Relationship Among Pulmonary Hypertension, Autoimmunity, Thyroid Hormones and Dyspnea in Patients With Hyperthyroidism.

PubMed

Zuhur, Sayid Shafi; Baykiz, Derya; Kara, Sonat Pinar; Sahin, Ertan; Kuzu, Idris; Elbuken, Gulsah

2017-04-01

Previous studies have reported conflicting results regarding the mechanisms underlying the pathophysiology of pulmonary hypertension (PHT) in patients with hyperthyroidism. Therefore, in this study, we investigated the association between PHT and thyroid-stimulating hormone (TSH) receptor antibody, thyroid peroxidase antibody, thyroglobulin antibody, TSH, fT3, fT4 and dyspnea during daily activities in a large population of patients with hyperthyroidism. A total of 129 consecutive patients with hyperthyroidism, 37 with hypothyroidism and 38 euthyroid controls were enrolled in this study. The modified medical research council scale was used for the assessment of dyspnea in daily activities. All the patients and euthyroid controls underwent transthoracic echocardiography for the assessment of PHT. Mild PHT was present in 35%, 36%, 13.5% and 5% of the patients with Graves׳ disease, toxic multinodular goiter, hypothyroidism and euthyroid controls, respectively. Pulmonary vascular resistance (PVR) was higher in hyperthyroid patients with PHT than in those without PHT. Moreover, a significant positive correlation was found between modified medical research council scale and pulmonary artery systolic pressure as well as PVR in patients with hyperthyroidism. No association was found between PHT and serum TSH receptor antibody, thyroid peroxidase antibody, thyroglobulin antibody, TSH, fT3 and fT4 levels. Mild PHT is present in a significant proportion of patients with hyperthyroidism, regardless of etiology. PVR appears to be the main cause of PHT in patients with hyperthyroidism, and neither autoimmunity nor thyroid hormones are associated with PHT in these patients. Mild dyspnea during daily activities in patients with hyperthyroidism may be related to PHT; however, severe dyspnea requires further evaluation. Copyright © 2017 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.

Galectin-3 Induces Clustering of CD147 and Integrin-β1 Transmembrane Glycoprotein Receptors on the RPE Cell Surface

PubMed Central

Priglinger, Claudia S.; Szober, Christoph M.; Priglinger, Siegfried G.; Merl, Juliane; Euler, Kerstin N.; Kernt, Marcus; Gondi, Gabor; Behler, Jennifer; Geerlof, Arie; Kampik, Anselm; Ueffing, Marius; Hauck, Stefanie M.

2013-01-01

Proliferative vitreoretinopathy (PVR) is a blinding disease frequently occurring after retinal detachment surgery. Adhesion, migration and matrix remodeling of dedifferentiated retinal pigment epithelial (RPE) cells characterize the onset of the disease. Treatment options are still restrained and identification of factors responsible for the abnormal behavior of the RPE cells will facilitate the development of novel therapeutics. Galectin-3, a carbohydrate-binding protein, was previously found to inhibit attachment and spreading of retinal pigment epithelial cells, and thus bares the potential to counteract PVR-associated cellular events. However, the identities of the corresponding cell surface glycoprotein receptor proteins on RPE cells are not known. Here we characterize RPE-specific Gal-3 containing glycoprotein complexes using a proteomic approach. Integrin-β1, integrin-α3 and CD147/EMMPRIN, a transmembrane glycoprotein implicated in regulating matrix metalloproteinase induction, were identified as potential Gal-3 interactors on RPE cell surfaces. In reciprocal immunoprecipitation experiments we confirmed that Gal-3 associated with CD147 and integrin-β1, but not with integrin-α3. Additionally, association of Gal-3 with CD147 and integrin-β1 was observed in co-localization analyses, while integrin-α3 only partially co-localized with Gal-3. Blocking of CD147 and integrin-β1 on RPE cell surfaces inhibited binding of Gal-3, whereas blocking of integrin-α3 failed to do so, suggesting that integrin-α3 is rather an indirect interactor. Importantly, Gal-3 binding promoted pronounced clustering and co-localization of CD147 and integrin-β1, with only partial association of integrin-α3. Finally, we show that RPE derived CD147 and integrin-β1, but not integrin-α3, carry predominantly β-1,6-N-actyl-D-glucosamine-branched glycans, which are high-affinity ligands for Gal-3. We conclude from these data that extracellular Gal-3 triggers clustering of CD147 and integrin-β1 via interaction with β1,6-branched N-glycans on RPE cells and hypothesize that Gal-3 acts as a positive regulator for CD147/integrin-β1 clustering and therefore modifies RPE cell behavior contributing to the pathogenesis of PVR. Further investigations at this pathway may aid in the development of specific therapies for PVR. PMID:23922889

Compact optical multipass matrix system design based on slicer mirrors.

PubMed

Guo, Yin; Sun, Liqun

2018-02-10

High path-to-volume ratio (PVR) and low-aberration-output beams are the two main criteria to assess the performance of multipass absorption cells. However, no substantial progress has been reported for large-numerical-aperture-coupled multipass cells, which is due to the accumulated aberrations caused by a large number of off-axis reflections. Based on Chernin's design, in this study, we modified Chernin's four-objective multipass matrix cell by using slicer mirrors to eliminate alignment difficulty and decrease the system volume. A generalized design routine based on user requirements is also proposed. Based on the automatic modeling tool package (Pyzdde) connected with Zemax and boundary conditions of the parameters selection proposed, a low-aberration-output beam and a high PVR are easily obtained compared with other multipass cells schemes. In one demo design, 108 passes (5×7 matrix spots) in a base length of 300 mm are presented. The PVR and peak-to-valley value wavefront errors are 67.5 m/L and 0.92 μm, respectively. Finally, a tolerance analysis of this optical multipass system is also presented. This work may provide better broadband optical absorption cells in terms of response time and a better detection sensitivity in versatile applications.

Vitreous vascular endothelial growth factor concentrations in proliferative diabetic retinopathy versus proliferative vitreoretinopathy.

PubMed

Citirik, Mehmet; Kabatas, Emrah Utku; Batman, Cosar; Akin, Kadir Okhan; Kabatas, Naciye

2012-01-01

To assess vitreous vascular endothelial growth factor (VEGF) concentrations in proliferative diabetic retinopathy (PDR) in comparison to proliferative vitreoretinopathy (PVR). Vitreous samples were collected from 69 eyes of 69 patients with traumatic lens dislocation (n = 10), grade B PVR with rhegmatogenous retinal detachment (n = 13), grade C PVR with rhegmatogenous retinal detachment (n = 14), PDR with vitreous hemorrhage (n = 18), and PDR with vitreous hemorrhage and tractional retinal detachment (n = 14). Vitreous fluid samples were obtained at vitrectomy, and the levels of VEGF were measured by enzyme-linked immunosorbent assay. The mean vitreous level of VEGF was 15.14 ± 5.22 pg/ml in eyes with grade B PVR, 99.15 ± 38.58 pg/ml in eyes with grade C PVR, 4,534.01 ± 1,193.28 pg/ml in eyes with vitreous hemorrhage secondary to PDR, 5,157.29 ± 969.44 pg/ml in eyes with vitreous hemorrhage and tractional retinal detachment secondary to PDR, and 16.19 ± 5.76 pg/ml in eyes of the control group with traumatic lens dislocation. Vitreous VEGF concentrations were significantly higher in the patients with grade C PVR, PDR with vitreous hemorrhage and PDR with vitreous hemorrhage and tractional retinal detachment in comparison to the control patients (p < 0.05). A significant alteration was not observed in patients with grade B PVR (p = 0.55). Vitreous VEGF concentrations are increased in PDR and grade C PVR. The high VEGF concentrations could suggest a possible effect of VEGF on advanced PVR. Copyright © 2011 S. Karger AG, Basel.

Differential expression of poliovirus receptor, regulator of G-protein signaling 11 and erythrocyte protein band 4.1-like 3 in human granulosa cells during follicular growth and maturation.

PubMed

Barzilay, Eran; Yung, Yuval; Shapira, Lev; Haas, Jigal; Ophir, Libby; Yerushalmi, Gil M; Maman, Ettie; Hourvitz, Ariel

2014-09-01

Poliovirus receptor (PVR), regulator of G-protein signaling-11 (RGS11), and erythrocyte protein band-4.1-like 3 (EPB41L3) have been proposed to function in follicular maturation in mouse models. We have examined their expression in human mural (mGCs) and cumulus granulosa cells (CCs). Expression of PVR and RGS11 in mGCs decreased in medium-sized follicles compared to small follicles of IVM cycles and increased again in large follicles. Luteinization caused decreased expression of both PVR and RGS11. In vitro incubation of mGCs with progesterone-rich conditioned media decreased expression of RGS11 without affecting PVR levels. Inhibition of progesterone signaling enhanced expression of both RGS11 and PVR. Expression in CCs was examined by means of global transcriptome sequencing analysis RGS11 and EPB41L3 increased in CCs during follicular maturation while PVR levels did not change. In conclusion, during human follicular maturation there are significant changes in expression of PVR, RGS11 and EPB41L3, possibly regulated by progesterone.

Pulmonary Hypertension After Heart Transplantation in Patients Bridged with the Total Artificial Heart.

PubMed

Shah, Rachit; Patel, Dhavalkumar B; Mankad, Anit K; Rennyson, Stephen L; Tang, Daniel G; Quader, Mohammed A; Smallfield, Melissa C; Kasirajan, Vigneshwar; Shah, Keyur B

2016-01-01

Pulmonary hypertension (PH) among heart transplant recipients is associated with an increased risk of mortality. Pulmonary hemodynamics improves after left ventricular assist device (LVAD) implantation; however, the impact of PH before total artificial heart (TAH) implantation on posttransplant hemodynamics and survival is unknown. This is a single center retrospective study aimed to evaluate the impact of TAH implantation on posttransplant hemodynamics and mortality in two groups stratified according to severity of PH: high (≥3 Woods units [WU]) and low (<3 WU) baseline pulmonary vascular resistance (PVR). Hemodynamic data were obtained from right heart catheterization performed at baseline (before TAH) and posttransplant at 1 and 12 months. Patients in the high PVR group (n = 12) experienced improvement in PVR (baseline = 4.31 ± 0.7; 1-month = 1.69 ± 0.7, p < 0.001; 12-month = 48 ± 0.9, p < 0.001) and transpulmonary gradient (baseline = 15.8 ± 3.3; 1-month = 11.57 ± 5.0, p = 0.07; 12-month = 8.50 ± 4.0, p = 0.008) after transplantation, reaching similar values as the low PVR group at 12 months. The filling pressures improved in the high PVR group after heart transplantation (HT), but remained elevated. There was no significant difference in survival between the two groups at 12 months follow-up. Patients with high PVR who are bridged to transplant with TAH had improvement in PVR at 12 months after transplant, and the degree of PVR did not impact posttransplant survival.

Quantitative trait loci from the host genetic background modulate the durability of a resistance gene: a rational basis for sustainable resistance breeding in plants.

PubMed

Quenouille, J; Paulhiac, E; Moury, B; Palloix, A

2014-06-01

The combination of major resistance genes with quantitative resistance factors is hypothesized as a promising breeding strategy to preserve the durability of resistant cultivar, as recently observed in different pathosystems. Using the pepper (Capsicum annuum)/Potato virus Y (PVY, genus Potyvirus) pathosystem, we aimed at identifying plant genetic factors directly affecting the frequency of virus adaptation to the major resistance gene pvr2(3) and at comparing them with genetic factors affecting quantitative resistance. The resistance breakdown frequency was a highly heritable trait (h(2)=0.87). Four loci including additive quantitative trait loci (QTLs) and epistatic interactions explained together 70% of the variance of pvr2(3) breakdown frequency. Three of the four QTLs controlling pvr2(3) breakdown frequency were also involved in quantitative resistance, strongly suggesting that QTLs controlling quantitative resistance have a pleiotropic effect on the durability of the major resistance gene. With the first mapping of QTLs directly affecting resistance durability, this study provides a rationale for sustainable resistance breeding. Surprisingly, a genetic trade-off was observed between the durability of PVY resistance controlled by pvr2(3) and the spectrum of the resistance against different potyviruses. This trade-off seemed to have been resolved by the combination of minor-effect durability QTLs under long-term farmer selection.

Pulmonary Vascular Input Impedance is a Combined Measure of Pulmonary Vascular Resistance and Stiffness and Predicts Clinical Outcomes Better than PVR Alone in Pediatric Patients with Pulmonary Hypertension

PubMed Central

Hunter, Kendall S.; Lee, Po-Feng; Lanning, Craig J.; Ivy, D. Dunbar; Kirby, K. Scott; Claussen, Lori R.; Chan, K. Chen; Shandas, Robin

2011-01-01

Background Pulmonary vascular resistance (PVR) is the current standard for evaluating reactivity in children with pulmonary arterial hypertension (PAH). However, PVR measures only the mean component of right ventricular afterload and neglects pulsatile effects. We recently developed and validated an method to measure pulmonary vascular input impedance, which revealed excellent correlation between the zero-harmonic impedance value and PVR, and suggested a correlation between higher harmonic impedance values and pulmonary vascular stiffness (PVS). Here we show that input impedance can be measured routinely and easily in the catheterization laboratory, that impedance provides PVR and PVS from a single measurement, and that impedance is a better predictor of disease outcomes compared to PVR. Methods Pressure and velocity waveforms within the main PA were measured during right-heart catheterization of patients with normal PA hemodynamics (n=14) and those with PAH undergoing reactivity evaluation (49 subjects; 95 conditions). A correction factor needed to transform velocity into flow was obtained by calibrating against cardiac output. Input impedance was obtained off-line by dividing Fourier-transformed pressure and flow waveforms. Results Exceptional correlation was found between the indexed zero harmonic of impedance and indexed PVR (y=1.095·x+1.381, R2=0.9620). Additionally, the modulus sum of the first two harmonics of impedance was found to best correlate with indexed pulse pressure over stroke volume (PP/SV) (y=13.39·x-0.8058, R2=0.7962). Amongst a subset of PAH patients (n=25), cumulative logistic regression between outcomes to total indexed impedance was better (RL2=0.4012) than between outcomes and indexed PVR (RL2=0.3131). Conclusions Input impedance can be consistently and easily obtained from PW Doppler and a single catheter pressure measurement, provides comprehensive characterization of the main components of RV afterload, and better predicts patient outcomes compared to PVR alone. PMID:18082509

The assisted bidirectional Glenn: a novel surgical approach for first-stage single-ventricle heart palliation.

PubMed

Esmaily-Moghadam, Mahdi; Hsia, Tain-Yen; Marsden, Alison L

2015-03-01

Outcomes after a modified Blalock-Taussig shunt (mBTS) in neonates with single-ventricle physiology remain unsatisfactory. However, initial palliation with a superior cavopulmonary connection, such as a bidirectional Glenn (BDG), is discouraged, owing to potential for inadequate pulmonary blood flow (PBF). We tested the feasibility of a novel surgical approach, adopting the engineering concept of an ejector pump, whereby the flow in the BDG is "assisted" by injection of a high-energy flow stream from the systemic circulation. Realistic 3-dimensional models of the neonatal mBTS and BDG circulations were created. The "assisted" bidirectional Glenn (ABG) consisted of a shunt between the right innominate artery and the superior vena cava (SVC), with a 1.5-mm clip near the SVC anastomosis to create a Venturi effect. The 3 models were coupled to a validated hydraulic circulation model, and 2 pulmonary vascular resistance (PVR) values (7 and 2.3 Wood units) were simulated. The ABG provided the highest systemic oxygen saturation and oxygen delivery at both PVR levels. In addition to achieving higher PBF than the BDG, the ABG produced a lower single-ventricular workload than mBTS. SVC pressure was highest in the ABG model (ABG: 15; Glenn: 11; mBTS: 3 mm Hg; PVR = 7 Wood units), but at low PVR, the SVC pressure was significantly lower (ABG: 8; Glenn: 6; mBTS: <3 mm Hg). Adopting the principle of an ejector pump, with additional flow directed into the SVC in a BDG, the ABG appears to increase PBF with a modest increase in SVC and pulmonary arterial pressure. Although multiscale modeling results demonstrate the conceptual feasibility of the ABG circulation, further technical refinement and investigations are necessary, especially in an appropriate animal model. Copyright © 2015 The American Association for Thoracic Surgery. Published by Elsevier Inc. All rights reserved.

Epithelial Membrane Protein-2 in Human Proliferative Vitreoretinopathy and Epiretinal Membranes.

PubMed

Telander, David G; Yu, Alfred K; Forward, Krisztina I; Morales, Shawn A; Morse, Lawrence S; Park, Susanna S; Gordon, Lynn K

2016-06-01

To determine the level of epithelial membrane protein-2 (EMP2) expression in preretinal membranes from surgical patients with proliferative vitreoretinopathy (PVR) or epiretinal membranes (ERMs). EMP2, an integrin regulator, is expressed in the retinal pigment epithelium and understanding EMP2 expression in human retinal disease may help determine whether EMP2 is a potential therapeutic target. Preretinal membranes were collected during surgical vitrectomies after obtaining consents. The membranes were fixed, processed, sectioned, and protein expression of EMP2 was evaluated by immunohistochemistry. The staining intensity (SI) and percentage of positive cells (PP) in membranes were compared by masked observers. Membranes were categorized by their cause and type including inflammatory and traumatic. All of the membranes stained positive for EMP2. Proliferative vitreoretinopathy-induced membranes (all causes) showed greater expression of EMP2 than ERMs with higher SI (1.81 vs. 1.38; P = 0.07) and PP (2.08 vs. 1.54; P = 0.09). However all the PVR subgroups had similar levels of EMP2 expression without statistically significant differences by Kruskal-Wallis test. Inflammatory PVR had higher expression of EMP2 than ERMs (SI of 2.58 vs. 1.38); however, this was not statistically significant. No correlation was found between duration of PVR membrane and EMP2 expression. EMP2 was detected by RT-PCR in all samples (n = 6) tested. All studied ERMs and PVR membranes express EMP2. Levels of EMP2 trended higher in all PVR subgroups than in ERMs, especially in inflammatory and traumatic PVR. Future studies are needed to determine the role of EMP2 in the pathogenesis and treatment of various retinal conditions including PVR.

Estimation of cardiac output and pulmonary vascular resistance by contrast echocardiography transit time measurement: a prospective pilot study.

PubMed

Choi, Brian G; Sanai, Reza; Yang, Benjamin; Young, Heather A; Mazhari, Ramesh; Reiner, Jonathan S; Lewis, Jannet F

2014-10-31

Studies with other imaging modalities have demonstrated a relationship between contrast transit and cardiac output (CO) and pulmonary vascular resistance (PVR). We tested the hypothesis that the transit time during contrast echocardiography could accurately estimate both CO and PVR compared to right heart catheterization (RHC). 27 patients scheduled for RHC had 2D-echocardiogram immediately prior to RHC. 3 ml of DEFINITY contrast followed by a 10 ml saline flush was injected, and a multi-cycle echo clip was acquired from the beginning of injection to opacification of the left ventricle. 2D-echo based calculations of CO and PVR along with the DEFINITY-based transit time calculations were subsequently correlated with the RHC-determined CO and PVR. The transit time from full opacification of the right ventricle to full opacification of the left ventricle inversely correlated with CO (r=-0.61, p<0.001). The transit time from peak opacification of the right ventricle to first appearance in the left ventricle moderately correlated with PVR (r=0.46, p<0.01). Previously described echocardiographic methods for the determination of CO (Huntsman method) and PVR (Abbas and Haddad methods) did not correlate with RHC-determined values (p = 0.20 for CO, p = 0.18 and p = 0.22 for PVR, respectively). The contrast transit time method demonstrated reliable intra- (p<0.0001) and inter-observer correlation (p<0.001). We describe a novel method for the quantification of CO and estimation of PVR using contrast echocardiography transit time. This technique adds to the methodologies used for noninvasive hemodynamic assessment, but requires further validation to determine overall applicability.

Complementary DNA characterization and chromosomal localization of a human gene related to the poliovirus receptor-encoding gene.

PubMed

Lopez, M; Eberlé, F; Mattei, M G; Gabert, J; Birg, F; Bardin, F; Maroc, C; Dubreuil, P

1995-04-03

The human poliovirus (PV) receptor (PVR) is a member of the immunoglobulin (Ig) superfamily with unknown cellular function. We have isolated a human PVR-related (PRR) cDNA. The deduced amino acid (aa) sequence of PRR showed, in the extracellular region, 51.7 and 54.3% similarity with human PVR and with the murine PVR homolog, respectively. The cDNA coding sequence is 1.6-kb long and encodes a deduced 57-kDa protein; this protein has a structural organization analogous to that of PVR, that is, one V- and two C-set Ig domains, with a conserved number of aa. Northern blot analysis indicated that a major 5.9-kb transcript is present in all normal human tissues tested. In situ hybridization showed that the PRR gene is located at bands q23-q24 of human chromosome 11.

The receptor tyrosine kinase Pvr promotes tissue closure by coordinating corpse removal and epidermal zippering

PubMed Central

Garlena, Rebecca A.; Lennox, Ashley L.; Baker, Lewis R.; Parsons, Trish E.; Weinberg, Seth M.; Stronach, Beth E.

2015-01-01

A leading cause of human birth defects is the incomplete fusion of tissues, often manifested in the palate, heart or neural tube. To investigate the molecular control of tissue fusion, embryonic dorsal closure and pupal thorax closure in Drosophila are useful experimental models. We find that Pvr mutants have defects in dorsal midline closure with incomplete amnioserosa internalization and epidermal zippering, as well as cardia bifida. These defects are relatively mild in comparison to those seen with other signaling mutants, such as in the JNK pathway, and we demonstrate that JNK signaling is not perturbed by altering Pvr receptor tyrosine kinase activity. Rather, modulation of Pvr levels in the ectoderm has an impact on PIP3 membrane accumulation, consistent with a link to PI3K signal transduction. Polarized PI3K activity influences protrusive activity from the epidermal leading edge and the protrusion area changes in accord with Pvr signaling intensity, providing a possible mechanism to explain Pvr mutant phenotypes. Tissue-specific rescue experiments indicate a partial requirement in epithelial tissue, but confirm the essential role of Pvr in hemocytes for embryonic survival. Taken together, we argue that inefficient removal of the internalizing amnioserosa tissue by mutant hemocytes coupled with impaired midline zippering of mutant epithelium creates a situation in some embryos whereby dorsal midline closure is incomplete. Based on these observations, we suggest that efferocytosis (corpse clearance) could contribute to proper tissue closure and thus might underlie some congenital birth defects. PMID:26293306

Macitentan for the treatment of inoperable chronic thromboembolic pulmonary hypertension (MERIT-1): results from the multicentre, phase 2, randomised, double-blind, placebo-controlled study.

PubMed

Ghofrani, Hossein-Ardeschir; Simonneau, Gérald; D'Armini, Andrea M; Fedullo, Peter; Howard, Luke S; Jaïs, Xavier; Jenkins, David P; Jing, Zhi-Cheng; Madani, Michael M; Martin, Nicolas; Mayer, Eckhard; Papadakis, Kelly; Richard, Dominik; Kim, Nick H

2017-10-01

Macitentan is beneficial for long-term treatment of pulmonary arterial hypertension. The microvasculopathy of chronic thromboembolic pulmonary hypertension (CTEPH) and pulmonary arterial hypertension are similar. The phase 2, double-blind, randomised, placebo-controlled MERIT-1 trial assessed macitentan in 80 patients with CTEPH adjudicated as inoperable. Patients identified as WHO functional class II-IV with a pulmonary vascular resistance (PVR) of at least 400 dyn·s/cm 5 and a walk distance of 150-450 m in 6 min were randomly assigned (1:1), via an interactive voice/web response system, to receive oral macitentan (10 mg once a day) or placebo. Treatment with phosphodiesterase type-5 inhibitors and oral or inhaled prostanoids was permitted for WHO functional class III/IV patients. The primary endpoint was resting PVR at week 16, expressed as percentage of PVR measured at baseline. Analyses were done in all patients who were randomly assigned to treatment; safety analyses were done in all patients who received at least one dose of the study drug. This study is registered with ClinicalTrials.gov, number NCT02021292. Between April 3, 2014, and March 17, 2016, we screened 186 patients for eligibility at 48 hospitals across 20 countries. Of these, 80 patients in 36 hospitals were randomly assigned to treatment (40 patients to macitentan, 40 patients to placebo). At week 16, geometric mean PVR decreased to 73·0% of baseline in the macitentan group and to 87·2% in the placebo group (geometric means ratio 0·84, 95% CI 0·70-0·99, p=0·041). The most common adverse events in the macitentan group were peripheral oedema (9 [23%] of 40 patients) and decreased haemoglobin (6 [15%]). In MERIT-1, macitentan significantly improved PVR in patients with inoperable CTEPH and was well tolerated. Actelion Pharmaceuticals Ltd. Copyright © 2017 Elsevier Ltd. All rights reserved.

Metabolic Profiling of Right Ventricular-Pulmonary Vascular Function Reveals Circulating Biomarkers of Pulmonary Hypertension.

PubMed

Lewis, Gregory D; Ngo, Debby; Hemnes, Anna R; Farrell, Laurie; Domos, Carly; Pappagianopoulos, Paul P; Dhakal, Bishnu P; Souza, Amanda; Shi, Xu; Pugh, Meredith E; Beloiartsev, Arkadi; Sinha, Sumita; Clish, Clary B; Gerszten, Robert E

2016-01-19

Pulmonary hypertension and associated right ventricular (RV) dysfunction are important determinants of morbidity and mortality, which are optimally characterized by invasive hemodynamic measurements. This study sought to determine whether metabolite profiling could identify plasma signatures of right ventricular-pulmonary vascular (RV-PV) dysfunction. We measured plasma concentrations of 105 metabolites using targeted mass spectrometry in 71 individuals (discovery cohort) who underwent comprehensive physiological assessment with right-sided heart catheterization and radionuclide ventriculography at rest and during exercise. Our findings were validated in a second cohort undergoing invasive hemodynamic evaluations (n = 71), as well as in an independent cohort with or without known pulmonary arterial (PA) hypertension (n = 30). In the discovery cohort, 21 metabolites were associated with 2 or more hemodynamic indicators of RV-PV function (i.e., resting right atrial pressure, mean PA pressure, pulmonary vascular resistance [PVR], and PVR and PA pressure-flow response [ΔPQ] during exercise). We identified novel associations of RV-PV dysfunction with circulating indoleamine 2,3-dioxygenase (IDO)-dependent tryptophan metabolites (TMs), tricarboxylic acid intermediates, and purine metabolites and confirmed previously described associations with arginine-nitric oxide metabolic pathway constituents. IDO-TM levels were inversely related to RV ejection fraction and were particularly well correlated with exercise PVR and ΔPQ. Multisite sampling demonstrated transpulmonary release of IDO-TMs. IDO-TMs also identified RV-PV dysfunction in a validation cohort with known risk factors for pulmonary hypertension and in patients with established PA hypertension. Metabolic profiling identified reproducible signatures of RV-PV dysfunction, highlighting both new biomarkers and pathways for further functional characterization. Copyright © 2016 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

OM-101 Decreases the Fibrotic Response Associated with Proliferative Vitreoretinopathy

PubMed Central

Dvashi, Zeev; Ben-Yaakov, Keren; Weinberg, Tamir; Greenwald, Yoel

2017-01-01

Purpose This study aimed to investigate the effect of OM-101 on the fibrotic response occurring in proliferative vitreoretinopathy (PVR) in an animal model. Methods Antifibrotic effect of OM-101 was investigated in vivo. As control, eight weeks old c57black mice underwent intravitreal injection with Hepes (group A) or dispase (0.3 units), to induce retinal detachment (RD) and PVR. The dispase-injected mice were randomly divided into two groups B and C (N = 25 mice); in group C, the eyes were treated with intravitreal injection of OM-101 (3 μl), and group B with PBS, as a control. After additional five days, mice were injected with the same initial treatment. Three days later, mice were euthanized, and the eyes were enucleated and processed for histological analysis. Results Intravitreal injection of dispase caused RD in 64% of the mice in group B, and 93% of those mice had PVR. Only 32% of mice treated with OM-101 and dispase (group C) developed RD, and only 25% of those developed PVR. Conclusions OM-101 was found effective in reducing the incidence of RD and PVR maintaining the normal architecture of the retina. This study suggests that OM-101 is a potentially effective and safe drug for the treatment of PVR patients. PMID:29109865

Value of echo-Doppler derived pulmonary vascular resistance, net-atrioventricular compliance and tricuspid annular velocity in determining exercise capacity in patients with mitral stenosis.

PubMed

Choi, Eui-Young; Shim, Jaemin; Kim, Sung-Ai; Shim, Chi Young; Yoon, Se-Jung; Kang, Seok-Min; Choi, Donghoon; Ha, Jong-Won; Rim, Se-Joong; Jang, Yangsoo; Chung, Namsik

2007-11-01

The present study sought to determine if echo-Doppler-derived pulmonary vascular resistance (PVR echo), net-atrioventricular compliance (Cn) and tricuspid peak systolic annular velocity (Sa), as parameters of right ventricular function, have value in predicting exercise capacity in patients with mitral stenosis (MS). Thirty-two patients with moderate or severe MS without left ventricular systolic dysfunction were studied. After comprehensive echo-Doppler measurements, including PVR echo, tricuspid Sa and left-sided Cn, supine bicycle exercise echo and concomitant respiratory gas analysis were performed. Measurements during 5 cardiac cycles representing the mean heart rate were averaged. Increment of resting PVR(echo) (r=-0.416, p=0.018) and decrement of resting Sa (r=0.433, p=0.013) and Cn (r=0.469, p=0.007) were significantly associated with decrease in %VO(2) peak. The predictive accuracy for %VO2 peak could increase by combining these parameters as Sa/PVR echo (r=0.500, p=0.004) or Cn. (Sa/PVR echo) (r=0.572, p=0.001) independent of mitral valve area, mean diastolic pressure gradients or presence of atrial fibrillation. Measurement of PVR echo, Cn and Sa might provide important information about the exercise capacity of patients with MS.

Premature remodeling of fat body and fat mobilization triggered by platelet-derived growth factor/VEGF receptor in Drosophila.

PubMed

Zheng, Huimei; Wang, Xuexiang; Guo, Pengfei; Ge, Wanzhong; Yan, Qinfeng; Gao, Weiqiang; Xi, Yongmei; Yang, Xiaohang

2017-05-01

In Drosophila, fat-body remodeling accompanied with fat mobilization is an ecdysone-induced dynamic process that only occurs during metamorphosis. Here, we show that the activated Drosophila platelet-derived growth factor/VEGF receptor (PVR) is sufficient to induce shape changes in the fat body, from thin layers of tightly conjugated polygonal cells to clusters of disaggregated round-shaped cells. These morphologic changes are reminiscent of those seen during early pupation upon initiation of fat-body remodeling. Activation of PVR also triggers an early onset of lipolysis and mobilization of internal storage, as revealed by the appearance of small lipid droplets and up-regulated lipolysis-related genes. We found that PVR displays a dynamic expression pattern in the fat body and peaks at the larval-prepupal transition under the control of ecdysone signaling. Removal of PVR, although it does not prevent ecdysone-induced fat-body remodeling, causes ecdysone signaling to be up-regulated. Our data reveal that PVR is active in a dual-secured mechanism that involves an ecdysone-induced fat-body remodeling pathway and a reinforced PVR pathway for effective lipid mobilization. Ectopic expression of activated c-kit-the mouse homolog of PVR in the Drosophila fat body-also results in a similar phenotype. This may suggest a novel function of c-kit as it relates to lipid metabolism in mammals.-Zheng, H., Wang, X., Guo, P., Ge, W., Yan, Q., Gao, W., Xi, Y., Yang, X. Premature remodeling of fat body and fat mobilization triggered by platelet-derived growth factor/VEGF receptor in Drosophila . © FASEB.

Pulmonary vascular input impedance is a combined measure of pulmonary vascular resistance and stiffness and predicts clinical outcomes better than pulmonary vascular resistance alone in pediatric patients with pulmonary hypertension.

PubMed

Hunter, Kendall S; Lee, Po-Feng; Lanning, Craig J; Ivy, D Dunbar; Kirby, K Scott; Claussen, Lori R; Chan, K Chen; Shandas, Robin

2008-01-01

Pulmonary vascular resistance (PVR) is the current standard for evaluating reactivity in children with pulmonary arterial hypertension (PAH). However, PVR measures only the mean component of right ventricular afterload and neglects pulsatile effects. We recently developed and validated a method to measure pulmonary vascular input impedance, which revealed excellent correlation between the zero harmonic impedance value and PVR and suggested a correlation between higher-harmonic impedance values and pulmonary vascular stiffness. Here we show that input impedance can be measured routinely and easily in the catheterization laboratory, that impedance provides PVR and pulmonary vascular stiffness from a single measurement, and that impedance is a better predictor of disease outcomes compared with PVR. Pressure and velocity waveforms within the main pulmonary artery were measured during right heart catheterization of patients with normal pulmonary artery hemodynamics (n = 14) and those with PAH undergoing reactivity evaluation (49 subjects, 95 conditions). A correction factor needed to transform velocity into flow was obtained by calibrating against cardiac output. Input impedance was obtained off-line by dividing Fourier-transformed pressure and flow waveforms. Exceptional correlation was found between the indexed zero harmonic of impedance and indexed PVR (y = 1.095x + 1.381, R2 = 0.9620). In addition, the modulus sum of the first 2 harmonics of impedance was found to best correlate with indexed pulse pressure over stroke volume (y = 13.39x - 0.8058, R2 = 0.7962). Among a subset of patients with PAH (n = 25), cumulative logistic regression between outcomes to total indexed impedance was better (R(L)2 = 0.4012) than between outcomes and indexed PVR (R(L)2 = 0.3131). Input impedance can be consistently and easily obtained from pulse-wave Doppler and a single catheter pressure measurement, provides comprehensive characterization of the main components of RV afterload, and better predicts patient outcomes compared with PVR alone.

Acute right heart failure after hemorrhagic shock and trauma pneumonectomy-a management approach: A blinded randomized controlled animal trial using inhaled nitric oxide.

PubMed

Lubitz, Andrea L; Sjoholm, Lars O; Goldberg, Amy; Pathak, Abhijit; Santora, Thomas; Sharp, Thomas E; Wallner, Markus; Berretta, Remus M; Poole, Lauren A; Wu, Jichuan; Wolfson, Marla R

2017-02-01

Hemorrhagic shock and pneumonectomy causes an acute increase in pulmonary vascular resistance (PVR). The increase in PVR and right ventricular (RV) afterload leads to acute RV failure, thus reducing left ventricular (LV) preload and output. Inhaled nitric oxide (iNO) lowers PVR by relaxing pulmonary arterial smooth muscle without remarkable systemic vascular effects. We hypothesized that with hemorrhagic shock and pneumonectomy, iNO can be used to decrease PVR and mitigate right heart failure. A hemorrhagic shock and pneumonectomy model was developed using sheep. Sheep received lung protective ventilatory support and were instrumented to serially obtain measurements of hemodynamics, gas exchange, and blood chemistry. Heart function was assessed with echocardiography. After randomization to study gas of iNO 20 ppm (n = 9) or nitrogen as placebo (n = 9), baseline measurements were obtained. Hemorrhagic shock was initiated by exsanguination to a target of 50% of the baseline mean arterial pressure. The resuscitation phase was initiated, consisting of simultaneous left pulmonary hilum ligation, via median sternotomy, infusion of autologous blood and initiation of study gas. Animals were monitored for 4 hours. All animals had an initial increase in PVR. PVR remained elevated with placebo; with iNO, PVR decreased to baseline. Echo showed improved RV function in the iNO group while it remained impaired in the placebo group. After an initial increase in shunt and lactate and decrease in SvO2, all returned toward baseline in the iNO group but remained abnormal in the placebo group. These data indicate that by decreasing PVR, iNO decreased RV afterload, preserved RV and LV function, and tissue oxygenation in this hemorrhagic shock and pneumonectomy model. This suggests that iNO may be a useful clinical adjunct to mitigate right heart failure and improve survival when trauma pneumonectomy is required.

THC/CBD oromucosal spray in patients with multiple sclerosis overactive bladder: a pilot prospective study.

PubMed

Maniscalco, Giorgia Teresa; Aponte, R; Bruzzese, D; Guarcello, G; Manzo, V; Napolitano, M; Moreggia, O; Chiariello, F; Florio, C

2018-01-01

Lower urinary tract dysfunctions (LUTDs) are commonly reported in multiple sclerosis (MS) patients and are mainly related to neurogenic overactive bladder (OAB). The aim of this observational study was to assess the effect of a tetrahydrocannabinol-cannabidiol (THC/CBD) oromucosal spray on resistant OAB by means of clinical and instrumental tools. Twenty-one MS patients were screened, and 15 cases have been evaluated. They underwent a specific clinical assessment (overactive bladder symptom score, OABSS) and a urodynamic assessment evaluating the maximal cystometric capacity (CCmax), bladder compliance (Qmax), maximum detrusor pressure (Pdet max), detrusor pressure at the first desire (Pdet first), bladder volume at the first desire (BVFD), leakage volume (LV), and post-void residual volume (PVR), before and after 4 weeks of THC/CBD administration. A complete neurological evaluation, including the assessment of their spasticity using the Modified Ashworth Scale (MAS) and the spasticity 0-10 numerical rating scale (NRS), was performed at the same times. Mobility was evaluated through the 25-ft walking-time test (T25-WT). The THC/CBD treatment successfully reduced the OAB symptoms (p = 0.001). Regarding the urodynamic findings after the end of treatment, PVR was significantly reduced (p = 0.016). Regarding the urodynamic findings after the end of treatment, PVR was significantly reduced (p = 0.016), while BVFD and CCmax were increased although the difference was not statistically significant. THC/CBD oromucosal spray has shown to be effective in improving overactive bladder symptoms in MS patients demonstrating a favorable impact on detrusor overactivity.

Outcome after surgical treatment of chronic thromboembolic pulmonary hypertension: dealing with different patient subsets. A single-centre experience.

PubMed

Nierlich, Patrick; Hold, Alina; Ristl, Robin

2016-11-01

Pulmonary endarterectomy (PEA) is the only curative treatment for patients suffering from chronic thromboembolic pulmonary hypertension (CTEPH). In patients with a pulmonary vascular resistance (PVR) higher than 1000 dynes s cm -5 , this procedure is linked with an increased perioperative risk. We compare the outcomes of patients with moderate to severe versus extremely elevated PVR. Between 1992 and 2013, 214 patients underwent PEA for CTEPH at our institution. All patient data were entered in a prospective database. We performed a retrospective analysis of our total patient collective and of subgroups defined by: PVR ≤ 800, PVR > 800 < 1200 and PVR ≥ 1200 dynes s cm -5 , to assess the therapeutic success regarding pulmonary pressure reduction, functional outcome and risk factors for perioperative mortality. There was a significant reduction in mean pulmonary pressure (from 51 to 33 mmHg), PVR (860 to 337 dynes s cm -5 ) and an increase in cardiac index (CI, 2.3 to 2.8 l/min/m 2 ) in the whole group and in each subgroup. At 1-year follow-up, 91.2% of patients were alive and haemodynamic improvements were sustained in the majority of patients. Age, a PVR of higher than 800 dynes, NYHA functional class IV and a CI lower than 2.2 l/min/m 2 were significant predictors of in-hospital mortality. The median duration of surgery was 360 min, cardiopulmonary bypass 230 min, aortic cross-clamp time 150 min and circulatory arrest 34 min. In total, there were 14 in-hospital deaths (6.5%) mainly due to right heart failure (n = 7) and multiorgan failure (n = 3). Bleeding, stroke, sepsis and pneumonia led to death in 1 patient each. Mortality was significantly higher in the two groups with PVR > 800, but absolute pressure reduction was also higher in these groups. The 1-year survival rate was 91.2%. Despite the increased perioperative risk and mortality, PEA should not be denied to patients with extremely elevated PVR but clear indication for surgery. Keeping increased perioperative risk and mortality in mind, significant pressure reduction and improved functional outcome can be achieved in the majority of these patients. © The Author 2016. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.

Rationale and design of a trial on the role of bosentan in Fontan patients: improvement of exercise capacity?

PubMed

Schuuring, Mark J; Vis, Jeroen C; Bouma, Berto J; van Dijk, Arie P J; van Melle, Joost P; Pieper, Petronella G; Vliegen, Hubert W; Sieswerda, Gertjan Tj; Mulder, Barbara J M

2011-07-01

The Fontan circulation is a palliative procedure performed in patients with complex congenital heart disease (CHD), making transpulmonary blood flow dependent on the systemic venous pressure. In a Fontan circulation a low pulmonary vascular resistance (PVR) is crucial, as is epitomized by the observation that a high PVR is a strong predictor of mortality. Long-term follow-up has shown that PVR may rise many years after the Fontan procedure has been performed, possibly due to micro-emboli from a dilated right atrium or from the venous system. Other mechanisms of increased PVR might be aging, obstructed airways caused by lymphatic dysfunction, lack of pulsatile pulmonary flow causing a release of endothelium-derived vasoactive molecules, and prolonged overexpression of vasoconstrictors such as endothelin-1. Mean plasma level of endothelin-1 has been shown to be significantly higher in Fontan patients compared to healthy controls. In patients with pulmonary arterial hypertension (PAH), therapy with bosentan, an endothelin-1 receptor antagonist, has demonstrated to improve exercise capacity and to reduce the elevated PVR. In addition, reduction of PVR is shown early and late after the Fontan procedure on treatment with exogenous NO, another advanced PAH therapy. However, the long term effect of reducing the PVR by bosentan treatment on exercise capacity in Fontan patients is still unknown. We designed a prospective, multicenter, randomized open label trial to study the effect of bosentan in Fontan patients. The primary endpoint will be the change in maximum exercise capacity (peak V'O2). We hypothesize that treatment with bosentan, an endothelin-1 receptor antagonist, improves maximum exercise capacity and functional capacity in adult Fontan patients. Copyright © 2011 Elsevier Inc. All rights reserved.

Serotonin contributes to high pulmonary vascular tone in a sheep model of persistent pulmonary hypertension of the newborn

PubMed Central

Gien, Jason; Roe, Gates; Isenberg, Nicole; Kailey, Jenai; Abman, Steven H.

2013-01-01

Although past studies demonstrate that altered serotonin (5-HT) signaling is present in adults with idiopathic pulmonary arterial hypertension, whether serotonin contributes to the pathogenesis of persistent pulmonary hypertension of the newborn (PPHN) is unknown. We hypothesized that 5-HT contributes to increased pulmonary vascular resistance (PVR) in a sheep model of PPHN and that selective 5-HT reuptake inhibitor (SSRI) treatment increases PVR in this model. We studied the hemodynamic effects of 5-HT, ketanserin (5-HT2A receptor antagonist), and sertraline, an SSRI, on pulmonary hemodynamics of the late gestation fetal sheep with PPHN caused by prolonged constriction of the ductus arteriosis. Brief intrapulmonary infusions of 5-HT increased PVR from 1.0 ± 0.07 (baseline) to 1.4 ± 0.22 mmHg/ml per minute of treatment (P < 0.05). Ketanserin decreased PVR from 1.1 ± 0.15 (baseline) to 0.82 ± 0.09 mmHg/ml per minute of treatment (P < 0.05). Sertraline increased PVR from 1.1 ± 0.17 (baseline) to 1.4 ± 0.17 mmHg/ml per minute of treatment (P = 0.01). In addition, we studied 5-HT production and activity in vitro in experimental PPHN. Compared with controls, pulmonary artery endothelial cells from fetal sheep with PPHN exhibited increased expression of tryptophan hydroxylase 1 and 5-HT production by twofold and 56%, respectively. Compared with controls, 5-HT2A R expression was increased in lung homogenates and pulmonary artery smooth muscle cell lysates by 35% and 32%, respectively. We concluded that increased 5-HT contributes to high PVR in experimental PPHN through activation of the 5-HT2A receptor and that SSRI infusion further increases PVR in this model. PMID:23605003

The effects of pleiotrophin in proliferative vitreoretinopathy.

PubMed

Ding, Xue; Bai, Yujing; Zhu, Xuemei; Li, Tianqi; Jin, Enzhong; Huang, Lvzhen; Yu, Wenzhen; Zhao, Mingwei

2017-05-01

The purpose of our study was to investigate the effects of pleiotrophin (PTN) in proliferative vitreoretinopathy (PVR) both in vitro and in vivo. Immunofluorescence was used to observe the PTN expression in periretinal membrane samples from patients with PVR and controls. ARPE-19 cells were exposed to TGF-β1. The epithelial-to-mesenchymal transition (EMT) of the ARPE-19 cells was confirmed by observed morphological changes and the increased expression of α-SMA and fibronectin at both the mRNA and protein levels. We used specific small interfering (si)RNA to knock down the expression of PTN. The subsequent effects of PTN inhibition were assessed with regard to the EMT, migration, proliferation, cytoskeletal arrangement, TGF-β signaling, PTN signaling, integral tight junction protein expression (e.g., claudin-1 and occludin), and p38 MAPK and p-p38 MAPK levels. Additionally, a PVR rat model was established by the intravitreal injection of ARPE-19 cells transfected with PTN-siRNA and was evaluated accordingly. PTN was highly expressed in PVR membranes compared to controls. PTN knockdown attenuated the TGF-β1-induced migration, proliferation, cytoskeletal rearrangement, and expression of EMT markers such as α-SMA and fibronectin in the ARPE-19 cells, and these effects may have been mediated through p38 MAPK signaling pathway activation. PTN silencing inhibited the up-regulation of claudin-1 and occludin stimulated by TGF-β1, and PTN knockdown inhibited the proliferative aspects of severe PVR in vivo. PTN is involved in the process of EMT induced by TGF-β1 in human ARPE-19 cells in vitro, and PTN knockdown attenuated the progression of experimental PVR in vivo. These findings provide new insights into the pathogenesis of PVR.

The utility of a Personal Values Report for medical decision-making.

PubMed

Henderson, W; Corke, C

2015-09-01

Our aim was to determine if a patient's Personal Values Report (PVR) has a positive impact on a doctor's decisions regarding treatment. We conducted a prospective cohort study delivering a short, web-based hypothetical case-centred questionnaire to intensive care doctors practising in Australia and New Zealand. One hundred and twenty-four intensive care consultants and registrars agreed to participate in an online questionnaire in two routine mailings between November 2013 and February 2014. We evaluated the effect of a PVR on clinical decision-making in a case-based scenario. In addition, participants rated the utility of the PVR on their decision-making process. Participants were presented with a difficult scenario in a frail elderly man where death was almost inevitable without aggressive support but survival with severe disability was possible with significant intervention. Most doctors (52.4%) elected to continue ventilation and admit to ICU. After the PVR was made available, only 8.1% of doctors continued to choose to admit the patient to the ICU. In all cases where admission to the ICU was chosen after seeing the PVR, the admission to the ICU was stated to be to permit family to arrive before withdrawing support (an approach which was consistent with the values stated in the PVR). One hundred and twenty-one of the 124 participants (97.6%) agreed or strongly agreed that the PVR helped them get an understanding of the patient's wishes, whereas none of the participants (0%) were unsure, disagreed or strongly disagreed with this statement. The remaining 2.4% did not answer the question. It is surmised that PVRs pre-written by patients are potentially an effective and valuable tool for use in helping doctors make decisions regarding patient care.

In Vitro Study of Flow Regulation for Pulmonary Insufficiency

PubMed Central

Camp, T. A.; Stewart, K. C.; Figliola, R. S.; McQuinn, T.

2007-01-01

Given the tolerance of the right heart circulation to mild regurgitation and gradient, we study the potential of using motionless devices to regulate the pulmonary circulation. In addition, we document the flow performance of two mechanical valves. A motionless diode, a nozzle, a mechanical bileaflet valve, and a tilting disk valve were tested in a pulmonary mock circulatory system over the normal human range of pulmonary vascular resistance (PVR). For the mechanical valves, regurgitant fractions (RFs) and transvalvular pressure gradients were found to be weak functions of PVR. On the low end of normal PVR, the bileaflet and tilting disk valves fluttered and would not fully close. Despite this anomaly, the regurgitant fraction of either valve did not change significantly. The values for RF and transvalvular gradient measured varied from 4 to 7% and 4 to 7 mm Hg, respectively, at 5 lpm for all tests. The diode valve was able to regulate flow with mild regurgitant fraction and trivial gradient but with values higher than either mechanical valve tested. Regurgitant fraction ranged from 2 to 17% in tests extending from PVR values of 1 to 4.5 mm Hg/lpm at 5 lpm and with concomitant increases in gradient up to 17 mm Hg. The regurgitant fraction for the nozzle increased from 2 to 23% over the range of PVR with gradients increasing to 18 mm Hg. The significant findings were: (1) the mechanical valves controlled regurgitation at normal physiological cardiac output and PVR even though they failed to close at some normal values of PVR and showed leaflet flutter; and (2) it may be possible to regulate the pulmonary circulation to tolerable levels using a motionless pulmonary valve device. PMID:17408334

High pulmonary vascular resistance in addition to low right ventricular stroke work index effectively predicts biventricular assist device requirement.

PubMed

Imamura, Teruhiko; Kinugawa, Koichiro; Kinoshita, Osamu; Nawata, Kan; Ono, Minoru

2016-03-01

Although the right ventricular stroke work index (RVSWI) is a good index for RV function, a low RVSWI is not necessarily an indicator for the need for a right ventricular assist device at the time of left VAD implantation. We here aimed to determine a more precise indicator for the need for a biventricular assist device (BiVAD). In total, 116 patients (mean age, 38 ± 14 years), who underwent hemodynamic assessments preoperatively including 12 BiVAD patients, and had been followed at our institute from 2003 to 2015, were included. Multivariate logistic regression analysis indicated that RVSWI and pulmonary vascular resistance (PVR) were independent predictors of BiVAD requirement (P < 0.05 for both). In addition, all patients were classified into 4 groups: (1) normal (RVSWI > 5 g/m, PVR < 3.7 WU), (2) pulmonary hypertension (RVSWI > 5, PVR > 3.7), (3) RV failure (RVSWI < 5, PVR < 3.7), and (4) both pulmonary hypertension and RV failure (RVSWI < 5, PVR > 3.7), and examined. Most of the patients in Group 4 (75 %), with acutely depressed hemodynamics and inflammatory responses in the myocardium, required BiVAD. Overall, patients with BiVAD had a worse survival rate as compared with those with LVAD alone. In conclusion, high PVR in addition to low RVSWI effectively predicts BiVAD requirement.

Planned delayed relaxing retinotomy for proliferative vitreoretinopathy.

PubMed

Williamson, Tom H; Gupta, Bhaskar

2010-01-01

A program involving three operations-the first to reattach most of the retina under silicone oil, the second to reattach the remaining retina by planned delayed relaxing retinectomy (PDRR), and the third to remove silicone oil-was tested. Review of electronic records of patients receiving PDRR for proliferative vitreoretinopathy (PVR). The primary end point was reattached retina without silicone oil. Eighty-seven patients had PVR and 27 received PDRR (mean age: 66.6 years; mean follow-up: 2.3 years). Ten patients had grade B PVR, 8 had CP1 to CP6, and 7 had CA2 to CA6. Twenty-four (89%) patients achieved a reattached retina without silicone oil. Mean logarithm of the minimum angle of resolution visual acuities were 1.41 (standard deviation = 0.67) at presentation and 1.21 (standard deviation = 0.58) at final follow-up. Four patients had glaucoma and 1 had scleromalacia. The overall success rate for all patients with PVR was 85% reattached retina without oil tamponade. PDRR contributes to a high chance of reattached retina and oil removal in PVR. Copyright 2010, SLACK Incorporated.

A Transgenic Mouse Model of Poliomyelitis.

PubMed

Koike, Satoshi; Nagata, Noriyo

2016-01-01

Transgenic mice (tg mice) that express the human poliovirus receptor (PVR), CD155, are susceptible to poliovirus and develop a neurological disease that resembles human poliomyelitis. Assessment of the neurovirulence levels of poliovirus strains, including mutant viruses produced by reverse genetics, circulating vaccine-derived poliovirus, and vaccine candidates, is useful for basic research of poliovirus pathogenicity, the surveillance of circulating polioviruses, and the quality control of oral live poliovirus vaccines, and does not require the use of monkeys. Furthermore, PVR-tg mice are useful for studying poliovirus tissue tropism and host immune responses. PVR-tg mice can be bred with mice deficient in the genes involved in viral pathogenicity. This report describes the methods used to analyze the pathogenicity and immune responses of poliovirus using the PVR-tg mouse model.

Speckle-Tracking Echocardiography Improves Pre-operative Risk Stratification Before the Total Cavopulmonary Connection.

PubMed

Park, Patsy W; Atz, Andrew M; Taylor, Carolyn L; Chowdhury, Shahryar M

2017-05-01

Single-ventricle patients with elevated pulmonary vascular resistance (PVR) or end-diastolic pressure (EDP) are excluded from undergoing total cavopulmonary connection (TCPC). However, a subset of patients deemed to be at acceptable risk experience prolonged length of stay (LOS) after TCPC. Routine assessment of ventricular function has been inadequate in identifying these high-risk patients. Speckle-tracking echocardiography (STE) is a novel method for assessment of myocardial deformation that may be useful in single-ventricle patients. The aim of this study was to perform a contemporary preoperative risk assessment for prolonged LOS to determine whether STE improves risk stratification before TCPC. Our single institution's perioperative data were retrospectively collected. The primary outcome was postoperative LOS >14 days. Longitudinal and circumferential STE deformation measures were analyzed on echocardiograms obtained during preoperative catheterization. Patient-specific, echocardiographic, and catheterization data were included in multivariable logistic regression. Receiver operating characteristic area under the curves (AUC) were analyzed. From 2007 to 2014, 135 patients who underwent TCPC were included in the analysis. The median LOS was 11 (IQR 9-14) days. The PVR (P < .01) and circumferential strain rate (CSR) (P < .01) were the only variables independently associated with LOS >14 days. For every 0.1 s -1 CSR increased, there was a 20% increased odds of prolonged LOS. The AUC for CSR was 0.70. The AUC for PVR and EDP combined was 0.68. The AUC for PVR, EDP, and CSR combined was 0.73. Preoperative CSR is independently associated with LOS >14 days and improves preoperative risk stratification in patients undergoing TCPC. Copyright © 2017 American Society of Echocardiography. Published by Elsevier Inc. All rights reserved.

Pulmonary vascular responses during acute and sustained respiratory alkalosis or acidosis in intact newborn piglets.

PubMed

Gordon, J B; Rehorst-Paea, L A; Hoffman, G M; Nelin, L D

1999-12-01

Acute alkalosis-induced pulmonary vasodilation and acidosis-induced pulmonary vasoconstriction have been well described, but responses were generally measured within 5-30 min of changing pH. In contrast, several in vitro studies have found that relatively brief periods of sustained alkalosis can enhance, and sustained acidosis can decrease, vascular reactivity. In this study of intact newborn piglets, effects of acute (20 min) and sustained (60-80 min) alkalosis or acidosis on baseline (35% O2) and hypoxic (12% O2) pulmonary vascular resistance (PVR) were compared with control piglets exposed only to eucapnia. Acute alkalosis decreased hypoxic PVR, but sustained alkalosis failed to attenuate either baseline PVR or the subsequent hypoxic response. Acute acidosis did not significantly increase hypoxic PVR, but sustained acidosis markedly increased both baseline PVR and the subsequent hypoxic response. Baseline PVR was similar in all piglets after resumption of eucapnic ventilation, but the final hypoxic response was greater in piglets previously exposed to alkalosis than in controls. Thus, hypoxic pulmonary vasoconstriction was not attenuated during sustained alkalosis, but was accentuated during sustained acidosis and after the resumption of eucapnia in alkalosis-treated piglets. Although extrapolation of data from normal piglets to infants and children with pulmonary hypertension must be done with caution, this study suggests that sustained alkalosis may be of limited efficacy in treating acute hypoxia-induced pulmonary hypertension and the risks of pulmonary hypertension must be considered when using ventilator strategies resulting in permissive hypercapnic acidosis.

Retrograde transcatheter device closure of a complex paravalvular leak after bioprosthetic pulmonary valve replacement in a pediatric patient.

PubMed

Chikkabyrappa, Sathish; Mosca, Ralph S; McElhinney, Doff B

2016-06-01

We report a case of retrograde transcatheter device closure of a complex paravalvular leak (PVL) after bioprosthetic pulmonary valve replacement (PVR) in a 13-year-old patient with congenital pulmonary valve stenosis. There are prior reports of pulmonary PVL closure after PVR in adults (Seery and Slack, Congenit Heart Dis 2014;9:E19-F22), but indications for and technical considerations in PVL closure after bioprosthetic PVR, particularly in children, are not well defined. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

Expression patterns of poliovirus receptor, erythrocyte protein band 4.1-like 3, regulator of g-protein signaling 11, and oxytocin receptor in mouse ovarian cells during follicle growth and early luteinization in vitro and in vivo.

PubMed

Segers, Ingrid; Adriaenssens, Tom; Smitz, Johan

2012-01-01

Poliovirus receptor (Pvr), erythrocyte protein band 4.1-like 3 (Epb4.1l3), regulator of G-protein signaling 11 (Rgs11), and oxytocin receptor (Oxtr) expression were quantified in in vitro- and in vivo-grown mouse follicles. The expression of all genes was increased during antral growth in in vitro-grown cumulus cells, whereas only Rgs11 and Oxtr were increased and Pvr and Epb4.1l3 were decreased in in vivo grown cumulus cells. In vivo mural granulosa cells showed the highest expression of Pvr, Rgs11, and Oxtr. The in vitro granulosa + theca compartment responded to human chorionic gonadotropinduring early luteinization by either an upregulation (Pvr, Oxtr) or downregulation (Epb41l3, Rgs11). Oocytes expressed Epb4.1l3, not Rgs11, and Pvr only in in vitro-grown oocytes. Translation into protein was confirmed for Epb4.1l3 in in vitro-grown follicles and in vivo-grown cumulus-oocyte complexes. Protein 4.1B was present during antral growth in cumulus, granulosa cells, and oocytes. Hypothetical functions of Epb4.1l3 and Pvr involve cell adhesion regulation and Rgs11 could be involved in cAMP production in the follicle. Oxtr is known to be important during and after the ovulatory stimulus, but, as in bovine, was also regulated during folliculogenesis. High expression of Pvr and Epb4.1l3 with culture duration in cumulus cells might mark inappropriate differentiation into a mural granulosa-like cell type and function as negative follicle development marker. Rgs11 and Oxtr are both in vivo and in vitro upregulated in cumulus cells during antral follicle growth and might be considered positive markers for follicle development.

Quantity and location of aortic valve complex calcification predicts severity and location of paravalvular regurgitation and frequency of post-dilation after balloon-expandable transcatheter aortic valve replacement.

PubMed

Khalique, Omar K; Hahn, Rebecca T; Gada, Hemal; Nazif, Tamim M; Vahl, Torsten P; George, Isaac; Kalesan, Bindu; Forster, Molly; Williams, Mathew B; Leon, Martin B; Einstein, Andrew J; Pulerwitz, Todd C; Pearson, Gregory D N; Kodali, Susheel K

2014-08-01

This study sought to determine the impact of quantity and location of aortic valve calcification (AVC) on paravalvular regurgitation (PVR) and rates of post-dilation (PD) immediately after transcatheter aortic valve replacement (TAVR). The impact of AVC in different locations within the aortic valve complex is incompletely understood. This study analyzed 150 patients with severe, symptomatic aortic stenosis who underwent TAVR. Total AVC volume scores were calculated from contrast-enhanced multidetector row computed tomography imaging. AVC was divided by leaflet sector and region (Leaflet, Annulus, left ventricular outflow tract [LVOT]), and a combination of LVOT and Annulus (AnnulusLVOT). Asymmetry was assessed. Receiver-operating characteristic analysis was performed with greater than or equal to mild PVR and PD as classification variables. Logistic regression was performed. Quantity of and asymmetry of AVC for all regions of the aortic valve complex predicted greater than or equal to mild PVR by receiver-operating characteristic analysis (area under the curve = 0.635 to 0.689), except Leaflet asymmetry. Receiver-operating characteristic analysis for PD was significant for quantity and asymmetry of AVC in all regions, with higher area under the curve values than for PVR (area under the curve = 0.648 to 0.741). On multivariable analysis, Leaflet and AnnulusLVOT calcification were independent predictors of both PVR and PD regardless of multidetector row computed tomography area cover index. Quantity and asymmetry of AVC in all regions of the aortic valve complex predict greater than or equal to mild PVR and performance of PD, with the exception of Leaflet asymmetry. Quantity of AnnulusLVOT and Leaflet calcification independently predict PVR and PD when taking into account multidetector row computed tomography area cover index. Copyright © 2014 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Clinical Implications of Residual Urine in Korean Benign Prostatic Hyperplasia (BPH) Patients: A Prognostic Factor for BPH-Related Clinical Events.

PubMed

Ko, Young Hwii; Chae, Ji Yun; Jeong, Seung Min; Kang, Jae Il; Ahn, Hong Jae; Kim, Hyung Woo; Kang, Sung Gu; Jang, Hoon Ah; Cheon, Jun; Kim, Je Jong; Lee, Jeong Gu

2010-12-01

Although post-void residual urine (PVR) is frequently utilized clinically in patients with benign prostatic hyperplasia (BPH), mainly because of its procedural simplicity, its role as a clinical prognostic factor, predictive of treatment goals, is still under much dispute. We investigated the predictive value of PVR for BPH-related clinical events including surgery, acute urinary retention (AUR), and admission following urinary tract infection (UTI). From January to June of 2006, patients over 50 years of age who were diagnosed with BPH for the first time at the outpatient clinic and were then treated for at least 3 years with medications were enrolled in this study. The variables of patients who underwent surgical intervention for BPH, had occurrences of AUR, or required admission due to UTI (Group 1, n=43) were compared with those of patients who were maintained with medications only (Group 2, n=266). Group 1 had a significantly higher PVR, more severe symptoms, and a larger prostate at the time of the initial diagnosis in both the univariate and the multivariate analysis. In the 39 patients who underwent BPH-related surgery, although there was a significant change in Qmax at the time of surgery (mean, 13.1 months), PVR and the symptom score remained unchanged compared with the initial evaluation. In the receiver-operating characteristic curve analysis, the area under the curve of Group 1 was in the order of prostate volume (0.834), PVR (0.712), and symptom score (0.621). When redivided by arbitrarily selected PVR cutoffs of 50 mL, 100 mL, and 150 mL, the relative risk of clinical BPH progression was measured as 3.93, 2.61, and 2.11. These data indicate that, in the symptomatic Korean population, increased PVR at baseline is a significant indicator of BPH-related clinical events along with increased symptom score or prostate volume.

Intravitreal invading cells contribute to vitreal cytokine milieu in proliferative vitreoretinopathy

PubMed Central

El-Ghrably, I; Dua, H.; Orr, G.; Fischer, D.; Tighe, P.

2001-01-01

AIM—To examine the contribution of infiltrating cells in the local production of cytokines within the vitreous of patients with proliferative vitreoretinopathy (PVR).
METHODS—The presence of mRNA coding for IL-6, IL-8, IL-1β, IL-1α, TNFα, IFNγ, IL-12, and HPRT was investigated in 25 vitreous samples from patients with PVR, 11 vitreous samples from patients with retinal detachment (RD) not complicated by PVR, and 10 vitreous samples from patients with macular hole (MH). A quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using an internal competitor was used to investigate these samples. From these samples, 15 PVR, 8 RD, and 8 MH were analysed for the protein levels of the same cytokines using enzyme linked immunosorbent assay (ELISA). Spearman correlation was used to test any association between mRNA and cytokine protein levels, as an indicator of the contribution these cells make to the intravitreal cytokine milieu.
RESULTS—A strong correlation was found between mRNA and their respective cytokine levels (protein products) for IL-6, IL-8, IL-1β, IL-1α, TNFα, IFNγ (Spearman r = 0.83, 0.73, 0.67, 0.91, 0.73, and 0.73 respectively), but not for IL-12. The median levels of IL-6, IL-8, IL-1β, and IFNγ mRNA and their respective cytokines were significantly higher (p <0.05) in patients with PVR than in those with macular hole. There was no statistically significant difference in the median levels of IL-1α mRNA between PVR and MH but the cytokine IL-1α was detected at a significantly higher level in PVR compared with MH patients. Between PVR and RD patients, there was no statistically significant difference in mRNA levels for all the investigated cytokines (p >0.05) except for IL-6 where there was a statistical significance (p= 0.038). In contrast, the median levels of IL-6, IL-8, and IL-1β cytokines were significantly higher (p <0.05) in patients with PVR than in those with RD, whereas for IL-1α and IFNγ no significant statistical difference was detected between PVR and RD patients (p >0.05). When results of RD and MH patients were compared, a statistical difference was only detected in mRNA levels of INFγ (p = 0.008). However, no difference was detected for INFγ (protein product) or for any of the other cytokines between RD and MH patients.
CONCLUSION—Levels of both protein and mRNA encoding IL-6, IL-8, IL-1β, and IFNγ is significantly increased in vitreous samples from patients with PVR. The strong correlation between ELISA detectable cytokines (protein products) and their respective mRNA levels suggest that intravitreal, invasive cells are the major source of these cytokines, with the exception of IL-12. Cells invading the vitreous do not appear to locally produce IL-12 mRNA. This would appear to implicate cells peripheral to the vitreal mass as the major source of this cytokine.

 PMID:11264138

Effect of high altitude exposure on the hemodynamics of the bidirectional Glenn physiology: modeling incremented pulmonary vascular resistance and heart rate.

PubMed

Vallecilla, Carolina; Khiabani, Reza H; Sandoval, Néstor; Fogel, Mark; Briceño, Juan Carlos; Yoganathan, Ajit P

2014-06-03

The considerable blood mixing in the bidirectional Glenn (BDG) physiology further limits the capacity of the single working ventricle to pump enough oxygenated blood to the circulatory system. This condition is exacerbated under severe conditions such as physical activity or high altitude. In this study, the effect of high altitude exposure on hemodynamics and ventricular function of the BDG physiology is investigated. For this purpose, a mathematical approach based on a lumped parameter model was developed to model the BDG circulation. Catheterization data from 39 BDG patients at stabilized oxygen conditions was used to determine baseline flows and pressures for the model. The effect of high altitude exposure was modeled by increasing the pulmonary vascular resistance (PVR) and heart rate (HR) in increments up to 80% and 40%, respectively. The resulting differences in vascular flows, pressures and ventricular function parameters were analyzed. By simultaneously increasing PVR and HR, significant changes (p <0.05) were observed in cardiac index (11% increase at an 80% PVR and 40% HR increase) and pulmonary flow (26% decrease at an 80% PVR and 40% HR increase). Significant increase in mean systemic pressure (9%) was observed at 80% PVR (40% HR) increase. The results show that the poor ventricular function fails to overcome the increased preload and implied low oxygenation in BDG patients at higher altitudes, especially for those with high baseline PVRs. The presented mathematical model provides a framework to estimate the hemodynamic performance of BDG patients at different PVR increments. Copyright © 2014 Elsevier Ltd. All rights reserved.

Long-Term Survival and Freedom From Reoperation After Placement of a Pulmonary Xenograft Valved Conduit.

PubMed

Alfieris, George M; Swartz, Michael F; Lehoux, Juan; Bove, Edward L

2016-08-01

The optimal choice for pulmonary valve replacement (PVR) remains controversial. This study hypothesized that xenografts used for PVR would result in prolonged long-term survival and freedom from reoperation. Children and adults with congenital heart disease requiring PVR using a xenograft from 1980 to 1985 were reviewed. In all cases, the xenograft valve was either sewn or manufactured into a Dacron conduit, and the conduit was sewn to the pulmonary artery bifurcation. Clinical data were analyzed, and survival and freedom from reoperation were determined using Kaplan-Meier analysis. Twenty-four patients received a xenograft for PVR at 14.6 ± 5.6 years. Conduit size ranged from 21 to 27 mm. Most patients received a Carpentier-Edwards valved conduit (n = 17), followed by a Hancock valved conduit (n = 5) and an Ionescu-Shiley valve sewn into a Dacron graft (n = 2). No perioperative deaths occurred. Reoperation was required mainly for pulmonary stenosis (72.7%), followed by pulmonary insufficiency (18.2%), or both stenosis and insufficiency (9%). Freedom from reoperation was 90%, 56%, 43%, and 14% at 10, 20, 25, and 30 years, respectively. At most recent follow-up the was only death, which was related to severe biventricular failure 25 years after conduit implant. PVR using a xenograft valved conduit results in prolonged freedom from reoperation and excellent long-term survival. These data, which provide long-term follow-up information on xenograft valves after PVR. Copyright © 2016 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

Patient-Specific MRI-Based Right Ventricle Models Using Different Zero-Load Diastole and Systole Geometries for Better Cardiac Stress and Strain Calculations and Pulmonary Valve Replacement Surgical Outcome Predictions.

PubMed

Tang, Dalin; Del Nido, Pedro J; Yang, Chun; Zuo, Heng; Huang, Xueying; Rathod, Rahul H; Gooty, Vasu; Tang, Alexander; Wu, Zheyang; Billiar, Kristen L; Geva, Tal

2016-01-01

Accurate calculation of ventricular stress and strain is critical for cardiovascular investigations. Sarcomere shortening in active contraction leads to change of ventricular zero-stress configurations during the cardiac cycle. A new model using different zero-load diastole and systole geometries was introduced to provide more accurate cardiac stress/strain calculations with potential to predict post pulmonary valve replacement (PVR) surgical outcome. Cardiac magnetic resonance (CMR) data were obtained from 16 patients with repaired tetralogy of Fallot prior to and 6 months after pulmonary valve replacement (8 male, 8 female, mean age 34.5 years). Patients were divided into Group 1 (n = 8) with better post PVR outcome and Group 2 (n = 8) with worse post PVR outcome based on their change in RV ejection fraction (EF). CMR-based patient-specific computational RV/LV models using one zero-load geometry (1G model) and two zero-load geometries (diastole and systole, 2G model) were constructed and RV wall thickness, volume, circumferential and longitudinal curvatures, mechanical stress and strain were obtained for analysis. Pairwise T-test and Linear Mixed Effect (LME) model were used to determine if the differences from the 1G and 2G models were statistically significant, with the dependence of the pair-wise observations and the patient-slice clustering effects being taken into consideration. For group comparisons, continuous variables (RV volumes, WT, C- and L- curvatures, and stress and strain values) were summarized as mean ± SD and compared between the outcome groups by using an unpaired Student t-test. Logistic regression analysis was used to identify potential morphological and mechanical predictors for post PVR surgical outcome. Based on results from the 16 patients, mean begin-ejection stress and strain from the 2G model were 28% and 40% higher than that from the 1G model, respectively. Using the 2G model results, RV EF changes correlated negatively with stress (r = -0.609, P = 0.012) and with pre-PVR RV end-diastole volume (r = -0.60, P = 0.015), but did not correlate with WT, C-curvature, L-curvature, or strain. At begin-ejection, mean RV stress of Group 2 was 57.4% higher than that of Group 1 (130.1±60.7 vs. 82.7±38.8 kPa, P = 0.0042). Stress was the only parameter that showed significant differences between the two groups. The combination of circumferential curvature, RV volume and the difference between begin-ejection stress and end-ejection stress was the best predictor for post PVR outcome with an area under the ROC curve of 0.855. The begin-ejection stress was the best single predictor among the 8 individual parameters with an area under the ROC curve of 0.782. The new 2G model may be able to provide more accurate ventricular stress and strain calculations for potential clinical applications. Combining morphological and mechanical parameters may provide better predictions for post PVR outcome.

Relationship between virological response and FIB-4 index in chronic hepatitis B patients with entecavir therapy.

PubMed

Li, Ni; Xu, Jing-Hang; Yu, Min; Wang, Sa; Si, Chong-Wen; Yu, Yan-Yan

2015-11-21

To investigate whether long-term low-level hepatitis B virus (HBV) DNA influences dynamic changes of the FIB-4 index in chronic hepatitis B (CHB) patients receiving entecavir (ETV) therapy with partial virological responses. We retrospectively analyzed 231 nucleos(t)ide (NA) naïve CHB patients from our previous study (NCT01926288) who received continuous ETV or ETV maleate therapy for three years. The patients were divided into partial virological response (PVR) and complete virological response (CVR) groups according to serum HBV DNA levels at week 48. Seventy-six patients underwent biopsies at baseline and at 48 wk. The performance of the FIB-4 index and area under the receiver operating characteristic (AUROC) curve for predicting fibrosis were determined for the patients undergoing biopsy. The primary objective of the study was to compare the cumulative probabilities of virological responses between the two groups during the treatment period. The secondary outcome was to observe dynamic changes of the FIB-4 index between CVR patients and PVR patients. For hepatitis B e antigen (HBeAg)-positive patients (n = 178), the cumulative probability of achieving undetectable levels at week 144 was 95% and 69% for CVR and PVR patients, respectively (P < 0.001). In the Cox proportional hazards model, a lower pretreatment serum HBV DNA level was an independent factor predicting maintained viral suppression. The cumulative probability of achieving undetectable levels of HBV DNA for HBeAg-negative patients (n = 53) did not differ between the two groups. The FIB-4 index efficiently identified fibrosis, with an AUROC of 0.80 (95%CI: 0.69-0.89). For HBeAg-positive patients, the FIB-4 index was higher in CVR patients than in PVR patients at baseline (1.89 ± 1.43 vs 1.18 ± 0.69, P < 0.001). There was no significant difference in the reduction of the FIB-4 index between the CVR and PVR groups from weeks 48 to 144 (-0.11 ± 0.47 vs -0.13 ± 0.49, P = 0.71). At week 144, the FIB-4 index levels were similar between the two groups (1.24 ± 0.87 vs 1.02 ± 0.73, P = 0.06). After multivariate logistic regression analysis, a lower baseline serum HBV DNA level was associated with improvement of liver fibrosis. In HBeAg-negative patients, the FIB-4 index did not differ between the two groups. The cumulative probabilities of HBV DNA responses showed significant differences between CVR and PVR HBeAg-positive CHB patients undergoing entecavir treatment for 144 wk. However, long-term low-level HBV DNA did not deteriorate the FIB-4 index, which was used to evaluate liver fibrosis, at the end of three years.

Differential regulation of protein tyrosine kinase signalling by Dock and the PTP61F variants.

PubMed

Willoughby, Lee F; Manent, Jan; Allan, Kirsten; Lee, Han; Portela, Marta; Wiede, Florian; Warr, Coral; Meng, Tzu-Ching; Tiganis, Tony; Richardson, Helena E

2017-07-01

Tyrosine phosphorylation-dependent signalling is coordinated by the opposing actions of protein tyrosine kinases (PTKs) and protein tyrosine phosphatases (PTPs). There is a growing list of adaptor proteins that interact with PTPs and facilitate the dephosphorylation of substrates. The extent to which any given adaptor confers selectivity for any given substrate in vivo remains unclear. Here we have taken advantage of Drosophila melanogaster as a model organism to explore the influence of the SH3/SH2 adaptor protein Dock on the abilities of the membrane (PTP61Fm)- and nuclear (PTP61Fn)-targeted variants of PTP61F (the Drosophila othologue of the mammalian enzymes PTP1B and TCPTP respectively) to repress PTK signalling pathways in vivo. PTP61Fn effectively repressed the eye overgrowth associated with activation of the epidermal growth factor receptor (EGFR), PTK, or the expression of the platelet-derived growth factor/vascular endothelial growth factor receptor (PVR) or insulin receptor (InR) PTKs. PTP61Fn repressed EGFR and PVR-induced mitogen-activated protein kinase signalling and attenuated PVR-induced STAT92E signalling. By contrast, PTP61Fm effectively repressed EGFR- and PVR-, but not InR-induced tissue overgrowth. Importantly, coexpression of Dock with PTP61F allowed for the efficient repression of the InR-induced eye overgrowth, but did not enhance the PTP61Fm-mediated inhibition of EGFR and PVR-induced signalling. Instead, Dock expression increased, and PTP61Fm coexpression further exacerbated the PVR-induced eye overgrowth. These results demonstrate that Dock selectively enhances the PTP61Fm-mediated attenuation of InR signalling and underscores the specificity of PTPs and the importance of adaptor proteins in regulating PTP function in vivo. © 2017 Federation of European Biochemical Societies.

Pulmonary venous flow index as a predictor of pulmonary vascular resistance variability in congenital heart disease with increased pulmonary flow: a comparative study before and after oxygen inhalation.

PubMed

Rivera, Ivan Romero; Mendonça, Maria Alayde; Andrade, José Lázaro; Moises, Valdir; Campos, Orlando; Silva, Célia Camelo; Carvalho, Antonio Carlos

2013-09-01

There is no definitive and reliable echocardiographic method for estimating the pulmonary vascular resistance (PVR) to differentiate persistent vascular disease from dynamic pulmonary hypertension. The aim of this study was to analyze the relationship between the pulmonary venous blood flow velocity-time integral (VTIpv) and PVR. Eighteen patients (10 females; 4 months to 22 years of age) with congenital heart disease and left to right shunt were studied. They underwent complete cardiac catheterization, including measurements of the PVR and Qp:Qs ratio, before and after 100% oxygen inhalation. Simultaneous left inferior pulmonary venous flow VTIpv was obtained by Doppler echocardiography. The PVR decreased significantly from 5.0 ± 2.6 W to 2.8 ± 2.2 W (P = 0.0001) with a significant increase in the Qp:Qs ratio, from 3.2 ± 1.4 to 4.9 ± 2.4 (P = 0.0008), and the VTIpv increased significantly from 22.6 ± 4.7 cm to 28.1 ± 6.2 cm (P = 0.0002) after 100% oxygen inhalation. VTIpv correlated well with the PVR and Qp:Qs ratio (r = -0.74 and 0.72, respectively). Diagnostic indexes indicated a sensitivity of 86%, specificity of 75%, accuracy of 83%, a positive predictive value of 92% and a negative predictive value of 60%. The VTIpv correlated well with the PVR. The measurement of this index before and after oxygen inhalation may become a useful noninvasive test for differentiating persistent vascular disease from dynamic and flow-related pulmonary hypertension. © 2013, Wiley Periodicals, Inc.

Prophylactic chorioretinectomy for eye injuries with high proliferative-vitreoretinopathy risk.

PubMed

Kuhn, Ferenc; Schrader, Wolfgang

2018-01-01

With its incidence exceeding 60%, proliferative vitreoretinopathy (PVR) remains the most important pathology responsible for loss of vision, even the eyeball, after certain types of severe trauma. In this article, we present results obtained using our novel surgical technique, prophylactic chorioretinectomy (PCR), to prevent the development of PVR. Data on severely injured eyes at high risk for PVR [rupture, posterior laceration, deep-impact intraocular foreign body (IOFB) trauma, perforating injury] were collected prospectively. All eyes underwent vitrectomy (PPV) by PCR within 100 hr of the trauma. Eyes were excluded if they presented with endophthalmitis or if the reconstructive surgery was performed outside this time frame. Forty eyes of 40 consecutive patients were analyzed; full follow-up information was obtained for all of them. The injury was rupture in 27%, penetrating in 15%, (deep-impact) IOFB in 35%, and perforating in 23%. PPV-PCR was performed during primary (wound closure) surgery in 59% of cases. All eyes had at least minimal vitreous hemorrhage, and none had a true posterior vitreous detachment. At the time of PPV, 30% of the eyes had a retinal detachment. Sixteen percent developed PVR, but none from the site of the PCR procedure. In 20%, silicone oil remained in the eye at the last follow-up. The visual acuity improved in 93% of eyes and worsened in none; the improvement was mostly due to surgical clearing of the media opacity. In this subgroup of eyes with severe open-globe trauma, over 60% are expected to develop PVR. PPV/PCR performed within 100 hr reduced the PVR risk significantly, so currently it remains the best option for the surgeon. Clin. Anat. 31:28-38, 2018. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Integrated application of combined cooling, heating and power poly-generation PV radiant panel system of zero energy buildings

NASA Astrophysics Data System (ADS)

Yin, Baoquan

2018-02-01

A new type of combined cooling, heating and power of photovoltaic radiant panel (PV/R) module was proposed, and applied in the zero energy buildings in this paper. The energy system of this building is composed of PV/R module, low temperature difference terminal, energy storage, multi-source heat pump, energy balance control system. Radiant panel is attached on the backside of the PV module for cooling the PV, which is called PV/R module. During the daytime, the PV module was cooled down with the radiant panel, as the temperature coefficient influence, the power efficiency was increased by 8% to 14%, the radiant panel solar heat collecting efficiency was about 45%. Through the nocturnal radiant cooling, the PV/R cooling capacity could be 50 W/m2. For the multifunction energy device, the system shows the versatility during the heating, cooling and power used of building utilization all year round.

