassARRAY Compact system, SEQUENOM) of leptin gene by invivo and insilico approach. Results Homozygous WNIN/Ob and WNIN/GROb showed significantly higher leptin gene expression compared to carrier and lean counterparts. Leptin gene promoter DNA sequence region was analyzed ranging from transcription start site (TSS) to-550 bp length and found four CpGs in this sequence among them only three CpG loci (-309, -481, -502) were methylated in these WNIN mutant rat phenotypes. Conclusion The increased percentage of methylation in WNIN mutant lean and carrier phenotypes is positively correlated with transcription levels. Thus genetic variation may have effect on methylation percentages and subsequently on the regulation of leptin gene expression which may lead to obesity in these obese mutant rat strains. PMID:24495350

Hierarchical mutational events compensate for glutamate auxotrophy of a Bacillus subtilis gltC mutant.

PubMed

Dormeyer, Miriam; Lübke, Anastasia L; Müller, Peter; Lentes, Sabine; Reuß, Daniel R; Thürmer, Andrea; Stülke, Jörg; Daniel, Rolf; Brantl, Sabine; Commichau, Fabian M

2017-06-01

Glutamate is the major donor of nitrogen for anabolic reactions. The Gram-positive soil bacterium Bacillus subtilis either utilizes exogenously provided glutamate or synthesizes it using the gltAB-encoded glutamate synthase (GOGAT). In the absence of glutamate, the transcription factor GltC activates expression of the GOGAT genes for glutamate production. Consequently, a gltC mutant strain is auxotrophic for glutamate. Using a genetic selection and screening system, we could isolate and differentiate between gltC suppressor mutants in one step. All mutants had acquired the ability to synthesize glutamate, independent of GltC. We identified (i) gain-of-function mutations in the gltR gene, encoding the transcription factor GltR, (ii) mutations in the promoter of the gltAB operon and (iii) massive amplification of the genomic locus containing the gltAB operon. The mutants belonging to the first two classes constitutively expressed the gltAB genes and produced sufficient glutamate for growth. By contrast, mutants that belong to the third class appeared most frequently and solved glutamate limitation by increasing the copy number of the poorly expressed gltAB genes. Thus, glutamate auxotrophy of a B. subtilis gltC mutant can be relieved in multiple ways. Moreover, recombination-dependent amplification of the gltAB genes is the predominant mutational event indicating a hierarchy of mutations. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Identification of compounds protective against G93A-SOD1 toxicity for the treatment of amyotrophic lateral sclerosis.

PubMed

Benmohamed, Radhia; Arvanites, Anthony C; Kim, Jinho; Ferrante, Robert J; Silverman, Richard B; Morimoto, Richard I; Kirsch, Donald R

2011-03-01

The underlying cause of amyotrophic lateral sclerosis (ALS), a progressive neurodegenerative disorder, remains unknown. However, there is strong evidence that one pathophysiological mechanism, toxic protein misfolding and/or aggregation, may trigger motor neuron dysfunction and loss. Since the clinical and pathological features of sporadic and familial ALS are indistinguishable, all forms of the disease may be better understood and ultimately treated by studying pathogenesis and therapy in models expressing mutant forms of SOD1. We developed a cellular model in which cell death depended on the expression of G93A-SOD1, a mutant form of superoxide dismutase found in familial ALS patients that produces toxic protein aggregates. This cellular model was optimized for high throughput screening to identify protective compounds from a >50,000 member chemical library. Three novel chemical scaffolds were selected for further study following screen implementation, counter-screening and secondary testing, including studies with purchased analogs. All three scaffolds blocked SOD1 aggregation in high content screening assays and data on the optimization and further characterization of these compounds will be reported separately. These data suggest that optimization of these chemicals scaffolds may produce therapeutic candidates for ALS patients.

Epidermal Growth Factor Receptor Mutation Enhances Expression of Cadherin-5 in Lung Cancer Cells.

PubMed

Hung, Ming-Szu; Chen, I-Chuan; Lung, Jr-Hau; Lin, Paul-Yann; Li, Ya-Chin; Tsai, Ying-Huang

2016-01-01

Epidermal growth factor receptor (EGFR) activation has been shown to play a critical role in tumor angiogenesis. In this study, we investigate the correlation between EGFR mutations and cadherin-5 (CDH5), which is an angiogenic factor, in lung cancer cells. Increased expression CDH5 is observed in lung cancer cells with EGFR mutations. Stable lung cancer cell lines expressing mutant (exon 19 deletion E746-A750, and exon 21 missense mutation L858R) and wild type EGFR genes are established. A significantly higher expression of CDH5 is observed in exon 19 deletion stable lung cancer cells and mouse xenografts. Further studies show that expression of CDH5 is decreased after the inhibition of EGFR and downstream Akt pathways in lung cancer cells with EGFR mutation. In addition, mutant EGFR genes potentiates angiogenesis in lung cancer cells, which is inhibited by CDH5 siRNA, and potentiates migration and invasion in lung cancer cells. Our study shows that mutant EGFR genes are associated with overexpression of CDH5 through increased phosphorylation of EGFR and downstream Akt pathways. Our result may provide an insight into the association of mutant EGFR and CDH5 expression in lung cancer and aid further development of target therapy for NSCLC in the future.

Epidermal Growth Factor Receptor Mutation Enhances Expression of Cadherin-5 in Lung Cancer Cells

PubMed Central

Hung, Ming-Szu; Chen, I-Chuan; Lung, Jr-Hau; Lin, Paul-Yann; Li, Ya-Chin; Tsai, Ying-Huang

2016-01-01

Epidermal growth factor receptor (EGFR) activation has been shown to play a critical role in tumor angiogenesis. In this study, we investigate the correlation between EGFR mutations and cadherin-5 (CDH5), which is an angiogenic factor, in lung cancer cells. Increased expression CDH5 is observed in lung cancer cells with EGFR mutations. Stable lung cancer cell lines expressing mutant (exon 19 deletion E746-A750, and exon 21 missense mutation L858R) and wild type EGFR genes are established. A significantly higher expression of CDH5 is observed in exon 19 deletion stable lung cancer cells and mouse xenografts. Further studies show that expression of CDH5 is decreased after the inhibition of EGFR and downstream Akt pathways in lung cancer cells with EGFR mutation. In addition, mutant EGFR genes potentiates angiogenesis in lung cancer cells, which is inhibited by CDH5 siRNA, and potentiates migration and invasion in lung cancer cells. Our study shows that mutant EGFR genes are associated with overexpression of CDH5 through increased phosphorylation of EGFR and downstream Akt pathways. Our result may provide an insight into the association of mutant EGFR and CDH5 expression in lung cancer and aid further development of target therapy for NSCLC in the future. PMID:27362942

Spontaneous hepatic repopulation in transgenic mice expressing mutant human α1-antitrypsin by wild-type donor hepatocytes.

PubMed

Ding, Jianqiang; Yannam, Govardhana R; Roy-Chowdhury, Namita; Hidvegi, Tunda; Basma, Hesham; Rennard, Stephen I; Wong, Ronald J; Avsar, Yesim; Guha, Chandan; Perlmutter, David H; Fox, Ira J; Roy-Chowdhury, Jayanta

2011-05-01

α1-Antitrypsin deficiency is an inherited condition that causes liver disease and emphysema. The normal function of this protein, which is synthesized by the liver, is to inhibit neutrophil elastase, a protease that degrades connective tissue of the lung. In the classical form of the disease, inefficient secretion of a mutant α1-antitrypsin protein (AAT-Z) results in its accumulation within hepatocytes and reduced protease inhibitor activity, resulting in liver injury and pulmonary emphysema. Because mutant protein accumulation increases hepatocyte cell stress, we investigated whether transplanted hepatocytes expressing wild-type AAT might have a competitive advantage relative to AAT-Z-expressing hepatocytes, using transgenic mice expressing human AAT-Z. Wild-type donor hepatocytes replaced 20%-98% of mutant host hepatocytes, and repopulation was accelerated by injection of an adenovector expressing hepatocyte growth factor. Spontaneous hepatic repopulation with engrafted hepatocytes occurred in the AAT-Z-expressing mice even in the absence of severe liver injury. Donor cells replaced both globule-containing and globule-devoid cells, indicating that both types of host hepatocytes display impaired proliferation relative to wild-type hepatocytes. These results suggest that wild-type hepatocyte transplantation may be therapeutic for AAT-Z liver disease and may provide an alternative to protein replacement for treating emphysema in AAT-ZZ individuals.