Increase in whole-body peripheral vascular resistance during three hours of air or oxygen prebreathing

NASA Technical Reports Server (NTRS)

Waligora, J. M.; Horrigan, D. J., Jr.; Conkin, J.; Dierlam, J. J.; Stanford, J., Jr.; Riddle, J. R.

1984-01-01

Male and female subjects prebreathed air or 100% oxygen through a mask for 3.0 hours while comfortably reclined. Blood pressures, heart rate, and cardiac output were collected before and after the prebreathe. Peripheral vascular resistance (PVR) was calculated from these parameters and increased by 29% during oxygen prebreathing and 15% during air prebreathing. The oxygen contributed substantially to the increase in PVR. Diastolic blood pressure increased by 18% during the oxygen prebreathe while stystolic blood pressure showed no change under either procedure. The increase in PVR during air prebreathing was attributed to procedural stress common to air and oxygen prebreathing.

Proliferative vitreoretinopathy in the Swine-a new model.

PubMed

Umazume, Kazuhiko; Barak, Yoreh; McDonald, Kevin; Liu, Lanhsin; Kaplan, Henry J; Tamiya, Shigeo

2012-07-24

To develop a large animal model of proliferative vitreoretinopathy (PVR) in the swine to eventually study disease pathophysiology, as well as novel therapies. PVR was induced in domestic swine by creation of a posterior vitreous detachment, creation of a retinal detachment by the injection of subretinal fluid, and intravitreal injection of green fluorescent protein-positive retinal pigment epithelial (GFP+ RPE) cells. Control eyes had the same surgical procedures without RPE cell injection. PVR was clinically graded on days 3, 7, and 14. Animals were euthanized on day 14, and enucleated eyes were analyzed by light microscopy and immunohistochemistry. Injection of GFP+ RPE cells into the vitreous cavity produced localized, traction retinal detachments by day 14 in all eyes (14 of 14); in contrast, the retina spontaneously reattached by day 3 and remained attached in all control eyes (10 of 10). Contractile epiretinal membranes on the inner retinal surface that caused the traction retinal detachments consisted predominantly of GFP+ RPE cells. These cells stained positive for cytokeratin, confirming their epithelial origin, and also expressed α-SMA and fibronectin, markers for myofibroblasts and fibrosis, respectively. We established a swine PVR model that recapitulates key clinical features found in humans and, thus, can be used to study the pathophysiology of PVR, as well as new novel therapies. GFP+ RPE cells injected into the vitreous cavity formed contractile membranes on the inner retinal surface and caused localized traction retinal detachments.

Pre-transplant reversible pulmonary hypertension predicts higher risk for mortality after cardiac transplantation.

PubMed

Butler, Javed; Stankewicz, Mark A; Wu, Jack; Chomsky, Don B; Howser, Renee L; Khadim, Ghazanfar; Davis, Stacy F; Pierson, Richard N; Wilson, John R

2005-02-01

Pre-transplant fixed pulmonary hypertension is associated with higher post-transplant mortality. In this study, we assessed the significance of pre-transplant reversible pulmonary hypertension in patients undergoing cardiac transplantation. Overall, we studied 182 patients with baseline normal pulmonary pressures or reversible pulmonary hypertension, defined as a decrease in pulmonary vascular resistance (PVR) to < or =2.5 Wood units (WU), who underwent cardiac transplantation. Multiple recipient and donor characteristics were assessed to identify independent predictors of mortality. The average duration of follow-up was 42 +/- 28 months. Forty patients (22%) died during the follow-up period. Baseline hemodynamics for alive vs dead patients were as follows: pulmonary artery systolic (PAS) 42 +/- 15 vs 52 +/- 15 mm Hg; PA diastolic 21 +/- 9 vs 25 +/- 9 mm Hg; PA mean 28 +/- 11 vs 35 +/- 10 mm Hg; transpulmonary gradient (TPG) 9 +/- 4 vs 11 +/- 7 mm Hg (all p < 0.05); total pulmonary resistance 7.7 +/- 4.8 vs 8.8 +/- 3.2 WU (p = 0.08); and PVR 2.3 +/- 1.5 vs 2.9 +/- 1.6 WU (p = 0.06). In an unadjusted analysis, patients with PAS >50 mm Hg had a higher risk of death (odds ratio [OR] 5.96, 95% confidence interval [CI] 1.46 to 19.84 as compared with PAS < or =30 mm Hg). There was no significant difference in survival among patients with baseline PVR <2.5, 2.5 to 4.0 or >4.0 WU, but patients with TPG > or =16 had a higher risk of mortality (OR 4.93, 95% CI 1.84 to 13.17). PAS pressure was an independent predictor of mortality (OR 1.04, 95% CI 1.02 to 1.06). Recipient body mass index, history of sternotomy; and donor ischemic time were the other independent predictors of mortality. Pre-transplant pulmonary hypertension, even when reversible to a PVR of < or =2.5 WU, is associated with a higher mortality post-transplant.

A poliomyelitis model through mucosal infection in transgenic mice bearing human poliovirus receptor, TgPVR21.

PubMed

Nagata, Noriyo; Iwasaki, Takuya; Ami, Yasushi; Sato, Yuko; Hatano, Ikuyoshi; Harashima, Ayako; Suzaki, Yuriko; Yoshii, Takao; Hashikawa, Tsutomu; Sata, Tetsutaro; Horiuchi, Yoshinobu; Koike, Satoshi; Kurata, Takeshi; Nomoto, Akio

2004-03-30

Transgenic mice bearing the human poliovirus receptor (TgPVR) are less susceptible to oral inoculation, although they are susceptible to parenteral inoculation. We investigated the susceptibility of TgPVR 21 line [Arch. Virol. 130 (1994) 351] to poliovirus through various mucosal routes. Intranasal inoculation of a neurovirulent Mahoney strain (OM1) caused flaccid paralysis with viral replication in the central nervous system at a dose of 10(6) cell culture infectious dose (CCID50), in contrast, no paralysis following oral or intragastric inoculation of the same dose. Intranasal inoculation of a vaccine strain, Sabin 1, at 10(6) CCID50, resulted in no paralysis. Initial replication of poliovirus in the nasal cavity was confirmed by virus isolation and detection of negative-stranded replicative intermediates by RT-PCR and viral antigens using a high-sensitive immunohistochemistry and genome/transcripts by in situ hybridization. Poliovirus-specific IgG antibodies were elevated in the sera of surviving TgPVR21. This model can be used as a mucosal infection model and for differentiation of neurovirulent and attenuated poliovirus strains.

Does the cancer drugs fund lead to faster uptake of cost-effective drugs? A time-trend analysis comparing England and Wales.

PubMed

Chamberlain, C; Collin, S M; Stephens, P; Donovan, J; Bahl, A; Hollingworth, W

2014-10-28

The Cancer Drugs Fund (CDF) provides £200 million annually in England for 'anti-cancer' drugs. We used a controlled pre-/post-intervention design to compare IMS Health dispensing data for 15 cancer drugs (2007-2012) in England vs Wales, stratified by pre-CDF NICE drug approval status (rejected, mixed recommendations, recommended, not appraised). The CDF was associated with increased prescribing in England for three of five drugs rejected or with mixed NICE recommendations. The prescribing volume ratios (PVR) ranged from 1.29 (95% CI 1.00, 1.67) for sorafenib to 3.28 (2.59, 4.14) for bevacizumab (NICE rejected) and 0.93 (0.81, 1.06) and 1.35 (1.21, 1.49) for sunitinib and imatinib respectively (mixed recommendations). Post CDF prescribing in England increased for both drugs awaiting NICE appraisal pre-CDF (lapatinib PVR=7.44 (5.81, 9.54), panitumumab PVR=5.40 (1.20, 24.42)) and subsequently rejected. The CDF was not associated with increased prescribing in England of NICE-recommended drugs. The three most recently launched, subsequently recommended drugs were adopted faster in Wales (from pazopanib PVR=0.51 (0.28, 0.96) to abiraterone PVR=0.78 (0.61-0.99)). These data indicate that the CDF is used to access drugs deemed not cost-effective by NICE. The CDF did not expedite access to new cost-effective cancer agents prior to NICE approval.

The effect of alpha blockers on uroflowmetric parameters in different voiding positions

PubMed Central

Koc, Gokhan; Yilmaz, Yuksel; Un, Sitki; Akbay, Kaan; Akdeniz, Firat

2013-01-01

Introduction: We assessed the effect of different voiding positions on uroflowmetric parameters and post-void residual (PVR) urine volume in symptomatic benign prostatic hyperplasia (BPH) patients. We also evaluated the effect of alpha blockers on PVR in different voiding positions. Methods: The study was performed with 110 BPH patients over 50 years old. In total, 4 uroflowmetries were performed in all patients: 2 patients in the sitting position and 2 in the standing position. PVR was measured with transabdominal ultrasonography. Also, patients were divided into two groups according to the alpha adrenergic blocker treatment; the effect of this treatment on their uroflowmetric parameters in different positions was evaluated. Results: Maximum flow rate (Qmax) and average flow rate (Qave) were significantly higher in patients in the sitting position, but there were no differences in other uroflowmetric parameters and PVR volume (Qmax: 15.5±5.9 mL/s vs. 13.7±5.2 mL/s, Qave: 11.4±4.6 mL/s vs. 10.7± 3.9 mL/s, respectively; p < 0.05). The Qmax and Qave were significantly higher in sitting position, compared to the standing position, in both alpha adrenergic treatment and non-treated groups; again, there were no differences in other uroflowmetric parameters and PVR volume. Conclusion: Qmax and Qave values were significantly higher in the sitting position. Alpha blockers did not affect any change. PMID:23766834

Relationship between virological response and FIB-4 index in chronic hepatitis B patients with entecavir therapy

PubMed Central

Li, Ni; Xu, Jing-Hang; Yu, Min; Wang, Sa; Si, Chong-Wen; Yu, Yan-Yan

2015-01-01

AIM: To investigate whether long-term low-level hepatitis B virus (HBV) DNA influences dynamic changes of the FIB-4 index in chronic hepatitis B (CHB) patients receiving entecavir (ETV) therapy with partial virological responses. METHODS: We retrospectively analyzed 231 nucleos(t)ide (NA) naïve CHB patients from our previous study (NCT01926288) who received continuous ETV or ETV maleate therapy for three years. The patients were divided into partial virological response (PVR) and complete virological response (CVR) groups according to serum HBV DNA levels at week 48. Seventy-six patients underwent biopsies at baseline and at 48 wk. The performance of the FIB-4 index and area under the receiver operating characteristic (AUROC) curve for predicting fibrosis were determined for the patients undergoing biopsy. The primary objective of the study was to compare the cumulative probabilities of virological responses between the two groups during the treatment period. The secondary outcome was to observe dynamic changes of the FIB-4 index between CVR patients and PVR patients. RESULTS: For hepatitis B e antigen (HBeAg)-positive patients (n = 178), the cumulative probability of achieving undetectable levels at week 144 was 95% and 69% for CVR and PVR patients, respectively (P < 0.001). In the Cox proportional hazards model, a lower pretreatment serum HBV DNA level was an independent factor predicting maintained viral suppression. The cumulative probability of achieving undetectable levels of HBV DNA for HBeAg-negative patients (n = 53) did not differ between the two groups. The FIB-4 index efficiently identified fibrosis, with an AUROC of 0.80 (95%CI: 0.69-0.89). For HBeAg-positive patients, the FIB-4 index was higher in CVR patients than in PVR patients at baseline (1.89 ± 1.43 vs 1.18 ± 0.69, P < 0.001). There was no significant difference in the reduction of the FIB-4 index between the CVR and PVR groups from weeks 48 to 144 (-0.11 ± 0.47 vs -0.13 ± 0.49, P = 0.71). At week 144, the FIB-4 index levels were similar between the two groups (1.24 ± 0.87 vs 1.02 ± 0.73, P = 0.06). After multivariate logistic regression analysis, a lower baseline serum HBV DNA level was associated with improvement of liver fibrosis. In HBeAg-negative patients, the FIB-4 index did not differ between the two groups. CONCLUSION: The cumulative probabilities of HBV DNA responses showed significant differences between CVR and PVR HBeAg-positive CHB patients undergoing entecavir treatment for 144 wk. However, long-term low-level HBV DNA did not deteriorate the FIB-4 index, which was used to evaluate liver fibrosis, at the end of three years. PMID:26604649

Effect of inhaled nitric oxide on pulmonary hemodynamics after acute lung injury in dogs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Romand, J.A.; Pinsky, M.R.; Firestone, L.

Increased pulmonary vascular resistance (PVR) and mismatch in ventilation-to-perfusion ratio characterize acute lung injury (ALI). Pulmonary arterial pressure (Ppa) decreases when nitric oxide (NO) is inhaled during hypoxic pulmonary vasoconstriction (HPV); thus NO inhalation may reduce PVR and improve gas exchange in ALI. The authors studied the hemodynamic and gas exchange effects of NO inhalation during HPV and then ALI in eight anesthetized open-chest mechanically ventilated dogs. Right atrial pressure, Ppa, and left ventricular and arterial pressures were measured, and cardiac output was estimated by an aortic flow probe. Shunt and dead space were also estimated. The effect of 5-minmore » exposures to 0, 17, 28, 47, and 0 ppm inhaled NO was recorded during hyperoxia, hypoxia, and oleic acid-induced ALI. During ALI, partial [beta]-adrenergic blockage (propanolol, 0.15 mg/kg iv) was induced and 74 ppm NO was inhaled. Nitrosylhemoglobin (NO-Hb) and methemoglobin (MetHb) levels were measured. During hyperoxia, NO inhalation had no measurable effects. Hypoxia increased Ppa and calculated PVR, both of which decreased with 17 ppm NO. ALI decreased arterial Po[sub 2] and increased airway pressure, shunt, and dead space ventilation. Ppa and PVR were greater during ALI than during hyperoxia. NO inhalation had no measurable effect during ALI before or after [beta]-adrenergic blockage. MetHb remained low, and NO-Hb was unmeasurable. Bolus infusion of nitroglycerin (15 [mu]g) induced an immediate decrease in Ppa and PVR during ALI. Short-term NO inhalation does not affect PVR or gas exchange in dogs with oleic acid-induced ALI, nor does it increase NO-Hb or MetHb. In contrast, NO can diminish hypoxia-induced elevations in pulmonary vascular tone. These data suggest that NO inhalation selectively dilates the pulmonary circulation and specifically reduces HPV but not oleic acid-induced increases in pulmonary vasomotor tone. 28 refs., 3 figs., 2 tabs.« less

Minireview: Fibronectin in retinal disease.

PubMed

Miller, Charles G; Budoff, Greg; Prenner, Jonathan L; Schwarzbauer, Jean E

2017-01-01

Retinal fibrosis, characterized by dysregulation of extracellular matrix (ECM) protein deposition by retinal endothelial cells, pigment epithelial cells, and other resident cell-types, is a unifying feature of several common retinal diseases. Fibronectin is an early constituent of newly deposited ECM and serves as a template for assembly of other ECM proteins, including collagens. Under physiologic conditions, fibronectin is found in all layers of Bruch's membrane. Proliferative vitreoretinopathy (PVR), a complication of retinal surgery, is characterized by ECM accumulation. Among the earliest histologic manifestations of diabetic retinopathy (DR) is capillary basement membrane thickening, which occurs due to perturbations in ECM homeostasis. Neovascularization, the hallmark of late stage DR as well as exudative age-related macular degeneration (AMD), involves ECM assembly as a scaffold for the aberrant new vessel architecture. Rodent models of retinal injury demonstrate a key role for fibronectin in complications characteristic of PVR, including retinal detachment. In mouse models of DR, reducing fibronectin gene expression has been shown to arrest the accumulation of ECM in the capillary basement membrane. Alterations in matrix metalloproteinase activity thought to be important in the pathogenesis of AMD impact the turnover of fibronectin matrix as well as collagens. Growth factors involved in PVR, AMD, and DR, such as PDGF and TGFβ, are known to stimulate fibronectin matrix assembly. A deeper understanding of how pathologic ECM deposition contributes to disease progression may help to identify novel targets for therapeutic intervention. © 2016 by the Society for Experimental Biology and Medicine.

Pulmonary stenosis and pulmonary regurgitation: both ends of the spectrum in residual hemodynamic impairment after tetralogy of Fallot repair.

PubMed

Yoo, Byung Won; Park, Han Ki

2013-06-01

Repair of tetralogy of Fallot (TOF) has shown excellent outcomes. However it leaves varying degrees of residual hemodynamic impairment, with severe pulmonary stenosis (PS) and free pulmonary regurgitation (PR) at both ends of the spectrum. Since the 1980s, studies evaluating late outcomes after TOF repair revealed the adverse impacts of residual chronic PR on RV volume and function; thus, a turnaround of operational strategies has occurred from aggressive RV outflow tract (RVOT) reconstruction for complete relief of RVOT obstruction to conservative RVOT reconstruction for limiting PR. This transformation has raised the question of how much residual PS after conservative RVOT reconstruction is acceptable. Besides, as pulmonary valve replacement (PVR) increases in patients with RV deterioration from residual PR, there is concern regarding when it should be performed. Regarding residual PS, several studies revealed that PS in addition to PR was associated with less PR and a small RV volume. This suggests that PS combined with PR makes RV diastolic property to protect against dilatation through RV hypertrophy and supports conservative RVOT enlargement despite residual PS. Also, several studies have revealed the pre-PVR threshold of RV parameters for the normalization of RV volume and function after PVR, and based on these results, the indications for PVR have been revised. Although there is no established strategy, better understanding of RV mechanics, development of new surgical and interventional techniques, and evidence for the effect of PVR on RV reverse remodeling and its late outcome will aid us to optimize the management of TOF.

Prognostic Value of Pulmonary Vascular Resistance by Magnetic Resonance in Systolic Heart Failure

PubMed Central

Fabregat-Andrés, Óscar; Estornell-Erill, Jordi; Ridocci-Soriano, Francisco; Pérez-Boscá, José Leandro; García-González, Pilar; Payá-Serrano, Rafael; Morell, Salvador; Cortijo, Julio

2016-01-01

Background Pulmonary hypertension is associated with poor prognosis in heart failure. However, non-invasive diagnosis is still challenging in clinical practice. Objective We sought to assess the prognostic utility of non-invasive estimation of pulmonary vascular resistances (PVR) by cardiovascular magnetic resonance to predict adverse cardiovascular outcomes in heart failure with reduced ejection fraction (HFrEF). Methods Prospective registry of patients with left ventricular ejection fraction (LVEF) < 40% and recently admitted for decompensated heart failure during three years. PVRwere calculated based on right ventricular ejection fraction and average velocity of the pulmonary artery estimated during cardiac magnetic resonance. Readmission for heart failure and all-cause mortality were considered as adverse events at follow-up. Results 105 patients (average LVEF 26.0 ±7.7%, ischemic etiology 43%) were included. Patients with adverse events at long-term follow-up had higher values of PVR (6.93 ± 1.9 vs. 4.6 ± 1.7estimated Wood Units (eWu), p < 0.001). In multivariate Cox regression analysis, PVR ≥ 5 eWu(cutoff value according to ROC curve) was independently associated with increased risk of adverse events at 9 months follow-up (HR2.98; 95% CI 1.12-7.88; p < 0.03). Conclusions In patients with HFrEF, the presence of PVR ≥ 5.0 Wu is associated with significantly worse clinical outcome at follow-up. Non-invasive estimation of PVR by cardiac magnetic resonance might be useful for risk stratification in HFrEF, irrespective of etiology, presence of late gadolinium enhancement or LVEF. PMID:26840055

PVR: Patch-to-Volume Reconstruction for Large Area Motion Correction of Fetal MRI.

PubMed

Alansary, Amir; Rajchl, Martin; McDonagh, Steven G; Murgasova, Maria; Damodaram, Mellisa; Lloyd, David F A; Davidson, Alice; Rutherford, Mary; Hajnal, Joseph V; Rueckert, Daniel; Kainz, Bernhard

2017-10-01

In this paper, we present a novel method for the correction of motion artifacts that are present in fetal magnetic resonance imaging (MRI) scans of the whole uterus. Contrary to current slice-to-volume registration (SVR) methods, requiring an inflexible anatomical enclosure of a single investigated organ, the proposed patch-to-volume reconstruction (PVR) approach is able to reconstruct a large field of view of non-rigidly deforming structures. It relaxes rigid motion assumptions by introducing a specific amount of redundant information that is exploited with parallelized patchwise optimization, super-resolution, and automatic outlier rejection. We further describe and provide an efficient parallel implementation of PVR allowing its execution within reasonable time on commercially available graphics processing units, enabling its use in the clinical practice. We evaluate PVR's computational overhead compared with standard methods and observe improved reconstruction accuracy in the presence of affine motion artifacts compared with conventional SVR in synthetic experiments. Furthermore, we have evaluated our method qualitatively and quantitatively on real fetal MRI data subject to maternal breathing and sudden fetal movements. We evaluate peak-signal-to-noise ratio, structural similarity index, and cross correlation with respect to the originally acquired data and provide a method for visual inspection of reconstruction uncertainty. We further evaluate the distance error for selected anatomical landmarks in the fetal head, as well as calculating the mean and maximum displacements resulting from automatic non-rigid registration to a motion-free ground truth image. These experiments demonstrate a successful application of PVR motion compensation to the whole fetal body, uterus, and placenta.

Exercise capacity in the Bidirectional Glenn physiology: Coupling cardiac index, ventricular function and oxygen extraction ratio.

PubMed

Vallecilla, Carolina; Khiabani, Reza H; Trusty, Phillip; Sandoval, Néstor; Fogel, Mark; Briceño, Juan Carlos; Yoganathan, Ajit P

2015-07-16

In Bi-directional Glenn (BDG) physiology, the superior systemic circulation and pulmonary circulation are in series. Consequently, only blood from the superior vena cava is oxygenated in the lungs. Oxygenated blood then travels to the ventricle where it is mixed with blood returning from the lower body. Therefore, incremental changes in oxygen extraction ratio (OER) could compromise exercise tolerance. In this study, the effect of exercise on the hemodynamic and ventricular performance of BDG physiology was investigated using clinical patient data as inputs for a lumped parameter model coupled with oxygenation equations. Changes in cardiac index, Qp/Qs, systemic pressure, oxygen extraction ratio and ventricular/vascular coupling ratio were calculated for three different exercise levels. The patient cohort (n=29) was sub-grouped by age and pulmonary vascular resistance (PVR) at rest. It was observed that the changes in exercise tolerance are significant in both comparisons, but most significant when sub-grouped by PVR at rest. Results showed that patients over 2 years old with high PVR are above or close to the upper tolerable limit of OER (0.32) at baseline. Patients with high PVR at rest had very poor exercise tolerance while patients with low PVR at rest could tolerate low exercise conditions. In general, ventricular function of SV patients is too poor to increase CI and fulfill exercise requirements. The presented mathematical model provides a framework to estimate the hemodynamic performance of BDG patients at different exercise levels according to patient specific data. Published by Elsevier Ltd.

Smart, Injury-Triggered Therapy for Ocular Trauma

DTIC Science & Technology

2016-10-01

prognosis due to retinal cell death , scar formation, and lack of functional regeneration. Proliferative vitreoretinopathy (PVR), a form of intraocular...Proteases, Metalloproteinases, Cell death , Gene Therapy 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME...vision has a poor prognosis due to retinal cell death , scar formation, and lack of functional regeneration. Proliferative vitreoretinopathy (PVR), a

Unnoticed Post-Void Residual Urine Volume in People with Moderate to Severe Intellectual Disabilities: Prevalence and Risk Factors

ERIC Educational Resources Information Center

de Waal, K. H.; Tinselboer, B. M.; Evenhuis, H. M.; Penning, C.

2009-01-01

Background: Increased post-void residual urine volume (PVR) is often seen in geriatric populations. People with intellectual disabilities (ID) have risk factors in common with these populations. Aims: To investigate in adults with ID: (1) Feasibility of portable ultrasound bladder scanning; (2) Prevalence of PVR; and (3) Relations with proposed…

Origin of negative resistance in anion migration controlled resistive memory

NASA Astrophysics Data System (ADS)

Banerjee, Writam; Wu, Facai; Hu, Yuan; Wu, Quantan; Wu, Zuheng; Liu, Qi; Liu, Ming

2018-03-01

Resistive random access memory (RRAM) is one of the most promising emerging nonvolatile technologies for the futuristic memory devices. Resistive switching behavior often shows negative resistance (NR), either voltage controlled or current controlled. In this work, the origin of a current compliance dependent voltage controlled NR effect during the resetting of anion migration based RRAM devices is discussed. The N-type voltage controlled NR is a high field driven phenomena. The current conduction within the range of a certain negative voltage is mostly dominated by space charge limited current. But with the higher negative voltage, a field induced tunneling effect is generated in the NR region. The voltage controlled NR is strongly dependent on the compliance current. The area independent behavior indicates the filamentary switching. The peak to valley ratio (PVR) is > 5. The variation of PVR as a function of the conduction band offset is achieved. Compared to other reported works, based on the PVR, it is possible to distinguish the RRAM types. Generally, due to the higher electric field effect on the metallic bridge during RESET, the electrochemical metallization type RRAM shows much higher PVR than the valance change type RRAM.

Modeling of pharmacokinetics, efficacy, and hemodynamic effects of macitentan in patients with pulmonary arterial hypertension.

PubMed

Krause, Andreas; Zisowsky, Jochen; Dingemanse, Jasper

2018-04-01

Macitentan is the first endothelin receptor antagonist with demonstrated efficacy on morbidity and mortality in pulmonary arterial hypertension (PAH) in the pivotal study SERAPHIN. The pharmacokinetics (PK) of macitentan and its active metabolite, ACT-132577, were characterized in a population model. Efficacy and hemodynamics (pharmacodynamics, PD) were related to PK based on PK/PD modeling. Sex, age, and body weight influenced the PK to a statistically significant extent. Model-based simulations showed that these variables are clinically not relevant. Concomitant use of PAH medication (PDE-5 inhibitors) did not influence macitentan trough concentration to a relevant extent. Efficacy and hemodynamics showed clear differences from placebo for macitentan concentrations on 3 and 10 mg with consistent superior effects for 10 mg. After 6 months, PAH patients showed model-predicted 6-min walk distance (6-MWD) improvements of 1.0 m on placebo compared to 29.8 and 34.1 m on 3 and 10 mg of macitentan, respectively. Higher macitentan concentrations were associated with reductions in pulmonary vascular resistance (PVR), mean right atrial and pulmonary arterial pressure, and total pulmonary resistance (TPR) and increases in cardiac index (CI) and mixed venous oxygen saturation. Statistical significance was determined for PVR, TPR, and CI but not for 6-MWD. In addition, PVR showed more pronounced differences between active treatment and placebo than 6-MWD. Modeling identified statistically significant inter-patient differences; simulations to assess the magnitude of the effects permitted clinical judgment. The same approach will allow for extrapolation to children. Hemodynamic markers might be better markers of treatment effects than 6-MWD. The SERAPHIN study and its open-label extension are registered with ClinicalTrials.gov with identifiers NCT00660179 (https://www.clinicaltrials.gov/ct2/show/NCT00660179) and NCT00667823 (https://clinicaltrials.gov/ct2/show/NCT00667823) and with EudraCT with identifiers 2007-002440-14 (https://www.clinicaltrialsregister.eu/ctr-search/search?query=2007-002440-14) and 2007-003694-27 (https://www.clinicaltrialsregister.eu/ctr-search/search?query=2007-003694-27). Copyright © 2018 Elsevier Ltd. All rights reserved.

Atrial fibrillation patients with isolated pulmonary veins: Is sinus rhythm achievable?

PubMed

Szilágyi, Judit; Marcus, Gregory M; Badhwar, Nitish; Lee, Byron K; Lee, Randall J; Vedantham, Vasanth; Tseng, Zian H; Walters, Tomos; Scheinman, Melvin; Olgin, Jeffrey; Gerstenfeld, Edward P

2017-07-01

The cornerstone of atrial fibrillation (AF) ablation is isolation of the pulmonary veins (PVs). Patients with recurrent AF undergoing repeat ablation usually have PV reconnection (PVr). The ablation strategy and outcome of patients undergoing repeat ablation who have persistent isolation of all PVs (PVi) at the time of repeat ablation is unknown. We studied consecutive patients with recurrent AF undergoing repeat ablation and compared patients with PVi to those with PVr. One hundred fifty-two patients underwent repeat ablation, and of these, 25 patients (16.4%) had PVi. Patients with PVi underwent ablation targeting any isoproterenol induced AF triggers, atrial substrate, or inducible atrial tachycardias or flutters. Patients with PVi compared to PVr were more likely to have a history of persistent AF (64% vs. 26%; P < 0.0001), obesity (BMI 30.4 vs. 28.2; P = 0.05), and prior use of contact force sensing catheters (28% vs. 0.8%, P < 0.0001). After a mean follow-up of 19 ± 15 months, 56% of PVi patients remained in sinus rhythm compared to 76.3% of PVr patients (P = 0.036). In a multivariable model, PVi patients and those with cardiomyopathy had a higher risk of recurrent atrial tachyarrhythmias (HR = 3.6 95%, CI 1.6-8.3, P = 0.002 and HR = 6.2, 95% CI 2.3-16.3, P < 0.0001, respectively). In patients who have all PVs isolated at the time of the redo AF ablation, a strategy of targeting non-PV AF triggers and inducible flutters can still lead to AF freedom in more than half of patients. Patients with PVr, however, have a better long-term outcome. © 2017 Wiley Periodicals, Inc.

Risk Factors for Prosthetic Pulmonary Valve Failure in Patients With Congenital Heart Disease.

PubMed

Oliver, Jose Maria; Garcia-Hamilton, Diego; Gonzalez, Ana Elvira; Ruiz-Cantador, Jose; Sanchez-Recalde, Angel; Polo, Maria Luz; Aroca, Angel

2015-10-15

The incidence and risk factors for prosthetic pulmonary valve failure (PPVF) should be considered when determining optimal timing for pulmonary valve replacement (PVR) in asymptomatic patients with congenital heart disease (CHD). The cumulative freedom for reintervention due to PPVF after 146 PVR in 114 patients with CHD was analyzed. Six potential risk factors (underlying cardiac defect, history of palliative procedures, number of previous cardiac interventions, hemodynamic indication for PVR, type of intervention, and age at intervention) were analyzed using Cox proportional hazard modeling. Receiver operating characteristic (ROC) curves were used for discrimination. Internal validation in patients with tetralogy of Fallot was also performed. Median age at intervention was 23 years. There were 60 reinterventions due to PPVF (41%). Median event-free survival was 14 years (95% confidence interval [CI] 12 to 16 years). The only independent risk factor was the age at intervention (hazard ratio [HR] 0.93, 95% CI 0.90 to 0.97; p = 0.001; area under the ROC curve 0.95, 95% CI 0.92 to 0.98; p <0.001). The best cut-off point was 20.5 years. Freedom from reintervention for PPVF 15 years after surgery was 70% when it was performed at age >20.5 years compared with 33% when age at intervention was <20.5 years (p = 0.004). Internal validation in 102 PVR in patient cohort with tetralogy of Fallot (ROC area 0.98, 95% CI 0.96 to 1.0; p <0.001) was excellent. In conclusion, age at intervention is the main risk factor of reintervention for PPVF. The risk of reintervention is 2-fold when PVR is performed before the age of 20.5 years. Copyright © 2015 Elsevier Inc. All rights reserved.

Quantified degree of eccentricity of aortic valve calcification predicts risk of paravalvular regurgitation and response to balloon post-dilation after self-expandable transcatheter aortic valve replacement.

PubMed

Park, Jun-Bean; Hwang, In-Chang; Lee, Whal; Han, Jung-Kyu; Kim, Chi-Hoon; Lee, Seung-Pyo; Yang, Han-Mo; Park, Eun-Ah; Kim, Hyung-Kwan; Chiam, Paul T L; Kim, Yong-Jin; Koo, Bon-Kwon; Sohn, Dae-Won; Ahn, Hyuk; Kang, Joon-Won; Park, Seung-Jung; Kim, Hyo-Soo

2018-05-15

Limited data exist regarding the impact of aortic valve calcification (AVC) eccentricity on the risk of paravalvular regurgitation (PVR) and response to balloon post-dilation (BPD) after transcatheter aortic valve replacement (TAVR). We investigated the prognostic value of AVC eccentricity in predicting the risk of PVR and response to BPD in patients undergoing TAVR. We analyzed 85 patients with severe aortic stenosis who underwent self-expandable TAVR (43 women; 77.2±7.1years). AVC was quantified as the total amount of calcification (total AVC load) and as the eccentricity of calcium (EoC) using calcium volume scoring with contrast computed tomography angiography (CTA). The EoC was defined as the maximum absolute difference in calcium volume scores between 2 adjacent sectors (bi-partition method) or between sectors based on leaflets (leaflet-based method). Total AVC load and bi-partition EoC, but not leaflet-based EoC, were significant predictors for the occurrence of ≥moderate PVR, and bi-partition EoC had a better predictive value than total AVC load (area under the curve [AUC]=0.863 versus 0.760, p for difference=0.006). In multivariate analysis, bi-partition EoC was an independent predictor for the risk of ≥moderate PVR regardless of perimeter oversizing index. The greater bi-partition EoC was the only significant parameter to predict poor response to BPD (AUC=0.775, p=0.004). Pre-procedural assessment of AVC eccentricity using CTA as "bi-partition EoC" provides useful predictive information on the risk of significant PVR and response to BPD in patients undergoing TAVR with self-expandable valves. Copyright © 2017 Elsevier B.V. All rights reserved.

Arterial morphology responds differently to Captopril then N-acetylcysteine in a monocrotaline rat model of pulmonary hypertension

NASA Astrophysics Data System (ADS)

Molthen, Robert; Wu, Qingping; Baumgardt, Shelley; Kohlhepp, Laura; Shingrani, Rahul; Krenz, Gary

2010-03-01

Pulmonary hypertension (PH) is an incurable condition inevitably resulting in death because of increased right heart workload and eventual failure. PH causes pulmonary vascular remodeling, including muscularization of the arteries, and a reduction in the typically large vascular compliance of the pulmonary circulation. We used a rat model of monocrotaline (MCT) induced PH to evaluated and compared Captopril (an angiotensin converting enzyme inhibitor with antioxidant capacity) and N-acetylcysteine (NAC, a mucolytic with a large antioxidant capacity) as possible treatments. Twenty-eight days after MCT injection, the rats were sacrificed and heart, blood, and lungs were studied to measure indices such as right ventricular hypertrophy (RVH), hematocrit, pulmonary vascular resistance (PVR), vessel morphology and biomechanics. We implemented microfocal X-ray computed tomography to image the pulmonary arterial tree at intravascular pressures of 30, 21, 12, and 6 mmHg and then used automated vessel detection and measurement algorithms to perform morphological analysis and estimate the distensibility of the arterial tree. The vessel detection and measurement algorithms quickly and effectively mapped and measured the vascular trees at each intravascular pressure. Monocrotaline treatment, and the ensuing PH, resulted in a significantly decreased arterial distensibility, increased PVR, and tended to decrease the length of the main pulmonary trunk. In rats with PH induced by monocrotaline, Captopril treatment significantly increased arterial distensibility and decrease PVR. NAC treatment did not result in an improvement, it did not significantly increase distensibility and resulted in further increase in PVR. Interestingly, NAC tended to increase peripheral vascular density. The results suggest that arterial distensibility may be more important than distal collateral pathways in maintaining PVR at normally low values.

Substance P prevents development of proliferative vitreoretinopathy in mice by modulating TNF-α

PubMed Central

Yoo, Kyungsang; Son, Bo Kwon; Kim, Suna; Son, Youngsook; Yu, Seung-Young

2017-01-01

Purpose Proliferative vitreoretinopathy (PVR) is an inflammatory fibrotic disease resulting from the inflammatory milieu after retinal detachment, which can prevent retinal healing. This study aimed to elucidate the effect of substance P (SP) on retinal degeneration caused by retinal detachment in vivo and to examine the role of SP in the tumor necrosis factor-alpha (TNF-α)-induced epithelial-mesenchymal transition (EMT) of human RPE cells in vitro. Methods PVR-like retinal damage was induced by intravitreally injecting dispase into mice, and SP was systemically injected twice a week for 3 weeks. Histological analysis and cytokine profile with enzyme-linked immunosorbent assay (ELISA) were performed. The direct effect of SP on induction of EMT in vitro was studied by adding SP to TNF-α-treated ARPE-19 cells and then evaluating the change in the characteristics of the epithelial and mesenchymal cells. Results Dispase injection led to a PVR-like retinal condition, demonstrating an inflammatory response with disruption of RPE interaction within 1 week and severe destruction with enfolding within 3 weeks after the dispase injection. The inflammatory environment promoted apoptosis and migration of fibroblast-like cells in the retinal layer, which can cause fibrotic disease, such as PVR. However, SP treatment suppressed early inflammatory responses by reducing TNF-α and elevating interleukin-10 (IL-10), with cell death and the appearance of fibroblastic cells inhibited and the progression of retinal degeneration obviously delayed. Moreover, SP ameliorated TNF-α-induced EMT of the RPE and directly prevented fibrotic change in the RPE. Conclusions This study revealed that SP can block apoptosis and EMT due to retinal inflammation and inhibit the development of PVR. This effect most likely occurred by modulating the secretion and action of TNF-α.. PMID:29296073

15-PGDH/15-KETE plays a role in hypoxia-induced pulmonary vascular remodeling through ERK1/2-dependent PAR-2 pathway.

PubMed

Wei, Liuping; Yu, Xiufeng; Shi, Hengyuan; Zhang, Bo; Lian, Mingming; Li, Jing; Shen, Tingting; Xing, Yan; Zhu, Daling

2014-07-01

We have established that 15-hydroxyeicosatetraenoic acid is an important factor in regulation of pulmonary vascular remodeling (PVR) associated with hypoxia-induced pulmonary hypertension (PH), which is further metabolized by 15-hydroxyprostaglandin dehydrogenase (15-PGDH) to form 15-ketoeicosatetraenoic acid (15-KETE). However, the role of 15-PGDH and 15-KETE on PH has not been identified. The purpose of this study was to investigate whether 15-PGDH/15-KETE pathway regulates hypoxia-induced PVR in PH and to characterize the underlying mechanisms. To accomplish this, Immunohistochemistry, Ultra Performance Liquid Chromatography, Western blot, bromodeoxyuridine incorporation and cell cycle analysis were preformed. Our results showed that the levels of 15-PGDH expression and endogenous 15-KETE were drastically elevated in the lungs of humans with PH and hypoxic PH rats. Hypoxia stimulated pulmonary arterial smooth muscle cell (PASMC) proliferation, which seemed to be due to the increased 15-PGDH/15-KETE. 15-PGDH/15-KETE pathway was also capable of stimulating the cell cycle progression and promoting the cell cycle-related protein expression. Furthermore, 15-KETE-promoted cell cycle progression and proliferation in PASMCs depended on protease-activated receptor 2 (PAR-2). ERK1/2 signaling was likely required for 15-PGDH/15-KETE-induced PAR-2 expression under hypoxia. Our study indicates that 15-PGDH/15-KETE stimulates the cell cycle progression and proliferation of PASMCs involving ERK1/2-mediated PAR-2 expression, and contributes to hypoxia-induced PVR. Copyright © 2014 Elsevier Inc. All rights reserved.

The Midterm Outcomes of Bioprosthetic Pulmonary Valve Replacement in Children.

PubMed

Shinkawa, Takeshi; Lu, Chiajung K; Chipman, Carl; Tang, Xinyu; Gossett, Jeffrey M; Imamura, Michiaki

2015-01-01

The purpose of this study was to assess the outcomes of bioprosthetic pulmonary valve replacement (PVR) in children. This is a retrospective review of all bioprosthetic PVR in children (≤ 20-year old) between 1992 and 2013 at a single institution. Most outcomes studied included pulmonary valve reintervention and bioprosthetic valve function. A total of 136 bioprosthetic PVRs were identified for 123 patients. The median age and body weight at the time of operation were 13.2 years and 48.4 kg. There were 1 early death and 3 late deaths during the median follow-up of 7.2 years (0-22.0 years). The actuarial transplant-free survival was 97.6% at 10 years. There were 43 bioprosthesis reinterventions with 29 reoperations and 14 catheter-based interventions. The freedom from bioprosthesis reintervention was 89.6% and 55.0% at 5 and 10 years, respectively. Echocardiographic bioprosthesis dysfunction (≥ moderate bioprosthesis insufficiency, ≥ 50 mmHg peak gradient through bioprosthesis, or bioprosthesis endocarditis with vegetation) was found in 57 bioprostheses. The freedom from bioprosthesis dysfunction was 74.0% and 32.8% at 5 and 10 years, respectively. Results from the Cox proportional hazards models showed that age had significant association with freedom from bioprosthesis reintervention and freedom from bioprosthesis dysfunction (P < 0.001 and P = 0.03), whereas bioprosthesis type had nonsignificant association with freedom from bioprosthesis dysfunction (P = 0.068). Bioprosthetic PVR in children had excellent early outcomes but rapidly deteriorating midterm outcomes. Careful and close follow-up are necessary for children with bioprosthesis in the pulmonary position. Copyright © 2015 Elsevier Inc. All rights reserved.

Cardiovascular function in women with recurrent miscarriage, pre-eclampsia and/or intrauterine growth restriction.

PubMed

Mahendru, Amita A; Everett, Thomas R; McEniery, Carmel M; Wilkinson, Ian B; Lees, Christoph C

2013-03-01

To investigate prepregnancy cardiovascular function and risk factors in women with previous pregnancy complications. Thirty-four women with previous normal pregnancy (controls), 26 with unexplained recurrent miscarriage (RM) and 14 with pre-eclampsia (PE) and/or intrauterine growth restriction (IUGR), planning to conceive were recruited. Brachial and central blood pressures (BP), cardiac output (CO), peripheral vascular resistance (PVR), aortic stiffness, blood biochemistry and platelet aggregation were assessed. Women with previous PE/IUGR had higher brachial diastolic BP (78 ± 9 vs 71 ± 7 mmHg; p = 0.03), central systolic BP (107 ± 10 vs 99 ± 8 mmHg; p = 0.03), mean arterial pressure (92 ± 10 vs 84 ± 8 mmHg; p = 0.01) and PVR (1499 ± 300 vs 1250 ± 220 dynes.s(-1) cm(-5); p = 0.005), than the controls. No differences were observed in either cardiovascular function or blood biochemistry in women with unexplained RM compared with the controls. Women with previous PE/IUGR though not with RM had a stronger family history of cardiovascular disease (CVD) than controls. Women with previous PE and/or IUGR had higher BP and PVR compared with controls, which may predispose them to CVD later in life. However, in the absence of underlying vascular pathology, women with unexplained RM did not have abnormal cardiovascular function. Prepregnancy period provides an opportunity to identify cardiovascular risks in relation to previous obstetric history.

Four-year durability of clinical and haemodynamic outcomes of transcatheter aortic valve implantation with the self-expanding CoreValve.

PubMed

Gulino, Simona; Barbanti, Marco; Deste, Wanda; Immè, Sebastiano; Aruta, Patrizia; Bottari, Vera; Benvenuto, Emanuele; Tamburino, Claudia; Di Landro, Alessio; Liberto, Daria; Santonoceto, Letizia; Sicuso, Rita; Di Stefano, Daniele; Todaro, Denise; Di Simone, Emanuela; Indelicato, Antonino; Giannazzo, Daniela; Sgroi, Carmelo; Tamburino, Corrado

2016-10-10

Long-term data on the durability of currently available transcatheter heart valves are limited. We sought to assess four-year clinical and echocardiographic outcomes in patients undergoing transcatheter aortic valve implantation (TAVI) with the CoreValve prosthesis. Between June 2007 and February 2014, 450 consecutive patients with symptomatic severe aortic stenosis underwent TAVI in our institution. For the purposes of this study, we included only those patients undergoing successful TAVI with the CoreValve prosthesis who had a minimum follow-up of four years (n=125). Survival rates at one, two, three and four years were 83.2, 76.8, 73.6 and 66.3%, respectively. Aortic regurgitation was a common finding after the procedure, especially due to paravalvular regurgitation (PVR), which was observed in the majority of patients (71.5%), mostly mild (52.0%). Progression from mild acute PVR to moderate PVR at four-year follow-up was reported in three patients. No cases of severe PVR were observed. Prosthetic valve failure was reported in four patients (3.2%). Our study demonstrates that favourable outcomes after successful TAVI are associated with sustained clinical and functional cardiovascular benefits up to four-year follow-up. Signs of moderate prosthetic valve failure are present only in a small percentage of patients.

Ankle-Brachial Index, Toe-Brachial Index, and Pulse Volume Recording in Healthy Young Adults

PubMed Central

Masaki, Hisao; Yunoki, Yasuhiro; Tabuchi, Atushi; Morita, Ichiro; Mohri, Satoshi; Tanemoto, Kazuo

2015-01-01

Objective: To clarify the characteristics of ankle-brachial index (ABI), toe-brachial index (TBI), and pulse volume recording (PVR) of the ankle with brachial-ankle pulse wave velocity (baPWV) in healthy young adults. Material and Methods: We analyzed ABI, TBI, baPWV, and PVR in the ankle of healthy adults aged 20 to 25 years (median, 20 years) using an automatic oscillometric device between 2002 and 2013. The ABI, baPWV, and PVR in 1282 legs of 641 subjects (301 men and 340 women) and the TBI in 474 toes of 237 subjects (117 men and 120 women) were evaluated. Results: The measured values showed no bilateral differences. ABI and baPWV were higher in men than in women, but TBI was similar in both sexes. ABI <1.0 was observed in 18.1% of the legs in men and in 25.6% in women. TBI <0.7 was observed in 16.2% of the toes in men and 19.1% in women. For ankle PVR, the % mean arterial pressure was higher in women than in men. The upstroke time was <180 ms in most subjects. Conclusions: For young people, ABI <1.0 or TBI <0.7 may not always indicate vascular abnormalities. When evaluating circulatory indexes, age and sex should be considered. PMID:26421072

Effect of Biodegradable Scleral Plugs Containing Curcumin on Proliferative Vitreoretinopathy.

PubMed

Zhang, Jun; Zhou, Nalei; Zhang, Bin; Ma, Jingxue

2018-01-01

This study aimed to explore the inhibitory effect of biodegradable scleral plugs containing curcumin on rabbits with proliferative vitreoretinopathy (PVR). The biodegradable scleral plugs containing curcumin were prepared by dissolving PLGA [poly(lactide-co-glycolide)] and curcumin. In total, 30 rabbits were divided into 2 groups: the model group received a vitreous injection of self-blood, and the treatment group received a vitreous injection of self-blood plus biodegradable scleral implants containing 1.5 mg of curcumin. On days 1, 3, 7, 14, 21, and 28 after the operation, clinical observations and PVR classifications were performed. Then, after vitreous samples were collected, different cytokines were detected using antibody chip technology. The scleral plug was 5 mm in length and 1 mm in diameter. Clinical observation showed marked inflammation in the model group. The development grade of PVR in the treatment group was lower than that in the model group (p < 0.05). The outcome of antibody chip technology showed that the expression levels of IL-1α, IL-1β, IL-8, leptin, MMP-9, NCAM, and TNF-α in the treatment group at different time points were significantly lower than those in the model group (p < 0.05). Curcumin might have great potential as a therapeutic agent for PVR by inhibiting various inflammatory factors. © 2017 S. Karger AG, Basel.

Annexin A2 in Proliferative Vitreoretinopathy

DTIC Science & Technology

2017-10-01

cells , leading to formation of an epiretinal membrane, retinal detachment, and loss of vision. At present, there are no reliable means of...type versus annexin A2- deficient mice, [2] define the role of A2 in the function of activated macrophages and RPE cells in PVR, and [3] examine the...expression is needed in both macrophages and RPE cells , and that A2 is extensively expressed within cells of epiretinal membranes in human PVR. Our

Development of medical treatment for eye injuries in the mainland of China over the past decade.

PubMed

Wang, Chang-Guan; Ma, Zhi-Zhong

2016-12-01

In the article, the development of medical treatment for eye injuries in the mainland of China was reviewed. According to the data provided in Eye Injury Vitrectomy Study (EIVS), 27% of 72 eyes with no light perception (NLP) gained recovery in term of antomy and visual function. Vitrectomy initiated at more than 4 weeks after open eye injury is an independent risk factor for developing PVR. Prognosis of anatomy and visual function of the injured eye with PVR is markedly worse than that without PVR. Serious injuries of ciliary body, choroid and retina are three key parts of the eye with NLP. The concept that the treatment of the eye injury gradually focus on the whole globe is embodied. The data from 13575 in patients with traumatic eyes in 14 hospitals revealed that the rate of immediate enucleation was remarkable reduced with comparison of 20 years ago.

Observation and measurement of negative differential resistance on PtSi Schottky junctions on porous silicon.

PubMed

Banihashemian, Seyedeh Maryam; Hajghassem, Hassan; Erfanian, Alireza; Aliahmadi, Majidreza; Mohtashamifar, Mansor; Mosakazemi, Seyed Mohamadhosein

2010-01-01

Nanosize porous Si is made by two step controlled etching of Si. The first etching step is carried on the Si surface and the second is performed after deposition of 75 Å of platinum on the formed surface. A platinum silicide structure with a size of less than 25 nm is formed on the porous Si surface, as measured with an Atomic Forced Microscope (AFM). Differential resistance curve as a function of voltage in 77 K and 100 K shows a negative differential resistance and indicates the effect of quantum tunneling. In general form, the ratio of maximum to minimum tunneling current (PVR) and the number of peaks in I-V curves reduces by increasing the temperature. However, due to accumulation of carriers behind the potential barrier and superposition of several peaks, it is observed that the PVR increases at 100 K and the maximum PVR at 100 K is 189.6.

Echocardiographic Assessment of Pulmonary Arterial Hypertension for Pediatricians and Neonatologists.

PubMed

Skinner, Gregory James

2017-01-01

There is a growing awareness of the role that increased pulmonary vascular resistance (PVR) plays in many pathologies; therefore, assessment of pulmonary artery pressure (PAP) is an increasingly requested investigation in the critical care environment. This article will go through the basic concepts regarding PAP and PVR, then will go on to outline the various echocardiographic parameters which are used to assess them. Finally, an outline of how to undertake this assessment will be presented.

Effects of various timings and concentrations of inhaled nitric oxide in lung ischemia-reperfusion. The Paris-Sud University Lung Transplantation Group.

PubMed

Murakami, S; Bacha, E A; Mazmanian, G M; Détruit, H; Chapelier, A; Dartevelle, P; Hervé, P

1997-08-01

Experimental studies reveal that inhaled nitric oxide (NO) can prevent, worsen, or have no effect on lung injury in the setting of ischemia-reperfusion (I-R). We tested the hypothesis that these disparate effects could be related to differences in the timing of administration and/or concentration of inhaled NO during I-R. Isolated rat lungs were subjected to 1-h periods of ischemia followed by 1-h periods of blood reperfusion. We investigated the effects of NO (30 ppm) given during ischemia, NO (30 or 80 ppm) begun immediately at reperfusion, or NO (30 ppm) given 15 min after the beginning of reperfusion, on total pulmonary vascular resistance (PVR), the coefficient of filtration (Kfc), the lung wet/dry weight ratio (W/D) of lung tissue, and lung myeloperoxidase activity (MPO). A control group did not receive NO. NO given during ischemia had no effect on Kfc or MPO, but decreased PVR. NO (30 ppm) during reperfusion (early or delayed) decreased PVR, W/D, Kfc and MPO. NO at 80 ppm decreased PVR and MPO but not W/D or Kfc. In conclusion, NO at 30 ppm, given immediately or in a delayed fashion during reperfusion, attenuates I-R-induced lung injury. NO at 30 ppm given during ischemia or at 80 ppm during reperfusion is not protective.

"Pulmonary valve replacement diminishes the presence of restrictive physiology and reduces atrial volumes": a prospective study in Tetralogy of Fallot patients.

PubMed

Pijuan-Domenech, Antonia; Pineda, Victor; Castro, Miguel Angel; Sureda-Barbosa, Carlos; Ribera, Aida; Cruz, Luz M; Ferreira-Gonzalez, Ignacio; Dos-Subirà, Laura; Subirana-Domènech, Teresa; Garcia-Dorado, David; Casaldàliga-Ferrer, Jaume

2014-11-15

Pulmonary valve replacement (PVR) reduces right ventricular (RV) volumes in the setting of long-term pulmonary regurgitation after Tetralogy of Fallot (ToF) repair; however, little is known of its effect on RV diastolic function. Right atrial volumes may reflect the burden of RV diastolic dysfunction. The objective of this paper is to evaluate the clinical, echocardiographic, biochemical and cardiac magnetic resonance (CMR) variables, focusing particularly on right atrial response and right ventricular diastolic function prior to and after elective PVR in adult patients with ToF. This prospective study was conducted from January 2009 to April 2013 in consecutive patients > 18 years of age who had undergone ToF repair in childhood and were accepted for elective PVR. Twenty patients (mean age: 35 years; 70% men) agreed to enter the study. PVR was performed with a bioporcine prosthesis. Concomitant RV reduction was performed in all cases when technically possible. Pulmonary end-diastolic forward flow (EDFF) decreased significantly from 5.4 ml/m(2) to 0.3 ml/m(2) (p < 0.00001), and right atrial four-chamber echocardiographic measurements and volumes by 25% (p = 0.0024): mean indexed diastolic/systolic atrial volumes prior to surgery were 43 ml/m(2) (SD+/-4.6)/63 ml/m(2) (SD+/-5.5), and dropped to 33 ml/m(2) (SD+/-3)/46 ml/m(2) (SD+/-2.55) post-surgery. All patients presented right ventricular diastolic and systolic volume reductions, with a mean volume reduction of 35% (p < 0.00001). Right ventricular diastolic dysfunction was common in a population of severely dilated RV patients long term after ToF repair. Right ventricular diastolic parameters improved as did right atrial volumes in keeping with the known reduction in RV volumes, after PVR. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Practical determination of aortic valve calcium volume score on contrast-enhanced computed tomography prior to transcatheter aortic valve replacement and impact on paravalvular regurgitation: Elucidating optimal threshold cutoffs.

PubMed

Bettinger, Nicolas; Khalique, Omar K; Krepp, Joseph M; Hamid, Nadira B; Bae, David J; Pulerwitz, Todd C; Liao, Ming; Hahn, Rebecca T; Vahl, Torsten P; Nazif, Tamim M; George, Isaac; Leon, Martin B; Einstein, Andrew J; Kodali, Susheel K

The threshold for the optimal computed tomography (CT) number in Hounsfield Units (HU) to quantify aortic valvular calcium on contrast-enhanced scans has not been standardized. Our aim was to find the most accurate threshold to predict paravalvular regurgitation (PVR) after transcatheter aortic valve replacement (TAVR). 104 patients who underwent TAVR with the CoreValve prosthesis were studied retrospectively. Luminal attenuation (LA) in HU was measured at the level of the aortic annulus. Calcium volume score for the aortic valvular complex was measured using 6 threshold cutoffs (650 HU, 850 HU, LA × 1.25, LA × 1.5, LA+50, LA+100). Receiver-operating characteristic (ROC) analysis was performed to assess the predictive value for > mild PVR (n = 16). Multivariable analysis was performed to determine the accuracy to predict > mild PVR after adjustment for depth and perimeter oversizing. ROC analysis showed lower area under the curve (AUC) values for fixed threshold cutoffs (650 or 850 HU) compared to thresholds relative to LA. The LA+100 threshold had the highest AUC (0.81), and AUC was higher than all studied protocols, other than the LA x 1.25 and LA + 50 protocols, where the difference approached statistical significance (p = 0.05, and 0.068, respectively). Multivariable analysis showed calcium volume determined by the LAx1.25, LAx1.5, LA+50, and LA+ 100 HU protocols to independently predict PVR. Calcium volume scoring thresholds which are relative to LA are more predictive of PVR post-TAVR than those which use fixed cutoffs. A threshold of LA+100 HU had the highest predictive value. Copyright © 2017 Society of Cardiovascular Computed Tomography. Published by Elsevier Inc. All rights reserved.

Static cardiomyoplasty with synthetic elastic net suppresses ventricular dilatation and dysfunction after myocardial infarction in the rat: a chronic study.

PubMed

Kato, Nobusuke; Kawaguchi, Akira T; Kishida, Akio; Yamaoka, Tetsuji

2013-07-01

Although static cardiomyoplasty prevents the left ventricle (LV) from dilatation, it may interfere with diastolic relaxation, or cause restriction. We developed a synthetic net with dual elasticity and tested its effect late after myocardial infarction in the rat. LV pressure-volume relationships (PVR) were successively analyzed before, after intravenous volume load, and 10 minutes after occlusion of the left anterior descending artery. Rats were then randomized into groups receiving synthetic net wrapping around the heart (NET+, n = 8) and only partially behind LV (NET-, n = 9), and they underwent the same PVR studies 6 weeks later. End-diastolic and end-systolic PVR were defined, and LV size and function were compared under standardized loading conditions. Although there was no difference in Day 0, increase in LV end-diastolic and end-systolic volumes were significantly attenuated in NET+ rats 6 weeks later when there was a significant correlation between LV volumes by PVR estimation and actual measurements, with significant differences in both measures between the groups: NET+ < NET-. The presence or absence of net did not show restrictive hemodynamics under acute volume load. Static cardiomyoplasty using a synthetic elastic net significantly attenuated LV dilatation and dysfunction without restriction late after myocardial infarction in the rat. © 2013, Copyright the Authors. Artificial Organs © 2013, International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

Transjugular portal vein recanalization with creation of intrahepatic portosystemic shunt (PVR-TIPS) in patients with chronic non-cirrhotic, non-malignant portal vein thrombosis.

PubMed

Klinger, Christoph; Riecken, Bettina; Schmidt, Arthur; De Gottardi, Andrea; Meier, Benjamin; Bosch, Jaime; Caca, Karel

2018-03-01

To determine safety and efficacy of transjugular portal vein recanalization with creation of intrahepatic portosystemic shunt (PVR-TIPS) in patients with chronic non-cirrhotic, non-malignant portal vein thrombosis (PVT). This retrospective study includes 17 consecutive patients with chronic non-cirrhotic PVT (cavernous transformation n = 15). PVR-TIPS was indicated because of variceal bleeding (n = 13), refractory ascites (n = 2), portal biliopathy with recurrent cholangitis (n = 1), or abdominal pain (n = 1). Treatment consisted of a combination of transjugular balloon angioplasty, mechanical thrombectomy, and-depending on extent of residual thrombosis-transjugular intrahepatic portosystemic shunt and additional stenting of the portal venous system. Recanalization was successful in 76.5 % of patients despite cavernous transformation in 88.2 %. Both 1- and 2-year secondary PV and TIPS patency rates were 69.5 %. Procedure-related bleeding complications occurred in 2 patients (intraperitoneal bleeding due to capsule perforation, n = 1; liver hematoma, n = 1) and resolved spontaneously. However, 1 patient died due to subsequent nosocomial pneumonia. During follow-up, 3 patients with TIPS occlusion and PVT recurrence experienced portal hypertensive complications. PVR-TIPS is safe and effective in selected patients with chronic non-cirrhotic PVT. Due to technical complexity and possible complications, it should be performed only in specialized centers with high experience in TIPS procedures. © Georg Thieme Verlag KG Stuttgart · New York.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ullrich, C. A.; Kohn, W.

An electron density distribution n(r) which can be represented by that of a single-determinant ground state of noninteracting electrons in an external potential v(r) is called pure-state v -representable (P-VR). Most physical electronic systems are P-VR. Systems which require a weighted sum of several such determinants to represent their density are called ensemble v -representable (E-VR). This paper develops formal Kohn-Sham equations for E-VR physical systems, using the appropriate coupling constant integration. It also derives local density- and generalized gradient approximations, and conditions and corrections specific to ensembles.

Determinants of exercise-induced pulmonary arterial hypertension in systemic sclerosis.

PubMed

Voilliot, Damien; Magne, Julien; Dulgheru, Raluca; Kou, Seisyou; Henri, Christine; Laaraibi, Saloua; Sprynger, Muriel; Andre, Béatrice; Pierard, Luc A; Lancellotti, Patrizio

2014-05-15

Exercise-induced pulmonary arterial hypertension (EIPH) in systemic sclerosis (SSc) has already been observed but its determinants remain unclear. The aim of this study was to determine the incidence and the determinants of EIPH in SSc. We prospectively enrolled 63 patients with SSc (age 54±3years, 76% female) followed in CHU Sart-Tilman in Liège. All patients underwent graded semi-supine exercise echocardiography. Systolic pulmonary arterial pressure (sPAP) was derived from the peak velocity of the tricuspid regurgitation jet and adding the estimation of right atrial pressure, both at rest and during exercise. Resting pulmonary arterial hypertension (PH) was defined as sPAP > 35 mmHg and EIPH as sPAP > 50 mmHg during exercise. The following formulas were used: mean PAP (mPAP) = 0.61 × sPAP + 2, left atrial pressure (LAP)=1.9+1.24 × left ventricular (LV) E/e' and pulmonary vascular resistance (PVR)=(mPAP-LAP)/LV cardiac output (CO) and slope of mPAP-LVCO relationship=changes in mPAP/changes in LVCO. Resting PH was present in 3 patients (7%) and 21 patients developed EIPH (47%). Patients with EIPH had higher resting LAP (10.3 ± 2.2 versus 8.8 ± 2.3 mmHg; p = 0.03), resting PVR (2.6 ± 0.8 vs. 1.4 ± 1.1 Woods units; p=0.004), exercise LAP (13.3 ± 2.3 vs. 9 ± 1.7 mmHg; p < 0.0001), exercise PVR (3.6 ± 0.7 vs. 2.1 ± 0.9 Woods units; p = 0.02) and slope of mPAP-LVCO (5.8 ± 2.4 vs. 2.9 ± 2.1 mmHg/L/min; p < 0.0001). After adjustment for age and gender, exercise LAP (β=3.1 ± 0.8; p=0.001) and exercise PVR (β=7.9 ± 1.7; p=0.0001) were independent determinants of exercise sPAP. EIPH is frequent in SSc patients and is mainly related to both increased exercise LV filling pressure and exercise PVR. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Should Tricuspid Annuloplasty be Performed With Pulmonary Valve Replacement for Pulmonary Regurgitation in Repaired Tetralogy of Fallot?

PubMed

Kurkluoglu, Mustafa; John, Anitha S; Cross, Russell; Chung, David; Yerebakan, Can; Zurakowski, David; Jonas, Richard A; Sinha, Pranava

2015-01-01

Indications for prophylactic tricuspid annuloplasty in patients with pulmonary regurgitation (PR) after tetralogy of Fallot (TOF) repair are unclear and often extrapolated from acquired functional tricuspid regurgitation (TR) data in adults, where despite correction of primary left heart pathology, progressive tricuspid annular dilation is noted beyond a threshold diameter >4 cm (21 mm/m(2)). We hypothesized that unlike in adult functional TR, in pure volume-overload conditions such as patients with PR after TOF, the tricuspid valve size is likely to regress after pulmonary valve replacement (PVR). A total of 43 consecutive patients who underwent PVR from 2005 until 2012 at a single institution were retrospectively reviewed. Absolute and indexed tricuspid annulus diameters (TADs), tricuspid annulus Z-scores, grade of TR along with right ventricular size, and function indices were recorded before and after PVR. Preoperative and postoperative echocardiographic data were available in all patients. A higher tricuspid valve Z-score correlated with greater TR both preoperatively (P = 0.005) and postoperatively (P = 0.02). Overall reductions in the absolute and indexed TAD and tricuspid valve Z-scores were seen postoperatively, with greater absolute as well as percentage reduction seen with larger preoperative TAD index (P = 0.007) and higher tricuspid annulus Z-scores (P = 0.06). In pure volume-overload conditions such as patients with PR after TOF, reduction in the tricuspid valve size is seen after PVR. Concomitant tricuspid annuloplasty should not be considered based on tricuspid annular dilation alone. Copyright © 2015 Elsevier Inc. All rights reserved.

Trichome density of main stem is tightly linked to PepMoV resistance in chili pepper (Capsicum annuum L.).

PubMed

Kim, Hyun Jung; Han, Jung-Heon; Kim, Seungill; Lee, Heung Ryul; Shin, Jun-Sung; Kim, Jeong-Ho; Cho, Juok; Kim, Young Ho; Lee, Hee Jae; Kim, Byung-Dong; Choi, Doil

2011-04-01

A relationship between pepper trichome and pepper mottle virus (PepMoV) resistance was examined. In an intraspecific F(2) mapping population from the cross between Capsicum annuum CM334 (trichome-bearing and PepMoV resistant) and Chilsungcho (glabrous and PepMoV susceptible), major QTLs for both traits were identified by composite interval mapping in linkage group (LG) 24 corresponding a telomere region on pepper chromosome 10. Ptel1 of putative trichome enhancing locus was a common major QTL for trichome density on the main stem and calyx. Ptel1 apart from HpmsE031 at a 1.03 cM interval was specifically associated to the trichome density on the main stem, whereas Ptel2 near m104 marker on LG2 was specific for the calyx trichome. Epistatic analysis indicated that Ptel1 engaged in controlling the trichome density by mutual interactions with the organ-specific QTLs. For PepMoV resistance, two QTLs (Pep1 and Pep2) were identified on the LG 24. Pep1 was located with Ptel1 in the R-gene cluster (RGC) for potyvirus resistance including Pvr4 with broad spectrum resistance to potyviruses. Pep1 flanking TG420 marker seemed to be the major factors determining correlation with PepMoV resistance. These results indicate that the level of trichome density on pepper main stem can be used as a morphological marker for Pvr4 in pepper breeding.

A compliant, banded outflow cannula for decreased afterload sensitivity of rotary right ventricular assist devices.

PubMed

Gregory, Shaun D; Schummy, Emma; Pearcy, Mark; Pauls, Jo P; Tansley, Geoff; Fraser, John F; Timms, Daniel

2015-02-01

Biventricular support with dual rotary ventricular assist devices (VADs) has been implemented clinically with restriction of the right VAD (RVAD) outflow cannula to artificially increase afterload and, therefore, operate within recommended design speed ranges. However, the low preload and high afterload sensitivity of these devices increase the susceptibility of suction events. Active control systems are prone to sensor drift or inaccurate inferred (sensor-less) data, therefore an alternative solution may be of benefit. This study presents the in vitro evaluation of a compliant outflow cannula designed to passively decrease the afterload sensitivity of rotary RVADs and minimize left-sided suction events. A one-way fluid-structure interaction model was initially used to produce a design with suitable flow dynamics and radial deformation. The resultant geometry was cast with different initial cross-sectional restrictions and concentrations of a softening diluent before evaluation in a mock circulation loop. Pulmonary vascular resistance (PVR) was increased from 50 dyne s/cm(5) until left-sided suction events occurred with each compliant cannula and a rigid, 4.5 mm diameter outflow cannula for comparison. Early suction events (PVR ∼ 300 dyne s/cm(5) ) were observed with the rigid outflow cannula. Addition of the compliant section with an initial 3 mm diameter restriction and 10% diluent expanded the outflow restriction as PVR increased, thus increasing RVAD flow rate and preventing left-sided suction events at PVR levels beyond 1000 dyne s/cm(5) . Therefore, the compliant, restricted outflow cannula provided a passive control system to assist in the prevention of suction events with rotary biventricular support while maintaining pump speeds within normal ranges of operation. Copyright © 2014 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

Sustained Improvement in Right Ventricular Chamber Dimensions 10 Years Following Xenograft Pulmonary Valve Replacement.

PubMed

Schubmehl, Heidi B; Swartz, Michael F; Atallah-Yunes, Nader; Wittlieb-Weber, Carol; Pratt, Rebecca E; Alfieris, George M

2017-01-01

The goals following pulmonary valve replacement (PVR) are to optimize right ventricular hemodynamics and minimize the need for subsequent reoperations on the right ventricular outflow tract. We hypothesized PVR using a xenograft valved conduit would result in superior freedom from reoperation with sustained improvement in right ventricular chamber dimensions. Xenograft valved conduits placed in patients aged >16 years were reviewed from 2000 to 2010 to allow for a 5-year minimum follow-up. Preoperative, one-year, and the most recent echocardiograms quantified right ventricular chamber dimensions, corresponding Z scores, and prosthetic valve function. Magnetic resonance imaging (MRI) studies compared preoperative and follow-up right ventricular volumes. A total of 100 patients underwent PVR at 24 (19-34) years. Freedom from reintervention was 100% at 10 years. At most recent follow-up, only one patient had greater than mild pulmonary insufficiency. The one-year (17.3 ± 7.2 mm Hg; P < .01) and most recent follow-up (18.6 ± 9.8 mm Hg; P < .01) Doppler-derived right ventricular outflow tract gradients remained significantly lower than preoperative measurements (36.7 ± 27.0 mm Hg). Similarly, right ventricular basal diameter, basal longitudinal diameter, and the corresponding Z scores remained lower at one year and follow-up from preoperative measurements. From 34 MRI studies, the right ventricular end-diastolic indexed volume (161.7 ± 58.5 vs 102.9 ± 38.3; P < .01) and pulmonary regurgitant fraction (38.0% ± 15.9% vs 0.8% ± 3.3%; P < .01) were significantly lower at 7.1 ± 3.4 years compared to the preoperative levels. Use of a xenograft valved conduit for PVR results in excellent freedom from reoperation with sustained improvement in right ventricular dimensions at an intermediate-term follow-up.

Balloon pulmonary angioplasty relieves haemodynamic stress towards untreated-side pulmonary vasculature and improves its resistance in patients with chronic thromboembolic pulmonary hypertension.

PubMed

Hosokawa, Kazuya; Abe, Kohtaro; Horimoto, Koshin; Yamasaki, Yuzo; Nagao, Michinobu; Tsutsui, Hiroyuki

2018-04-20

Chronic thromboembolic pulmonary hypertension (CTEPH) is characterised by organised thrombotic obliteration of major vessels and small-vessel arteriopathy in the non-thrombosed vessels. The aim of this study was to investigate the impact of balloon pulmonary angioplasty (BPA) on the non-BPA-side pulmonary vasculature in patients with CTEPH. This study explored the outcomes of 20 unilateral BPA sessions in 13 CTEPH patients. We measured the pulmonary vascular resistance (PVR), pulmonary artery (PA) flow in the BPA-side and non-BPA-side lungs, respectively, using phase contrast MRI and cardiac catheterisation. The interval from BPA to the follow-up evaluation was 92.8±52.0 days. A single session of BPA decreased mean PA pressure from 37.4±6.2 to 30.9±6.5 mmHg (p<0.001). In the BPA side, BPA increased the PA flow from 1.58±0.65 to 1.95±0.62 L/min (p=0.001) and decreased the PVR from 27.3±27.4 to 14.4±9.0 Wood units (p=0.004). In contrast, it decreased both the non-BPA-side PA flow from 2.25±0.64 to 1.90±0.23 L/min (p=0.008) and the non-BPA-side PVR from 14.8±6.6 to 12.8±3.9 Wood units (p=0.01). BPA could relieve haemodynamic stress towards the non-BPA-side vasculature and decrease its PVR in patients with CTEPH, suggesting that it can suppress or regress the progression of the small-vessel arteriopathy in non-BPA-side vasculature, presumably due to haemodynamic unloading.

Cranberry fruit powder (Flowens™) improves lower urinary tract symptoms in men: a double-blind, randomized, placebo-controlled study.

PubMed

Vidlar, Ales; Student, Vladimir; Vostalova, Jitka; Fromentin, Emilie; Roller, Marc; Simanek, Vilím; Student, Vladimir

2016-03-01

Lower urinary tract symptoms (LUTS) and benign prostatic hyperplasia increase with age. To date, several medications are available to treat LUTS, including herbal remedies which offer less side effects but lack robust efficacy studies. This 6-month, randomized, double-blind, placebo-controlled study aimed at evaluating the dose effect of 250 or 500 mg cranberry powder (Flowens™) on LUTS and uroflowmetry in men over the age of 45. A total of 124 volunteers with PSA levels <2.5 ng/mL and an international prostate symptoms score (IPSS) score ≥8 were recruited and randomized. The primary outcome measure was the IPSS, evaluated at 3 and 6 months. Secondary outcome measures included quality of life, bladder volume (Vol), maximum urinary flow rate (Q max), average urinary flow rate (Q ave), ultrasound-estimated post-void residual urine volume (PVR), serum prostate-specific antigen, selenium, interleukin 6, and C-reactive protein at 6 months. After 6 months, subjects in both Flowens™ groups had a lower IPSS (-3.1 and -4.1 in the 250- and 500-mg groups, p = 0.05 and p < 0.001, respectively) versus the placebo group (-1.5), and a dose-response effect was observed. There were significant differences in Q max, Q ave, PVR, and Vol in the Flowens™ 500-mg group versus baseline (p < 0.05). A dose-dependent effect on Vol was observed, as well as on PVR, for participants with a nonzero PVR. There was no effect on clinical chemistry or hematology markers. Flowens™ showed a clinically relevant, dose-dependent, and significant reduction in LUTS in men over 45.

Matrix metalloproteinases and their natural inhibitors in fibrovascular membranes of proliferative diabetic retinopathy

PubMed Central

Salzmann, J.; Limb, G; Khaw, P.; Gregor, Z.; Webster, L.; Chignell, A.; Charteris, D.

2000-01-01

AIM—To examine epiretinal membranes of proliferative diabetic retinopathy (PDR) for the presence of selective matrix metalloproteinases (MMPs) and their natural inhibitors (TIMPs), in order to determine whether neovascularisation and fibrosis, characteristic of this complication of diabetes mellitus, are associated with specific anomalies of MMP or TIMP expression.
METHODS—The presence of selected MMPs and TIMPs was investigated in 24 fibrovascular epiretinal membranes of PDR, and the findings compared with that observed in 21 avascular epiretinal membranes of proliferative vitreoretinopathy (PVR) and five normal retinas. Specimens were examined for deposition of interstitial collagenase (MMP-1), stromelysin-1 (MMP-3), gelatinase A (MMP-2), gelatinase B (MMP-9), and three tissue inhibitors of metalloproteinases (TIMP-1, TIMP-2, and TIMP-3).
RESULTS—The results showed that unlike normal retina, which constitutively expresses MMP-1 and TIMP-2, a large proportion of PDR membranes (> 62%) stained for MMP-1, MMP-2, MMP-3, MMP-9, TIMP-1, TIMP-2, and TIMP-3. There were no differences in the expression of these molecules when compared with PVR membranes. A characteristic staining for MMP-9 was observed within the perivascular matrix of PDR membranes, and there was a significant increase in TIMP-2 expression by PDR membranes (p= 0.036) when compared with PVR membranes.
CONCLUSIONS—The findings that MMPs involved in degradation of fibrovascular tissue matrix, as well as TIMP-1 and TIMP-2, are found in a large proportion of PDR membranes, and that their expression does not differ from that of PVR membranes, suggest the existence of common pathways of extracellular matrix degradation in pathological processes leading to retinal neovascularisation and fibrosis.

 PMID:11004090

Outcomes of intradetrusor onabotulinum toxin A injection in patients with Parkinson's disease.

PubMed

Vurture, Gregory; Peyronnet, Benoit; Feigin, Andrew; Biagioni, Milton C; Gilbert, Rebecca; Rosenblum, Nirit; Frucht, Steven; Di Rocco, Alessandro; Nitti, Victor W; Brucker, Benjamin M

2018-05-16

To assess the safety and efficacy of intradetrusor onabotulinum toxin A injections for the treatment of overactive bladder (OAB) in patients with Parkinson's disease (PD). All PD patients who underwent intradetrusor injections of onabotulinum toxin A (BoNT-A) for storage symptoms between 2010 and 2017 were included in a retrospective study. A 100 U dose of BoNT-A (Botox®, Allergan Irvine, CA) was used for the first injection in all patients. The primary endpoint was clinical success defined as any subjective improvement in OAB symptoms self-assessed by the patients 4 weeks after the injections. Out of 24 patients analyzed, 19 reported improvement of their OAB symptoms 4 weeks after the first injection (79.2%) with complete resolution of urgency urinary incontinence in seven patients (29.1%; P < 0.001). The average post-void residual (PVR) increased significantly after the first injection from 17.6 to 125.3 mL (P < 0.001). Three of the patients had to start clean intermittent catheterization (CIC) after the first injection (12.5%). Out of 49 injections in total, only five caused incomplete bladder emptying requiring the use of CIC (10.2%). Higher pre-injection PVR was significantly associated with both a lower chance of symptomatic improvement (P = 0.04) and a higher risk of incomplete bladder emptying with institution of CIC (P = 0.047). Intradetrusor injections of BoNT-A 100 U appeared as a safe and effective option in PD patients with OAB symptoms and a low PVR before the injection. Higher preoperative PVR was the strongest predictor of both treatment failure and postoperative urinary retention requiring CIC. © 2018 Wiley Periodicals, Inc.

Pulmonary vascular response to exercise in symptomatic heart failure with reduced ejection fraction and pulmonary hypertension.

PubMed

Verbrugge, Frederik H; Dupont, Matthias; Bertrand, Philippe B; Nijst, Petra; Grieten, Lars; Dens, Joseph; Verhaert, David; Janssens, Stefan; Tang, W H Wilson; Mullens, Wilfried

2015-03-01

To study pulmonary vascular response patterns to exercise in heart failure with reduced ejection fraction (HFrEF) and pulmonary hypertension (PH). In this prospective single-centre cohort study, consecutive symptomatic HFrEF patients (n = 40) with mean pulmonary arterial pressure (MPAP) ≥25 mmHg, pulmonary artery wedge pressure (PAWP) >15 mmHg, and cardiac index <2.5 L/min.m(2) , received protocol-driven titrated sodium nitroprusside (SNP) and diuretics to reach mean arterial blood pressure 65-75 mmHg and PAWP ≤15 mmHg. Patients performed symptom-limited supine bicycle testing under continued SNP administration. Afterwards, SNP was gradually withdrawn, renin-angiotensin system blockers uptitrated, and hydralazine added to maintain haemodynamic targets. Subsequently, bicycle testing was repeated. Patients presented with pulmonary vascular resistance (PVR) = 3.8 ± 1.4 Wood Units at rest, decreasing to 2.9 ± 0.9 Wood Units after decongestion, with PH was completely reversed (MPAP <25 mmHg) in 22%. From rest to maximal exercise, the cardiac index did not change significantly (P = 0.334 under SNP; P-value = 0.552 under oral therapy). A dynamic exercise-induced PVR increase >3.5 Wood Units was noted in 19 patients (48%) under oral therapy vs. five (13%) under SNP. Such exercise-induced PVR increase was associated with a 33% relative decrease in right ventricular stroke work index (P = 0.037). Even after thorough decongestion and under continuous afterload reduction, PH secondary to HFrEF is completely reversible in only a minority of patients. Others demonstrate an exercise-induced PVR increase, associated with impaired right ventricular stroke work, which might be ameliorated by nitric oxide donor support. © 2014 The Authors. European Journal of Heart Failure © 2014 European Society of Cardiology.

Quantitative analysis of poliomyelitis-like paralysis in mice induced by a poliovirus replicon.

PubMed

Arita, Minetaro; Nagata, Noriyo; Sata, Tetsutaro; Miyamura, Tatsuo; Shimizu, Hiroyuki

2006-11-01

Poliovirus (PV) infection causes severe paralysis, typically of the legs, by destruction of the motor neurons in the spinal cord. In this study, the relationship between PV replication in the spinal cord, damage in the motor neurons and poliomyelitis-like paralysis was analysed in transgenic mice expressing the human PV receptor (TgPVR21). First, a PV replicon encoding firefly luciferase in place of the capsid genes (PV-Fluc mc) was trans-encapsidated in 293T cells and the trans-encapsidated PV-Fluc mc (TE-PV-Fluc mc) was then inoculated into the spinal cords of TgPVR21 mice. TE-PV-Fluc mc was recovered with a titre of 6.3 x 10(7) infectious units ml(-1), which was comparable to those of PV1 strains. TgPVR21 mice inoculated with TE-PV-Fluc mc showed non-lethal paralysis of the hindlimbs, with severity ranging from a decline in grip strength to complete flaccid paralysis. The replication of TE-PV-Fluc mc in the spinal cord reached peak levels at 10 h post-inoculation (p.i.), followed by the appearance of paralysis at as early as 12 h p.i., reaching a plateau at 16 h p.i. Histological analysis showed a correlation between the lesion and the severity of the clinical symptoms in most mice. However, severe paralysis could also be observed with an apparently low lesion score, where as few as 5.3 x 10(2) motor neurons (1.4 % of the susceptible cells in the lumbar cord) were infected by TE-PV-Fluc mc. These results indicate that PV replication in a small population of the motor neurons was critical for severe residual poliomyelitis-like paralysis in TgPVR21 mice.