BIG: a calossin-like protein required for polar auxin transport in Arabidopsis

PubMed Central

Gil, Pedro; Dewey, Elizabeth; Friml, Jiri; Zhao, Yunde; Snowden, Kimberley C.; Putterill, Jo; Palme, Klaus; Estelle, Mark; Chory, Joanne

2001-01-01

Polar auxin transport is crucial for the regulation of auxin action and required for some light-regulated responses during plant development. We have found that two mutants of Arabidopsis—doc1, which displays altered expression of light-regulated genes, and tir3, known for its reduced auxin transport—have similar defects and define mutations in a single gene that we have renamed BIG. BIG is very similar to the Drosophila gene Calossin/Pushover, a member of a gene family also present in Caenorhabditis elegans and human genomes. The protein encoded by BIG is extraordinary in size, 560 kD, and contains several putative Zn-finger domains. Expression-profiling experiments indicate that altered expression of multiple light-regulated genes in doc1 mutants can be suppressed by elevated levels of auxin caused by overexpression of an auxin biosynthetic gene, suggesting that normal auxin distribution is required to maintain low-level expression of these genes in the dark. Double mutants of tir3 with the auxin mutants pin1, pid, and axr1 display severe defects in auxin-dependent growth of the inflorescence. Chemical inhibitors of auxin transport change the intracellular localization of the auxin efflux carrier PIN1 in doc1/tir3 mutants, supporting the idea that BIG is required for normal auxin efflux. PMID:11485992

The C. elegans ceh-36 gene encodes a putative homemodomain transcription factor involved in chemosensory functions of ASE and AWC neurons.

PubMed

Koga, Makoto; Ohshima, Yasumi

2004-02-20

Chemotaxis to water-soluble chemicals such as sodium ion is an important behavior of Caenorhabditis elegans for seeking food, and ASE chemosensory neurons have a major role in this behavior. We isolated mutants defective in chemotaxis to sodium acetate. We show here that among them ks86 had a mutation in the ceh-36 gene. ceh-36 :: gfp reporter constructs were expressed in ASE and AWC neurons. In a mutant of the che-1 gene, which encodes another transcription factor and is required for specification of ASE neurons, expression of the ceh-36 :: gfp reporter in ASE is lost. This indicates that the ceh-36 gene functions downstream of the che-1 gene in ASE. In the ceh-36(ks86) mutant, expression of the tax-2 gene encoding a cyclic nucleotide-gated channel was reduced in ASE and AWC. This affords an explanation for defects of the ceh-36 mutant in the chemotaxis mediated by ASE and AWC. When a ceh-36 cDNA was expressed in an adult ceh-36 mutant by a heat shock promoter, chemotaxis to sodium acetate was recovered. These results suggest that ceh-36 is required for functions, and not for development, of ASE.

[Expression in E.coli and bioactivity assay of Micrococcus luteus resuscitation promoting factor domain and its mutants].

PubMed

Yue, Chen-Li; Shi, Jie-Ran; Shi, Chang-Hong; Zhang, Hai; Zhao, Lei; Zhang, Ting-Fen; Zhao, Yong; Xi, Li

2008-10-01

To express Micrococcus luteus resuscitation promoting factor (Rpf) domain and its mutants in prokaryotic cells, and to investigate their bioactivity. The gene of Rpf domain and its mutants (E54K, E54A) were amplified by polymerase chain reaction (PCR) from the genome of Micrococcus luteus and cloned into pMD18-T vector. After sequenced, the Rpf domain and its mutant gene were subcloned into expression vector PGEX-4T-1, and transfected into E. coli DH5alpha. The expressed product was purified by affinity chromatography using GST Fusion Protein Purification bead. The aim proteins were identified by SDS-PAGE analysis and by Western blot with monoclonal antibodies against Rpf domain (mAb). The bioactivity of the proteins was analyzed by stimulating the resuscitation of Mycobacterium smegmatis. The sequences of the PCR products were identical to those of the Rpf domain and its mutant gene in GenBank. The relative molecular mass identified by SDS-PAGE analysis was consistent with that had been reported, which was also confirmed by Western blot analysis that there were specific bindings at 32 000 with Rpf domain mAb. The purified GST-Rpf domain could stimulate resuscitation of Mycobacterium smegmatis. Replacements E54A and especially E54K resulted in inhibition of Rpf resuscitation activity. Rpf domain and two kinds of its mutant protein were obtained, and its effects on the resuscitation of dormant Mycobacterium smegmatis were clarified.

Differential requirements of two recA mutants for constitutive SOS expression in Escherichia coli K-12.

PubMed

Long, Jarukit Edward; Renzette, Nicholas; Centore, Richard C; Sandler, Steven J

2008-01-01

Repairing DNA damage begins with its detection and is often followed by elicitation of a cellular response. In E. coli, RecA polymerizes on ssDNA produced after DNA damage and induces the SOS Response. The RecA-DNA filament is an allosteric effector of LexA auto-proteolysis. LexA is the repressor of the SOS Response. Not all RecA-DNA filaments, however, lead to an SOS Response. Certain recA mutants express the SOS Response (recA(C)) in the absence of external DNA damage in log phase cells. Genetic analysis of two recA(C) mutants was used to determine the mechanism of constitutive SOS (SOS(C)) expression in a population of log phase cells using fluorescence of single cells carrying an SOS reporter system (sulAp-gfp). SOS(C) expression in recA4142 mutants was dependent on its initial level of transcription, recBCD, recFOR, recX, dinI, xthA and the type of medium in which the cells were grown. SOS(C) expression in recA730 mutants was affected by none of the mutations or conditions tested above. It is concluded that not all recA(C) alleles cause SOS(C) expression by the same mechanism. It is hypothesized that RecA4142 is loaded on to a double-strand end of DNA and that the RecA filament is stabilized by the presence of DinI and destabilized by RecX. RecFOR regulate the activity of RecX to destabilize the RecA filament. RecA730 causes SOS(C) expression by binding to ssDNA in a mechanism yet to be determined.

Staying Alive: Cancer Cells Expressing Mutant KRas Depend on ERH for Survival | Center for Cancer Research

Cancer.gov

The small G-protein KRas acts like a molecular switch, turning on and off pro-growth signaling pathways within cells when appropriate. In a large number of cancers, KRas is permanently turned on by a variety of mutations and drives the constant growth of these tumor cells. KRas itself has proved to be a poor drug target so researchers in the laboratory of Ji Luo, Ph.D., in CCR’s Medical Oncology Branch decided to look for other pathways that are essential for the growth of cells expressing mutant KRas. These pathways could present new drug targets, and blocking their activities might selectively affect cells that express mutant KRas.

Sterol Methyl Oxidases Affect Embryo Development via Auxin-Associated Mechanisms.

PubMed

Zhang, Xia; Sun, Shuangli; Nie, Xiang; Boutté, Yohann; Grison, Magali; Li, Panpan; Kuang, Susu; Men, Shuzhen

2016-05-01

Sterols are essential molecules for multiple biological processes, including embryogenesis, cell elongation, and endocytosis. The plant sterol biosynthetic pathway is unique in the involvement of two distinct sterol 4α-methyl oxidase (SMO) families, SMO1 and SMO2, which contain three and two isoforms, respectively, and are involved in sequential removal of the two methyl groups at C-4. In this study, we characterized the biological functions of members of the SMO2 gene family. SMO2-1 was strongly expressed in most tissues during Arabidopsis (Arabidopsis thaliana) development, whereas SMO2-2 showed a more specific expression pattern. Although single smo2 mutants displayed no obvious phenotype, the smo2-1 smo2-2 double mutant was embryonic lethal, and the smo2-1 smo2-2/+ mutant was dwarf, whereas the smo2-1/+ smo2-2 mutant exhibited a moderate phenotype. The phenotypes of the smo2 mutants resembled those of auxin-defective mutants. Indeed, the expression of DR5rev:GFP, an auxin-responsive reporter, was reduced and abnormal in smo2-1 smo2-2 embryos. Furthermore, the expression and subcellular localization of the PIN1 auxin efflux facilitator also were altered. Consistent with these observations, either the exogenous application of auxin or endogenous auxin overproduction (YUCCA9 overexpression) partially rescued the smo2-1 smo2-2 embryonic lethality. Surprisingly, the dwarf phenotype of smo2-1 smo2-2/+ was completely rescued by YUCCA9 overexpression. Gas chromatography-mass spectrometry analysis revealed a substantial accumulation of 4α-methylsterols, substrates of SMO2, in smo2 heterozygous double mutants. Together, our data suggest that SMO2s are important for correct sterol composition and function partially through effects on auxin accumulation, auxin response, and PIN1 expression to regulate Arabidopsis embryogenesis and postembryonic development. © 2016 American Society of Plant Biologists. All Rights Reserved.