The therapeutic potential of royal jelly in benign prostatic hyperplasia. Comparison with contemporary literature.

PubMed

Pajovic, Bogdan; Radojevic, Nemanja; Dimitrovski, Antonio; Tomovic, Savo; Vukovic, Marko

2016-09-01

The aim of this study is to establish the scientific benefit of royal jelly (RJ) on prostatic-specific antigen (PSA), post-void residual (PVR) volume and International Prostate Symptom Score (IPSS) in benign prostatic hyperplasia. For the study, a group of 40 men were administered 38 mg of RJ over a period of three months, their PSA values, prostate volumes and the volumes of their transitory prostate zones, PVR and IPPS values were measured at the end of the first month, and at the end of the third month. The results of this study confirm the potential of RJ in reducing PSA scores and improving IPSS values. Since the use of RJ did not lead to any significant reduction in PVR, prostate volume, or to any involution of the transitory zone, it appears that it may only affect the blood marker of prostatic hyperplasia and to improve quality-of-life (QoL) in those patients. Overall, in comparison to phytotherapy and conventional therapy, RJ had similar positive effects on QoL in patients with BPH, however it exhibited markedly better effects on reducing PSA levels in blood. The therapeutical use of RJ exhibited no side effects.

Parental attitudes regarding behavior guidance of dental patients with autism.

PubMed

Marshall, Jennifer; Sheller, Barbara; Mancl, Lloyd; Williams, Bryan J

2008-01-01

The purposes of this study were to evaluate: (1) parents' ability to predict dental treatment cooperation by their autistic child; (2) behavior guidance techniques (BGTs) used during treatment; and (3) parental attitudes regarding basic and advanced BGTs. Data were collected from 85 parent/autistic child pairs and their dentists using surveys and treatment records. Parents most accurately predicted if their child would permit an examination in the dental chair (> or = 88%) and would cooperate for radiographs (> or = 84%). BGTs utilized most often (> 50%) were positive verbal reinforcement (PVR), tell-show-do (TSD), mouthprops, and rewards. In general, basic BGTs were more acceptable (> 81%) than advanced BGTs (>54%). The most acceptable techniques (>90%) in order were: PVR, TSD, distraction, rewards, general anesthesia, hand-holding by parent, and mouth-props. When parents evaluated only BGTs used for their child, all BGTs, including a stabilization device, were highly acceptable (> 91%), except for staff restraint (74%). Parents were accurate in predicting cooperation for some procedures. The most acceptable and efficacious BGTs in order were: PVR, TSD, distraction, rewards, and hand-holding by parent. Parental perceptions of BGTs were influenced by whether or not they had been used for their child.

Role of macrophage migration inhibitory factor (MIF) in the effects of oxidative stress on human retinal pigment epithelial cells.

PubMed

Ko, Ji-Ae; Sotani, Yasuyuki; Ibrahim, Diah Gemala; Kiuchi, Yoshiaki

2017-10-01

Proliferative vitreoretinopathy (PVR) is the major cause of treatment failure in individuals who undergo surgery for retinal detachment. The epithelial-mesenchymal transition (EMT) in retinal pigment epithelium (RPE) cells contributes to the pathogenesis of PVR. Oxidative stress is thought to play a role in the progression of retinal diseases including PVR. We have now examined the effects of oxidative stress on the EMT and related processes in the human RPE cell line. We found that H 2 O 2 induced the contraction of RPE cells in a three-dimensional collagen gel. Analysis of a cytokine array revealed that H 2 O 2 specifically increased the release of macrophage migration inhibitory factor (MIF) from RPE cells. Reverse transcription-polymerase chain reaction and immunoblot analyses showed that H 2 O 2 increased the expression of MIF in RPE cells. Immunoblot and immunofluorescence analyses revealed that H 2 O 2 upregulated the expression of α-SMA and vimentin and downregulated that of ZO-1 and N-cadherin. Consistent with these observations, the transepithelial electrical resistance of cell was reduced by exposure to H 2 O 2 . The effects of oxidative stress on EMT-related and junctional protein expression as well as on transepithelial electrical resistance were inhibited by antibodies to MIF, but they were not mimicked by treatment with recombinant MIF. Finally, analysis with a profiling array for mitogen-activated protein kinase signalling revealed that H 2 O 2 specifically induced the phosphorylation of p38 mitogen-activated protein kinase. Our results thus suggest that MIF may play a role in induction of the EMT and related processes by oxidative stress in RPE cells and that it might thereby contribute to the pathogenesis of PVR. Proliferative vitreoretinopathy is a major complication of rhegmatogenous retinal detachment, and both oxidative stress and induction of the EMT in RPE cells are thought to contribute to the pathogenesis of this condition. We have now examined the effects of oxidative stress on the EMT and related processes in the human RPE cell line ARPE19. Our results thus implicate MIF in induction of the EMT and related processes by oxidative stress in RPE cells and the regulated expression of EMT markers. They further suggest that MIF may play an important role in the pathogenesis of PVR. Copyright © 2017 John Wiley & Sons, Ltd.

Effect of Increased Blood Flow on Pulmonary Circulation Before and During High Altitude Acclimatization.

PubMed

Hilty, Matthias Peter; Müller, Andrea; Flück, Daniela; Siebenmann, Christoph; Rasmussen, Peter; Keiser, Stefanie; Auinger, Katja; Lundby, Carsten; Maggiorini, Marco

2016-12-01

Matthias Peter Hilty, Andrea Mueller, Daniela Flück, Christoph Siebenmann, Peter Rasmussen, Stefanie Keiser, Katja Auinger, Carsten Lundby, and Marco Maggiorini. Effect of increased blood flow on the pulmonary circulation before and during high altitude acclimatization. High Alt Med Biol. 17:305-314, 2016.-Introduction and Methods: Acute exposure to high altitude increases pulmonary artery pressure (Ppa) and pulmonary vascular resistance (PVR). The evolution of Ppa and PVR with continuous hypoxic exposure remains, however, elusive. To test the hypothesis that altitude exposure leads to a persistent elevation in Ppa and PVR throughout acclimatization in seven healthy male subjects, echocardiography was performed at sea level (SL; 488 m) weekly during a 4-week sojourn at 3454 m (HA1-HA4) and upon return (SL2). Pulmonary artery catheterization and bilateral thigh cuff release maneuver were performed at SL and HA3 to study the properties of pulmonary circulation after 3 weeks of acclimatization. Pulmonary artery catheter determined that systolic Ppa (mean ± SEM) was increased from 20 ± 1 at SL to 27 ± 2 mmHg at HA3 (p < 0.01). Echocardiography assessed that systolic Ppa remained equally increased throughout acclimatization (26 ± 2, 25 ± 2, 25 ± 2, and 24 ± 2 mmHg at HA1-HA4; p = 0.93) and returned to baseline upon return (17 ± 2, 18 ± 1 mmHg at SL, SL2; p = 0.3). The same was shown for PVR. Right heart function remained unaffected. Thigh cuff release maneuvers at SL and HA3 resulted in similar increase in cardiac output (2.5 ± 0.5 and 2.2 ± 0.4 L/min; p = 0.61) without affecting mean Ppa. Prolonged altitude exposure leads to a persistent increase in Ppa and PVR without affecting right heart function and is fully reversible within 1 week after return to SL. The thigh cuff release maneuver-induced increase in cardiac output suggests a preserved ability of pulmonary circulation to cope with sudden remarkable increase in pulmonary blood flow throughout acclimatization.

Combined prostatic urethral lift and remodeling of the prostate and bladder neck: a modified transurethral approach in the treatment of symptomatic lower urinary tract obstruction.

PubMed

Schoenthaler, Martin; Sievert, Karl-Dietrich; Schoeb, Dominik Stefan; Miernik, Arkadiusz; Kunit, Thomas; Hein, Simon; Herrmann, Thomas R W; Wilhelm, Konrad

2018-02-15

The aim of the study was to evaluate the feasibility and safety of combining prostatic urethral lift (PUL) and a limited resection of the prostatic middle lobe or bladder neck incision in the treatment of lower urinary tract symptoms (LUTS) secondary to benign prostatic hyperplasia (BPH). Twenty-eight patients were treated at two tertiary centers and followed prospectively. Patient evaluations included patient characteristics, relief of LUTS symptoms, erectile and ejaculatory function, continence, operative time and adverse events. Patients were followed for a mean of 10.9 months. Patient characteristics were as follows: age 66 years (46-85), prostate volume 39.6 cc (22-66), preoperative IPSS/AUASI 20 (6-35)/QoL 3.9 (1-6)/peak flow 10.5 mL/s (4.0-19)/post-void residual volume (PVR) 123 mL (0-500). Mean operating time was 31 min (9-55). Postoperative complications were minor except for the surgical retreatment of one patient for blood clot retention (Clavien 3b). One patient required catheterization due to urinary retention. Reduction of symptoms (IPSS - 59.6%), increase in QoL (+ 49.0%), increase in flow (+ 111.5%), and reduction of PVR (- 66.8%) were significant. Antegrade ejaculation was always maintained. Our data suggest that a combination of PUL and transurethral surgical techniques is feasible, safe, and effective. This approach may be offered to patients with moderate size prostates including those with unfavorable anatomic conditions for PUL. This procedure is still 'minimally invasive' and preserves sexual function. In addition, it may add to a higher functional efficacy compared to PUL alone. DRKS00008970.

Image-Based Patient-Specific Ventricle Models with Fluid-Structure Interaction for Cardiac Function Assessment and Surgical Design Optimization

PubMed Central

Tang, Dalin; Yang, Chun; Geva, Tal; del Nido, Pedro J.

2010-01-01

Recent advances in medical imaging technology and computational modeling techniques are making it possible that patient-specific computational ventricle models be constructed and used to test surgical hypotheses and replace empirical and often risky clinical experimentation to examine the efficiency and suitability of various reconstructive procedures in diseased hearts. In this paper, we provide a brief review on recent development in ventricle modeling and its potential application in surgical planning and management of tetralogy of Fallot (ToF) patients. Aspects of data acquisition, model selection and construction, tissue material properties, ventricle layer structure and tissue fiber orientations, pressure condition, model validation and virtual surgery procedures (changing patient-specific ventricle data and perform computer simulation) were reviewed. Results from a case study using patient-specific cardiac magnetic resonance (CMR) imaging and right/left ventricle and patch (RV/LV/Patch) combination model with fluid-structure interactions (FSI) were reported. The models were used to evaluate and optimize human pulmonary valve replacement/insertion (PVR) surgical procedure and patch design and test a surgical hypothesis that PVR with small patch and aggressive scar tissue trimming in PVR surgery may lead to improved recovery of RV function and reduced stress/strain conditions in the patch area. PMID:21344066

Pirfenidone inhibits post-traumatic proliferative vitreoretinopathy.

PubMed

Khanum, B N M K; Guha, R; Sur, V P; Nandi, S; Basak, S K; Konar, A; Hazra, S

2017-09-01

PurposeThe purpose of the study was to evaluate the efficacy and safety of intravitreal pirfenidone for inhibition of proliferative vitreoretinopathy (PVR) in a model of penetrating ocular injury.Patients and methodsPenetrating trauma was induced on the retina of rabbit and treated either with 0.1 ml of phosphate-buffered saline (PBS) or 0.1 ml of 0.5% pirfenidone, and development of PVR was evaluated clinically and graded after 1 month. Histopathology and immunohistochemistry with transforming growth factor beta (TGFβ), alpha smooth muscle actin (αSMA), and collagen-1 were performed to assess the fibrotic changes. Expression of cytokines in the vitro-retinal tissues at different time points following pirfenidone and PBS injection was examined by RT-PCR. Availability of pirfenidone in the vitreous of rabbit at various time points was determined by high-performance liquid chromatography following injection of 0.1 ml of 0.5% pirfenidone. In normal rabbit eye, 0.1 ml of 0.5% pirfenidone was injected to evaluate any toxic effect.ResultsClinical assessment and grading revealed prevention of PVR formation in pirfenidone-treated animals, gross histology, and histopathology confirmed the observation. Immunohistochemistry showed prevention in the expression of collagen-I, αSMA, and TGFβ in the pirfenidone-treated eyes compared to the PBS-treated eyes. Pirfenidone inhibited increased gene expression of cytokines observed in control eyes. Pirfenidone could be detected up to 48 h in the vitreous of rabbit eye following single intravitreal injection. Pirfenidone did not show any adverse effect following intravitreal injection; eyes were devoid of any abnormal clinical sign, intraocular pressure, and electroretinography did not show any significant change and histology of retina remained unchanged.ConclusionThis animal study shows that pirfenidone might be a potential therapy for PVR. Further clinical study will be useful to evaluate the clinical application of pirfenidone.

A randomized, controlled, double-blind crossover study on the effects of 1-L infusions of 6% hydroxyethyl starch suspended in 0.9% saline (voluven) and a balanced solution (Plasma Volume Redibag) on blood volume, renal blood flow velocity, and renal cortical tissue perfusion in healthy volunteers.

PubMed

Chowdhury, Abeed H; Cox, Eleanor F; Francis, Susan T; Lobo, Dileep N

2014-05-01

We compared the effects of intravenous administration of 6% hydroxyethyl starch (maize-derived) in 0.9% saline (Voluven; Fresenius Kabi, Runcorn, United Kingdom) and a "balanced" preparation of 6% hydroxyethyl starch (potato-derived) [Plasma Volume Redibag (PVR); Baxter Healthcare, Thetford, United Kingdom] on renal blood flow velocity and renal cortical tissue perfusion in humans using magnetic resonance imaging. Hyperchloremia resulting from 0.9% saline infusion may adversely affect renal hemodynamics when compared with balanced crystalloids. This phenomenon has not been studied with colloids. Twelve healthy adult male subjects received 1-L intravenous infusions of Voluven or PVR over 30 minutes in a randomized, double-blind manner, with crossover studies 7 to 10 days later. Magnetic resonance imaging proceeded for 60 minutes after commencement of infusion to measure renal artery blood flow velocity and renal cortical perfusion. Blood was sampled, and weight was recorded at 0, 30, 60, 120, 180, and 240 minutes. Mean peak serum chloride concentrations were 108 and 106 mmol/L, respectively, after Voluven and PVR infusion (P = 0.032). Changes in blood volume (P = 0.867), strong ion difference (P = 0.219), and mean renal artery flow velocity (P = 0.319) were similar. However, there was a significant increase in mean renal cortical tissue perfusion after PVR when compared with Voluven (P = 0.033). There was no difference in urinary neutrophil gelatinase-associated liopcalin to creatinine ratios after the infusion (P = 0.164). There was no difference in the blood volume-expanding properties of the 2 preparations of 6% hydroxyethyl starch. The balanced starch produced an increase in renal cortical tissue perfusion, a phenomenon not seen with starch in 0.9% saline.

Inhaled carbon monoxide does not cause pulmonary vasodilation in the late-gestation fetal lamb.

PubMed

Grover, T R; Rairigh, R L; Zenge, J P; Abman, S H; Kinsella, J P

2000-04-01

As observed with nitric oxide (NO), carbon monoxide (CO) binds and may activate soluble guanylate cyclase and increase cGMP levels in smooth muscle cells in vitro. Because inhaled NO (I(NO)) causes potent and sustained pulmonary vasodilation, we hypothesized that inhaled CO (I(CO)) may have similar effects on the perinatal lung. To determine whether I(CO) can lower pulmonary vascular resistance (PVR) during the perinatal period, we studied the effects of I(CO) on late-gestation fetal lambs. Catheters were placed in the main pulmonary artery, left pulmonary artery (LPA), aorta, and left atrium to measure pressure. An ultrasonic flow transducer was placed on the LPA to measure blood flow to the left lung. After baseline measurements, fetal lambs were mechanically ventilated with a hypoxic gas mixture (inspired O(2) fraction < 0.10) to maintain a constant fetal arterial PO(2). After 60 min (baseline), the lambs were treated with I(CO) [5-2,500 parts/million (ppm)]. Comparisons were made with I(NO) (5 and 20 ppm) and combined I(NO) (5 ppm) and I(CO) (100 and 2,500 ppm). We found that I(CO) did not alter left lung blood flow or PVR at any of the study doses. In contrast, low-dose I(NO) decreased PVR by 47% (P < 0.005). The combination of I(NO) and I(CO) did not enhance the vasodilator response to I(NO). To determine whether endogenous CO contributes to vascular tone in the fetal lung, zinc protoporphyrin IX, an inhibitor of heme oxygenase, was infused into the LPA in three lambs. Zinc protoporphyrin IX had no effect on baseline PVR, aortic pressure, or the pressure gradient across the ductus arteriosus. We conclude that I(CO) does not cause vasodilation in the near-term ovine transitional circulation, and endogenous CO does not contribute significantly to baseline pulmonary vascular tone or ductus arteriosus tone in the late-gestation ovine fetus.

Nectin-like interactions between poliovirus and its receptor trigger conformational changes associated with cell entry.

PubMed

Strauss, Mike; Filman, David J; Belnap, David M; Cheng, Naiqian; Noel, Roane T; Hogle, James M

2015-04-01

Poliovirus infection is initiated by attachment to a receptor on the cell surface called Pvr or CD155. At physiological temperatures, the receptor catalyzes an irreversible expansion of the virus to form an expanded form of the capsid called the 135S particle. This expansion results in the externalization of the myristoylated capsid protein VP4 and the N-terminal extension of the capsid protein VP1, both of which become inserted into the cell membrane. Structures of the expanded forms of poliovirus and of several related viruses have recently been reported. However, until now, it has been unclear how receptor binding triggers viral expansion at physiological temperature. Here, we report poliovirus in complex with an enzymatically partially deglycosylated form of the 3-domain ectodomain of Pvr at a 4-Å resolution, as determined by cryo-electron microscopy. The interaction of the receptor with the virus in this structure is reminiscent of the interactions of Pvr with its natural ligands. At a low temperature, the receptor induces very few changes in the structure of the virus, with the largest changes occurring within the footprint of the receptor, and in a loop of the internal protein VP4. Changes in the vicinity of the receptor include the displacement of a natural lipid ligand (called "pocket factor"), demonstrating that the loss of this ligand, alone, is not sufficient to induce particle expansion. Finally, analogies with naturally occurring ligand binding in the nectin family suggest which specific structural rearrangements in the virus-receptor complex could help to trigger the irreversible expansion of the capsid. The cell-surface receptor (Pvr) catalyzes a large structural change in the virus that exposes membrane-binding protein chains. We fitted known atomic models of the virus and Pvr into three-dimensional experimental maps of the receptor-virus complex. The molecular interactions we see between poliovirus and its receptor are reminiscent of the nectin family, by involving the burying of otherwise-exposed hydrophobic groups. Importantly, poliovirus expansion is regulated by the binding of a lipid molecule within the viral capsid. We show that receptor binding either causes this molecule to be expelled or requires it, but that its loss is not sufficient to trigger irreversible expansion. Based on our model, we propose testable hypotheses to explain how the viral shell becomes destabilized, leading to RNA uncoating. These findings give us a better understanding of how poliovirus has evolved to exploit a natural process of its host to penetrate the membrane barrier. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Nectin-Like Interactions between Poliovirus and Its Receptor Trigger Conformational Changes Associated with Cell Entry

PubMed Central

Strauss, Mike; Filman, David J.; Belnap, David M.; Cheng, Naiqian; Noel, Roane T.

2015-01-01

ABSTRACT Poliovirus infection is initiated by attachment to a receptor on the cell surface called Pvr or CD155. At physiological temperatures, the receptor catalyzes an irreversible expansion of the virus to form an expanded form of the capsid called the 135S particle. This expansion results in the externalization of the myristoylated capsid protein VP4 and the N-terminal extension of the capsid protein VP1, both of which become inserted into the cell membrane. Structures of the expanded forms of poliovirus and of several related viruses have recently been reported. However, until now, it has been unclear how receptor binding triggers viral expansion at physiological temperature. Here, we report poliovirus in complex with an enzymatically partially deglycosylated form of the 3-domain ectodomain of Pvr at a 4-Å resolution, as determined by cryo-electron microscopy. The interaction of the receptor with the virus in this structure is reminiscent of the interactions of Pvr with its natural ligands. At a low temperature, the receptor induces very few changes in the structure of the virus, with the largest changes occurring within the footprint of the receptor, and in a loop of the internal protein VP4. Changes in the vicinity of the receptor include the displacement of a natural lipid ligand (called “pocket factor”), demonstrating that the loss of this ligand, alone, is not sufficient to induce particle expansion. Finally, analogies with naturally occurring ligand binding in the nectin family suggest which specific structural rearrangements in the virus-receptor complex could help to trigger the irreversible expansion of the capsid. IMPORTANCE The cell-surface receptor (Pvr) catalyzes a large structural change in the virus that exposes membrane-binding protein chains. We fitted known atomic models of the virus and Pvr into three-dimensional experimental maps of the receptor-virus complex. The molecular interactions we see between poliovirus and its receptor are reminiscent of the nectin family, by involving the burying of otherwise-exposed hydrophobic groups. Importantly, poliovirus expansion is regulated by the binding of a lipid molecule within the viral capsid. We show that receptor binding either causes this molecule to be expelled or requires it, but that its loss is not sufficient to trigger irreversible expansion. Based on our model, we propose testable hypotheses to explain how the viral shell becomes destabilized, leading to RNA uncoating. These findings give us a better understanding of how poliovirus has evolved to exploit a natural process of its host to penetrate the membrane barrier. PMID:25631086

Pulmonary vascular dysfunction in ARDS

PubMed Central

2014-01-01

Acute respiratory distress syndrome (ARDS) is characterised by diffuse alveolar damage and is frequently complicated by pulmonary hypertension (PH). Multiple factors may contribute to the development of PH in this setting. In this review, we report the results of a systematic search of the available peer-reviewed literature for papers that measured indices of pulmonary haemodynamics in patients with ARDS and reported on mortality in the period 1977 to 2010. There were marked differences between studies, with some reporting strong associations between elevated pulmonary arterial pressure or elevated pulmonary vascular resistance and mortality, whereas others found no such association. In order to discuss the potential reasons for these discrepancies, we review the physiological concepts underlying the measurement of pulmonary haemodynamics and highlight key differences between the concepts of resistance in the pulmonary and systemic circulations. We consider the factors that influence pulmonary arterial pressure, both in normal lungs and in the presence of ARDS, including the important effects of mechanical ventilation. Pulmonary arterial pressure, pulmonary vascular resistance and transpulmonary gradient (TPG) depend not alone on the intrinsic properties of the pulmonary vascular bed but are also strongly influenced by cardiac output, airway pressures and lung volumes. The great variability in management strategies within and between studies means that no unified analysis of these papers was possible. Uniquely, Bull et al. (Am J Respir Crit Care Med 182:1123–1128, 2010) have recently reported that elevated pulmonary vascular resistance (PVR) and TPG were independently associated with increased mortality in ARDS, in a large trial with protocol-defined management strategies and using lung-protective ventilation. We then considered the existing literature to determine whether the relationship between PVR/TPG and outcome might be causal. Although we could identify potential mechanisms for such a link, the existing evidence does not allow firm conclusions to be drawn. Nonetheless, abnormally elevated PVR/TPG may provide a useful index of disease severity and progression. Further studies are required to understand the role and importance of pulmonary vascular dysfunction in ARDS in the era of lung-protective ventilation. PMID:25593744

Chronic urinary retention in men: how we define it, and how does it affect treatment outcome.

PubMed

Negro, Carlo L A; Muir, Gordon H

2012-12-01

What's known on the subject? and What does the study add? Chronic urinary retention (CUR) is a poorly defined entity, as the key element of definition, significant postvoid residual urine volume (PVR), has not a worldwide and moreover evidenced-based definition. There is no agreement on which is the threshold value to define a significant PVR and different society produced guidelines with different thresholds ranging from 300 mL to 1000 mL. Diagnosis is difficult, and management has not been defined yet. There is a lack of studies on the best management of these patients, as this group of patients has always been considered at high risk of failure. Only one study compares conservative with the surgical management but it is not a randomised controlled trail. This review offers a systematic appraisal of the most recent publications on CUR. It indicates the absence of a real worldwide agreed definition, as the two keys element of it are not satisfactorily defined yet: significant PVR, is suffering from a lack of evidenced-based definition, and percussable or palpable bladder is a very nebulous concept as it is not a criteria of certainty as different individual variables affect it. This has an important effect on management which is not structured. Most of the trials involving benign prostatic hyperplasia treatments (either medical or surgical) tend to exclude this group of patients, which is a clinically important group, comprising up to a quarter of men undergoing TURP in the UK. Urinary retention describes a bladder that does not empty completely or does not empty at all. Historically, urinary retention has been classified as either acute or chronic the latter is generally classified as high pressure or low pressure according to the bladder filling pressure on urodynamic. A MEDLINE® search for articles written in English and published before January 2010 was done using a list of terms related to urinary retention: 'urinary retention', 'chronic urinary retention' and 'PVR'. Chronic urinary retention (CUR) is defined by the International Continence Society as 'a non-painful bladder, which remains palpable or percussable after the patient has passed urine'. Abrams was the first to choose a residual urine volume >300 mL to define CUR as he considered it the minimum volume at which the bladder becomes palpable suprapubically. The UK National Institute for Health and Clinical Excellence lower urinary tract symptoms (LUTS) guidelines define CUR as a postvoid residual urine volume (PVR) of >1000 mL. No studies have specifically addressed the problem of quantifying the minimum amount of urine present in the bladder to define CUR. Nor did we find any publications objectively assessing at what amount of urine a bladder can be palpable. The ability to feel a bladder may rely on variables (i.e. medical skills and patient habitus). There is a marked variability of PVR, so the test should be repeated to improve precision. As defining CUR is difficult, structured management is challenging. Nearly all prospective trials exclude men with CUR from analysis, possibly anticipating a poor outcome and a high risk of complications. However, men with CUR are a clinically important group, comprising up to 25% of men undergoing transurethral resection of the prostate. Definition of CUR is imprecise and arbitrary. Most studies seem to describe the condition as either a PVR of >300 mL in men who are voiding, or >1000 mL in men who are unable to void. This confusion leads to an inability to design and interpret studies; indeed most prospective trials simply exclude these patients. There is a clear need for internationally accepted definitions of retention to allow both treatment and reporting of outcomes in men with LUTS, and for such definitions to be used by all investigators in future trials. © 2012 BJU INTERNATIONAL.

Portable bladder ultrasound: an evidence-based analysis.

PubMed

2006-01-01

The aim of this review was to assess the clinical utility of portable bladder ultrasound. TARGET POPULATION AND CONDITION Data from the National Population Health Survey indicate prevalence rates of urinary incontinence are 2.5% in women and 1.4 % in men in the general population. Prevalence of urinary incontinence is higher in women than men and prevalence increases with age. Identified risk factors for urinary incontinence include female gender, increasing age, urinary tract infections (UTI), poor mobility, dementia, smoking, obesity, consuming alcohol and caffeine beverages, physical activity, pregnancy, childbirth, forceps and vacuum-assisted births, episiotomy, abdominal resection for colorectal cancer, and hormone replacement therapy. For the purposes of this review, incontinence populations will be stratified into the following; the elderly, urology patients, postoperative patients, rehabilitation settings, and neurogenic bladder populations. Urinary incontinence is defined as any involuntary leakage of urine. Incontinence can be classified into diagnostic clinical types that are useful in planning evaluation and treatment. The major types of incontinence are stress (physical exertion), urge (overactive bladder), mixed (combined urge and stress urinary incontinence), reflex (neurological impairment of the central nervous system), overflow (leakage due to full bladder), continuous (urinary tract abnormalities), congenital incontinence, and transient incontinence (temporary incontinence). Postvoid residual (PVR) urine volume, which is the amount of urine in the bladder immediately after urination, represents an important component in continence assessment and bladder management to provide quantitative feedback to the patient and continence care team regarding the effectiveness of the voiding technique. Although there is no standardized definition of normal PVR urine volume, measurements greater than 100 mL to 150 mL are considered an indication for urinary retention, requiring intermittent catheterization, whereas a PVR urine volume of 100 mL to 150 mL or less is generally considered an acceptable result of bladder training. Urinary retention has been associated with poor outcomes including UTI, bladder overdistension, and higher hospital mortality rates. The standard method of determining PVR urine volumes is intermittent catheterization, which is associated with increased risk of UTI, urethral trauma and discomfort. Portable bladder ultrasound products are transportable ultrasound devices that use automated technology to register bladder volume digitally, including PVR volume, and provide three-dimensional images of the bladder. The main clinical use of portable bladder ultrasound is as a diagnostic aid. Health care professionals (primarily nurses) administer the device to measure PVR volume and prevent unnecessary catheterization. An adjunctive use of the bladder ultrasound device is to visualize the placement and removal of catheters. Also, portable bladder ultrasound products may improve the diagnosis and differentiation of urological problems and their management and treatment, including the establishment of voiding schedules, study of bladder biofeedback, fewer UTIs, and monitoring of potential urinary incontinence after surgery or trauma. To determine the effectiveness and clinical utility of portable bladder ultrasound as reported in the published literature, the Medical Advisory Secretariat used its standard search strategy to retrieve international health technology assessments and English-language journal articles from selected databases. Nonsystematic reviews, nonhuman studies, case reports, letters, editorials, and comments were excluded. Of the 4 included studies that examined the clinical utility of portable bladder ultrasound in the elderly population, all found the device to be acceptable. One study reported that the device underestimated catheterized bladder volume In patients with urology problems, 2 of the 3 studies concerning portable bladder ultrasound found the device acceptable to use. However, one study did not find the device as accurate for small PVR volume as for catheterization and another found that the device overestimated catheterized bladder volume. In the remaining study, the authors reported that when the device's hand-held ultrasound transducers (scanheads) were aimed improperly, bladders were missed, or lateral borders of bladders were missed resulting in partial bladder volume measurements and underestimation of PVR measurements. They concluded that caution should be used in interpreting PVR volume measured by portable bladder ultrasound machines and that catheterization may be the preferred assessment modality if an accurate PVR measurement is necessary. All 3 studies with post-operative populations found portable bladder ultrasound use to be reasonably acceptable. Two studies reported that the device overestimated catheter-derived bladder volumes, one by 7% and the other by 21 mL. The third study reported the opposite, that the device underestimated catheter bladder volume by 39 mL but that the results remained acceptable In rehabilitation settings, 2 studies found portable bladder ultrasound to underestimate catheter-derived bladder volumes; yet, both authors concluded that the mean errors were within acceptable limits. In patients with neurogenic bladder problems, 2 studies found portable bladder ultrasound to be an acceptable alternative to catheterization despite the fact that it was not as accurate as catheterization for obtaining bladder volumes. Lastly, examinations concerning avoidance of negative health outcomes showed that, after use of the portable bladder ultrasound, unnecessary catheterizations and UTIs were decreased. Unnecessary catheterizations avoided ranged from 16% to 47% in the selected articles. Reductions in UTI ranged from 38% to 72%. In sum, all but one study advocated the use of portable bladder ultrasound as an alternative to catheterization. An economic analysis estimating the budget-impact of BladderScan in complex continuing care facilities was completed. The analysis results indicated a $192,499 (Cdn) cost-savings per year per facility and a cost-savings of $2,887,485 (Cdn) for all 15 CCC facilities. No economic analysis was completed for long-term care and acute care facilities due to lack of data. Rapid diffusion of portable bladder ultrasound technology is expected. Recently, the IC5 project on improving continence care in Ontario's complex continuing care centres piloted portable bladder ultrasound at 12 sites. Preliminary results were promising. Many physicians and health care facilities already have portable bladder ultrasound devices. However, portable bladder ultrasound devices for PVR measurement are not in use at most health care facilities in Ontario and Canada. The Verathon Corporation (Bothell, Wisconsin, United States), which patents BladderScan, is the sole licensed manufacturer of the portable bladder ultrasound in Canada. Field monopoly may influence the rising costs of portable bladder ultrasound, particularly when faced with rapid expansion of the technology. Several thousand residents of Ontario would benefit from portable bladder ultrasound. The number of residents of Ontario that would benefit from the technology is difficult to quantify, because the incidence and prevalence of incontinence are grossly under-reported. However, long-term care and complex continuing care institutions would benefit greatly from portable bladder ultrasound, as would numerous rehabilitation units, postsurgical care units, and urology clinics. The cost of the portable bladder ultrasound devices ranges from $17,698.90 to $19,565.95 (Cdn) (total purchase price per unit as quoted by the manufacturer). Additional training packages, batteries and battery chargers, software, gel pads, and yearly warranties are additional costs. Studies indicate that portable bladder ultrasound is a cost-effective technology, because it avoids costs associated with catheterization equipment, saves nursing time, and reduces catheter-related complications and UTIs. The use of portable bladder ultrasound device will affect the patient directly in terms of health outcomes. Its use avoids the trauma related to the urinary tract that catheterization inflicts, and does not result in UTIs. In addition, patients prefer it, because it preserves dignity and reduces discomfort.

Portable Bladder Ultrasound

PubMed Central

2006-01-01

Executive Summary Objective The aim of this review was to assess the clinical utility of portable bladder ultrasound. Clinical Need: Target Population and Condition Data from the National Population Health Survey indicate prevalence rates of urinary incontinence are 2.5% in women and 1.4 % in men in the general population. Prevalence of urinary incontinence is higher in women than men and prevalence increases with age. Identified risk factors for urinary incontinence include female gender, increasing age, urinary tract infections (UTI), poor mobility, dementia, smoking, obesity, consuming alcohol and caffeine beverages, physical activity, pregnancy, childbirth, forceps and vacuum-assisted births, episiotomy, abdominal resection for colorectal cancer, and hormone replacement therapy. For the purposes of this review, incontinence populations will be stratified into the following; the elderly, urology patients, postoperative patients, rehabilitation settings, and neurogenic bladder populations. Urinary incontinence is defined as any involuntary leakage of urine. Incontinence can be classified into diagnostic clinical types that are useful in planning evaluation and treatment. The major types of incontinence are stress (physical exertion), urge (overactive bladder), mixed (combined urge and stress urinary incontinence), reflex (neurological impairment of the central nervous system), overflow (leakage due to full bladder), continuous (urinary tract abnormalities), congenital incontinence, and transient incontinence (temporary incontinence). Postvoid residual (PVR) urine volume, which is the amount of urine in the bladder immediately after urination, represents an important component in continence assessment and bladder management to provide quantitative feedback to the patient and continence care team regarding the effectiveness of the voiding technique. Although there is no standardized definition of normal PVR urine volume, measurements greater than 100 mL to 150 mL are considered an indication for urinary retention, requiring intermittent catheterization, whereas a PVR urine volume of 100 mL to 150 mL or less is generally considered an acceptable result of bladder training. Urinary retention has been associated with poor outcomes including UTI, bladder overdistension, and higher hospital mortality rates. The standard method of determining PVR urine volumes is intermittent catheterization, which is associated with increased risk of UTI, urethral trauma and discomfort. The Technology Being Reviewed Portable bladder ultrasound products are transportable ultrasound devices that use automated technology to register bladder volume digitally, including PVR volume, and provide three-dimensional images of the bladder. The main clinical use of portable bladder ultrasound is as a diagnostic aid. Health care professionals (primarily nurses) administer the device to measure PVR volume and prevent unnecessary catheterization. An adjunctive use of the bladder ultrasound device is to visualize the placement and removal of catheters. Also, portable bladder ultrasound products may improve the diagnosis and differentiation of urological problems and their management and treatment, including the establishment of voiding schedules, study of bladder biofeedback, fewer UTIs, and monitoring of potential urinary incontinence after surgery or trauma. Review Strategy To determine the effectiveness and clinical utility of portable bladder ultrasound as reported in the published literature, the Medical Advisory Secretariat used its standard search strategy to retrieve international health technology assessments and English-language journal articles from selected databases. Nonsystematic reviews, nonhuman studies, case reports, letters, editorials, and comments were excluded. Summary of Findings Of the 4 included studies that examined the clinical utility of portable bladder ultrasound in the elderly population, all found the device to be acceptable. One study reported that the device underestimated catheterized bladder volume In patients with urology problems, 2 of the 3 studies concerning portable bladder ultrasound found the device acceptable to use. However, one study did not find the device as accurate for small PVR volume as for catheterization and another found that the device overestimated catheterized bladder volume. In the remaining study, the authors reported that when the device’s hand-held ultrasound transducers (scanheads) were aimed improperly, bladders were missed, or lateral borders of bladders were missed resulting in partial bladder volume measurements and underestimation of PVR measurements. They concluded that caution should be used in interpreting PVR volume measured by portable bladder ultrasound machines and that catheterization may be the preferred assessment modality if an accurate PVR measurement is necessary. All 3 studies with post-operative populations found portable bladder ultrasound use to be reasonably acceptable. Two studies reported that the device overestimated catheter-derived bladder volumes, one by 7% and the other by 21 mL. The third study reported the opposite, that the device underestimated catheter bladder volume by 39 mL but that the results remained acceptable In rehabilitation settings, 2 studies found portable bladder ultrasound to underestimate catheter-derived bladder volumes; yet, both authors concluded that the mean errors were within acceptable limits. In patients with neurogenic bladder problems, 2 studies found portable bladder ultrasound to be an acceptable alternative to catheterization despite the fact that it was not as accurate as catheterization for obtaining bladder volumes. Lastly, examinations concerning avoidance of negative health outcomes showed that, after use of the portable bladder ultrasound, unnecessary catheterizations and UTIs were decreased. Unnecessary catheterizations avoided ranged from 16% to 47% in the selected articles. Reductions in UTI ranged from 38% to 72%. In sum, all but one study advocated the use of portable bladder ultrasound as an alternative to catheterization. Economic Analysis An economic analysis estimating the budget-impact of BladderScan in complex continuing care facilities was completed. The analysis results indicated a $192,499 (Cdn) cost-savings per year per facility and a cost-savings of $2,887,485 (Cdn) for all 15 CCC facilities. No economic analysis was completed for long-term care and acute care facilities due to lack of data. Considerations for Policy Development Rapid diffusion of portable bladder ultrasound technology is expected. Recently, the IC5 project on improving continence care in Ontario’s complex continuing care centres piloted portable bladder ultrasound at 12 sites. Preliminary results were promising. Many physicians and health care facilities already have portable bladder ultrasound devices. However, portable bladder ultrasound devices for PVR measurement are not in use at most health care facilities in Ontario and Canada. The Verathon Corporation (Bothell, Wisconsin, United States), which patents BladderScan, is the sole licensed manufacturer of the portable bladder ultrasound in Canada. Field monopoly may influence the rising costs of portable bladder ultrasound, particularly when faced with rapid expansion of the technology. Several thousand residents of Ontario would benefit from portable bladder ultrasound. The number of residents of Ontario that would benefit from the technology is difficult to quantify, because the incidence and prevalence of incontinence are grossly under-reported. However, long-term care and complex continuing care institutions would benefit greatly from portable bladder ultrasound, as would numerous rehabilitation units, postsurgical care units, and urology clinics. The cost of the portable bladder ultrasound devices ranges from $17,698.90 to $19,565.95 (Cdn) (total purchase price per unit as quoted by the manufacturer). Additional training packages, batteries and battery chargers, software, gel pads, and yearly warranties are additional costs. Studies indicate that portable bladder ultrasound is a cost-effective technology, because it avoids costs associated with catheterization equipment, saves nursing time, and reduces catheter-related complications and UTIs. The use of portable bladder ultrasound device will affect the patient directly in terms of health outcomes. Its use avoids the trauma related to the urinary tract that catheterization inflicts, and does not result in UTIs. In addition, patients prefer it, because it preserves dignity and reduces discomfort. PMID:23074481

The effects of oxygen induced pulmonary vasoconstriction on bedside measurement of pulmonary gas exchange.

PubMed

Weinreich, Ulla M; Thomsen, Lars P; Rees, Stephen E; Rasmussen, Bodil S

2016-04-01

In patients with respiratory failure measurements of pulmonary gas exchange are of importance. The bedside automatic lung parameter estimator (ALPE) of pulmonary gas exchange is based on changes in inspired oxygen (FiO2) assuming that these changes do not affect pulmonary circulation. This assumption is investigated in this study. Forty-two out of 65 patients undergoing coronary artery bypass grafting (CABG) had measurements of mean pulmonary arterial pressure (MPAP), cardiac output and pulmonary capillary wedge pressure thus enabling the calculation of pulmonary vascular resistance (PVR) at each FiO2 level. The research version of ALPE was used and FiO2 was step-wise reduced a median of 0.20 and ultimately returned towards baseline values, allowing 6-8 min' steady state period at each of 4-6 levels before recording the oxygen saturation (SpO2). FiO2 reduction led to median decrease in SpO2 from 99 to 92 %, an increase in MPAP of 4 mmHg and an increase in PVR of 36 dyn s cm(-5). Changes were immediately reversed on returning FiO2 towards baseline. In this study changes in MPAP and PVR are small and immediately reversible consistent with small changes in pulmonary gas exchange. This indicates that mild deoxygenation induced pulmonary vasoconstriction does not have significant influences on the ALPE parameters in patients after CABG.

Tunable negative differential resistance in planar graphene superlattice resonant tunneling diode

NASA Astrophysics Data System (ADS)

Sattari-Esfahlan, S. M.; Fouladi-Oskuei, J.; Shojaei, S.

2017-04-01

Here, we study the negative differential resistance (NDR) of Dirac electrons in biased planar graphene superlattice (PGSL) and investigate the transport characteristics by adopted transfer matrix method within Landauer-Buttiker formalism. Our model device is based on one-dimensional Kronig-Penney type electrostatic potential in monolayer graphene deposited on a substrate, where the bias voltage is applied by two electrodes in the left and right. At Low bias voltages, we found that NDR appears due to breaking of minibands to Wannier-Stark ladders (WSLs). At the critical bias voltage, delocalization appeared by WS states leads to tunneling peak current in current-voltage (I-V) characteristics. With increasing bias voltage, crossing of rungs from various WSL results in multi-peak NDR. The results demonstrate that the structure parameters like barrier/well thickness and barrier height have remarkable effect on I-V characteristics of PGSL. In addition, Dirac gap enhances peak to valley (PVR) value due to suppressing Klein tunneling. Our results show that the tunable PVR in PGSL resonant tunneling diode can be achievable by structure parameters engineering. NDR at ultra-low bias voltages, such as 100 mV, with giant PVR of 20 is obtained. In our device, the multiple same NDR peaks with ultra-low bias voltage provide promising prospect for multi-valued memories and the low power nanoelectronic tunneling devices.

The Swedish infant high-grade reflux trial: UTI and renal damage.

PubMed

Nordenström, Josefin; Sjöström, Sofia; Sillén, Ulla; Sixt, Rune; Brandström, Per

2017-04-01

High-grade vesicoureteral reflux (VUR) in children is associated with recurrent urinary tract infection (UTI) and renal damage. Breakthrough UTI despite continuous antibiotic prophylaxis (CAP) during the first years of life is a matter of concern and evokes early intervention. We investigated whether early endoscopic treatment (ET) of VUR grade 4-5 can reduce the risk of UTI recurrence and renal scarring. This prospective, randomized, controlled, multicentre, 1-year follow-up trial comprised 77 infants, <8 months of age with VUR grade 4-5 (Table) randomized to CAP (n = 39) or ET (with prophylaxis until resolution) (n = 38). Voiding cystourethrogram, ultrasound, renal scintigraphy, and free voiding observation were performed at study entry and after 1 year. Parenchymal defects were seen in 67 (87%) children at entry, 39 (34 boys, 5 girls) of them characterized as generalized. At follow-up, renal deterioration (new scars or progress in old damaged area) and symptomatic UTIs were reported. There were 27 recurrent febrile UTIs in 6 (16%) children in the ET group and in 10 (26%) in the CAP group (p = 0.43), in eight (36%) girls and eight (15%) boys (p = 0.039). Successful VUR outcome (VUR 0-2) was seen in 22 (59%) in the ET and eight (21%) in the CAP group (p = 0.0014). Multiple recurrences were only seen in patients with persistent dilating reflux at follow-up (p = 0.019). Deterioration on scintigraphy was seen in eight children (9 kidneys) with no difference between treatment groups (p = 0.48) or sex (p = 0.17). Renal deterioration was associated with high bladder capacity (BC) and large residual volume (PVR) at 1 year (p = 0.0092 and p = 0.041). Six of the eight children with renal deterioration had a recurrent UTI (p = 0.0032). Seven of nine renal units with deterioration were seen in children with persistent VUR 3-5 at follow-up. Univariable logistic regression identified female sex and high PVR as positive predictors for recurrent UTI (p = 0.039 and 0.034) and high PVR tended to predict renal deterioration (p = 0.053). No differences between the treatment groups regarding recurrent UTI and renal deterioration could be found. Increased PVR and female sex were positive predictors for UTI recurrences. VUR grade at follow-up was correlated to UTI recurrence and renal deterioration. This study did not show any difference between ET and CAP in reducing the risk of UTI recurrence or renal deterioration. The rate of VUR resolution was higher in the ET group and VUR grade at follow-up correlated with both UTI recurrence and renal deterioration. Copyright © 2017. Published by Elsevier Ltd.

An analytical approach to obtaining JWL parameters from cylinder tests

NASA Astrophysics Data System (ADS)

Sutton, B. D.; Ferguson, J. W.; Hodgson, A. N.

2017-01-01

An analytical method for determining parameters for the JWL Equation of State from cylinder test data is described. This method is applied to four datasets obtained from two 20.3 mm diameter EDC37 cylinder tests. The calculated pressure-relative volume (p-Vr) curves agree with those produced by hydro-code modelling. The average calculated Chapman-Jouguet (CJ) pressure is 38.6 GPa, compared to the model value of 38.3 GPa; the CJ relative volume is 0.729 for both. The analytical pressure-relative volume curves produced agree with the one used in the model out to the commonly reported expansion of 7 relative volumes, as do the predicted energies generated by integrating under the p-Vr curve. The calculated energy is within 1.6% of that predicted by the model.

Open-label study evaluating outpatient urethral sphincter injections of onabotulinumtoxinA to treat women with urinary retention due to a primary disorder of sphincter relaxation (Fowler's syndrome).

PubMed

Panicker, Jalesh N; Seth, Jai H; Khan, Shahid; Gonzales, Gwen; Haslam, Collette; Kessler, Thomas M; Fowler, Clare J

2016-05-01

To assess the efficacy (defined as improvements in maximum urinary flow rate [Qmax ] of ≥50%, post-void residual urine volume [PVR] and scores on the International Prostate Symptom Score [IPSS] questionnaire) and safety of urethral sphincter injections of onabotulinumtoxinA in women with a primary disorder of urethral sphincter relaxation, characterised by an elevated urethral pressure profile (UPP) and specific findings at urethral sphincter electromyography (EMG), i.e. Fowler's syndrome. In this open-label pilot Institutional Review Board-approved study, 10 women with a primary disorder of urethral sphincter relaxation (elevated UPP, sphincter volume, and abnormal EMG) presenting with obstructed voiding (five) or in complete urinary retention (five) were recruited from a single tertiary referral centre. Baseline symptoms were assessed using the IPSS, and Qmax and PVR were measured. After 2% lidocaine injection, 100 U of onabotulinumtoxinA was injected into the striated urethral sphincter, divided on either side, under EMG guidance. Patients were reviewed at 1, 4 and 10 weeks after injection, and assessed using the IPSS, Qmax and PVR measurements. The UPP was repeated at week 4. The mean (range) patient age was 40 (25-65) years, and the mean symptom scores on the IPSS improved from 25.6 to 14.1, and the mean 'bother' score reduced from 6.1 to 3.5 at week 10. As compared with a baseline mean Qmax of 8.12 mL/s in the women who could void, the Qmax improved to 15.8 mL/s at week 10. Four of the five women in complete retention could void spontaneously, with a mean Qmax of 14.3 mL/s at week 10. The mean PVR decreased from 260 to 89 mL and the mean static UPP improved from 113 cmH2 O at baseline to 90 cmH2 O. No serious side-effects were reported. Three women with a history of recurrent urinary tract infections developed a urinary tract infection. There were no reports of stress urinary incontinence. Seven of the 10 women opted to return for repeat injections. This pilot study shows an improvement in patient-reported lower urinary tract symptoms, and the objective parameters of Qmax , PVR and UPP, at 10 weeks after urethral sphincter injections of onabotulinumtoxinA. No serious side-effects were reported. This treatment could represent a safe outpatient treatment for young women in retention due to a primary disorder of urethral sphincter relaxation. However, a larger study is required to confirm the findings of this pilot study. © 2015 The Authors BJU International © 2015 BJU International Published by John Wiley & Sons Ltd.

Annexin A2 in Proliferative Vitreoretinopathy

DTIC Science & Technology

2015-10-01

retinopathy annexin macrophage retinal pigmented epithelial cell dispase penetrating ocular injury diabetic retinopathy epithelial...include evaluation of human surgical PVR samples from patients with diabetic retinopathy and a history of prior retinal surgery. Dissemination of

High current density Esaki tunnel diodes based on GaSb-InAsSb heterostructure nanowires.

PubMed

Ganjipour, Bahram; Dey, Anil W; Borg, B Mattias; Ek, Martin; Pistol, Mats-Erik; Dick, Kimberly A; Wernersson, Lars-Erik; Thelander, Claes

2011-10-12

We present electrical characterization of broken gap GaSb-InAsSb nanowire heterojunctions. Esaki diode characteristics with maximum reverse current of 1750 kA/cm(2) at 0.50 V, maximum peak current of 67 kA/cm(2) at 0.11 V, and peak-to-valley ratio (PVR) of 2.1 are obtained at room temperature. The reverse current density is comparable to that of state-of-the-art tunnel diodes based on heavily doped p-n junctions. However, the GaSb-InAsSb diodes investigated in this work do not rely on heavy doping, which permits studies of transport mechanisms in simple transistor structures processed with high-κ gate dielectrics and top-gates. Such processing results in devices with improved PVR (3.5) and stability of the electrical properties.

Spatial distribution of pulmonary blood flow in dogs in increased force environments

NASA Technical Reports Server (NTRS)

Greenleaf, J. F.; Ritman, E. L.; Chevalier, P. A.; Sass, D. J.; Wood, E. H.

1978-01-01

Spatial distribution of pulmonary blood flow during 2- to 3-min exposures to 6-8 Gy acceleration was studied, using radioactive microspheres in dogs, and compared to previously reported 1 Gy control distributions. Isotope distributions were measured by scintiscanning individual 1-cm-thick cross sections of excised, fixed lungs. Results indicate: (1) the fraction of cardiac output traversing left and right lungs did not change systematically with the duration and magnitude of acceleration; but (2) the fraction is strongly affected by the occurrence or absence of fast deep breaths, which cause an increase or decrease, respectively, in blood flow through the dependent lung; and (3) Gy acceleration caused a significant increase in relative pulmonary vascular resistance (PVR) in nondependent and dependent regions of the lung concurrent with a decrease in PVR in the midsagittal region of the thorax.

The Right Ventricle Explains Sex Differences in Survival in Idiopathic Pulmonary Arterial Hypertension

PubMed Central

Jacobs, Wouter; van de Veerdonk, Mariëlle C.; Trip, Pia; de Man, Frances; Heymans, Martijn W.; Marcus, Johannes T.; Kawut, Steven M.; Bogaard, Harm-Jan; Boonstra, Anco

2014-01-01

Background: Male sex is an independent predictor of worse survival in pulmonary arterial hypertension (PAH). This finding might be explained by more severe pulmonary vascular disease, worse right ventricular (RV) function, or different response to therapy. The aim of this study was to investigate the underlying cause of sex differences in survival in patients treated for PAH. Methods: This was a retrospective cohort study of 101 patients with PAH (82 idiopathic, 15 heritable, four anorexigen associated) who were diagnosed at VU University Medical Centre between February 1999 and January 2011 and underwent right-sided heart catheterization and cardiac MRI to assess RV function. Change in pulmonary vascular resistance (PVR) was taken as a measure of treatment response in the pulmonary vasculature, whereas change in RV ejection fraction (RVEF) was used to assess RV response to therapy. Results: PVR and RVEF were comparable between men and women at baseline; however, male patients had a worse transplant-free survival compared with female patients (P = .002). Although male and female patients showed a similar reduction in PVR after 1 year, RVEF improved in female patients, whereas it deteriorated in male patients. In a mediator analysis, after correcting for confounders, 39.0% of the difference in transplant-free survival between men and women was mediated through changes in RVEF after initiating PAH medical therapies. Conclusions: This study suggests that differences in RVEF response with initiation of medical therapy in idiopathic PAH explain a significant portion of the worse survival seen in men. PMID:24306900

Urinary retention in female OAB after intravesical Botox injection: who is really at risk?

PubMed

Miotla, Pawel; Cartwright, Rufus; Skorupska, Katarzyna; Bogusiewicz, Michal; Markut-Miotla, Ewa; Futyma, Konrad; Rechberger, Tomasz

2017-06-01

Intravesical onabotulinumtoxinA (Botox) injections are effective for the treatment of idiopathic overactive bladder (OAB) symptoms. The aim of our study was to assess the predisposing factors for urinary retention in women with OAB after intravesical Botox injection. All participants were women of European descent with idiopathic OAB. OnabotulinumtoxinA (100 U) was administered in 20 intra-detrusor injections. Analysis was performed based on the results of safety assessments made during follow-up (FU) visits on weeks 2, 4 and 12, in 208 women who were treated with Botox injections for refractory OAB and who completed all FU visits. Women who required clean intermittent self-catheterisation (CISC) and those with post-void residual (PVR) greater than 200 ml were older in comparison with patients with PVR between 50 and 200 ml. Patients who required CISC were also characterised by higher parity and particularly by a higher number of vaginal deliveries. Other factors such as body mass index or comorbidities did not significantly influence PVR and the risk of CISC. Elderly and/or multiparous women are at increased risk of urinary retention after intravesical 100-U Botox injections. The risk of new onset urine retention in our study has completely disappeared 2 weeks after Botox injections. Based on our results of the way in which the PVRs have changed over time, we can conclude that OAB patients should be optimally assessed during the first 2 weeks after Botox injections.

Comparative Results of Transurethral Incision with Transurethral Resection of The Prostate in Renal Transplant Recipients with Benign Prostate Hyperplasia.

PubMed

Sarier, Mehmet; Duman, Ibrahim; Kilic, Suleyman; Yuksel, Yucel; Demir, Meltem; Aslan, Mesut; Yucetin, Levent; Tekin, Sabri; Yavuz, Asuman Havva; Emek, Mestan

2018-02-18

The aim of this study is to compare the results of transurethral incision of the prostate (TUIP) and transurethral resection of the prostate (TURP) for the surgical treatment of benign prostate hyperplasia (BPH) in patients with renal transplantation. Between April 2009 and May 2016, BPH patients with renal transplants whose prostate volumes were less than 30 cm3 were treated surgically. Forty-seven patients received TURP and 32 received TUIP. The patients' age, duration of dialysis, duration between transplant and TURP/TUIP, preoperative and postoperative serum creatinine (SCr), International Prostate Symptom Score (IPSS), maximum flow rate (Qmax) and postvoidresidual volume (PVR) were recorded. At 1-,6- and 12-month follow-up, early and long-term complications were assessed. Results were evaluated retrospectively. In both groups, SCr, PVR and IPSS decreased significantly after the operation, while Qmax increased significantly (P < .001). There was no difference between the two groups in terms of increase in Qmax and decrease in IPSS, SCr and PVR (P = .89, P = .27, P = .08, and P = .27). Among postoperative complications, urinary tract infection (UTIs) and retrograde ejaculation (RE) rates were higher in the TURP group than the TUIP group (12.7% versus 6.2% and 68.1% versus 25%,respectively), whereas urethral strictures were more prevalent in the TUIP group (12.5% versus 6.3%). For the treatment of BPH in renal transplant patients with a prostate volume less than 30 cm3, bothTUIP and TURP are safe and effective.

The Clustered, Regularly Interspaced, Short Palindromic Repeats-associated Endonuclease 9 (CRISPR/Cas9)-created MDM2 T309G Mutation Enhances Vitreous-induced Expression of MDM2 and Proliferation and Survival of Cells.

PubMed

Duan, Yajian; Ma, Gaoen; Huang, Xionggao; D'Amore, Patricia A; Zhang, Feng; Lei, Hetian

2016-07-29

The G309 allele of SNPs in the mouse double minute (MDM2) promoter locus is associated with a higher risk of cancer and proliferative vitreoretinopathy (PVR), but whether SNP G309 contributes to the pathogenesis of PVR is to date unknown. The clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease (Cas) 9 from Streptococcus pyogenes (SpCas9) can be harnessed to manipulate a single or multiple nucleotides in mammalian cells. Here we delivered SpCas9 and guide RNAs using dual adeno-associated virus-derived vectors to target the MDM2 genomic locus together with a homologous repair template for creating the mutation of MDM2 T309G in human primary retinal pigment epithelial (hPRPE) cells whose genotype is MDM2 T309T. The next-generation sequencing results indicated that there was 42.51% MDM2 G309 in the edited hPRPE cells using adeno-associated viral CRISPR/Cas9. Our data showed that vitreous induced an increase in MDM2 and subsequent attenuation of p53 expression in MDM2 T309G hPRPE cells. Furthermore, our experimental results demonstrated that MDM2 T309G in hPRPE cells enhanced vitreous-induced cell proliferation and survival, suggesting that this SNP contributes to the pathogenesis of PVR. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Transgenic mice as an alternative to monkeys for neurovirulence testing of live oral poliovirus vaccine: validation by a WHO collaborative study.

PubMed Central

Dragunsky, Eugenia; Nomura, Tatsuji; Karpinski, Kazimir; Furesz, John; Wood, David J.; Pervikov, Yuri; Abe, Shinobu; Kurata, Takeshi; Vanloocke, Olivier; Karganova, Galina; Taffs, Rolf; Heath, Alan; Ivshina, Anna; Levenbook, Inessa

2003-01-01

OBJECTIVE: Extensive WHO collaborative studies were performed to evaluate the suitability of transgenic mice susceptible to poliovirus (TgPVR mice, strain 21, bred and provided by the Central Institute for Experimental Animals, Japan) as an alternative to monkeys in the neurovirulence test (NVT) of oral poliovirus vaccine (OPV). METHODS: Nine laboratories participated in the collaborative study on testing neurovirulence of 94 preparations of OPV and vaccine derivatives of all three serotypes in TgPVR21 mice. FINDINGS: Statistical analysis of the data demonstrated that the TgPVR21 mouse NVT was of comparable sensitivity and reproducibility to the conventional WHO NVT in simians. A statistical model for acceptance/rejection of OPV lots in the mouse test was developed, validated, and shown to be suitable for all three vaccine types. The assessment of the transgenic mouse NVT is based on clinical evaluation of paralysed mice. Unlike the monkey NVT, histological examination of central nervous system tissue of each mouse offered no advantage over careful and detailed clinical observation. CONCLUSIONS: Based on data from the collaborative studies the WHO Expert Committee for Biological Standardization approved the mouse NVT as an alternative to the monkey test for all three OPV types and defined a standard implementation process for laboratories that wish to use the test. This represents the first successful introduction of transgenic animals into control of biologicals. PMID:12764491

Internal limiting membrane peeling in macula-off retinal detachment complicated by grade B proliferative vitreoretinopathy.

PubMed

Foveau, Pauline; Leroy, Bertrand; Berrod, Jean-Paul; Conart, Jean-Baptiste

2018-04-02

To investigate the clinical benefit of internal limiting membrane (ILM) peeling as a surgical adjunct in the repair of primary retinal detachment (RD) complicated by grade B proliferative vitreoretinopathy (PVR). Retrospective, interventional, comparative case series. SETTING: Institutional. 75 consecutive patients who underwent vitrectomy for primary macula off RD complicated by grade B PVR. Patients were divided into an ILM peeling (group P) and a no ILM peeling (group NP). Anatomical success rate, best-corrected visual acuity, and spectral-domain optical coherence tomography (SD-OCT) characteristics were collected at 1 and 6 months. In all, 37 eyes with ILM peeling were included in group P and 38 eyes without ILM peeling were included in group NP. The anatomical success rate after single surgery was higher in group P (89%) than in group NP (66%, p=0.03). Mean final visual acuity was 0.41 ±0.40 logMAR in group P versus 0.43 ±0.22 logMAR in group NP (p=0.82). We found no epiretinal membrane (ERM) formation in group P, whereas five cases of ERM (20%) were detected in group NP (p=0.012). The two groups did not differ in terms of cystoid macular edema occurrence, macular thickness, or photoreceptor damage. ILM peeling during vitrectomy in macula off RD complicated by grade B PVR reduces the need for a second surgery for re-detachment or macular pucker. Copyright © 2018. Published by Elsevier Inc.

Photoselective vaporization with the green light laser vs transurethral resection of the prostate for treating benign prostate hyperplasia: a systematic review and meta-analysis.

PubMed

Teng, Jingfei; Zhang, Dongxu; Li, Yao; Yin, Lei; Wang, Kai; Cui, Xingang; Xu, Danfeng

2013-02-01

To assess the overall efficacy and safety of photoselective vaporization of the prostate (PVP) vs transurethral resection of the prostate (TURP) for treating patients with lower urinary tract symptoms (LUTS) secondary to benign prostate hyperplasia (BPH). A systematic search of the electronic databases, including MEDLINE, Embase, Web of Science and The Cochrane Library, as well as manual bibliography searches were performed. The pooled estimates of maximum flow rate (Q(max)), postvoid residual (PVR), quality of life (QoL), International Prostate Symptom Score (IPSS), operation duration, blood loss, catheterization time, hospital stay, capsule perforation, transfusion, transurethral resection (TUR) syndrome, urethral stricture and reintervention were calculated. At the 3-month follow-up, there was no significant difference in Q(max), PVR, QoL and IPSS between the TURP and PVP groups. At the 6-month follow-up, the pooled QoL favoured TURP, but there was no significant difference in the other variables between the two groups. PVP was associated with less blood loss, transfusion, capsular perforation, TUR syndrome, shorter catheterization time and hospital stay, but longer operation duration and higher reintervention rate. The efficacy of PVP was similar to that of TURP in relation to Q(max), PVR, QoL and IPSS, and it offered several advantages over TURP. As a promising minimal invasive technique, PVP could be used as an alternative surgical procedure for treating BPH. © 2012 BJU International.

Stress urinary incontinence

MedlinePlus

... leakage and fluid intake. Pelvic or abdominal ultrasound . Post-void residual (PVR) to measure the amount of urine left after you urinate. Urinalysis to check for urinary tract infection. Urinary stress test: You stand with a full bladder and then ...

Modulation of electronic transport properties in armchair phosphorene nanoribbons by doping and edge passivation.

PubMed

Guo, Caixia; Wang, Tianxing; Xia, Congxin; Liu, Yufang

2017-10-09

The electronic structures and transport properties of group IV atoms (C, Si, Ge)-doped armchair phosphorene nanoribbons (APNRs) are investigated using first-principles calculations, considering different edge passivation. The results show that the C, Si, Ge dopants can induce the transition occur from semiconductor to metal in the APNRs. The negative differential resistance (NDR) behavior in the doped APNR system is robust with respect to the doping concentration and edge passivation type. However, their current peak positions and peak-to-valley ratio (PVR) values are correlated with doping concentration and edge passivation type. In particular, for the C, Si-doped APNRs, the low bias NDR behavior with the PVR (10 5 -10 8 ) can be observed when doping concentration is low in the APNRs with the F and H edge passivation. These results may play an important role for the fabrication of future low power consumption nano-electronic devices.

Endothelin B receptor blockade attenuates pulmonary vasodilation in oxygen-ventilated fetal lambs.

PubMed

Ivy, D Dunbar; Lee, Dong-Seok; Rairigh, Robyn L; Parker, Thomas A; Abman, Steven H

2004-01-01

Endothelin-1 (ET-1) contributes to the regulation of pulmonary vascular tone in the normal ovine fetus and in models of perinatal pulmonary hypertension. In the fetal lamb lung, the effects of ET-1 depend on the balance of at least two endothelin receptor subtypes: ETA and ETB. ETA receptors are located on smooth muscle cells and mediate vasoconstriction and smooth muscle proliferation. Stimulation of endothelial ETB receptors causes vasodilation through release of nitric oxide and also functions to remove ET-1 from the circulation. However, whether activation of ETB receptors contributes to the fall in pulmonary vascular tone at birth is unknown. To determine the role of acute ETB receptor blockade in pulmonary vasodilation in response to birth-related stimuli, we studied the hemodynamic effects of selective ETB receptor blockade with BQ-788 during mechanical ventilation with low (<10%) and high FiO2 (100%) in near-term fetal sheep. Intrapulmonary infusion of BQ-788 did not change left pulmonary artery (LPA) blood flow and pulmonary vascular resistance (PVR) at baseline. In comparison with controls, BQ-788 treatment attenuated the rise in LPA flow with low and high FiO2 ventilation (p <0.001 vs. control for each FiO2 concentration). PVR progressively decreased during mechanical ventilation with low and high FiO2 in both groups, but PVR remained higher after BQ-788 treatment throughout the study period (p <0.001). We conclude that selective ETB receptor blockade attenuates pulmonary vasodilation at birth. We speculate that ETB receptor stimulation contributes to pulmonary vasodilation at birth in the ovine fetus.

Quantification of lung perfusion blood volume (lung PBV) by dual-energy CT in patients with chronic thromboembolic pulmonary hypertension (CTEPH) before and after balloon pulmonary angioplasty (BPA): Preliminary results.

PubMed

Koike, Hirofumi; Sueyoshi, Eijun; Sakamoto, Ichiro; Uetani, Masataka; Nakata, Tomoo; Maemura, Kouji

2016-09-01

Balloon pulmonary angioplasty (BPA) is a treatment option for patients with chronic thromboembolic pulmonary hypertension (CTEPH). Its effect on pulmonary perfusion has not been quantified; we examined the clinical significance of pulmonary blood volume (PBV) using dual-energy computed tomography (DECT) in patients with CTEPH undergoing BPA. In this retrospective study of 16 BPAs in eight female patients with CTEPH, we evaluated both-lung (n=16), right- or left-lung (n=32), and three right- or left-segment (upper, middle, and lower) (n=96) PBVs before and after BPA, using DECT. We evaluated the relationships between improvement in lung PBV and pulmonary artery (PA) pressure (PAP), cardiac index (CI), pulmonary vascular resistance (PVR), and 6-min walking distance. We measured PA enhancement (PAenh) on DECT images and calculated lung PBV/PAenh to adjust timing. Pre- and post-BPA 6-segment lung PBV/PAenh were 0.067±0.021 and 0.077±0.019, respectively, in the treated segment (p<0.0001). There were significant positive correlations between pre- to post-BPA improvements in both-lung PBV/PAenh and PAP (R=0.69, p=0.005), PVR (R=0.56, p=0.03), and 6-min walking distance (R=0.67, p=0.01). Improved PBV after BPA, reflecting increased lung perfusion, was positively correlated with PAP, PVR, and 6-min walking distance. Lung PBV may be an indicator of BPA treatment effect. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Changes in urination according to the sound of running water using a mobile phone application.

PubMed

Kwon, Whi-An; Kim, Sung Han; Kim, Sohee; Joung, Jae Young; Chung, Jinsoo; Lee, Kang Hyun; Lee, Sang-Jin; Seo, Ho Kyung

2015-01-01

The sound of running water (SRW) has been effectively used for toilet training during toddlerhood. However, the effect of SRW on voiding functions in adult males with lower urinary tract symptoms (LUTS) has not been evaluated. To determine the effect of SRW on urination in male patients with LUTS, multiple voiding parameters of uroflowmetry with postvoid residual urine (PVR) were assessed according to the presence of SRW played by a mobile application. Eighteen consecutive male patients with LUTS were prospectively enrolled between March and April 2014. Uroflowmetry with PVR measured by a bladder scan was randomly performed once weekly for two consecutive weeks with and without SRW in a completely sealed room after pre-checked bladder volume was scanned to be more than 150 cc. SRW was played with river water sounds amongst relaxed melodies from a smartphone mobile application. The mean age of enrolled patients and their mean International Prostate Symptom Score (IPSS) were 58.9 ± 7.7 years (range: 46-70) and 13.1 ± 5.9, respectively. All patients had not been prescribed any medications, including alpha-blockers or anti-muscarinic agents, in the last 3 months. There was a significant increase in mean peak flow rate (PFR) with SRW in comparison to without SRW (15.7 mL/s vs. 12.3 mL/s, respectively, p = 0.0125). However, there were no differences in other uroflowmetric parameters, including PVR. The study showed that SRW from a mobile phone application may be helpful in facilitating voiding functions by increasing PFR in male LUTS patients.

Differential roles of endothelin-1 ETA and ETB receptors and vasoactive intestinal polypeptide in regulation of the airways and the pulmonary vasculature in isolated rat lung.

PubMed

Janosi, Tibor; Peták, Ferenc; Fontao, Fabienne; Morel, Denis R; Beghetti, Maurice; Habre, Walid

2008-11-01

The available treatment strategies against pulmonary hypertension include the administration of endothelin-1 (ET-1) receptor subtype blockers (ET(A) and ET(B) antagonists); vasoactive intestinal polypeptide (VIP) has recently been suggested as a potential new therapeutic agent. We set out to investigate the ability of these agents to protect against the vasoconstriction and impairment of lung function commonly observed in patients with pulmonary hypertension. An ET(A) blocker (BQ123), ET(B) blocker (BQ788), a combination of these selective blockers (ET(A) + ET(B) blockers) or VIP (V6130) was administered into the pulmonary circulation in four groups of perfused normal rat lungs. Pulmonary vascular resistance (PVR) and forced oscillatory lung input impedance (Z(L)) were measured in all groups under baseline conditions and at 1 min intervals following ET-1 administrations. The airway resistance, inertance, tissue damping and elastance were extracted from the Z(L) spectra. While VIP, ET(A) blocker and combined ET(A) and ET(B) blockers significantly prevented the pulmonary vasoconstriction induced by ET-1, ET(B) blockade enhanced the ET-1-induced increases in PVR. In contrast, the ET(A) and ET(B) blockers markedly elevated the ET-1-induced increases in airway resistance, while VIP blunted this constrictor response. Our results suggest that VIP potently acts against the airway and pulmonary vascular constriction mediated by endothelin-1, while the ET(A) and ET(B) blockers exert a differential effect between airway resistance and PVR.

Clinical features of sarcoidosis associated pulmonary hypertension: Results of a multi-national registry.

PubMed

Baughman, Robert P; Shlobin, Oksana A; Wells, Athol U; Alhamad, Esam H; Culver, Daniel A; Barney, Joseph; Cordova, Francis C; Carmona, Eva M; Scholand, Mary Beth; Wijsenbeek, Marlies; Ganesh, Sivagini; Birring, Surinder S; Kouranos, Vasilis; O'Hare, Lanier; Baran, Joanne M; Cal, Joseph G; Lower, Elyse E; Engel, Peter J; Nathan, Steven D

2018-06-01

Pulmonary hypertension (PH) is a significant cause of morbidity and mortality in sarcoidosis. We established a multi-national registry of sarcoidosis associated PH (SAPH) patients. Sarcoidosis patients with PH confirmed by right heart catheterization (RHC) were studied. Patients with pulmonary artery wedge pressure (PAWP) of 15 mmHg or less and a mean pulmonary artery pressure (mPAP) ≥ 25 Hg were subsequently analyzed. Data collected included hemodynamics, forced vital capacity (FVC), diffusion capacity of carbon monoxide (DL CO ), chest x-ray, and 6-min walk distance (6MWD). A total of 176 patients were analyzed. This included 84 (48%) cases identified within a year of entry into the registry and 94 (53%) with moderate to severe PH. There was a significant correlation between DL CO percent predicted (% pred) andmPAP (Rho = -0.228, p = 0.0068) and pulmonary vascular resistance (PVR) (Rho = -0.362, p < 0.0001). PVR was significantly higher in stage 4 disease than in stage 0 or 1 disease (p < 0.05 for both comparisons). About two-thirds of the SAPH patients came from the United States (US). There was a significant difference in the rate of treatment between US (67.5%) versus non-US (86%) (Chi Square 11.26, p = 0.0008) sites. The clinical features of SAPH were similar across multiple centers in the US, Europe, and the Middle East. The severity of SAPH was related to reduced DLCO. There were treatment differences between the US and non-US centers. Copyright © 2018. Published by Elsevier Ltd.

Assessment of noninvasive predictors of bladder detrusor underactivity in BPH/LUTs patients.

PubMed

Luo, Fei; Sun, Hong-Hong; Su, Yan-Hui; Zhang, Zhi-Hua; Wang, Ya-Shen; Zhao, Zhen; Li, Jian

2017-05-01

To retrospectively assess the diagnostic predictive value of clinical characteristics to improve the diagnostic accuracy of bladder detrusor underactivity (DU) among benign prostatic hyperplasia/lower urinary tract symptoms (BPH/LUTS) patients who cannot undergo urodynamic examinations. A total of 704 BPH/LUTS patients at Tianjin Medical Union Center from January 2013 through June 2016 were enrolled in the study. All cases were stratified by maximum detrusor pressure (Pdet.max) into two groups (DU and control). Patient and clinical variables were analyzed in both groups. One hundred twelve and 592 cases were classified into the DU and control group, respectively. PV (OR 0.976, 95% CI 0.961-0.991, P = 0.002) and PVR (OR 1.004, 95% CI 1.001-1.007, P = 0.004) were independent predictors of DU. In addition, Pdet.max was positively correlated with HTN (≥10 years) (r = 0.373, P = 0.001), smoking (r = 0.108, P = 0.039), IPSS (20-23) (r = 0.257, P = 0.013), PV (r = 0.305, P < 0.001), PSA (1-2.2 ng/mL) (r = 0.428, P = 0.002), PSAD (0-0.02) (r = 0.430, P = 0.02), and Q max (≤4 mL/s) (r = 0.372, P < 0.001), and inversely correlated with age (>76 years) (r = -0.265, P = 0.015), BMI (21-23) (r = -0.382, P = 0.001), DM (0-20 years) (r = 0.365, P = 0.009) and PVR (50-400 mL) (r = 0.423, P = 0.001). The AUCs for BMI, PV, tPSA, PSAD, Q max , and PVR were 0.762, 0.739, 0.727, 0.681, 0.749, and 0.716, respectively. Combined ROC analysis showed the AUC for PV + PVR was 0.774 with sensitivity of 77.78% and specificity of 73.68%. Clinical factors were effective for predicting DU and could help improve the diagnostic accuracy for BPH/LUTS patients who cannot undergo urodynamic examinations.

BPH progression: concept and key learning from MTOPS, ALTESS, COMBAT, and ALF-ONE.

PubMed

Roehrborn, Claus G

2008-03-01

Benign prostatic hyperplasia (BPH) represents a significant burden in ageing men due to frequently associated lower urinary tract symptoms (LUTS), which may impair quality of life. BPH is also a progressive disease, mainly characterized by a deterioration of LUTS over time, and in some patients by the occurrence of serious outcomes such as acute urinary retention (AUR) and need for BPH-related surgery. The goals of therapy for BPH are not only to improve bothersome LUTS but also to identify those patients at risk of unfavourable outcomes, to optimize their management. In selected patients, combination of an alpha(1)-blocker and a 5alpha-reductase inhibitor is the most effective form of BPH medical therapy to reduce the risk of clinical progression and relieve LUTS. Monotherapy also significantly reduces the risk of BPH clinical progression, mainly through a reduction of LUTS deterioration for alpha(1)-blockers while 5alpha-reductase inhibitors also reduce the risk of AUR and need for BPH-related surgery. Enlarged prostate and high serum prostate-specific antigen levels have been consistently found to be good clinical predictors of AUR and BPH-related surgery in longitudinal population-based studies and placebo arms of controlled studies. High post-void residual urine (PVR) is also associated with an increased risk of LUTS deterioration and should thus be reconsidered in practice as a predictor of BPH progression. Conversely, baseline LUTS severity and low peak flow rate, initially identified as predictors of unfavourable outcomes in community setting, behave paradoxically in controlled trials, probably as a consequence of strict inclusion criteria and subsequent regression to the mean and glass ceiling effects. Lastly, there is increasing evidence that dynamic variables, such as LUTS and PVR worsening, and lack of symptomatic improvement with alpha(1)-blockers are important predictors of future LUTS/BPH-related events, allowing better identification and management of patients at risk of BPH progression.

Implementation of centrifuge testing of expansive soils for pavement design.

DOT National Transportation Integrated Search

2017-03-01

The novel centrifuge-based method for testing of expansive soils from project 5-6048-01 was implemented into : use for the determination of the Potential Vertical Rise (PVR) of roadways that sit on expansive subgrades. The : centrifuge method was mod...

Associations between lower urinary tract dysfunction and glycemic control in women with type 2 diabetes: A cross-sectional study.

PubMed

Tai, Huai-Ching; Tai, Tong-Yuan; Yang, Wei-Shiung; Wang, Shin-Wei; Yu, Hong-Jeng

2016-04-01

Patients with diabetes are predisposed to develop a variety of complications, including lower urinary tract (LUT) dysfunction. We aimed to examine the associations between glycemic control and LUT dysfunction in women with type 2 diabetes (T2D). We included 400 women with T2D (age range, 48-75 years) in this cross-sectional analysis. The participants were divided into tertiles according to glycosylated hemoglobin (HbA1c) measurements. The mean HbA1c levels for tertiles 1, 2, and 3 were 6.2% (N=132), 7.1% (N=132), and 8.4% (N=136), respectively. We evaluated LUT dysfunction with the American Urological Association Symptom Index (AUA-SI) questionnaire, uroflowmetry (UFM), and post-void residual (PVR). No significant differences were found among HbA1c tertiles regarding storage, voiding and total AUA-SI scores, and prevalence of LUT symptoms. However, women in tertile 3 had higher prevalences of severe LUT symptoms (AUA-SI≥20) and clinically significant PVR (≥100mL) compared to women in the other tertiles. Multivariate analysis revealed that diabetic neuropathy, but not HbA1c, significantly predicted LUT symptoms in women with T2D after adjustment for age, body mass index (BMI) and hypertension. However, HbA1c was associated with an increased risk of developing clinically significant PVR. Our findings do not support significant associations between glycemic control and LUT symptoms in women with T2D. However, women with poor glycemic control are more likely to develop urinary retention than women with proper glycemic control. Clinicians should, therefore, be aware of and educate patients about the association between urinary retention and glycemic control. Copyright © 2016 Elsevier Inc. All rights reserved.

Mechanical versus humoral determinants of brain death-induced lung injury

PubMed Central

Dewachter, Laurence; Rorive, Sandrine; Remmelink, Myriam; Weynand, Birgit; Melot, Christian; Hupkens, Emeline; Dewachter, Céline; Creteur, Jacques; Mc Entee, Kathleen; Naeije, Robert; Rondelet, Benoît

2017-01-01

Background The mechanisms of brain death (BD)-induced lung injury remain incompletely understood, as uncertainties persist about time-course and relative importance of mechanical and humoral perturbations. Methods Brain death was induced by slow intracranial blood infusion in anesthetized pigs after randomization to placebo (n = 11) or to methylprednisolone (n = 8) to inhibit the expression of pro-inflammatory mediators. Pulmonary artery pressure (PAP), wedged PAP (PAWP), pulmonary vascular resistance (PVR) and effective pulmonary capillary pressure (PCP) were measured 1 and 5 hours after Cushing reflex. Lung tissue was sampled to determine gene expressions of cytokines and oxidative stress molecules, and pathologically score lung injury. Results Intracranial hypertension caused a transient increase in blood pressure followed, after brain death was diagnosed, by persistent increases in PAP, PCP and the venous component of PVR, while PAWP did not change. Arterial PO2/fraction of inspired O2 (PaO2/FiO2) decreased. Brain death was associated with an accumulation of neutrophils and an increased apoptotic rate in lung tissue together with increased pro-inflammatory interleukin (IL)-6/IL-10 ratio and increased heme oxygenase(HO)-1 and hypoxia inducible factor(HIF)-1 alpha expression. Blood expressions of IL-6 and IL-1β were also increased. Methylprednisolone pre-treatment was associated with a blunting of increased PCP and PVR venous component, which returned to baseline 5 hours after BD, and partially corrected lung tissue biological perturbations. PaO2/FiO2 was inversely correlated to PCP and lung injury score. Conclusions Brain death-induced lung injury may be best explained by an initial excessive increase in pulmonary capillary pressure with increased pulmonary venous resistance, and was associated with lung activation of inflammatory apoptotic processes which were partially prevented by methylprednisolone. PMID:28753621

Beta-3 adrenergic agonists reduce pulmonary vascular resistance and improve right ventricular performance in a porcine model of chronic pulmonary hypertension.