Sterol Methyl Oxidases Affect Embryo Development via Auxin-Associated Mechanisms1

PubMed Central

Zhang, Xia; Sun, Shuangli; Nie, Xiang; Boutté, Yohann; Grison, Magali; Li, Panpan; Kuang, Susu

2016-01-01

Sterols are essential molecules for multiple biological processes, including embryogenesis, cell elongation, and endocytosis. The plant sterol biosynthetic pathway is unique in the involvement of two distinct sterol 4α-methyl oxidase (SMO) families, SMO1 and SMO2, which contain three and two isoforms, respectively, and are involved in sequential removal of the two methyl groups at C-4. In this study, we characterized the biological functions of members of the SMO2 gene family. SMO2-1 was strongly expressed in most tissues during Arabidopsis (Arabidopsis thaliana) development, whereas SMO2-2 showed a more specific expression pattern. Although single smo2 mutants displayed no obvious phenotype, the smo2-1 smo2-2 double mutant was embryonic lethal, and the smo2-1 smo2-2/+ mutant was dwarf, whereas the smo2-1/+ smo2-2 mutant exhibited a moderate phenotype. The phenotypes of the smo2 mutants resembled those of auxin-defective mutants. Indeed, the expression of DR5rev:GFP, an auxin-responsive reporter, was reduced and abnormal in smo2-1 smo2-2 embryos. Furthermore, the expression and subcellular localization of the PIN1 auxin efflux facilitator also were altered. Consistent with these observations, either the exogenous application of auxin or endogenous auxin overproduction (YUCCA9 overexpression) partially rescued the smo2-1 smo2-2 embryonic lethality. Surprisingly, the dwarf phenotype of smo2-1 smo2-2/+ was completely rescued by YUCCA9 overexpression. Gas chromatography-mass spectrometry analysis revealed a substantial accumulation of 4α-methylsterols, substrates of SMO2, in smo2 heterozygous double mutants. Together, our data suggest that SMO2s are important for correct sterol composition and function partially through effects on auxin accumulation, auxin response, and PIN1 expression to regulate Arabidopsis embryogenesis and postembryonic development. PMID:27006488

Interaction between sleep and the immune response in Drosophila: a role for the NFkappaB relish.

PubMed

Williams, Julie A; Sathyanarayanan, Sriram; Hendricks, Joan C; Sehgal, Amita

2007-04-01

The regulation of sleep is poorly understood. While some molecules, including those involved in inflammatory/immune responses, have been implicated in the control of sleep, their role in this process remains unclear. The Drosophila model for sleep provides a powerful system to identify and test the role of sleep-relevant molecules. We conducted an unbiased screen for molecular candidates involved in sleep regulation by analyzing genome-wide changes in gene expression associated with sleep deprivation in Drosophila. To further examine a role of immune-related genes identified in the screen, we performed molecular assays, analysis of sleep behavior in relevant mutant and transgenic flies, and quantitative analysis of the immune response following sleep deprivation. A major class of genes that increased expression with sleep deprivation was that involved in the immune response. We found that immune genes were also upregulated during baseline conditions in the cyc01 sleep mutant. Since the expression of an NFkappaB, Relish, a central player in the inflammatory response, was increased with all manipulations that reduced sleep, we focused on this gene. Flies deficient in, but not lacking, Relish expression exhibited reduced levels of nighttime sleep, supporting a role for Relish in the control of sleep. This mutant phenotype was rescued by expression of a Relish transgene in fat bodies, which are the major site of inflammatory responses in Drosophila. Finally, sleep deprivation also affected the immune response, such that flies deprived of sleep for several hours were more resistant to bacterial infection than those flies not deprived of sleep. These results demonstrate a conserved interaction between sleep and the immune system. Genetic manipulation of an immune component alters sleep, and likewise, acute sleep deprivation alters the immune response.

Interaction Between Sleep and the Immune Response in Drosophila: A Role for the NFκB Relish

PubMed Central

Williams, Julie A.; Sathyanarayanan, Sriram; Hendricks, Joan C.; Sehgal, Amita

2010-01-01

Study Objectives The regulation of sleep is poorly understood. While some molecules, including those involved in inflammatory/immune responses, have been implicated in the control of sleep, their role in this process remains unclear. The Drosophila model for sleep provides a powerful system to identify and test the role of sleep-relevant molecules. Design We conducted an unbiased screen for molecular candidates involved in sleep regulation by analyzing genome-wide changes in gene expression associated with sleep deprivation in Drosophila. To further examine a role of immune-related genes identified in the screen, we performed molecular assays, analysis of sleep behavior in relevant mutant and transgenic flies, and quantitative analysis of the immune response following sleep deprivation. Results A major class of genes that increased expression with sleep deprivation was that involved in the immune response. We found that immune genes were also upregulated during baseline conditions in the cyc01 sleep mutant. Since the expression of an NFκB, Relish, a central player in the inflammatory response, was increased with all manipulations that reduced sleep, we focused on this gene. Flies deficient in, but not lacking, Relish expression exhibited reduced levels of nighttime sleep, supporting a role for Relish in the control of sleep. This mutant phenotype was rescued by expression of a Relish transgene in fat bodies, which are the major site of inflammatory responses in Drosophila. Finally, sleep deprivation also affected the immune response, such that flies deprived of sleep for several hours were more resistant to bacterial infection than those flies not deprived of sleep. Conclusion These results demonstrate a conserved interaction between sleep and the immune system. Genetic manipulation of an immune component alters sleep, and likewise, acute sleep deprivation alters the immune response. PMID:17520783

Lifespan decrease in a Caenorhabditis elegans mutant lacking TRX-1, a thioredoxin expressed in ASJ sensory neurons.

PubMed

Miranda-Vizuete, Antonio; Fierro González, Juan Carlos; Gahmon, Gabriele; Burghoorn, Jan; Navas, Plácido; Swoboda, Peter

2006-01-23

Thioredoxins are a class of small proteins that play a key role in regulating many cellular redox processes. We report here the characterization of the first member of the thioredoxin family in metazoans that is mainly associated with neurons. The Caenorhabditis elegans gene B0228.5 encodes a thioredoxin (TRX-1) that is expressed in ASJ ciliated sensory neurons, and to some extent also in the posterior-most intestinal cells. TRX-1 is active at reducing protein disulfides in the presence of a heterologous thioredoxin reductase. A mutant worm strain carrying a null allele of the trx-1 gene displays a reproducible decrease in both mean and maximum lifespan when compared to wild-type. The identification and characterization of TRX-1 paves the way to use C. elegans as an in vivo model to study the role of thioredoxins in lifespan and nervous system physiology and pathology.

Motor neurons and glia exhibit specific individualized responses to TDP-43 expression in a Drosophila model of amyotrophic lateral sclerosis.

PubMed

Estes, Patricia S; Daniel, Scott G; McCallum, Abigail P; Boehringer, Ashley V; Sukhina, Alona S; Zwick, Rebecca A; Zarnescu, Daniela C

2013-05-01

Amyotrophic lateral sclerosis (ALS) is a fatal disease characterized by complex neuronal and glial phenotypes. Recently, RNA-based mechanisms have been linked to ALS via RNA-binding proteins such as TDP-43, which has been studied in vivo using models ranging from yeast to rodents. We have developed a Drosophila model of ALS based on TDP-43 that recapitulates several aspects of pathology, including motor neuron loss, locomotor dysfunction and reduced survival. Here we report the phenotypic consequences of expressing wild-type and four different ALS-linked TDP-43 mutations in neurons and glia. We show that TDP-43-driven neurodegeneration phenotypes are dose- and age-dependent. In motor neurons, TDP-43 appears restricted to nuclei, which are significantly misshapen due to mutant but not wild-type protein expression. In glia and in the developing neuroepithelium, TDP-43 associates with cytoplasmic puncta. TDP-43-containing RNA granules are motile in cultured motor neurons, although wild-type and mutant variants exhibit different kinetic properties. At the neuromuscular junction, the expression of TDP-43 in motor neurons versus glia leads to seemingly opposite synaptic phenotypes that, surprisingly, translate into comparable locomotor defects. Finally, we explore sleep as a behavioral readout of TDP-43 expression and find evidence of sleep fragmentation consistent with hyperexcitability, a suggested mechanism in ALS. These findings support the notion that although motor neurons and glia are both involved in ALS pathology, at the cellular level they can exhibit different responses to TDP-43. In addition, our data suggest that individual TDP-43 alleles utilize distinct molecular mechanisms, which will be important for developing therapeutic strategies.

Potentiation of antileukemic therapies by the dual PI3K/PDK-1 inhibitor, BAG956: effects on BCR-ABL– and mutant FLT3-expressing cells

PubMed Central

Weisberg, Ellen; Banerji, Lolita; Wright, Renee D.; Barrett, Rosemary; Ray, Arghya; Moreno, Daisy; Catley, Laurence; Jiang, Jingrui; Hall-Meyers, Elizabeth; Sauveur-Michel, Maira; Stone, Richard; Galinsky, Ilene; Fox, Edward; Kung, Andrew L.

2008-01-01

Mediators of PI3K/AKT signaling have been implicated in chronic myeloid leukemia (CML) and acute myeloid leukemia (AML). Studies have shown that inhibitors of PI3K/AKT signaling, such as wortmannin and LY294002, are able to inhibit CML and AML cell proliferation and synergize with targeted tyrosine kinase inhi-bitors. We investigated the ability of BAG956, a dual PI3K/PDK-1 inhibitor, to be used in combination with inhibitors of BCR-ABL and mutant FLT3, as well as with the mTOR inhibitor, rapamycin, and the rapamycin derivative, RAD001. BAG956 was shown to block AKT phosphorylation induced by BCR-ABL–, and induce apoptosis of BCR-ABL–expressing cell lines and patient bone marrow cells at concentrations that also inhibit PI3K signaling. Enhancement of the inhibitory effects of the tyrosine kinase inhibitors, imatinib and nilotinib, by BAG956 was demonstrated against BCR-ABL expressing cells both in vitro and in vivo. We have also shown that BAG956 is effective against mutant FLT3-expressing cell lines and AML patient bone marrow cells. Enhancement of the inhibitory effects of the tyrosine kinase inhibitor, PKC412, by BAG956 was demonstrated against mutant FLT3-expressing cells. Finally, BAG956 and rapamycin/RAD001 were shown to combine in a nonantagonistic fashion against BCR-ABL– and mutant FLT3-expressing cells both in vitro and in vivo. PMID:18184863

HoxB2 binds mutant SOD1 and is altered in transgenic model of ALS.

PubMed

Zhai, Jinbin; Lin, Hong; Canete-Soler, Rafaela; Schlaepfer, William W

2005-09-15

Mutations in Cu/Zn superoxide dismutase (SOD1) cause approximately 20% of familial amyotrophic lateral sclerosis by a toxic gain of function; however, the precise mechanisms remain unclear. Here, we report the identification of HoxB2, a homeodomain-containing transcription factor, as a G93A mutant SOD1 interactive protein in a yeast two-hybrid screen. We show that HoxB2 co-precipitates and co-localizes with mutant SOD1 in neuronal cell lines, as well as in brain and spinal cord of G93A mutant SOD1 transgenic mice. Mutagenesis further shows that this interaction is mediated by the central homeodomain of HoxB2. In motor neuron-like NSC-34 cells, overexpression of HoxB2 or its homeodomain decreases the insolubility of mutant SOD1 and inhibits G93A or G86R mutant SOD1-induced neuronal cell death. In human and mouse tissues, we show that expression of HoxB2 persists in adult spinal cord and is primarily localized in nuclei of motor neurons. In G93A transgenic mice, HoxB2 co-localizes with mutant SOD1 and is redistributed to perikarya and proximal neurites of motor neurons. In addition, there is progressive accumulation of HoxB2 and mutant SOD1 as punctate inclusions in the neuropil surrounding motor neurons. Taken together, our findings demonstrate that interaction of HoxB2 with mutant SOD1 occurs in motor neurons of G93A mutant SOD1 transgenic mice and suggest that this interaction may modulate the neurotoxicity of mutant SOD1.

Characterization of a Mutant Deficient for Ammonium and Nitric Oxide Signalling in the Model System Chlamydomonas reinhardtii

PubMed Central

Sanz-Luque, Emanuel; Ocaña-Calahorro, Francisco; Galván, Aurora; Fernández, Emilio; de Montaigu, Amaury

2016-01-01

The ubiquitous signalling molecule Nitric Oxide (NO) is characterized not only by the variety of organisms in which it has been described, but also by the wealth of biological processes that it regulates. In contrast to the expanding repertoire of functions assigned to NO, however, the mechanisms of NO action usually remain unresolved, and genes that work within NO signalling cascades are seldom identified. A recent addition to the list of known NO functions is the regulation of the nitrogen assimilation pathway in the unicellular alga Chlamydomonas reinhardtii, a well-established model organism for genetic and molecular studies that offers new possibilities in the search for mediators of NO signalling. By further exploiting a collection of Chlamydomonas insertional mutant strains originally isolated for their insensitivity to the ammonium (NH4+) nitrogen source, we found a mutant which, in addition to its ammonium insensitive (AI) phenotype, was not capable of correctly sensing the NO signal. Similarly to what had previously been described in the AI strain cyg56, the expression of nitrogen assimilation genes in the mutant did not properly respond to treatments with various NO donors. Complementation experiments showed that NON1 (NO Nitrate 1), a gene that encodes a protein containing no known functional domain, was the gene underlying the mutant phenotype. Beyond the identification of NON1, our findings broadly demonstrate the potential for Chlamydomonas reinhardtii to be used as a model system in the search for novel components of gene networks that mediate physiological responses to NO. PMID:27149516

Loss of protein phosphatase 6 in mouse keratinocytes enhances K-rasG12D -driven tumor promotion.

PubMed

Kurosawa, Koreyuki; Inoue, Yui; Kakugawa, Yoichiro; Yamashita, Yoji; Kanazawa, Kosuke; Kishimoto, Kazuhiro; Nomura, Miyuki; Momoi, Yuki; Sato, Ikuro; Chiba, Natsuko; Suzuki, Mai; Ogoh, Honami; Yamada, Hidekazu; Miura, Koh; Watanabe, Toshio; Tanuma, Nobuhiro; Tachi, Masahiro; Shima, Hiroshi

2018-05-14

Here, we address the function of protein phosphatase 6 (PP6) loss on K-ras-initiated tumorigenesis in keratinocytes. To do so, we developed tamoxifen-inducible double mutant (K-ras G12D -expressing and Ppp6c-deficient) mice in which K-ras G12D expression is driven by the cytokeratin 14 (K14) promoter. Doubly-mutant mice showed early onset tumor formation in lip, nipples, external genitalia, anus and palms, and had to be sacrificed by three weeks after induction by tamoxifen, while comparably-treated K-ras G12D -expressing mice did not. HE-staining of lip tumors before euthanasia revealed that all were papillomas, some containing focal squamous cell carcinoma. Immunohistochemical analysis of lip of doubly-mutant versus K-ras G12D mice revealed that cell proliferation and cell size increased approximately two-fold relative to K-ras G12D -expressing mutants, and epidermal thickness of lip tissue greatly increased relative to that seen in K-ras G12D only mice. Moreover, AKT phosphorylation increased in K-ras G12D -expressing/Ppp6c-deficient cells, as did phosphorylation of the downstream effectors 4EBP1, S6, and GSK3, suggesting that protein synthesis and survival signals are enhanced in lip tissues of doubly-mutant mice. Finally, increased numbers of K14-positive cells were present in the suprabasal layer of doubly-mutant mice, indicating abnormal keratinocyte differentiation, and γH2AX-positive cells accumulated, indicating perturbed DNA repair. Taken together, Ppp6c deficiency enhances K-ras G12D -dependent tumor promotion. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Mutant matrix metalloproteinase-9 reduces postoperative peritoneal adhesions in rats.

PubMed

Atta, Hussein; El-Rehany, Mahmoud; Roeb, Elke; Abdel-Ghany, Hend; Ramzy, Maggie; Gaber, Shereen

2016-02-01

Postoperative peritoneal adhesions continue to be a major source of morbidity and occasional mortality. Studies have shown that matrix metalloproteinase-9 (MMP-9) levels are decreased postoperatively which may limits matrix degradation and participate in the development of peritoneal adhesions. In this proof-of-principle study, we evaluated the effect of gene therapy with catalytically inactive mutant MMP-9 on postoperative peritoneal adhesions in rats. Adenovirus encoding mutant MMP-9 (Ad-mMMP-9) or saline was instilled in the peritoneal cavity after cecal and parietal peritoneal injury in rats. Expression of mutant MMP-9 transcript was verified by sequencing. Adenovirus E4 gene expression, adhesion scores, MMP-9, tissue plasminogen activator (tPA), plasminogen activator inhibitor-1 (PAI-1) and transforming growth factor-β1 (TGF-β1) expression were evaluated at sacrifice one week after treatment. Both mutant MMP-9 transcripts and adenovirus E4 gene were expressed in Ad-mMMP-9 treated adhesions. Adhesions severity decreased significantly (p = 0.036) in the Ad-mMMP-9-treated compared with saline-treated adhesions. Expression of MMP-9 mRNA and protein were elevated (p = 0.001 and p = 0.029, respectively) in the Ad-mMMP-9-treated adhesions compared with saline-treated adhesions. While tPA levels were increased (p = 0.02) in Ad-mMMP-9 treated adhesions compared with saline-treated adhesions, TGF-β1 and PAI-1 levels were decreased (p = 0.017 and p = 0.042, respectively). No difference in mortality were found between groups (p = 0.64). Mutant MMP-9 gene therapy effectively transduced peritoneal adhesions resulting in reduction of severity of primary peritoneal adhesions. Copyright © 2016 IJS Publishing Group Limited. Published by Elsevier Ltd. All rights reserved.