PubMed

García-Álvarez, Ana; Pereda, Daniel; García-Lunar, Inés; Sanz-Rosa, David; Fernández-Jiménez, Rodrigo; García-Prieto, Jaime; Nuño-Ayala, Mario; Sierra, Federico; Santiago, Evelyn; Sandoval, Elena; Campelos, Paula; Agüero, Jaume; Pizarro, Gonzalo; Peinado, Víctor I; Fernández-Friera, Leticia; García-Ruiz, José M; Barberá, Joan A; Castellá, Manuel; Sabaté, Manel; Fuster, Valentín; Ibañez, Borja

2016-07-01

Beta-3 adrenergic receptor (β3AR) agonists have been shown to produce vasodilation and prevention of ventricular remodeling in different conditions. Given that these biological functions are critical in pulmonary hypertension (PH), we aimed to demonstrate a beneficial effect of β3AR agonists in PH. An experimental study in pigs (n = 34) with chronic PH created by pulmonary vein banding was designed to evaluate the acute hemodynamic effect and the long-term effect of β3AR agonists on hemodynamics, vascular remodeling and RV performance in chronic PH. Ex vivo human experiments were performed to explore the expression of β3AR mRNA and the vasodilator response of β3AR agonists in pulmonary arteries. Single intravenous administration of the β3AR agonist BRL37344 produced a significant acute reduction in PVR, and two-weeks treatment with two different β3AR selective agonists, intravenous BRL37344 or oral mirabegron, resulted in a significant reduction in PVR (median of -2.0 Wood units/m(2) for BRL37344 vs. +1.5 for vehicle, p = 0.04; and -1.8 Wood units/m(2) for mirabegron vs. +1.6 for vehicle, p = 0.002) associated with a significant improvement in magnetic resonance-measured RV performance. Histological markers of pulmonary vascular proliferation (p27 and Ki67) were significantly attenuated in β3AR agonists-treated pigs. β3AR was expressed in human pulmonary arteries and β3AR agonists produced vasodilatation. β3AR agonists produced a significant reduction in PVR and improved RV performance in experimental PH, emerging as a potential novel approach for treating patients with chronic PH.

Acute effects of the combination of sildenafil and inhaled treprostinil on haemodynamics and gas exchange in pulmonary hypertension.

PubMed

Voswinckel, Robert; Reichenberger, Frank; Enke, Beate; Kreckel, Andre; Krick, Stefanie; Gall, Henning; Schermuly, Ralph Theo; Grimminger, Friedrich; Rubin, Lewis J; Olschewski, Horst; Seeger, Werner; Ghofrani, Hossein A

2008-10-01

Inhaled treprostinil was recently developed for the treatment of pulmonary arterial hypertension (PAH). We investigated the safety and acute haemodynamic effects of the combination oral sildenafil and inhaled treprostinil in an open label study in patients with precapillary pulmonary hypertension. Inhaled nitric oxide (20ppm; n=50), sildenafil (50mg; n=50) and inhaled treprostinil (15microg; n=25 or 30microg; n=25) were applied in subsequent order during right heart catheter investigation to consecutive patients with pulmonary arterial hypertension (PAH; n=28), non-operable chronic thromboembolic pulmonary hypertension (CTEPH; n=17) and pulmonary fibrosis associated pulmonary hypertension (n=5). Inhaled nitric oxide reduced pulmonary vascular resistance (PVR) to 87.3+/-5.1% of baseline values, reduced mean pulmonary arterial pressure (PAP) to 89.7+/-3.5% and increased cardiac output (CO) to 102.4+/-2.9%. Sildenafil reduced PVR to 80.1+/-5.0%, mPAP to 86.5+/-2.9% and increased CO to 103.8+/-3.2%. Treprostinil, inhaled 1h after sildenafil, reduced PVR to 66.3+/-3.8%, mPAP to 77.8+/-3.3%, and increased CO to 107.1+/-3.3% (mean+/-95% confidence interval). Subgroup analysis showed similar acute haemodynamic effects in PAH and CTEPH patients. Ventilation/perfusion distribution measurement in six patients with pre-existing gas exchange limitations was not changed by sildenafil and treprostinil. Relevant side effects were not observed. The combination of sildenafil and inhaled treprostinil was well tolerated and induced additive, pulmonary selective vasodilatation in pulmonary hypertension patients. This could be of relevance also for long-term treatment of PAH and CTEPH patients.

Efficacy and Safety of Initial Combination Treatment of an Alpha Blocker with an Anticholinergic Medication in Benign Prostatic Hyperplasia Patients with Lower Urinary Tract Symptoms: Updated Meta-Analysis.

PubMed

Kim, Hyun Jung; Sun, Hwa Yeon; Choi, Hoon; Park, Jae Young; Bae, Jae Hyun; Doo, Seung Whan; Yang, Won Jae; Song, Yun Seob; Ko, Young Myoung; Kim, Jae Heon

2017-01-01

There is still controversy as to whether initial combination treatment is superior to serial addition of anticholinergics after maintenance or induction of alpha blockers in benign prostatic hyperplasia (BPH)/lower urinary tract symptoms (LUTS). The objective of this study was to determine the benefits and safety of initial combination treatment of an alpha blocker with anticholinergic medication in BPH/LUTS through a systematic review and meta-analysis. We conducted a meta-analysis of improvement in LUTS using International Prostate Symptom Score (IPSS), maximal urinary flow rate (Qmax), post-voided residual volume (PVR), and quality of life (QoL). In total, 16 studies were included in our analysis, with a total sample size of 3,548 subjects (2,195 experimental subjects and 1,353 controls). The mean change in total IPSS improvement from baseline in the combination group versus the alpha blocker monotherapy group was -0.03 (95% CI: -0.14-0.08). The pooled overall SMD change of storage IPSS improvement from baseline was -0.28 (95% CI: -0.40 - -0.17). The pooled overall SMD changes of QoL, Qmax, and PVR were -0.29 (95% CI: -0.50 - -0.07), 0.00 (95% CI: -0.08-0.08), and 0.56 (95% CI: 0.23-0.89), respectively. There was no significant difference in the number of acute urinary retention (AUR) events or PVR. Initial combination treatment of an alpha blocker with anticholinergic medication is efficacious for in BPH/ LUTS with improved measures such as storage symptoms and QoL without causing significant deterioration of voiding function.

Efficacy and Safety of Initial Combination Treatment of an Alpha Blocker with an Anticholinergic Medication in Benign Prostatic Hyperplasia Patients with Lower Urinary Tract Symptoms: Updated Meta-Analysis

PubMed Central

Kim, Hyun Jung; Sun, Hwa Yeon; Choi, Hoon; Park, Jae Young; Bae, Jae Hyun; Doo, Seung Whan; Yang, Won Jae; Song, Yun Seob; Ko, Young Myoung

2017-01-01

Background There is still controversy as to whether initial combination treatment is superior to serial addition of anticholinergics after maintenance or induction of alpha blockers in benign prostatic hyperplasia (BPH)/lower urinary tract symptoms (LUTS) Objective The objective of this study was to determine the benefits and safety of initial combination treatment of an alpha blocker with anticholinergic medication in BPH/LUTS through a systematic review and meta-analysis. Methods We conducted a meta-analysis of improvement in LUTS using International Prostate Symptom Score (IPSS), maximal urinary flow rate (Qmax), post-voided residual volume (PVR), and quality of life (QoL). Results In total, 16 studies were included in our analysis, with a total sample size of 3,548 subjects (2,195 experimental subjects and 1,353 controls). The mean change in total IPSS improvement from baseline in the combination group versus the alpha blocker monotherapy group was -0.03 (95% CI: -0.14–0.08). The pooled overall SMD change of storage IPSS improvement from baseline was -0.28 (95% CI: -0.40 - -0.17). The pooled overall SMD changes of QoL, Qmax, and PVR were -0.29 (95% CI: -0.50 - -0.07), 0.00 (95% CI: -0.08–0.08), and 0.56 (95% CI: 0.23–0.89), respectively. There was no significant difference in the number of acute urinary retention (AUR) events or PVR. Conclusions Initial combination treatment of an alpha blocker with anticholinergic medication is efficacious for in BPH/ LUTS with improved measures such as storage symptoms and QoL without causing significant deterioration of voiding function. PMID:28072862

Prostacyclin and milrinone by aerosolization improve pulmonary hemodynamics in newborn lambs with experimental pulmonary hypertension.

PubMed

Kumar, Vasanth H; Swartz, Daniel D; Rashid, Nasir; Lakshminrusimha, Satyan; Ma, Changxing; Ryan, Rita M; Morin, Frederick C

2010-09-01

Aerosolized prostacyclin (PGI2) produces selective pulmonary vasodilation in patients with pulmonary hypertension (PH). The response to PGI2 may be increased by phosphodiesterase type 3 inhibitors such as milrinone. We studied the dose response effects of aerosolized PGI2 and aerosolized milrinone both alone and in combination on pulmonary and systemic hemodynamics in newborn lambs with Nomega-nitro-L-arginine methyl ester (L-NAME)-induced PH. We hypothesized that coaerosolization of PGI2 with milrinone would additively decrease pulmonary vascular resistance (PVR), prolong the duration of action of PGI2, and selectively dilate the pulmonary vasculature. Near-term lambs were delivered by C-section and instrumented and PH was induced by L-NAME (bolus 25 mg/kg; infusion 10 mg.kg(-1).h(-1)) and indomethacin. In the first set of experiments, PGI2 was aerosolized at random doses of 2, 20, 100, 200, 500, and 1,000 ng.kg(-1).min(-1) followed by milrinone at doses of 0.1, 1, and 10 microg.kg(-1).min(-1) over 10 min. In the second set of experiments, milrinone at 1 microg.kg(-1).min(-1) was aerosolized in combination with PGI2 at doses of 20, 100, and 200 ng.kg(-1).min(-1) over 10 min. Pulmonary arterial pressures (PAP) and PVR decreased significantly with increasing doses of aerosolized PGI2 and milrinone. The combination of PGI2 and milrinone significantly reduced PAP and PVR more than either of the drugs aerosolized alone. Addition of milrinone significantly increased the duration of action of PGI2. When aerosolized independently, PGI2 and milrinone selectively dilated the pulmonary vasculature but the combination did not. Milrinone enhances the vasodilatory effects of PGI2 on the pulmonary vasculature but caution must be exercised regarding systemic hypotension.

Thulium laser enucleation (ThuLEP) versus transurethral resection of the prostate in saline (TURis): A randomized prospective trial to compare intra and early postoperative outcomes.

PubMed

Bozzini, G; Seveso, M; Melegari, S; de Francesco, O; Buffi, N M; Guazzoni, G; Provenzano, M; Mandressi, A; Taverna, G

2017-06-01

To compare clinical intra and early postoperative outcomes between thulium laser transurethral enucleation of the prostate (ThuLEP) and transurethral bipolar resection of the prostate (TURis) for treating benign prostatic hyperplasia (BPH) in a prospective randomized trial. The study randomized 208 consecutive patients with BPH to ThuLEP (n=102) or TURis (n=106). For all patients were evaluated preoperatively with regards to blood loss, catheterization time, irrigation volume, hospital stay and operative time. At 3 months after surgery they were also evaluated by International Prostate Symptom Score (IPSS), maximum flow rate (Qmax), and postvoid residual urine volume (PVR). The patients in each study arm each showed no significant difference in preoperative parameters. Compared with TURIS, ThuLEP had same operative time (53.69±31.44 vs 61.66±18.70minutes, P=.123) but resulted in less hemoglobin decrease (0.45 vs 2.83g/dL, P=.005). ThuLEP also needed less catheterization time (1.3 vs 4.8 days, P=.011), irrigation volume (29.4 vs 69.2 L, P=.002), and hospital stay (1.7 vs 5.2 days, P=.016). During the 3 months of follow-up, the procedures did not demonstrate a significant difference in Qmax, IPSS, PVR, and QOLS. ThuLEP and TURis both relieve lower urinary tract symptoms equally, with high efficacy and safety. ThuLEP was statistically superior to TURis in blood loss, catheterization time, irrigation volume, and hospital stay. However, procedures did not differ significantly in Qmax, IPSS, PVR, and QOLS through 3 months of follow-up. Copyright © 2016 AEU. Publicado por Elsevier España, S.L.U. All rights reserved.

Clinical features and prognosis of eyeball rupture: eye injury vitrectomy study.

PubMed

Feng, Kang; Wang, Chang-guan; Hu, Yun-tao; Yao, Yi; Jiang, Yan-rong; Shen, Li-jun; Pang, Xiu-qin; Nie, Hong-ping; Ma, Zhi-zhong

2015-01-01

The objective of the study was to delineate clinical characteristics, surgical interventions, anatomic and visual outcomes of ruptured eye balls after trauma, and establish the prognostic indicators, which can assist clinicians in making correct surgical decisions during globe exploration for ruptured eyes. The study design used was a multicentre prospective cohort study, including six university-affiliated tertiary hospitals. We selected 242 cases of ruptured globe from the Eye Injury Vitrectomy Study database, until 31 December 2012. All selected cases underwent vitreoretinal surgery, enucleation or evisceration, and were followed up for at least 6 months. Age, visual acuity (VA) after injury, ocular trauma zone, time to surgery, corneal laceration, scleral wound, extrusion of iris or lens, ciliary body damage, intraocular haemorrhage, retinal detachment or defect, proliferative vitreoretinopathy (PVR) and choroidal damage were the predisposing factors evaluated by logistic regression models. We compared the pre-surgical indicators between cases of anatomically restored eyes with VA of 4/200 or better, or eyes with initial no light perception restored light perception or better, and cases of VA worse than 4/200, silicone oil-sustained eyes, phthisis or enucleation. Nearly 40% of cases with ruptured globe were anatomically restored through vitreoretinal surgery. The closed-funnel retinal detachment or extensive retinal loss (odds ratio [OR] = 3.38, P = 0.026), PVR-C (OR = 3.45, P = 0.008), and choroidal damage (OR = 4.20, P = 0.004) were correlated with poor outcomes. The closed-funnel retinal detachment or extensive retinal loss, PVR-C, and choroidal damage are the risk factors for unfavourable outcomes in globe ruptures. © 2015 Royal Australian and New Zealand College of Ophthalmologists.

Pulmonary hypertension and ventilation during exercise: Role of the pre-capillary component.

PubMed

Caravita, Sergio; Faini, Andrea; Deboeck, Gael; Bondue, Antoine; Naeije, Robert; Parati, Gianfranco; Vachiéry, Jean-Luc

2017-07-01

Excessive exercise-induced hyperventilation and high prevalence of exercise oscillatory breathing (EOB) are present in patients with post-capillary pulmonary hypertension (PH) complicating left heart disease (LHD). Patients with pre-capillary PH have even higher hyperventilation but no EOB. We sought to determine the impact of a pre-capillary component of PH on ventilatory response to exercise in patients with PH and left heart disease. We retrospectively compared patients with idiopathic or heritable pulmonary arterial hypertension (PAH, n = 29), isolated post-capillary PH (IpcPH, n = 29), and combined post- and pre-capillary PH (CpcPH, n = 12). Diastolic pressure gradient (DPG = diastolic pulmonary artery pressure - pulmonary wedge pressure) was used to distinguish IpcPH (DPG <7 mm Hg) from CpcPH (DPG ≥7 mm Hg). Pulmonary vascular resistance (PVR) was higher in PAH, intermediate in CpcPH, and low in IpcPH. All patients with CpcPH but 1 had PVR >3 Wood unit. Exercise-induced hyperventilation (high minute ventilation over carbon dioxide production, low end-tidal carbon dioxide) was marked in PAH, intermediate in CpcPH, and low in IpcPH (p < 0.001) and correlated with DPG and PVR. Prevalence of EOB decreased from IpcPH to CpcPH to PAH (p < 0.001). Patients with CpcPH may have worse hemodynamics than patients with IpcPH and distinct alterations of ventilatory control, consistent with more exercise-induced hyperventilation and less EOB. This might be explained at least in part by the presence and extent of pulmonary vascular disease. Copyright © 2017 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

Atrial natriuretic peptide ameliorates hypoxic pulmonary vasoconstriction without influencing systemic circulation.

PubMed

Höhne, C; Drzimalla, M; Krebs, M O; Boemke, W; Kaczmarczyk, G

2003-12-01

Hypoxic pulmonary vasoconstriction (HPV) is encountered during ascent to high altitude. Atrial natriuretic peptide (ANP) could be an option to treat HPV because of its natriuretic, diuretic, and vasodilatory properties. Data on effects of ANP on pulmonary and systemic circulation during HVP are conflicting, partly owing to anesthesia, surgical stress or uncontrolled dietary conditions. Therefore, ten conscious, chronically tracheotomized dogs were studied under standardized dietary conditions. The dogs were trained to breathe spontaneously at a ventilator circuit. 30min of normoxia [inspiratory oxygen fraction (F(i)O(2))=0.21] were followed by 30min of hypoxia without ANP infusion (Hypoxia I, F(i)O(2)=0.1). While maintaining hypoxia an intravenous infusion of atrial natriuretic peptide was started with 50ng x kg body wt(-1) x min(-1) for 30min (Hypoxia+ANP1=low dose), followed by 1000ng x kg body wt(-1) x min(-1) for 30min (Hypoxia+ANP2=high dose). Thereafter, ANP infusion was stopped and hypoxia maintained for a final 30min (Hypoxia II). Compared to normoxia, mean pulmonary arterial pressure (MPAP) (16+/-0.7 vs. 26+/-1.3mmHg) and pulmonary vascular resistance (PVR) (448+/-28 vs. 764+/-89dyn x s(-1) x cm(-5)) increased during Hypoxia I and decreased during Hypoxia+ANP 1 (MPAP 20+/-1mmHg, PVR 542+/-55dyn x s(-1) x cm(-5)) (P<0.05). The higher dose of ANP did not further decrease MPAP or PVR, but started to have a tendency to decrease mean arterial pressure and cardiac output. We conclude that low dose ANP is able to reduce HPV without affecting systemic circulation during acute hypoxia.

Use of the Frank-Starling mechanism during exercise is linked to exercise-induced changes in arterial load

PubMed Central

Chantler, Paul D.; Melenovsky, Vojtech; Schulman, Steven P.; Gerstenblith, Gary; Becker, Lewis C.; Ferrucci, Luigi; Fleg, Jerome L.; Najjar, Samer S.

2012-01-01

Effective arterial elastance(EA) is a measure of the net arterial load imposed on the heart that integrates the effects of heart rate(HR), peripheral vascular resistance(PVR), and total arterial compliance(TAC) and is a modulator of cardiac performance. To what extent the change in EA during exercise impacts on cardiac performance and aerobic capacity is unknown. We examined EA and its relationship with cardiovascular performance in 352 healthy subjects. Subjects underwent rest and exercise gated scans to measure cardiac volumes and to derive EA[end-systolic pressure/stroke volume index(SV)], PVR[MAP/(SV*HR)], and TAC(SV/pulse pressure). EA varied with exercise intensity: the ΔEA between rest and peak exercise along with its determinants, differed among individuals and ranged from −44% to +149%, and was independent of age and sex. Individuals were separated into 3 groups based on their ΔEAI. Individuals with the largest increase in ΔEA(group 3;ΔEA≥0.98 mmHg.m2/ml) had the smallest reduction in PVR, the greatest reduction in TAC and a similar increase in HR vs. group 1(ΔEA<0.22 mmHg.m2/ml). Furthermore, group 3 had a reduction in end-diastolic volume, and a blunted increase in SV(80%), and cardiac output(27%), during exercise vs. group 1. Despite limitations in the Frank-Starling mechanism and cardiac function, peak aerobic capacity did not differ by group because arterial-venous oxygen difference was greater in group 3 vs. 1. Thus the change in arterial load during exercise has important effects on the Frank-Starling mechanism and cardiac performance but not on exercise capacity. These findings provide interesting insights into the dynamic cardiovascular alterations during exercise. PMID:22003052

Pulmonary vascular and right ventricular dysfunction in adult critical care: current and emerging options for management: a systematic literature review.

PubMed

Price, Laura C; Wort, Stephen J; Finney, Simon J; Marino, Philip S; Brett, Stephen J

2010-01-01

Pulmonary vascular dysfunction, pulmonary hypertension (PH), and resulting right ventricular (RV) failure occur in many critical illnesses and may be associated with a worse prognosis. PH and RV failure may be difficult to manage: principles include maintenance of appropriate RV preload, augmentation of RV function, and reduction of RV afterload by lowering pulmonary vascular resistance (PVR). We therefore provide a detailed update on the management of PH and RV failure in adult critical care. A systematic review was performed, based on a search of the literature from 1980 to 2010, by using prespecified search terms. Relevant studies were subjected to analysis based on the GRADE method. Clinical studies of intensive care management of pulmonary vascular dysfunction were identified, describing volume therapy, vasopressors, sympathetic inotropes, inodilators, levosimendan, pulmonary vasodilators, and mechanical devices. The following GRADE recommendations (evidence level) are made in patients with pulmonary vascular dysfunction: 1) A weak recommendation (very-low-quality evidence) is made that close monitoring of the RV is advised as volume loading may worsen RV performance; 2) A weak recommendation (low-quality evidence) is made that low-dose norepinephrine is an effective pressor in these patients; and that 3) low-dose vasopressin may be useful to manage patients with resistant vasodilatory shock. 4) A weak recommendation (low-moderate quality evidence) is made that low-dose dobutamine improves RV function in pulmonary vascular dysfunction. 5) A strong recommendation (moderate-quality evidence) is made that phosphodiesterase type III inhibitors reduce PVR and improve RV function, although hypotension is frequent. 6) A weak recommendation (low-quality evidence) is made that levosimendan may be useful for short-term improvements in RV performance. 7) A strong recommendation (moderate-quality evidence) is made that pulmonary vasodilators reduce PVR and improve RV function, notably in pulmonary vascular dysfunction after cardiac surgery, and that the side-effect profile is reduced by using inhaled rather than systemic agents. 8) A weak recommendation (very-low-quality evidence) is made that mechanical therapies may be useful rescue therapies in some settings of pulmonary vascular dysfunction awaiting definitive therapy. This systematic review highlights that although some recommendations can be made to guide the critical care management of pulmonary vascular and right ventricular dysfunction, within the limitations of this review and the GRADE methodology, the quality of the evidence base is generally low, and further high-quality research is needed.

Regional differences of maternal health care utilization in China.

PubMed

Tang, Mengsha; Wang, Debin; Hu, Hong; Wang, Guoping; Li, Rongjie

2015-03-01

To describe regional differences in maternal health care (MHC) utilization in China. Cross-sectional comparisons of 4 MHC utilization indicators, namely, early (13 weeks within pregnancy) examinations rate (EER), prenatal examination (>4 times) rate (PER), hospital delivery rate (HDR), and postnatal visit (>1 time) rate (PVR), using index of dissimilarity (ID), linear correlation analysis, and geographical mapping. Significant differences existed across regions in all the indicators (P < .01). All the IDs for rural areas were higher than that for urban areas. The IDs for major regions ranged from 0.01 to 0.27. Linear correlation coefficients between MHC utilization indicators by regions varied from 0.007 to 0.889 (in absolute value, P < .05). Characteristic formats of geographical distribution were found with PER, EER, HDR, and PVR being in "high-plateau," "low-plateau," and "shifting" patterns, respectively. There exist substantial regional discrepancies in MHC utilization in China and future MHC-related policies should take account regional context. © 2013 APJPH.

Provably secure identity-based identification and signature schemes from code assumptions

PubMed Central

Zhao, Yiming

2017-01-01

Code-based cryptography is one of few alternatives supposed to be secure in a post-quantum world. Meanwhile, identity-based identification and signature (IBI/IBS) schemes are two of the most fundamental cryptographic primitives, so several code-based IBI/IBS schemes have been proposed. However, with increasingly profound researches on coding theory, the security reduction and efficiency of such schemes have been invalidated and challenged. In this paper, we construct provably secure IBI/IBS schemes from code assumptions against impersonation under active and concurrent attacks through a provably secure code-based signature technique proposed by Preetha, Vasant and Rangan (PVR signature), and a security enhancement Or-proof technique. We also present the parallel-PVR technique to decrease parameter values while maintaining the standard security level. Compared to other code-based IBI/IBS schemes, our schemes achieve not only preferable public parameter size, private key size, communication cost and signature length due to better parameter choices, but also provably secure. PMID:28809940

Provably secure identity-based identification and signature schemes from code assumptions.

PubMed

Song, Bo; Zhao, Yiming

2017-01-01

Code-based cryptography is one of few alternatives supposed to be secure in a post-quantum world. Meanwhile, identity-based identification and signature (IBI/IBS) schemes are two of the most fundamental cryptographic primitives, so several code-based IBI/IBS schemes have been proposed. However, with increasingly profound researches on coding theory, the security reduction and efficiency of such schemes have been invalidated and challenged. In this paper, we construct provably secure IBI/IBS schemes from code assumptions against impersonation under active and concurrent attacks through a provably secure code-based signature technique proposed by Preetha, Vasant and Rangan (PVR signature), and a security enhancement Or-proof technique. We also present the parallel-PVR technique to decrease parameter values while maintaining the standard security level. Compared to other code-based IBI/IBS schemes, our schemes achieve not only preferable public parameter size, private key size, communication cost and signature length due to better parameter choices, but also provably secure.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wexler, J.P.; Davis, L.; Mancini, D.

Cardioactive drugs may effect both the central and peripheral circulatory systems. The effects on the central and peripheral circulatory systems of chronic Captorpril therapy in 7 pts with severe congestive heart failure (CHF) were evaluated simultaneously. Skeletal muscle blood flow (SMBF) determined using 133-Xe washout and a Cd/Te detector, oxygen consumption (VO/sub 2/), and radial artery and femoral vein O/sub 2/ concentration difference (A-V) were determined at rest and peak upright bicycle exercise before (BT) and after (AT) 6-12 weeks of Captopril therapy. In CI pts there was a significant increase in VO/sub 2/ and SMBF AT vs BT. Inmore » contrast, in CNC pts there was no change in VO/sub 2/ and a significant decrease in SMBF AT vs BT. In pts with severe CHF who are CI, there is an apparent fall in peripheral vascular resistance (PVR). In contrast, in CNC pts there is an increase in PVR. This study demonstrates that SMBF determines using 133-Xe is an important method for determining the effects of cardioactive drugs.« less

A proposed application programming interface for a physical volume repository

NASA Technical Reports Server (NTRS)

Jones, Merritt; Williams, Joel; Wrenn, Richard

1996-01-01

The IEEE Storage System Standards Working Group (SSSWG) has developed the Reference Model for Open Storage Systems Interconnection, Mass Storage System Reference Model Version 5. This document, provides the framework for a series of standards for application and user interfaces to open storage systems. More recently, the SSSWG has been developing Application Programming Interfaces (APIs) for the individual components defined by the model. The API for the Physical Volume Repository is the most fully developed, but work is being done on APIs for the Physical Volume Library and for the Mover also. The SSSWG meets every other month, and meetings are open to all interested parties. The Physical Volume Repository (PVR) is responsible for managing the storage of removable media cartridges and for mounting and dismounting these cartridges onto drives. This document describes a model which defines a Physical Volume Repository, and gives a brief summary of the Application Programming Interface (API) which the IEEE Storage Systems Standards Working Group (SSSWG) is proposing as the standard interface for the PVR.

Exercise Physiology and Pulmonary Hemodynamic Abnormality in PH Patients with Exercise Induced Venous-To-Systemic Shunt.

PubMed

Guo, Jian; Shi, Xue; Yang, Wenlan; Gong, Sugang; Zhao, Qinhua; Wang, Lan; He, Jing; Shi, Xiaofang; Sun, Xingguo; Liu, Jinming

2014-01-01

To identify the pulmonary hypertension (PH) patients who develop an exercise induced venous-to-systemic shunt (EIS) by performing the cardiopulmonary exercise test (CPET), analyse the changes of CPET measurements during exercise and compare the exercise physiology and resting pulmonary hemodynamics between shunt-PH and no-shunt-PH patients. Retrospectively, resting pulmonary function test (PFT), right heart catheterization (RHC), and CPET for clinical evaluation of 104 PH patients were studied. Considering all 104 PH patients by three investigators, 37 were early EIS+, 61 were EIS-, 3 were late EIS+, and 3 others were placed in the discordant group. PeakVO2, AT and OUES were all reduced in the shunt-PH patients compared with the no-shunt-PH subjects, whereas VE/VCO2 slope and the lowest VE/VCO2 increased. Besides, the changes and the response characteristics of the key CPET parameters at the beginning of exercise in the shunt group were notably different from those of the no shunt one. At cardiac catheterization, the shunt patients had significantly increased mean pulmonary artery pressure (mPAP), mean right atrial pressure (mRAP) and pulmonary vascular resistance (PVR), reduced cardiac output (CO) and cardiac index (CI) compared with the no shunt ones (P<0.05). Resting CO was significantly correlated with exercise parameters of AT (r = 0.527, P<0.001), OUES (r = 0.410, P<0.001) and Peak VO2 (r = 0.405, P<0.001). PVR was significantly, but weakly, correlated with the above mentioned CPET parameters. CPET may allow a non-invasive method for detecting an EIS and assessing the severity of the disease in PH patients.

Evaluation of the Microcirculation in Chronic Thromboembolic Pulmonary Hypertension Patients: The Impact of Pulmonary Arterial Remodeling on Postoperative and Follow-Up Pulmonary Arterial Pressure and Vascular Resistance.

PubMed

Jujo, Takayuki; Sakao, Seiichiro; Ishibashi-Ueda, Hatsue; Ishida, Keiichi; Naito, Akira; Sugiura, Toshihiko; Shigeta, Ayako; Tanabe, Nobuhiro; Masuda, Masahisa; Tatsumi, Koichiro

2015-01-01

Chronic thromboembolic pulmonary hypertension (CTEPH) is generally recognized to be caused by persistent organized thrombi that occlude the pulmonary arteries. The aim of this study was to investigate the characteristics of small vessel remodeling and its impact on the hemodynamics in CTEPH patients. Hemodynamic data were obtained from right heart catheterization in 17 CTEPH patients before pulmonary endarterectomy (PEA). Lung tissue specimens were obtained at the time of PEA. Pathological observations and evaluation of quantitative changes in pulmonary muscular arteries and veins were performed using light microscopy on 423 slides in 17 patients. The relationship between the results and the hemodynamics of CTEPH was investigated. Pulmonary arteriopathy and venopathy were recognized in most cases, although no plexiform lesions and no capillary-hemangiomatosis-like lesions were detected in any of the specimens. The severity of pulmonary arteriopathy was correlated with pulmonary vascular resistance (PVR) in the postoperative and follow-up periods. The PVR and mean pulmonary arterial pressure were significantly higher in the high-obstruction group than in the low-obstruction group. The findings in pulmonary venopathy were similar to the findings seen in pulmonary veno-occlusive disease in some cases, although severe venopathy was only observed in a portion of the pulmonary veins. There was a significant correlation between the extent of pulmonary arteriopathy and venopathy, although an effect of pulmonary venopathy to hemodynamics, including pulmonary arterial wedged pressure (PAWP), could not be identified. The vascular remodeling of the pulmonary muscular arteries was closely associated with the hemodynamics of CTEPH. Severe pulmonary arteriopathy might be related to residual pulmonary hypertension after PEA. Those altered pulmonary arteries might be a new target for the persistent PH after the operation.

Efficacy and safety of TVT-O and TVT-Secur in the treatment of female stress urinary incontinence: 1-year follow-up.

PubMed

Tommaselli, Giovanni A; Di Carlo, Costantino; Gargano, Virginia; Formisano, Carmen; Scala, Mariamaddalena; Nappi, Carmine

2010-10-01

To reduce complications of transobturator tension-free vaginal tape, single-incision devices were introduced in the last years. We here report a comparison between the tension-free vaginal tape-obturator (TVT-O) and the TVT-Secur techniques in terms of efficacy and safety. Eighty-four patients with stress urinary incontinence (SUI) were scheduled to undergo TVT-O or TVT-Secur. Duration of the procedure, subjective estimate of blood loss, intraoperative and postoperative complications, postoperative postvoidal residue (PVR), time to first voiding, and pain level were recorded. Urodynamic tests, PVR, Incontinence Questionnaire Short Form (ICIQ-SF), King's Health Questionnaire, and a urinary diary were performed before and 12 months after procedure. No differences in terms of cure rate were observed between the two groups (81.6% vs. 83.8%). Complication rate in the TVT-Secur group was lower (8.1%) than in the TVT-O group (15.8%), but not significant. Both techniques seem to be effective and safe, with a low incidence of complications in both groups.

Integrating bio-prosthetic valves in the Fontan operation - Novel treatment to control retrograde flow in caval veins

NASA Astrophysics Data System (ADS)

Vukicevic, Marija; Conover, Timothy; Zhou, Jian; Hsia, Tain-Yen; Figliola, Richard

2012-11-01

For a child born with only one functional heart ventricle, the sequence of palliative surgeries typically culminates in the Fontan operation. This procedure is usually successful initially, but leads to later complications, for reasons not fully understood. Examples are respiratory-dependent retrograde flows in the caval and hepatic veins, and increased pulmonary vascular resistance (PVR), hypothesized to be responsible for elevated pressure in the liver and disease of the liver and intestines. Here we study the parameters responsible for retrograde flows in the inferior vena cava (IVC) and hepatic vein (HV), and investigate two novel interventions to control retrograde flow: implanting either a Medtronic Contegra valved conduit or an Edwards lifescience pericardial aortic valve in the IVC or HV. We performed the experiments in a multi-scale, patient specific mock circuit, with normal and elevated PVR, towards the optimization of the Fontan circulation. The results show that both valves can significantly reduce retrograde flows in the veins, suggesting potential advantages in the treatment of the patients with congenital heart diseases. Fondation Leducq

Development of oral CTL vaccine using a CTP-integrated Sabin 1 poliovirus-based vector system.

PubMed

Han, Seung-Soo; Lee, Jinjoo; Jung, Yideul; Kang, Myeong-Ho; Hong, Jung-Hyub; Cha, Min-Suk; Park, Yu-Jin; Lee, Ezra; Yoon, Cheol-Hee; Bae, Yong-Soo

2015-09-11

We developed a CTL vaccine vector by modification of the RPS-Vax system, a mucosal vaccine vector derived from a poliovirus Sabin 1 strain, and generated an oral CTL vaccine against HIV-1. A DNA fragment encoding a cytoplasmic transduction peptide (CTP) was integrated into the RPS-Vax system to generate RPS-CTP, a CTL vaccine vector. An HIV-1 p24 cDNA fragment was introduced into the RPS-CTP vector system and a recombinant poliovirus (rec-PV) named vRPS-CTP/p24 was produced. vRPS-CTP/p24 was genetically stable and efficiently induced Th1 immunity and p24-specific CTLs in immunized poliovirus receptor-transgenic (PVR-Tg) mice. In challenge experiments, PVR-Tg mice that were pre-immunized orally with vRPS-CTP/p24 were resistant to challenge with a lethal dose of p24-expressing recombinant vaccinia virus (rMVA-p24). These results suggested that the RPS-CTP vector system had potential for developing oral CTL vaccines against infectious diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

Myeloid-Related Protein-14/MRP-14/S100A9/Calgranulin B is Associated with Inflammation in Proliferative Diabetic Retinopathy.

PubMed

Abu El-Asrar, Ahmed M; Alam, Kaiser; Siddiquei, Mohammad M; Van den Eynde, Kathleen; Mohammad, Ghulam; De Hertogh, Gert; Opdenakker, Ghislain

2018-01-01

To investigate the expression of the leukocyte proteins myeloid-related protein (MRP)-8 and MRP-14 in proliferative diabetic retinopathy (PDR) and the effect of MRP-8/MRP-14 (calprotectin) heterodimer on induction of proinflammatory factors in human retinal microvascular endothelial cells (HRMEC). Epiretinal membranes from 20 patients with PDR and 10 patients with proliferative vitreoretinopathy (PVR), vitreous fluid samples from PDR and non-diabetic subjects and HRMEC were studied by immunohistochemistry and Western blot analysis. MRP-14 expression was localized in endothelial cells, leukocytes and myofibroblasts in all PDR membranes. MRP-8 expression was limited to intravascular leukocytes in 42% of the studied membranes. In PVR membranes, MRP-14 was expressed in leukocytes and myofibroblasts, whereas MRP-8 immunoreactivity was limited to leukocytes. MRP-14 was significantly upregulated in vitreous from PDR patients. MRP-8/MRP-14 (calprotectin) increased expression of intercellular adhesion molecule-1, but attenuated vascular cell adhesion molecule-1 expression in HRMEC. Increased MRP-14 levels are associated with inflammation in PDR.

Serenoa repens, lycopene and selenium versus tamsulosin for the treatment of LUTS/BPH. An Italian multicenter double-blinded randomized study between single or combination therapy (PROCOMB trial).

PubMed

Morgia, Giuseppe; Russo, Giorgio I; Voce, Salvatore; Palmieri, Fabiano; Gentile, Marcello; Giannantoni, Antonella; Blefari, Franco; Carini, Marco; Minervini, Andrea; Ginepri, Andrea; Salvia, Giuseppe; Vespasiani, Giuseppe; Santelli, Giorgio; Cimino, Sebastiano; Allegro, Rosalinda; Collura, Zaira; Fragalà, Eugenia; Arnone, Salvatore; Pareo, Rosaria M

2014-11-01

Phytotherapy has been used to treat patients with lower urinary tract symptoms (LUTS). We evaluated the efficacy and tolerability of combination therapy between Serenoa Repens (SeR), Lycopene (Ly), and Selenium (Se) + tamsulosin versus single therapies. PROCOMB trial (ISRCTN78639965) was a randomized double-blinded, double-dummy multicenter study of 225 patients between 55 and 80 years old, PSA ≤ 4 ng/ml, IPSS ≥12, prostate volume ≤60 cc, Qmax ≤15 ml/sec, postvoid residual urine (PVR) <150 ml. Participants were randomized group A (SeR-Se-Ly), group B (tamsulosin 0.4 mg), group C (SeR-Se-Ly + tamsulosin 0.4 mg). The primary endpoints of the study were the reduction of IPSS, PVR, and increase of Qmax in group C versus monotherapy groups. The decrease for combination therapy was significantly greater versus group A (P < 0.05) and group B (P < 0.01) for IPSS and versus group A (P < 0.01) for PVR from baseline to 6 months. A greater decrease in IPSS was observed for Group C versus group A (P < 0.01) and increase in Qmax versus group B (P < 0.01), from 6 months to 12 months. At one year, the changes of IPSS and Qmax were greater for Group C versus monotherapies (each comparison <0.05). The proportions of men with a decrease of at least three points (each comparison P < 0.05) and decrease of 25% for IPSS (each comparison P < 0.01) were greater for Group C. SeR-Se-Ly + tamsulosin therapy is more effective than single therapies in improving IPSS and increasing Qmax in patients with LUTS. © 2014 Wiley Periodicals, Inc.

Efficacy and Safety of the Selective α1A-Adrenoceptor Blocker Silodosin for Severe Lower Urinary Tract Symptoms Associated With Benign Prostatic Hyperplasia: A Prospective, Single-Open-Label, Multicenter Study in Korea

PubMed Central

Moon, Ki Hak; Song, Phil Hyun; Yang, Dae Yul; Park, Nam Cheol; Kim, Soo Woong; Lee, Sung Won; Kim, Sae Woong; Moon, Du Geon; Park, Jong Kwan; Ahn, Tai Young

2014-01-01

Purpose To evaluate the efficacy and safety of silodosin 8 mg once daily in a 12-week treatment of subjects with severe lower urinary tract symptoms (LUTS) associated with benign prostatic hyperplasia (BPH). Materials and Methods A total of 100 subjects from 10 urology centers in Korea were included in this study. The inclusion criteria were as follows: age ≥50 years, International Prostate Symptom Score (IPSS) ≥20, quality of life (QoL) score ≥3, urine volume ≥120 mL and maximal urinary flow rate (Qmax) <15 mL/s, and postvoid residual volume (PVR) <100 mL. We assessed the improvement of LUTS with change in IPSS, QoL score, Qmax, PVR, and adverse events at baseline and 4 and 12 weeks after treatment with silodosin 8 mg once daily. Results The IPSS values were 23.27±3.34, 15.89±6.26, and 13.80±6.31 at baseline, 4, and 12 weeks, respectively, with significant improvements (p<0.0001, p=0.0214, respectively). QoL scores were 4.44±0.85, 3.38±1.20, and 3.04±1.20 at baseline, 4, and 12 weeks, respectively, and the differences were statistically significant (p<0.0001). There was a significant difference in Qmax between baseline and 12 weeks (p<0.0001) but not in PVR (p=0.9404) during the clinical trial. The most frequent adverse event in this study was ejaculation failure with 13 cases. However, no subject dropped out because of ejaculation failure, and in 12 of the 13 cases it was fully resolved without further treatment. Conclusions Silodosin 8 mg once daily may be effective and safe in Korean patients with severe LUTS associated with BPH. PMID:24868338

Photoselective vaporization of the prostate with GreenLight 120-W laser versus transurethral resection of the prostate for benign prostatic hyperplasia: a systematic review with meta-analysis of randomized controlled trials.

PubMed

Zang, Ya-Chen; Deng, Xin-Xi; Yang, Dong-Rong; Xue, Bo-Xin; Xu, Li-Jun; Liu, Xiao-Long; Zhou, Yi-Bin; Shan, Yu-Xi

2016-02-01

The aim of this study is to assess the overall efficacy and safety of photoselective vaporization of the prostate (PVP) with GreenLight 120-W laser versus transurethral resection of the prostate (TURP) for treating patients of benign prostate hyperplasia (BPH) with lower urinary tract symptoms (LUTS). We performed a literature search of The Cochrane Library and the electronic databases, including Embase, Medline, and Web of Science. Manual searches were conducted of the conference proceedings, including European Association of Urology and American Urological Association (2007 to 2012). Outcomes reviewed included clinical baseline characteristics, perioperative data, complications, and postoperative functional results, such as postvoid residual (PVR), international prostate symptom score (IPSS), quality of life (QoL), and maximum flow rate (Qmax). Six randomized controlled trials (RCTs) were enrolled. Three hundred and forty-seven patients undergone 120-W PVP, and 350 patients were treated with TURP in the RCTs. There were no significant differences for clinical characteristics in these trials. In perioperative data, catheterization time and length of hospital stay were shorter in the PVP group. However, the operation time was shorter in the TURP group. Capsular perforation, blood transfusion, clot retention, and macroscopic hematuria were markedly less likely in PVP-treated subjects. The other complications between PVP and TURP did not demonstrate a statistic difference. There were no significant differences in QoL, PVR, IPSS, and Qmax in the 1, 3, 6, 12, and 24 months of postoperative follow-up. There was no significant difference at postoperation follow-up of functional outcomes including IPSS, PVR, Qmax, and QoL between the TURP-treated subjects and PVP-treated subjects. Owing to a shorter catheterization time, reduced hospital duration and less complication, PVP could be used as an alternative and a promising minimal invasive surgical procedure for the treatment of BPH.

Successful prolonged ex vivo lung perfusion for graft preservation in rats.

PubMed

Noda, Kentaro; Shigemura, Norihisa; Tanaka, Yugo; Bhama, Jay K; D'Cunha, Jonathan; Luketich, James D; Bermudez, Christian A

2014-03-01

Ex vivo lung perfusion (EVLP) strategies represent a new frontier in lung transplantation technology, and there have been many clinical studies of EVLP in lung transplantation. The establishment of a reliable EVLP model in small animals is crucial to facilitating translational research using an EVLP strategy. The main objective of this study was to develop a reproducible rat EVLP (R-EVLP) model that enables prolonged evaluation of the explanted lung during EVLP and successful transplantation after EVLP. The donor heart-lung blocks were procured with cold low-potassium dextran solution and immersed in the solution for 1 h at 4 °C. And then, the heart-lung blocks were flushed retrogradely and warmed up to 37 °C in a circuit perfused antegradely with acellular perfusate. The perfusate was deoxygenated with a gas mixture (6% O2, 8% CO2, 86% N2). The perfusion flow was maintained at 20% of the entire cardiac output. At 37 °C, the lungs were mechanically ventilated and perfusion continued for 4 h. Every hour, the perfused lung was evaluated for gas exchange, dynamic lung compliance (Cdyn) and pulmonary vascular resistance (PVR). R-EVLP was performed for 4 h. Pulmonary oxygenation ability (pO2/pCO2) was stable for 4 h during EVLP. It was noted that Cdyn and PVR were also stable. After 4 h of EVLP, pO2 was 303 ± 19 mmHg, pCO2 was 39.6 ± 1.2 mmHg, PVR was 1.75 ± 0.10 mmHg/ml/min and Cdyn was 0.37 ± 0.03 ml/cmH2O. Lungs that were transplanted after 2 h of R-EVLP resulted in significantly better post-transplant oxygenation and compliance when compared with those after standard cold static preservation. Our R-EVLP model maintained stable lung oxygenation, compliance and vascular resistance for up to 4 h of perfusion duration. This reliable model should facilitate further advancement of experimental work using EVLP.

NT-proBNP and exercise capacity in adult patients with congenital heart disease and a prosthetic valve: a multicentre PROSTAVA study.

PubMed

Schoonbeek, R C; Pieper, P G; van Slooten, Y J; Freling, H G; Sieswerda, G T; van Dijk, A P J; Jongbloed, M R M; Post, M C; Bouma, B J; Berger, R M F; Ebels, T; van Melle, J P

2016-11-01

N-terminal B‑type natriuretic peptide (NT-proBNP) is an important biomarker for the detection of heart failure. Adults with congenital heart disease (ACHD) and a prosthetic heart valve are at risk for heart failure. This study aimed to determine the value of NT-proBNP in ACHD patients with a prosthetic valve and investigate its relationship with cardiac function and exercise capacity. In this multi-centre cross-sectional observational study, data regarding medical history, echocardiography, exercise testing (VO 2 peak) and laboratory blood evaluation (including NT-proBNP) were collected in ACHD patients with a single prosthetic valve (either homografts, heterografts or mechanical valves). A total of 306 ACHD patients with pulmonary valve replacement (PVR, n = 139), aortic valve replacement (n = 141), mitral valve replacement (n = 21) or tricuspid valve replacement (n = 5) were investigated. The majority of patients (77 %) were in NYHA class I or II. Elevated NT-proBNP levels (cut-off ≥125 pg/ml) were found in 50 % of the patients, with the highest levels in patients with mitral valve replacements. In this study population, NT-proBNP levels were associated with gender (p = 0.029) and VO 2 max (p < 0.001). In PVR patients, NT-proBNP levels were associated with lower VO 2 peak, also after adjustment for age, gender and age at valve replacement in a multivariate model (p = 0.015). In patients with ACHD and a prosthetic valve, elevated NT-proBNP levels are frequently observed despite preserved NYHA class. In PVR patients, a higher NT-proBNP level was associated with a lower VO 2 peak. These results may be of importance in the ongoing discussion about the timing of valve replacement in patients with CHD.

Determinants and prognostic implications of the negative diastolic pulmonary pressure gradient in patients with pulmonary hypertension due to left heart disease.

PubMed

Nagy, Anikó Ilona; Venkateshvaran, Ashwin; Merkely, Béla; Lund, Lars H; Manouras, Aristomenis

2017-01-01

The diastolic pulmonary pressure gradient (DPG) has recently been introduced as a specific marker of combined pre-capillary pulmonary hypertension (Cpc-PH) in left heart disease (LHD). However, its diagnostic and prognostic superiority compared with traditional haemodynamic indices has been challenged lately. Current recommendations explicitly denote that in the normal heart, DPG values are greater than zero, with DPG ≥7 mmHg indicating Cpc-PH. However, clinicians are perplexed by the frequent observation of DPG <0 mmHg (DPG NEG ), as its physiological explanation and clinical impact are unclear to date. We hypothesized that large V-waves in the pulmonary artery wedge pressure (PAWP) curve yielding asymmetric pressure transmission might account for DPG NEG and undertook this study to clarify the physiological and prognostic implications of DPG NEG . Right heart catheterization and echocardiography were performed in 316 patients with LHD due to primary myocardial dysfunction or valvular disease. A total of 256 patients had PH-LHD, of whom 48% demonstrated DPG NEG . The V-wave amplitude inversely correlated with DPG (r = -0.45, P < 0.001) in patients with low pulmonary vascular resistance (PVR), but not in those with elevated PVR (P > 0.05). Patients with large V-waves had negative and lower DPG than those without augmented V-waves (P < 0.001) despite similar PVR (P >0.05). Positive, but normal DPG (0-6 mmHg) carried a worse 2-year prognosis for death and/or heart transplantation than DPG NEG (hazard ratio 2.97; P < 0.05). Our results advocate against DPG NEG constituting a measurement error. We propose that DPG NEG can partially be ascribed to large V-waves and carries a better prognosis than DPG within the normal positive range. © 2016 The Authors. European Journal of Heart Failure © 2016 European Society of Cardiology.

Photoselective vaporization of the prostate for the treatment of benign prostatic hyperplasia: 12-month results from the first United States multicenter prospective trial.

PubMed

Te, Alexis E; Malloy, Terrence R; Stein, Barry S; Ulchaker, James C; Nseyo, Unyime O; Hai, Mahmood A; Malek, Reza S

2004-10-01

We report the 1-year efficacy and safety of photoselective vaporization of the prostate (PVP) for symptomatic and obstructive benign prostatic hyperplasia (BPH). A prospective clinical trial was performed in 139 men clinically diagnosed with symptomatic bladder outlet obstruction secondary to BPH who were enrolled and treated with a high power, 80 W, quasicontinuous wave potassium-titanyl-phosphate laser at 6 American medical centers across the country. Efficacy parameters were mean and percent changes from baseline in the American Urological Association Symptom Index (AUA-SI) score, quality of life score (QOL), peak urinary flow rate (Qmax), post-void residual urine volume (PVR) and transrectal ultrasound prostate volume measurement. Patients were evaluated 1, 3, 6 and 12 months following treatment. At each followup evaluation side effects were elicited. Significant improvements in AUA-SI score, QOL score, Qmax and PVR were noted as early as 1 month after PVP treatment. At 12 months the mean AUA-SI score decreased from 23.9 to 4.3 (p <0.0001) and the QOL score decreased from 4.3 to 1.1 (p <0.0001), while mean Qmax increased from 7.8 to 22.6 ml per second (p <0.0001). PVR decreased from 114.3 to 24.8 ml (p <0.0001), while the transrectal ultrasound volume reduction went from 54.6 ml at baseline to 34.4 ml. There was no significant blood loss or fluid absorption during or immediately after PVP. Complications consisted of transient hematuria, dysuria and urinary retention in 12 (8.6%), 13 (9.3%) and 7 (5%) patients, respectively. PVP is a unique, safe and effective outpatient modality that provides immediate symptomatic and urodynamic relief of bladder outlet obstruction secondary to BPH. Long-term followup is needed to validate further the maintenance of clinical efficacy beyond 1 year.

Decellularized fresh homografts for pulmonary valve replacement: a decade of clinical experience†

PubMed Central

Sarikouch, Samir; Horke, Alexander; Tudorache, Igor; Beerbaum, Philipp; Westhoff-Bleck, Mechthild; Boethig, Dietmar; Repin, Oleg; Maniuc, Liviu; Ciubotaru, Anatol; Haverich, Axel; Cebotari, Serghei

2016-01-01

OBJECTIVES Decellularized homografts have shown auspicious early results when used for pulmonary valve replacement (PVR) in congenital heart disease. The first clinical application in children was performed in 2002, initially using pre-seeding with endogenous progenitor cells. Since 2005, only non-seeded, fresh decellularized allografts have been implanted after spontaneous recellularization was observed by several groups. METHODS A matched comparison of decellularized fresh pulmonary homografts (DPHs) implanted for PVR with cryopreserved pulmonary homografts (CHs) and bovine jugular vein conduits (BJVs) was conducted. Patients’ age at implantation, the type of congenital malformation, number of previous cardiac operations and number of previous PVRs were considered for matching purposes, using an updated contemporary registry of right ventricular outflow tract conduits (2300 included conduits, >12 000 patient-years). RESULTS A total of 131 DPHs were implanted for PVR in the period from January 2005 to September 2015. Of the 131, 38 were implanted within prospective trials on DPH from October 2014 onwards and were therefore not analysed within this study. A total of 93 DPH patients (58 males, 35 females) formed the study cohort and were matched to 93 CH and 93 BJV patients. The mean age at DPH implantation was 15.8 ± 10.21 years (CH 15.9 ± 10.4, BJV 15.6 ± 9.9) and the mean DPH diameter was 23.9 mm (CH 23.3 ± 3.6, BJV 19.9 ± 2.9). There was 100% follow-up for DPH, including 905 examinations with a mean follow-up of 4.59 ± 2.76 years (CH 7.4 ± 5.8, BJV 6.4 ± 3.8), amounting to 427.27 patient-years in total (CH 678.3, BJV 553.0). Tetralogy-of-Fallot was the most frequent malformation (DPH 50.5%, CH 54.8%, BJV 68.8%). At 10 years, the rate of freedom of explantation was 100% for DPH, 84.2% for CH (P = 0.01) and 84.3% for BJV (P= 0.01); the rate of freedom from explantation and peak trans-conduit gradient ≥50 mmHg was 86% for DPH, 64% for CH (n.s.) and 49% for BJV (P < 0.001); the rate of freedom from infective endocarditis (IE) was 100% for DPH, 97.3 ± 1.9% within the matched CH patients (P = 0.2) and 94.3 ± 2.8% for BJV patients (P = 0.06). DPH valve annulus diameters converged towards normal Z-values throughout the observation period, in contrast to other valve prostheses (BJV). CONCLUSIONS Mid-term results of DPH for PVR confirm earlier results of reduced re-operation rates compared with CH and BJV. PMID:27013071

Impact of pre-transplant pulmonary hypertension on survival after heart transplantation: a UNOS registry analysis.

PubMed

Vakil, Kairav; Duval, Sue; Sharma, Alok; Adabag, Selcuk; Abidi, Kashan Syed; Taimeh, Ziad; Colvin-Adams, Monica

2014-10-20

Severe pre-transplant pulmonary hypertension (PH) has been associated with adverse short-term clinical outcomes after heart transplantation in relatively small single-center studies. The impact of pre-transplant PH on long-term survival after heart transplantation has not been examined in a large, multi-center cohort. Adults (≥18 years) who underwent first time heart transplantation in the United States between 1987 and 2012 were retrospectively identified from the United Network for Organ Sharing registry. Pre-transplant PH was classified as mild, moderate, or severe based on pulmonary vascular resistance (PVR), trans-pulmonary gradient (TPG), and pulmonary artery (PA) mean pressure. Primary outcome was all-cause mortality. Data from 26,649 heart transplant recipients (mean age 52±12 years; 76% male; 76% Caucasian) were analyzed. During a mean follow-up of 5.7±4.8 years, there were 10,334 (39%) deaths. Pre-transplant PH (PVR≥2.5 WU) was a significant predictor of mortality (hazard ratio 1.10, 95% confidence interval 1.05-1.14, p<0.0001) in multivariable analysis. However, the severity of pre-transplant PH (mild/moderate vs. severe) did not affect short or long-term survival. Similarly, even in patients who were supported with either a left ventricular assist device or a total artificial heart prior to transplant, severe pre-transplant PH was not associated with worse survival when compared to patients with mild/moderate pre-transplant PH. Pre-transplant PH (PVR≥2.5 WU) is associated with a modest increase in mortality when compared to patients without pre-transplant PH. However, the severity of pre-transplant PH, assessed by PVR, TPG, or mean PA pressure, is not a discriminating factor for poor survival in patients listed for heart transplantation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Prostatic Arterial Embolization Treating Moderate-to-Severe Lower Urinary Tract Symptoms Related to Benign Prostate Hyperplasia: A Meta-Analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feng, Shijian; Tian, Ye; Liu, Wei

PurposeTo evaluate the clinical efficiency and safety of PAE treating moderate-to-severe LUTS related to BPH.Materials and MethodsA systematic literature search was performed using PUBMED, EMBASE, Cochrane database of systematic review, and Web of Science, up to April 2016, to identify eligible studies. The Cochrane Collaboration’s RevMan 5.3 was used to analyze the extracted data. Random- or fixed-effect model was selected to fit the pooled out heterogeneity.Results20 eligible studies were included in this meta-analysis. Synthetic data showed that there were statistically significant improvements in IPSS (MD = −13.25; 95% CI −14.81 to −11.69; P < 0.00001), QoL score (MD = −2.34; 95% CI −2.69 to −2.00, P < 0.00001),more » PSA level (MD = −1.33; 95% CI −1.86 to −0.80; P < 0.00001), PV (MD = −28.00; 95% CI −35.94 to −20.07; P < 0.00001), Qmax (MD = 5.51; 95% CI 4.62 to 6.40; P < 0.00001), and PVR (MD = −67.8; 95% CI −81.35 to −53.60; P < 0.00001). There was no significant difference in IIEF score (MD = 0.93; 95% CI 0.43–1.42; P = 0.07). Major complications following PAE include pain in the perineum, retropubic area, and/or urethra (9.4%), and hematuria (9.0%).ConclusionsPAE should be considered to be the very promising alternative treatment for those who do not want or cannot tolerate surgical treatment, with its benefits on IPSS, QoL score, PSA level, PV, Qmax, and PVR without affecting erectile function.« less

Evaluation of the Microcirculation in Chronic Thromboembolic Pulmonary Hypertension Patients: The Impact of Pulmonary Arterial Remodeling on Postoperative and Follow-Up Pulmonary Arterial Pressure and Vascular Resistance

PubMed Central

Ishida, Keiichi; Naito, Akira; Sugiura, Toshihiko; Shigeta, Ayako; Tanabe, Nobuhiro; Masuda, Masahisa; Tatsumi, Koichiro

2015-01-01

Background Chronic thromboembolic pulmonary hypertension (CTEPH) is generally recognized to be caused by persistent organized thrombi that occlude the pulmonary arteries. The aim of this study was to investigate the characteristics of small vessel remodeling and its impact on the hemodynamics in CTEPH patients. Methods and Results Hemodynamic data were obtained from right heart catheterization in 17 CTEPH patients before pulmonary endarterectomy (PEA). Lung tissue specimens were obtained at the time of PEA. Pathological observations and evaluation of quantitative changes in pulmonary muscular arteries and veins were performed using light microscopy on 423 slides in 17 patients. The relationship between the results and the hemodynamics of CTEPH was investigated. Pulmonary arteriopathy and venopathy were recognized in most cases, although no plexiform lesions and no capillary-hemangiomatosis-like lesions were detected in any of the specimens. The severity of pulmonary arteriopathy was correlated with pulmonary vascular resistance (PVR) in the postoperative and follow-up periods. The PVR and mean pulmonary arterial pressure were significantly higher in the high-obstruction group than in the low-obstruction group. The findings in pulmonary venopathy were similar to the findings seen in pulmonary veno-occlusive disease in some cases, although severe venopathy was only observed in a portion of the pulmonary veins. There was a significant correlation between the extent of pulmonary arteriopathy and venopathy, although an effect of pulmonary venopathy to hemodynamics, including pulmonary arterial wedged pressure (PAWP), could not be identified. Conclusion The vascular remodeling of the pulmonary muscular arteries was closely associated with the hemodynamics of CTEPH. Severe pulmonary arteriopathy might be related to residual pulmonary hypertension after PEA. Those altered pulmonary arteries might be a new target for the persistent PH after the operation. PMID:26252755

NOISECHECK Procedures for Measuring Noise Exposure from Aircraft Operations

DTIC Science & Technology

1980-11-01

in § afterburner , 8 min € MIL PVR, 8 min 6 80« rpm, and 20 min « idle). Aircraft Maintenance and Runup Log Procedure 1. Log every maintenance...OoMirtnat OltUnct »it« Profilt & SEL utt Eq. l Stipolt- « tnt I Fro» lorkihttt 7 NOISEFILE Sa ♦ 4 SEL Sltnt OltUnct WtSEFlLE SEL Mrtrift

STS-117 ISS configuration

NASA Image and Video Library

2007-02-01

JSC2007-E-06523 (February 2007) --- Computer-generated artist's rendering of the International Space Station after Space Shuttle Atlantis' (STS-117/13A) undocking and departure. The image shows the addition of the second and third starboard truss segments (S3/S4) with Photovoltaic Radiator (PVR) and the deployed third set of solar arrays. P6 starboard solar array wing and one radiator are retracted.

[Investigation of urinary management after removal of indwelling urethral catheters in a general hospital: associations between bedridden state and impaired bladder emptying].

PubMed

Tsuchiyama, Katsuki; Ueki, Osamu; Minami, Hidero; Kawaguchi, Kouhei; Aoki, Yoshitaka; Yokoyama, Osamu

2010-06-01

In this study we investigated the influences of decreased levels of activities of daily living (ADL), especially in bedridden patients,on lower urinary tract dysfunction and urinary management during hospital care. All 1,106 non-urological inpatients (896 non-bedridden patients and 210 bedridden patients) with an indwelling urethral catheter treated at Noto General Hospital between April 2006 and October 2009 were retrospectively evaluated. Maximum bladder capacity and post-void residual urine volume (PVR) were evaluated with uroflowmetry or voiding cystourethrography at the time the catheter was removed. Clean intermittent catheterization (CIC) and drug administration were performed for patients who had a PVR of 100 ml or more. Bedridden patients required urinary interventions at a higher rate than did non-bedridden patients (bedridden : 29.0%,non-bedridden : 17.6%). Although indwelling urethral catheters were reinserted in 13 patients in the bedridden group and 16 patients in the non-bedridden group,many patients in both groups could be free from the catheter. Our results indicate that patients with low ADL are vulnerable to impaired bladder emptying,and early diagnosis of impaired bladder emptying and active urinary management are required to solve their urinary problems.

Accurate palm vein recognition based on wavelet scattering and spectral regression kernel discriminant analysis

NASA Astrophysics Data System (ADS)

Elnasir, Selma; Shamsuddin, Siti Mariyam; Farokhi, Sajad

2015-01-01

Palm vein recognition (PVR) is a promising new biometric that has been applied successfully as a method of access control by many organizations, which has even further potential in the field of forensics. The palm vein pattern has highly discriminative features that are difficult to forge because of its subcutaneous position in the palm. Despite considerable progress and a few practical issues, providing accurate palm vein readings has remained an unsolved issue in biometrics. We propose a robust and more accurate PVR method based on the combination of wavelet scattering (WS) with spectral regression kernel discriminant analysis (SRKDA). As the dimension of WS generated features is quite large, SRKDA is required to reduce the extracted features to enhance the discrimination. The results based on two public databases-PolyU Hyper Spectral Palmprint public database and PolyU Multi Spectral Palmprint-show the high performance of the proposed scheme in comparison with state-of-the-art methods. The proposed approach scored a 99.44% identification rate and a 99.90% verification rate [equal error rate (EER)=0.1%] for the hyperspectral database and a 99.97% identification rate and a 99.98% verification rate (EER=0.019%) for the multispectral database.

A review of wave mechanics in the pulmonary artery with an emphasis on wave intensity analysis.

PubMed

Su, J; Hilberg, O; Howard, L; Simonsen, U; Hughes, A D

2016-12-01

Mean pulmonary arterial pressure and pulmonary vascular resistance (PVR) remain the most common haemodynamic measures to evaluate the severity and prognosis of pulmonary hypertension. However, PVR only captures the non-oscillatory component of the right ventricular hydraulic load and neglects the dynamic compliance of the pulmonary arteries and the contribution of wave transmission. Wave intensity analysis offers an alternative way to assess the pulmonary vasculature in health and disease. Wave speed is a measure of arterial stiffness, and the magnitude and timing of wave reflection provide information on the degree of impedance mismatch between the proximal and distal circulation. Studies in the pulmonary artery have demonstrated distinct differences in arterial wave propagation between individuals with and without pulmonary vascular disease. Notably, greater wave speed and greater wave reflection are observed in patients with pulmonary hypertension and in animal models exposed to hypoxia. Studying wave propagation makes a valuable contribution to the assessment of the arterial system in pulmonary hypertension, and here, we briefly review the current state of knowledge of the methods used to evaluate arterial waves in the pulmonary artery. © 2016 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.

Assessment of the relative merits of a few methods to detect evolutionary trends.

PubMed

Laurin, Michel

2010-12-01

Some of the most basic questions about the history of life concern evolutionary trends. These include determining whether or not metazoans have become more complex over time, whether or not body size tends to increase over time (the Cope-Depéret rule), or whether or not brain size has increased over time in various taxa, such as mammals and birds. Despite the proliferation of studies on such topics, assessment of the reliability of results in this field is hampered by the variability of techniques used and the lack of statistical validation of these methods. To solve this problem, simulations are performed using a variety of evolutionary models (gradual Brownian motion, speciational Brownian motion, and Ornstein-Uhlenbeck), with or without a drift of variable amplitude, with variable variance of tips, and with bounds placed close or far from the starting values and final means of simulated characters. These are used to assess the relative merits (power, Type I error rate, bias, and mean absolute value of error on slope estimate) of several statistical methods that have recently been used to assess the presence of evolutionary trends in comparative data. Results show widely divergent performance of the methods. The simple, nonphylogenetic regression (SR) and variance partitioning using phylogenetic eigenvector regression (PVR) with a broken stick selection procedure have greatly inflated Type I error rate (0.123-0.180 at a 0.05 threshold), which invalidates their use in this context. However, they have the greatest power. Most variants of Felsenstein's independent contrasts (FIC; five of which are presented) have adequate Type I error rate, although two have a slightly inflated Type I error rate with at least one of the two reference trees (0.064-0.090 error rate at a 0.05 threshold). The power of all contrast-based methods is always much lower than that of SR and PVR, except under Brownian motion with a strong trend and distant bounds. Mean absolute value of error on slope of all FIC methods is slightly higher than that of phylogenetic generalized least squares (PGLS), SR, and PVR. PGLS performs well, with low Type I error rate, low error on regression coefficient, and power comparable with some FIC methods. Four variants of skewness analysis are examined, and a new method to assess significance of results is presented. However, all have consistently low power, except in rare combinations of trees, trend strength, and distance between final means and bounds. Globally, the results clearly show that FIC-based methods and PGLS are globally better than nonphylogenetic methods and variance partitioning with PVR. FIC methods and PGLS are sensitive to the model of evolution (and, hence, to branch length errors). Our results suggest that regressing raw character contrasts against raw geological age contrasts yields a good combination of power and Type I error rate. New software to facilitate batch analysis is presented.

Annexin A2 in Proliferative Vitreoretinopathy

DTIC Science & Technology

2016-10-01

migrate in the presence of macrophages in an in vitro system. In addition, analysis of human retinal tissue from subjects undergoing ocular surgery... tissue from subjects undergoing ocular surgery for PVR reveals the presence of A2- immunoreactive cells that express both macrophage and RPE cell...greatly attenuated in the absence of annexin A2. Task 2: Macrophage depletion and tissue specific knockout. We have completed the characterization

The efficacy of mirabegron additional therapy for lower urinary tract symptoms after treatment with α1-adrenergic receptor blocker monotherapy: prospective analysis of elderly men.

PubMed

Matsuo, Tomohiro; Miyata, Yasuyoshi; Kakoki, Katsura; Yuzuriha, Miki; Asai, Akihiro; Ohba, Kojiro; Sakai, Hideki

2016-07-29

Mirabegron is a β3-adrenoreceptor agonist developed for treatment of overactive bladder (OAB). α1-Adrenergic receptor blockers are effective for lower urinary tract symptoms (LUTS) in male patients. However, the efficacy of mirabegron additional treatment in elderly male patients with persistent male LUTS, especially in OAB after monotherapy with α1-adrenergic blockers, is not fully understood. This study was conducted in male LUTS patients who were ≥ 65 years of age and had persistent OAB symptoms, regardless of whether they took an α1-adrenergic receptor blocker orally. Before and 12 weeks after mirabegron additional therapy (50 mg once daily), we evaluated the efficacy of this treatment using the Overactive Bladder Symptom Score (OABSS) and International Prostate Symptom Score (IPSS), and changes in the maximum flow rate (Qmax) and post-void residual urine volume (PVR). We evaluated patients overall and divided into two groups by age: young-old (from 65 to 74 years old) and old-old (from 75 to 84 years old). Fifty men were enrolled in this study. Mirabegron additional therapy improved the total OABSS, total IPSS, and IPSS-quality of life (QOL) score. The voided volume (VV) and Qmax improved after treatment in patients overall. However, there was no significant change in PVR. The total OABSS, total IPSS, and IPSS-QOL score significantly improved in both of the young-old and old-old groups. However, a significant increasing of VV was detected in the young-old group. There were no significant differences in the Qmax or PVR in either group. Mirabegron additional therapy was effective for male patients whose persistent LUTS and particularly OAB was not controlled with α1-adrenergic receptor blocker monotherapy, and mirabegron did not have negative effects on voiding function. Additionally, mirabegron additional therapy was considered effective regardless of patient age. Trial registration number (TRN) trial registration number (TRN) and date of registration: ISRCTN16759097 in July 8, 2016.

Vitreous-induced cytoskeletal rearrangements via the Rac1 GTPase-dependent signaling pathway in human retinal pigment epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Xionggao; Department of Ophthalmology, Hainan Medical College, Haikou; Wei, Yantao

2012-03-09

Highlights: Black-Right-Pointing-Pointer Vitreous induces morphological changes and cytoskeletal rearrangements in RPE cells. Black-Right-Pointing-Pointer Rac1 is activated in vitreous-transformed RPE cells. Black-Right-Pointing-Pointer Rac inhibition prevents morphological changes in vitreous-transformed RPE cells. Black-Right-Pointing-Pointer Rac inhibition suppresses cytoskeletal rearrangements in vitreous-transformed RPE cells. Black-Right-Pointing-Pointer The vitreous-induced effects are mediated by a Rac1 GTPase/LIMK1/cofilin pathway. -- Abstract: Proliferative vitreoretinopathy (PVR) is mainly caused by retinal pigment epithelial (RPE) cell migration, invasion, proliferation and transformation into fibroblast-like cells that produce the extracellular matrix (ECM). The vitreous humor is known to play an important role in PVR. An epithelial-to-mesenchymal transdifferentiation (EMT) of human RPE cells inducedmore » by 25% vitreous treatment has been linked to stimulation of the mesenchymal phenotype, migration and invasion. Here, we characterized the effects of the vitreous on the cell morphology and cytoskeleton in human RPE cells. The signaling pathway that mediates these effects was investigated. Serum-starved RPE cells were incubated with 25% vitreous, and the morphological changes were examined by phase-contrast microscopy. Filamentous actin (F-actin) was examined by immunofluorescence and confocal microscopy. Protein phosphorylation of AKT, ERK1/2, Smad2/3, LIM kinase (LIMK) 1 and cofilin was analyzed by Western blot analysis. Vitreous treatment induced cytoskeletal rearrangements, activated Rac1 and enhanced the phosphorylation of AKT, ERK1/2 and Smad2/3. When the cells were treated with a Rac activation-specific inhibitor, the cytoskeletal rearrangements were prevented, and the phosphorylation of Smad2/3 was blocked. Vitreous treatment also enhanced the phosphorylation of LIMK1 and cofilin and the Rac inhibitor blocked this effect. We propose that vitreous-transformed human RPE cells undergo cytoskeletal rearrangements via Rac1 GTPase-dependent pathways that modulate LIMK1 and cofilin activity. The TGF{beta}-like activity of the vitreous may participate in this effect. Actin polymerization causes the cytoskeletal rearrangements that lead to the plasticity of vitreous-transformed RPE cells in PVR.« less

Exercise during cardiac catheterization distinguishes between pulmonary and left ventricular causes of dyspnea in systemic sclerosis patients.

PubMed

Hager, W David; Collins, Irina; Tate, Janet P; Azrin, Michael; Foley, Raymond; Lakshminarayanan, Santha; Rothfield, Naomi F

2013-07-01

The cause for shortness of breath among systemic sclerosis (SSc) patients is often lacking. We sought to characterize the hemodynamics of these patients by using simple isotonic arm exercise during cardiac catheterization. Catheterization was performed in 173 SSc patients when resting echocardiographic pulmonary systolic pressures were <40 but >40 mmHg post stress. Patients with resting mean pulmonary arterial pressures (mPAP) ≤ 25 and pulmonary arterial wedge pressures (PAWP) ≤ 15 mmHg exercised with 1-pound hand weights. Normal exercise was defined as a change in mPAP divided by the change in cardiac output (CO) (ΔmPAP/ΔCO) ratio ≤ 2 for patients <50 years (≤3 for >50). An abnormal ΔmPAP/ΔCO ratio, an exercise transpulmonary gradient (TPG) ≥ 15, a PAWP < 20, a ΔTPG > ΔPAWP and a pulmonary vascular resistance (PVR) which increased defined exercise-induced pulmonary arterial hypertension (EIPAH). An abnormal ΔmPAP/ΔCO ratio, an exercise TPG < 15, a PAWP ≥ 20, a ΔTPG < ΔPAWP and a drop in PVR defined left ventricular diastolic dysfunction (DD). Twelve patients without SSc served as controls. Pulmonary pressures increased with exercise in 53 patients. Six had EIPAH and 47 had DD. With exercise, mPAP and PAWP were 20 ± 4 and 13 ± 2 in controls, 36 ± 3 and 12 ± 4 in EIPAH and 34 ± 6 and 26 ± 4 in DD. Control ΔmPAP/ΔCO was 0.8 ± 0.7, 7.5 ± 3.9 in EIPAH and 9.1 ± 7.2 in DD. Rest and exercise TPG was normal for control and DD patients but increased (12 ± 4 to 23 ± 4) in EIPAH (P < 0.0001). PVR decreased in DD but increased in EIPAH with exercise. Exercise during catheterization elucidates the pathophysiology of dyspnea and distinguishes EIPAH from the more common DD in SSc patients. © 2012 John Wiley & Sons Ltd.

Medical Therapy Versus Balloon Angioplasty for CTEPH: A Systematic Review and Meta-Analysis.

PubMed

Phan, Kevin; Jo, Helen E; Xu, Joshua; Lau, Edmund M

2018-01-01

A significant number of chronic thromboembolic pulmonary hypertension (CTEPH) patients will have an inoperable disease. Medical therapy and balloon pulmonary angioplasty (BPA) have provided alternate therapeutic options for patients with inoperable CTEPH, although there are a limited number of published studies examining the outcomes. Thus, our study aims to evaluate and compare the efficacy of medical therapy and BPA in patients with inoperable CTEPH. An electronic search of six databases was performed and the search results were screened against established criteria for inclusion into this study. Data was extracted and meta-analytical techniques were used to analyse the data. Pooled data from RCTs revealed that medical therapy, compared with a placebo, was associated with a significant improvement of at least one functional class (p=0.038). With regards to pulmonary haemodynamics, medical therapy also resulted in a significant reduction in both mean pulmonary arterial pressure (mPAP) (p=0.002) and pulmonary vascular resistance (PVR) (p<0.001). From the included observational studies, the 6-minute walk distance (6MWD) significantly increased following medical therapy by an average of 22.8% (p<0.001). The pooled improvement in 6MWD was found to be significantly higher in the BPA group when compared to medical therapy for CTEPH (p=0.001). Pooled data from available observational studies of medical therapy or BPA all demonstrated significant improvements in mPAP and PVR for pre versus post intervention comparisons. The improvement in mPAP (p=0.002) and PVR (p=0.002) were significantly greater for BPA intervention when compared to medical therapy. High-quality evidence supports the use of targeted medical therapy in improving haemodynamics in patients with inoperable CTEPH. There is only moderate-quality evidence from observational studies supporting the efficacy of BPA in improving both haemodynamics and exercise capacity. Further RCTs and prospective observational studies comparing medical therapy and BPA in patients with inoperable CTEPH are required. Copyright © 2017 Australian and New Zealand Society of Cardiac and Thoracic Surgeons (ANZSCTS) and the Cardiac Society of Australia and New Zealand (CSANZ). Published by Elsevier B.V. All rights reserved.

Assessment of right ventricular longitudinal strain by 2D speckle tracking imaging compared with RV function and hemodynamics in pulmonary hypertension.

PubMed

Li, Yidan; Wang, Yidan; Meng, Xiangli; Zhu, Weiwei; Lu, Xiuzhang

2017-11-01

The right ventricular longitudinal strain (RVLS) of pulmonary hypertension (PH) patients and its relationship with RV function parameters measured by echocardiography and hemodynamic parameters measured by right heart catheterization was investigated. According to the WHO functional class (FC), 66 PH patients were divided into FC I/II (group 1) and III/IV (group 2). RV function parameters were measured by echocardiographic examinations. Hemodynamic parameters were obtained by right heart catheterization. Patients in group 2 had higher systolic pulmonary artery pressure (sPAP; P < 0.05) than patients in group (1) significant between-group differences were observed in global RVLS (RVLS global ), free wall RVLS (RVLS FW ; P < 0.01), and RV conventional function parameters (all P < 0.05). Moreover, mPAP and PVR increased remarkably and CI decreased significantly in group (2) RVLS global had a positive correlation with 6-min walking distance (6MWD; r = 0.492, P < 0.001) and N-terminal pro-brain natriuretic peptide (NT-proBNP; r = 0.632, P < 0.001), while RVLS FW had a positive correlation with 6MWD (r = 0.483, P < 0.001) and NT-proBNP (r = 0.627, P < 0.001). Hemodynamics analysis revealed that RVLS global had a positive correlation with mPAP (r = 0.594, P < 0.001), PVR (r = 0.573, P < 0.001) and CI (r = 0.366, P = 0.003), while RVLS FW had a positive correlation with mPAP (r = 0.597, P < 0.001), PVR (r = 0.577, P < 0.001) and CI (r = 0.369, P = 0.002). According to receiver operating characteristic curves, the optimal cut-off values of RVLS global (-15.0%) and RVLS FW (-15.3%) for prognosis detection with good sensitivity and specificity. Evidence has shown that RVLS measurement can provide the much-needed and reliable information on RV function and hemodynamics. Therefore, this qualifies as a patient-friendly approach for the clinical management of PH patients.

Comparison of Prophylactic Naftopidil, Tamsulosin, and Silodosin for {sup 125}I Brachytherapy-Induced Lower Urinary Tract Symptoms in Patients With Prostate Cancer: Randomized Controlled Trial

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsumura, Hideyasu, E-mail: sugan@pd5.so-net.ne.jp; Satoh, Takefumi; Ishiyama, Hiromichi

2011-11-15

Purpose: To compare the efficacy of three {alpha}{sub 1A}/{alpha}{sub 1D}-adrenoceptor (AR) antagonists-naftopidil, tamsulosin, and silodosin-that have differing affinities for the {alpha}{sub 1}-AR subtypes in treating urinary morbidities in Japanese men with {sup 125}I prostate implantation (PI) for prostate cancer. Methods and Materials: This single-institution prospective randomized controlled trial compared naftopidil, tamsulosin, and silodosin in patients undergoing PI. Patients were randomized and received either naftopidil, tamsulosin, or silodosin. Treatment began 1 day after PI and continued for 1 year. The primary efficacy variables were the changes in total International Prostate Symptom Score (IPSS) and postvoid residual urine (PVR). The secondary efficacymore » variables were changes in IPSS storage score and IPSS voiding score from baseline to set points during the study (1, 3, 6, and 12 months). Results: Two hundred twelve patients were evaluated in this study between June 2006 and February 2009: 71, 70, and 71 patients in the naftopidil, tamsulosin, and silodosin groups, respectively. With respect to the primary efficacy variables, the mean changes in the total IPSS at 1 month after PI in the naftopidil, tamsulosin, and silodosin groups were +10.3, +8.9, and +7.5, respectively. There were significantly greater decreases with silodosin than naftopidil at 1 month in the total IPSS. The mean changes in the PVR at 6 months were +14.6, +23.7, and +5.7 mL in the naftopidil, tamsulosin, and silodosin groups, respectively; silodosin showed a significant improvement in the PVR at 6 months vs. tamsulosin. With respect to the secondary efficacy variables, the mean changes in the IPSS voiding score at 1 month in the naftopidil, tamsulosin, and silodosin groups were +6.5, +5.6, and +4.5, respectively; silodosin showed a significant improvement in the IPSS voiding score at 1 month vs. naftopidil. Conclusions: Silodosin has a greater impact on improving PI-induced lower urinary tract symptoms than the other two agents.« less

Suction prevention and physiologic control of continuous flow left ventricular assist devices using intrinsic pump parameters.