The plasma membrane Ca2+ pump PMCA4b inhibits the migratory and metastatic activity of BRAF mutant melanoma cells.

PubMed

Hegedũs, Luca; Garay, Tamás; Molnár, Eszter; Varga, Karolina; Bilecz, Ágnes; Török, Szilvia; Padányi, Rita; Pászty, Katalin; Wolf, Matthias; Grusch, Michael; Kállay, Enikõ; Döme, Balázs; Berger, Walter; Hegedũs, Balázs; Enyedi, Agnes

2017-06-15

Oncogenic mutations of BRAF lead to constitutive ERK activity that supports melanoma cell growth and survival. While Ca 2+ signaling is a well-known regulator of tumor progression, the crosstalk between Ca 2+ signaling and the Ras-BRAF-MEK-ERK pathway is much less explored. Here we show that in BRAF mutant melanoma cells the abundance of the plasma membrane Ca 2+ ATPase isoform 4b (PMCA4b, ATP2B4) is low at baseline but markedly elevated by treatment with the mutant BRAF specific inhibitor vemurafenib. In line with these findings gene expression microarray data also shows decreased PMCA4b expression in cutaneous melanoma when compared to benign nevi. The MEK inhibitor selumetinib-similarly to that of the BRAF-specific inhibitor-also increases PMCA4b levels in both BRAF and NRAS mutant melanoma cells suggesting that the MAPK pathway is involved in the regulation of PMCA4b expression. The increased abundance of PMCA4b in the plasma membrane enhances [Ca 2+ ] i clearance from cells after Ca 2+ entry. Moreover we show that both vemurafenib treatment and PMCA4b overexpression induce marked inhibition of migration of BRAF mutant melanoma cells. Importantly, reduced migration of PMCA4b expressing BRAF mutant cells is associated with a marked decrease in their metastatic potential in vivo. Taken together, our data reveal an important crosstalk between Ca 2+ signaling and the MAPK pathway through the regulation of PMCA4b expression and suggest that PMCA4b is a previously unrecognized metastasis suppressor. © 2016 UICC.

Increased phospho-adducin immunoreactivity in a murine model of amyotrophic lateral sclerosis.

PubMed

Shan, X; Hu, J H; Cayabyab, F S; Krieger, C

2005-01-01

Adducins alpha, beta and gamma are proteins that link spectrin and actin in the regulation of cytoskeletal architecture and are substrates for protein kinase C and other signaling molecules. Previous studies have shown that expressions of phosphorylated adducin (phospho-adducin) and protein kinase C are increased in spinal cord tissue from patients who died with amyotrophic lateral sclerosis, a neurodegenerative disorder of motoneurons and other cells. However, the distribution of phospho-adducin immunoreactivity has not been described in the mammalian spinal cord. We have evaluated the distribution of immunoreactivity to serine/threonine-dependent phospho-adducin at a region corresponding to the myristoylated alanine-rich C kinase substrate-related domain of adducin in spinal cords of mice over-expressing mutant human superoxide dismutase, an animal model of amyotrophic lateral sclerosis, and in control littermates. We find phospho-adducin immunoreactivity in control spinal cord in ependymal cells surrounding the central canal, neurons and astrocytes. Phospho-adducin immunoreactivity is localized to the cell bodies, dendrites and axons of some motoneurons, as well as to astrocytes in the gray and white matter. Spinal cords of mutant human superoxide dismutase mice having motoneuron loss exhibit significantly increased phospho-adducin immunoreactivity in ventral and dorsal horn spinal cord regions, but not in ependyma surrounding the central canal, compared with control animals. Increased phospho-adducin immunoreactivity localizes predominantly to astrocytes and likely increases as a consequence of the astrogliosis that occurs in the mutant human superoxide dismutase mouse with disease progression. These findings demonstrate increased immunoreactivity against phosphorylated adducin at the myristoylated alanine-rich C kinase substrate domain in a murine model of amyotrophic lateral sclerosis. As adducin is a substrate for protein kinase C at the myristoylated alanine-rich C kinase substrate domain, the increased phospho-adducin immunoreactivity is likely a consequence of protein kinase C activation in neurons and astrocytes of the spinal cord and evidence for aberrant phosphorylation events in mutant human superoxide dismutase mice that may affect neuron survival.

Novel Gal3 proteins showing altered Gal80p binding cause constitutive transcription of Gal4p-activated genes in Saccharomyces cerevisiae.

PubMed Central

Blank, T E; Woods, M P; Lebo, C M; Xin, P; Hopper, J E

1997-01-01

Gal4p-mediated activation of galactose gene expression in Saccharomyces cerevisiae normally requires both galactose and the activity of Gal3p. Recent evidence suggests that in cells exposed to galactose, Gal3p binds to and inhibits Ga180p, an inhibitor of the transcriptional activator Gal4p. Here, we report on the isolation and characterization of novel mutant forms of Gal3p that can induce Gal4p activity independently of galactose. Five mutant GAL3(c) alleles were isolated by using a selection demanding constitutive expression of a GAL1 promoter-driven HIS3 gene. This constitutive effect is not due to overproduction of Gal3p. The level of constitutive GAL gene expression in cells bearing different GAL3(c) alleles varies over more than a fourfold range and increases in response to galactose. Utilizing glutathione S-transferase-Gal3p fusions, we determined that the mutant Gal3p proteins show altered Gal80p-binding characteristics. The Gal3p mutant proteins differ in their requirements for galactose and ATP for their Gal80p-binding ability. The behavior of the novel Gal3p proteins provides strong support for a model wherein galactose causes an alteration in Gal3p that increases either its ability to bind to Gal80p or its access to Gal80p. With the Gal3p-Gal80p interaction being a critical step in the induction process, the Gal3p proteins constitute an important new reagent for studying the induction mechanism through both in vivo and in vitro methods. PMID:9111326

Multiple developmental programs are altered by loss of Zic1 and Zic4 to cause Dandy-Walker malformation cerebellar pathogenesis

PubMed Central

Blank, Marissa C.; Grinberg, Inessa; Aryee, Emmanuel; Laliberte, Christine; Chizhikov, Victor V.; Henkelman, R. Mark; Millen, Kathleen J.

2011-01-01

Heterozygous deletions encompassing the ZIC1;ZIC4 locus have been identified in a subset of individuals with the common cerebellar birth defect Dandy-Walker malformation (DWM). Deletion of Zic1 and Zic4 in mice produces both cerebellar size and foliation defects similar to human DWM, confirming a requirement for these genes in cerebellar development and providing a model to delineate the developmental basis of this clinically important congenital malformation. Here, we show that reduced cerebellar size in Zic1 and Zic4 mutants results from decreased postnatal granule cell progenitor proliferation. Through genetic and molecular analyses, we show that Zic1 and Zic4 have Shh-dependent function promoting proliferation of granule cell progenitors. Expression of the Shh-downstream genes Ptch1, Gli1 and Mycn was downregulated in Zic1/4 mutants, although Shh production and Purkinje cell gene expression were normal. Reduction of Shh dose on the Zic1+/−;Zic4+/− background also resulted in cerebellar size reductions and gene expression changes comparable with those observed in Zic1−/−;Zic4−/− mice. Zic1 and Zic4 are additionally required to pattern anterior vermis foliation. Zic mutant folial patterning abnormalities correlated with disrupted cerebellar anlage gene expression and Purkinje cell topography during late embryonic stages; however, this phenotype was Shh independent. In Zic1+/−;Zic4+/−;Shh+/−, we observed normal cerebellar anlage patterning and foliation. Furthermore, cerebellar patterning was normal in both Gli2-cko and Smo-cko mutant mice, where all Shh function was removed from the developing cerebellum. Thus, our data demonstrate that Zic1 and Zic4 have both Shh-dependent and -independent roles during cerebellar development and that multiple developmental disruptions underlie Zic1/4-related DWM. PMID:21307096

Functional Phenotypic Rescue of Caenorhabditis elegans Neuroligin-Deficient Mutants by the Human and Rat NLGN1 Genes

PubMed Central

Calahorro, Fernando; Ruiz-Rubio, Manuel

2012-01-01

Neuroligins are cell adhesion proteins that interact with neurexins at the synapse. This interaction may contribute to differentiation, plasticity and specificity of synapses. In humans, single mutations in neuroligin encoding genes lead to autism spectrum disorder and/or mental retardation. Caenorhabditis elegans mutants deficient in nlg-1, an orthologue of human neuroligin genes, have defects in different behaviors. Here we show that the expression of human NLGN1 or rat Nlgn1 cDNAs in C. elegans nlg-1 mutants rescues the fructose osmotic strength avoidance and gentle touch response phenotypes. Two specific point mutations in NLGN3 and NLGN4 genes, involved in autistic spectrum disorder, were further characterized in this experimental system. The R451C allele described in NLGN3, was analyzed with both human NLGN1 (R453C) and worm NLG-1 (R437C) proteins, and both were not functional in rescuing the osmotic avoidance behavior and the gentle touch response phenotype. The D396X allele described in NLGN4, which produces a truncated protein, was studied with human NLGN1 (D432X) and they did not rescue any of the behavioral phenotypes analyzed. In addition, RNAi feeding experiments measuring gentle touch response in wild type strain and worms expressing SID-1 in neurons (which increases the response to dsRNA), both fed with bacteria expressing dsRNA for nlg-1, provided evidence for a postsynaptic in vivo function of neuroligins both in muscle cells and neurons, equivalent to that proposed in mammals. This finding was further confirmed generating transgenic nlg-1 deficient mutants expressing NLG-1 under pan-neuronal (nrx-1) or pan-muscular (myo-3) specific promoters. All these results suggest that the nematode could be used as an in vivo model for studying particular synaptic mechanisms with proteins orthologues of humans involved in pervasive developmental disorders. PMID:22723984

Functional phenotypic rescue of Caenorhabditis elegans neuroligin-deficient mutants by the human and rat NLGN1 genes.

PubMed

Calahorro, Fernando; Ruiz-Rubio, Manuel

2012-01-01

Neuroligins are cell adhesion proteins that interact with neurexins at the synapse. This interaction may contribute to differentiation, plasticity and specificity of synapses. In humans, single mutations in neuroligin encoding genes lead to autism spectrum disorder and/or mental retardation. Caenorhabditis elegans mutants deficient in nlg-1, an orthologue of human neuroligin genes, have defects in different behaviors. Here we show that the expression of human NLGN1 or rat Nlgn1 cDNAs in C. elegans nlg-1 mutants rescues the fructose osmotic strength avoidance and gentle touch response phenotypes. Two specific point mutations in NLGN3 and NLGN4 genes, involved in autistic spectrum disorder, were further characterized in this experimental system. The R451C allele described in NLGN3, was analyzed with both human NLGN1 (R453C) and worm NLG-1 (R437C) proteins, and both were not functional in rescuing the osmotic avoidance behavior and the gentle touch response phenotype. The D396X allele described in NLGN4, which produces a truncated protein, was studied with human NLGN1 (D432X) and they did not rescue any of the behavioral phenotypes analyzed. In addition, RNAi feeding experiments measuring gentle touch response in wild type strain and worms expressing SID-1 in neurons (which increases the response to dsRNA), both fed with bacteria expressing dsRNA for nlg-1, provided evidence for a postsynaptic in vivo function of neuroligins both in muscle cells and neurons, equivalent to that proposed in mammals. This finding was further confirmed generating transgenic nlg-1 deficient mutants expressing NLG-1 under pan-neuronal (nrx-1) or pan-muscular (myo-3) specific promoters. All these results suggest that the nematode could be used as an in vivo model for studying particular synaptic mechanisms with proteins orthologues of humans involved in pervasive developmental disorders.

Cysteine Scanning Mutagenesis of Transmembrane Domain 10 in Organic Anion Transporting Polypeptide 1B1

PubMed Central

2015-01-01

Organic anion transporting polypeptide (OATP) 1B1 is an important drug transporter expressed in human hepatocytes. Previous studies have indicated that transmembrane (TM) domain 2, 6, 8, 9, and in particular 10 might be part of the substrate binding site/translocation pathway. To explore which amino acids in TM10 are important for substrate transport, we mutated 34 amino acids individually to cysteines, expressed them in HEK293 cells, and determined their surface expression. Transport activity of the two model substrates estrone-3-sulfate and estradiol-17β-glucuronide as well as of the drug substrate valsartan for selected mutants was measured. Except for F534C and F537C, all mutants were expressed at the plasma membrane of HEK293 cells. Mutants Q541C and A549C did not transport estradiol-17β-glucuronide and showed negligible estrone-3-sulfate transport. However, A549C showed normal valsartan transport. Pretreatment with the anionic and cell impermeable sodium (2-sulfonatoethyl)methanethiosulfonate (MTSES) affected the transport of each substrate differently. Pretreatment of L545C abolished estrone-3-sulfate uptake almost completely, while it stimulated estradiol-17β-glucuronide uptake. Further analyses revealed that mutant L545C in the absence of MTSES showed biphasic kinetics for estrone-3-sulfate that was converted to monophasic kinetics with a decreased apparent affinity, explaining the previously seen inhibition. In contrast, the apparent affinity for estradiol-17β-glucuronide was not changed by MTSES treatment, but the Vmax value was increased about 4-fold, explaining the previously seen stimulation. Maleimide labeling of L545C was affected by preincubation with estrone-3-sulfate but not with estradiol-17β-glucuronide. These results strongly suggest that L545C is part of the estrone-3-sulfate binding site/translocation pathway but is not directly involved in binding/translocation of estradiol-17β-glucuronide. PMID:24673529

Myc, Aurora Kinase-A, and mutant p53R172H co-operate in a mouse model of metastatic skin carcinoma

PubMed Central

Torchia, Enrique C.; Caulin, Carlos; Acin, Sergio; Terzian, Tamara; Kubick, Bradley J.; Box, Neil F.; Roop, Dennis R.

2015-01-01

Clinical observations, as well as data obtained from the analysis of genetically engineered mouse models, firmly established the gain-of-function (GOF) properties of certain p53 mutations. However, little is known about the underlying mechanisms. We have used two independent microarray platforms to perform a comprehensive and global analysis of tumors arising in a model of metastatic skin cancer progression, which compares the consequences of a GOF p53R172H mutant vs. p53 deficiency. DNA profiling revealed a higher level of genomic instability in GOF vs. loss-of-function (LOF) p53 squamous cell carcinomas (SCCs). Moreover, GOF p53 SCCs showed preferential amplification of Myc with a corresponding increase in its expression and deregulation of Aurora Kinase-A. Fluorescent in situ hybridization confirmed amplification of Myc in primary GOF p53 SCCs and its retention in metastatic tumors. We also identified by RNA profiling distinct gene expression profiles in GOF p53 tumors, which included enriched integrin and Rho signaling, independent of tumor stage. Thus, the progression of GOF p53 papillomas to carcinoma was marked by the acquisition of epithelial to mesenchymal transition and metastatic signatures. In contrast, LOF p53 tumors showed enrichment of genes associated with cancer proliferation and chromosomal instability. Collectively, these observations suggest that genomic instability plays a prominent role in the early stages of GOF p53 tumor progression (i.e., papillomas), while it is implicated at a later stage in LOF p53 tumors (i.e., SCCs). This model will allow us to identify specific targets in mutant p53 SCCs, which may lead to the development of new therapeutic agents for the treatment of metastatic SCCs. PMID:21963848

Murine Denys-Drash syndrome: evidence of podocyte de-differentiation and systemic mediation of glomerulosclerosis.

PubMed

Patek, Charles E; Fleming, Stewart; Miles, Colin G; Bellamy, Christopher O; Ladomery, Michael; Spraggon, Lee; Mullins, John; Hastie, Nicholas D; Hooper, Martin L

2003-09-15

Denys-Drash syndrome (DDS) is caused by dominant mutations of the Wilms' tumour suppressor gene, WT1, and characterized by a nephropathy involving diffuse mesangial sclerosis, male pseudohermaphroditism and/or Wilms' tumourigenesis. Previously, we reported that heterozygosity for the Wt1tmT396 mutation induces DDS in heterozygous and chimeric (Wt1tmT396/+<-->+/+) mice. In the present study, the fate of Wt1 mutant cells in chimeric kidneys was assessed by in situ marker analysis, and immunocytochemistry was used to re-examine the claim that glomerulosclerosis (GS) is caused by loss of WT1 and persistent Pax-2 expression by podocytes. Wt1 mutant cells colonized glomeruli efficiently, including podocytes, but some sclerotic glomeruli contained no detectable Wt1 mutant cells. The development of GS was preceded by widespread loss of ZO-1 signal in podocytes (even in kidneys where <5% of glomeruli contained Wt1 mutant podocytes), increased intra-renal renin expression, and de novo podocyte TGF-beta1 expression, but not podocyte Pax-2 expression or loss of WT1, synaptopodin, alpha-actinin-4 or nephrin expression. However, podocytes in partially sclerotic glomeruli that still expressed WT1 at high levels showed reduced vimentin expression, cell cycle re-entry, and re-expressed desmin, cytokeratin and Pax-2. The results suggest that: (i) GS is not due to loss of WT1 expression by podocytes; (ii) podocyte Pax-2 expression reflects re-expression rather than persistent expression, and is the consequence of GS; (iii) GS is mediated systemically and the mechanism involves activation of the renin-angiotensin system; and (iv) podocytes undergo typical maturational changes but subsequently de-differentiate and revert to an immature phenotype during disease progression.