PubMed

Wang, Yu; Koenig, Steven C; Slaughter, Mark S; Giridharan, Guruprasad A

2015-01-01

The risk for left ventricular (LV) suction during left ventricular assist devices (LVAD) support has been a clinical concern. Current development efforts suggest LVAD suction prevention and physiologic control algorithms may require chronic implantation of pressure or flow sensors, which can be unreliable because of baseline drift and short lifespan. To overcome this limitation, we designed a sensorless suction prevention and physiologic control (eSPPC) algorithm that only requires LVAD intrinsic parameters (pump speed and power). Two gain-scheduled, proportional-integral controllers maintain a differential pump speed (ΔRPM) above a user-defined threshold to prevent LV suction while maintaining an average reference differential pressure (ΔP) between the LV and aorta. ΔRPM is calculated from noisy pump speed measurements that are low-pass filtered, and ΔP is estimated using an extended Kalman filter. Efficacy and robustness of the eSPPC algorithm were evaluated in silico during simulated rest and exercise test conditions for 1) excessive ΔP setpoint (ES); 2) rapid eightfold increase in pulmonary vascular resistance (PVR); and 3) ES and PVR. Simulated hemodynamic waveforms (LV pressure and volume; aortic pressure and flow) using only intrinsic pump parameters showed the feasibility of our proposed eSPPC algorithm in preventing LV suction for all test conditions.

Pregnancy outcomes in pulmonary arterial hypertension in the modern management era.

PubMed

Jaïs, Xavier; Olsson, Karen M; Barbera, Joan A; Blanco, Isabel; Torbicki, Adam; Peacock, Andrew; Vizza, C Dario; Macdonald, Peter; Humbert, Marc; Hoeper, Marius M

2012-10-01

Previous studies have reported mortality rates of up to 56% associated with pregnancy in pulmonary arterial hypertension (PAH) but the management of this disease has changed considerably in recent years. We compiled a multinational, prospective registry to examine the contemporary outcome of pregnancies in patients with PAH. During a 3-yr period, the 13 participating centres reported 26 pregnancies. Three (12%) females died and one (4%) developed right heart failure requiring urgent heart-lung transplantation. There were eight abortions; two spontaneous and six induced. 16 (62%) pregnancies were successful, i.e. the females delivered healthy babies without complications. These females had well controlled PAH (pulmonary vascular resistance (PVR) 500 ± 352 dyn·s·cm(-5)); eight of them were long-term responders to calcium channel blockers. In contrast, the females who died or required transplantation had poorly controlled PAH (PVR 1,667 ± 209 dyn·s·cm(-5)). Pregnancy remains associated with a substantial mortality rate in PAH. However, our results indicate that the outcome of pregnancy in PAH has improved, at least when PAH is well controlled, and particularly in long-term responders to calcium channel blockers. These data must be confirmed by larger series before the general recommendation to avoid pregnancy in all patients with PAH is reconsidered.

A Systematic Review of Prostatic Artery Embolization in the Treatment of Symptomatic Benign Prostatic Hyperplasia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuang, Michelle; Vu, Anthony; Athreya, Sriharsha, E-mail: sathreya@stjoes.ca

PurposeTo summarize current evidence on outcomes and complications of prostatic artery embolization as a treatment for patients with lower urinary tract symptoms secondary to benign prostatic hyperplasia.Methods and MaterialsA database search of MEDLINE, Embase, Web of Science, and Cochrane Library was performed for published literature up to August 2015 concerning PAE in the treatment of BPH. Inclusion and exclusion criteria were applied by two independent reviewers, and disagreements were resolved by consensus. Peer-reviewed studies concerning PAE with BPH with a sample size >10 and at least one measured parameter were included.ResultsThe search yielded 193 articles, of which ten studies representingmore » 788 patients, with a mean age of 66.97 years, were included. Patients had LUTS ranging from moderate to severe. At 6 months following procedure, PV, PVR, Qmax, IPSS, and QoL were significantly improved (P < 0.05), while for PSA there was no significant change. At 12 and 24 months, PV, PSA, PVR, Qmax, IPSS, and QoL were significantly improved (P < 0.05). IIEF was unchanged at 6 and 12 months but was significantly reduced at 24 months.ConclusionThis suggests that PAE is effective in treating LUTS in the short and intermediate term.« less

Effects of dutasteride on lower urinary tract symptoms and general health in men with benign prostatic hypertroplasia and hypogonadism: a prospective study.

PubMed

Shigehara, Kazuyoshi; Koh, Eitetsu; Sakamoto, Jiro; Yaegashi, Hiroshi; Izumi, Koji; Ueno, Satoru; Kitagawa, Yasuhide; Maeda, Yuji; Kadono, Yoshifumi; Konaka, Hiroyuki; Mizokami, Atsushi; Nakashima, Takao; Namiki, Mikio

2014-03-01

We investigated the effects of the relative increase in testosterone by dutasteride administration in patients with benign prostatic hyperplasia and hypogonadism on urinary symptoms or androgen-responsive general health. Seventy-six patients were enrolled, and were taking 0.5 mg dutasteride daily for 52 weeks. Before and after treatment, all participants underwent blood test, and body mass index, prostate volume (PV), bone mineral density (BMD), post-voiding residual (PVR) volume, and muscle volume were measured. All patients responded to the questionnaires: International prostatic symptom score (IPSS), Overactive Bladder Symptom score (OABSS). Patients were divided into two groups according to the increase rate of total testosterone (TT): group A, ≥20% increase in TT level; group B, <20% increase or decrease. Baseline TT and free testosterone (FT) levels were significantly lower in group A than group B. Both groups showed marked improvement in PV and PVR. Group A showed significant improvement in IPSS and OABSS with a significant increase of FT level, whereas group B showed no significant change. Dutasteride treatment contributed to a significant increase in BMD in group A. Dutasteride treatment significantly improved urinary symptoms and BMD in patients with low baseline serum TT and FT levels.

Infrared Heater Used in Qualification Testing of International Space Station Radiators

NASA Technical Reports Server (NTRS)

Ziemke, Robert A.

2004-01-01

Two heat rejection radiator systems for the International Space Station (ISS) have undergone thermal vacuum qualification testing at the NASA Glenn Research Center (GRC), Plum Brook Station, Sandusky, Ohio. The testing was performed in the Space Power Facility (SPF), the largest thermal vacuum chamber in the world. The heat rejection system radiator was tested first; it removes heat from the ISS crew living quarters. The second system tested was the photovoltaic radiator (PVR), which rejects heat from the ISS photovoltaic arrays and the electrical power-conditioning equipment. The testing included thermal cycling, hot- and cold-soaked deployments, thermal gradient deployments, verification of the onboard heater controls, and for the PVR, thermal performance tests with ammonia flow. Both radiator systems are orbital replacement units for ease of replacement on the ISS. One key to the success of these tests was the performance of the infrared heater system. It was used in conjunction with a gaseous-nitrogen-cooled cryoshroud in the SPF vacuum chamber to achieve the required thermal vacuum conditions for the qualification tests. The heater, which was designed specifically for these tests, was highly successful and easily met the test requirements. This report discusses the heating requirements, the heater design features, the design approach, and the mathematical basis of the design.

Assay for identification of heterozygous single-nucleotide polymorphism (Ala67Thr) in human poliovirus receptor gene.

PubMed

Nandi, Shyam Sundar; Sharma, Deepa Kailash; Deshpande, Jagadish M

2016-07-01

It is important to understand the role of cell surface receptors in susceptibility to infectious diseases. CD155 a member of the immunoglobulin super family, serves as the poliovirus receptor (PVR). Heterozygous (Ala67Thr) polymorphism in CD155 has been suggested as a risk factor for paralytic outcome of poliovirus infection. The present study pertains to the development of a screening test to detect the single nucleotide (SNP) polymorphism in the CD155 gene. New primers were designed for PCR, sequencing and SNP analysis of Exon2 of CD155 gene. DNAs extracted from either whole blood (n=75) or cells from oral cavity (n=75) were used for standardization and validation of the SNP assay. DNA sequencing was used as the gold standard method. A new SNP assay for detection of heterozygous Ala67Thr genotype was developed and validated by testing 150 DNA samples. Heterozygous CD155 was detected in 27.33 per cent (41/150) of DNA samples tested by both SNP detection assay and sequencing. The SNP detection assay was successfully developed for identification of Ala67Thr polymorphism in human PVR/CD155 gene. The SNP assay will be useful for large scale screening of DNA samples.

[The effects of perioperative continuous administration of mivazerol on early postoperative hemodynamics and plasma catecholamines after major surgery].

PubMed

Apitzsch, H; Olthoff, D; Thieme, V; Vetter, B; Wiegel, M

2000-08-01

During and after surgical procedures a strong activation of the sympatho-adrenergic system is common with correlation to adverse cardiac outcome. Several drugs (alpha 2-adrenoceptor-agonists, beta blockers) are discussed to prevent this reaction. The new alpha 2-adrenoceptor-agonist mivazerol with marked specificity for alpha 2-adrenergic receptors may be suitable for this indication. The aim of the present study was to investigate the effects of perioperative continuous administration of mivazerol on plasma catecholamines, body temperature and calculated haemodynamic parameters in the early postoperative period in cardiac risk patients undergoing non-cardiac surgery. 36 patients with known coronary heart disease or risk factors for coronary heart disease scheduled for elective abdominal or vascular surgery were included in the study. Patients received either mivazerol (n = 18) or placebo (n = 18) [initial dose 4 micrograms kg-1 for 10 minutes before induction of anaesthesia, followed by a continuous infusion of 1.5 micrograms kg-1 h-1 intraoperatively and for as long as 72 h after surgery] in a double-blinded, randomized manner. Blood pressure, heart rate and body temperature were measured every 10 minutes until 240 minutes after arrival at the ICU. During 240 minutes after arrival at the ICU measured parameters (CVP, PAP, PCWP, SaO2, SvO2, CO), calculated parameters (CI, SVR, PVR, VO2) and plasma catecholamines were measured at defined time intervalls. The plasma concentrations of epinephrine and norepinephrine and the heart rate were significantly lower in the mivazerol group in the study period. Regarding blood pressure and body temperature there were no differences between the groups. At some measuring points preload was higher in the mivazerol group, but there were no differences between the groups for measured (SaO2, SvO2, CO) and calculated (CI, SVR, PVR, VO2) cardiorespiratory parameters. The incidence of shivering, nausea and vomiting were similar in both groups. Continuous, perioperative administration of mivazerol decreased the heart rate and the plasma catecholamines in the early postoperative period, but did not affect blood pressure, body temperature and the incidence of shivering. There were also no effects of mivazerol on calculated haemodynamic parameters (CO, SVR, PVR, VO2). These findings show a selective decrease in heart rate by Mivazerol without markedly cardiorespiratory side effects.

Absence of Gal epitope prolongs survival of swine lungs in an ex vivo model of hyperacute rejection

PubMed Central

Nguyen, Bao-Ngoc H.; Azimzadeh, Agnes M.; Schroeder, Carsten; Buddensick, Thomas; Zhang, Tianshu; Laaris, Amal; Cochrane, Megan; Schuurman, Henk-Jan; Sachs, David H.; Allan, James S.; Pierson, Richard N.

2012-01-01

Background Galactosyl transferase gene knock-out (GalTKO) swine offer a unique tool to evaluate the role of the Gal antigen in xenogenic lung hyperacute rejection. Methods We perfused GalTKO miniature swine lungs with human blood. Results were compared with those from previous studies using wild-type and human decay-accelerating factor-transgenic (hDAF+/+) pig lungs. Results GalTKO lungs survived 132 ± 52 min compared to 10 ± 9 min for wild-type lungs (P = 0.001) and 45 ± 60 min for hDAF+/+ lungs (P = 0.18). GalTKO lungs displayed stable physiologic flow and pulmonary vascular resistance (PVR) until shortly before graft demise, similar to autologous perfusion, and unlike wild-type or hDAF+/+ lungs. Early (15 and 60 min) complement (C3a) and platelet activation and intrapulmonary platelet deposition were significantly diminished in GalTKO lungs relative to wild-type or hDAF+/+ lungs. However, GalTKO lungs adsorbed cytotoxic anti-non-Gal antibody and elaborated high levels of thrombin; their demise was associated with increased PVR, capillary congestion, intravascular thrombi and strong CD41 deposition not seen at earlier time points. Conclusions In summary, GalTKO lungs are substantially protected from injury but, in addition to anti-non-Gal antibody and complement, platelet adhesion and non-physiologic intravascular coagulation contribute to Gal-independent lung injury mechanisms. PMID:21496117

Airway and Pulmonary β2-Adrenergic Vasodilatory Function in Current Smokers and Never Smokers.

PubMed

Hurwitz, Barry E; Mendes, Eliana S; Schmid, Andreas; Parker, Meela; Arana, Johana; Gonzalez, Alex; Wanner, Adam

2017-03-01

Cigarette smoking has been associated with diminished vasodilatory function in the airway circulation. It is possible that cigarette smoking similarly affects the pulmonary circulation before resting pulmonary circulatory abnormalities become manifested. The aim of this study was to compare the acute effect of inhaled albuterol on airway and pulmonary hemodynamic function as an index of β 2 -adrenoceptor-mediated vasodilation in smokers and never smokers. In 30 adults, airway and pulmonary vascular function was assessed before and 15 min after albuterol inhalation (270 μg). From mean systemic arterial pressure, cardiac output, airway blood flow, and mean pulmonary arterial pressure, airway vascular resistance (AVR) and pulmonary vascular resistance (PVR) were derived. Albuterol induced a substantial drop in mean (± SE) PVR (-67.2% ± 5%), with no difference between groups. In contrast, the albuterol-induced decrease in AVR was significantly greater in never smokers than in smokers (-28.6% ± 3% vs -3.1% ± 6%; P < .02). These results are consistent with a dysfunction in a β 2 -adrenergic signaling pathway mediating vasorelaxation in the airway circulation of current smokers. The vasodilatory deficit in the airway circulation but not in the pulmonary circulation could be related to local differences in the impact of cigarette smoke on the vascular endothelium. Copyright © 2016 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.

The Cost of Surveillance After Urethroplasty

PubMed Central

Zaid, Uwais B.; Hawkins, Mitchel; Wilson, Leslie; Ting, Jie; Harris, Catherine; Alwaal, Amjad; Zhao, Lee C.; Morey, Allen F.; Breyer, Benjamin N.

2015-01-01

Objectives To determine variability in urethral stricture surveillance. Urethral strictures impact quality of life and exact a large economic burden. Although urethroplasty is the gold standard for durable treatment, strictures recur in 8–18%. There are no universally accepted guidelines for post-urethroplasty surveillance. We performed a literature search to evaluate variability in surveillance protocols, analyzed costs, and reviewed performance of each commonly employed modality. Methods Medline search was performed using the keywords: “urethroplasty,” “urethral stricture,” “stricture recurrence” to ascertain commonly used surveillance strategies for stricture recurrence. We included English language manuscripts from the past 10 years with at least 10 patients, and age greater than 18. Cost data was calculated based on standard 2013 Centers for Medicare and Medicaid Services physician’s fees. Results Surveillance methods included retrograde urethrogram/voiding cystourethrogram (RUG/VCUG), cystourethroscopy, urethral ultrasound, AUA-Symptom Score, and post void residual (PVR) and urine flowmetry (UF) measurement. Most protocols call for a RUG/VCUG at time of catheter removal. Following this, UF/PVR, cystoscopy, urine culture, or a combination of UF and AUA-SS were performed at variable intervals. The first year follow-up cost of anterior urethral surgery ranged from $205 to $1,784. For posterior urethral surgery, follow-up cost for the first year ranged from $404 to $961. Conclusions Practice variability for surveillance of urethral stricture recurrence after urethroplasty leads to significant differences in cost. PMID:25819624

Childhood Obesity Associates Haemodynamic and Vascular Changes That Result in Increased Central Aortic Pressure with Augmented Incident and Reflected Wave Components, without Changes in Peripheral Amplification

PubMed Central

Castro, Juan M.; García-Espinosa, Victoria; Curcio, Santiago; Arana, Maite; Chiesa, Pedro; Giachetto, Gustavo; Zócalo, Yanina; Bia, Daniel

2016-01-01

The aims were to determine if childhood obesity is associated with increased central aortic blood pressure (BP) and to characterize haemodynamic and vascular changes associated with BP changes in obese children and adolescents by means of analyzing changes in cardiac output (stroke volume, SV), arterial stiffness (aortic pulse wave velocity, PWV), peripheral vascular resistances (PVR), and net and relative contributions of reflected waves to the aortic pulse wave amplitude. We included 117 subjects (mean/range age: 10 (5–15) years, 49 females), who were obese (OB) or had normal weight (NW). Peripheral and central aortic BP, PWV, and pulse wave-derived parameters (augmentation index, amplitude of forward and backward components) were measured with tonometry (SphygmoCor) and oscillometry (Mobil-O-Graph). With independence of the presence of dyslipidemia, hypertension, or sedentarism, the aortic systolic and pulse BP were higher in OB than in NW subjects. The increase in central BP could not be explained by the elevation in the relative contribution of reflections to the aortic pressure wave and higher PVR or by an augmented peripheral reflection coefficient. Instead, the rise in central BP could be explained by an increase in the amplitude of both incident and reflect wave components associated to augmented SV and/or PWV. PMID:26881081

The neuropathology observed in wild-type mice inoculated with human poliovirus mirrors human paralytic poliomyelitis.

PubMed

Ford, Dayton J; Ropka, Stacie L; Collins, George H; Jubelt, Burk

2002-09-01

Human paralytic poliomyelitis results from the destruction of spinal cord anterior horn motor neurons by human poliovirus (PV). CNS disease pathology similar to human poliomyelitis has been observed in experimentally infected chimpanzees, monkeys and wild-type mice. In this study we present a detailed examination of the clinical and histopathological features in the wild-type mouse after intracranial (i.c.) and novel intramuscular (i.m.) injection of poliovirus. Either route of poliovirus administration results in a clinical disease characterized predominately by flaccid paralysis. The observed histopathological features are compared with the histopathology reported for human paralytic poliomyelitis, experimentally infected chimpanzees, monkeys and transgenic mice expressing the human poliovirus receptor (hPVR). The observation of flaccid paralysis and anterior horn motor neuron destruction mirrors what is observed in human paralytic poliomyelitis. Our results suggest that the neuropathology observed in the wild-type mouse model is similar to what has been observed in both the human disease and in other experimental animal models, with the possible exception of the transgenic mouse model. The observed neuropathology of the wild-type mouse model more closely reflects what has been observed in human poliomyelitis, as well as in experimentally infected chimpanzees and monkeys, than does the hPVR transgenic mouse model. The previously reported poliovirus-induced white matter demyelinating disease was not observed.

Limb Lengthening in Patients with Achondroplasia

PubMed Central

Park, Kwang-Won; Garcia, Rey-an Niño; Rejuso, Chastity Amor; Choi, Jung-Woo

2015-01-01

Purpose Although bilateral lower-limb lengthening has been performed on patients with achondroplasia, the outcomes for the tibia and femur in terms of radiographic parameters, clinical results, and complications have not been compared with each other. We proposed 1) to compare the radiological outcomes of femoral and tibial lengthening and 2) to investigate the differences of complications related to lengthening. Materials and Methods We retrospectively reviewed 28 patients (average age, 14 years 4 months) with achondroplasia who underwent bilateral limb lengthening between 2004 and 2012. All patients first underwent bilateral tibial lengthening, and at 9-48 months (average, 17.8 months) after this procedure, bilateral femoral lengthening was performed. We analyzed the pixel value ratio (PVR) and characteristics of the callus of the lengthened area on serial radiographs. The external fixation index (EFI) and healing index (HI) were computed to compare tibial and femoral lengthening. The complications related to lengthening were assessed. Results The average gain in length was 8.4 cm for the femur and 9.8 cm for the tibia. The PVR, EFI, and HI of the tibia were significantly better than those of the femur. Fewer complications were found during the lengthening of the tibia than during the lengthening of the femur. Conclusion Tibial lengthening had a significantly lower complication rate and a higher callus formation rate than femoral lengthening. Our findings suggest that bilateral limb lengthening (tibia, followed by femur) remains a reasonable option; however, we should be more cautious when performing femoral lengthening in selected patients. PMID:26446651

Limb Lengthening in Patients with Achondroplasia.

PubMed

Park, Kwang-Won; Garcia, Rey-an Niño; Rejuso, Chastity Amor; Choi, Jung-Woo; Song, Hae-Ryong

2015-11-01

Although bilateral lower-limb lengthening has been performed on patients with achondroplasia, the outcomes for the tibia and femur in terms of radiographic parameters, clinical results, and complications have not been compared with each other. We proposed 1) to compare the radiological outcomes of femoral and tibial lengthening and 2) to investigate the differences of complications related to lengthening. We retrospectively reviewed 28 patients (average age, 14 years 4 months) with achondroplasia who underwent bilateral limb lengthening between 2004 and 2012. All patients first underwent bilateral tibial lengthening, and at 9-48 months (average, 17.8 months) after this procedure, bilateral femoral lengthening was performed. We analyzed the pixel value ratio (PVR) and characteristics of the callus of the lengthened area on serial radiographs. The external fixation index (EFI) and healing index (HI) were computed to compare tibial and femoral lengthening. The complications related to lengthening were assessed. The average gain in length was 8.4 cm for the femur and 9.8 cm for the tibia. The PVR, EFI, and HI of the tibia were significantly better than those of the femur. Fewer complications were found during the lengthening of the tibia than during the lengthening of the femur. Tibial lengthening had a significantly lower complication rate and a higher callus formation rate than femoral lengthening. Our findings suggest that bilateral limb lengthening (tibia, followed by femur) remains a reasonable option; however, we should be more cautious when performing femoral lengthening in selected patients.

Does age affect the efficacy and safety of GreenLight HPS™ laser photoselective vaporization prostatectomy?

PubMed

Gu, Xiao; Strom, Kurt; Spaliviero, Massimiliano; Wong, Carson

2012-03-01

To evaluate the efficacy and safety of GreenLight HPS(™) (High Performance System) laser photoselective vaporization prostatectomy (PVP) for the treatment of benign prostatic hyperplasia (BPH) in patients of different age groups. 164 consecutive patients were stratified into two groups: age <70 (group I, n = 93) and age ≥70 (group II, n = 71) years. Transurethral PVP was performed using a GreenLight HPS™ side-firing laser system. Voiding parameters were measured preoperatively and at 1 and 4 weeks and 3, 6, 12, 18, 24 and 36 months postoperatively. Among the preoperative parameters evaluated, there were significant differences (p < 0.05) in prostate volume (I: 58.7; II: 73.6 mL) and serum prostate-specific antigen (I: 1.9; II: 2.9 ng/mL), while American Urological Association Symptom Score (AUASS), Quality of Life (QoL), maximum flow rate (Qmax), Sexual Health Inventory for Men (SHIM) and post void residual (PVR) were similar (p > 0.05) between groups. No significant differences in laser utilization, energy usage and operating time were noted. Clinical outcomes (AUASS, QoL, Qmax, PVR) showed immediate and stable improvement from baseline (p < 0.05) within each group, but no significant differences between the two groups were observed during the follow-up period. The incidence of adverse events was low and similar in both groups. The results suggest that age has little effect on the efficacy and safety of GreenLight HPS™ laser PVP.

Electroacupuncture versus sham electroacupuncture for urinary retention in poststroke patients: study protocol for a multicenter, randomized controlled trial.

PubMed

Shin, Seungwon; Lee, Jiwon; Yoo, Junghee; Lim, Sung Min; Lee, Euiju

2016-04-12

This study protocol evaluates the effectiveness of adjuvant electroacupuncture (EA) for urinary retention in poststroke patients undergoing conventional treatments, in comparison with that of a sham control. A multicenter, blinded, randomized controlled trial will be conducted in three hospitals in the Republic of Korea. We are recruiting 54 stroke survivors (aged >19 years), who were diagnosed with urinary retention based on the results of two consecutive post-void residual (PVR) tests, and dividing them randomly into two arms: the EA and Park-sham control groups. They will receive ten sessions of EA or sham treatment for 2 weeks. The participants will be blinded with non-penetrating needles and fake sounds of EA stimulators. The daily PVR ratio will be primarily measured at baseline and at the end of the study to statistically test the effectiveness of EA for poststroke urinary retention. Then, the Korean version of the Qualiveen Questionnaire, the Korean version of the International Prostate Symptom Score, and the blinding index will be assessed. After each EA session or sham EA, adverse events will be reported to evaluate the safety of EA. Results will be analyzed by using the independent t-test or Mann-Whitney U test, based on both intention-to-treat and per-protocol principles. The findings will provide clinical evidence for the effectiveness of EA treatment to improve urinary retention in stroke survivors. This study protocol was registered in ClinicalTrials.gov (NCT02472288) on 10 June 2015.

Folic Acid Promotes Recycling of Tetrahydrobiopterin and Protects Against Hypoxia-Induced Pulmonary Hypertension by Recoupling Endothelial Nitric Oxide Synthase.

PubMed

Chalupsky, Karel; Kračun, Damir; Kanchev, Ivan; Bertram, Katharina; Görlach, Agnes

2015-11-10

Nitric oxide (NO) derived from endothelial NO synthase (eNOS) has been implicated in the adaptive response to hypoxia. An imbalance between 5,6,7,8-tetrahydrobiopterin (BH4) and 7,8-dihydrobiopterin (BH2) can result in eNOS uncoupling and the generation of superoxide instead of NO. Dihydrofolate reductase (DHFR) can recycle BH2 to BH4, leading to eNOS recoupling. However, the role of DHFR and eNOS recoupling in the response to hypoxia is not well understood. We hypothesized that increasing the capacity to recycle BH4 from BH2 would improve NO bioavailability as well as pulmonary vascular remodeling (PVR) and right ventricular hypertrophy (RVH) as indicators of pulmonary hypertension (PH) under hypoxic conditions. In human pulmonary artery endothelial cells and murine pulmonary arteries exposed to hypoxia, eNOS was uncoupled as indicated by reduced superoxide production in the presence of the nitric oxide synthase inhibitor, L-(G)-nitro-L-arginine methyl ester (L-NAME). Concomitantly, NO levels, BH4 availability, and expression of DHFR were diminished under hypoxia. Application of folic acid (FA) restored DHFR levels, NO bioavailability, and BH4 levels under hypoxia. Importantly, FA prevented the development of hypoxia-induced PVR, right ventricular pressure increase, and RVH. FA-induced upregulation of DHFR recouples eNOS under hypoxia by improving BH4 recycling, thus preventing hypoxia-induced PH. FA might serve as a novel therapeutic option combating PH.

Effect of PAH specific therapy on pulmonary hemodynamics and six-minute walk distance in portopulmonary hypertension: a systematic review and meta-analysis.

PubMed

Faisal, Muhammad; Siddiqi, Furqan; Alkaddour, Ahmad; Bajwa, Abubakr A; Shujaat, Adil

2014-01-01

Little is known about the effect of pulmonary arterial hypertension (PAH) specific therapy on pulmonary hemodynamics and exercise capacity in patients with portopulmonary hypertension (PoPH) because such patients are usually excluded from randomized clinical trials (RCT) of such therapy. We searched PUBMED using the terms "(Therapy/Broad (filter)) AND (portopulmonary hypertension)." We included studies that met the following criteria: ≥5 patients, AND PoPH confirmed by right heart catheterization (RHC), AND follow-up RHC data, AND/OR baseline and follow-up 6MWD available. 12 studies met our inclusion criteria. None was a RCT. The baseline mPAP was 48.6 ± 4.4 mmHg, cardiac output (CO) 5.6 ± 0.9 L/min, and pulmonary vascular resistance (PVR) 668.6 ± 219.1 dynes.sec/cm(5). The baseline 6MWD was 348.2 ± 35.6 meters. The use of PAH specific therapy improved mPAP by 7.54 mmHg (95% CI 10.2 to 4.9), CO by 1.77 L/min (95% CI 1.1 to 2.4), and PVR by 253 dynes.sec/cm(5) (95% CI 291.4 to 214.6) (n = 135) and 6MWD by 61.8 meters (95% CI 47.5 to 76) (n = 122). The use of PAH specific therapy in PoPH results in significant improvement in both pulmonary hemodynamics and 6MWD.

Medium term outcome of bipolar plasma vaporization in prostate cancer patients--a palliative modality of preserving spontaneous voiding.

PubMed

Geavlete, B; Moldoveanu, C; Niţă, Gh; Stănescu, F; Jecu, M; Geavlete, P

2012-12-15

This retrospective analysis evaluated the efficiency, safety, and medium term postoperative results of bipolar plasma vaporization (BPV) in prostate cancer (PCa) cases associating complete urinary retention. A series of 40 patients diagnosed with locally advanced or metastatic PCa and complete urinary retention requiring a Foley catheter indwelling underwent BPV aiming to restore spontaneous voiding. A total of 35 patients completed the one year evaluation protocol consisting of International Prostate Symptom Score (IPSS), quality of life score (QoL), maximum flow rate (Q(max)) and post-voiding residual urinary volume (PVR), measured at 1, 3, 6 and 12 months after surgery. BPV was successfully performed in all cases with satisfactory efficiency, as confirmed by the mean operation time (42.8 minutes) and hemoglobin drop (0.7 g/dl). A fast and safe postoperative recovery period was described in this series (hematuria rate--7.5%; mean catheterization period--36 hours; mean hospital stay--2.5 days; early-irritative symptoms' rate--15%). At 1, 3, 6 and 12 months, satisfactory values were determined in terms of IPSS, Qmax, QoL and PVR. These parameters emphasized a stable evolution throughout the entire follow-up, as 88.6% of the patients maintained spontaneous voiding. The present trial confirmed the plasma-button vaporization as a promising therapeutic approach in PCa cases associating complete urinary retention. The technique displayed good efficacy, low perioperative morbidity, short convalescence, and satisfactory urodynamics and symptom score parameters during the one-year follow-up period.

A porcine model for acute ischaemic right ventricular dysfunction.

PubMed

Haraldsen, Pernille; Lindstedt, Sandra; Metzsch, Carsten; Algotsson, Lars; Ingemansson, Richard

2014-01-01

To establish an experimental model for acute ischaemic isolated right ventricular dysfunction and the subsequent haemodynamic changes. An open-chest porcine model with ischaemic dysfunction of the right ventricle induced by ligation of the three main branches supporting the right ventricular free wall. Invasive monitoring of mean arterial blood pressure (MAP), central venous pressure (CVP), left atrial pressure (LAP) and right ventricular pressure (RVP); ultrasonic measurement of cardiac output (CO) and calculation of haemodynamic parameters such as stroke volume (SV), systemic vascular resistance (SVR), pulmonary vascular resistance (PVR) and right ventricular stroke work (RVSW) using standard formulae. The ischaemic challenge to the right ventricle resulted in a significant (≥30%) reduction in RVSW associated with an increase (6-25%) in CVP and reduction (8-18%) in pulmonary artery pressure (PAP) despite unchanged PVR, all reflecting the failing right ventricle. There was also a significant drop in CO (14-22%) despite unchanged LAP indicating lessened transpulmonary delivery of left ventricular preload due to the failing right ventricle causing the haemodynamic compromise rather than left ventricular failure. Supraventricular and ventricular arrhythmias occurred in three and two out of seven pigs, respectively-all of which except one were successfully resuscitated with cardioversion and/or defibrillation. This novel open-chest porcine model of induced ischaemia of the right ventricular free wall resulted in significant haemodynamic compromise confirmed using standard haemodynamic measurements making it useful for further research on acute, ischaemic isolated right ventricular failure.

Diode laser vaporisation of the prostate vs. diode laser under cold irrigation: A randomised control trial.

PubMed

Pillai, Ravisankar G; Al Naieb, Ziad; Angamuthu, Stephen; Mundackal, Tintu

2014-12-01

To compare the perioperative morbidity and early follow-up after diode laser vaporisation of the prostate (LVP) and its modification, diode laser under cold irrigation (LUCI) in patients with symptomatic benign prostatic hyperplasia, as the main disadvantages of LVP are the postoperative pain, dysuria and storage urinary symptoms. This was a single-centre prospective randomised control trial in which 100 patients were randomised to receive LVP (50) or LUCI (50) from June 2011 until July 2012. LUCI is similar to LVP except that it is done under normal irrigation with saline at 4 °C instead of saline at room temperature. The primary outcome measures were the International Prostate Symptom Score (IPSS), IPSS-Dysuria, a pain scale (PS), maximum flow rate (Q max), a quality-of-life (QoL) score and the postvoid residual urine volume (PVR) after 1 month, then the IPSS, Q max, QoL, and PVR at 3 and 12 months. Secondary outcomes included intraoperative surgical variables, e.g., the decline in core temperature, bleeding, peri- and postoperative morbidity. The baseline characteristics of both groups were similar. For the primary outcome measures, there was a statistically significant difference between the groups in all variables except Q max after 1 month, in favour of LUCI. The mean (SD) IPSS at 1 month in the LVP group was 8.97 (1.68), statistically significantly different from that after LUCI, of 6.89 (1.5) (P < 0.05). The mean IPSS-Dysuria at 1 month was also significantly, at -2.32 (0.91) for LVP and 3.54 (1.07) for LUCI (P < 0.05). The respective mean PS at 1 month was 7.84 (2.92) and 5.7 (2.1) (P < 0.05). The QoL and PVR at 1 month were also significantly different. Within the first month 17% of patients in the LVP group and 4% in the LUCI group complained of transient urgency or stress incontinence, and this difference was statistically significant (P < 0.05). There was no significant bleeding in either group. The mean operative time or applied energy of LVP was not statistically significant from that of LUCI, and there was no significant difference in the decline in core temperature between the groups (P > 0.05). LUCI is a good modification for reducing the pain, dysuria and storage symptoms associated with LVP. The procedure appears to be safe, with no significant decrease in core temperature in either group.

Involvement of up-regulated Necl-5/Tage4/PVR/CD155 in the loss of contact inhibition in transformed NIH3T3 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Minami, Yukiko; Department of Surgery and Clinical Oncology, Osaka University Graduate School of Medicine/Faculty of Medicine, Suita 565-0871, Osaka; Ikeda, Wataru

2007-01-26

Normal cells show contact inhibition of cell movement and proliferation, but this is lost following transformation. We found that Necl-5, originally identified as a poliovirus receptor and up-regulated in many cancer cells, enhances growth factor-induced cell movement and proliferation. We showed that when cells contact other cells, Necl-5 interacts in trans with nectin-3 and is removed by endocytosis from the cell surface, resulting in a reduction of cell movement and proliferation. We show here that up-regulation of the gene encoding Necl-5 by the oncogene V12-Ki-Ras causes enhanced cell movement and proliferation. Upon cell-cell contact, de novo synthesis of Necl-5 exceedsmore » the rate of Necl-5 endocytosis, eventually resulting in a net increase in the amount of Necl-5 at the cell surface. In addition, expression of the gene encoding nectin-3 is markedly reduced in transformed cells. Thus, up-regulation of Necl-5 following transformation contributes to the loss of contact inhibition in transformed cells.« less

n/a

NASA Image and Video Library

2007-06-10

This nadir view of the STS-117 mission Space Shuttle Atlantis, taken by the Expedition 15 crew aboard the International Space Station (ISS), occurred just before the two spacecraft linked up in Earth orbit. Berthed in the cargo bay are the 17.8 ton second and third (S3 and S4) truss segments ready for installment. STS-117 mission objectives included the addition of S3 and S4 with Photovoltaic Radiator (PVR), the deployment of the third set of solar arrays, and the retraction of the P4 starboard solar array wing and one radiator.

Holmium laser enucleation versus simple prostatectomy for treating large prostates: Results of a systematic review and meta-analysis.

PubMed

Jones, Patrick; Alzweri, Laith; Rai, Bhavan Prasad; Somani, Bhaskar K; Bates, Chris; Aboumarzouk, Omar M

2016-03-01

To compare and evaluate the safety and efficacy of holmium laser enucleation of the prostate (HoLEP) and simple prostatectomy for large prostate burdens, as discussion and debate continue about the optimal surgical intervention for this common pathology. A systematic search was conducted for studies comparing HoLEP with simple prostatectomy [open (OP), robot-assisted, laparoscopic] using a sensitive strategy and in accordance with Cochrane collaboration guidelines. Primary parameters of interest were objective measurements including maximum urinary flow rate (Q max) and post-void residual urine volume (PVR), and subjective outcomes including International Prostate Symptom Score (IPSS) and quality of life (QoL). Secondary outcomes of interest included volume of tissue retrieved, catheterisation time, hospital stay, blood loss and serum sodium decrease. Data on baseline characteristics and complications were also collected. Where possible, comparable data were combined and meta-analysis was conducted. In all, 310 articles were identified and after screening abstracts (114) and full manuscripts (14), three randomised studies (263 patients) were included, which met our pre-defined inclusion criteria. All these compared HoLEP with OP. The mean transrectal ultrasonography (TRUS) volume was 113.9 mL in the HoLEP group and 119.4 mL in the OP group. There was no statistically significant difference in Q max, PVR, IPSS and QoL at 12 and 24 months between the two interventions. OP was associated with a significantly shorter operative time (P = 0.01) and greater tissue retrieved (P < 0.001). However, with HoLEP there was significantly less blood loss (P < 0.001), patients had a shorter hospital stay (P = 0.03), and were catheterised for significantly fewer hours (P = 0.01). There were no significant differences in the total number of complications recorded amongst HoLEP and OP (P = 0.80). The results of the meta-analysis have shown that HoLEP and OP possess similar overall efficacy profiles for both objective and subjective disease status outcome measures. This review shows these improvements persist to at least the 24 month follow-up point. Further randomised studies are warranted to fully determine the optimal surgical intervention for large prostate burdens.

Urtica dioica for treatment of benign prostatic hyperplasia: a prospective, randomized, double-blind, placebo-controlled, crossover study.

PubMed

Safarinejad, Mohammad Reza

2005-01-01

To determine the effects of therapy with Urtica dioica for symptomatic relief of lower urinary tract symptoms (LUTS) secondary to benign prostatic hyperplasia (BPH). A 6-month, double-blind, placebo-controlled, randomized, partial crossover, comparative trial of Urtica dioica with placebo in 620 patients was conducted. Patients were evaluated using the International Prostate Symptom Score (IPSS), the maximum urinary flow rate (Qmax), postvoid residual urine volume (PVR), Serum Prostatic- Specific Antigen (PSA), testosterone levels, and prostate size. At the end of 6-month trial, unblinding revealed that patients who initially received the placebo were switched to Urtica dioica. Both groups continued the medication up to 18 months. 558 patients (90%) completed the study (287/305, 91% in the Urtica dioica group, and 271/315, 86% in the placebo group). By intention- to-treat analysis, at the end of 6-month trial, 232 (81%) of 287 patients in the Urtica dioica group reported improved LUTS compared with 43 (16%) of 271 patients in the placebo group (P < 0.001). Both IPSS and Qmax showed greater improvement with drug than with placebo. The IPSS went from 19.8 down to 11.8 with Urtica dioica and from 19.2 to 17.7 with placebo (P = 0.002). Peak flow rates improved by 3.4 mL/s for placebo recipients and by 8.2 mL/s for treated patients (P < 0.05). In Urtica dioica group, PVR decreased from an initial value of 73 to 36 mL (P < 0.05). No appreciable change was seen in the placebo group. Serum PSA and testosterone levels were unchanged in both groups. A modest decrease in prostate size as measured by transrectal ultrasonography (TRUS) was seen in Urtica dioica group (from 40.1 cc initially to 36.3 cc; P < 0.001). There was no change in the prostate volume at the end of study with placebo. At 18-month follow-up, only patients who continued therapy, had a favorable treatment variables value. No side effects were identified in either group. In the present study, Urtica dioica have beneficial effects in the treatment of symptomatic BPH. Further clinical trials should be conducted to confirm these results before concluding that Urtica dioica is effective.

Ocular injuries from improvised explosive devices

PubMed Central

Erdurman, F C; Hurmeric, V; Gokce, G; Durukan, A H; Sobaci, G; Altinsoy, H I

2011-01-01

Purpose To document the characteristics, treatments, and anatomical and functional outcomes of patients with ocular trauma from improvised explosive devices (IEDs). Methods Retrospective review of ocular injuries caused by IEDs, admitted to our tertiary referral centre. Results In total, sixty-one eyes of the 39 patients with an average age of 24 years (range, 20–42 years) were included in the study. In total, 49 (80%) eyes of the patients had open-globe and 12 (20%) had closed-globe injury. In eyes with open-globe injury, intraocular foreign body (IOFB) injury was the most frequently encountered type of injury, observed in 76% of eyes. Evisceration or enucleation was required as a primary surgical intervention in 17 (28%) of the eyes. Twenty-two (36%) eyes had no light perception at presentation. Patients were followed up for an average of 6 months (range, 4–34 months). At the last follow-up, 26 (43%) of 61 eyes had no light perception. Postoperative proliferative vitreoretinopathy (PVR) developed in 12 (50%) of the 24 eyes that underwent vitreoretinal surgery, and four of these eyes became phthisical. There were no cases of endophthalmitis. The presence of open-globe injury and presenting visual acuity worse than 5/200 were significantly associated with poor visual outcome (<5/200, P<0.05). In eyes with open-globe injury, the presence of an IOFB was not associated with poor visual outcome (P>0.05). Conclusion Ocular injuries from IEDs are highly associated with severe ocular damage requiring extensive surgical repair or evisceration/enucleation. Postoperative PVR is a common cause of poor anatomical and visual outcome. PMID:21852806

The predictive factors of α1-D/A adrenoceptor antagonist, naftopidil, dose increase therapy for male lower urinary tract symptoms caused by benign prostatic hyperplasia: INFORM study.

PubMed

Tanuma, Yasushi; Tanaka, Yoshinori; Takeyama, Ko; Okamoto, Tomoshi

2017-01-01

We evaluated the predictive factors which affect the efficacy of naftopidil 50 mg/day therapy and dose increase therapy to administration of 75 mg/day after an initial dose of 50 mg/day. A total of 92 patients with male lower urinary tract symptoms/benign prostatic hyperplasia were administrated naftopidil 50 mg/day for 4 weeks (50 mg therapy). At week 4, the patients were divided into an effective and an ineffective group (Group E and Group I, respectively). For further 4 weeks, the dosage of naftopidil was increased to 75 mg/day in all patients. At week 8, the patients of Group E and Group I were divided into an effective and an ineffective group (Group EE, Group EI, Group IE, and Group II, respectively). Postvoid residual (PVR) urine volume at baseline was a predictive factor for efficacy of 50 mg therapy. In Group E, change in International Prostate Symptom Score storage symptoms subscore from baseline to week 4 was a predictive factor for efficacy of this dose increase therapy. In Group I, change in maximum flow rate from baseline to week 4 was a predictive factor for efficacy of this dose increase therapy. The short term of naftopidil 50 mg therapy was ineffective for the patients who had large PVR. The predictive factor of this dose increase therapy might be a dynamic variable in 50 mg/day of dose period, but not a baseline variable at the time of 75 mg/day dosage starts.

A green and black tea extract benefits urological health in men with lower urinary tract symptoms

PubMed Central

Efros, Mitchell; Kaminetsky, Jed; Herrlinger, Kelli; Chirouzes, Diana; Ceddia, Michael

2014-01-01

Objectives: The objective of this study was to examine the effects of a green and black tea extract blend [AssuriTEA Men’s Health (AMH)] in men with lower urinary tract symptoms (LUTS). Methods: In this randomized, double-blind, placebo-controlled study, 46 men aged 30–70 with an American Urologic Association symptom score (AUAss) of at least 8 and up to 24 were randomized to 500 mg AMH, 1000 mg AMH, or placebo daily for 12 weeks. Measurements were taken at baseline (BL), week 6 and week 12 for AUAss, simple uroflowmetry, postvoid residual volume (PVR), C-reactive protein (CRP), Short-Form 36 Health Survey (SF-36), and International Index of Erectile Function (IIEF). Results: A total of 40 subjects completed the study. AUAss decreased 34.5% from BL to week 12 in the 1000 mg AMH group (p = 0.008). At week 12, CRP increased in the 500 mg AMH (p = 0.003) and placebo (p = 0.012) groups from their BL levels but not in the 1000 mg group. Average urine flow (Qmean) increased in the 500 mg (p = 0.033) and 1000 mg AMH (p = 0.002) groups versus placebo. PVR decreased in the 1000 mg AMH group (p = 0.034) from BL at week 6. Treatment group effects were observed for the physical functioning and sexual desire domains of the SF-36 and IIEF (p = 0.051 and p = 0.005 respectively). AMH was well tolerated. Conclusions: Oral administration of AMH improved LUTS and quality of life in as little as 6 weeks. PMID:24883106

Increased centrosome amplification in aged stem cells of the Drosophila midgut

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Joung-Sun; Pyo, Jung-Hoon; Na, Hyun-Jin

Highlights: • Increased centrosome amplification in ISCs of aged Drosophila midguts. • Increased centrosome amplification in ISCs of oxidative stressed Drosophila midguts. • Increased centrosome amplification in ISCs by overexpression of PVR, EGFR, and AKT. • Supernumerary centrosomes can be responsible for abnormal ISC polyploid cells. • Supernumerary centrosomes can be a useful marker for aging stem cells. - Abstract: Age-related changes in long-lived tissue-resident stem cells may be tightly linked to aging and age-related diseases such as cancer. Centrosomes play key roles in cell proliferation, differentiation and migration. Supernumerary centrosomes are known to be an early event in tumorigenesismore » and senescence. However, the age-related changes of centrosome duplication in tissue-resident stem cells in vivo remain unknown. Here, using anti-γ-tubulin and anti-PH3, we analyzed mitotic intestinal stem cells with supernumerary centrosomes in the adult Drosophila midgut, which may be a versatile model system for stem cell biology. The results showed increased centrosome amplification in intestinal stem cells of aged and oxidatively stressed Drosophila midguts. Increased centrosome amplification was detected by overexpression of PVR, EGFR, and AKT in intestinal stem cells/enteroblasts, known to mimic age-related changes including hyperproliferation of intestinal stem cells and hyperplasia in the midgut. Our data show the first direct evidence for the age-related increase of centrosome amplification in intestinal stem cells and suggest that the Drosophila midgut is an excellent model for studying molecular mechanisms underlying centrosome amplification in aging adult stem cells in vivo.« less

Folic Acid Promotes Recycling of Tetrahydrobiopterin and Protects Against Hypoxia-Induced Pulmonary Hypertension by Recoupling Endothelial Nitric Oxide Synthase

PubMed Central

Chalupsky, Karel; Kračun, Damir; Kanchev, Ivan; Bertram, Katharina

2015-01-01

Abstract Aims: Nitric oxide (NO) derived from endothelial NO synthase (eNOS) has been implicated in the adaptive response to hypoxia. An imbalance between 5,6,7,8-tetrahydrobiopterin (BH4) and 7,8-dihydrobiopterin (BH2) can result in eNOS uncoupling and the generation of superoxide instead of NO. Dihydrofolate reductase (DHFR) can recycle BH2 to BH4, leading to eNOS recoupling. However, the role of DHFR and eNOS recoupling in the response to hypoxia is not well understood. We hypothesized that increasing the capacity to recycle BH4 from BH2 would improve NO bioavailability as well as pulmonary vascular remodeling (PVR) and right ventricular hypertrophy (RVH) as indicators of pulmonary hypertension (PH) under hypoxic conditions. Results: In human pulmonary artery endothelial cells and murine pulmonary arteries exposed to hypoxia, eNOS was uncoupled as indicated by reduced superoxide production in the presence of the nitric oxide synthase inhibitor, L-(G)-nitro-L-arginine methyl ester (L-NAME). Concomitantly, NO levels, BH4 availability, and expression of DHFR were diminished under hypoxia. Application of folic acid (FA) restored DHFR levels, NO bioavailability, and BH4 levels under hypoxia. Importantly, FA prevented the development of hypoxia-induced PVR, right ventricular pressure increase, and RVH. Innovation: FA-induced upregulation of DHFR recouples eNOS under hypoxia by improving BH4 recycling, thus preventing hypoxia-induced PH. Conclusion: FA might serve as a novel therapeutic option combating PH. Antioxid. Redox Signal. 23, 1076–1091. PMID:26414244

Sex-based differences in veterans with pulmonary hypertension: Results from the veterans affairs-clinical assessment reporting and tracking database.

PubMed

Ventetuolo, Corey E; Hess, Edward; Austin, Eric D; Barón, Anna E; Klinger, James R; Lahm, Tim; Maddox, Thomas M; Plomondon, Mary E; Thompson, Lauren; Zamanian, Roham T; Choudhary, Gaurav; Maron, Bradley A

2017-01-01

Women have an increased risk of pulmonary hypertension (PH) but better survival compared to men. Few studies have explored sex-based differences in population-based cohorts with PH. We sought to determine whether sex was associated with hemodynamics and survival in US veterans with PH (mean pulmonary artery pressure [mPAP] ≥ 25 mm Hg) from the Veterans Affairs Clinical Assessment, Reporting, and Tracking database. The relationship between sex and hemodynamics was assessed with multivariable linear mixed modeling. Cox proportional hazards models were used to compare survival by sex for those with PH and precapillary PH (mPAP ≥ 25 mm Hg, pulmonary artery wedge pressure [PAWP] ≤ 15 mm Hg and pulmonary vascular resistance [PVR] > 3 Wood units) respectively. The study population included 15,464 veterans with PH, 516 (3%) of whom were women; 1,942 patients (13%) had precapillary PH, of whom 120 (6%) were women. Among those with PH, women had higher PVR and pulmonary artery pulse pressure, and lower right atrial pressure and PAWP (all p <0.001) compared with men. There were no significant differences in hemodynamics according to sex in veterans with precapillary PH. Women with PH had 18% greater survival compared to men with PH (adjusted HR 0.82, 95% CI 0.69-0.97, p = 0.020). Similarly, women with precapillary PH were 29% more likely to survive as compared to men with PH (adjusted HR 0.71, 95% CI 0.52-0.98, p = 0.040). In conclusion, female veterans with PH have better survival than males despite higher pulmonary afterload.

Pulmonary blood flow and pulmonary hypertension: Is the pulmonary circulation flowophobic or flowophilic?

PubMed Central

Kulik, Thomas J.

2012-01-01

Increased pulmonary blood flow (PBF) is widely thought to provoke pulmonary vascular obstructive disease (PVO), but the impact of wall shear stress in the lung is actually poorly defined. We examined information from patients having cardiac lesions which impact the pulmonary circulation in distinct ways, as well as experimental studies, asking how altered hemodynamics impact the risk of developing PVO. Our results are as follows: (1) with atrial septal defect (ASD; increased PBF but low PAP), shear stress may be increased but there is little tendency to develop PVO; (2) with normal PBF but increased pulmonary vascular resistance (PVR; mitral valve disease) shear stress may also be increased but risk of PVO still low; (3) with high PVR and PBF (e.g., large ventricular septal defect), wall shear stress is markedly increased and the likelihood of developing PVO is much higher than with high PBF or PAP only; and (4) with ASD, experimental and clinical observations suggest that increased PBF plus another stimulus (e.g., endothelial inflammation) may be required for PVO. We conclude that modestly increased wall shear stress (e.g., ASD) infrequently provokes PVO, and likely requires other factors to be harmful. Likewise, increased PAP seldom causes PVO. Markedly increased wall shear stress may greatly increase the likelihood of PVO, but we cannot discriminate its effect from the combined effects of increased PAP and PBF. Finally, the age of onset of increased PAP may critically impact the risk of PVO. Some implications of these observations for future investigations are discussed. PMID:23130101

Electron microscopic changes of detrusor in benign enlargement of prostate and its clinical correlation.

PubMed

Yadav, Sher Singh; Bhattar, Rohit; Sharma, Lokesh; Banga, Gautam; Sadasukhi, Trilok Chandra

2017-01-01

To study the ultra structural changes in bladder musculature in cases of BPE and their clinical relevance. In this descriptive longitudinal, controlled, observational study patients were enrolled into three groups, group 1, group 2A and group 2B. Control group (group-1) consisted of age matched normal male patients, who underwent surveillance or diagnostic cystoscopy for microscopic hematuria or irritative symptoms. Case group (group-2) comprised of patients with BPE, undergoing TURP. Case group (group-2) was further classified into: Category 2A (patients not on catheter) and cat-egory 2B (patients on catheter). All relevant clinical parameters like IPSS, prostate size, Qmax, PVR were recorded. Cystoscopy and bladder biopsy were performed in all patients. Various ultrastructural parameters like myocytes, fascicular pattern, interstitial tissue, nerve hypertrophy and cell junction pattern were analyzed under electron microscope and they were clinically correlated using appropriate statistical tests. Control group had significant difference as compared to case group in terms of baseline parameters like IPSS, flow rate and prostate size, both preoperatively and postoperatively, except for PVR, which was seen only preoperatively. There was statistically significant difference in ultrastructural patterns between case and control group in all five electron microscopic patterns. However, no significant difference was found between the subcategories of case groups. BPE is responsible for ultra structural changes in detrusor muscle and these changes remain persistent even after TURP. Nerve hypertrophy, which was not thoroughly discussed in previous studies, is also one of the salient feature of this study. Copyright® by the International Brazilian Journal of Urology.

Nonhomologous Recombination between Defective Poliovirus and Coxsackievirus Genomes Suggests a New Model of Genetic Plasticity for Picornaviruses

PubMed Central

Holmblat, Barbara; Jégouic, Sophie; Muslin, Claire; Blondel, Bruno; Joffret, Marie-Line

2014-01-01

ABSTRACT Most of the circulating vaccine-derived polioviruses (cVDPVs) implicated in poliomyelitis outbreaks in Madagascar have been shown to be recombinants between the type 2 poliovirus (PV) strain of the oral polio vaccine (Sabin 2) and another species C human enterovirus (HEV-C), such as type 17 coxsackie A virus (CA17) in particular. We studied intertypic genetic exchanges between PV and non-PV HEV-C by developing a recombination model, making it possible to rescue defective type 2 PV RNA genomes with a short deletion at the 3′ end by the cotransfection of cells with defective or infectious CA17 RNAs. We isolated over 200 different PV/CA17 recombinants, using murine cells expressing the human PV receptor (PVR) and selecting viruses with PV capsids. We found some homologous (H) recombinants and, mostly, nonhomologous (NH) recombinants presenting duplications of parental sequences preferentially located in the regions encoding proteins 2A, 2B, and 3A. Short duplications appeared to be stable, whereas longer duplications were excised during passaging in cultured cells or after multiplication in PVR-transgenic mice, generating H recombinants with diverse sites of recombination. This suggests that NH recombination events may be a transient, intermediate step in the generation and selection of the fittest H recombinants. In addition to the classical copy-choice mechanism of recombination thought to generate mostly H recombinants, there may also be a modular mechanism of recombination, involving NH recombinant precursors, shaping the genomes of recombinant enteroviruses and other picornaviruses. PMID:25096874

Contribution of titin and extracellular matrix to passive pressure and measurement of sarcomere length in the mouse left ventricle

PubMed Central

Chung, Charles S; Granzier, Henk L

2011-01-01

It remains to be established to what degree titin and the extracellular matrix (ECM) contribute to passive pressure in the left ventricle (LV). Thus, we aimed to elucidate the contribution of major molecular determinants of passive pressure in the normal mouse LV. Furthermore, we determined the working sarcomere length (SL) range of the LV to bridge our findings to earlier work in skinned muscle fibers. We utilized Frank-Starling type protocols to obtain diastolic pressure-volume relationships (PVR) in Langendorff perfused isolated LVs. To quantify the molecular contribution of titin and ECM, we innovated on methods of fiber mechanics to chemically permeabilize intact LVs and measure a fully passive PVR. To differentially dissect the contributions of the ECM and titin, we utilized myofilament extraction techniques in permeabilized LVs, measuring passive PVRs at each stage in the protocol. Myofilament extraction suggests that titin contributes ~80% of passive pressures in the heart. Langendorff perfusion was also used to chemically fix passive and BaCl2 activated hearts at specific volumes to determine that the maximal working SL range of the midwall LV fibers is approximately 1.8-2.2 μm. A model of the passive SL-Volume relationship was then used to estimate the pressure-SL relationships, indicating that the ECM contribution does not exceed titin's contribution until large volumes with SLs>~2.2μm. In conclusion, within physiological volumes titin is the dominant contributor to LV passive pressure, and ECM-based pressures dominates at larger volumes. PMID:21255582

Growth hormone and the heart.

PubMed

Cittadini, A; Longobardi, S; Fazio, S; Saccà, L

1999-01-01

Until a few years ago, growth hormone (GH) and insulin-like growth factor-1 (IGF-1) were considered essential only to the control of linear growth, glucose homeostasis, and for the maintenance of skeletal muscle mass. A large body of evidence recently coming from animal and human studies has unequivocally proven that the heart is a target organ for the GH/IGF-1 axis. Specifically GH exerts both direct and indirect cardiovascular actions. Among the direct effects, the ability of GH to trigger cardiac tissue growth plays a pivotal role. Another direct effect is to augment cardiac contractility, independent of myocardial growth. Direct effects of GH also include the improvement of myocardial energetics and mechanical efficiency. Indirect effects of GH on the heart include decreased peripheral vascular resistance (PVR), expansion of blood volume, increased glomerular filtration rate, enhanced respiratory activity, increased skeletal muscle performance, and psychological well-being. Among them, the most consistently found is the decrease of PVR. GH may also raise preload through its sodium-retaining action and its interference with the hormonal system that regulates water and electrolyte metabolism. Particularly important is the effect of GH on skeletal muscle mass and performance. Taking into account that heart failure is characterized by left ventricular dilation, reduced cardiac contractility, and increase of wall stress and peripheral vascular resistance, GH may be beneficial for treatment of heart failure. Animal studies and preliminary human trials have confirmed the validity of the GH approach to the treatment of heart failure. Larger placebo-controlled human studies represent the main focus of future investigations.

International Space Station (ISS)

NASA Image and Video Library

2006-09-13

These six STS 117 astronauts, assigned to launch aboard the Space Shuttle Atlantis, are (from the left) astronauts James F. Reilly II, Steven R. Swanson, mission specialists; Frederick W. (Rick) Sturckow, commander; Lee J. Archambault, pilot; and Patrick G. Forrester and John D. (Danny) Olivas, mission specialists. The crewmembers are attired in training versions of their shuttle launch and entry suits. Mission objectives include the addition of the second and third starboard truss segments (S3/S4) with Photovoltaic Radiator (PVR), the deployed third set of solar arrays. The P6 starboard solar array wing and one radiator are to be retracted.

Effects of Eicosapentaenoic Acid (EPA) and Docosahexaenoic Acid (DHA) on Fetal Pulmonary Circulation: An Experimental Study in Fetal Lambs

PubMed Central

Sharma, Dyuti; Aubry, Estelle; Ouk, Thavarak; Houeijeh, Ali; Houfflin-Debarge, Véronique; Besson, Rémi; Deruelle, Philippe; Storme, Laurent

2017-01-01

Background: Persistent pulmonary hypertension of the newborn (PPHN) causes significant morbidity and mortality in neonates. n-3 Poly-unsaturated fatty acids have vasodilatory properties in the perinatal lung. We studied the circulatory effects of eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) in fetal sheep and in fetal pulmonary arterial rings. Methods: At 128 days of gestation, catheters were placed surgically in fetal systemic and pulmonary circulation, and a Doppler probe around the left pulmonary artery (LPA). Pulmonary arterial pressure and LPA flow were measured while infusing EPA or DHA for 120 min to the fetus, to compute pulmonary vascular resistance (PVR). The dose effects of EPA or DHA were studied in vascular rings pre-constricted with serotonin. Rings treated with EPA were separated into three groups: E+ (intact endothelium), E− (endothelium stripped) and LNA E+ (pretreatment of E+ rings with l-nitro-arginine). Results: EPA, but not DHA, induced a significant and prolonged 25% drop in PVR (n = 8, p < 0.001). Incubation of vascular rings with EPA (100 µM) caused a maximum relaxation of 60% in the E+ (n = 6), whereas vessel tone did not change in the E− (n = 6, p < 0.001). The vascular effects of EPA were significantly decreased in LNA E+ (n = 6). Incubation with DHA resulted in only a mild relaxation at the highest concentration of DHA (300 µM) compared to E+. Conclusions: EPA induces a sustained pulmonary vasodilatation in fetal lambs. This effect is endothelium- and dose-dependent and involves nitric oxide (NO) production. We speculate that EPA supplementation may improve pulmonary circulation in clinical conditions with PPHN. PMID:28714905

Inter-Observer, Intra-Observer and Intra-Individual Reliability of Uroflowmetry Tests in Aged Men: A Generalizability Theory Approach.

PubMed

Liu, Ying-Buh; Yang, Stephen S; Hsieh, Cheng-Hsing; Lin, Chia-Da; Chang, Shang-Jen

2014-05-01

To evaluate the inter-observer, intra-observer and intra-individual reliability of uroflowmetry and post-void residual urine (PVR) tests in adult men. Healthy volunteers aged over 40 years were enrolled. Every participant underwent two sets of uroflowmetry and PVR tests with a 2-week interval between the tests. The uroflowmetry tests were interpreted by four urologists independently. Uroflowmetry curves were classified as bell-shaped, bell-shaped with tail, obstructive, restrictive, staccato, interrupted and tower-shaped and scored from 1 (highly abnormal) to 5 (absolutely normal). The agreements between the observers, interpretations and tests within individuals were analyzed using kappa statistics and intraclass correlation coefficients. Generalizability theory with decision analysis was used to determine how many observers, tests, and interpretations were needed to obtain an acceptable reliability (> 0.80). Of 108 volunteers, we randomly selected the uroflowmetry results from 25 participants for the evaluation of reliability. The mean age of the studied adults was 55.3 years. The intra-individual and intra-observer reliability on uroflowmetry tests ranged from good to very good. However, the inter-observer reliability on normalcy and specific type of flow pattern were relatively lower. In generalizability theory, three observers were needed to obtain an acceptable reliability on normalcy of uroflow pattern if the patient underwent uroflowmetry tests twice with one observation. The intra-individual and intra-observer reliability on uroflowmetry tests were good while the inter-observer reliability was relatively lower. To improve inter-observer reliability, the definition of uroflowmetry should be clarified by the International Continence Society. © 2013 Wiley Publishing Asia Pty Ltd.

OnabotulinumtoxinA injection therapy in men with LUTS due to primary bladder-neck dysfunction: objective and patient-reported outcomes.

PubMed

Sacco, Emilio; Tienforti, Daniele; Bientinesi, Riccardo; D'Addessi, Alessandro; Racioppi, Marco; Pinto, Francesco; Totaro, Angelo; Vittori, Matteo; D'Agostino, Daniele; Bassi, Pierfrancesco

2014-01-01

To determine efficacy and safety of OnabotulinumtoxinA (BoNT-A) injection therapy in medically refractory patients with lower urinary tract symptoms (LUTS) due to primary bladder-neck dysfunction (PBND). Thirty-five consecutive ambulatory males diagnosed with PBND and refractory to medical therapy, with IPSS > 15, Qmax < 15 ml/sec, and total prostate volume < 30 cm(3), were screened from January 2010 to December 2011. Eligible patients underwent transurethral bladder-neck injection of BoNT-A (200 U, 50 U/ml × 4 sites) and were assessed at baseline, 2-, 6-, 9-, and 12-month postprocedure and until duration of clinical response. The primary outcome was the change from baseline in total IPSS, and secondary outcome were storage- and voiding-IPSS, QoL score, Qmax, and postvoiding residual volume (PVR), patient-reported outcomes. Adverse effects were also recorded, including ejaculatory dysfunctions. Of 30 enrolled patients (mean age 33.8 years), 29 (96.7%) completed the study. A statistically significant improvement of total IPSS was observed from 21.9 at baseline, to 7.8, 10.3, and 16.6 at 2, 6, and 9 months, respectively (P < 0.000). Statistically significant improvements from baseline of storage- and voiding-IPSS, QoL score, Qmax, and PVR were also observed until 9-month postprocedure. The proportion of patients with overall satisfaction was favorable although decreasing from 80% at 2 months, to 44.8% at 12 months. No significant adverse effects or ejaculatory dysfunctions were noted. BoNT-A injection therapy appears effective and safe in medically refractory men with PBND, although repeated procedures are required for long-term sustained benefit. Randomized controlled trials are warranted in order to corroborate these results. © 2013 Wiley Periodicals, Inc.

MicroRNA-29b regulates TGF-β1-mediated epithelial–mesenchymal transition of retinal pigment epithelial cells by targeting AKT2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Min; Li, Hui; Liu, Xiaoqiang

2016-07-15

The role of microRNA (miRNA) in proliferative vitreoretinopathy (PVR) progression has not been studied extensively, especially in retinal pigment epithelial–mesenchymal transition (EMT) which is the main reason for formation of PVR. In this study, we first investigated the miRNA expression profile in transforming growth factor beta 1 (TGF-β1) mediated EMT of ARPE-19 cells. Among the five changed miRNAs, miR-29b showed the most significant downregulation. Enhanced expression of miR-29b could reverse TGF-β1 induced EMT through targeting Akt2. Akt2 downregulation could inhibit TGF-β1-induced EMT. Furthermore, inhibition of miR-29b in ARPE-19 cells directly triggered EMT process, which characterized by the phenotypic transition andmore » the upregulation of α-smooth muscle actin (α-SMA) and downregulation of E-cadherin and zona occludin-1 (ZO-1) with increased cell migration. Akt2-shRNA also inhibited miR-29 inhibitor-induced EMT process. These data indicate that miR-29b plays an important role in TGF-β1-mediated EMT in ARPE-19 cells by targeting Akt2. - Highlights: • MiR-29b expression is decreased in TGF-β1-induced EMT of ARPE-19 cells. • MiR-29b inhibits TGF-β1-induced EMT in ARPE-19 cells. • MiR-29b inhibitor induces EMT in ARPE-19 cells. • Akt2 is the target for miR-29b. • Downregulation of Akt2 prevents TGF-β1-induced EMT of ARPE-19 cells.« less

Effects of captopril administration on pulmonary haemodynamics and tissue oxygenation during exercise in ACE gene subtypes in patients with COPD: a preliminary study.

PubMed

Kanazawa, H; Hirata, K; Yoshikawa, J

2003-07-01

We have previously shown that angiotensin converting enzyme (ACE) DD genotype is associated with exaggerated pulmonary hypertension and disturbance of tissue oxygenation during exercise in patients with chronic obstructive pulmonary disease (COPD). A pilot study was designed to examine the effects of captopril on these exercise related variables in COPD patients categorised according to ACE gene polymorphisms. Thirty six patients with COPD (II=13, ID=11, DD=12) received oral captopril (25 mg) or placebo in a randomised, double blind, crossover manner and underwent right heart catheterisation with exercise. Mean pulmonary arterial pressure (mPAP), pulmonary vascular resistance (PVR), and lactate concentration after exercise with both placebo and captopril were higher in patients with the DD genotype than in those with the II or ID genotypes. In contrast, mixed venous oxygen tension (PvO(2)) was lower in patients with the DD genotype than in those with the other genotypes. Moreover, mPAP, PVR, and lactate concentration after exercise were lower in the captopril group than in the placebo group in patients with the II or ID genotype, but not in those with the DD genotype. PvO(2) after exercise was higher with captopril than with placebo in patients with the II genotype, but not in those with the other genotypes. These findings suggest that pulmonary haemodynamic variables and state of tissue oxygenation during exercise are dependent on ACE genotypes, and that captopril administration effectively influences these exercise related variables. Although the sample size in this pilot study was limited, it is likely that the improvement in exercise related variables in COPD patients with the II genotype is relatively sensitive to captopril.

Cold ischemia with selective anterograde in situ pulmonary perfusion preserves gas exchange and mitochondrial homeostasis and curbs inflammation in an experimental model of donation after cardiac death.

PubMed

Pottecher, Julien; Santelmo, Nicola; Noll, Eric; Charles, Anne-Laure; Benahmed, Malika; Canuet, Matthieu; Frossard, Nelly; Namer, Izzie J; Geny, Bernard; Massard, Gilbert; Diemunsch, Pierre

2013-10-01

The aim of this study was to assess the functional preservation of the lung graft with anterograde lung perfusion in a model of donation after cardiac death. Thirty minutes after cardiac arrest, in situ anterograde selective pulmonary cold perfusion was started in six swine. The alveolo-capillary membrane was challenged at 3, 6, and 8 h with measurements of the mean pulmonary arterial pressure (mPAP), the pulmonary vascular resistance (PVR), the PaO2 /FiO2 ratio, the transpulmonary oxygen output (tpVO2 ), and the transpulmonary CO2 clearance (tpCO2 ). Mitochondrial homeostasis was investigated by measuring maximal oxidative capacity (Vmax ) and the coupling of phosphorylation to oxidation (ACR, acceptor control ratio) in lung biopsies. Inflammation and induction of primary immune response were assessed by measurement of tumor necrosis factor alpha (TNFα), interleukine-6 (IL-6) and receptor for advanced glycation endproducts (RAGE) in bronchoalveolar lavage fluid. Data were compared using repeated measures Anova. Pulmonary hemodynamics (mPAP: P = 0.69; PVR: P = 0.46), oxygenation (PaO2 /FiO2 : P = 0.56; tpVO2 : P = 0.46), CO2 diffusion (tpCO2 : P = 0.24), mitochondrial homeostasis (Vmax : P = 0.42; ACR: P = 0.8), and RAGE concentrations (P = 0.24) did not significantly change up to 8 h after cardiac arrest. TNFα and IL-6 were undetectable. Unaffected pulmonary hemodynamics, sustained oxygen and carbon dioxide diffusion, preserved mitochondrial homeostasis, and lack of inflammation suggest a long-lasting functional preservation of the graft with selective anterograde in situ pulmonary perfusion. © 2013 Steunstichting ESOT. Published by John Wiley & Sons Ltd.

Alterations in plasma L-arginine and methylarginines in heart failure and after heart transplantation.

PubMed

Lundgren, Jakob; Sandqvist, Anna; Hedeland, Mikael; Bondesson, Ulf; Wikström, Gerhard; Rådegran, Göran

2018-04-12

Endothelial function, including the nitric oxide (NO)-pathway, has previously been extensively investigated in heart failure (HF). In contrast, studies are lacking on the NO pathway after heart transplantation (HT). We therefore investigated substances in the NO pathway prior to and after HT in relation to hemodynamic parameters. 12 patients (median age 50.0 yrs, 2 females), heart transplanted between June 2012 and February 2014, evaluated at our hemodynamic lab, at rest, prior to HT, as well as four weeks and six months after HT were included. All patients had normal left ventricular function post-operatively and none had post-operative pulmonary hypertension or acute cellular rejection requiring therapy at the evaluations. Plasma concentrations of ADMA, SDMA, L-Arginine, L-Ornithine and L-Citrulline were analyzed at each evaluation. In comparison to controls, the plasma L-Arginine concentration was low and ADMA high in HF patients, resulting in low L-Arginine/ADMA-ratio pre-HT. Already four weeks after HT L-Arginine was normalized whereas ADMA remained high. Consequently the L-Arginine/ADMA-ratio improved, but did not normalize. The biomarkers remained unchanged at the six-month evaluation and the L-Arginine/ADMA-ratio correlated inversely to pulmonary vascular resistance (PVR) six months post-HT. Plasma L-Arginine concentrations normalize after HT. However, as ADMA is unchanged, the L-Arginine/ADMA-ratio remained low and correlated inversely to PVR. Together these findings suggest that (i) the L-Arginine/ADMA-ratio may be an indicator of pulmonary vascular tone after HT, and that (ii) NO-dependent endothelial function is partly restored after HT. Considering the good postoperative outcome, the biomarker levels may be considered "normal" after HT.

Fisetin inhibits epidermal growth factor-induced migration of ARPE-19 cells by suppression of AKT activation and Sp1-dependent MMP-9 expression.

PubMed

Lin, Hung-Yu; Chen, Yong-Syuan; Wang, Kai; Chien, Hsiang-Wen; Hsieh, Yi-Hsien; Yang, Shun-Fa

2017-01-01

Proliferative vitreoretinopathy (PVR) can result in abnormal migration of RPE cells. Fisetin is a naturally occurring compound that has been reported to have antitumor effects, but its effects on epidermal growth factor (EGF)-induced cell migration and the underlying mechanisms remain unclear. Effects of fisetin on EGF-induced cell viability and migration were examined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and in vitro migration assays. Reverse transcription-PCR (RT-PCR) and immunoblotting were performed to evaluate matrix metallopeptidase-9 (MMP-9) expression and activation of specificity protein-1 (Sp1) and protein kinase B (AKT) in ARPE-19 cells treated with EGF and with or without fisetin. Luciferase and chromatin immunoprecipitation (ChIP) assays were performed to examine Sp1 transcription activity and MMP-9 binding activity. Fisetin did not affect ARPE-19 cell viability and significantly inhibited the EGF-induced migration capacity of ARPE-19 cells. Furthermore, fisetin exerted an antimigratory effect and suppressed MMP-9 mRNA and protein expression. Treatment with EGF induced phosphorylation of AKT and expression of MMP-9 and Sp1. Fisetin combined with LY294002 (an inhibitor of AKT) prevented the EGF-induced migration involved in downregulation of Sp1 and MMP-9 expression. Luciferase and ChIP assays suggested that fisetin remarkably decreased the EGF-induced transcription activity of MMP-9 and Sp1 and inhibited EGF-mediated Sp1 from directly binding to the MMP-9 promoter in ARPE-19 cells. Fisetin inhibited EGF-induced cell migration via modulation of AKT/Sp1-dependent MMP-9 transcriptional activity. Therefore, fisetin may be a potential agent in the treatment of migratory PVR diseases.

Changes in Central Aortic Pressure Levels, Wave Components and Determinants Associated with High Peripheral Blood Pressure States in Childhood: Analysis of Hypertensive Phenotype.

PubMed

García-Espinosa, Victoria; Curcio, Santiago; Marotta, Marco; Castro, Juan M; Arana, Maite; Peluso, Gonzalo; Chiesa, Pedro; Giachetto, Gustavo; Bia, Daniel; Zócalo, Yanina

2016-10-01

The aims were to determine whether children's high peripheral blood pressure states (HBP) are associated with increased central aortic blood pressure (BP) and to characterize hemodynamic and vascular changes associated with HBP in terms of changes in cardiac output (stroke volume, SV), arterial stiffness (aortic pulse wave velocity, PWV), peripheral vascular resistances (PVR) and net and relative contributions of reflected waves to the aortic pulse amplitude. We included 154 subjects (mean age 11; range 4-16 years) assigned to one of two groups: normal peripheral BP (NBP, n = 101), defined as systolic and diastolic BP < 90th percentile, or high BP (HBP, n = 53), defined as average systolic and/or diastolic BP levels ≥90th percentile (curves for sex, age and body height). The HBP group included children with hypertensive and pre-hypertensive BP levels. After a first analysis, groups were compared excluding obese and dyslipidemic children. Peripheral and central aortic BP, PWV and pulse wave-derived parameters (augmentation index, forward and backward wave components' amplitude) were measured using gold-standard techniques, applanation tonometry (SphygmoCor) and oscillometry (Mobil-O-Graph). Independent of the presence of dyslipidemia and/or obesity, aortic systolic and pulse BP were higher in HBP than in NBP children. The increase in central BP could not be explained by an increase in the relative contribution of reflections to the aortic pressure wave, higher PVR or by an augmented peripheral reflection coefficient. Instead, the rise in central BP would be explained by an increase in the amplitude of both incident and reflected wave components.

Overexpression of Snail in retinal pigment epithelial triggered epithelial–mesenchymal transition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Hui; Li, Min; Xu, Ding

2014-03-28

Highlights: • First reported overexpression of Snail in RPE cells could directly trigger EMT. • Further confirmed the regulator role of Snail in RPE cells EMT in vitro. • Snail may be a potential therapeutic target to prevent the fibrosis of PVR. - Abstract: Snail transcription factor has been implicated as an important regulator in epithelial–mesenchymal transition (EMT) during tumourigenesis and fibrogenesis. Our previous work showed that Snail transcription factor was activated in transforming growth factor β1 (TGF-β1) induced EMT in retinal pigment epithelial (RPE) cells and may contribute to the development of retinal fibrotic disease such as proliferative vitreoretinopathymore » (PVR). However, whether Snail alone has a direct role on retinal pigment epithelial–mesenchymal transition has not been investigated. Here, we analyzed the capacity of Snail to drive EMT in human RPE cells. A vector encoding Snail gene or an empty vector were transfected into human RPE cell lines ARPE-19 respectively. Snail overexpression in ARPE-19 cells resulted in EMT, which was characterized by the expected phenotypic transition from a typical epithelial morphology to mesenchymal spindle-shaped. The expression of epithelial markers E-cadherin and Zona occludin-1 (ZO-1) were down-regulated, whereas mesenchymal markers a-smooth muscle actin (a-SMA) and fibronectin were up-regulated in Snail expression vector transfected cells. In addition, ectopic expression of Snail significantly enhanced ARPE-19 cell motility and migration. The present data suggest that overexpression of Snail in ARPE-19 cells could directly trigger EMT. These results may provide novel insight into understanding the regulator role of Snail in the development of retinal pigment epithelial–mesenchymal transition.« less

Dose-Response Head-to-Head Comparison of Inodilators Dobutamine, Milrinone, and Levosimendan in Chronic Experimental Pulmonary Hypertension.

PubMed

Tavares-Silva, Marta; Alaa, Mohamed; Leite, Sara; Oliveira-Pinto, José; Lopes, Lucas; Leite-Moreira, Adelino F; Lourenço, André P

2017-09-01

The choice of inodilator drug in the acute management of patients with pulmonary hypertension (PH) having right ventricular (RV) failure remains unsettled and challenging. Comprehensive experimental evaluations may provide further insight and fundamental translational research clues to support inodilator selection and clinical trial design. Our aim was to compare acute dose-response hemodynamic effects of inodilators dobutamine (DOB), milrinone (MIL), and levosimendan (LEV) in chronic experimental PH. Seven-week-old male Wistar rats were randomly injected with 60 mg·kg -1 monocrotaline (MCT) or vehicle (Ctrl, n = 7) and underwent systemic and pulmonary artery (PA) pressure and RV pressure-volume (PV) hemodynamic evaluation under halogenate anesthesia 24 to 30 days after injection. The MCT-injected animals (n = 7 each) randomly received dose-response infusions of DOB (1, 3, 6 and 12 μg·kg -1 ·min -1 ), MIL (MIL: 1, 3, 6 and 12 μg·kg -1 ·min -1 ), or LEV (0.3, 0.6, 1.2 and 2.4 μg·kg -1 ·min -1 ). Load-independent indexes were obtained by inferior vena cava occlusion at baseline and after the last dose. All inodilators increased RV ejection fraction, preload recruitable stroke work, and ventricular-vascular coupling without jeopardizing perfusion pressure. Dobutamine raised heart rate and PA pressure. Only LEV increased cardiac index and decreased PA elastance and pulmonary vascular resistance (PVR). Moreover, only LEV downward-shifted the end-diastolic PV relationship, thereby improving RV compliance. Adding sildenafil to LEV further decreased PVR. Levosimendan had beneficial acute systolic and diastolic functional effects in experimental chronic PH and RV afterload compared to DOB and MIL. It should be further tested in clinical trials enrolling patients with PH in the perioperative and critical care settings.