Deciphering the role of the signal- and Sty1 kinase-dependent phosphorylation of the stress-responsive transcription factor Atf1 on gene activation.

PubMed

Salat-Canela, Clàudia; Paulo, Esther; Sánchez-Mir, Laura; Carmona, Mercè; Ayté, José; Oliva, Baldo; Hidalgo, Elena

2017-08-18

Adaptation to stress triggers the most dramatic shift in gene expression in fission yeast ( Schizosaccharomyces pombe ), and this response is driven by signaling via the MAPK Sty1. Upon activation, Sty1 accumulates in the nucleus and stimulates expression of hundreds of genes via the nuclear transcription factor Atf1, including expression of atf1 itself. However, the role of stress-induced, Sty1-mediated Atf1 phosphorylation in transcriptional activation is unclear. To this end, we expressed Atf1 phosphorylation mutants from a constitutive promoter to uncouple Atf1 activity from endogenous, stress-activated Atf1 expression. We found that cells expressing a nonphosphorylatable Atf1 variant are sensitive to oxidative stress because of impaired transcription of a subset of stress genes whose expression is also controlled by another transcription factor, Pap1. Furthermore, cells expressing a phospho-mimicking Atf1 mutant display enhanced stress resistance, and although expression of the Pap1-dependent genes still relied on stress induction, another subset of stress-responsive genes was constitutively expressed in these cells. We also observed that, in cells expressing the phospho-mimicking Atf1 mutant, the presence of Sty1 was completely dispensable, with all stress defects of Sty1-deficient cells being suppressed by expression of the Atf1 mutant. We further demonstrated that Sty1-mediated Atf1 phosphorylation does not stimulate binding of Atf1 to DNA but, rather, establishes a platform of interactions with the basal transcriptional machinery to facilitate transcription initiation. In summary, our results provide evidence that Atf1 phosphorylation by the MAPK Sty1 is required for oxidative stress responses in fission yeast cells by promoting transcription initiation. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Learning defects in Drosophila growth restricted chico mutants are caused by attenuated adenylyl cyclase activity.

PubMed

Naganos, Shintaro; Ueno, Kohei; Horiuchi, Junjiro; Saitoe, Minoru

2016-04-06

Reduced insulin/insulin-like growth factor signaling (IIS) is a major cause of symmetrical intrauterine growth retardation (IUGR), an impairment in cell proliferation during prenatal development that results in global growth defects and mental retardation. In Drosophila, chico encodes the only insulin receptor substrate. Similar to other animal models of IUGR, chico mutants have defects in global growth and associative learning. However, the physiological and molecular bases of learning defects caused by chico mutations, and by symmetrical IUGR, are not clear. In this study, we found that chico mutations impair memory-associated synaptic plasticity in the mushroom bodies (MBs), neural centers for olfactory learning. Mutations in chico reduce expression of the rutabaga-type adenylyl cyclase (rut), leading to decreased cAMP synthesis in the MBs. Expressing a rut (+) transgene in the MBs restores memory-associated plasticity and olfactory associative learning in chico mutants, without affecting growth. Thus chico mutations disrupt olfactory learning, at least in part, by reducing cAMP signaling in the MBs. Our results suggest that some cognitive defects associated with reduced IIS may occur, independently of developmental defects, from acute reductions in cAMP signaling.

Synthetic Lethal Therapy for KRAS Mutant Non-small-cell Lung Carcinoma with Nanoparticle-mediated CDK4 siRNA Delivery

PubMed Central

Mao, Cheng-Qiong; Xiong, Meng-Hua; Liu, Yang; Shen, Song; Du, Xiao-Jiao; Yang, Xian-Zhu; Dou, Shuang; Zhang, Pei-Zhuo; Wang, Jun

2014-01-01

The KRAS mutation is present in ~20% of lung cancers and has not yet been effectively targeted for therapy. This mutation is associated with a poor prognosis in non-small-cell lung carcinomas (NSCLCs) and confers resistance to standard anticancer treatment drugs, including epidermal growth factor receptor tyrosine kinase inhibitors. In this study, we exploited a new therapeutic strategy based on the synthetic lethal interaction between cyclin-dependent kinase 4 (CDK4) downregulation and the KRAS mutation to deliver micellar nanoparticles (MNPs) containing small interfering RNA targeting CDK4 (MNPsiCDK4) for treatment in NSCLCs harboring the oncogenic KRAS mutation. Following MNPsiCDK4 administration, CDK4 expression was decreased, accompanied by inhibited cell proliferation, specifically in KRAS mutant NSCLCs. However, this intervention was harmless to normal KRAS wild-type cells, confirming the proposed mechanism of synthetic lethality. Moreover, systemic delivery of MNPsiCDK4 significantly inhibited tumor growth in an A549 NSCLC xenograft murine model, with depressed expression of CDK4 and mutational KRAS status, suggesting the therapeutic promise of MNPsiCDK4 delivery in KRAS mutant NSCLCs via a synthetic lethal interaction between KRAS and CDK4. PMID:24496383

Deficient Gene Expression in Protein Kinase Inhibitor α Null Mutant Mice

PubMed Central

Gangolli, Esha A.; Belyamani, Mouna; Muchinsky, Sara; Narula, Anita; Burton, Kimberly A.; McKnight, G. Stanley; Uhler, Michael D.; Idzerda, Rejean L.

2000-01-01

Protein kinase inhibitor (PKI) is a potent endogenous inhibitor of the cyclic AMP (cAMP)-dependent protein kinase (PKA). It functions by binding the free catalytic (C) subunit with a high affinity and is also known to export nuclear C subunit to the cytoplasm. The significance of these actions with respect to PKI's physiological role is not well understood. To address this, we have generated by homologous recombination mutant mice that are deficient in PKIα, one of the three isoforms of PKI. The mice completely lack PKI activity in skeletal muscle and, surprisingly, show decreased basal and isoproterenol-induced gene expression in muscle. Further examination revealed reduced levels of the phosphorylated (active) form of the transcription factor CREB (cAMP response element binding protein) in the knockouts. This phenomenon stems, at least in part, from lower basal PKA activity levels in the mutants, arising from a compensatory increase in the level of the RIα subunit of PKA. The deficit in gene induction, however, is not easily explained by current models of PKI function and suggests that PKI may play an as yet undescribed role in PKA signaling. PMID:10779334

Tricarboxylic acid cycle without malate dehydrogenase in Streptomyces coelicolor M-145.

PubMed

Takahashi-Íñiguez, Tóshiko; Barrios-Hernández, Joana; Rodríguez-Maldonado, Marion; Flores, María Elena

2018-06-23

The oxidation of malate to oxaloacetate is catalysed only by a nicotinamide adenine dinucleotide-dependent malate dehydrogenase encoded by SCO4827 in Streptomyces coelicolor. A mutant lacking the malate dehydrogenase gene was isolated and no enzymatic activity was detected. As expected, the ∆mdh mutant was unable to grow on malate as the sole carbon source. However, the mutant grew less in minimal medium with glucose and there was a delay of 36 h. The same behaviour was observed when the mutant was grown on minimal medium with casamino acids or glycerol. For unknown reasons, the mutant was not able to grow in YEME medium with glucose. The deficiency of malate dehydrogenase affected the expression of the isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase genes, decreasing the expression of both genes by approximately two- to threefold.

Herpes Simplex Virus Selectively Induces Expression of the CC Chemokine RANTES/CCL5 in Macrophages through a Mechanism Dependent on PKR and ICP0

PubMed Central

Melchjorsen, Jesper; Pedersen, Finn S.; Mogensen, Søren C.; Paludan, Søren R.