Fisetin inhibits epidermal growth factor–induced migration of ARPE-19 cells by suppression of AKT activation and Sp1-dependent MMP-9 expression

PubMed Central

Lin, Hung-Yu; Chen, Yong-Syuan; Wang, Kai; Chien, Hsiang-Wen

2017-01-01

Purpose Proliferative vitreoretinopathy (PVR) can result in abnormal migration of RPE cells. Fisetin is a naturally occurring compound that has been reported to have antitumor effects, but its effects on epidermal growth factor (EGF)–induced cell migration and the underlying mechanisms remain unclear. Methods Effects of fisetin on EGF-induced cell viability and migration were examined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and in vitro migration assays. Reverse transcription–PCR (RT–PCR) and immunoblotting were performed to evaluate matrix metallopeptidase-9 (MMP-9) expression and activation of specificity protein-1 (Sp1) and protein kinase B (AKT) in ARPE-19 cells treated with EGF and with or without fisetin. Luciferase and chromatin immunoprecipitation (ChIP) assays were performed to examine Sp1 transcription activity and MMP-9 binding activity. Results Fisetin did not affect ARPE-19 cell viability and significantly inhibited the EGF-induced migration capacity of ARPE-19 cells. Furthermore, fisetin exerted an antimigratory effect and suppressed MMP-9 mRNA and protein expression. Treatment with EGF induced phosphorylation of AKT and expression of MMP-9 and Sp1. Fisetin combined with LY294002 (an inhibitor of AKT) prevented the EGF-induced migration involved in downregulation of Sp1 and MMP-9 expression. Luciferase and ChIP assays suggested that fisetin remarkably decreased the EGF-induced transcription activity of MMP-9 and Sp1 and inhibited EGF-mediated Sp1 from directly binding to the MMP-9 promoter in ARPE-19 cells. Conclusions Fisetin inhibited EGF-induced cell migration via modulation of AKT/Sp1–dependent MMP-9 transcriptional activity. Therefore, fisetin may be a potential agent in the treatment of migratory PVR diseases. PMID:29296070

Safety and efficacy of tamsulosin, alfuzosin or silodosin as monotherapy for LUTS in BPH – a double-blind randomized trial

PubMed Central

Manohar, Chikka Moga Siddaiah; Nagabhushana, Mahadevappa; Sanjay, Ramachandra Pudakalkatti; Kamath, Ananth Janardhan; Keshavamurthy, Ramaiah

2017-01-01

Introduction Currently alpha1-adrenoceptor blockers (AB) are widely used as first-line therapy to improve lower urinary tract symptoms (LUTS) associated with benign prostatic hyperplasia (BPH). We compared the efficacy and safety profile of tamsulosin, alfuzosin and silodosin in LUTS due to BPH. Material and methods Consecutive consenting male patients (N = 269) undergoing medical management of BPH with AB from February 2012 to October 2015 were enrolled. Patients were randomized to a 0.4 mg tamsulosin (group T), 10 mg alfuzosin (group A) or a 8 mg silodosin (group S) by double-blind randomization. All patients were assessed for improvements and post-void residual urine (PVR) and for adverse drug events (ADE). Results IPSS showed significant improvement in Group S at the first week (11.7 ±4.18, p = 0.027) and at 3 months (7.97 ±3.84, p = 0.020). QOL showed significant improvement at 1 (2.2 ±0.76, p = 0.020), 4 (1.47 ±0.63, p <0.001) and 12 (1.2 ±0.66, p <0.001) weeks in Group S. The mean Qmax improvement was the maximum (13.76 ±2.44, p = 0.028) in Group S at 1 week. Reduction in PVR was the maximum in Group S, but it was not statistically significant. Adverse drug events (ADE) were observed in 20.07% (54/269) patients and distribution was similar in the three groups with decreasing incidence with progression of time. Conclusions Silodosin is the most efficacious AB with rapid onset of action. Silodosin also improves the quality of life in patients with LUTS due to BPH and objectively improves maximum flow rate. However, silodosin has more adverse events when compared to tamsulosin and alfuzosin. PMID:28721281

SIMULTANEOUS URODYNAMIC AND ANORECTAL MANOMETRY STUDIES IN CHILDREN: INSIGHTS INTO THE RELATIONSHIP BETWEEN THE LOWER GASTROINTESTINAL AND LOWER URINARY TRACTS

PubMed Central

Ambartsumyan, Lusine; Siddiqui, Anees; Bauer, Stuart; Nurko, Samuel

2016-01-01

Background Children with urinary incontinence (UI) have associated functional constipation (FC) and fecal incontinence (FI). The physiology between lower urinary tract (LUT) and anorectum in children has not been elucidated. Aims Observe the effect of rectal distention (RD) on LUT function, and bladder filling and voiding on anorectal function. Methods Children with voiding dysfunction referred to Boston Children’s Hospital were prospectively enrolled for combined urodynamic (UDS) and anorectal manometry (ARM). Anorectal and urodynamic parameters were simultaneously measured. Patients underwent 2 micturition cycles, 1st with rectal balloon deflated and 2nd with it inflated (RD). LUT and anorectal parameters were compared between cycles. Key Results 10 children (7 UI, 4 recurrent UTIs, 9 FC ± FI) were enrolled. Post void residual (PVR) increased (p=0.02) with RD. No differences were observed in percent of bladder filling to expected bladder capacity, sensation, and bladder compliance with and without RD. Bladder and abdominal pressures increased at voiding with RD (p<0.05). Intra-anal pressures decreased at voiding (p<0.05), at 25% (p=0.03) and 50% (p=0.06) of total volume of bladder filling. Conclusions & Inferences The PVR volume increased with RD. Stool in the rectum does not alter filling cystometric capacity but decreases the bladder’s ability to empty predisposing patients with fecal retention to UI and UTIs. Bladder and abdominal pressures increased during voiding demonstrating a physiological correlate of dysfunctional voiding. Intra-anal pressures decreased during bladder filling and voiding. This is the first time intra-anal relaxation during bladder filling and voiding has been described. PMID:27214097

Assessment of N-terminal prohormone B-type natriuretic peptide as a measure of vascular and ventricular function in pediatric pulmonary arterial hypertension

PubMed Central

Dunning, Jamie; Truong, Uyen; Ivy, D. Dunbar; Hunter, Kendall A.; Shandas, Robin

2015-01-01

Abstract Pulmonary arterial hypertension (PAH) is a progressive disease that puts excessive mechanical loads on the ventricle due to a gradual increase in pulmonary vascular impedance. We hypothesize that the increase in right ventricular (RV) afterload is reflected in the concentration of circulating biochemical markers of ventricular strain and stress (B-type natriuretic peptide [BNP] and N-terminal prohormone BNP [NT-proBNP]). We retrospectively analyzed right heart catheterization (RHC) and serum biochemical analysis data () for a pediatric PAH cohort with no sign of left ventricular dysfunction. Using RHC data, we computed an estimate of pulmonary vascular resistance (PVR), compliance, and ventricular-vascular coupling. We also compared how the early onset of interventricular decoupling (characterized as septal flattening) impacts serum NT-proBNP concentrations. Our data revealed correlated NT-proBNP expression with both the resistive and reactive components of RV afterload, an estimate of ventricular-vascular coupling, and a significant increase in biomarker expression in patients with a flattened interventricular septum. Furthermore, the strong correlation between PVR and NT-proBNP appears to break down under flat septum morphology. Over 80% of resistive RV afterload variance is reflected in serum NT-proBNP concentration in pediatric patients with PAH with no sign of left ventricular dysfunction. Reactive afterload appears to contribute to myocardial NT-proBNP release at advanced stages of PAH. Therefore, in mild-to-moderate PAH, resistive afterload is likely the greatest contributor to RV wall stress. These findings could also be used to estimate invasive RHC measurements from serum biochemical analysis, but more work is needed to improve correlations and overcome the issue of interventricular decoupling. PMID:26697173

3-Bromopyruvate reverses hypoxia-induced pulmonary arterial hypertension through inhibiting glycolysis: In vitro and in vivo studies.

PubMed

Chen, Fangzheng; Wang, Heng; Lai, Jiadan; Cai, Shujing; Yuan, Linbo

2018-05-04

Pulmonary arterial smooth muscle cell (PASMC) proliferation is vital to pulmonary vascular remodeling in pulmonary arterial hypertension (PAH) pathogenesis, and inhibiting PASMC metabolism could serve as a new possible therapy to reverse the process. 3-Bromopyruvate (3-BrPA) is an effective glycolysis inhibitor with its effect in PAH remains unclear. Our study aims to assess the therapeutic effect of 3-BrPA in PAH rats and investigate the possible mechanism of 3-BrPA in PASMC proliferation and apoptosis. 27 healthy SD rats were grouped and treated with hypoxia/normoxia and administration of 3-BrPA/physiological saline. Mean pulmonary artery pressure (mPAP) and cardiac output (CO) were measured and pulmonary vascular resistance (PVR) was calculated. Right ventricular hypertrophy index (RVHI) was calculated to evaluate the right ventricular hypertrophy degree. The percentage of medial wall area (WA%) and medial wall thickness (WT%) were measured by image analysis. PASMCs groups received hypoxia/normoxia treatments and 3-BrPA/physiological saline. PASMC proliferation and migration were respectively detected by CCK-8 and cell wound scratch assay. Hexokinase II (HK-2) expression and lactate level were respectively measured by Western Blotting and lactate test kit to detect glycolysis. mPAP, PVR, PVHI, WA% and WT% in rats increased after the hypoxia treatment, but were lower compared to rats received 3-BrPA in hypoxia environment. HK-2 expression, lactate concentration, OD value and scratch areas in PASMCs increased after the hypoxia treatment, but were decreased after the administration of 3-BrPA. 3-BrPA can inhibit PASMC proliferation and migration by inhibiting glycolysis, and is effective in reversing the vascular remodeling in hypoxia-induced PAH rats. Copyright © 2017. Published by Elsevier B.V.

GreenLight HPS laser 120-W versus diode laser 200-W vaporization of the prostate: comparative clinical experience.

PubMed

Chiang, Po Hui; Chen, Chien Hsu; Kang, Chih Hsiung; Chuang, Yao Chi

2010-09-01

We present our clinical experiences of two recently introduced vaporization laser systems: the GreenLight High Performance System (HPS) laser (532 nm, 120 W) and the Diolas LFD diode laser (980 nm, 200 W). Two laser systems were evaluated to compare their clinical results for the treatment of benign prostatic hyperplasia (BPH). Patients were treated using either the GreenLight HPS laser (n = 84) or the diode laser (n = 55) in a prospective randomized study. The data of International Prostate Symptom Score (IPSS), maximum flow rate (Q(max)), post-void residual urine (PVR), and quality of life score (Qols) were recorded at baseline, 1-, 6-, and 12-month follow-ups. The prostate volume and prostate-specific antigen (PSA) level were assessed at baseline and 6-month follow-up. All complications were also recorded. There was a statistically significant difference in IPSS, Q(max), PVR, and QoLs in each laser group at the 1-, 6-, and 12-month follow-ups compared with baseline. There was no statistical significant difference in any of these parameters at any follow-up interval between each group. The diode laser demonstrates superior hemostatic properties compared with the GreenLight HPS laser. Postoperative incontinence and postoperative irritative symptoms are more pronounced (P < 0.05) after diode laser prostatectomy. Higher incidence of dysuria with sloughing tissues and epididymitis (P < 0.05) is noted after diode laser prostatectomy. Other complications were comparable for both procedures. Although both lasers can improve subjective and objective parameters of BPH, both can produce undesired effects. The search for the ideal vaporization laser to treat BPH still continues. 2010 Wiley-Liss, Inc.

Transurethral vaporesection of prostate: diode laser or thulium laser?

PubMed

Tan, Xinji; Zhang, Xiaobo; Li, Dongjie; Chen, Xiong; Dai, Yuanqing; Gu, Jie; Chen, Mingquan; Hu, Sheng; Bai, Yao; Ning, Yu

2018-05-01

This study compared the safety and effectiveness of the diode laser and thulium laser during prostate transurethral vaporesection for treating benign prostate hyperplasia (BPH). We retrospectively analyzed 205 patients with BPH who underwent a diode laser or thulium laser technique for prostate transurethral vaporesection from June 2016 to June 2017 and who were followed up for 3 months. Baseline characteristics of the patients, perioperative data, postoperative outcomes, and complications were compared. We also assessed the International Prostate Symptom Score (IPSS), quality of life (QoL), maximum flow rate (Q max ), average flow rate (AFR), and postvoid residual volume (PVR) at 1 and 3 months postoperatively to evaluate the functional improvement of each group. There were no significant differences between the diode laser and thulium laser groups related to age, prostate volume, operative time, postoperative hospital stays, hospitalization costs, or perioperative data. The catheterization time was 3.5 ± 0.8 days for the diode laser group and 4.7 ± 1.8 days for the thulium laser group (p < 0.05). Each group had dramatic improvements in IPSS, QoL, Q max , AFR, and PVR compared with the preoperative values (p < 0.05), although there were no significant differences between the two groups. Use of both diode laser and thulium laser contributes to safe, effective transurethral vaporesection in patients with symptomatic BPH. Diode laser, however, is better than thulium laser for prostate transurethral vaporesection because of its shorter catheterization time. The choice of surgical approach is more important than the choice of laser types during clinical decision making for transurethral laser prostatectomy.

Serotonin (5-HT)2A/2C receptor agonist (2,5-dimethoxy-4-idophenyl)-2-aminopropane hydrochloride (DOI) improves voiding efficiency in the diabetic rat.

PubMed

Tu, Hongjian; Cao, Nailong; Gu, Baojun; Si, Jiemin; Chen, Zhong; Andersson, Karl-Erik

2015-07-01

To examine the effects of the serotonin (5-HT)2A/2C receptor agonist (2,5-dimethoxy-4-idophenyl)-2-aminopropane hydrochloride (DOI) on micturition in rats with diabetes mellitus (DM). Female Sprague-Dawley rats (n = 16) were divided into two groups: rats with Type 1 DM and age-matched control rats. DM was induced by i.p. injection of streptozotocin (65 mg/kg) and detailed cystometrogram (CMG) studies were performed 8 weeks post-injection in all rats under urethane anaesthesia. The selective 5-HT2A antagonist ketanserin was administered after each DOI dose-response curve was plotted. All drugs were administered i.v. Compared with controls, comprehensive urodynamic studies showed that DM rats had a higher bladder capacity and post-void residual urine volume (PVR), and a markedly lower voiding efficiency. In DM rats, DOI (0.01-0.3 mg/kg) induced significant dose-dependent increases in micturition volume and reductions in PVR, resulting in greater voiding efficiency. CMG measurements showed a dose-dependent increase in high-frequency oscillation (HFO) activity, evidenced by an increased duration of HFOs per voiding. This correlated with the improved voiding efficiency. Ketanserin (0.1 mg/kg) partially or completely reversed the DOI-induced changes. The HFOs observed in the present study seem to correlate with external urethral sphincter bursting activity during voiding. Bladder voiding efficiency was reduced in DM rats. The 5-HT2A receptor agonist can enhance HFO activity and improves voiding efficiency, and so may represent a new strategy to improve voiding efficiency after DM in experimental studies. © 2014 The Authors BJU International © 2014 BJU International Published by John Wiley & Sons Ltd.

Oxygen saturation index and severity of hypoxic respiratory failure.

PubMed

Rawat, Munmun; Chandrasekharan, Praveen K; Williams, Ashley; Gugino, Sylvia; Koenigsknecht, Carmon; Swartz, Daniel; Ma, Chang Xing; Mathew, Bobby; Nair, Jayasree; Lakshminrusimha, Satyan

2015-01-01

The oxygenation index (OI = mean airway pressure, MAP × FiO2 × 100 : PaO2) is used to assess the severity of hypoxic respiratory failure (HRF) and persistent pulmonary hypertension of the newborn (PPHN). An indwelling arterial line or arterial punctures are necessary to obtain PaO2 for the calculation of OI. Oxygenation can be continuously and noninvasively assessed using pulse oximetry. The use of the oxygen saturation index (OSI = MAP × FiO2 × 100 : SpO2) can be an alternate method of assessing the severity of HRF. To evaluate the correlation between OSI and OI in the following: (1) neonates with HRF and (2) a lamb model of meconium aspiration syndrome. Human neonates: a retrospective chart review of 74 ventilated late preterm/term neonates with indwelling arterial access and SpO2 values in the first 24 h of life was conducted. OSI and OI were calculated and correlated. Lamb model: arterial blood gases were drawn and preductal SpO2 was documented in 40 term newborn lambs with asphyxia and meconium aspiration. OI and OSI were calculated and correlated with pulmonary vascular resistance (PVR). Mean values of OSI and OI showed a correlation coefficient of 0.952 in neonates (mean value of 308 observations in 74 neonates) and 0.948 in lambs (mean value of 743 observations in 40 lambs). In lambs, with increasing PVR, there was a decrease in OI and OSI. OSI correlates significantly with OI in infants with HRF. This noninvasive measure may be used to assess the severity of HRF and PPHN in neonates without arterial access. © 2015 S. Karger AG, Basel

Effect of re-expansion after short-period lung collapse on pulmonary capillary permeability and pro-inflammatory cytokine gene expression in isolated rabbit lungs.

PubMed

Funakoshi, T; Ishibe, Y; Okazaki, N; Miura, K; Liu, R; Nagai, S; Minami, Y

2004-04-01

Re-expansion pulmonary oedema is a rare complication caused by rapid re-expansion of a chronically collapsed lung. Several cases of pulmonary oedema associated with one-lung ventilation (OLV) have been reported recently. Elevated levels of pro-inflammatory cytokines in pulmonary oedema fluid are suggested to play important roles in its development. Activation of cytokines after re-expansion of collapsed lung during OLV has not been thoroughly investigated. Here we investigated the effects of re-expansion of the collapsed lung on pulmonary oedema formation and pro-inflammatory cytokine expression. Lungs isolated from female white Japanese rabbits were perfused and divided into a basal (BAS) group (n=7, baseline measurement alone), a control (CONT) group (n=9, ventilated without lung collapse for 120 min) and an atelectasis (ATEL) group (n=9, lung collapsed for 55 min followed by re-expansion and ventilation for 65 min). Pulmonary vascular resistance (PVR) and the coefficient of filtration (Kfc) were measured at baseline and 60 and 120 min. At the end of perfusion, bronchoalveolar lavage fluid/plasma protein ratio (B/P), wet/dry lung weight ratio (W/D) and mRNA expressions of tumour necrosis factor (TNF)-alpha, interleukin (IL)-1beta and myeloperoxidase (MPO) were determined. TNF-alpha and IL-1beta mRNA were significantly up-regulated in lungs of the ATEL group compared with BAS and CONT, though no significant differences were noted in PVR, Kfc, B/P and W/D within and between groups. MPO increased at 120 min in CONT and ATEL groups. Pro-inflammatory cytokines were up-regulated upon re-expansion and ventilation after short-period lung collapse, though no changes were noted in pulmonary capillary permeability.

Clinical and hemodynamic improvements after adding ambrisentan to background PDE5i therapy in patients with pulmonary arterial hypertension exhibiting a suboptimal therapeutic response (ATHENA-1).

PubMed

Shapiro, Shelley; Torres, Fernando; Feldman, Jeremy; Keogh, Anne; Allard, Martine; Blair, Christiana; Gillies, Hunter; Tislow, James; Oudiz, Ronald J

2017-05-01

Pulmonary arterial hypertension (PAH) is a condition which may lead to right ventricular failure and premature death. While recent data supports the initial combination of ambrisentan (a selective ERA) and tadalafil (a PDE5i) in functional class II or III patients, there is no published data describing the safety and efficacy of ambrisentan when added to patients currently receiving a PDE5i and exhibiting a suboptimal response. The ATHENA-1 study describes the safety and efficacy of the addition of ambrisentan in this patient population. PAH patients with a suboptimal response to current PDE5i monotherapy were assigned ambrisentan in an open-label fashion and evaluated for up to 48 weeks. Cardiopulmonary hemodynamics (change in PVR as primary endpoint) were evaluated at week 24 and functional parameters and biomarkers were measured through week 48. Time to clinical worsening (TTCW) and survival are also described. Thirty-three subjects were included in the analysis. At week 24, statistically significant improvements in PVR (-32%), mPAP (-11%), and CI (+25%) were observed. Hemodynamic improvements at week 24 were further supported by improvements in the secondary endpoints: 6-min walk distance (+18 m), NT-proBNP (-31%), and maintenance or improvement in WHO FC in 97% of patients. Adverse events were consistent with known effects of ambrisentan. The hemodynamic, functional, and biomarker improvements observed in the ATHENA-1 study suggests that the sequential addition of ambrisentan to patients not having a satisfactory response to established PDE5i monotherapy is a reasonable option. Published by Elsevier Ltd.

Bladder control training in girls with lower urinary tract dysfunction.

PubMed

Amira, Peco-Antić; Dušan, Paripović; Gordana, Miloševski-Lomić; Sandra, Trojanović; Ivaniševic, Ivana

2013-01-01

To evaluate the efficacy of standard and biofeedback bladder control training (BCT) on the resolution of dysfunctional elimination syndrome (primary outcome), and on the reduction of urinary tract infections (UTI) and the use of medications such as antibacterial prophylaxis and/or anticholinergic/alpha-blockers (secondary outcome) in girls older than aged least 5 years. 72 girls, median age of 8 years (interquartile range, IQR 7-10) were subjected to standard BCT (cognitive, behavioural and constipation treatment) and 12 one-hour sessions of animated biofeedback using interactive computer games within 8 weeks. Fifty patients were reevaluated after median 11 (IQR, 6-17) months. Effectiveness of BCT was determined by reduction of dysfunctional voiding score (DVS), daytime urinary incontinence (DUI), constipation, UTI, nocturnal enuresis (NE), post void residual (PVR), and improvements in bladder capacity and uroflow/EMG patterns. BCT resulted in significant normalization of DUI, NE, constipation, bladder capacity, uroflow/EMG, while decrease of PVR didn't reach statistical significance. In addition, the incidence of UTI, antibacterial prophylaxis and medical urotherapy significantly decreased. There were no significant differences in DVS, DVI, NE, bladder capacity and voiding pattern at the end of the BCT and at the time of reevaluation. The success on BCT was supported by parenteral perception of the treatment response in 63.9% and full response in additional 15.3% of the patients. Combination of standard and biofeedback BCT improved dysfunctional elimination syndrome and decreased UTI with discontinuation of antibacterial prophylaxis and/or anticholinergic/alpha-blockers in the majority of the patients. Better training results are expected in patients with higher bladder wall thickness as well as in those with vesicoureteral reflux, while presence of nocturnal enuresis may be a negative predictor of the training effect.

Comparison of four surgical techniques for management of pseudophakic and aphakic retinal detachment: a multicenter clinical trial.

PubMed

Moradian, Siamak; Ahmadieh, Hamid; Faghihi, Hooshang; Ramezani, Alireza; Entezari, Morteza; Banaee, Touka; Heidari, Ebadollah; Behboudi, Hassan; Yasseri, Mehdi

2016-09-01

To compare the visual and anatomical outcomes of four surgical techniques to manage pseudophakic and aphakic retinal detachment (PARD). In a multicenter randomized clinical trial, 211 eyes of 211 patients with PARD and proliferative vitreoretinopathy (PVR) grade B or less were randomly assigned to one of the four treatment groups: (1) scleral buckling (SB), 50 eyes, (2) vitrectomy without band, 51 eyes, (3) vitrectomy with encircling band (EB), 58 eyes, and (4) triamcinolone acetonide (TA) assisted vitrectomy, 52 eyes. Patients were followed for 12 months after the surgery. The best-corrected visual acuity (BCVA) and retinal reattachment rate at each follow-up time point were considered as the primary outcome measures. PVR, macular pucker, and cystoid macular edema were considered as the secondary outcomes. Visual improvement was achieved in all treatment groups relative to the baseline at all time points (all Ps < 0.001). There were no statistically significant differences among the groups with regard to BCVA changes. However, there was a significant difference in the slope of visual improvement curve: the SB group had a more rapid visual improvement compared to the vitrectomy with buckle group at month 12 (P = 0.032). The retinal reattachment rates at month 12 were 75, 64.7, 68.5, and 66.7 % in SB, vitrectomy without buckle, vitrectomy with EB, and TA-assisted vitrectomy groups respectively (P > 0.99). There were no statistically significant differences among the groups in terms of adverse events. SB, TA-assisted vitrectomy, and vitrectomy with and without buckle had comparable outcomes in the management of PARD.

Effects of Eicosapentaenoic Acid (EPA) and Docosahexaenoic Acid (DHA) on Fetal Pulmonary Circulation: An Experimental Study in Fetal Lambs.

PubMed

Sharma, Dyuti; Aubry, Estelle; Ouk, Thavarak; Houeijeh, Ali; Houfflin-Debarge, Véronique; Besson, Rémi; Deruelle, Philippe; Storme, Laurent

2017-07-16

Background: Persistent pulmonary hypertension of the newborn (PPHN) causes significant morbidity and mortality in neonates. n -3 Poly-unsaturated fatty acids have vasodilatory properties in the perinatal lung. We studied the circulatory effects of eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) in fetal sheep and in fetal pulmonary arterial rings. Methods: At 128 days of gestation, catheters were placed surgically in fetal systemic and pulmonary circulation, and a Doppler probe around the left pulmonary artery (LPA). Pulmonary arterial pressure and LPA flow were measured while infusing EPA or DHA for 120 min to the fetus, to compute pulmonary vascular resistance (PVR). The dose effects of EPA or DHA were studied in vascular rings pre-constricted with serotonin. Rings treated with EPA were separated into three groups: E+ (intact endothelium), E- (endothelium stripped) and LNA E+ (pretreatment of E+ rings with l-nitro-arginine). Results: EPA, but not DHA, induced a significant and prolonged 25% drop in PVR ( n = 8, p < 0.001). Incubation of vascular rings with EPA (100 µM) caused a maximum relaxation of 60% in the E+ ( n = 6), whereas vessel tone did not change in the E- ( n = 6, p < 0.001). The vascular effects of EPA were significantly decreased in LNA E+ ( n = 6). Incubation with DHA resulted in only a mild relaxation at the highest concentration of DHA (300 µM) compared to E+. Conclusions: EPA induces a sustained pulmonary vasodilatation in fetal lambs. This effect is endothelium- and dose-dependent and involves nitric oxide (NO) production. We speculate that EPA supplementation may improve pulmonary circulation in clinical conditions with PPHN.

Lung microvascular transport properties measured by multiple indicator dilution methods in patients with adult respiratory distress syndrome. A comparison between patients reversing respiratory failure and those failing to reverse

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harris, T.R.; Bernard, G.R.; Brigham, K.L.

1990-02-01

We conducted indicator dilution studies on the lungs of patients in the early phases of adult respiratory distress syndrome (ARDS) to test the hypothesis that capillary permeability was increased in patients with respiratory failure. Indicator dilution studies were performed using 51Cr-erythrocytes, 125I-albumin, 14C-urea, and 3H-water as tracers. The injectate was infused as a bolus into a central venous line. Peripheral arterial blood was collected and counted for radioactivity. Mathematical analysis of the indicator curves yielded cardiac output, measures of the product of capillary permeability and surface area for urea (PS and D1/2S), the intravascular lung volume (Vv), and the extravascularmore » lung water volume (Ve). Permeability was separated from surface area by normalizing PS and D1/2S to Vv. Patients could be divided into 16 in whom blood gas determinations and radiologic criteria for ARDS were reversed and 23 in whom they were not. We examined indicator dilution and other measures of lung function in the two groups to determine whether significant differences in microvascular function existed. PS and PS/Vv were significantly higher in the nonreversal patients. Ve was above normal, but not different between groups. Linear regression analysis showed significant correlations for all of the following in the nonreversal group: Ve and all measures of permeability, pulmonary vascular resistance (PVR), and the inverse of permeability-surface area measures and AaDO2 and PVR. Only measures of Ve and PS correlated in the reversal group. These results support the hypothesis that capillary permeability is increased in patients with early ARDS and continuing respiratory failure.« less

Safety and efficacy of tamsulosin, alfuzosin or silodosin as monotherapy for LUTS in BPH - a double-blind randomized trial.

PubMed

Manohar, Chikka Moga Siddaiah; Nagabhushana, Mahadevappa; Karthikeyan, Vilvapathy Senguttuvan; Sanjay, Ramachandra Pudakalkatti; Kamath, Ananth Janardhan; Keshavamurthy, Ramaiah

2017-06-30

Currently alpha1-adrenoceptor blockers (AB) are widely used as first-line therapy to improve lower urinary tract symptoms (LUTS) associated with benign prostatic hyperplasia (BPH). We compared the efficacy and safety profile of tamsulosin, alfuzosin and silodosin in LUTS due to BPH. Consecutive consenting male patients (N = 269) undergoing medical management of BPH with AB from February 2012 to October 2015 were enrolled. Patients were randomized to a 0.4 mg tamsulosin (group T), 10 mg alfuzosin (group A) or a 8 mg silodosin (group S) by double-blind randomization. All patients were assessed for improvements and post-void residual urine (PVR) and for adverse drug events (ADE). IPSS showed significant improvement in Group S at the first week (11.7 ±4.18, p = 0.027) and at 3 months (7.97 ±3.84, p = 0.020). QOL showed significant improvement at 1 (2.2 ±0.76, p = 0.020), 4 (1.47 ±0.63, p <0.001) and 12 (1.2 ±0.66, p <0.001) weeks in Group S. The mean Qmax improvement was the maximum (13.76 ±2.44, p = 0.028) in Group S at 1 week. Reduction in PVR was the maximum in Group S, but it was not statistically significant. Adverse drug events (ADE) were observed in 20.07% (54/269) patients and distribution was similar in the three groups with decreasing incidence with progression of time. Silodosin is the most efficacious AB with rapid onset of action. Silodosin also improves the quality of life in patients with LUTS due to BPH and objectively improves maximum flow rate. However, silodosin has more adverse events when compared to tamsulosin and alfuzosin.

Changing the strategy of balloon pulmonary angioplasty resulted in a reduced complication rate in patients with chronic thromboembolic pulmonary hypertension. A single-centre European experience.

PubMed

Kurzyna, Marcin; Darocha, Szymon; Pietura, Radosław; Pietrasik, Arkadiusz; Norwa, Justyna; Mańczak, Rafał; Wieteska, Maria; Biederman, Andrzej; Matsubara, Hiromi; Torbicki, Adam

2017-01-01

To assess the safety and efficacy of a refined balloon pulmonary angioplasty (BPA) strategy in patients with chronic thromboembolic pulmonary hypertension (CTEPH). There were 157 BPA sessions performed in 56 CTEPH patients (47 non-operable, nine after pulmonary endarterectomy; aged 58.6 ± 17.9 years; 28 females) with severely impaired pulmonary haemodynamics (mean pulmonary artery pressure [mPAP]: 51.3 ± 12.2 mm Hg, pulmonary vascular resistance [PVR]: 10.1 ± 3.9 Wood Units). The first 50 sessions aimed to recanalise chronic occlusions and prevent reocclusion with aggressive anticoagulation. The next 107 sessions aimed to relieve "web" and "ring" lesions using reduced tip load guidewires and less intensive anticoagulation. There was significant reduction in haemoptysis (22% vs. 7%, p = 0.01), vessel injury (30% vs. 13%, p = 0.01), and reperfusion pulmonary injuries (22% vs. 4%, p = 0.01) after changing the BPA strategy. Mortality at 14 days was also reduced (6% vs. 0%; p = 0.05). The cumulative survival rate was 94.6% at 24 months after the first BPA, which was more favourable than medically treated historic controls. In the 31 patients with > 3 BPA sessions, there was significant reduction of PVR (10.3 ± 3.7 vs. 5.9 ± 2.8 Wood Units; p = 0.01), mPAP (50.7 ± 10.8 vs. 35.6 ± 9.3 mm Hg; p = 0.01) and improvement in World Health Organisation functional class (3.19 ± 0.48 vs. 1.97 ± 0.80; p < 0.001). Balloon pulmonary angioplasty improves haemodynamics and outcome but requires refined strategy to limit early complication rate.

Improvement in Quality of Life and Hemodynamics in Chronic Thromboembolic Pulmonary Hypertension Treated With Balloon Pulmonary Angioplasty.

PubMed

Darocha, Szymon; Pietura, Radosław; Pietrasik, Arkadiusz; Norwa, Justyna; Dobosiewicz, Anna; Piłka, Michał; Florczyk, Michał; Biederman, Andrzej; Torbicki, Adam; Kurzyna, Marcin

2017-03-24

The effect of balloon pulmonary angioplasty (BPA) on improvement in functional and hemodynamic parameters in chronic thromboembolic pulmonary hypertension (CTEPH) is known, but the quality of life (QoL) of patients treated with BPA has never been studied before.Methods and Results:Twenty-five patients with inoperable or persistent CTEPH were enrolled in the study and filled out the 36-item Short Form (SF-36v2) questionnaire twice: prior to commencement of BPA treatment and after ≥3 BPA sessions. In addition WHO functional class, distance on the 6-min walk test (6MWT) and hemodynamic parameters such as right atrial pressure (RAP), mean pulmonary artery pressure (mPAP), cardiac index (CI) and pulmonary vascular resistance (PVR) were assessed. QoL improved significantly in all domains, except for physical pain. Improvement in RAP (10.5±3.4 vs. 6.2±2.2 mmHg; P<0.05), mPAP (51.7±10.6 vs. 35.0±9.1 mmHg; P<0.05), CI (2.2±0.5 vs. 2.5±0.4 L/min·m 2 ; P=0.04), PVR (10.4±3.9 vs. 5.5±2.2 Wood units; P<0.05), functional class (96% vs. 20% in WHO class III and IV, P<0.05) and improvement in 6MWT distance (323±135 vs. 410±109 m; P<0.05) was observed. The only significant correlation was between the mental component summary score of QoL after completion of treatment and percentage improvement in the 6MWT (-0.404, P<0.05). Alongside improvement in functional and hemodynamic parameters, BPA also provides significant improvement in QoL.

Vertical interferometer workstation for testing large spherical optics

NASA Astrophysics Data System (ADS)

Truax, B.

2013-09-01

The design of an interferometer workstation for the testing of large concave and convex spherical optics is presented. The workstation handles optical components and mounts up to 425 mm in diameter with mass of up to 40 kg with 6 axes of adjustment. A unique method for the implementation of focus, roll and pitch was used allowing for extremely precise adjustment. The completed system includes transmission spheres with f-numbers from f/1.6 to f/0.82 incorporating reference surface diameters of up to 306 mm and surface accuracies of better than 63 nm PVr. The design challenges and resulting solutions are discussed. System performance results are presented.

STS-117 S3 and S4 Trusses in the Space Shuttle Atlantis Cargo Bay

NASA Technical Reports Server (NTRS)

2007-01-01

This nadir view of the STS-117 mission Space Shuttle Atlantis, taken by the Expedition 15 crew aboard the International Space Station (ISS), occurred just before the two spacecraft linked up in Earth orbit. Berthed in the cargo bay are the 17.8 ton second and third (S3 and S4) truss segments ready for installment. STS-117 mission objectives included the addition of S3 and S4 with Photovoltaic Radiator (PVR), the deployment of the third set of solar arrays, and the retraction of the P4 starboard solar array wing and one radiator.

[From acute pulmonary embolism to chronic thromboembolic pulmonary hypertension: Pathobiology and pathophysiology].

PubMed

Beltrán-Gámez, Miguel E; Sandoval-Zárate, Julio; Pulido, Tomás

Chronic thromboembolic pulmonary hypertension (CTEPH) represents a unique subtype of pulmonary hypertension characterized by the presence of mechanical obstruction of the major pulmonary vessels caused by venous thromboembolism. CTEPH is a progressive and devastating disease if not treated, and is the only subset of PH potentially curable by a surgical procedure known as pulmonary endarterectomy. The clot burden and pulmonary embolism recurrence may contribute to the development of CTEPH however only few thrombophilic factors have been found to be associated. A current hypothesis is that CTEPH results from the incomplete resolution and organization of thrombus modified by inflammatory, immunologic and genetic mechanisms, leading to the development of fibrotic stenosis and adaptive vascular remodeling of resistance vessels. The causes of thrombus non-resolution have yet to be fully clarified. CTEPH patients often display severe PH that cannot be fully explained by the degree of pulmonary vascular obstruction apparent on imaging studies. In such cases, the small vessel disease and distal obstructive thrombotic lesions beyond the sub-segmental level may contribute for out of proportion elevated PVR. The processes implicated in the development of arteriopathy and micro-vascular changes might explain the progressive nature of PH and gradual clinical deterioration with poor prognosis, as well as lack of correlation between measurable hemodynamic parameters and vascular obstruction even in the absence of recurrent venous thromboembolism. This review summarizes the most relevant up-to-date aspects on pathobiology and pathophysiology of CTEPH. Copyright © 2016 Instituto Nacional de Cardiología Ignacio Chávez. Publicado por Masson Doyma México S.A. All rights reserved.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Thromboxane Mediation of Cardiopulmonary Effects of Embolism

PubMed Central

Utsunomiya, Takayoshi; Krausz, Michael M.; Levine, Lawrence; Shepro, David; Hechtman, Herbert B.

1982-01-01

Humoral factors released from platelets during pulmonary embolism may be the cause of several attendant cardiopulmonary abnormalities. This study examines the role of thromboxanes (Tx) after experimental embolism induced with 0.5 g/kg autologous clot in four groups of five dogs: (a) untreated embolized controls; (b) pretreatment with the Tx synthetase inhibitor, imidazole 25 mg/kg · h i.v., starting 30 min before embolization; (c) pretreatment with the cyclooxygenase inhibitor indomethacin, 5 mg/kg, 12 h per os and 1 mg/kg, 1 h i.v. before the experiment; (d) treatment with prostacyclin (PGI2) 100 ηg/kg · min i.v. for 1 h, 1 h after embolization. Within 30 min, embolization led to increases of 6-keto-PGF1α, the stable hydrolysis product of PGI2, from 0.11±0.08 ηg/ml (mean±SD) to 0.33±0.10 ηg/ml (P < 0.005) and TxB2, the stable product of TxA2, from 0.10±0.04 ηg/ml to 0.38±0.06 ηg/ml (P < 0.001). Increases were observed in total dead space (VD/VT) from 0.46±0.03 to 0.61±0.08 (P < 0.025, physiologic shunting (Q̇S/Q̇T) from 16±4% to 38±9% (P < 0.01), pulmonary vascular resistance (PVR) from 2.27±0.59 mm Hg·min/liter to 9.21±1.90 mm Hg·min/liter (P < 0.005) and mean pulmonary arterial pressure from 14±6 mm Hg to 34±1 mm Hg (P < 0.001). Cardiac index (CI) fell from 139±11 ml/kg·min to 95±17 ml/kg·min in 4 h (P < 0.025). Imidazole pretreatment prevented a rise of TxB2, but not 6-keto-PGF1α; indomethacin blocked both. Both agents maintained VD/VT at base line and limited increases in Q̇S/Q̇T and PVR. CI was higher after imidazole pretreatment compared with controls (P < 0.025). Indomethacin led to intermediate levels of CI. PGI2 lowered TxB2 (P < 0.025), VD/VT (P < 0.025), Q̇S/Q̇T (P < 0.025) and PVR (P < 0.05) within 30 min. During PGI2 infusion, CI was higher than controls. Concentrations of TxB2 correlated with VD/VT, r = 0.79 and Q̇S/Q̇T, r = 0.69 (P < 0.001). Treatment of three dogs with the imidazole derivative ketoconazole, 10 mg/kg IV, 30 min after 0.75 g/kg autologous clot resulted in a lowering of physiologic dead space, but no other improvement of cardiopulmonary function. These results show that a number of cardiopulmonary abnormalities induced by pulmonary embolism are related directly or indirectly to platelet secretions and that VD/VT is closely allied to TxA2 levels. PMID:6284801

Diagnosis and treatment of pulmonary hypertension in infancy

PubMed Central

Steinhorn, Robin H.

2013-01-01

Normal pulmonary vascular development in infancy requires maintenance of low pulmonary vascular resistance after birth, and is necessary for normal lung function and growth. The developing lung is subject to multiple genetic, pathological and/or environmental influences that can adversely affect lung adaptation, development, and growth, leading to pulmonary hypertension. New classifications of pulmonary hypertension are beginning to account for these diverse phenotypes, and or pulmonary hypertension in infants due to PPHN, congenital diaphragmatic hernia, and bronchopulmonary dysplasia (BPD). The most effective pharmacotherapeutic strategies for infants with PPHN are directed at selective reduction of PVR, and take advantage of a rapidly advancing understanding of the altered signaling pathways in the remodeled vasculature. PMID:24083892

International Space Station (ISS)

NASA Image and Video Library

2007-06-08

Headed toward Earth orbit and a link up with the International Space Station (ISS), the Space Shuttle Atlantis lifted off from Kennedy Space Center on June 8, 2007. Aboard were STS-117 astronauts James F. Reilly II, Steven R. Swanson, Patrick G. Forrester and John D. “Danny” Olivas, all mission specialists; Frederick W. (Rick) Sturckow, commander; Lee J. Archambault, pilot; and Clayton Anderson, mission specialist who joined the Expedition 15 crew. The crew members along with the Expedition 15 crew spent 8 days resuming construction on the ISS with the installation of the second and third starboard truss segments (S3 and S4) with Photovoltaic Radiator (PVR), and retracted the P6 starboard solar array wing and radiator for later use.

Large negative differential resistance in graphene nanoribbon superlattices

NASA Astrophysics Data System (ADS)

Tseng, P.; Chen, C. H.; Hsu, S. A.; Hsueh, W. J.

2018-05-01

A graphene nanoribbon superlattice with a large negative differential resistance (NDR) is proposed. Our results show that the peak-to-valley ratio (PVR) of the graphene superlattices can reach 21 at room temperature with bias voltages between 90-220 mV, which is quite large compared with the one of traditional graphene-based devices. It is found that the NDR is strongly influenced by the thicknesses of the potential barrier. Therefore, the NDR effect can be optimized by designing a proper barrier thickness. The large NDR effect can be attributed to the splitting of the gap in transmission spectrum (segment of Wannier-Stark ladder) with larger thicknesses of barrier when the applied voltage increases.

A Non-Invasive Assessment of Cardiopulmonary Hemodynamics with MRI in Pulmonary Hypertension

PubMed Central

Bane, Octavia; Shah, Sanjiv J.; Cuttica, Michael J.; Collins, Jeremy D.; Selvaraj, Senthil; Chatterjee, Neil R.; Guetter, Christoph; Carr, James C.; Carroll, Timothy J.

2015-01-01

Purpose We propose a method for non-invasive quantification of hemodynamic changes in the pulmonary arteries resulting from pulmonary hypertension (PH). Methods Using a two-element windkessel model, and input parameters derived from standard MRI evaluation of flow, cardiac function and valvular motion, we derive: pulmonary artery compliance (C), mean pulmonary artery pressure (mPAP), pulmonary vascular resistance (PVR), pulmonary capillary wedge pressure (PCWP), time-averaged intra-pulmonary pressure waveforms and pulmonary artery pressures (systolic (sPAP) and diastolic (dPAP)). MRI results were compared directly to reference standard values from right heart catheterization (RHC) obtained in a series of patients with suspected pulmonary hypertension (PH). Results In 7 patients with suspected PH undergoing RHC, MRI and echocardiography, there was no statistically significant difference (p<0.05) between parameters measured by MRI and RHC. Using standard clinical cutoffs to define PH (mPAP ≥ 25 mmHg), MRI was able to correctly identify all patients as having pulmonary hypertension, and to correctly distinguish between pulmonary arterial (mPAP≥ 25 mmHg, PCWP<15 mmHg) and venous hypertension (mPAP ≥ 25 mmHg, PCWP ≥ 15 mmHg) in 5 of 7 cases. Conclusions We have developed a mathematical model capable of quantifying physiological parameters that reflect the severity of PH. PMID:26283577

[Clinical experiences after implantation of various lens types in silicon oil tamponade].

PubMed

Effert, R; Lommatzsch, A; Wessing, A

1996-06-01

A tamponade of the vitreous space with silicone oil will obligatory lead to cataract after 6 to 12 months. Today it is easily possible, to implant an artificial lense in silicone oil filled eyes. However the combination of an artificial lense and silicone oil will lead to a strong inflammation in the anterior segment of the eye. 22 pseudophacic patients with silicone oil tamponade were examined 2 to 6 months after the operation. In 12 patients simple artificial lenses were implanted, in 10 patients heparin modified lenses were implanted. In 10 cases the lens was implanted followed by the insufflation of silicone oil in the vitreous cavity, in 2 cases a lens was implanted in a silicone oil filled eye and the silicon oil was not removed. In 8 cases the implantation of the artificial lens has been performed some months to years before the insufflation of the silicone oil. The indication for the silicon oil tamponade was a PVR retinal detachment in all cases. The following parameters were examined: Reaction of the pupil to light, pupil round or oval in miosis, examination of the fundus peripherie possible after mydriasis, fixation of the iris with parts of the capsula or with the anterior surface of the lens? In addition in 12 cases the postoperative refraction was compared with the results of the biometry, which was performed before the operation. In the cases with a simple lens in about 50% an incomplete miosis or an oval pupil because of fixation of the iris with parts of the capsula or with the anterior surface of the lense could be observed. In the cases with heparin modified lenses these complications could be observed in 20%. In all cases a strong opacification of the capsula was seen. In 8 of 12 cases with combined procedure a small hyperopia was measured, in 4 cases a large deviation was measured. The implantation of an artificial lens in silicone oil filled eyes is an alternative to the aphacic status with an Ando Iridectomy. Obviously heparin modified lenses have advantages in these cases. Because of the strong cataract formation we suggest to remove the anterior and the posterior capsula in the first operative session and to implant the haptics of the lens into the sulcus. Because of the high rate of complications generally first a stable retina condition should be reached before the implanation of an artificial lens is performed.

Nitric oxide alterations following acute ductal constriction in the fetal lamb: a role for superoxide

PubMed Central

Hsu, Jong-Hau; Oishi, Peter; Wiseman, Dean A.; Hou, Yali; Chikovani, Omar; Datar, Sanjeev; Sajti, Eniko; Johengen, Michael J.; Harmon, Cynthia; Black, Stephen M.

2010-01-01

Acute partial compression of the fetal ductus arteriosus (DA) results in an initial abrupt increase in pulmonary blood flow (PBF), which is followed by a significant reduction in PBF to baseline values over the ensuing 2–4 h. We have previously demonstrated that this potent vasoconstricting response is due, in part, to an endothelin-1 (ET-1)-mediated decrease in nitric oxide synthase (NOS) activity. In addition, in vitro data demonstrate that ET-1 increases superoxide levels in pulmonary arterial smooth muscle cells and that oxidative stress alters NOS activity. Therefore, the objectives of this study were to determine the potential role of superoxide in the alterations of hemodynamics and NOS activity following acute ductal constriction in the late-gestation fetal lamb. Eighteen anesthetized near-term fetal lambs were instrumented, and a lung biopsy was performed. After a 48-h recovery, acute constriction of the DA was performed by inflating a vascular occluder. Polyethylene glycol-superoxide dismutase (PEG-SOD; 1,000–1,500 units/kg, n = 7) or PEG-alone (vehicle control group, n = 5) was injected into the pulmonary artery before ductal constriction. Six animals had a sham operation. In PEG-alone-treated lambs, acute ductal constriction rapidly decreased pulmonary vascular resistance (PVR) by 88%. However, by 4 h, PVR returned to preconstriction baseline. This vasoconstriction was associated with an increase in lung superoxide levels (82%), a decrease in total NOS activity (50%), and an increase in P-eNOS-Thr495 (52%) (P < 0.05). PEG-SOD prevented the increase of superoxide after ductal constriction, attenuated the vasoconstriction, preserved NOS activity, and increased P-eNOS Ser1177 (307%, P < 0.05). Sham procedure induced no changes. These data suggest that an acute decrease in NOS activity that is mediated, in part, by increased superoxide levels, and alterations in the phosphorylation status of the endothelial NOS isoform, underlie the pulmonary vascular response to acute ductal constriction. PMID:20363848

SERAPHIN haemodynamic substudy: the effect of the dual endothelin receptor antagonist macitentan on haemodynamic parameters and NT-proBNP levels and their association with disease progression in patients with pulmonary arterial hypertension

PubMed Central

Galiè, Nazzareno; Jansa, Pavel; Pulido, Tomás; Channick, Richard N.; Delcroix, Marion; Ghofrani, Hossein-Ardeschir; Le Brun, Franck-Olivier; Mehta, Sanjay; Perchenet, Loïc; Rubin, Lewis J.; Sastry, B.K.S.; Simonneau, Gérald; Sitbon, Olivier; Souza, Rogério; Torbicki, Adam

2017-01-01

Aims The effect of macitentan on haemodynamic parameters and NT-proBNP levels was evaluated in pulmonary arterial hypertension (PAH) patients in the SERAPHIN study. Association between these parameters and disease progression, assessed by the primary endpoint (time to first morbidity/mortality event), was explored. Methods and results Of the 742 randomized patients, 187 with right heart catheterization at baseline and month 6 participated in a haemodynamic sub-study. Prespecified endpoints included change from baseline to month 6 in cardiac index (CI), right atrial pressure (RAP), mean pulmonary arterial pressure (mPAP), pulmonary vascular resistance (PVR), mixed-venous oxygen saturation, and NT-proBNP. Exploratory analyses examined associations between CI, RAP, and NT-proBNP and disease progression using the Kaplan-Meier method and Cox regression models. Macitentan improved CI, RAP, mPAP, PVR and NT-proBNP vs. placebo at month 6. Absolute levels of CI, RAP and NT-proBNP at baseline and month 6, but not their changes, were associated with morbidity/mortality events. Patients with CI > 2.5 L/min/m2, RAP < 8 mmHg, or NT-proBNP < 750 fmol/ml at month 6 had a lower risk of morbidity/mortality than those not meeting these thresholds (HR 0.49, 95% CL 0.28–0.86; HR 0.72, 95% CL 0.42–1.22; and HR 0.22, 95% CL 0.15–0.33, respectively). Conclusions For all treatment groups, baseline and month 6 values of CI, RAP, and NT-proBNP, but not their changes, were associated with morbidity/mortality events, confirming their relevance in predicting disease progression in patients with PAH. By improving those parameters, macitentan increased the likelihood of reaching threshold values associated with lower risk of morbidity/mortality. PMID:28329315

Can preoperative detrusor underactivity influence surgical outcomes of 120 W HPS vaporization of the prostate (PVP) or holmium laser enucleation of the prostate (HoLEP)? A serial 3-year follow-up study.

PubMed

Cho, Min Chul; Park, Juhyun; Kim, Jung Kwon; Cho, Sung Yong; Jeong, Hyeon; Oh, Seung-June; Paick, Jae-Seung; Son, Hwancheol

2018-01-01

To determine the influence of preoperative detrusor underactivity (DU) on serial long-term outcomes of HPS/PVP or HoLEP for LUTS/BPH, and to compare the influence between the two surgeries. A total of 382 men, who underwent 120W-HPS/PVP or HoLEP for LUTS/BPH and for whom 36-month follow-up data were available, were classified into four groups: HPS with DU (n = 145), HPS without DU (n = 44), HoLEP with DU (n = 105), and HoLEP without DU (n = 88). DU was defined as bladder contractility index of <100. Surgical outcomes were assessed at postoperative 6, 12, 24, and 36 months using IPSS, uroflowmetry, and serum PSA. All four groups maintained improvements in voiding symptom score (VSS), storage symptom score, total-IPSS, QOL index, maximum flow rate (Qmax), post-void residual urine volume (PVR), and bladder voiding efficiency (BVE) compared with baseline up to 3 years postoperatively. There were no significant differences in improvements of postoperative IPSS parameters including QOL index between men with and without DU throughout the follow-up period after HPS or HoLEP. In men with DU, there were no significant differences in improvements of postoperative QOL index, Qmax, PVR, or BVE between HPS and HoLEP groups throughout the follow-up period, except for VSS and total IPSS. Serum PSA reductions after HoLEP were greater than after PVP. Improvements in LUTS, Qmax, and BVE can maintain up to 3 years after HPS or HoLEP for LUTS/BPH, irrespective of the presence or absence of preoperative DU. Although HoLEP may provide more durable improvement of VS in men with DU than HPS, there seems to be no difference in improvement of QOL or Qmax or BVE between HPS and HoLEP. © 2017 Wiley Periodicals, Inc.

Open vs Laparoscopic Simple Prostatectomy: A Comparison of Initial Outcomes and Cost.

PubMed

Demir, Aslan; Günseren, Kadir Ömür; Kordan, Yakup; Yavaşçaoğlu, İsmet; Vuruşkan, Berna Aytaç; Vuruşkan, Hakan

2016-08-01

We compared the cost-effectiveness of laparoscopic simple prostatectomy (LSP) vs open prostatectomy (OP). A total of 73 men treated for benign prostatic hyperplasia were enrolled for OP and LSP in groups 1 and 2, respectively. The findings were recorded perioperative, including operation time (OT), blood lost, transfusion rate, conversion to the open surgery, and the complications according to the Clavien Classification. The postoperative findings, including catheterization and drainage time, the amount of analgesic used, hospitalization time, postoperative complications, international prostate symptom score (IPSS) and International Index of Erectile Function (IIEF) scores, the extracted prostate weight, the uroflowmeter, as well as postvoiding residual (PVR) and quality of life (QoL) score at the postoperative third month, were analyzed. The cost of both techniques was also compared statistically. No statistical differences were found in the preoperative parameters, including age, IPSS and QoL score, maximum flow rate (Qmax), PVR, IIEF score, and prostate volumes, as measured by transabdominal ultrasonography. No statistical differences were established in terms of the OT and the weight of the extracted prostate. No differences were established with regard to complications according to Clavien's classification in groups. However, the bleeding rate was significantly lower in group 2. The drainage, catheterization, and hospitalization times and the amount of analgesics were significantly lower in the second group. The postoperative third month findings were not different statistically. Only the Qmax values were significantly greater in group 2. While there was only a $52 difference between groups with regard to operation cost, this difference was significantly different. The use of LSP for the prostates over 80 g is more effective than the OP in terms of OT, bleeding amount, transfusion rates, catheterization time, drain removal time, hospitalization time, consumed analgesic amount, and Qmax values. On the other hand, the mean cost of the LSP is higher than OP. Better effectiveness comes with higher cost.

Randomized, double-blind, placebo controlled pilot study of intradetrusor injections of onabotulinumtoxinA for the treatment of refractory overactive bladder persisting following surgical management of benign prostatic hyperplasia.

PubMed

Chughtai, Bilal; Dunphy, Claire; Lee, Richard; Lee, Daniel; Sheth, Seema; Marks, Leonard; Kaplan, Steven A; Te, Alexis E

2014-04-01

We assessed the efficacy of onabotulinumtoxinA (BOTOX, Allergan Inc., Irvine, CA, USA) in patients with refractory overactive bladder (OAB) after treatment for benign prostatic hyperplasia (BPH). This was a two-center, randomized, double-blinded pilot study conducted in patients with OAB secondary to bladder outlet obstruction (BOO), refractory to anticholinergic medication and persistent for greater than 3 months after surgical intervention to relieve obstruction, with an International Prostate Symptom Score (IPSS) > 12. Patients were randomized in 1:1 fashion to either 200 units of onabotulinumtoxinA versus placebo. Fifteen patients received onabotulinumtoxinA versus 13 who received placebo. Follow up was performed at 1 week and then 1, 3, 6, and 9 months. The primary endpoint was reduction in the frequency of micturition per 24 hours by 3-day voiding diary. Secondary endpoints were maximum flow rate (Qmax), post-void residual (PVR), and IPSS scores. Patients receiving onabotulinumtoxinA demonstrated significantly improved quality of life scores at 180 and 270 days after treatment (p = 0.02 and 0.03, respectively) as well as significantly lower International Consultation on Incontinence Questionnaire (ICIQ) scores (p < 0.05). Baseline urinary frequency was 10.5 versus 11.0 voids/day (p = 0.47). Frequency episodes improved from 11 episodes per day to 8 episodes per day in the treatment arm. The placebo arm did not have a decrease in frequency episodes. This response was durable up to 90 days, although this was not statistically significant. IPSS, PVR, and urgency were unchanged postoperatively in both groups. OnabotulinumtoxinA was safe in patients with refractory irritative lower urinary tracts symptoms after surgical treatment of BPH. There were improvements in daily frequency, although the results were not statistically significant. Larger trials are needed to help characterize the utility of onabotulinumtoxinA in the treatment of OAB secondary to BPH.

Five-Year Follow-Up Study of Transurethral Plasmakinetic Resection of the Prostate for Benign Prostatic Hyperplasia.

PubMed

Hu, Yangyang; Dong, Xuecheng; Wang, Guangchun; Huang, Jianhua; Liu, Min; Peng, Bo

2016-01-01

To explore the long-term clinical efficacy and safety of transurethral plasmakinetic resection of the prostate (PKRP) for benign prostatic hyperplasia (BPH). A total of 550 patients with BPH who had undergone PKRP from October 2006 to September 2009 were enrolled in this study. All patients were evaluated at baseline and follow-up (3, 12, 24, 36, 48, 60 months postoperatively) by peak flow rate (Qmax), postvoid residual (PVR), quality of life (QoL), International Prostate Symptom Score (IPSS), and Overactive Bladder Symptom Score (OABSS). Operative details and postoperative complications regarded as safety outcomes were documented. A total of 467 patients completed the 5-year follow-up. The mean duration of surgery was 36.43 minutes, mean catheterization time was 48.81 hours, mean hospital stay was 4.21 days. At 60 months postoperatively, the mean Qmax increased from 6.94 mL/s at baseline to 19.28 mL/s, the mean PVR decreased from 126.33 mL to 10.45 mL, the mean IPSS score decreased from 15.79 to 7.51, the mean QoL score decreased from 4.36 to 1.91, and the mean OABSS score decreased from 6.39 to 3.65 (P < 0.001), respectively. In perioperative complications, the blood transfusion rate was 2.7%, urinary tract infection rate was 3.6%; no transurethral resection syndrome (TUR syndrome) occurred. In late complications, urethral stricture rate was 5.4%, recurrent bladder outlet obstruction rate was 2.1%, and the reoperation rate was 4.5%. PKRP is based on conventional monopolar transurethral resection of the prostate (TURP) and uses a bipolar plasmakinetic system. Our results indicate that the long-term clinical efficacy and safety of PKRP for BPH are remarkable. In particular, the incidence of urethral stricture, recurrent bladder outlet obstruction, and reoperation is low. We suggest that PKRP is a reliable minimally invasive technique that may be the preferred procedure for the treatment of patients with BPH.

SERAPHIN haemodynamic substudy: the effect of the dual endothelin receptor antagonist macitentan on haemodynamic parameters and NT-proBNP levels and their association with disease progression in patients with pulmonary arterial hypertension.

PubMed

Galiè, Nazzareno; Jansa, Pavel; Pulido, Tomás; Channick, Richard N; Delcroix, Marion; Ghofrani, Hossein-Ardeschir; Le Brun, Franck-Olivier; Mehta, Sanjay; Perchenet, Loïc; Rubin, Lewis J; Sastry, B K S; Simonneau, Gérald; Sitbon, Olivier; Souza, Rogério; Torbicki, Adam

2017-04-14

The effect of macitentan on haemodynamic parameters and NT-proBNP levels was evaluated in pulmonary arterial hypertension (PAH) patients in the SERAPHIN study. Association between these parameters and disease progression, assessed by the primary endpoint (time to first morbidity/mortality event), was explored. Of the 742 randomized patients, 187 with right heart catheterization at baseline and month 6 participated in a haemodynamic sub-study. Prespecified endpoints included change from baseline to month 6 in cardiac index (CI), right atrial pressure (RAP), mean pulmonary arterial pressure (mPAP), pulmonary vascular resistance (PVR), mixed-venous oxygen saturation, and NT-proBNP. Exploratory analyses examined associations between CI, RAP, and NT-proBNP and disease progression using the Kaplan-Meier method and Cox regression models. Macitentan improved CI, RAP, mPAP, PVR and NT-proBNP vs. placebo at month 6. Absolute levels of CI, RAP and NT-proBNP at baseline and month 6, but not their changes, were associated with morbidity/mortality events. Patients with CI > 2.5 L/min/m2, RAP < 8 mmHg, or NT-proBNP < 750 fmol/ml at month 6 had a lower risk of morbidity/mortality than those not meeting these thresholds (HR 0.49, 95% CL 0.28-0.86; HR 0.72, 95% CL 0.42-1.22; and HR 0.22, 95% CL 0.15-0.33, respectively). For all treatment groups, baseline and month 6 values of CI, RAP, and NT-proBNP, but not their changes, were associated with morbidity/mortality events, confirming their relevance in predicting disease progression in patients with PAH. By improving those parameters, macitentan increased the likelihood of reaching threshold values associated with lower risk of morbidity/mortality. © The Author 2017. Published on behalf of the European Society of Cardiology

Cognitive Development of Toddlers: Does Parental Stimulation Matter?

PubMed

Malhi, Prahbhjot; Menon, Jagadeesh; Bharti, Bhavneet; Sidhu, Manjit

2018-02-01

To examine the impact of quality of early stimulation on cognitive functioning of toddlers living in a developing country. The developmental functioning of 150 toddlers in the age range of 12-30 mo (53% boys; Mean = 1.76 y, SD = 0.48) was assessed by the mental developmental index of the Developmental Assessment Scale for Indian Infants (DASII). The StimQ questionnaire- toddler version was used to measure cognitive stimulation at home. The questionnaire consists of four subscales including availability of learning materials (ALM), reading activities (READ), parent involvement in developmental activities (PIDA), and parent verbal responsivity (PVR). Multivariate regression analysis was used to predict cognitive scores using demographic (age of child), socio-economic status (SES) (income, parental education), and home environment (subscale scores of StimQ) as independent variables. Mean Mental Development Index (MDI) score was 91.5 (SD = 13.41), nearly one-fifth (17.3%) of the toddlers had MDI scores less than 80 (cognitive delay). Children with cognitive delay, relative to typically developing (TD, MDI score ≥ 80) cohort of toddlers, had significantly lower scores on all the subscales of StimQ and the total StimQ score. Despite the overall paucity of learning materials available to toddlers, typical developing toddlers were significantly more likely to have access to symbolic toys (P = 0.004), art materials (P = 0.032), adaptive/fine motor toys (P = 0.018), and life size toys (P = 0.036). Multivariate regression analysis results indicated that controlling for confounding socio-economic status variables, higher parental involvement in developmental activities (PIDA score) and higher parental verbal responsivity (PVR score) emerged as significant predictors of higher MDI scores and explained 34% of variance in MDI scores (F = 23.66, P = 0.001). Disparities in child development emerge fairly early and these differences are not all linked to economic disparities. There is a need to develop evidence-based parenting interventions for primary prevention of developmental problems, especially in resource poor countries.

Results of transurethral resection of the prostate in renal transplant recipients: a single center experience.

PubMed

Sarier, Mehmet; Tekin, Sabri; Duman, İbrahim; Yuksel, Yucel; Demir, Meltem; Alptekinkaya, Furkan; Guler, Mehmet; Yavuz, Asuman Havva; Kosar, Alim

2018-01-01

The aim of this study was to retrospectively evaluate the early and long-term results of renal transplantation (RT) patients undergoing transurethral resection of the prostate (TURP) due to benign prostate hyperplasia (BPH). Eighty-nine patients with RT performed in our hospital underwent TURP between November 2008 and March 2016. Results were evaluated along with early and long-term complications. Patients were followed up for a minimum of 12 months. The mean age of the patients was 61.4 ± 7.4 years. The median duration of dialysis was 28 (0-180) months. The median duration between transplantation and TURP was 13 (0-84) months. Before TURP, the mean serum creatinine (sCr) was 1.99 ± 0.83 mg/dL and the mean prostate volume was 33.3 ± 14.6 cm 3 . The mean Q max , Q ave and PVR values were 9.5 ± 3.7, 5.2 ± 2.2 ml/s and 85(5-480) mL, respectively. None of the patients developed perioperative and postoperative major complications. Twelve patients (13.4%) developed urinary tract infections in the postoperative period. The sCr, IPSS and PVR values significantly decreased, while Q max and Q ave significantly increased at the 1-month follow-up. At the 6-month follow-up, 63 (70.8%) patients had retrograde ejaculation. Patients were followed up for a median of 42 (12-96) months. Three patients (3.3%) were re-operated for bladder neck contracture and eight (8.9%) patients were re-operated for urethral stricture. TURP can be safely and successfully applied for the treatment of BPH after RT. LUTS and renal functions significantly improve after the operation. Patients should be followed up for UTIs in the short term and for urethral stricture in the long term.

Patient-specific computational modeling of blood flow in the pulmonary arterial circulation.

PubMed

Kheyfets, Vitaly O; Rios, Lourdes; Smith, Triston; Schroeder, Theodore; Mueller, Jeffrey; Murali, Srinivas; Lasorda, David; Zikos, Anthony; Spotti, Jennifer; Reilly, John J; Finol, Ender A

2015-07-01

Computational fluid dynamics (CFD) modeling of the pulmonary vasculature has the potential to reveal continuum metrics associated with the hemodynamic stress acting on the vascular endothelium. It is widely accepted that the endothelium responds to flow-induced stress by releasing vasoactive substances that can dilate and constrict blood vessels locally. The objectives of this study are to examine the extent of patient specificity required to obtain a significant association of CFD output metrics and clinical measures in models of the pulmonary arterial circulation, and to evaluate the potential correlation of wall shear stress (WSS) with established metrics indicative of right ventricular (RV) afterload in pulmonary hypertension (PH). Right Heart Catheterization (RHC) hemodynamic data and contrast-enhanced computed tomography (CT) imaging were retrospectively acquired for 10 PH patients and processed to simulate blood flow in the pulmonary arteries. While conducting CFD modeling of the reconstructed patient-specific vasculatures, we experimented with three different outflow boundary conditions to investigate the potential for using computationally derived spatially averaged wall shear stress (SAWSS) as a metric of RV afterload. SAWSS was correlated with both pulmonary vascular resistance (PVR) (R(2)=0.77, P<0.05) and arterial compliance (C) (R(2)=0.63, P<0.05), but the extent of the correlation was affected by the degree of patient specificity incorporated in the fluid flow boundary conditions. We found that decreasing the distal PVR alters the flow distribution and changes the local velocity profile in the distal vessels, thereby increasing the local WSS. Nevertheless, implementing generic outflow boundary conditions still resulted in statistically significant SAWSS correlations with respect to both metrics of RV afterload, suggesting that the CFD model could be executed without the need for complex outflow boundary conditions that require invasively obtained patient-specific data. A preliminary study investigating the relationship between outlet diameter and flow distribution in the pulmonary tree offers a potential computationally inexpensive alternative to pressure based outflow boundary conditions. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Host range phenotype induced by mutations in the internal ribosomal entry site of poliovirus RNA.

PubMed Central

Shiroki, K; Ishii, T; Aoki, T; Ota, Y; Yang, W X; Komatsu, T; Ami, Y; Arita, M; Abe, S; Hashizume, S; Nomoto, A

1997-01-01

Most poliovirus strains infect only primates. The host range (HR) of poliovirus is thought to be primarily determined by a cell surface molecule that functions as poliovirus receptor (PVR), since it has been shown that transgenic mice are made poliovirus sensitive by introducing the human PVR gene into the genome. The relative levels of neurovirulence of polioviruses tested in these transgenic mice were shown to correlate well with the levels tested in monkeys (H. Horie et al., J. Virol. 68:681-688, 1994). Mutants of the virulent Mahoney strain of poliovirus have been generated by disruption of nucleotides 128 to 134, at stem-loop II within the 5' noncoding region, and four of these mutants multiplicated well in human HeLa cells but poorly in mouse TgSVA cells that had been established from the kidney of the poliovirus-sensitive transgenic mouse. Neurovirulence tests using the two animal models revealed that these mutants were strongly attenuated only in tests with the mouse model and were therefore HR mutants. The virus infection cycle in TgSVA cells was restricted by an internal ribosomal entry site (IRES)-dependent initiation process of translation. Viral protein synthesis and the associated block of cellular protein synthesis were not observed in TgSVA cells infected with three of four HR mutants and was evident at only a low level in the remaining mutant. The mutant RNAs were functional in a cell-free protein synthesis system from HeLa cells but not in those from TgSVA and mouse neuroblastoma NS20Y cells. These results suggest that host factor(s) affecting IRES-dependent translation of poliovirus differ between human and mouse cells and that the mutant IRES constructs detect species differences in such host factor(s). The IRES could potentially be a host range determinant for poliovirus infection. PMID:8985316

Pulmonary arterial capacitance in children with idiopathic pulmonary arterial hypertension and pulmonary arterial hypertension associated with congenital heart disease: relation to pulmonary vascular resistance, exercise capacity, and survival.

PubMed

Sajan, Imran; Manlhiot, Cedric; Reyes, Janette; McCrindle, Brian W; Humpl, Tilman; Friedberg, Mark K

2011-09-01

Pediatric pulmonary arterial hypertension (PAH), whether idiopathic PAH (iPAH) or PAH associated with congenital heart disease (aPAH), carries high morbidity and mortality. Low pulmonary arterial capacitance (PAC), defined as right ventricular stroke volume/pulmonary artery pulse pressure, is a risk factor for mortality in adults with PAH. However, the relation of PAC to pulmonary vascular resistance (PVR), exercise endurance, and survival is poorly defined in children. Catheterization and clinical data of children with PAH (mean pulmonary artery pressure >25 mm Hg) were reviewed. Children with pulmonary shunts, stents, collaterals, or pulmonary venous hypertension were excluded. Primary outcomes were 6-minute walk distance and freedom from death/lung transplant. Forty-seven patients were studied. Nineteen (43%) had iPAH, and 28 (57%) had aPAH (7.1 ± 6.2 vs 8.4 ± 5.5 years, P = .45). Patients with iPAH had higher PVR indexed for body surface area (PVRi), lower indexed PAC (PACi), lower exercise tolerance, and lower freedom from death/lung transplant than patients with aPAH. Both higher PVRi (P < .0001) and lower PACi (P = .02) were associated with shorter 6-minute walk distance. A PACi <0.70 mL/mm Hg per square meter or >1.25 mL/mm Hg per square meter and a PVRi >13 Wood units × m(2) were associated with decreased freedom from death or lung transplant. The relationships between PVRi and PACi and survival were independent of each other and not confounded by etiologic group. Low PACi and high PVRi are independently associated with low 6-minute walk distance and survival in children with PAH. Therefore, both should be assessed for better prognostication and management in this high-risk population. Copyright © 2011 Mosby, Inc. All rights reserved.

Brief report: effect of ambrisentan treatment on exercise-induced pulmonary hypertension in systemic sclerosis: a prospective single-center, open-label pilot study.

PubMed

Saggar, Rajeev; Khanna, D; Shapiro, S; Furst, D E; Maranian, P; Clements, P; Abtin, F; Dua, Shiv; Belperio, J; Saggar, Rajan

2012-12-01

Exercise-induced pulmonary hypertension (ePH) may represent an early, clinically relevant phase in the spectrum of pulmonary vascular disease. The purpose of this pilot study was to describe the changes in hemodynamics and exercise capacity in patients with systemic sclerosis (SSc) spectrum-associated ePH treated with open-label daily ambrisentan. Patients were treated with ambrisentan, 5 mg or 10 mg once daily, for 24 weeks. At baseline and 24 weeks, patients with SSc spectrum disorders exercised in a supine position, on a lower extremity cycle ergometer. All patients had normal hemodynamics at rest. We defined baseline ePH as a mean pulmonary artery pressure of >30 mm Hg with maximum exercise and a transpulmonary gradient (TPG) of >15 mm Hg. The primary end point was change in pulmonary vascular resistance (PVR) with exercise. Secondary end points included an improvement from baseline in 6-minute walking distance, health-related quality of life assessments, and cardiopulmonary hemodynamics. Of the 12 enrolled patients, 11 completed the study. At 24 weeks there were improvements in mean exercise PVR (85.8 dynes × second/cm(5) ; P = 0.003) and mean distance covered during 6-minute walk (44.5 meters; P = 0.0007). Improvements were also observed in mean exercise cardiac output (1.4 liters/minute; P = 0.006), mean pulmonary artery pressure (-4.1 mm Hg; P = 0.02), and total pulmonary resistance (-93.0 dynes × seconds/cm(5) ; P = 0.0008). Three patients developed resting pulmonary arterial hypertension during the 24 weeks. Exercise hemodynamics and exercise capacity in patients with SSc spectrum-associated ePH improved over 24 weeks with exposure to ambrisentan. Placebo-controlled studies are needed to confirm whether this is a drug-related effect and to determine optimal therapeutic regimens for patients with ePH. Copyright © 2012 by the American College of Rheumatology.

In Vivo Evaluation of Active and Passive Physiological Control Systems for Rotary Left and Right Ventricular Assist Devices.

PubMed

Gregory, Shaun D; Stevens, Michael C; Pauls, Jo P; Schummy, Emma; Diab, Sara; Thomson, Bruce; Anderson, Ben; Tansley, Geoff; Salamonsen, Robert; Fraser, John F; Timms, Daniel

2016-09-01

Preventing ventricular suction and venous congestion through balancing flow rates and circulatory volumes with dual rotary ventricular assist devices (VADs) configured for biventricular support is clinically challenging due to their low preload and high afterload sensitivities relative to the natural heart. This study presents the in vivo evaluation of several physiological control systems, which aim to prevent ventricular suction and venous congestion. The control systems included a sensor-based, master/slave (MS) controller that altered left and right VAD speed based on pressure and flow; a sensor-less compliant inflow cannula (IC), which altered inlet resistance and, therefore, pump flow based on preload; a sensor-less compliant outflow cannula (OC) on the right VAD, which altered outlet resistance and thus pump flow based on afterload; and a combined controller, which incorporated the MS controller, compliant IC, and compliant OC. Each control system was evaluated in vivo under step increases in systemic (SVR ∼1400-2400 dyne/s/cm(5) ) and pulmonary (PVR ∼200-1000 dyne/s/cm(5) ) vascular resistances in four sheep supported by dual rotary VADs in a biventricular assist configuration. Constant speed support was also evaluated for comparison and resulted in suction events during all resistance increases and pulmonary congestion during SVR increases. The MS controller reduced suction events and prevented congestion through an initial sharp reduction in pump flow followed by a gradual return to baseline (5.0 L/min). The compliant IC prevented suction events; however, reduced pump flows and pulmonary congestion were noted during the SVR increase. The compliant OC maintained pump flow close to baseline (5.0 L/min) and prevented suction and congestion during PVR increases. The combined controller responded similarly to the MS controller to prevent suction and congestion events in all cases while providing a backup system in the event of single controller failure. © 2016 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

Increased pulmonary vascular contraction to serotonin after cardiopulmonary bypass: role of cyclooxygenase.

PubMed

Sato, K; Li, J; Metais, C; Bianchi, C; Sellke, F

2000-05-15

Pulmonary vascular resistance is frequently elevated after cardiopulmonary bypass (CPB). We examined if altered pulmonary microvascular reactivity to serotonin (5-HT) is due to altered expression of isoforms of nitric oxide synthase (NOS) or cyclooxygenase (COX). Pigs (n = 8) were heparinized and placed on total CPB for 90 min and then perfused off CPB for 90 min. Noninstrumented pigs (n = 6) served as controls for vascular studies. Relaxation responses (% of precontraction) of microvessels (60-150 microm in diameter) were examined in vitro in a pressurized (20 mm Hg) no-flow state with video microscopic imaging. Expression of eNOS, iNOS, and inducible (COX-2) and constitutive (COX-1) cyclooxygenase was examined with Western blotting and reverse transcription polymerase chain reaction. Pulmonary vascular resistance (PVR) increased from 316 +/- 39 mm Hg x s/cm(5) at baseline to 495 +/- 53 at 60 min and 565 +/- 62 at 90 min after termination of CPB. 5-HT elicited a relaxation response (46.8 +/- 11. 8%) in precontracted control microvessels. This response was not affected by the NOS inhibitor N(G)-nitro-l-arginine. After CPB, pulmonary microvessels contracted significantly to 5-HT (-29 +/- 27%, P < 0.05 vs control). This response was partially inhibited (7 +/- 20%, P = 0.06) in the presence of the COX-2 inhibitor NS398, but was unaffected by the thromboxane synthase inhibitor U63557A (-20 +/- 19%). Expression of iNOS or COX-1 was not changed after CPB. Protein and mRNA expressions of COX-2 both increased significantly after CPB, while that of eNOS decreased by approximately 50%. PVR increased after CPB. This was associated with a hypercontractile response of isolated pulmonary microvessels to 5-HT that was in part mediated by the release of prostaglandins (but not thromboxane) and associated with increased expression of COX-2 and with decreased expression of eNOS. Copyright 2000 Academic Press.

Laser transurethral resection of the prostate: Safety study of a novel system of photoselective vaporization with high power diode laser in prostates larger than 80mL.

PubMed

Andrés, G; Arance, I; Gimbernat, H; Redondo, C; García-Tello, A; Angulo, J C

2015-01-01

To present the feasibility of photoselective vaporization of the prostate (PVP) with of a new diode laser-resection system. Surgical treatment of benign prostatic hyperplasia (BPH) is constantly evolving. Laser techniques are increasingly used in prostates of large size. A prospective study was performed to evaluate operative data and patient outcomes with PVP using high-power diode laser (HPD) and a novel quartz-head fiber with shovel shape in patients with prostate>80mL. Demographic data, operative time, hemoglobin loss, operative results (IPSS, quality of life (QoL), Qmax, post void residue (PVR), IIEF-5 and micturition diary) and complications following Clavien-Dindo classification are described. Thirty-one patients were included in the study. Sixteen (51.6%) were on active antiplatelet treatment and 12 (38.7%) had received anticoagulants before surgery. All cases were followed at least 6mo. No intraoperative or postoperative major complications occurred. Three patients (9.7%) had minor complications according to Clavien-Dindo classification. Twenty-seven (87.1%) were discharged on postoperative day one without catheter. There were significant improvements in IPSS, QoL, Qmax and PVR, both at 3 and 6mo (P<.0001), but sexual function according to IIEF-5 showed no differences. Urgency (any grade) increased at 3mo (48.4%; P=.002) and considerably decreased at 6mo (9.7%; P<.0001). This pilot experience with shovel shape fiber and HPD is encouraging. It shows that laser-resection is a safe procedure, achieving excellent results in terms of IPSS, QoL and Qmax in large prostates even in high-risk patients. Longer follow-up, comparative and randomized controlled studies are needed to widespread these results. Copyright © 2014 AEU. Publicado por Elsevier España, S.L.U. All rights reserved.

Retinal Detachment in Southwest Ethiopia: A Hospital Based Prospective Study

PubMed Central

Asaminew, Tsedeke; Gelaw, Yeshigeta; Bekele, Sisay; Solomon, Berhan

2013-01-01

Purpose The incidence of retinal detachment in Blacks is generally considered to be low though there are few supporting studies in Africa. This study, thus, aimed at describing the clinical profile of patients with retinal detachment in Southwest Ethiopia. Methods A hospital-based study was done on all consecutive retinal detachment patients who presented to Jimma University Hospital over six months period. A semi-structured questionnaire was used to collect patients’ sociodemographic characteristics and clinical history. Comprehensive anterior and posterior segment eye examinations were done and risk factors were sought for. Statistical tests were considered significant if P < 0.05. Results A total of 94 eyes of 80 patients (1.5%) had retinal detachment (RD) and about 69% of patients were symptomatic for over a month before presentation. The mean age was 41.4 years (SD ±16.5). Fourteen patients (17.5%) had bilateral RD. At presentation, 61 eyes (64.9%) were blind from RD and 11 (13.8%) patients were bilaterally blind from RD. Rhegmatogenous RD was seen in 55 eyes (58.5%) and tractional RD in 22 eyes (23.4%). The most common risk factors were ocular trauma (32 eyes, 34.0%), myopia (23 eyes, 24.5%), posterior uveitis (13 eyes, 13.8%) and diabetic retinopathy (9 eyes, 9.6%). Most retinal breaks (25 eyes, 43.1%) were superotemporal and horse-shoe tear was the most common (19 eyes, 20.2%). Macula was off in 77 eyes (81.9%) and 38 eyes (69.1% of RRD eyes) had grade C proliferative vitreoretinopathy (PVR). Macular status was significantly associated with PVR (P=0.011), and duration of symptoms (RR=1.25, 95%CI: 1.059-1.475, P=0.040). Conclusions A significant numbers of patients with ocular problem had retinal detachment, and nearly two third of the patients presented late. Trauma and myopia were the most important risk factors. People should be educated to improve their health seeking behavior and use eye safety precautions to prevent ocular trauma. PMID:24086614

Right ventricular stroke work correlates with outcomes in pediatric pulmonary arterial hypertension.

PubMed

Yang, Weiguang; Marsden, Alison L; Ogawa, Michelle T; Sakarovitch, Charlotte; Hall, Keeley K; Rabinovitch, Marlene; Feinstein, Jeffrey A

2018-01-01

Pulmonary arterial hypertension (PAH) is characterized by elevated pulmonary artery pressures (PAP) and pulmonary vascular resistance (PVR). Optimizing treatment strategies and timing for transplant remains challenging. Thus, a quantitative measure to predict disease progression would be greatly beneficial in treatment planning. We devised a novel method to assess right ventricular (RV) stroke work (RVSW) as a potential biomarker of the failing heart that correlates with clinical worsening. Pediatric patients with idiopathic PAH or PAH secondary to congenital heart disease who had serial, temporally matched cardiac catheterization and magnetic resonance imaging (MRI) data were included. RV and PA hemodynamics were numerically determined by using a lumped parameter (circuit analogy) model to create pressure-volume (P-V) loops. The model was tuned using optimization techniques to match MRI and catheterization derived RV volumes and pressures for each time point. RVSW was calculated from the corresponding P-V loop and indexed by ejection fraction and body surface area (RVSW EF ) to compare across patients. Seventeen patients (8 boys; median age = 9.4 years; age range = 4.4-16.3 years) were enrolled. Nine were clinically stable; the others had clinical worsening between the time of their initial matched studies and their most recent follow-up (mean time = 3.9 years; range = 1.1-8.0 years). RVSW EF and the ratio of pulmonary to systemic resistance (Rp:Rs) values were found to have more significant associations with clinical worsening within one, two, and five years following the measurements, when compared with PVR index (PVRI). A receiver operating characteristic analysis showed RVSW EF outperforms PVRI, Rp:Rs and ejection fraction for predicting clinical worsening. RVSW EF correlates with clinical worsening in pediatric PAH, shows promising results towards predicting adverse outcomes, and may serve as an indicator of future clinical worsening.

Comparison of stroke work between repaired tetralogy of Fallot and normal right ventricular physiologies.

PubMed

Lee, Namheon; Das, Ashish; Banerjee, Rupak K; Gottliebson, William M

2013-01-01

Adult patients who underwent tetralogy of Fallot repair surgery (rTOF) confront life-threatening ailments due to right ventricular (RV) myocardial dysfunction. Pulmonary valve replacement (PVR) needs to be performed to restore the deteriorating RV function. Determination of correct timing to perform PVR in an rTOF patient remains subjective, due to the unavailability of quantifiable clinical diagnostic parameters. The objective of this study is to evaluate the possibility of using RV body surface area (BSA)-indexed stroke work (SW(I)) to quantify RV inefficiency in TOF patients. We hypothesized that RV SW(I) required to push blood to the lungs in rTOF patients is significantly higher than that of normal subjects. Seven patients with rTOF pathophysiology and eight controls with normal RV physiology were registered for this study. Right ventricular volume and pressure were measured using cardiac magnetic resonance imaging and catheterization, respectively. Statistical analysis was performed to quantify the difference in SW(I) between the RV of the rTOF and control groups. Right ventricular SW(I) in rTOF patients (0.176 ± 0.055 J/m(2)) was significantly higher by 93.4% (P = 0.0026) than that of controls (0.091 ± 0.030 J/m(2)). Further, rTOF patients were found to have significantly higher (P < 0.05) BSA normalized RV end-systolic volume, end-systolic pressure, and regurgitation fraction than control subjects. Ejection fraction and peak ejection rate of rTOF patients were significantly lower (P < 0.05) than those of controls. Patients with rTOF pathophysiology had significantly higher RV SW(I) compared with subjects with normal RV physiology. Therefore, RV SW(I) may be useful to quantify RV inefficiency in rTOF patients along with currently used clinical end points such as RV volume, pressure, regurgitation fraction, and ejection fraction.

Transaortic TAVI Is a Valid Alternative to Transapical Approach.

PubMed

O' Sullivan, Katie E; Hurley, Eoghan T; Segurado, Ricardo; Sugrue, Declan; Hurley, John P

2015-05-01

Transcatheter aortic valve implantation (TAVI) can be performed via a number of different anatomical approaches based on patient characteristics and operator choice. The aim of this study was to compare procedural outcomes between transaortic (TAo) and transapical (TA) approaches in an effort to establish whether any differences exist. A systematic review and meta-analysis of the current literature reporting outcomes for patients undergoing TAo and TA TAVI was performed to compare outcomes using each vascular approach to valve deployment. A total of 10 studies and 1736 patients were included. A total of 193 patients underwent TAo and 1543 TA TAVI. No significant difference in 30-day mortality was identified (TAo 9.4, TA 10.4 p = 0.7). There were no significant differences identified between TAo and TA TAVI in procedural success rate (96.3% vs. 93.7% p = 0.3), stroke and transient ischemic attack (TIA) incidence (1.8% vs. 2.3% p = 0.7), major bleed (5.8% vs. 5.5% p = 0.97) or pacemaker insertion rates (6.1% vs. 7.4% p = 0.56). In addition, the incidence of clinically significant paravalvular regurgitation (PVR) was the same between groups (6.7% vs. 11% p = 0.43). Comparison of TAo and TA approaches revealed equivalent outcomes in 30-day mortality, procedural success, major bleeding, stroke/TIA incidence, pacemaker insertion rates and paravalvular leak. Heart teams should be familiar with the use of both TA and TAo access and tailor their selection on a case-to-case basis. © 2015 Wiley Periodicals, Inc.

Right ventricular sex differences in patients with idiopathic pulmonary arterial hypertension characterised by magnetic resonance imaging: pair-matched case controlled study.

PubMed

Swift, Andrew J; Capener, Dave; Hammerton, Charlotte; Thomas, Steven M; Elliot, Charlie; Condliffe, Robin; Wild, Jim M; Kiely, David G

2015-01-01

Sex differences exist in both the prevalence and survival of patients with idiopathic pulmonary arterial hypertension (IPAH). Men are less frequently affected by the condition but have worse outcome as compared to females. We sought to characterise the sex related differences in right ventricular remodelling in age matched male and female patients with IPAH using cardiac magnetic resonance imaging (MRI). A case controlled pair-matched study was conducted with patients matched by age and sex. Steady state free precession (SSFP) MRI of the heart was performed at 1.5T. Cardiac volume, function and mass measurements were corrected for age, sex and BSA according to reference data. 40 age and sex matched patients with IPAH were identified. The mean age was 57 (SD 17) in both male and female cohorts. Men had proportionally lower right ventricular (RV) ejection fraction, RV stroke volume and LV stroke volume than females, p=0.028, p=0.007 and p=0.013, respectively. However, there was no significant difference in RV mass or haemodynamic indices of mPAP and PVR between males and females. Male patients with IPAH have proportionally worse RV function despite similar afterload. We hypothesise that adaptive remodelling of the RV in response to increased afterload in IPAH is more effective in females.

Right Ventricular Sex Differences in Patients with Idiopathic Pulmonary Arterial Hypertension Characterised by Magnetic Resonance Imaging: Pair-Matched Case Controlled Study

PubMed Central

Swift, Andrew J.; Capener, Dave; Hammerton, Charlotte; Thomas, Steven M.; Elliot, Charlie; Condliffe, Robin; Wild, Jim M.; Kiely, David G.

2015-01-01

Purpose Sex differences exist in both the prevalence and survival of patients with idiopathic pulmonary arterial hypertension (IPAH). Men are less frequently affected by the condition but have worse outcome as compared to females. We sought to characterise the sex related differences in right ventricular remodelling in age matched male and female patients with IPAH using cardiac magnetic resonance imaging (MRI). Methods A case controlled pair-matched study was conducted with patients matched by age and sex. Steady state free precession (SSFP) MRI of the heart was performed at 1.5T. Cardiac volume, function and mass measurements were corrected for age, sex and BSA according to reference data. Results 40 age and sex matched patients with IPAH were identified. The mean age was 57 (SD 17) in both male and female cohorts. Men had proportionally lower right ventricular (RV) ejection fraction, RV stroke volume and LV stroke volume than females, p=0.028, p=0.007 and p=0.013, respectively. However, there was no significant difference in RV mass or haemodynamic indices of mPAP and PVR between males and females. Conclusion Male patients with IPAH have proportionally worse RV function despite similar afterload. We hypothesise that adaptive remodelling of the RV in response to increased afterload in IPAH is more effective in females. PMID:25996939

Fifth NASA Goddard Conference on Mass Storage Systems and Technologies.. Volume 1

NASA Technical Reports Server (NTRS)

Kobler, Benjamin (Editor); Hariharan, P. C. (Editor)

1996-01-01

This document contains copies of those technical papers received in time for publication prior to the Fifth Goddard Conference on Mass Storage Systems and Technologies. As one of an ongoing series, this conference continues to serve as a unique medium for the exchange of information on topics relating to the ingestion and management of substantial amounts of data and the attendant problems involved. This year's discussion topics include storage architecture, database management, data distribution, file system performance and modeling, and optical recording technology. There will also be a paper on Application Programming Interfaces (API) for a Physical Volume Repository (PVR) defined in Version 5 of the Institute of Electrical and Electronics Engineers (IEEE) Reference Model (RM). In addition, there are papers on specific archives and storage products.

Gate-Tunable Electron Transport Phenomena in Al-Ge⟨111⟩-Al Nanowire Heterostructures.

PubMed

Brunbauer, Florian M; Bertagnolli, Emmerich; Lugstein, Alois

2015-11-11

Electrostatically tunable negative differential resistance (NDR) is demonstrated in monolithic metal-semiconductor-metal (Al-Ge-Al) nanowire (NW) heterostructures integrated in back-gated field-effect transistors (FETs). Unambiguous signatures of NDR even at room temperature are attributed to intervalley electron transfer. At yet higher electric fields, impact ionization leads to an exponential increase of the current in the ⟨111⟩ oriented Ge NW segments. Modulation of the transfer rates, manifested as a large tunability of the peak-to-valley ratio (PVR) and the onset of impact ionization is achieved by the combined influences of electrostatic gating, geometric confinement, and heterojunction shape on hot electron transfer and by electron-electron scattering rates that can be altered by varying the charge carrier concentration in the NW FETs.

Conserved Genes Act as Modifiers of Invertebrate SMN Loss of Function Defects

PubMed Central

Chang, Howard C.; Sen, Anindya; Kalloo, Geetika; Harris, Jevede; Barsby, Tom; Walsh, Melissa B.; Satterlee, John S.; Li, Chris; Van Vactor, David; Artavanis-Tsakonas, Spyros; Hart, Anne C.

2010-01-01

Spinal Muscular Atrophy (SMA) is caused by diminished function of the Survival of Motor Neuron (SMN) protein, but the molecular pathways critical for SMA pathology remain elusive. We have used genetic approaches in invertebrate models to identify conserved SMN loss of function modifier genes. Drosophila melanogaster and Caenorhabditis elegans each have a single gene encoding a protein orthologous to human SMN; diminished function of these invertebrate genes causes lethality and neuromuscular defects. To find genes that modulate SMN function defects across species, two approaches were used. First, a genome-wide RNAi screen for C. elegans SMN modifier genes was undertaken, yielding four genes. Second, we tested the conservation of modifier gene function across species; genes identified in one invertebrate model were tested for function in the other invertebrate model. Drosophila orthologs of two genes, which were identified originally in C. elegans, modified Drosophila SMN loss of function defects. C. elegans orthologs of twelve genes, which were originally identified in a previous Drosophila screen, modified C. elegans SMN loss of function defects. Bioinformatic analysis of the conserved, cross-species, modifier genes suggests that conserved cellular pathways, specifically endocytosis and mRNA regulation, act as critical genetic modifiers of SMN loss of function defects across species. PMID:21124729

A pig model of acute right ventricular afterload increase by hypoxic pulmonary vasoconstriction.

PubMed

Knai, Kathrine; Skjaervold, Nils Kristian

2017-01-03

The aim of this study was to construct a non-invasive model for acute right ventricular afterload increase by hypoxic pulmonary vasoconstriction. Intact animal models are vital to improving our understanding of the pathophysiology of acute right ventricular failure. Acute right ventricular failure is caused by increased afterload of the right ventricle by chronic or acute pulmonary hypertension combined with regionally or globally reduced right ventricular contractile capacity. Previous models are hampered by their invasiveness; this is unfortunate as the pulmonary circulation is a low-pressure system that needs to be studied in closed chest animals. Hypoxic pulmonary vasoconstriction is a mechanism that causes vasoconstriction in alveolar vessels in response to alveolar hypoxia. In this study we explored the use of hypoxic pulmonary vasoconstriction as a means to increase the pressure load on the right ventricle. Pulmonary hypertension was induced by lowering the FiO 2 to levels below the physiological range in eight anesthetized and mechanically ventilated pigs. The pigs were monitored with blood pressure measurements and blood gases. The mean pulmonary artery pressures (mPAP) of the animals increased from 18.3 (4.2) to 28.4 (4.6) mmHg and the pulmonary vascular resistance (PVR) from 254 (76) dyns/cm 5 to 504 (191) dyns/cm 5 , with a lowering of FiO 2 from 0.30 to 0.15 (0.024). The animals' individual baseline mPAPs varied substantially as did their response to hypoxia. The reduced FiO 2 level yielded an overall lowering in oxygen offer, but the global oxygen consumption was unaltered. We showed in this study that the mPAP and the PVR could be raised by approximately 100% in the study animals by lowering the FiO 2 from 0.30 to 0.15 (0.024). We therefore present a novel method for minimally invasive (closed chest) right ventricular afterload manipulations intended for future studies of acute right ventricular failure. The method should in theory be reversible, although this was not studied in this work.

Hemodynamic effects of butorphanol in desflurane-anesthetized dogs.

PubMed

dos Santos, Paulo Sérgio P; Nunes, Newton; de Souza, Almir P; de Rezende, Márlis L; Nishimori, Celina T D; de Paula, Danielli P; Ferro Lopes, Patrícia C

2011-09-01

To evaluate the effects of butorphanol on cardiopulmonary parameters in dogs anesthetized with desflurane and breathing spontaneously. Prospective, randomized experimental trial. Twenty dogs weighing 12 ± 3 kg. Animals were distributed into two groups: a control group (CG) and butorphanol group (BG). Propofol was used for induction and anesthesia was maintained with desflurane (10%). Forty minutes after induction, the dogs in the CG received sodium chloride 0.9% (0.05 mL kg(-1) IM), and dogs in the BG received butorphanol (0.4 mg kg(-1) IM). The first measurements of body temperature (BT), heart rate (HR), arterial pressures (AP), cardiac output (CO), cardiac index (CI), central venous pressure (CVP), stroke volume index (SVI), pulmonary arterial occlusion pressure (PAOP), mean pulmonary arterial pressure (mPAP), left ventricular stroke work (LVSW), systemic (SVR) and pulmonary (PVR) vascular resistances, respiratory rate (f(R) ), and arterial oxygen (PaO(2) ) and carbon dioxide (PaCO(2) ) partial pressures were taken immediately before the administration of butorphanol or sodium chloride solution (T0) and then at 15-minute intervals (T15-T75). In the BG, HR, AP, mPAP and SVR decreased significantly from T15 to T75 compared to baseline. f(R) was lower at T30 than at T0 in the BG. AP and f(R) were significantly lower than in the CG from T15 to T75. PVR was lower in the BG than in the CG at T30, while PaCO(2) was higher compared with T0 from T30 to T75 in the BG and significantly higher than in the CG at T30 to T75. At the studied dose, butorphanol caused hypotension and decreased ventilation during desflurane anesthesia in dogs. The hypotension (from 86 ± 10 to 64 ± 10 mmHg) is clinically relevant, despite the maintenance of cardiac index. © 2011 The Authors. Veterinary Anaesthesia and Analgesia. © 2011 Association of Veterinary Anaesthetists and the American College of Veterinary Anesthesiologists.

Pericardial tissue valves and Gore-Tex conduits as an alternative for right ventricular outflow tract replacement in children.

PubMed

Allen, Bradley S; El-Zein, Chawki; Cuneo, Betina; Cava, Joseph P; Barth, Mary Jane; Ilbawi, Michel N

2002-09-01

There is still no perfect conduit for reconstruction of the right ventricular outflow tract (RVOT) in children. Homografts are not always available in the appropriate size, and degenerate in a few years. This study evaluates the pericardial valve with Gore-Tex conduit as an alternative for RVOT construction. From January 1, 1993, to September 30, 1999, a pericardial tissue valve was inserted in all patients undergoing RVOT reconstruction or pulmonary valve replacement (PVR) who were large enough to accommodate a tissue valve. In patients without a native main pulmonary artery, a new technique was used to construct an RV-PA conduit out of a flat sheet of Gore-Tex, as Dacron frequently leads to stenosis. Data were collected by retrospective review, follow-up echocardiograms, and assessment by a single cardiologist. There were 48 patients, 22 undergoing a PVR alone and 26 a RV-PA valved Gore-Tex conduit. Diagnosis included tetralogy of Fallot (n = 25); truncus arteriosis (n = 9); ventricular septal defect with PA (n = 5); DORV (n = 4); D-TGA with PS (n = 2); and 1 each IAA with sub AS, VSD with PI, and PS s/p Ross procedure. Patient age ranged from 3 to 33 years and 98% were reoperations. The valve sizes ranged from 19 to 33 mm and the median hospital length of stay was 4 days. There were 2 (4.2%) perioperative and 1 (2.1%) late deaths, none related to the valve or Gore-Tex conduit. At a follow-up of 15 to 86 months (mean 43 +/- 16 months), all remaining 45 patients are New York Heart Association class I, all valves are functional, and no patient has required valve or conduit replacement or revision; more importantly, echocardiogram revealed no significant valve or conduit stenosis (mean gradient 16 +/- 8 mm Hg) and no evidence of regurgitation or structural degeneration. A pericardial tissue valve and Gore-Tex conduit provides a reliable alternative for RVOT reconstruction in pediatric patients. It is readily available, molds in the limited retrosternal space, and has outstanding intermediate results with no evidence of failure or deterioration up to 7 years after insertion.

Assessment of operability by means of CTPA and perfusion SPECT in patients with chronic thromboembolic pulmonary hypertension.

PubMed

Grgic, Aleksandar; Miodek, Florian; Schäfers, Hans-Joachim; Held, Matthias; Kaiser, Ralf; Khreish, Fadi; Buecker, Arno; Bals, Robert; Kirsch, Carl-Martin; Wilkens, Heinrike

2016-01-01

Chronic thromboembolic pulmonary hypertension (CTEPH) can potentially be cured by pulmonary thrombendarterectomy (PEA), the criteria for differentiation between operable and non-operable patients are not standardized. To retrospectively evaluate the value of rigidly registered computed tomography pulmonary angiography (CTPA) and single photon emission CT (SPECT) in differentiating for PEA. Forty-nine patients with CTEPH (21 men; age, 58 ± 13 years) were evaluated by an interdisciplinary expert board using all available diagnostic information and their consensus statement as gold standard. For SPECT a lobe based perfusion score was visually assessed using the score of 0 (lack of perfusion) to 1 (normal perfusion) calculating percentage of vascular obstruction (PVO). By CTPA, vascular obstruction index (OI) of central, peripheral, and global PA-bed were determined. The accuracy of the alignment between CTPA and SPECT was determined by fusion score (FS) ranging from 1 (no alignment) to 5 (exact alignment). Angiography provided PA pressure (PAP), pulmonary vascular resistance (PVR), and PA wedge pressure (PAWP). Receiver operating characteristics (ROC) analysis was performed. Twenty-nine patients were considered surgically amenable, and 20 patients were inoperable. Mean PAP, PVR, and PAWP were 48 ± 11 mmHg, 868 ± 461 dynes*sec*cm(-5), and 11 ± 5 mmHg, without differences between surgical and non-surgical patients (P > 0.5). In all patients accurate registration was reached (FS = 4.1 ± 0.7; range, 2-5). PVO and central OI separated PEA-amenable patients (P ≤ 0.001) resulting in the area under the curve of 0.828 (cutoff for PVO: 37.8% with a sensitivity of 82% and specificity of 79%) and 0.755 (cutoff for central OI: 29% with a sensitivity and specificity of 86.2% and 79%) for operability. An accurate interpretation of rigidly registered CTPA and perfusion SPECT may contribute to stratification of operability in patients with CTEPH. © The Foundation Acta Radiologica 2015.

Transvesical robotic simple prostatectomy: initial clinical experience.

PubMed

Leslie, Scott; Abreu, Andre Luis de Castro; Chopra, Sameer; Ramos, Patrick; Park, Daniel; Berger, Andre K; Desai, Mihir M; Gill, Inderbir S; Aron, Monish

2014-08-01

Despite significant developments in transurethral surgery for benign prostatic hyperplasia (BPH), simple prostatectomy remains an excellent option for patients with large glands. To describe our technique of transvesical robotic simple prostatectomy (RSP). From May 2011 to April 2013, 25 patients underwent RSP. We performed RSP using our technique. Baseline demographics, pathology data, perioperative complications, 90-d complications, and functional outcomes were assessed. Mean patient age was 72.9 yr (range: 54-88), baseline International Prostate Symptom Score (IPSS) was 23.9 (range: 9-35), prostate volume was 149.6 ml (range: 91-260), postvoid residual (PVR) was 208.1 ml (range: 72-800), maximum flow rate (Qmax) was 11.3 ml/s, and preoperative prostate-specific antigen was 9.4 ng/ml (range: 1.9-56.3). Eight patients were catheter dependent before surgery. Mean operative time was 214 min (range: 165-345), estimated blood loss was 143 ml (range: 50-350), and the hospital stay was 4 d (range: 2-8). There were no intraoperative complications and no conversions to open surgery. Five patients had a concomitant robotic procedure performed. Early functional outcomes demonstrated significant improvement from baseline with an 85% reduction in mean IPSS (p<0.0001), an 82.2% reduction in mean PVR (p=0.014), and a 77% increase in mean Qmax (p=0.20). This study is limited by small sample size and short follow-up period. One patient had a urinary tract infection; two had recurrent hematuria, one requiring transfusion; one patient had clot retention and extravasation, requiring reoperation. Our technique of RSP is safe and effective. Good functional outcomes suggest it is a viable option for BPH and larger glands and can be used for patients requiring concomitant procedures. We describe the technique and report the initial results of a series of cases of transvesical robotic simple prostatectomy. The procedure is both feasible and safe and a good option for benign prostatic hyperplasia with larger glands. Copyright © 2013 European Association of Urology. Published by Elsevier B.V. All rights reserved.

Genetic analysis and characterization of wild poliovirus type 1 during sustained transmission in a population with >95% vaccine coverage, Israel 2013.

PubMed

Shulman, Lester M; Martin, Javier; Sofer, Danit; Burns, Cara C; Manor, Yossi; Hindiyeh, Musa; Gavrilin, Eugene; Wilton, Thomas; Moran-Gilad, Jacob; Gamzo, Ronni; Mendelson, Ella; Grotto, Itamar

2015-04-01

Israel has >95% polio vaccine coverage with the last 9 birth cohorts immunized exclusively with inactivated polio vaccine (IPV). Using acute flaccid paralysis and routine, monthly countrywide environmental surveillance, no wild poliovirus circulation was detected between 1989 and February 2013, after which wild type 1 polioviruses South Asia genotype (WPV1-SOAS) have persistently circulated in southern Israel and intermittently in other areas without any paralytic cases as determined by intensified surveillance of environmental and human samples. We aimed to characterize antigenic and neurovirulence properties of WPV1-SOAS silently circulating in a highly vaccinated population. WPV1-SOAS capsid genes from environmental and stool surveillance isolates were sequenced, their neurovirulence was determined using transgenic mouse expressing the human poliovirus receptor (Tg21-PVR) mice, and their antigenicity was characterized by in vitro neutralization using human sera, epitope-specific monoclonal murine anti-oral poliovirus vaccine (OPV) antibodies, and sera from IPV-immunized rats and mice. WPV1 amino acid sequences in neutralizing epitopes varied from Sabin 1 and Mahoney, with little variation among WPV1 isolates. Neutralization by monoclonal antibodies against 3 of 4 OPV epitopes was lost. Three-fold lower geometric mean titers (Z = -4.018; P < .001, Wilcoxon signed-rank test) against WPV1 than against Mahoney in human serum correlated with 4- to 6-fold lower neutralization titers in serum from IPV-immunized rats and mice. WPV1-SOAS isolates were neurovirulent (50% intramuscular paralytic dose in Tg21-PVR mice: log10(7.0)). IPV-immunized mice were protected against WPV1-induced paralysis. Phenotypic and antigenic profile changes of WPV1-SOAS may have contributed to the intense silent transmission, whereas the reduced neurovirulence may have contributed to the absence of paralytic cases in the background of high population immunity. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Ocular trauma resulting from paintball injury.

PubMed

Pahk, Patricia J; Adelman, Ron A

2009-04-01

Paintball-related ocular injuries result in severe damage and loss of vision. Despite efforts to increase public awareness and improve safety features, the incidence of eye injuries has increased over time. We examined the characteristics and ocular effects of paintball injury at our tertiary referral center. Retrospective review of charts of patients with paintball injury between 1998-2005. Fourteen patients were evaluated for paintball injury; 13 (93%) were male and one (7%) was female. Average age was 17 years (range from 9 to 30). Thirteen patients (95%) did not wear eye protection; one is unknown. Injuries occurred while playing paintball in three patients (21%); ten (71%) were injured in either accidental (four patients) or intentional (six patients) shootings not associated with play. Minimum follow-up was 6 weeks, except for one patient who was lost to follow-up. Seven patients (50%) had final visual acuity (VA) better than 20/200, six patients (43%) were 20/200 or worse, and information on one patient was not available. VA, except in one case, improved with treatment. Decreased VA in this case was due to proliferative vitreoretinopathy (PVR). Hyphema was noted in ten patients (71%), vitreous hemorrhage in eight (57%), retinal hemorrhage in six (43%), retinal tear or detachment in six (43%), commotio retinae in six (43%), iris injury in five (36%), keratopathy in four (29%), lens injury in two (14%), subluxation of lens in two (14%), secondary glaucoma in two (14%), open globe/intraocular foreign body (IOFB) in one (7%), choroidal rupture in one (7%), and proliferative vitreoretinopathy (PVR) in one (7%). Ten patients (71%) required intervention (surgery, laser retinopexy or cryotherapy). Paintball trauma results in significant ocular injury and loss of vision. Most injuries occur in unsupervised settings without proper eye protection. Ten patients (71%) were injured in accidental or intentional shootings. Lack of supervision and use of paintball materials as assault weapons make the risk for ocular injury more significant. Improved safety features of paintball equipment, along with continued education of proper eye protection, may reduce the incidence of severe ocular injuries.

Detection of Genetically Modified Sugarcane by Using Terahertz Spectroscopy and Chemometrics

NASA Astrophysics Data System (ADS)

Liu, J.; Xie, H.; Zha, B.; Ding, W.; Luo, J.; Hu, C.

2018-03-01

A methodology is proposed to identify genetically modified sugarcane from non-genetically modified sugarcane by using terahertz spectroscopy and chemometrics techniques, including linear discriminant analysis (LDA), support vector machine-discriminant analysis (SVM-DA), and partial least squares-discriminant analysis (PLS-DA). The classification rate of the above mentioned methods is compared, and different types of preprocessing are considered. According to the experimental results, the best option is PLS-DA, with an identification rate of 98%. The results indicated that THz spectroscopy and chemometrics techniques are a powerful tool to identify genetically modified and non-genetically modified sugarcane.

Genome-wide association study to identify potential genetic modifiers in a canine model for Duchenne muscular dystrophy.

PubMed

Brinkmeyer-Langford, Candice; Balog-Alvarez, Cynthia; Cai, James J; Davis, Brian W; Kornegay, Joe N

2016-08-22

Duchenne muscular dystrophy (DMD) causes progressive muscle degeneration, cardiomyopathy and respiratory failure in approximately 1/5,000 boys. Golden Retriever muscular dystrophy (GRMD) resembles DMD both clinically and pathologically. Like DMD, GRMD exhibits remarkable phenotypic variation among affected dogs, suggesting the influence of modifiers. Understanding the role(s) of genetic modifiers of GRMD may identify genes and pathways that also modify phenotypes in DMD and reveal novel therapies. Therefore, our objective in this study was to identify genetic modifiers that affect discrete GRMD phenotypes. We performed a linear mixed-model (LMM) analysis using 16 variably-affected dogs from our GRMD colony (8 dystrophic, 8 non-dystrophic). All of these dogs were either full or half-siblings, and phenotyped for 19 objective, quantitative biomarkers at ages 6 and 12 months. Each biomarker was individually assessed. Gene expression profiles of 59 possible candidate genes were generated for two muscle types: the cranial tibialis and medial head of the gastrocnemius. SNPs significantly associated with GRMD biomarkers were identified on multiple chromosomes (including the X chromosome). Gene expression levels for candidate genes located near these SNPs correlated with biomarker values, suggesting possible roles as GRMD modifiers. The results of this study enhance our understanding of GRMD pathology and represent a first step toward the characterization of GRMD modifiers that may be relevant to DMD pathology. Such modifiers are likely to be useful for DMD treatment development based on their relationships to GRMD phenotypes.

Genetic Polymorphisms Associated with Rubella Virus-Specific Cellular Immunity Following MMR Vaccination

PubMed Central

Kennedy, Richard B.; Ovsyannikova, Inna G.; Haralambieva, Iana H.; Lambert, Nathaniel D.; Pankratz, V. Shane; Poland, Gregory A.

2014-01-01

Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single dose seroconversion rates ~95%. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects ages 11–22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (ages 18–40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination. PMID:25098560

Genetic polymorphisms associated with rubella virus-specific cellular immunity following MMR vaccination.

PubMed

Kennedy, Richard B; Ovsyannikova, Inna G; Haralambieva, Iana H; Lambert, Nathaniel D; Pankratz, V Shane; Poland, Gregory A

2014-11-01

Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single-dose seroconversion rates ~95 %. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects aged 11-22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (age 18-40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination.

Structural, mutational and biophysical studies reveal a canonical mode of molecular recognition between immune receptor TIGIT and nectin-2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Samanta, Dibyendu; Guo, Haisu; Rubinstein, Rotem

In addition to antigen-specific stimulation of T cell receptor (TCR) by a peptide-MHC complex, the functional outcome of TCR engagement is regulated by antigen-independent costimulatory signals. Costimulatory signals are provided by an array of interactions involving activating and inhibitory receptors expressed on T cells and their cognate ligands on antigen presenting cells. T cell immunoglobulin and ITIM domain (TIGIT), a recently identified immune receptor expressed on T and NK cells, upon interaction with either of its two ligands, nectin-2 or poliovirus receptor (PVR), inhibits activation of T and NK cells. Here we report the crystal structure of the human TIGITmore » ectodomain, which exhibits the classic two-layer β-sandwich topology observed in other immunoglobulin super family (IgSF) members. Biophysical studies indicate that TIGIT is monomeric in solution but can form a dimer at high concentrations, consistent with the observation of a canonical immunoglobulin-like dimer interface in the crystalline state. Based on existing structural data, we present a model of the TIGIT:nectin-2 complex and utilized complementary biochemical studies to map the nectin-binding interface on TIGIT. Our data provide important structural and biochemical determinants responsible for the recognition of nectin-2 by TIGIT. Defining the TIGIT:nectin-2 binding interface provides the basis for rational manipulation of this molecular interaction for the development of immunotherapeutic reagents in autoimmunity and cancer.« less

A Modified Delphi to Identify the Significant Works Pertaining to the Understanding of Reading Comprehension and Content Analysis of the Identified Works

ERIC Educational Resources Information Center

Zunker, Norma D.; Pearce, Daniel L.

2012-01-01

The first part of this study explored the significant works pertaining to the understanding of reading comprehension using a Modified Delphi Method. A panel of reading comprehension experts identified 19 works they considered to be significant to the understanding of reading comprehension. The panel of experts identified the reasons they…

Functional Analysis of Problem Behavior: A Systematic Approach for Identifying Idiosyncratic Variables

PubMed Central

Roscoe, Eileen M.; Schlichenmeyer, Kevin J.; Dube, William V.

2015-01-01

When inconclusive functional analysis (FA) outcomes occur, a number of modifications have been made to enhance the putative establishing operation or consequence associated with behavioral maintenance. However, a systematic method for identifying relevant events to test during modified FAs has not been evaluated. The purpose of this study was to develop and evaluate a technology for systematically identifying events to test in a modified FA after an initial FA led to inconclusive outcomes. Six individuals whose initial FA showed little or no responding or high levels only in the control condition participated. An indirect assessment (IA) questionnaire developed for identifying idiosyncratic variables was administered, and a descriptive analysis (DA) was conducted. Results from the IA only or a combination of the IA and DA were used to inform modified FA test and control conditions. Conclusive FA outcomes were obtained with five of the six participants during the modified FA phase. PMID:25930176

Can we predict the outcome for people with patellofemoral pain? A systematic review on prognostic factors and treatment effect modifiers.

PubMed

Matthews, M; Rathleff, M S; Claus, A; McPoil, T; Nee, R; Crossley, K; Vicenzino, B

2017-12-01

Patellofemoral pain (PFP) is a multifactorial and often persistent knee condition. One strategy to enhance patient outcomes is using clinically assessable patient characteristics to predict the outcome and match a specific treatment to an individual. A systematic review was conducted to determine which baseline patient characteristics were (1) associated with patient outcome (prognosis); or (2) modified patient outcome from a specific treatment (treatment effect modifiers). 6 electronic databases were searched (July 2016) for studies evaluating the association between those with PFP, their characteristics and outcome. All studies were appraised using the Epidemiological Appraisal Instrument. Studies that aimed to identify treatment effect modifiers underwent a checklist for methodological quality. The 24 included studies evaluated 180 participant characteristics. 12 studies investigated prognosis, and 12 studies investigated potential treatment effect modifiers. Important methodological limitations were identified. Some prognostic studies used a retrospective design. Studies aiming to identify treatment effect modifiers often analysed too many variables for the limiting sample size and typically failed to use a control or comparator treatment group. 16 factors were reported to be associated with a poor outcome, with longer duration of symptoms the most reported (>4 months). Preliminary evidence suggests increased midfoot mobility may predict those who have a successful outcome to foot orthoses. Current evidence can identify those with increased risk of a poor outcome, but methodological limitations make it difficult to predict the outcome after one specific treatment compared with another. Adequately designed randomised trials are needed to identify treatment effect modifiers. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Pulmonary hypertension and right heart failure due to severe hypernatremic dehydration.

PubMed

Chiwane, Saurabh; Ahmed, Tageldin M; Bauerfeld, Christian P; Chauhan, Monika

2017-07-01

Neonates are at risk of developing hypernatremic dehydration and its associated complications, such as stroke, dural sinus thrombosis and renal vein thrombosis. Pulmonary hypertension has not been described as a complication of hypernatremia. We report a case of a seven-day-old neonate with severe hypernatremic dehydration who went on to develop pulmonary hypertension and right heart failure needing extracorporeal membrane oxygenation (ECMO). Normal or high anion gap metabolic acidosis commonly accompanies hypernatremic dehydration. The presence of acidosis and/or hypoxia can delay the normal drop in pulmonary vascular resistance (PVR) after birth, causing pulmonary hypertension and right ventricular failure. A high index of suspicion is paramount to diagnose pulmonary hypertension and aggressive correction of the acidosis and hypoxia is needed. In the presence of severe right ventricular failure, ECMO can be used as a bridge to recovery while underlying metabolic derangements are being corrected.

Identification of ganglion cell neurites in human subretinal and epiretinal membranes

PubMed Central

Lewis, Geoffrey P; Betts, Kellen E; Sethi, Charanjit S; Charteris, David G; Lesnik‐Oberstein, Sarit Y; Avery, Robert L; Fisher, Steven K

2007-01-01

Aim To determine whether neural elements are present in subretinal and epiretinal proliferative vitreoretinopathy (PVR) membranes as well as in diabetic, fibrovascular membranes removed from patients during vitrectomy surgery. Methods Human subretinal and epiretinal membranes of varying durations were immunolabelled with different combinations of antibodies to glial fibrillary acidic protein, vimentin, neurofilament protein and laminin. Results Anti‐neurofilament‐labelled neurites from presumptive ganglion cells were frequently found in epiretinal membranes and occasionally found in subretinal membranes. In addition, the neurites were only observed in regions that also contained glial processes. Conclusions These data demonstrate that neuronal processes are commonly found in human peri‐retinal cellular membranes similar to that demonstrated in animal models. These data also suggest that glial cells growing out of the neural retina form a permissive substrate for neurite growth and thus may hold clues to factors that support this growth. PMID:17108012

Fifth NASA Goddard Conference on Mass Storage Systems and Technologies. Volume 2

NASA Technical Reports Server (NTRS)

Kobler, Benjamin (Editor); Hariharan, P. C. (Editor)

1996-01-01

This document contains copies of those technical papers received in time for publication prior to the Fifth Goddard Conference on Mass Storage Systems and Technologies held September 17 - 19, 1996, at the University of Maryland, University Conference Center in College Park, Maryland. As one of an ongoing series, this conference continues to serve as a unique medium for the exchange of information on topics relating to the ingestion and management of substantial amounts of data and the attendant problems involved. This year's discussion topics include storage architecture, database management, data distribution, file system performance and modeling, and optical recording technology. There will also be a paper on Application Programming Interfaces (API) for a Physical Volume Repository (PVR) defined in Version 5 of the Institute of Electrical and Electronics Engineers (IEEE) Reference Model (RM). In addition, there are papers on specific archives and storage products.

[Heavy silicone oil (Densiron® 68) in proliferative vitreoretinopathy: 4 years of experience].

PubMed

Macías-Murelaga, B; Ruiz, M; Bascarán, L; Gibelalde, A; Aldazabal, M; Irigoyen, C

2013-11-01

Prospective observational study including 10 patients (age range: 27-74 years) with recurrent retinal detachment (RD) and proliferative vitreoretinopathy (PVR) and 2.8 mean unsatisfactory previous surgeries. Densiron® was injected in all patients, with surgical retinectomy being required in 70% of them. Minimum follow-up time was 12 months. The mean length of time before Densiron® withdrawal was 4 months. Three patients (30%) presented with a new RD. The main complication detected was cataract development. No relationship was found between re-detachments and tamponade time, baseline disease or RD evolution time. Densiron® may be a good option in cases of recurrent RD in which previous treatment with scleral buckle, gas and/or 1,000/5,000 silicone oils has proven to be unsatisfactory. Copyright © 2012 Sociedad Española de Oftalmología. Published by Elsevier Espana. All rights reserved.

40 CFR 721.5908 - Modified phenolic resin (generic).

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Modified phenolic resin (generic). 721... Substances § 721.5908 Modified phenolic resin (generic). (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as modified phenolic resin (PMN P...

40 CFR 721.5905 - Modified phenolic resin (generic).

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Modified phenolic resin (generic). 721... Substances § 721.5905 Modified phenolic resin (generic). (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as a modified phenolic resin (PMN...

Modifiable risk factors for schizophrenia and autism--shared risk factors impacting on brain development.

PubMed

Hamlyn, Jess; Duhig, Michael; McGrath, John; Scott, James

2013-05-01

Schizophrenia and autism are two poorly understood clinical syndromes that differ in age of onset and clinical profile. However, recent genetic and epidemiological research suggests that these two neurodevelopmental disorders share certain risk factors. The aims of this review are to describe modifiable risk factors that have been identified in both disorders, and, where available, collate salient systematic reviews and meta-analyses that have examined shared risk factors. Based on searches of Medline, Embase and PsycINFO, inspection of review articles and expert opinion, we first compiled a set of candidate modifiable risk factors associated with autism. Where available, we next collated systematic-reviews (with or without meta-analyses) related to modifiable risk factors associated with both autism and schizophrenia. We identified three modifiable risk factors that have been examined in systematic reviews for both autism and schizophrenia. Advanced paternal age was reported as a risk factor for schizophrenia in a single meta-analysis and as a risk factor in two meta-analyses for autism. With respect to pregnancy and birth complications, for autism one meta-analysis identified maternal diabetes and bleeding during pregnancy as risks factors for autism whilst a meta-analysis of eight studies identified obstetric complications as a risk factor for schizophrenia. Migrant status was identified as a risk factor for both autism and schizophrenia. Two separate meta-analyses were identified for each disorder. Despite distinct clinical phenotypes, the evidence suggests that at least some non-genetic risk factors are shared between these two syndromes. In particular, exposure to drugs, nutritional excesses or deficiencies and infectious agents lend themselves to public health interventions. Studies are now needed to quantify any increase in risk of either autism or schizophrenia that is associated with these modifiable environmental factors. Copyright © 2012 Elsevier Inc. All rights reserved.

Identification of prostate cancer modifier pathways using parental strain expression mapping

PubMed Central

Xu, Qing; Majumder, Pradip K.; Ross, Kenneth; Shim, Yeonju; Golub, Todd R.; Loda, Massimo; Sellers, William R.

2007-01-01

Inherited genetic risk factors play an important role in cancer. However, other than the Mendelian fashion cancer susceptibility genes found in familial cancer syndromes, little is known about risk modifiers that control individual susceptibility. Here we developed a strategy, parental strain expression mapping, that utilizes the homogeneity of inbred mice and genome-wide mRNA expression analyses to directly identify candidate germ-line modifier genes and pathways underlying phenotypic differences among murine strains exposed to transgenic activation of AKT1. We identified multiple candidate modifier pathways and, specifically, the glycolysis pathway as a candidate negative modulator of AKT1-induced proliferation. In keeping with the findings in the murine models, in multiple human prostate expression data set, we found that enrichment of glycolysis pathways in normal tissues was associated with decreased rates of cancer recurrence after prostatectomy. Together, these data suggest that parental strain expression mapping can directly identify germ-line modifier pathways of relevance to human disease. PMID:17978178

21 CFR 178.3520 - Industrial starch-modified.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Industrial starch-modified. 178.3520 Section 178... SANITIZERS Certain Adjuvants and Production Aids § 178.3520 Industrial starch-modified. Industrial starch... provisions of this section. (a) Industrial starch-modified is identified as follows: (1) A food starch...

21 CFR 178.3520 - Industrial starch-modified.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Industrial starch-modified. 178.3520 Section 178... SANITIZERS Certain Adjuvants and Production Aids § 178.3520 Industrial starch-modified. Industrial starch... provisions of this section. (a) Industrial starch-modified is identified as follows: (1) A food starch...

40 CFR 721.10145 - Modified reaction products of alkyl alcohol, halogenated alkane, substituted epoxide, and amino...

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Modified reaction products of alkyl... Modified reaction products of alkyl alcohol, halogenated alkane, substituted epoxide, and amino compound... identified generically as modified reaction products of alkyl alcohol, halogenated alkane, substituted...

40 CFR 721.10145 - Modified reaction products of alkyl alcohol, halogenated alkane, substituted epoxide, and amino...

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Modified reaction products of alkyl... Modified reaction products of alkyl alcohol, halogenated alkane, substituted epoxide, and amino compound... identified generically as modified reaction products of alkyl alcohol, halogenated alkane, substituted...

40 CFR 721.4380 - Modified hydrocarbon resin.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Modified hydrocarbon resin. 721.4380... Substances § 721.4380 Modified hydrocarbon resin. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as a modified hydrocarbon resin (P-91-1418) is...

Creatine kinase: Essential arginine residues at the nucleotide binding site identified by chemical modification and high-resolution tandem mass spectrometry

PubMed Central

Wood, Troy D.; Guan, Ziqiang; Borders, Charles L.; Chen, Lorenzo H.; Kenyon, George L.; McLafferty, Fred W.

1998-01-01

Phenylglyoxal is an arginine-specific reagent that inactivates creatine kinase (CK). Previous results suggest that modification of the dimeric enzyme at a single arginine residue per subunit causes complete inactivation accompanied by the loss of nucleotide binding; the actual site of modification was not identified. Here, high-resolution tandem mass spectrometry (MS/MS) was used to identify three phenylglyoxal-modified Arg residues in monomeric rabbit muscle CK. Electrospray ionizaton Fourier-transform MS of the phenylglyoxal-modified CK that had lost ≈80% activity identified three species: unmodified, once-modified (+116 Da), and twice-modified (+232 Da) enzyme in a ratio of approximately 1:4:1. MS/MS restricts the derivatized sites to P122-P212 and P283-V332, whereas MS of Lys-C digestions revealed two modified peptides, A266-K297 and G116-K137. The only Arg in A266-K297 is Arg-291 (invariant), whereas MS/MS of modified G116-K137 shows that two of the three sites Arg-129, Arg-131, or Arg-134 (all invariant) can contain the modification. The recently reported x-ray crystal structure for the octameric chicken mitochondrial CK indicates that its nucleotide triphosphate-binding site indeed contains the equivalent of R291, R129, and R131 reported here to be at the active site of rabbit muscle CK. PMID:9520370

Cellular and molecular modifier pathways in tauopathies: the big picture from screening invertebrate models.

PubMed

Hannan, Shabab B; Dräger, Nina M; Rasse, Tobias M; Voigt, Aaron; Jahn, Thomas R

2016-04-01

Abnormal tau accumulations were observed and documented in post-mortem brains of patients affected by Alzheimer's disease (AD) long before the identification of mutations in the Microtubule-associated protein tau (MAPT) gene, encoding the tau protein, in a different neurodegenerative disease called Frontotemporal dementia and Parkinsonism linked to chromosome 17 (FTDP-17). The discovery of mutations in the MAPT gene associated with FTDP-17 highlighted that dysfunctions in tau alone are sufficient to cause neurodegeneration. Invertebrate models have been diligently utilized in investigating tauopathies, contributing to the understanding of cellular and molecular pathways involved in disease etiology. An important discovery came with the demonstration that over-expression of human tau in Drosophila leads to premature mortality and neuronal dysfunction including neurodegeneration, recapitulating some key neuropathological features of the human disease. The simplicity of handling invertebrate models combined with the availability of a diverse range of experimental resources make these models, in particular Drosophila a powerful invertebrate screening tool. Consequently, several large-scale screens have been performed using Drosophila, to identify modifiers of tau toxicity. The screens have revealed not only common cellular and molecular pathways, but in some instances the same modifier has been independently identified in two or more screens suggesting a possible role for these modifiers in regulating tau toxicity. The purpose of this review is to discuss the genetic modifier screens on tauopathies performed in Drosophila and C. elegans models, and to highlight the common cellular and molecular pathways that have emerged from these studies. Here, we summarize results of tau toxicity screens providing mechanistic insights into pathological alterations in tauopathies. Key pathways or modifiers that have been identified are associated with a broad range of processes including, but not limited to, phosphorylation, cytoskeleton organization, axonal transport, regulation of cellular proteostasis, transcription, RNA metabolism, cell cycle regulation, and apoptosis. We discuss the utility and application of invertebrate models in elucidating the cellular and molecular functions of novel and uncharacterized disease modifiers identified in large-scale screens as well as for investigating the function of genes identified as risk factors in genome-wide association studies from human patients in the post-genomic era. In this review, we combined and summarized several large-scale modifier screens performed in invertebrate models to identify modifiers of tau toxicity. A summary of the screens show that diverse cellular processes are implicated in the modification of tau toxicity. Kinases and phosphatases are the most predominant class of modifiers followed by components required for cellular proteostasis and axonal transport and cytoskeleton elements. © 2016 International Society for Neurochemistry.

Thulium laser VapoResection of the prostate versus traditional transurethral resection of the prostate or transurethral plasmakinetic resection of prostate for benign prostatic obstruction: a systematic review and meta-analysis.

PubMed

Deng, Zheng; Sun, Menghao; Zhu, Yiping; Zhuo, Jian; Zhao, Fujun; Xia, Shujie; Han, Bangmin; Herrmann, Thomas R W

2018-04-12

To compare the efficacy and safety of thulium laser VapoResection of the prostate (ThuVaRP) versus standard traditional transurethral resection of the prostate (TURP) or plasmakinetic resection of prostate (PKRP) for benign prostatic obstruction. Systematic searches were performed in the Medline, EMBASE, the Cochrane Library, Web of Science, and CNKI in December 2017. The outcomes of demographic and clinical characteristics, perioperative variables, complications, and postoperative efficacy including International Prostate Symptom Score (IPSS), quality of life (QoL), maximum flow rate (Qmax), and postvoid residual (PVR) were assessed. 16 studies were selected in the meta-analysis including nine randomized controlled trials (RCTs) and seven non-RCTs. Among of them, nine studies compared ThuVaRP with PKRP, while seven studies compared ThuVaRP with TURP. It seemed that ThuVaRP needed longer operation time than TURP (WMD = 6.41, 95% CI 1.38-11.44, p = 0.01) and PKRP (WMD = 10.15, 95% CI 5.20-15.10, p < 0.0001). ThuVaRP was associated with less serum hemoglobin decreased, catheterization time, and the length of hospital stay compared with TURP (WMD = - 0.58, 95% CI - 0.77 to 0.38, p < 0.00001; WMD = - 1.89, 95% CI - 2.67 to 1.11, p < 0.00001; WMD = - 2.25, 95% CI - 2.91 to 1.60, p < 0.00001) and PKRP (WMD = - 0.28, 95% CI - 0.46 to 0.10, p = 0.002; WMD = - 1.88, 95% CI - 2.87 to 0.89, p = 0.0002; WMD = - 2.08, 95% CI - 2.63 to 1.54, p<0.00001). According to our assessment, there was no significantly difference in postoperative efficacy. The pooled data indicated that ThuVaRP had a nearly efficacy to TURP and PKRP based on IPSS, QoL, Qmax, and PVR. Although ThuVaRP was associated with longer operation time, it got distinct superiority on serum hemoglobin decreased, catheterization time, and hospital stay.

Predictive factors for postoperative visual function of primary chronic rhegmatogenous retinal detachment after scleral buckling.

PubMed

Fang, Wei; Li, Jiu-Ke; Jin, Xiao-Hong; Dai, Yuan-Min; Li, Yu-Min

2016-01-01

To evaluate predictive factors for postoperative visual function of primary chronic rhegmatgenous retinal detachment (RRD) after sclera buckling (SB). Totally 48 patients (51 eyes) with primary chronic RRD were included in this prospective interventional clinical cases study, which underwent SB alone from June 2008 to December 2014. Age, sex, symptoms duration, detached extension, retinal hole position, size, type, fovea on/off, proliferative vitreoretinopathy (PVR), posterior vitreous detachment (PVD), baseline best corrected visual acuity (BCVA), operative duration, follow up duration, final BCVA were measured. Pearson correlation analysis, Spearman correlation analysis and multivariate linear stepwise regression were used to confirm predictive factors for better final visual acuity. Student's t-test, Wilcoxon two-sample test, Chi-square test and logistic stepwise regression were used to confirm predictive factors for better vision improvement. Baseline BCVA was 0.8313±0.6911 logMAR and final BCVA was 0.4761±0.4956 logMAR. Primary surgical success rate was 92.16% (47/51). Correlation analyses revealed shorter symptoms duration (r=0.3850, P=0.0053), less detached area (r=0.5489, P<0.0001), fovea (r=0.4605, P=0.0007), no PVR (r=0.3138, P=0.0250), better baseline BCVA (r=0.7291, P<0.0001), shorter operative duration (r=0.3233, P=0.0207) and longer follow up (r=-0.3358, P=0.0160) were related with better final BCVA, while independent predictive factors were better baseline BCVA [partial R-square (PR(2))=0.5316, P<0.0001], shorter symptoms duration (PR(2)=0.0609, P=0.0101), longer follow up duration (PR(2)=0.0278, P=0.0477) and shorter operative duration (PR(2)=0.0338, P=0.0350). Patients with vision improvement took up 49.02% (25/51). Univariate and multivariate analyses both revealed predictive factors for better vision improvement were better baseline vision [odds ratio (OR) =50.369, P=0.0041] and longer follow up duration (OR=1.144, P=0.0067). Independent predictive factors for better visual outcome of primary chronic RRD after SB are better baseline BCVA, shorter symptoms duration, shorter operative duration and longer follow up duration, while independent predictive factors for better vision improvement after operation are better baseline vision and longer follow up duration.

SU-C-BRE-04: Microbeam-Radiation-Therapy (MRT): Characterizing a Novel MRT Device Using High Resolution 3D Dosimetry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Q; Juang, T; Bache, S

2014-06-15

Purpose: The feasibility of MRT has recently been demonstrated utilizing a new technology of Carbon-Nano-Tube(CNT) field emission x-ray sources.This approach can deliver very high dose(10's of Gy) in narrow stripes(sub-mm) of radiation which enables the study of novel radiation treatment approaches. Here we investigate the application of highresolution (50um isotropic) PRESAGE/Optical-CT 3D dosimetry techniques to characterize the radiation delivered in this extremely dosimetrically challenging scenario. Methods: The CNT field emission x-ray source irradiator comprises of a linear cathode array and a novel collimator alignment system. This allows a precise delivery of high-energy small beams up to 160 kVp. A cylindricalmore » dosimeter (∼2.2cm in height ∼2.5cm in diameter) was irradiated by CNT MRT delivering 3 strips of radiation with a nominal entrance dose of 32 Gy.A second dosimeter was irradiated with similar entrance dose, with a regular x-ray irradiator collimated to microscopical strip-beams. 50um (isotropic) 3D dosimetry was performed using an in-house optical-CT system designed and optimized for high resolution imaging (including a stray light deconvolution correction).The percentage depth dose (PDD), peak-to-valley ratio (PVR) and beam width (FWHM) data were obtained and analyzed in both cases. Results: High resolution 3D images were successfully achieved with the prototype system, enabling extraction of PDD and dose profiles. The PDDs for the CNT irradiation showed pronounced attenuation, but less build-up effect than that from the multibeam irradiation. The beam spacing between the three strips has an average value of 0.9mm while that for the 13 strips is 1.5 mm at a depth of 16.5 mm. The stray light corrected image shows line profiles with reduced noise and consistent PVR values. Conclusion: MRT dosimetry is extremely challenging due to the ultra small fields involved.This preliminary application of a novel, ultra-high resolution, optical-CT 3D dosimetry system shows promise, but further work is required to validate and investigate accuracy and artifacts. This work was supported by NIH R01CA100835.« less

A depth-of-interaction PET detector using a stair-shaped reflector arrangement and a single-ended scintillation light readout.

PubMed

Son, Jeong-Whan; Lee, Min Sun; Lee, Jae Sung

2017-01-21

Positron emission tomography (PET) detectors with the ability to encode depth-of-interaction (DOI) information allow us to simultaneously improve the spatial resolution and sensitivity of PET scanners. In this study, we propose a DOI PET detector based on a stair-pattern reflector arrangement inserted between pixelated crystals and a single-ended scintillation light readout. The main advantage of the proposed method is its simplicity; DOI information is decoded from a flood map and the data can be simply acquired by using a single-ended readout system. Another potential advantage is that the two-step DOI detectors can provide the largest peak position distance in a flood map because two-dimensional peak positions can be evenly distributed. We conducted a Monte Carlo simulation and obtained flood maps. Then, we conducted experimental studies using two-step DOI arrays of 5  ×  5 Lu 1.9 Y 0.1 SiO 5 :Ce crystals with a cross-section of 1.7  ×  1.7 mm 2 and different detector configurations: an unpolished single-layer ( U S) array, a polished single-layer ( P S) array and a polished stacked two-layer ( P T) array. For each detector configuration, both air gaps and room-temperature vulcanization (RTV) silicone gaps were tested. Detectors U S and P T showed good peak separation in each scintillator with an average peak-to-valley ratio (PVR) and distance-to-width ratio (DWR) of 2.09 and 1.53, respectively. Detector P S RTV showed lower PVR and DWR (1.65 and 1.34, respectively). The configuration of detector P T Air is preferable for the construction of time-of-flight-DOI detectors because timing resolution was degraded by only about 40 ps compared with that of a non-DOI detector. The performance of detectors U S Air and P S RTV was lower than that of a non-DOI detector, and thus these designs are favorable when the manufacturing cost is more important than timing performance. The results demonstrate that the proposed DOI-encoding method is a promising candidate for PET scanners that require high resolution and sensitivity and operate with conventional acquisition systems.

Effects of Constant Flow vs. Constant Pressure Perfusion on Fluid Filtration in Severe Hypothermic Isolated Blood-Perfused Rat Lungs.

PubMed

Halsøy, Kathrine; Kondratiev, Timofey; Tveita, Torkjel; Bjertnaes, Lars J

2016-01-01

Victims of severe accidental hypothermia are prone to fluid extravasation but rarely develop lung edema. We hypothesize that combined hypothermia-induced increase in pulmonary vascular resistance (PVR) and a concomitant fall in cardiac output protect the lungs against edema development. Our aim was to explore in hypothermic-isolated blood-perfused rat lungs whether perfusion at constant pressure influences fluid filtration differently from perfusion at constant flow. Isolated blood-perfused rat lungs were hanging freely in a weight transducer for measuring weight changes (ΔW). Fluid filtration coefficient (Kfc), was determined by transiently elevating left atrial pressure (Pla) by 5.8 mmHg two times each during normothermia (37°C) and during hypothermia (15°C). The lung preparations were randomized to two groups. One group was perfused with constant flow (Constant flow group) and the other group with constant pulmonary artery pressure (Constant PPA group). Microvascular pressure (Pmv) was determined before and during elevation of Pla (ΔPmv) by means of the double occlusion technique. Kfc was calculated with the formula Kfc = ΔW/ΔPmv/min. All Kfc values were normalized to predicted lung weight (P LW ), which was based on body weight (BW) according to the formula: P LW  = 0.0053 BW - 0.48 and presented as Kfc PLW in mg/min/mmHg/g. At cessation, bronchoalveolar lavage (BAL) fluid/perfusate protein concentration (B/P) ratio was determined photometrically. Data were analyzed with parametric or non-parametric tests as appropriate. p  < 0.05 considered as significant. Perfusate flow remained constant in the Constant flow group, but was more than halved during hypothermia in the Constant PPA group concomitant with a more fold increase in PVR. In the Constant flow group, Kfc PLW and B/P ratio increased significantly by more than 10-fold during hypothermia concerted by visible signs of edema in the trachea. Hemoglobin and hematocrit increased within the Constant flow group and between the groups at cessation of the experiments. In hypothermic rat lungs perfused at constant flow, fluid filtration coefficient per gram P LW and B/P ratio increased more than 10-fold concerted by increased hemoconcentration, but the changes were less in hypothermic lungs perfused at constant PPA.

Effects of clinically relevant acute hypercapnic and metabolic acidosis on the cardiovascular system: an experimental porcine study

PubMed Central

2013-01-01

Introduction Hypercapnic acidosis (HCA) that accompanies lung-protective ventilation may be considered permissive (a tolerable side effect), or it may be therapeutic by itself. Cardiovascular effects may contribute to, or limit, the potential therapeutic impact of HCA; therefore, a complex physiological study was performed in healthy pigs to evaluate the systemic and organ-specific circulatory effects of HCA, and to compare them with those of metabolic (eucapnic) acidosis (MAC). Methods In anesthetized, mechanically ventilated and instrumented pigs, HCA was induced by increasing the inspired fraction of CO2 (n = 8) and MAC (n = 8) by the infusion of HCl, to reach an arterial plasma pH of 7.1. In the control group (n = 8), the normal plasma pH was maintained throughout the experiment. Hemodynamic parameters, including regional organ hemodynamics, blood gases, and electrocardiograms, were measured in vivo. Subsequently, isometric contractions and membrane potentials were recorded in vitro in the right ventricular trabeculae. Results HCA affected both the pulmonary (increase in mean pulmonary arterial pressure (MPAP) and pulmonary vascular resistance (PVR)) and systemic (increase in mean arterial pressure (MAP), decrease in systemic vascular resistance (SVR)) circulations. Although the renal perfusion remained unaffected by any type of acidosis, HCA increased carotid, portal, and, hence, total liver blood flow. MAC influenced the pulmonary circulation only (increase in MPAP and PVR). Both MAC and HCA reduced the stroke volume, which was compensated for by an increase in heart rate to maintain (MAC), or even increase (HCA), the cardiac output. The right ventricular stroke work per minute was increased by both MAC and HCA; however, the left ventricular stroke work was increased by HCA only. In vitro, the trabeculae from the control pigs and pigs with acidosis showed similar contraction force and action-potential duration (APD). Perfusion with an acidic solution decreased the contraction force, whereas APD was not influenced. Conclusions MAC preferentially affects the pulmonary circulation, whereas HCA affects the pulmonary, systemic, and regional circulations. The cardiac contractile function was reduced, but the cardiac output was maintained (MAC), or even increased (HCA). The increased ventricular stroke work per minute revealed an increased work demand placed by acidosis on the heart. PMID:24377654

Para-nitrobenzyl esterases with enhanced activity in aqueous and nonaqueous media

DOEpatents

Arnold, Frances H.; Moore, Jeffrey C.

1998-01-01

A method for isolating and identifying modified para-nitrobenzyl esterases which exhibit improved stability and/or esterase hydrolysis activity toward selected substrates and under selected reaction conditions relative to the unmodified para-nitrobenzyl esterase. The method involves preparing a library of modified para-nitrobenzyl esterase nucleic acid segments (genes) which have nucleotide sequences that differ from the nucleic acid segment which encodes for unmodified para-nitrobenzyl esterase. The library of modified para-nitrobenzyl nucleic acid segments is expressed to provide a plurality of modified enzymes. The clones expressing modified enzymes are then screened to identify which enzymes have improved esterase activity by measuring the ability of the enzymes to hydrolyze the selected substrate under the selected reaction conditions. Specific modified para-nitrobenzyl esterases are disclosed which have improved stability and/or ester hydrolysis activity in aqueous or aqueous-organic media relative to the stability and/or ester hydrolysis activity of unmodified naturally occurring para-nitrobenzyl esterase.

Para-nitrobenzyl esterases with enhanced activity in aqueous and nonaqueous media

DOEpatents

Arnold, Frances H.; Moore, Jeffrey C.

1999-01-01

A method for isolating and identifying modified para-nitrobenzyl esterases which exhibit improved stability and/or esterase hydrolysis activity toward selected substrates and under selected reaction conditions relative to the unmodified para-nitrobenzyl esterase. The method involves preparing a library of modified para-nitrobenzyl esterase nucleic acid segments (genes) which have nucleotide sequences that differ from the nucleic acid segment which encodes for unmodified para-nitrobenzyl esterase. The library of modified para-nitrobenzyl nucleic acid segments is expressed to provide a plurality of modified enzymes. The clones expressing modified enzymes are then screened to identify which enzymes have improved esterase activity by measuring the ability of the enzymes to hydrolyze the selected substrate under the selected reaction conditions. Specific modified para-nitrobenzyl esterases are disclosed which have improved stability and/or ester hydrolysis activity in aqueous or aqueous-organic media relative to the stability and/or ester hydrolysis activity of unmodified naturally occurring para-nitrobenzyl esterase.

40 CFR 721.10044 - Metal oxide, modified with alkyl and vinyl terminated polysiloxanes (generic).

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Metal oxide, modified with alkyl and... SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.10044 Metal oxide, modified with alkyl... to reporting. (1) The chemical substance identified generically as metal oxide, modified with alkyl...

40 CFR 721.8658 - Modified polymer of vinyl acetate and quaternary ammonium compound (generic).

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Modified polymer of vinyl acetate and... Significant New Uses for Specific Chemical Substances § 721.8658 Modified polymer of vinyl acetate and.... (1) The chemical substance identified generically as modified polymer of vinyl acetate and quaternary...

40 CFR 721.8658 - Modified polymer of vinyl acetate and quaternary ammonium compound (generic).

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Modified polymer of vinyl acetate and... Significant New Uses for Specific Chemical Substances § 721.8658 Modified polymer of vinyl acetate and.... (1) The chemical substance identified generically as modified polymer of vinyl acetate and quaternary...

40 CFR 721.8658 - Modified polymer of vinyl acetate and quaternary ammonium compound (generic).

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Modified polymer of vinyl acetate and... Significant New Uses for Specific Chemical Substances § 721.8658 Modified polymer of vinyl acetate and.... (1) The chemical substance identified generically as modified polymer of vinyl acetate and quaternary...

40 CFR 721.8658 - Modified polymer of vinyl acetate and quaternary ammonium compound (generic).

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Modified polymer of vinyl acetate and... Significant New Uses for Specific Chemical Substances § 721.8658 Modified polymer of vinyl acetate and.... (1) The chemical substance identified generically as modified polymer of vinyl acetate and quaternary...

40 CFR 721.8658 - Modified polymer of vinyl acetate and quaternary ammonium compound (generic).

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Modified polymer of vinyl acetate and... Significant New Uses for Specific Chemical Substances § 721.8658 Modified polymer of vinyl acetate and.... (1) The chemical substance identified generically as modified polymer of vinyl acetate and quaternary...

77 FR 20822 - Disease, Disability, and Injury Prevention and Control Special Emphasis Panel (SEP): Initial Review

Federal Register 2010, 2011, 2012, 2013, 2014

2012-04-06

... announced below concerns Identifying Modifiable Protective Factors for Intimate Partner Violence or Sexual Violence Perpetration, Funding Opportunity Announcement (FOA) CE12-003, Initial Review In accordance with... in response to ``Identifying Modifiable Protective Factors for Intimate Partner Violence or Sexual...

Computer simulated modeling of healthy and diseased right ventricular and pulmonary circulation.

PubMed

Chou, Jody; Rinehart, Joseph B

2018-01-12

We have previously developed a simulated cardiovascular physiology model for in-silico testing and validation of novel closed-loop controllers. To date, a detailed model of the right heart and pulmonary circulation was not needed, as previous controllers were not intended for use in patients with cardiac or pulmonary pathology. With new development of controllers for vasopressors, and looking forward, for combined vasopressor-fluid controllers, modeling of right-sided and pulmonary pathology is now relevant to further in-silico validation, so we aimed to expand our existing simulation platform to include these elements. Our hypothesis was that the completed platform could be tuned and stabilized such that the distributions of a randomized sample of simulated patients' baseline characteristics would be similar to reported population values. Our secondary outcomes were to further test the system in representing acute right heart failure and pulmonary artery hypertension. After development and tuning of the right-sided circulation, the model was validated against clinical data from multiple previously published articles. The model was considered 'tuned' when 100% of generated randomized patients converged to stability (steady, physiologically-plausible compartmental volumes, flows, and pressures) and 'valid' when the means for the model data in each health condition were contained within the standard deviations for the published data for the condition. A fully described right heart and pulmonary circulation model including non-linear pressure/volume relationships and pressure dependent flows was created over a 6-month span. The model was successfully tuned such that 100% of simulated patients converged into a steady state within 30 s. Simulation results in the healthy state for central venous volume (3350 ± 132 ml) pulmonary blood volume (405 ± 39 ml), pulmonary artery pressures (systolic 20.8 ± 4.1 mmHg and diastolic 9.4 ± 1.8 mmHg), left atrial pressure (4.6 ± 0.8 mmHg), PVR (1.0 ± 0.2 wood units), and CI (3.8 ± 0.5 l/min/m 2 ) all met criteria for acceptance of the model, though the standard deviations of LAP and CI were somewhat narrower than published comparators. The simulation results for right ventricular infarction also fell within the published ranges: pulmonary blood volume (727 ± 102 ml), pulmonary arterial pressures (30 ± 4 mmHg systolic, 12 ± 2 mmHg diastolic), left atrial pressure (13 ± 2 mmHg), PVR (1.6 ± 0.3 wood units), and CI (2.0 ± 0.4 l/min/m 2 ) all fell within one standard deviation of the reported population values and vice-versa. In the pulmonary hypertension model, pulmonary blood volume of 615 ± 90 ml, pulmonary arterial pressures of 80 ± 14 mmHg systolic, 36 ± 7 mmHg diastolic, and the left atrial pressure of 11 ± 2 mmHg all met criteria for acceptance. For CI, the simulated value of 2.8 ± 0.4 l/min/m 2 once again had a narrower spread than most of the published data, but fell inside of the SD of all published data, and the PVR value of 7.5 ± 1.6 wood units fell in the middle of the four published studies. The right-ventricular and pulmonary circulation simulation appears to be a reasonable approximation of the right-sided circulation for healthy physiology as well as the pathologic conditions tested.

Applied Genomics: Data Mining Reveals Species-Specific Malaria Diagnostic Targets More Sensitive than 18S rRNA▿†‡

PubMed Central

Demas, Allison; Oberstaller, Jenna; DeBarry, Jeremy; Lucchi, Naomi W.; Srinivasamoorthy, Ganesh; Sumari, Deborah; Kabanywanyi, Abdunoor M.; Villegas, Leopoldo; Escalante, Ananias A.; Kachur, S. Patrick; Barnwell, John W.; Peterson, David S.; Udhayakumar, Venkatachalam; Kissinger, Jessica C.

2011-01-01

Accurate and rapid diagnosis of malaria infections is crucial for implementing species-appropriate treatment and saving lives. Molecular diagnostic tools are the most accurate and sensitive method of detecting Plasmodium, differentiating between Plasmodium species, and detecting subclinical infections. Despite available whole-genome sequence data for Plasmodium falciparum and P. vivax, the majority of PCR-based methods still rely on the 18S rRNA gene targets. Historically, this gene has served as the best target for diagnostic assays. However, it is limited in its ability to detect mixed infections in multiplex assay platforms without the use of nested PCR. New diagnostic targets are needed. Ideal targets will be species specific, highly sensitive, and amenable to both single-step and multiplex PCRs. We have mined the genomes of P. falciparum and P. vivax to identify species-specific, repetitive sequences that serve as new PCR targets for the detection of malaria. We show that these targets (Pvr47 and Pfr364) exist in 14 to 41 copies and are more sensitive than 18S rRNA when utilized in a single-step PCR. Parasites are routinely detected at levels of 1 to 10 parasites/μl. The reaction can be multiplexed to detect both species in a single reaction. We have examined 7 P. falciparum strains and 91 P. falciparum clinical isolates from Tanzania and 10 P. vivax strains and 96 P. vivax clinical isolates from Venezuela, and we have verified a sensitivity and specificity of ∼100% for both targets compared with a nested 18S rRNA approach. We show that bioinformatics approaches can be successfully applied to identify novel diagnostic targets and improve molecular methods for pathogen detection. These novel targets provide a powerful alternative molecular diagnostic method for the detection of P. falciparum and P. vivax in conventional or multiplex PCR platforms. PMID:21525225

Neurogenic bladder findings in patients with Congenital Zika Syndrome: A novel condition

PubMed Central

Cruz, Glaura Nisya de Oliveira; Fontes, Juliana Marin; Saad Salles, Tania Regina Dias; Boechat, Marcia Cristina Bastos; Monteiro, Ana Carolina; Moreira, Maria Elizabeth Lopes

2018-01-01

Introduction Congenital Zika Syndrome (CZS) has been associated with microcephaly and other central nervous system abnormalities including areas that have been implicated in the control of the lower urinary tract. As such, this descriptive case series has aimed to investigate whether CZS is linked with neurogenic bladder. Identifying such an association is paramount in the effort to recognize CZS complications that have putative treatment options that could mitigate the impact of CZS in infected children. Methods Following IRB approval, urological assessment was performed in all patients referred to our clinic between June 2016 and May 2017 who presented with confirmed CZS-associated microcephaly. The research protocol consisted of obtaining clinical history, laboratory tests, lower and upper urinary tract ultrasounds, as well as a diagnostic urodynamic evaluation. ZIKA virus infection was previously confirmed by maternal history and positive PCR in babies and mothers. Microcephaly and other central nervous system abnormalities were established based on neurological assessment and associated imaging of the central nervous system (CT head and/or Brain MRI). Results Twenty-two consecutive CZS patients were tested and confirmed to have neurogenic bladder. Of the 22 patients assessed, 21 presented with an overactive bladder combined with reduced bladder capacity and elevated detrusor filling pressures. Clinically significant increases in postvoid residual (PVR) were confirmed in 40% of cases while a urinary tract infection (UTI) was identified in 23% of cases. Conclusion Neurogenic bladder, a known treatable health condition, was confirmed in 100% of patients tested in this study, most presenting with high-risk urodynamic patterns known to lead to renal damage when left untreated. Follow up studies are necessary to provide further insight onto long-term disease progression and to investigate the response to standard therapies for neurogenic bladder. Nonetheless, we emphasize the importance of proactive management of neurogenic bladder and prompt referral so as to help mitigate CZS disease burden for patients and their families. PMID:29494684

Neurogenic bladder findings in patients with Congenital Zika Syndrome: A novel condition.

PubMed

Costa Monteiro, Lucia Maria; Cruz, Glaura Nisya de Oliveira; Fontes, Juliana Marin; Saad Salles, Tania Regina Dias; Boechat, Marcia Cristina Bastos; Monteiro, Ana Carolina; Moreira, Maria Elizabeth Lopes

2018-01-01

Congenital Zika Syndrome (CZS) has been associated with microcephaly and other central nervous system abnormalities including areas that have been implicated in the control of the lower urinary tract. As such, this descriptive case series has aimed to investigate whether CZS is linked with neurogenic bladder. Identifying such an association is paramount in the effort to recognize CZS complications that have putative treatment options that could mitigate the impact of CZS in infected children. Following IRB approval, urological assessment was performed in all patients referred to our clinic between June 2016 and May 2017 who presented with confirmed CZS-associated microcephaly. The research protocol consisted of obtaining clinical history, laboratory tests, lower and upper urinary tract ultrasounds, as well as a diagnostic urodynamic evaluation. ZIKA virus infection was previously confirmed by maternal history and positive PCR in babies and mothers. Microcephaly and other central nervous system abnormalities were established based on neurological assessment and associated imaging of the central nervous system (CT head and/or Brain MRI). Twenty-two consecutive CZS patients were tested and confirmed to have neurogenic bladder. Of the 22 patients assessed, 21 presented with an overactive bladder combined with reduced bladder capacity and elevated detrusor filling pressures. Clinically significant increases in postvoid residual (PVR) were confirmed in 40% of cases while a urinary tract infection (UTI) was identified in 23% of cases. Neurogenic bladder, a known treatable health condition, was confirmed in 100% of patients tested in this study, most presenting with high-risk urodynamic patterns known to lead to renal damage when left untreated. Follow up studies are necessary to provide further insight onto long-term disease progression and to investigate the response to standard therapies for neurogenic bladder. Nonetheless, we emphasize the importance of proactive management of neurogenic bladder and prompt referral so as to help mitigate CZS disease burden for patients and their families.

Contemporary survival of patients with pulmonary arterial hypertension and congenital systemic to pulmonary shunts

PubMed Central

Chungsomprasong, Paweena; Bositthipichet, Densiri; Ketsara, Salisa; Titaram, Yuttapon; Chanthong, Prakul; Kanjanauthai, Supaluck

2018-01-01

Objective To compare survival of patients with newly diagnosed pulmonary arterial hypertension associated with congenital heart disease (PAH-CHD) according to various clinical classifications with classifications of anatomical-pathophysiological systemic to pulmonary shunts in a single-center cohort. Methods All prevalent cases of PAH-CHD with hemodynamic confirmation by cardiac catheterization in 1995–2015 were retrospectively reviewed. Patients who were younger than three months of age, or with single ventricle following surgery were excluded. Baseline characteristics and clinical outcomes were retrieved from the database. The survival analysis was performed at the end of 2016. Prognostic factors were identified using multivariate analysis. Results A total of 366 consecutive patients (24.5 ± 17.6 years of age, 40% male) with PAH-CHD were analyzed. Most had simple shunts (85 pre-tricuspid, 105 post-tricuspid, 102 combined shunts). Patients with pre-tricuspid shunts were significantly older at diagnosis in comparison to post-tricuspid, combined, and complex shunts. Clinical classifications identified patients as having Eisenmenger syndrome (ES, 26.8%), prevalent left to right shunt (66.7%), PAH with small defect (3%), or PAH following defect correction (3.5%). At follow-up (median = 5.9 years; 0.1–20.7 years), no statistically significant differences in survival rate were seen among the anatomical-pathophysiological shunts (p = 0.1). Conversely, the clinical classifications revealed that patients with PAH-small defect had inferior survival compared to patients with ES, PAH post-corrective surgery, or PAH with prevalent left to right shunt (p = 0.01). Significant mortality risks were functional class III, age < 10 years, PAH-small defect, elevated right atrial pressure > 15 mmHg, and baseline PVR > 8 WU•m.2 Conclusion Patients with PAH-CHD had a modest long-term survival. Different anatomical-pathophysiological shunts affect the natural presentation, while clinical classifications indicate treatment strategies and survival. Contemporary therapy improves survival in deliberately selected patients. PMID:29664959

Germ-line variants identified by next generation sequencing in a panel of estrogen and cancer associated genes correlate with poor clinical outcome in Lynch syndrome patients.

PubMed

Jóri, Balazs; Kamps, Rick; Xanthoulea, Sofia; Delvoux, Bert; Blok, Marinus J; Van de Vijver, Koen K; de Koning, Bart; Oei, Felicia Trups; Tops, Carli M; Speel, Ernst Jm; Kruitwagen, Roy F; Gomez-Garcia, Encarna B; Romano, Andrea

2015-12-01

The risk to develop colorectal and endometrial cancers among subjects testing positive for a pathogenic Lynch syndrome mutation varies, making the risk prediction difficult. Genetic risk modifiers alter the risk conferred by inherited Lynch syndrome mutations, and their identification can improve genetic counseling. We aimed at identifying rare genetic modifiers of the risk of Lynch syndrome endometrial cancer. A family based approach was used to assess the presence of genetic risk modifiers among 35 Lynch syndrome mutation carriers having either a poor clinical phenotype (early age of endometrial cancer diagnosis or multiple cancers) or a neutral clinical phenotype. Putative genetic risk modifiers were identified by Next Generation Sequencing among a panel of 154 genes involved in endometrial physiology and carcinogenesis. A simple pipeline, based on an allele frequency lower than 0.001 and on predicted non-conservative amino-acid substitutions returned 54 variants that were considered putative risk modifiers. The presence of two or more risk modifying variants in women carrying a pathogenic Lynch syndrome mutation was associated with a poor clinical phenotype. A gene-panel is proposed that comprehends genes that can carry variants with putative modifying effects on the risk of Lynch syndrome endometrial cancer. Validation in further studies is warranted before considering the possible use of this tool in genetic counseling.

21 CFR 177.1635 - Poly(p-methylstyrene) and rubber-modified poly(p-methyl-styrene).

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Poly(p-methylstyrene) and rubber-modified poly(p... Poly(p-methylstyrene) and rubber-modified poly(p-methyl-styrene). Poly(p-methylstyrene) and rubber-modified poly(p-methylstyrene) identified in this section may be safely used as components of articles...

21 CFR 177.1635 - Poly(p-methylstyrene) and rubber-modified poly(p-methyl-styrene).

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Poly(p-methylstyrene) and rubber-modified poly(p... Components of Single and Repeated Use Food Contact Surfaces § 177.1635 Poly(p-methylstyrene) and rubber-modified poly(p-methyl-styrene). Poly(p-methylstyrene) and rubber-modified poly(p-methylstyrene) identified...

21 CFR 177.1635 - Poly(p-methylstyrene) and rubber-modified poly(p-methyl-styrene).

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Poly(p-methylstyrene) and rubber-modified poly(p... Poly(p-methylstyrene) and rubber-modified poly(p-methyl-styrene). Poly(p-methylstyrene) and rubber-modified poly(p-methylstyrene) identified in this section may be safely used as components of articles...

40 CFR 721.6498 - Modified polyisocyanates (generic).

Code of Federal Regulations, 2010 CFR

2010-07-01

... SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.6498 Modified polyisocyanates (generic). (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as modified polyisocyanates (PMN P...

40 CFR 721.6498 - Modified polyisocyanates (generic).

Code of Federal Regulations, 2012 CFR

2012-07-01

... SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.6498 Modified polyisocyanates (generic). (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as modified polyisocyanates (PMN P...

40 CFR 721.6498 - Modified polyisocyanates (generic).

Code of Federal Regulations, 2011 CFR

2011-07-01

... SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.6498 Modified polyisocyanates (generic). (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as modified polyisocyanates (PMN P...