2002-01-01

Recruitment of leukocytes is essential for eventual control of virus infections. Macrophages represent a leukocyte population involved in the first line of defense against many infections, including herpes simplex virus (HSV) infection. Through presentation of antigens to T cells and production of cytokines and chemokines, macrophages also constitute an important link between the innate and adaptive immune systems. Here, we have investigated the chemokine expression profile of macrophages after HSV infection and the virus-cell interactions involved. By reverse transcription-PCR and cDNA arrays, we found that HSV type 1 (HSV-1) and HSV-2 induced expression of the CC chemokine RANTES/CCL5 in murine macrophage cell lines and peritoneal cells. The CXC chemokine BCA-1/CXCL13 was also induced in peritoneal cells. Twenty-six other chemokines tested were not affected. Accumulation of RANTES mRNA was detectable after 5 h of infection, was sensitive to UV irradiation of the virus, and was preceded by accumulation of viral immediate-early mRNA and proteins. The viral components responsible for initiation of RANTES expression were examined with virus mutants and RAW 264.7 macrophage-like cells expressing a dominant negative mutant of the double-stranded-RNA-activated protein kinase (PKR). The PKR mutant cell line displayed reduced constitutive and HSV-inducible RANTES expression compared to the control cell line. HSV-1 mutants deficient in genes encoding the immediate-early proteins ICP4, ICP22, and ICP27 remained fully capable of inducing RANTES expression in macrophages. By contrast, the ability of an ICP0-deficient HSV-1 mutant to induce RANTES expression was compromised. Thus, HSV selectively induces expression of RANTES in macrophages through a mechanism dependent on cellular PKR and viral ICP0. PMID:11861845

Amino- and carboxy-terminal deletion mutants of Gs alpha are localized to the particulate fraction of transfected COS cells

PubMed Central

1992-01-01

To elucidate the structural basis for membrane attachment of the alpha subunit of the stimulatory G protein (Gs alpha), mutant Gs alpha cDNAs with deletions of amino acid residues in the amino and/or carboxy termini were transiently expressed in COS-7 cells. The particulate and soluble fractions prepared from these cells were analyzed by immunoblot using peptide specific antibodies to monitor distribution of the expressed proteins. Transfection of mutant forms of Gs alpha with either 26 amino terminal residues deleted (delta 3-28) or with 59 amino terminal residues deleted (delta 1-59) resulted in immunoreactive proteins which localized primarily to the particulate fraction. Similarly, mutants with 10 (delta 385-394), 32 (delta 353-384), or 42 (delta 353-394) amino acid residues deleted from the carboxy terminus also localized to the particulate fraction, as did a mutant form of Gs alpha lacking amino acid residues at both the amino and carboxy termini (delta 3-28)/(delta 353-384). Mutant and wild type forms of Gs alpha demonstrated a similar degree of tightness in their binding to membranes as demonstrated by treatment with 2.5 M NaCl or 6 M urea, but some mutant forms were relatively resistant compared with wild type Gs alpha to solubilization by 15 mM NaOH or 1% sodium cholate. We conclude that: (a) deletion of significant portions of the amino and/or carboxyl terminus of Gs alpha is still compatible with protein expression; (b) deletion of these regions is insufficient to cause cytosolic localization of the expressed protein. The basis of Gs alpha membrane targeting remains to be elucidated. PMID:1400589

Functional rescue of mutant ABCA1 proteins by sodium 4-phenylbutyrate.

PubMed

Sorrenson, Brie; Suetani, Rachel J; Williams, Michael J A; Bickley, Vivienne M; George, Peter M; Jones, Gregory T; McCormick, Sally P A

2013-01-01

Mutations in the ATP-binding cassette transporter A1 (ABCA1) are a major cause of decreased HDL cholesterol (HDL-C), which infers an increased risk of cardiovascular disease (CVD). Many ABCA1 mutants show impaired localization to the plasma membrane. The aim of this study was to investigate whether the chemical chaperone, sodium 4-phenylbutyrate (4-PBA) could improve cellular localization and function of ABCA1 mutants. Nine different ABCA1 mutants (p.A594T, p.I659V, p.R1068H, p.T1512M, p.Y1767D, p.N1800H, p.R2004K, p.A2028V, p.Q2239N) expressed in HEK293 cells, displaying different degrees of mislocalization to the plasma membrane and discrete impacts on cholesterol efflux, were subject to treatment with 4-PBA. Treatment restored localization to the plasma membrane and increased cholesterol efflux function for the majority of mutants. Treatment with 4-PBA also increased ABCA1 protein expression in all transfected cell lines. In fibroblast cells obtained from low HDL-C subjects expressing two of the ABCA1 mutants (p.R1068H and p.N1800H), 4-PBA increased cholesterol efflux without any increase in ABCA1 expression. Our study is the first to investigate the effect of the chemical chaperone, 4-PBA on ABCA1 and shows that it is capable of restoring plasma membrane localization and enhancing the cholesterol efflux function of mutant ABCA1s both in vitro and ex vivo. These results suggest 4-PBA may warrant further investigation as a potential therapy for increasing cholesterol efflux and HDL-C levels.

Development of EMS-induced mutation population for amylose and resistant starch variation in bread wheat (Triticum aestivum) and identification of candidate genes responsible for amylose variation.

PubMed

Mishra, Ankita; Singh, Anuradha; Sharma, Monica; Kumar, Pankaj; Roy, Joy

2016-10-06

Starch is a major part of cereal grain. It comprises two glucose polymer fractions, amylose (AM) and amylopectin (AP), that make up about 25 and 75 % of total starch, respectively. The ratio of the two affects processing quality and digestibility of starch-based food products. Digestibility determines nutritional quality, as high amylose starch is considered a resistant or healthy starch (RS type 2) and is highly preferred for preventive measures against obesity and related health conditions. The topic of nutrition security is currently receiving much attention and consumer demand for food products with improved nutritional qualities has increased. In bread wheat (Triticum aestivum L.), variation in amylose content is narrow, hence its limited improvement. Therefore, it is necessary to produce wheat lines or populations showing wide variation in amylose/resistant starch content. In this study, a set of EMS-induced M4 mutant lines showing dynamic variation in amylose/resistant starch content were produced. Furthermore, two diverse mutant lines for amylose content were used to study quantitative expression patterns of 20 starch metabolic pathway genes and to identify candidate genes for amylose biosynthesis. A population comprising 101 EMS-induced mutation lines (M4 generation) was produced in a bread wheat (Triticum aestivum) variety. Two methods of amylose measurement in grain starch showed variation in amylose content ranging from ~3 to 76 % in the population. The method of in vitro digestion showed variation in resistant starch content from 1 to 41 %. One-way ANOVA analysis showed significant variation (p < 0.05) in amylose and resistant starch content within the population. A multiple comparison test (Dunnett's test) showed that significant variation in amylose and resistant starch content, with respect to the parent, was observed in about 89 and 38 % of the mutant lines, respectively. Expression pattern analysis of 20 starch metabolic pathway genes in two diverse mutant lines (low and high amylose mutants) showed higher expression of key genes of amylose biosynthesis (GBSSI and their isoforms) in the high amylose mutant line, in comparison to the parent. Higher expression of amylopectin biosynthesis (SBE) was observed in the low amylose mutant lines. An additional six candidate genes showed over-expression (BMY, SPA) and reduced-expression (SSIII, SBEI, SBEIII, ISA3) in the high amylose mutant line, indicating that other starch metabolic genes may also contribute to amylose biosynthesis. In this study a set of 101 EMS-induced mutant lines (M4 generation) showing variation in amylose and resistant starch content in seed were produced. This population serves as useful germplasm or pre-breeding material for genome-wide study and improvement of starch-based processing and nutrition quality in wheat. It is also useful for the study of the genetic and molecular basis of amylose/resistant starch variation in wheat. Furthermore, gene expression analysis of 20 starch metabolic genes in the two diverse mutant lines (low and high amylose mutants) indicates that in addition to key genes, several other genes (such as phosphorylases, isoamylases, and pullulanases) may also be involved in contributing to amylose/amylopectin biosynthesis.

Effect of microculture on cell metabolism and biochemistry: do cells get stressed in microchannels?

PubMed

Su, Xiaojing; Theberge, Ashleigh B; January, Craig T; Beebe, David J

2013-02-05

Microfluidics is emerging as a promising platform for cell culture, enabling increased microenvironment control and potential for integrated analysis compared to conventional macroculture systems such as well plates and Petri dishes. To advance the use of microfluidic devices for cell culture, it is necessary to better understand how miniaturization affects cell behavior. In particular, microfluidic devices have significantly higher surface-area-to-volume ratios than conventional platforms, resulting in lower volumes of media per cell, which can lead to cell stress. We investigated cell stress under a variety of culture conditions using three cell lines: parental HEK (human embryonic kidney) cells and transfected HEK cells that stably express wild-type (WT) and mutant (G601S) human ether-a-go-go related gene (hERG) potassium channel protein. These three cell lines provide a unique model system through which to study cell-type-specific responses in microculture because mutant hERG is known to be sensitive to environmental conditions, making its expression a particularly sensitive readout through which to compare macro- and microculture. While expression of WT-hERG was similar in microchannel and well culture, the expression of mutant G601S-hERG was reduced in microchannels. Expression of the endoplasmic reticulum (ER) stress marker immunoglobulin binding protein (BiP) was upregulated in all three cell lines in microculture. Using BiP expression, glucose consumption, and lactate accumulation as readouts we developed methods for reducing ER stress including properly increasing the frequency of media replacement, reducing cell seeding density, and adjusting the serum concentration and buffering capacity of culture medium. Indeed, increasing the buffering capacity of culture medium or frequency of media replacement partially restored the expression of the G601S-hERG in microculture. This work illuminates how biochemical properties of cells differ in macro- and microculture and suggests strategies that can be used to modify cell culture protocols for future studies involving miniaturized culture platforms.