Para-nitrobenzyl esterases with enhanced activity in aqueous and nonaqueous media

DOEpatents

Arnold, F.H.; Moore, J.C.

1999-05-25

A method is disclosed for isolating and identifying modified para-nitrobenzyl esterases which exhibit improved stability and/or esterase hydrolysis activity toward selected substrates and under selected reaction conditions relative to the unmodified para-nitrobenzyl esterase. The method involves preparing a library of modified para-nitrobenzyl esterase nucleic acid segments (genes) which have nucleotide sequences that differ from the nucleic acid segment which encodes for unmodified para-nitrobenzyl esterase. The library of modified para-nitrobenzyl nucleic acid segments is expressed to provide a plurality of modified enzymes. The clones expressing modified enzymes are then screened to identify which enzymes have improved esterase activity by measuring the ability of the enzymes to hydrolyze the selected substrate under the selected reaction conditions. Specific modified para-nitrobenzyl esterases are disclosed which have improved stability and/or ester hydrolysis activity in aqueous or aqueous-organic media relative to the stability and/or ester hydrolysis activity of unmodified naturally occurring para-nitrobenzyl esterase. 43 figs.

Para-nitrobenzyl esterases with enhanced activity in aqueous and nonaqueous media

DOEpatents

Arnold, F.H.; Moore, J.C.

1998-04-21

A method is disclosed for isolating and identifying modified para-nitrobenzyl esterases. These enzymes exhibit improved stability and/or esterase hydrolysis activity toward selected substrates and under selected reaction conditions relative to the unmodified para-nitrobenzyl esterase. The method involves preparing a library of modified para-nitrobenzyl esterase nucleic acid segments (genes) which have nucleotide sequences that differ from the nucleic acid segment which encodes for unmodified para-nitrobenzyl esterase. The library of modified para-nitrobenzyl nucleic acid segments is expressed to provide a plurality of modified enzymes. The clones expressing modified enzymes are then screened to identify which enzymes have improved esterase activity by measuring the ability of the enzymes to hydrolyze the selected substrate under the selected reaction conditions. Specific modified para-nitrobenzyl esterases are disclosed which have improved stability and/or ester hydrolysis activity in aqueous or aqueous-organic media relative to the stability and/or ester hydrolysis activity of unmodified naturally occurring para-nitrobenzyl esterase. 43 figs.

Screening for Behavioral Health Issues in Children Enrolled in Massachusetts Medicaid

PubMed Central

Penfold, Robert; Arsenault, Lisa; Zhang, Fang; Murphy, Michael; Wissow, Larry

2014-01-01

OBJECTIVES: To understand mandated behavioral health (BH) screening in Massachusetts Medicaid including characteristics of screened children, predictors of positive screens, and whether screening identifies children without a previous BH history. METHODS: Massachusetts mandated BH screening in particularly among underidentified groups. 2008. Providers used a billing code and modifier to indicate a completed screen and whether a BH need was identified. Using MassHealth claims data, children with ≥300 days of eligibility in fiscal year (FY) 2009 were identified and categorized into groups based on first use of the modifier, screening code, or claim. Bivariate analyses were conducted to determine differences among groups. BH history was examined by limiting the sample to those continuously enrolled in FY 2008 and 2009. Multivariate logistic regression was used to determine predictors of positive screens. RESULTS: Of 355 490 eligible children, 46% had evidence of screening. Of those with modifiers, 12% were positive. Among continuously enrolled children (FY 2008 and FY 2009) with evidence of screening, 43% with positive modifiers had no BH history. This “newly identified” group were more likely to be female, younger, minority, and from rural residences (P < .0001). Among children with modifiers; gender (male), age (5–7), being in foster care, recent BH history, and Hispanic ethnicity predicted having a positive modifier. CONCLUSIONS: The high rate of newly identified Medicaid children with a BH need suggests that screening is performing well, particularly among underidentified groups. To better assess screening value, future work on cost-effectiveness and the impact on subsequent mental health treatment is needed. PMID:24298005

40 CFR 721.10149 - Carbon black, (3-methylphenyl)-modified, substituted (generic).

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Carbon black, (3-methylphenyl... Significant New Uses for Specific Chemical Substances § 721.10149 Carbon black, (3-methylphenyl)-modified... substance identified generically as carbon black, (3-methylphenyl)-modified, substituted (PMN P-07-522) is...

40 CFR 721.10150 - Carbon black, (4-methylphenyl)-modified, substituted (generic).

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Carbon black, (4-methylphenyl... Significant New Uses for Specific Chemical Substances § 721.10150 Carbon black, (4-methylphenyl)-modified... substance identified generically as carbon black, (4-methylphenyl)-modified, substituted (PMN P-07-523) is...

Modifiable predictors of depression following childhood maltreatment: a systematic review and meta-analysis

PubMed Central

Braithwaite, E C; O'Connor, R M; Degli-Esposti, M; Luke, N; Bowes, L

2017-01-01

Although maltreatment experiences in childhood increase the risk for depression, not all maltreated children become depressed. This review aims to systematically examine the existing literature to identify modifiable factors that increase vulnerability to, or act as a buffer against, depression, and could therefore inform the development of targeted interventions. Thirteen databases (including Medline, PsychINFO, SCOPUS) were searched (between 1984 and 2014) for prospective, longitudinal studies published in English that included at least 300 participants and assessed associations between childhood maltreatment and later depression. The study quality was assessed using an adapted Newcastle–Ottawa Scale checklist. Meta-analyses (random effects models) were performed on combined data to estimate the effect size of the association between maltreatment and depression. Meta-regressions were used to explore effects of study size and quality. We identified 22 eligible articles (N=12 210 participants), of which 6 examined potential modifiable predictors of depression following maltreatment. No more than two studies examined the same modifiable predictor; therefore, it was not possible to examine combined effects of modifiable predictors with meta-regression. It is thus difficult to draw firm conclusions from this study, but initial findings indicate that interpersonal relationships, cognitive vulnerabilities and behavioral difficulties may be modifiable predictors of depression following maltreatment. There is a lack of well-designed, prospective studies on modifiable predictors of depression following maltreatment. A small amount of initial research suggests that modifiable predictors of depression may be specific to maltreatment subtypes and gender. Corroboration and further investigation of causal mechanisms is required to identify novel targets for intervention, and to inform guidelines for the effective treatment of maltreated children. PMID:28675390

Neurocalcin Delta Suppression Protects against Spinal Muscular Atrophy in Humans and across Species by Restoring Impaired Endocytosis.

PubMed

Riessland, Markus; Kaczmarek, Anna; Schneider, Svenja; Swoboda, Kathryn J; Löhr, Heiko; Bradler, Cathleen; Grysko, Vanessa; Dimitriadi, Maria; Hosseinibarkooie, Seyyedmohsen; Torres-Benito, Laura; Peters, Miriam; Upadhyay, Aaradhita; Biglari, Nasim; Kröber, Sandra; Hölker, Irmgard; Garbes, Lutz; Gilissen, Christian; Hoischen, Alexander; Nürnberg, Gudrun; Nürnberg, Peter; Walter, Michael; Rigo, Frank; Bennett, C Frank; Kye, Min Jeong; Hart, Anne C; Hammerschmidt, Matthias; Kloppenburg, Peter; Wirth, Brunhilde

2017-02-02

Homozygous SMN1 loss causes spinal muscular atrophy (SMA), the most common lethal genetic childhood motor neuron disease. SMN1 encodes SMN, a ubiquitous housekeeping protein, which makes the primarily motor neuron-specific phenotype rather unexpected. SMA-affected individuals harbor low SMN expression from one to six SMN2 copies, which is insufficient to functionally compensate for SMN1 loss. However, rarely individuals with homozygous absence of SMN1 and only three to four SMN2 copies are fully asymptomatic, suggesting protection through genetic modifier(s). Previously, we identified plastin 3 (PLS3) overexpression as an SMA protective modifier in humans and showed that SMN deficit impairs endocytosis, which is rescued by elevated PLS3 levels. Here, we identify reduction of the neuronal calcium sensor Neurocalcin delta (NCALD) as a protective SMA modifier in five asymptomatic SMN1-deleted individuals carrying only four SMN2 copies. We demonstrate that NCALD is a Ca 2+ -dependent negative regulator of endocytosis, as NCALD knockdown improves endocytosis in SMA models and ameliorates pharmacologically induced endocytosis defects in zebrafish. Importantly, NCALD knockdown effectively ameliorates SMA-associated pathological defects across species, including worm, zebrafish, and mouse. In conclusion, our study identifies a previously unknown protective SMA modifier in humans, demonstrates modifier impact in three different SMA animal models, and suggests a potential combinatorial therapeutic strategy to efficiently treat SMA. Since both protective modifiers restore endocytosis, our results confirm that endocytosis is a major cellular mechanism perturbed in SMA and emphasize the power of protective modifiers for understanding disease mechanism and developing therapies. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Microbiota-Dependent Priming of Antiviral Intestinal Immunity in Drosophila.

PubMed

Sansone, Christine L; Cohen, Jonathan; Yasunaga, Ari; Xu, Jie; Osborn, Greg; Subramanian, Harry; Gold, Beth; Buchon, Nicolas; Cherry, Sara

2015-11-11

Enteric pathogens must overcome intestinal defenses to establish infection. In Drosophila, the ERK signaling pathway inhibits enteric virus infection. The intestinal microflora also impacts immunity but its role in enteric viral infection is unknown. Here we show that two signals are required to activate antiviral ERK signaling in the intestinal epithelium. One signal depends on recognition of peptidoglycan from the microbiota, particularly from the commensal Acetobacter pomorum, which primes the NF-kB-dependent induction of a secreted factor, Pvf2. However, the microbiota is not sufficient to induce this pathway; a second virus-initiated signaling event involving release of transcriptional paused genes mediated by the kinase Cdk9 is also required for Pvf2 production. Pvf2 stimulates antiviral immunity by binding to the receptor tyrosine kinase PVR, which is necessary and sufficient for intestinal ERK responses. These findings demonstrate that sensing of specific commensals primes inflammatory signaling required for epithelial responses that restrict enteric viral infections. Copyright © 2015 Elsevier Inc. All rights reserved.

Targeted delivery of non-viral vectors to cartilage in vivo using a chondrocyte-homing peptide identified by phage display.

PubMed

Pi, Yanbin; Zhang, Xin; Shi, Junjun; Zhu, Jinxian; Chen, Wenqing; Zhang, Chenguang; Gao, Weiwei; Zhou, Chunyan; Ao, Yingfang

2011-09-01

Gene therapy is a promising method for osteoarthritis and cartilage injury. However, specifically delivering target genes into chondrocytes is a great challenge because of their non-vascularity and the dense extracellular matrix of cartilage. In our study, we identified a chondrocyte-affinity peptide (CAP, DWRVIIPPRPSA) by phage display technology. Subsequent analysis suggests that the peptide can efficiently interact specifically with chondrocytes without any species specificity. Polyethylenimine (PEI) was covalently modified with CAP to construct a non-viral vector for cartilage-targeted therapy. To investigate the cartilage-targeting property of the CAP-modified vector, FITC-labeled CAP conjugated PEI/DNA particles were injected into rabbit knee joints, and visualized under confocal microscope. Higher concentrations of CAP-modified vector were detected in the cartilage and specifically taken up by chondrocytes compared with a randomly scrambled peptide (SP)-modified vector. To evaluate cartilage-targeting transfection efficiency, the GFP and luciferase genes were delivered into knee joints using CAP- and SP-modified PEI. Cartilage transfections mediated by CAP-modified PEI were much more efficient and specific than those by SP-modified PEI. This result suggests that CAP-modified PEI could be used as a specific cartilage-targeting vector for cartilage disorders. Copyright © 2011 Elsevier Ltd. All rights reserved.

A scoping review of epidemiologic risk factors for pediatric obesity: Implications for future childhood obesity and dental caries prevention research.

PubMed

Chi, Donald L; Luu, Monique; Chu, Frances

2017-06-01

What are the non-modifiable (socioeconomic, genetic) and modifiable factors (physical activity, dietary behaviors) related to childhood (under age 12) obesity? How can this knowledge be applied to oral health professionals' efforts to prevent or manage dental caries in children? Studies have identified risk factors for childhood obesity. The purpose of this scoping review was to develop a conceptual model to identify non-modifiable and modifiable risk factors for childhood obesity and to illustrate how these findings are relevant in developing interventions aimed at preventing obesity and dental caries in children. The authors searched PubMed and Embase and limited the study to English-language publications. A total of 2,572 studies were identified. After de-duplication, 2,479 studies remained and were downloaded into a citation-management tool. Two authors screened the titles and abstracts for relevance. Two hundred and sixty studies remained and were retrieved for a full-text review, and 80 studies were excluded, resulting in 180 studies included in the scoping review. An inductive content analytic methods was used to organize all statistically significant obesity risk factors into seven domains, which were classified as non-modifiable or modifiable; then a conceptual model of common risk factors associated with childhood obesity and dental caries was developed. Non-modifiable obesity risk factors include biological and developmental (e.g., genes, developmental conditions, puberty), sociodemographic and household (e.g., race/ethnicity, socioeconomic status, parent education, unemployment), cultural (e.g., degree of acculturation), and community (e.g., neighborhood composition). Modifiable risk factors included behavioral (e.g., diet, physical activity, weight), psychosocial (e.g., maternal stress, family functioning, parenting practices, child temperament), and medical (e.g., parent smoking, maternal health, child health). Identifying common risk factors has important implications for future oral health research aimed at preventing childhood obesity and dental caries. Epidemiologic knowledge gleaned from the literature can be used to develop rigorous interventions and programs aimed at preventing these highly prevalent diseases and improving health outcomes for children. © 2017 American Association of Public Health Dentistry.

Comparison of Helicopter Emergency Medical Services Transport Types and Delays on Patient Outcomes at Two Level I Trauma Centers.

PubMed

Nolan, Brodie; Tien, Homer; Sawadsky, Bruce; Rizoli, Sandro; McFarlan, Amanda; Phillips, Andrea; Ackery, Alun

2017-01-01

Helicopter emergency medical services (HEMS) have become an engrained component of trauma systems. In Ontario, transportation for trauma patients is through one of three ways: scene call, modified scene call, or interfacility transfer. We hypothesize that differences exist between these types of transports in both patient demographics and patient outcomes. This study compares the characteristics of patients transported by each of these methods to two level 1 trauma centers and assesses for any impact on morbidity or mortality. As a secondary outcome reasons for delay were identified. A local trauma registry was used to identify and abstract data for all patients transported to two trauma centers by HEMS over a 36-month period. Further chart abstraction using the HEMS patient care reports was done to identify causes of delay during HEMS transport. During the study period HEMS transferred a total of 911 patients of which 139 were scene calls, 333 were modified scene calls and 439 were interfacility transfers. Scene calls had more patients with an ISS of less than 15 and had more patients discharged home from the ED. Modified scene calls had more patients with an ISS greater than 25. The most common delays that were considered modifiable included the sending physician doing a procedure, waiting to meet a land EMS crew, delays for diagnostic imaging and confirming disposition or destination. Differences exist between the types of transports done by HEMS for trauma patients. Many identified reasons for delay to HEMS transport are modifiable and have practical solutions. Future research should focus on solutions to identified delays to HEMS transport. Key words: helicopter emergency medical services; trauma; prehospital care; delays.

Scoping review to identify potential non-antimicrobial interventions to mitigate antimicrobial resistance in commensal enteric bacteria in North American cattle production systems.

PubMed

Murphy, C P; Fajt, V R; Scott, H M; Foster, M J; Wickwire, P; McEwen, S A

2016-01-01

A scoping review was conducted to identify modifiable non-antimicrobial factors to reduce the occurrence of antimicrobial resistance in cattle populations. Searches were developed to retrieve peer-reviewed published studies in animal, human and in vitro microbial populations. Citations were retained when modifiable non-antimicrobial factors or interventions potentially associated with antimicrobial resistance were described. Studies described resistance in five bacterial genera, species or types, and 40 antimicrobials. Modifiable non-antimicrobial factors or interventions ranged widely in type, and the depth of evidence in animal populations was shallow. Specific associations between a factor or intervention with antimicrobial resistance in a population (e.g. associations between organic systems and tetracycline susceptibility in E. coli from cattle) were reported in a maximum of three studies. The identified non-antimicrobial factors or interventions were classified into 16 themes. Most reported associations between the non-antimicrobial modifiable factors or interventions and antimicrobial resistance were not statistically significant (P > 0·05 and a confidence interval including 1), but when significant, the results were not consistent in direction (increase or decrease in antimicrobial resistance) or magnitude. Research is needed to better understand the impacts of promising modifiable factors or interventions on the occurrence of antimicrobial resistance before any recommendations can be offered or adopted.

A comparative study of thulium laser resection of the prostate and bipolar transurethral plasmakinetic prostatectomy for treating benign prostatic hyperplasia.

PubMed

Peng, Bo; Wang, Guang-chun; Zheng, Jun-hua; Xia, Sheng-qiang; Geng, Jiang; Che, Jian-ping; Yan, Yang; Huang, Jian-hua; Xu, Yun-fei; Yang, Bin

2013-04-01

WHAT'S KNOWN ON THE SUBJECT? AND WHAT DOES THE STUDY ADD?: Thulium laser is a new generation of surgical laser. It is a minimally invasive technology with several advantages, including rapid vaporization and minimal tissue damage and bleeding. However, details regarding the safety and efficacy of thulium laser in treating BPH remains unknown. We performed a comparative study in 100 patients with BPH of the safety and efficacy of thulium laser resection of the prostate (TMLRP, n = 50) and bipolar transurethral plasmakinetic prostatectomy (TUPKP, n = 50). We found that the efficacy and indications were the same in TMLRP and TUPKP. In TUPKP, the morbidity of urethrostenosis was low, and was nearly bloodless in surgery and had higher safety. Nevertheless, TUPKP is more suitable for patients with larger prostate volume. To compare the safety and short-term efficacy of thulium laser resection of the prostate (TMLRP) and bipolar transurethral plasmakinetic prostatectomy (TUPKP) for the treatment of patients with benign prostatic hyperplasia (BPH). A total of 100 patients diagnosed with BPH were randomly divided into two groups, treated with either TMLRP (50, group 1) or TUPKP (50, group 2). There was no significant difference in preoperative variables such as age, prostate volume, prostate-specific antigen (PSA) level, International Prostate Symptom Score (IPSS), maximum urinary flow rate (Qmax ) and postvoid residual urine volume (PVR) between the two groups. The perioperative parameters and therapeutic effects were recorded and compared between the two groups. There were significant differences in the following parameters between the two groups (TMLRP vs TUPKP [mean ± SD]): operation duration, 61.2 ± 24.2 vs 30.14 ± 15.9 min; catheterization time, 1.8 ± 0.4 vs 3.2 ± 0.6 d; postoperative hospital stay, 3.3 ± 0.8 vs 4.1 ± 1.3 d. The volume of blood loss and postoperative bladder irrigation were significantly lower in TMLRP group than in the TUPKP group. At 1 month after the operation, there were four cases of urethral stricture in the TUPKP group. At 3 months after the operation, IPSS, quality of life (QoL), Qmax and PVR were significantly improved, with no significant difference between the two groups. TMLRP is superior to TUPKP in terms of safety, blood loss, recovery time and complication rate, and is as efficacious as TUPKP for treating BPH. Operation duration was significantly longer in the TMLRP group than in the TUPKP group. © 2012 BJU International.

The effectiveness of transcutaneous electrical neural stimulation therapy in patients with urinary incontinence resistant to initial medical treatment or biofeedback.

PubMed

Tugtepe, H; Thomas, D T; Ergun, R; Kalyoncu, A; Kaynak, A; Kastarli, C; Dagli, T E

2015-06-01

While there are many options for children with treatment refractory urinary incontinence, there is no single accepted method. This study's aim was to prospectively evaluate the effect of transcutaneous electrical nerve stimulation in children with urinary incontinence resistant to standard medical, urological therapy and/or biofeedback. This study was performed at a university hospital. For inclusion, patients >5 years of age first underwent evaluation with urinary ultrasonography, uroflow-electromyogram and voiding diaries. Treatment with biofeedback, alpha adrenergic blockers, anticholinergics and/or urotherapy was commenced according to uroflow-EMG and voiding diary findings. Patients with partial or no response to this standard therapy were then included in this study, performed between April 2012 and February 2014. Patients with anatomical or neurological causes for urinary incontinence were excluded. TENS was performed on S3 dermatome, every day for 3 months. Each session lasted 20 min with a frequency of 10 Hz and generated pulse of 350 μs. Intensity was determined by the child's sensitivity threshold. Medical treatment and urological therapy was continued during TENS. Uroflow parameters (voiding volume as percentage of expected bladder capacity, Qmax, Qave, flow and voiding time, postvoiding residual urine) and urinary system symptoms (presence of urinary tract infection, frequency, urge incontinence, fractionated voiding and constipation) were compared immediately before commencement and immediately after the completion of 3 months of TENS. Twenty-seven patients were included in this study (4 males, 23 females). Patients' average age was 7.2 years, 11 had overactive bladder and 16 had dysfunctional voiding. Comparison of urinary system symptoms and uroflow parameters before and after TENS are shown in Table. After 3 months of TENS; a statistically significant decrease was observed in the number of patients with frequency, urge incontinence, urinary tract infections and constipation. There was a decrease in the number of patients with fractionated voiding, although this change was not statistically significant. Similarly, for uroflow-EMG parameters; bladder capacity, Qmax, Qave and flow time increased while voiding time and PVR decreased. Changes seen in bladder capacity, Qmax and PVR were statically significant, while other changes were not. Patients' response rates after 3 months of TENS were; complete response in 70.4%, partial response in 22.2% and no response in 7.4%. This study has shown that transcutaneous electrical nerve stimulation is a promising treatment option for standard-treatment refractory children with urinary incontinence. Copyright © 2015 Journal of Pediatric Urology Company. Published by Elsevier Ltd. All rights reserved.

Nonhomologous recombination between defective poliovirus and coxsackievirus genomes suggests a new model of genetic plasticity for picornaviruses.

PubMed

Holmblat, Barbara; Jégouic, Sophie; Muslin, Claire; Blondel, Bruno; Joffret, Marie-Line; Delpeyroux, Francis

2014-08-05

Most of the circulating vaccine-derived polioviruses (cVDPVs) implicated in poliomyelitis outbreaks in Madagascar have been shown to be recombinants between the type 2 poliovirus (PV) strain of the oral polio vaccine (Sabin 2) and another species C human enterovirus (HEV-C), such as type 17 coxsackie A virus (CA17) in particular. We studied intertypic genetic exchanges between PV and non-PV HEV-C by developing a recombination model, making it possible to rescue defective type 2 PV RNA genomes with a short deletion at the 3' end by the cotransfection of cells with defective or infectious CA17 RNAs. We isolated over 200 different PV/CA17 recombinants, using murine cells expressing the human PV receptor (PVR) and selecting viruses with PV capsids. We found some homologous (H) recombinants and, mostly, nonhomologous (NH) recombinants presenting duplications of parental sequences preferentially located in the regions encoding proteins 2A, 2B, and 3A. Short duplications appeared to be stable, whereas longer duplications were excised during passaging in cultured cells or after multiplication in PVR-transgenic mice, generating H recombinants with diverse sites of recombination. This suggests that NH recombination events may be a transient, intermediate step in the generation and selection of the fittest H recombinants. In addition to the classical copy-choice mechanism of recombination thought to generate mostly H recombinants, there may also be a modular mechanism of recombination, involving NH recombinant precursors, shaping the genomes of recombinant enteroviruses and other picornaviruses. Importance: The multiplication of circulating vaccine-derived polioviruses (cVDPVs) in poorly immunized human populations can render these viruses pathogenic, causing poliomyelitis outbreaks. Most cVDPVs are intertypic recombinants between a poliovirus (PV) strain and another human enterovirus, such as type 17 coxsackie A viruses (CA17). For further studies of the genetic exchanges between PV and CA17, we have developed a model of recombination, making it possible to rescue defective PV RNA genomes with a short deletion by cotransfecting cells with the defective PV genome and CA17 genomic RNA. Numerous recombinants were found, including homologous PV/CA17 recombinants, but mostly nonhomologous recombinants presenting duplications of parental sequences preferentially located in particular regions. Long duplications were excised by passages in cultured cells or in mice, generating diverse homologous recombinants. Recombination leading to nonhomologous recombinants, which evolve into homologous recombinants, may therefore be seen as a model of genetic plasticity in enteroviruses and, possibly, in other RNA viruses. Copyright © 2014 Holmblat et al.

Wnt/B-Catenin Signaling is Required to Rescue Midbrain Dopaminergic Progenitors and Promote Neurorepair in Ageing Mouse Model of Parkinson’s Disease

PubMed Central

L’Episcopo, Francesca; Tirolo, Cataldo; Testa, Nunzio; Caniglia, Salvatore; Morale, Maria Concetta; Serapide, Maria Francesca; Pluchino, Stefano; Marchetti, Bianca

2014-01-01

SUMMARY Wnt/β-catenin signaling is required for specification and neurogenesis of midbrain dopaminergic (mDA) neurons, the pivotal neuronal population that degenerates in Parkinson’s disease (PD) and in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model of PD. Wnt/β-catenin signaling plays a vital role in adult neurogenesis but whether it might engage DA neurogenesis/neurorepair in the affected PD brain is yet unresolved. Recently, the adult midbrain aqueduct periventricular regions (Aq-PVRs) were shown to harbor neural stem/progenitor cells (mNPCs) with DA potential in vitro, but restrictive mechanisms in vivo are believed to limit their DA regenerative capacity. Using in vitro mNPC culture systems we herein demonstrate that aging is one most critical factor restricting mNPC neurogenic potential via dysregulation of Wnt/β-catenin signaling. Cococulture paradigms between young/aged (Y/A) mNPCs and Y/A astrocytes identified glial age and a decline of glial-derived factors including Wnts as key determinants of impaired neurogenic potential, whereas Wnt activation regimens efficiently reversed the diminished proliferative, neuronal and DA differentiation potential of A-mNPCs. Next, in vivo studies in wild (Wt) and transgenic β-catenin reporter mice uncovered Wnt/β-catenin signaling activation and remarkable astrocyte remodeling of Aq-PVR in response to MPTP-induced DA neuron death. Spatio-temporal analyses unveiled β-catenin signaling in predopaminergic (Nurr1+/TH−) and imperiled or rescuing DAT+ neurons during MPTP-induced DA neuron injury and self-repair. Aging inhibited Wnt signaling, whereas β-catenin activation in situ with a specific GSK-3β antagonist promoted a significant degree of DA neurorestoration associated with reversal of motor deficit, with implications for neurorestorative approaches in PD. PMID:24648001

Urinary tract abnormalities in boys with recurrent urinary tract infections after hypospadias repair.

PubMed

Wehbi, Elias; Patel, Premal; Kanaroglou, Niki; Tam, Stephanie; Weber, Bryce; Lorenzo, Armando; Pippi Salle, Joao Luiz; Bagli, Darius; Koyle, Martin; Farhat, Walid A

2014-02-01

To examine the development of recurrent urinary tract infections (UTIs) in boys who have undergone hypospadias repair. We retrospectively reviewed the records of all boys who had recurrent UTIs after primary or redo tubularized incised plate (TIP) or transverse island flap (TVIF) repairs, between 1998 and 2009. Data on age, operating details, postoperative complications and imaging studies were collected. We attempted to identify risk factors for recurrent UTIs after hypospadias repair. During the study period, 43/2249 boys (1.91%) were diagnosed with recurrent UTIs after hypospadias repair. The boys' mean (range) age at repair was 14 (6-24) months and the median (range) follow-up was 6.5 (1.5-11) years. Primary TIP and TVIF were performed in 47% (20/43) and 35% (15/43) of the boys, respectively. Redo surgeries were performed in 18% of the boys (8/43). The initial meatal location was proximal in all TVIF and redo repairs, and in one of the TIP repairs. Postoperative voiding cysto-urethrography, ultrasonography and dimercapto-succinic acid (DMSA) scans were performed in 58% (25/43), 90% (39/43) and 19% (8/43) of the boys, respectively. Abnormalities were noted. Of those boys who underwent a TVIF repair, urethral diverticula were seen in 47% (7/15) and urethral fistulae were also seen in 47% (7/15). Conversely, in those who had a TIP repair, an elevated PVR and vesico-ureteric reflux were more common; they were found in 40% (8/20) and 50% (10/20) of patients, respectively. The pathophysiology of recurrent UTI is multifactorial, but postoperative complications seem to vary with type of procedure. Recurrent UTIs after hypospadias surgery should prompt a specific assessment for potentially functionally relevant and correctable anatomical abnormalities. © 2013 The Authors. BJU International © 2013 BJU International.

Systematic review and meta-analysis on phosphodiesterase 5 inhibitors and α-adrenoceptor antagonists used alone or combined for treatment of LUTS due to BPH

PubMed Central

Wang, Xing-Huan; Wang, Xiao; Shi, Ming-Jun; Li, Sheng; Liu, Tao; Zhang, Xin-Hua

2015-01-01

The aim of this systematic review is to determine the comparative effectiveness and safety of phosphodiesterase 5 inhibitors (PDE5-Is) and α-blockers used alone or combined for the treatment of lower urinary tract symptoms (LUTS) due to benign prostatic hyperplasia (BPH). An electronic search of PubMed, Cochrane Library and Embase up to January 2014 was performed to identify randomized controlled trials comparing the efficacy and safety of PDE5-Is and α-blockers for treatment of lower urinary tract symptoms due to benign prostatic hyperplasia, which assessed IPSS score, maximum flow rate, postvoided residual urine, quality of life and Erectile Function (IIEF) score as outcomes. Data were analyzed by fixed or random effect models using Cochrane Collaboration review manager software. A total of 12 studies were included. Our novel data demonstrated that there was a trend that α-blockers were more efficacious than PDE5-Is on decreasing IPSS score and increasing maximum flow rate. α-blockers were significantly more effective than PDE5-Is on reduction of postvoided residual urine with a mean difference of 3.67 (95% CI 1.56 to 5.77, P = 0.0006) and PDE5-Is showed greater effect than α-blockers on increasing IIEF score with a mean difference of 9.82 (95% CI 3.80 to 15.85, P = 0.001). In conclusion, our novel data demonstrated that PDE5-Is plus ABs ranked the highest on the improvement of LUTS/BPH. PDE5-Is monotherapy was also effective in this kind of disorder except less reduction of PVR than ABs. In addition, both combined- or mono-therapy were safe. PMID:25994648

A screen for E3 ubiquitination ligases that genetically interact with the adaptor protein Cindr during Drosophila eye patterning

PubMed Central

Ketosugbo, Kwami F.; Bushnell, Henry L.

2017-01-01

Ubiquitination is a crucial post-translational modification that can target proteins for degradation. The E3 ubiquitin ligases are responsible for recognizing substrate proteins for ubiquitination, hence providing specificity to the process of protein degradation. Here, we describe a genetic modifier screen that identified E3 ligases that modified the rough-eye phenotype generated by expression of cindrRNAi transgenes during Drosophila eye development. In total, we identified 36 E3 ligases, as well as 4 Cullins, that modified the mild cindrRNA mis-patterning phenotype. This indicates possible roles for these E3s/Cullins in processes that require Cindr function, including cytoskeletal regulation, cell adhesion, cell signaling and cell survival. Three E3 ligases identified in our screen had previously been linked to regulating JNK signaling. PMID:29117266

Unintended Effects in Genetically Modified Food/Feed Safety: A Way Forward.

PubMed

Fernandez, Antonio; Paoletti, Claudia

2018-04-20

Identifying and assessing unintended effects in genetically modified food and feed are considered paramount by the Food and Agricultural Organization (FAO), World Health Organization (WHO), and Codex Alimentarius, despite heated debate. This paper addresses outstanding needs: building consensus on the history-of-safe-use concept, harmonizing criteria to select appropriate conventional counterparts, and improving endpoint selection to identify unintended effects. Copyright © 2018 Elsevier Ltd. All rights reserved.

Participation in modified sports programs: a longitudinal study of children's transition to club sport competition.

PubMed

Eime, Rochelle M; Casey, Meghan M; Harvey, Jack T; Charity, Melanie J; Young, Janet A; Payne, Warren R

2015-07-14

Many children are not physically active enough for a health benefit. One avenue of physical activity is modified sport programs, designed as an introduction to sport for young children. This longitudinal study identified trends in participation among children aged 4-12 years. Outcomes included continuation in the modified sports program, withdrawal from the program or transition to club sport competition. De-identified data on participant membership registrations in three popular sports in the Australian state of Victoria were obtained from each sport's state governing body over a 4-year period (2009-2012 for Sport A and 2010-2013 for Sports B and C). From the membership registrations, those who were enrolled in a modified sports program in the first year were tracked over the subsequent three years and classified as one of: transition (member transitioned from a modified sport program to a club competition); continue (member continued participation in a modified sport program; or withdraw (member discontinued a modified program and did not transition to club competition). Many modified sports participants were very young, especially males aged 4-6 years. More children withdrew from their modified sport program rather than transitioning. There were age differences between when boys and girls started, withdrew and transitioned from the modified sports programs. If we can retain children in sport it is likely to be beneficial for their health. This study highlights considerations for the development and implementation of sport policies and programming to ensure lifelong participation is encouraged for both males and females.

Identification of ubiquitin/ubiquitin-like protein modification from tandem mass spectra with various PTMs

PubMed Central

2011-01-01

Background Various solutions have been introduced for the identification of post-translational modification (PTM) from tandem mass spectrometry (MS/MS) in proteomics field but the identification of peptide modifiers, such as Ubiquitin (Ub) and ubiquitin-like proteins (Ubls), is still a challenge. The fragmentation of peptide modifier produce complex shifted ion mass patterns in combination with other PTMs, which makes it difficult to identify and locate the PTMs on a protein sequence. Currently, most PTM identification methods do not consider the complex fragmentation of peptide modifier or deals it separately from the other PTMs. Results We developed an advanced PTM identification method that inspects possible ion patterns of the most known peptide modifiers as well as other known biological and chemical PTMs to make more comprehensive and accurate conclusion. The proposed method searches all detectable mass differences of measured peaks from their theoretical values and the mass differences within mass tolerance range are grouped as mass shift classes. The most possible locations of multiple PTMs including peptide modifiers can be determined by evaluating all possible scenarios generated by the combination of the qualified mass shift classes.The proposed method showed excellent performance in the test with simulated spectra having various PTMs including peptide modifiers and in the comparison with recently developed methods such as QuickMod and SUMmOn. In the analysis of HUPO Brain Proteome Project (BPP) datasets, the proposed method could find the ubiquitin modification sites that were not identified by other conventional methods. Conclusions This work presents a novel method for identifying bothpeptide modifiers that generate complex fragmentation patternsand PTMs that are not fragmented during fragmentation processfrom tandem mass spectra. PMID:22373085

Fitness trade-offs modify community composition under contrasting disturbance regimes in Pseudomonas fluorescens microcosms.

PubMed

Engelmoer, Daniel J P; Rozen, Daniel E

2009-11-01

Disturbance is thought to be a major factor influencing patterns of biodiversity. In addition, disturbance can modify community composition if there are species specific trade-offs between fitness and disturbance tolerance. Here, we examine the role of disturbance on the evolution of coexisting biofilm-forming morphotypes of Pseudomonas fluorescens maintained in spatially structured laboratory microcosms. We identified four heritably stable ecotypes that varied significantly in their competitiveness under different disturbance treatments. Furthermore, we identified significant trade-offs in competitiveness across disturbance treatments for three of four of these ecotypes. These trade-offs modified dominance relationships between strains and thus altered community composition, with a peak of ecotype diversity occurring at intermediate disturbance frequencies.

Detection of polymer modifiers in asphalt binder.

DOT National Transportation Integrated Search

2006-01-01

This study addressed the evaluation of alternative test methods to identify the presence of polymer modifiers in performance-graded binders for the purpose of quality assurance. A method of identification is presented in AASHTO T302, Polymer Content ...

Longitudinal hemodynamics in acute phase of treatment with labetalol in hypertensive pregnant women to predict need for vasodilatory therapy.

PubMed

Stott, D; Bolten, M; Paraschiv, D; Papastefanou, I; Chambers, J B; Kametas, N A

2017-01-01

Hypertensive pregnant women who do not respond to treatment with labetalol to control blood pressure (BP), but require vasodilatory therapy, progress rapidly to severe hypertension. This could be delayed by early recognition and individualized treatment. In this study, we sought to create prediction models from data at presentation and at 1 h and 24 h after commencement of treatment to identify patients who will not have a sustained response to labetalol and therefore need vasodilatory therapy. The study population comprised 134 women presenting with hypertension at a UK hospital. Treatment with oral labetalol was administered when BP was > 150/100 mmHg or > 140/90 mmHg with systemic disease. BP and hemodynamic parameters were recorded at presentation and at 1 h and 24 h after commencement of treatment. Labetalol doses were titrated to maintain BP around 135/85 mmHg. Women with unresponsive BP, despite labetalol dose maximization (2400 mg/day), received additional vasodilatory therapy with nifedipine. Binary logistic and longitudinal (mixed-model) data analyses were performed to create prediction models anticipating the likelihood of hypertensive women needing vasodilatory therapy. The prediction models were created from data at presentation and at 1 h and 24 h after treatment, to assess the value of central hemodynamics relative to the predictive power of BP, heart rate and demographic variables at these intervals. Twenty-two percent of our cohort required additional vasodilatory therapy antenatally. These women had higher rates of severe hypertension and delivered smaller babies at earlier gestational ages. The unresponsive women were more likely to be of black ethnicity, had higher BP and peripheral vascular resistance (PVR), and lower heart rate and cardiac output (CO) at presentation. Those who needed vasodilatory therapy showed an initial decrease in BP and PVR, which rebounded at 24 h, whereas BP and PVR in those who responded to labetalol showed a sustained decrease at 1 h and 24 h. Stroke volume and CO did not decrease during the acute phase of treatment in either group. The best model for prediction of the need for vasodilators was provided at 24 h by combining ethnicity and longitudinal BP and heart rate changes. The model achieved a detection rate of 100% for a false-positive rate of 20% and an area under the receiver-operating characteristics curve of 0.97. Maternal demographics and hemodynamic changes in the acute phase of labetalol monotherapy provide a powerful tool to identify hypertensive pregnant patients who are unlikely to have their BP controlled by this therapy and will consequently need additional vasodilatory therapy. Copyright © 2016 ISUOG. Published by John Wiley & Sons Ltd. Las embarazadas hipertensas que no responden al tratamiento con labetalol para el control de la presión arterial (PA), pero que requieren terapia vasodilatadora, evolucionan rápidamente hacia una hipertensión severa. Ésta se puede retrasar mediante un diagnóstico precoz y un tratamiento individual. En este estudio se ha tratado de crear modelos de predicción a partir de datos al inicio del tratamiento y al cabo de 1 hora y de 24 horas después del mismo, para identificar a las pacientes que no mostrarán una respuesta constante al labetalol y que por lo tanto necesitarán terapia vasodilatadora. MÉTODOS: La población de estudio incluyó 134 mujeres con hipertensión en un hospital del Reino Unido. El tratamiento con labetalol por vía oral se administró cuando la PA fue >150/100 mm de Hg o >140/90 mm de Hg con enfermedad multisistémica. Se registró la PA y los parámetros hemodinámicos tanto al inicio como al cabo de 1 h y de 24 h después del inicio del tratamiento. Las dosis de Labetalol se ajustaron para mantener la PA en torno a los 135/85 mm de Hg. Las mujeres cuya PA no produjo respuesta, a pesar de haberles administrado la dosis máxima de labetalol (2400 mg/día), recibieron terapia vasodilatadora adicional con nifedipino. Se realizaron análisis de datos mediante logística binaria y longitudinal (modelo mixto), para crear modelos de predicción con los que pronosticar la probabilidad de la necesidad de terapia vasodilatadora en mujeres hipertensas. Los modelos de predicción se crearon a partir de datos al inicio y al cabo de 1 hora y 24 horas del tratamiento, para evaluar el valor de los parámetros hemodinámicos principales con respecto a la capacidad predictiva de la PA, la frecuencia cardíaca y las variables demográficas en estos intervalos. El 22 % de la cohorte necesitó terapia vasodilatadora adicional antes del parto. Estas mujeres tuvieron tasas más altas de hipertensión grave y neonatos más pequeños en edades gestacionales más tempranas. Las mujeres que no respondieron al tratamiento fueron con más frecuencia de raza negra, tuvieron la PA y la resistencia vascular periférica (RVP) más alta, y la frecuencia cardíaca y el gasto cardíaco (GC) más bajos al inicio del tratamiento. Aquellas que necesitaron terapia vasodilatadora mostraron un descenso inicial de la PA y la RVP, que se recuperó al cabo de 24 h, mientras que la PA y la RVP en las que respondieron al labetalol mostraron una disminución constante al cabo de 1 h y de 24 h. El volumen sistólico y el GC no disminuyeron durante la fase aguda del tratamiento en ninguno de los grupos. El mejor modelo para la predicción de la necesidad de vasodilatadores se obtuvo a las 24 h mediante la combinación de la etnia con los cambios longitudinales de la PA y la frecuencia cardíaca. El modelo alcanzó una tasa de detección del 100% para una tasa de falsos positivos del 20% y un área bajo la curva de características operativas del receptor de 0,97. CONCLUSIÓN: Los datos demográficos maternos y los cambios hemodinámicos en la fase aguda de la monoterapia con labetalol constituyen una herramienta poderosa para identificar a las pacientes embarazadas hipertensas con pocas probabilidades de que se les pueda controlar su PA mediante esta terapia y que por lo tanto necesitarán terapia vasodilatadora adicional. : 、(blood pressure,BP),。。,1 h24 h,。 : 134。BP>150/100 mmHgBP>140/90 mmHg。1 h24 hBP。,BP135/85 mmHg。BP,()。logistic(),。1 h24 h,,BP、。 : 22%。。,BP(peripheral vascular resistance,PVR),(cardiac output,CO)。BPPVR,24 h,1 h24 hBPPVR。CO。24hBP。100%,20%,0.97。 : ,BP。. Copyright © 2016 ISUOG. Published by John Wiley & Sons Ltd.

Inhibition of Comt with tolcapone slows progression of polycystic kidney disease in the more severely affected PKD/Mhm (cy/+) substrain of the Hannover Sprague-Dawley rat

PubMed Central

Boehn, Susanne N.E.; Spahn, Sonja; Neudecker, Sabine; Keppler, Andrea; Bihoreau, Marie-Thérèse; Kränzlin, Bettina; Pandey, Priyanka; Hoffmann, Sigrid C.; Li, Li; Torres, Vicente E.; Gröne, Hermann-Josef; Gretz, Norbert

2013-01-01

Background Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common human inherited diseases. Modifier genes seem to modulate the disease progression and might therefore be promising drug targets. Although a number of modifier loci have been already identified, no modifier gene has been proven to be a real modifier yet. Methods Gene expression profiling of two substrains of the Han:SPRD rat, namely PKD/Mhm and PKD/US, both harboring the same mutation, was conducted in 36-day-old animals. Catechol-O-methyltransferase (Comt) was identified as a potential modifier gene. A 3-month treatment with tolcapone, a selective inhibitor of Comt, was carried out in PKD/Mhm and PKD/US (cy/+) animals. Results Comt is localized within a known modifier locus of PKD (MOP2). The enzyme encoding gene was found upregulated in the more severely affected PKD/Mhm substrain and was hence presumed to be a putative modifier gene of PKD. The treatment with tolcapone markedly attenuated the loss of renal function, inhibited renal enlargement, shifted the size distribution of renal cysts and retarded cell proliferation, apoptosis, inflammation and fibrosis development in affected (cy/+) male and female PKD/Mhm and PKD/US rats. Conclusions Comt has been confirmed to be the first reported modifier gene for PKD and tolcapone offers a promising drug for treating PKD. PMID:23543593

Functional genomic screen and network analysis reveal novel modifiers of tauopathy dissociated from tau phosphorylation

PubMed Central

Ambegaokar, Surendra S.; Jackson, George R.

2011-01-01

A functional genetic screen using loss-of-function and gain-of-function alleles was performed to identify modifiers of tau-induced neurotoxicity using the 2N/4R (full-length) isoform of wild-type human tau expressed in the fly retina. We previously reported eye pigment mutations, which create dysfunctional lysosomes, as potent modifiers; here, we report 37 additional genes identified from ∼1900 genes screened, including the kinases shaggy/GSK-3beta, par-1/MARK, CamKI and Mekk1. Tau acts synergistically with Mekk1 and p38 to down-regulate extracellular regulated kinase activity, with a corresponding decrease in AT8 immunoreactivity (pS202/T205), suggesting that tau can participate in signaling pathways to regulate its own kinases. Modifiers showed poor correlation with tau phosphorylation (using the AT8, 12E8 and AT270 epitopes); moreover, tested suppressors of wild-type tau were equally effective in suppressing toxicity of a phosphorylation-resistant S11A tau construct, demonstrating that changes in tau phosphorylation state are not required to suppress or enhance its toxicity. Genes related to autophagy, the cell cycle, RNA-associated proteins and chromatin-binding proteins constitute a large percentage of identified modifiers. Other functional categories identified include mitochondrial proteins, lipid trafficking, Golgi proteins, kinesins and dynein and the Hsp70/Hsp90-organizing protein (Hop). Network analysis uncovered several other genes highly associated with the functional modifiers, including genes related to the PI3K, Notch, BMP/TGF-β and Hedgehog pathways, and nuclear trafficking. Activity of GSK-3β is strongly upregulated due to TDP-43 expression, and reduced GSK-3β dosage is also a common suppressor of Aβ42 and TDP-43 toxicity. These findings suggest therapeutic targets other than mitigation of tau phosphorylation. PMID:21949350

Field evaluation of Wisconsin modified binder selection guidelines - phase II.

DOT National Transportation Integrated Search

2013-12-01

The purpose of this project was to continue phase I of the study with the objective of identifying promising procedures and applicable modified binder specification criteria for use in Wisconsin, based on comparison of test results to field performan...

Identifying Treatment Effect Modifiers in the STarT Back Trial: A Secondary Analysis.

PubMed

Beneciuk, Jason M; Hill, Jonathan C; Campbell, Paul; Afolabi, Ebenezer; George, Steven Z; Dunn, Kate M; Foster, Nadine E

2017-01-01

Identification of patient characteristics influencing treatment outcomes is a top low back pain (LBP) research priority. Results from the STarT Back trial support the effectiveness of prognostic stratified care for LBP compared with current best care, however, patient characteristics associated with treatment response have not yet been explored. The purpose of this secondary analysis was to identify treatment effect modifiers within the STarT Back trial at 4-month follow-up (n = 688). Treatment response was dichotomized using back-specific physical disability measured using the Roland-Morris Disability Questionnaire (≥7). Candidate modifiers were identified using previous literature and evaluated using logistic regression with statistical interaction terms to provide preliminary evidence of treatment effect modification. Socioeconomic status (SES) was identified as an effect modifier for disability outcomes (odds ratio [OR] = 1.71, P = .028). High SES patients receiving prognostic stratified care were 2.5 times less likely to have a poor outcome compared with low SES patients receiving best current care (OR = .40, P = .006). Education level (OR = 1.33, P = .109) and number of pain medications (OR = .64, P = .140) met our criteria for effect modification with weaker evidence (.20 > P ≥ .05). These findings provide preliminary evidence for SES, education, and number of pain medications as treatment effect modifiers of prognostic stratified care delivered in the STarT Back Trial. This analysis provides preliminary exploratory findings about the characteristics of patients who might least likely benefit from targeted treatment using prognostic stratified care for LBP. Copyright © 2016 American Pain Society. Published by Elsevier Inc. All rights reserved.

Tissue Specific and Hormonal Regulation of Gene Expression

DTIC Science & Technology

1997-08-01

interference assays were performed. These assays identify DNA bases that, when modified, interfere with the binding of the nuclear factor to the hCRH promoter...thymidine residues. The DNA bases that when modified affected the binding of the protein are noted with arrows, and their location in the hCRH...indicated. B. Methylation interference. The fragments were partially methylated using dimethyl sulfate. The DNA bases that when modified affected the

40 CFR 721.2540 - Diphenylmethane diisocyanate (MDI) modified.

Code of Federal Regulations, 2010 CFR

2010-07-01

...) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.2540 Diphenylmethane diisocyanate (MDI) modified. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as a...

High effective heterogeneous plasma vortex reactor for production of heat energy and hydrogen

NASA Astrophysics Data System (ADS)

Belov, N. K.; Zavershinskii, I. P.; Klimov, A. I.; Molevich, N. E.; Porfiriev, D. P.; Tolkunov, B. N.

2018-03-01

This work is a continuation of our previous studies [1-10] of physical parameters and properties of a long-lived heterogeneous plasmoid (plasma formation with erosive nanoclusters) created by combined discharge in a high-speed swirl flow. Here interaction of metal nanoclusters with hydrogen atoms is studied in a plasma vortex reactor (PVR) with argon-water steam mixture. Metal nanoclusters were created by nickel cathode’s erosion at combined discharge on. Dissociated hydrogen atoms and ions were obtained in water steam by electric discharge. These hydrogen atoms and ions interacted with metal nanoclusters, which resulted in the creation of a stable plasmoid in a swirl gas flow. This plasmoid has been found to create intensive soft X-ray radiation. Plasma parameters of this plasmoid were measured by optical spectroscopy method. It has been obtained that there is a high non-equilibrium plasmoid: Te > TV >> TR. The measured coefficient of energy performance of this plasmoid is about COP = 2÷10. This extra power release in plasmoid is supposed to be connected with internal excited electrons. The obtained experimental results have proved our suggestion.

Advances in non-surgical treatments for urinary tract infections in children.

PubMed

Yang, Stephen Shei-Dei; Chiang, I-Ni; Lin, Chia-Da; Chang, Shang-Jen

2012-02-01

With growing antibiotics failure due to emerging resistance of bacteria, non-surgical management of pediatric UTI plays a more important role because of its non-invasive characteristics and little adverse effects. We searched the Pubmed for management of UTI in children other than surgical correction and antibiotics using terms: risk factor, prepuce/phimosis, steroid cream/steroid, behavioral therapy, urotherapy, biofeedback/pelvic floor exercise, adrenergic antagonist, anticholinergics, diet/dietary, dysfunctional voiding/dysfunctional elimination syndrome, constipation, dietary, clean intermittent catheterization, probiotics/lactobacillus, cranberry, vitamin supplement, breastfeeding, breast milk, with infant/child/children/pediatrics/pediatrics and urinary tract infection. The proposed non-surgical management of pediatric UTI included behavioral modification (timed voiding and adequate fluids intake), topical steroid for phimosis, nutrient supplements (breast milk, cranberry, probiotics, and vitamin A), biofeedback training for dysfunctional voiding, anticholinergics for reducing intravesical pressure, alpha-blockers in dysfunctional voiding and neurogenic bladder, and intermittent catheterization for children with large PVR. The published reports usually included small number of patients and were lacking of randomization and controlled group. Further well-designed studies are warranted to support the concepts of non-operative management for pediatric UTI.

Divergent evolution of multiple virus-resistance genes from a progenitor in Capsicum spp.

PubMed

Kim, Saet-Byul; Kang, Won-Hee; Huy, Hoang Ngoc; Yeom, Seon-In; An, Jeong-Tak; Kim, Seungill; Kang, Min-Young; Kim, Hyun Jung; Jo, Yeong Deuk; Ha, Yeaseong; Choi, Doil; Kang, Byoung-Cheorl

2017-01-01

Plants have evolved hundreds of nucleotide-binding and leucine-rich domain proteins (NLRs) as potential intracellular immune receptors, but the evolutionary mechanism leading to the ability to recognize specific pathogen effectors is elusive. Here, we cloned Pvr4 (a Potyvirus resistance gene in Capsicum annuum) and Tsw (a Tomato spotted wilt virus resistance gene in Capsicum chinense) via a genome-based approach using independent segregating populations. The genes both encode typical NLRs and are located at the same locus on pepper chromosome 10. Despite the fact that these two genes recognize completely different viral effectors, the genomic structures and coding sequences of the two genes are strikingly similar. Phylogenetic studies revealed that these two immune receptors diverged from a progenitor gene of a common ancestor. Our results suggest that sequence variations caused by gene duplication and neofunctionalization may underlie the evolution of the ability to specifically recognize different effectors. These findings thereby provide insight into the divergent evolution of plant immune receptors. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Risk factors for urinary tract infection following incontinence surgery.

PubMed

Nygaard, Ingrid; Brubaker, Linda; Chai, Toby C; Markland, Alayne D; Menefee, Shawn A; Sirls, Larry; Sutkin, Gary; Zimmern, Phillipe; Arisco, Amy; Huang, Liyuan; Tennstedt, Sharon; Stoddard, Anne

2011-10-01

The purpose of this study is to describe risk factors for post-operative urinary tract infection (UTI) the first year after stress urinary incontinence surgery. Multivariable logistic regression analyses were performed on data from 1,252 women randomized in two surgical trials, Stress Incontinence Surgical Treatment Efficacy trial (SISTEr) and Trial Of Mid-Urethral Slings (TOMUS). Baseline recurrent UTI (rUTI; ≥3 in 12 months) increased the risk of UTI in the first 6 weeks in both study populations, as did sling procedure and self-catheterization in SISTEr, and bladder perforation in TOMUS. Baseline rUTI, UTI in the first 6 weeks, and PVR > 100 cc at 12 months were independent risk factors for UTI between 6 weeks and 12 months in the SISTEr population. Few (2.3-2.4%) had post-operative rUTI, precluding multivariable analysis. In women with pre-operative rUTI, successful surgery (negative cough stress test) at 1 year did not appear to decrease the risk of persistent rUTI. Pre-operative rUTI is the strongest risk factor for post-operative UTI.

Evaluation of the new control methods for oral poliomyelitis vaccine.

PubMed

Grachev, V P; Karganova, G G; Rumyantsev, A A; Ivanova, O E; Eremeeva, T P; Drozdov, S G

2001-01-01

In the draft recommendations for production and control of OPV the WHO proposed new control methods: (i) mutant analysis with PCR and restriction enzyme cleavage (MAPREC) assay that allows evaluation of poliovirus population heterogeneity at the molecular level; (ii) neurovirulence (NV) test using transgenic mice susceptible to polioviruses and (iii) control of the seed lots for the presence of the simian virus 40 (SV40) DNA sequence. This paper is focused on our experience in the practical implementation of the new methods at the Institute of Poliomyelitis and Viral Encephalitides (IPVE). Using methods based on PCR we have demonstrated that working seed viruses used by IPVE for OPV production are free from SV40 DNA sequences. Our experience on the conduction of the OPV type 3 control using TgPVR21 mice NV test (seven vaccine lots) and the MAPREC assay (more than 150 samples of single harvests and monovalent bulks) showed that these methods may be used instead of the monkey NV test, because they could not pass the vaccine failed monkey NV test. The necessity for single harvests control is discussed.

The spectrum and clinical impact of epigenetic modifier mutations in myeloma

PubMed Central

Pawlyn, Charlotte; Kaiser, Martin F; Heuck, Christoph; Melchor, Lorenzo; Wardell, Christopher P; Murison, Alex; Chavan, Shweta; Johnson, David C; Begum, Dil; Dahir, Nasrin; Proszek, Paula; Cairns, David A; Boyle, Eileen M; Jones, John R; Cook, Gordon; Drayson, Mark T; Owen, Roger G; Gregory, Walter M; Jackson, Graham H; Barlogie, Bart; Davies, Faith E; Walker, Brian A; Morgan, Gareth J

2016-01-01

Purpose Epigenetic dysregulation is known to be an important contributor to myeloma pathogenesis but, unlike in other B cell malignancies, the full spectrum of somatic mutations in epigenetic modifiers has not been previously reported. We sought to address this using results from whole-exome sequencing in the context of a large prospective clinical trial of newly diagnosed patients and targeted sequencing in a cohort of previously treated patients for comparison. Experimental Design Whole-exome sequencing analysis of 463 presenting myeloma cases entered in the UK NCRI Myeloma XI study and targeted sequencing analysis of 156 previously treated cases from the University of Arkansas for Medical Sciences. We correlated the presence of mutations with clinical outcome from diagnosis and compared the mutations found at diagnosis with later stages of disease. Results In diagnostic myeloma patient samples we identify significant mutations in genes encoding the histone 1 linker protein, previously identified in other B-cell malignancies. Our data suggest an adverse prognostic impact from the presence of lesions in genes encoding DNA methylation modifiers and the histone demethylase KDM6A/UTX. The frequency of mutations in epigenetic modifiers appears to increase following treatment most notably in genes encoding histone methyltransferases and DNA methylation modifiers. Conclusions Numerous mutations identified raise the possibility of targeted treatment strategies for patients either at diagnosis or relapse supporting the use of sequencing-based diagnostics in myeloma to help guide therapy as more epigenetic targeted agents become available. PMID:27235425

Psychometric Characteristics of the Modified World Affairs Questionnaire.

ERIC Educational Resources Information Center

Mayton, Daniel M., II

1988-01-01

Subjected Modified World Affairs Questionnaire (MWAQ) to comparable common factor analysis which identified five factors: civil defense, escalation, nuclear war outcome, probability/worry, and patriotic. Alpha coefficients and test-retest reliability were determined to be adequate for the first four subscales. Acceptable discriminant validity and…

The removal of bacteria by modified natural zeolites.

PubMed

Milán, Z; de Las Pozas, C; Cruz, M; Borja, R; Sánchez, E; Ilangovan, K; Espinosa, Y; Luna, B

2001-01-01

The removal effect of natural and modified zeolites containing different heavy metals (Ni2+, Zn2+, Fe3+ and Cu2+) on pure cultures of Escherichia coli and Staphylococcus aureus in a solid medium was evaluated in this work. These experiments were carried out in a continuous mode treating municipal wastewater. Faecal coliform species and Pseudomonas aeruginosa were identified. The rate constants of heavy metal lixiviation were determined using a first order kinetic model. The removal effect of modified natural zeolites in both a solid medium and in continuous mode showed an increased elimination of the bacterial population. The results established a decreasing order of the removal effect as follows: Cu2+ > Fe3+ > Zn2+ > Ni2+. The best performance of columns was obtained for inlet bacterial concentrations below 10(6) cells/100 ml. Most of the identified bacterial species were affected by copper modified zeolites, although Serratia marcescens presented the highest sensitivity and Klebsiella pneumoniae the greatest resistance.

Analysis of potential protein-modifying variants in 9000 endometriosis patients and 150000 controls of European ancestry.

PubMed

Sapkota, Yadav; Vivo, Immaculata De; Steinthorsdottir, Valgerdur; Fassbender, Amelie; Bowdler, Lisa; Buring, Julie E; Edwards, Todd L; Jones, Sarah; O, Dorien; Peterse, Daniëlle; Rexrode, Kathryn M; Ridker, Paul M; Schork, Andrew J; Thorleifsson, Gudmar; Wallace, Leanne M; Kraft, Peter; Morris, Andrew P; Nyholt, Dale R; Edwards, Digna R Velez; Nyegaard, Mette; D'Hooghe, Thomas; Chasman, Daniel I; Stefansson, Kari; Missmer, Stacey A; Montgomery, Grant W

2017-09-12

Genome-wide association (GWA) studies have identified 19 independent common risk loci for endometriosis. Most of the GWA variants are non-coding and the genes responsible for the association signals have not been identified. Herein, we aimed to assess the potential role of protein-modifying variants in endometriosis using exome-array genotyping in 7164 cases and 21005 controls, and a replication set of 1840 cases and 129016 controls of European ancestry. Results in the discovery sample identified significant evidence for association with coding variants in single-variant (rs1801232-CUBN) and gene-level (CIITA and PARP4) meta-analyses, but these did not survive replication. In the combined analysis, there was genome-wide significant evidence for rs13394619 (P = 2.3 × 10 -9 ) in GREB1 at 2p25.1 - a locus previously identified in a GWA meta-analysis of European and Japanese samples. Despite sufficient power, our results did not identify any protein-modifying variants (MAF > 0.01) with moderate or large effect sizes in endometriosis, although these variants may exist in non-European populations or in high-risk families. The results suggest continued discovery efforts should focus on genotyping large numbers of surgically-confirmed endometriosis cases and controls, and/or sequencing high-risk families to identify novel rare variants to provide greater insights into the molecular pathogenesis of the disease.

Modifiable factors associated with caregiver burden among family caregivers of terminally ill Korean cancer patients.

PubMed

Yoon, Seok-Joon; Kim, Jong-Sung; Jung, Jin-Gyu; Kim, Sung-Soo; Kim, Samyong

2014-05-01

Higher caregiver burden is associated with poor quality of life among family caregivers. However, in Korea, very few studies have examined factors associated with caregiver burden. The present study investigated factors associated with caregiver burden among family caregivers of terminally ill Korean cancer patients, particularly modifiable factors as a potential target of intervention strategies. A cross-sectional study using self-administered questionnaires was performed. Sixty-four family caregivers of terminally ill cancer patients who were admitted to the hospice-palliative care unit of a university hospital in South Korea were included. To identify caregiver burden, the Caregiver Reaction Assessment scale (CRA) was used in this study. Time spent in providing care per day, number of visits per week from other family members, family functioning, and a positive subscale, self-esteem, of the CRA were deemed as modifiable factors. Other sociodemographic, caregiving characteristics of the subjects were non-modifiable factors. Longer time spent providing care per day, fewer weekly visits from other family members, poor family functioning, and low self-esteem were considered as modifiable factors associated with caregiver burden. Low monthly income and the spouse being the family caregiver were non-modifiable factors. Our study has practical significance in that it identifies modifiable factors that can be used to devise intervention strategies. Developing and applying such intervention strategies for alleviating the factors associated with high caregiver burden could be important for improving the quality of life of both patients and their families.

40 CFR 721.10029 - Isocyanate compound, modified with methoxysilane (generic).

Code of Federal Regulations, 2010 CFR

2010-07-01

... to those contained in the corresponding section 5(e) consent order. (ii) Hazard communication program...) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as isocyanate compound, modified with methoxysilane (PMN P-01-918) is subject to reporting under...

Negative ion spectrometry for detecting nitrated explosives

NASA Technical Reports Server (NTRS)

Boettger, H. G.; Yinon, J.

1975-01-01

Ionization procedure is modified to produce mainly negative ions by electron capture. Peaks of negative ions are monitored conventionally. Nitrated organic materials could be identified directly from sample sniff inlet stream by suitably modified mass spectrometer because of unique electronegativity which nitro group imparts to organic material.

Modifier locus mapping of a transgenic F2 mouse population identifies CCDC115 as a novel aggressive prostate cancer modifier gene in humans.

PubMed

Winter, Jean M; Curry, Natasha L; Gildea, Derek M; Williams, Kendra A; Lee, Minnkyong; Hu, Ying; Crawford, Nigel P S

2018-06-11

It is well known that development of prostate cancer (PC) can be attributed to somatic mutations of the genome, acquired within proto-oncogenes or tumor-suppressor genes. What is less well understood is how germline variation contributes to disease aggressiveness in PC patients. To map germline modifiers of aggressive neuroendocrine PC, we generated a genetically diverse F2 intercross population using the transgenic TRAMP mouse model and the wild-derived WSB/EiJ (WSB) strain. The relevance of germline modifiers of aggressive PC identified in these mice was extensively correlated in human PC datasets and functionally validated in cell lines. Aggressive PC traits were quantified in a population of 30 week old (TRAMP x WSB) F2 mice (n = 307). Correlation of germline genotype with aggressive disease phenotype revealed seven modifier loci that were significantly associated with aggressive disease. RNA-seq were analyzed using cis-eQTL and trait correlation analyses to identify candidate genes within each of these loci. Analysis of 92 (TRAMP x WSB) F2 prostates revealed 25 candidate genes that harbored both a significant cis-eQTL and mRNA expression correlations with an aggressive PC trait. We further delineated these candidate genes based on their clinical relevance, by interrogating human PC GWAS and PC tumor gene expression datasets. We identified four genes (CCDC115, DNAJC10, RNF149, and STYXL1), which encompassed all of the following characteristics: 1) one or more germline variants associated with aggressive PC traits; 2) differential mRNA levels associated with aggressive PC traits; and 3) differential mRNA expression between normal and tumor tissue. Functional validation studies of these four genes using the human LNCaP prostate adenocarcinoma cell line revealed ectopic overexpression of CCDC115 can significantly impede cell growth in vitro and tumor growth in vivo. Furthermore, CCDC115 human prostate tumor expression was associated with better survival outcomes. We have demonstrated how modifier locus mapping in mouse models of PC, coupled with in silico analyses of human PC datasets, can reveal novel germline modifier genes of aggressive PC. We have also characterized CCDC115 as being associated with less aggressive PC in humans, placing it as a potential prognostic marker of aggressive PC.

Comparison of Para-Selles Bailenger/Kop-Color Fumouze, Para-Selles-Iodésine/Kop-Color II Fumouze diagnostic kits with conventional microscopic methods in identifying intestinal parasitic diseases in Senegal.

PubMed

Sow, Doudou; Dieng, Yémou; Haouchine, Djamal; Niang, Khadim; Niang, Thiane; Sylla, Khadime; Tine, Roger Clément; Ndiaye, Magatte; Ndiaye, Jean Louis; Faye, Babacar; Faye, Omar; Gaye, Oumar; Dieng, Thérèse; Izri, Arezki

2017-09-01

In the context of controlling intestinal parasites, accurate diagnosis is essential. Our objective was to evaluate the performance of new diagnostic kits compared to conventional microscopic methods in identifying intestinal parasites. Faeces collected in rural area in Senegal were subjected to several detection techniques. Thus, the sensitivity, specificity, positive and negative predictive values of new diagnostic techniques were compared to conventional merthiolate-iodine-formalin, conventional Bailenger and modified Ritchie. Furthermore, the kappa coefficient was calculated to evaluate the correlation between the new kit and those of modified Ritchie. Out of the 117 patients examined, 102 presented with a parasite, or prevalence of 87.1%. The Fumouze techniques proved to be as effective as the conventional methods in detecting flagellates and helminths with sensitivities ranging from 97 to 100%. However, conventional techniques were slightly more sensitive in identifying Endolimax nana and Blastocystis hominis . The correlation was nearly perfect (k = 0.83 and 1), respectively between Bailenger Fumouze, Iodesine Fumouze and modified Ritchie in identifying helminths while it was just acceptable (k = 0.27 and 0.28) in identifying B. hominis . The modified Ritchie technique routinely used in our laboratory remains a good diagnostic tool. However, the use of kit techniques was interesting when reading the pellet after concentration and the Colour KOP staining was a considerable contribution to the diagnosis of the vegetative forms. Therefore, it would be interesting to determine the cost of a stool test using Fumouze kit techniques to provide the most cost effective way.

EAU Guidelines on the Assessment of Non-neurogenic Male Lower Urinary Tract Symptoms including Benign Prostatic Obstruction.

PubMed

Gratzke, Christian; Bachmann, Alexander; Descazeaud, Aurelien; Drake, Marcus J; Madersbacher, Stephan; Mamoulakis, Charalampos; Oelke, Matthias; Tikkinen, Kari A O; Gravas, Stavros

2015-06-01

Lower urinary tract symptoms (LUTS) represent one of the most common clinical complaints in adult men and have multifactorial aetiology. To develop European Association of Urology (EAU) guidelines on the assessment of men with non-neurogenic LUTS. A structured literature search on the assessment of non-neurogenic male LUTS was conducted. Articles with the highest available level of evidence were selected. The Delphi technique consensus approach was used to develop the recommendations. As a routine part of the initial assessment of male LUTS, a medical history must be taken, a validated symptom score questionnaire with quality-of-life question(s) should be completed, a physical examination including digital rectal examination should be performed, urinalysis must be ordered, post-void residual urine (PVR) should be measured, and uroflowmetry may be performed. Micturition frequency-volume charts or bladder diaries should be used to assess male LUTS with a prominent storage component or nocturia. Prostate-specific antigen (PSA) should be measured only if a diagnosis of prostate cancer will change the management or if PSA can assist in decision-making for patients at risk of symptom progression and complications. Renal function must be assessed if renal impairment is suspected from the history and clinical examination, if the patient has hydronephrosis, or when considering surgical treatment for male LUTS. Uroflowmetry should be performed before any treatment. Imaging of the upper urinary tract in men with LUTS should be performed in patients with large PVR, haematuria, or a history of urolithiasis. Imaging of the prostate should be performed if this assists in choosing the appropriate drug and when considering surgical treatment. Urethrocystoscopy should only be performed in men with LUTS to exclude suspected bladder or urethral pathology and/or before minimally invasive/surgical therapies if the findings may change treatment. Pressure-flow studies should be performed only in individual patients for specific indications before surgery or when evaluation of the pathophysiology underlying LUTS is warranted. These guidelines provide evidence-based practical guidance for assessment of non-neurogenic male LUTS. An extended version is available online (www.uroweb.org/guidelines). This article presents a short version of European Association of Urology guidelines for non-neurogenic male lower urinary tract symptoms (LUTS). The recommended tests should be able to distinguish between uncomplicated male LUTS and possible differential diagnoses and to evaluate baseline parameters for treatment. The guidelines also define the clinical profile of patients to provide the best evidence-based care. An algorithm was developed to guide physicians in using appropriate diagnostic tests. Copyright © 2014 European Association of Urology. Published by Elsevier B.V. All rights reserved.

Modified Acyl-ACP desaturase

DOEpatents

Cahoon, Edgar B.; Shanklin, John; Lindqvist, Ylva; Schneider, Gunter

1999-03-30

Disclosed is a method for modifying the chain length and double bond positional specificities of a soluble plant fatty acid desaturase. More specifically, the method involves modifying amino acid contact residues in the substrate binding channel of the soluble fatty acid desaturase which contact the fatty acid. Specifically disclosed is the modification of an acyl-ACP desaturase. Amino acid contact residues which lie within the substrate binding channel are identified, and subsequently replaced with different residues to effect the modification of activity.

Modified acyl-ACP desaturase

DOEpatents

Cahoon, Edgar B.; Shanklin, John; Lindgvist, Ylva; Schneider, Gunter

1998-01-06

Disclosed is a methods for modifying the chain length and double bond positional specificities of a soluble plant fatty acid desaturase. More specifically, the method involves modifying amino acid contact residues in the substrate binding channel of the soluble fatty acid desaturase which contact the fatty acid. Specifically disclosed is the modification of an acyl-ACP desaturase. Amino acid contact residues which lie within the substrate binding channel are identified, and subsequently replaced with different residues to effect the modification of activity.

Cystic fibrosis modifier genes.

PubMed Central

Davies, Jane; Alton, Eric; Griesenbach, Uta

2005-01-01

Since the recognition that CFTR genotype was not a good predictor of pulmonary disease severity in CF, several candidate modifier genes have been identified. It is unlikely that a single modifier gene will be found, but more probable that several haplotypes in combination may contribute, which in itself presents a major methodological challenge. The aims of such studies are to increase our understanding of disease pathogenesis, to aid prognosis and ultimately to lead to the development of novel treatments. PMID:16025767

Genome-Wide Association Study in BRCA1 Mutation Carriers Identifies Novel Loci Associated with Breast and Ovarian Cancer Risk

PubMed Central

Wang, Xianshu; McGuffog, Lesley; Lee, Andrew; Olswold, Curtis; Kuchenbaecker, Karoline B.; Soucy, Penny; Fredericksen, Zachary; Barrowdale, Daniel; Dennis, Joe; Gaudet, Mia M.; Dicks, Ed; Kosel, Matthew; Healey, Sue; Sinilnikova, Olga M.; Lee, Adam; Bacot, François; Vincent, Daniel; Hogervorst, Frans B. L.; Peock, Susan; Stoppa-Lyonnet, Dominique; Jakubowska, Anna; Investigators, kConFab; Radice, Paolo; Schmutzler, Rita Katharina; Domchek, Susan M.; Piedmonte, Marion; Singer, Christian F.; Friedman, Eitan; Thomassen, Mads; Hansen, Thomas V. O.; Neuhausen, Susan L.; Szabo, Csilla I.; Blanco, Ignacio; Greene, Mark H.; Karlan, Beth Y.; Garber, Judy; Phelan, Catherine M.; Weitzel, Jeffrey N.; Montagna, Marco; Olah, Edith; Andrulis, Irene L.; Godwin, Andrew K.; Yannoukakos, Drakoulis; Goldgar, David E.; Caldes, Trinidad; Nevanlinna, Heli; Osorio, Ana; Terry, Mary Beth; Daly, Mary B.; van Rensburg, Elizabeth J.; Hamann, Ute; Ramus, Susan J.; Ewart Toland, Amanda; Caligo, Maria A.; Olopade, Olufunmilayo I.; Tung, Nadine; Claes, Kathleen; Beattie, Mary S.; Southey, Melissa C.; Imyanitov, Evgeny N.; Tischkowitz, Marc; Janavicius, Ramunas; John, Esther M.; Kwong, Ava; Diez, Orland; Balmaña, Judith; Barkardottir, Rosa B.; Arun, Banu K.; Rennert, Gad; Teo, Soo-Hwang; Ganz, Patricia A.; Campbell, Ian; van der Hout, Annemarie H.; van Deurzen, Carolien H. M.; Seynaeve, Caroline; Gómez Garcia, Encarna B.; van Leeuwen, Flora E.; Meijers-Heijboer, Hanne E. J.; Gille, Johannes J. P.; Ausems, Margreet G. E. M.; Blok, Marinus J.; Ligtenberg, Marjolijn J. L.; Rookus, Matti A.; Devilee, Peter; Verhoef, Senno; van Os, Theo A. M.; Wijnen, Juul T.; Frost, Debra; Ellis, Steve; Fineberg, Elena; Platte, Radka; Evans, D. Gareth; Izatt, Louise; Eeles, Rosalind A.; Adlard, Julian; Eccles, Diana M.; Cook, Jackie; Brewer, Carole; Douglas, Fiona; Hodgson, Shirley; Morrison, Patrick J.; Side, Lucy E.; Donaldson, Alan; Houghton, Catherine; Rogers, Mark T.; Dorkins, Huw; Eason, Jacqueline; Gregory, Helen; McCann, Emma; Murray, Alex; Calender, Alain; Hardouin, Agnès; Berthet, Pascaline; Delnatte, Capucine; Nogues, Catherine; Lasset, Christine; Houdayer, Claude; Leroux, Dominique; Rouleau, Etienne; Prieur, Fabienne; Damiola, Francesca; Sobol, Hagay; Coupier, Isabelle; Venat-Bouvet, Laurence; Castera, Laurent; Gauthier-Villars, Marion; Léoné, Mélanie; Pujol, Pascal; Mazoyer, Sylvie; Bignon, Yves-Jean; Złowocka-Perłowska, Elżbieta; Gronwald, Jacek; Lubinski, Jan; Durda, Katarzyna; Jaworska, Katarzyna; Huzarski, Tomasz; Spurdle, Amanda B.; Viel, Alessandra; Peissel, Bernard; Bonanni, Bernardo; Melloni, Giulia; Ottini, Laura; Papi, Laura; Varesco, Liliana; Tibiletti, Maria Grazia; Peterlongo, Paolo; Volorio, Sara; Manoukian, Siranoush; Pensotti, Valeria; Arnold, Norbert; Engel, Christoph; Deissler, Helmut; Gadzicki, Dorothea; Gehrig, Andrea; Kast, Karin; Rhiem, Kerstin; Meindl, Alfons; Niederacher, Dieter; Ditsch, Nina; Plendl, Hansjoerg; Preisler-Adams, Sabine; Engert, Stefanie; Sutter, Christian; Varon-Mateeva, Raymonda; Wappenschmidt, Barbara; Weber, Bernhard H. F.; Arver, Brita; Stenmark-Askmalm, Marie; Loman, Niklas; Rosenquist, Richard; Einbeigi, Zakaria; Nathanson, Katherine L.; Rebbeck, Timothy R.; Blank, Stephanie V.; Cohn, David E.; Rodriguez, Gustavo C.; Small, Laurie; Friedlander, Michael; Bae-Jump, Victoria L.; Fink-Retter, Anneliese; Rappaport, Christine; Gschwantler-Kaulich, Daphne; Pfeiler, Georg; Tea, Muy-Kheng; Lindor, Noralane M.; Kaufman, Bella; Shimon Paluch, Shani; Laitman, Yael; Skytte, Anne-Bine; Gerdes, Anne-Marie; Pedersen, Inge Sokilde; Moeller, Sanne Traasdahl; Kruse, Torben A.; Jensen, Uffe Birk; Vijai, Joseph; Sarrel, Kara; Robson, Mark; Kauff, Noah; Mulligan, Anna Marie; Glendon, Gord; Ozcelik, Hilmi; Ejlertsen, Bent; Nielsen, Finn C.; Jønson, Lars; Andersen, Mette K.; Ding, Yuan Chun; Steele, Linda; Foretova, Lenka; Teulé, Alex; Lazaro, Conxi; Brunet, Joan; Pujana, Miquel Angel; Mai, Phuong L.; Loud, Jennifer T.; Walsh, Christine; Lester, Jenny; Orsulic, Sandra; Narod, Steven A.; Herzog, Josef; Sand, Sharon R.; Tognazzo, Silvia; Agata, Simona; Vaszko, Tibor; Weaver, Joellen; Stavropoulou, Alexandra V.; Buys, Saundra S.; Romero, Atocha; de la Hoya, Miguel; Aittomäki, Kristiina; Muranen, Taru A.; Duran, Mercedes; Chung, Wendy K.; Lasa, Adriana; Dorfling, Cecilia M.; Miron, Alexander; Benitez, Javier; Senter, Leigha; Huo, Dezheng; Chan, Salina B.; Sokolenko, Anna P.; Chiquette, Jocelyne; Tihomirova, Laima; Friebel, Tara M.; Agnarsson, Bjarni A.; Lu, Karen H.; Lejbkowicz, Flavio; James, Paul A.; Hall, Per; Dunning, Alison M.; Tessier, Daniel; Cunningham, Julie; Slager, Susan L.; Wang, Chen; Hart, Steven; Stevens, Kristen; Simard, Jacques; Pastinen, Tomi; Pankratz, Vernon S.; Offit, Kenneth; Antoniou, Antonis C.

2013-01-01

BRCA1-associated breast and ovarian cancer risks can be modified by common genetic variants. To identify further cancer risk-modifying loci, we performed a multi-stage GWAS of 11,705 BRCA1 carriers (of whom 5,920 were diagnosed with breast and 1,839 were diagnosed with ovarian cancer), with a further replication in an additional sample of 2,646 BRCA1 carriers. We identified a novel breast cancer risk modifier locus at 1q32 for BRCA1 carriers (rs2290854, P = 2.7×10−8, HR = 1.14, 95% CI: 1.09–1.20). In addition, we identified two novel ovarian cancer risk modifier loci: 17q21.31 (rs17631303, P = 1.4×10−8, HR = 1.27, 95% CI: 1.17–1.38) and 4q32.3 (rs4691139, P = 3.4×10−8, HR = 1.20, 95% CI: 1.17–1.38). The 4q32.3 locus was not associated with ovarian cancer risk in the general population or BRCA2 carriers, suggesting a BRCA1-specific association. The 17q21.31 locus was also associated with ovarian cancer risk in 8,211 BRCA2 carriers (P = 2×10−4). These loci may lead to an improved understanding of the etiology of breast and ovarian tumors in BRCA1 carriers. Based on the joint distribution of the known BRCA1 breast cancer risk-modifying loci, we estimated that the breast cancer lifetime risks for the 5% of BRCA1 carriers at lowest risk are 28%–50% compared to 81%–100% for the 5% at highest risk. Similarly, based on the known ovarian cancer risk-modifying loci, the 5% of BRCA1 carriers at lowest risk have an estimated lifetime risk of developing ovarian cancer of 28% or lower, whereas the 5% at highest risk will have a risk of 63% or higher. Such differences in risk may have important implications for risk prediction and clinical management for BRCA1 carriers. PMID:23544013

Modified measles versus rubella versus atypical measles: One and same thing

PubMed Central

Gupta, Surender Nikhil; Gupta, Naveen; Gupta, Shivani

2015-01-01

Introduction: In outbreak settings, more than one virus may be infecting the given population. In twin or triple outbreak of measles, German measles (rubella), and varicella in highly immunized hilly areas, maximal number of the case patients in all the hilly villages belonged to the older age group. It suggested an obvious shift to the higher age group, warranting second dose opportunity in such case scenario. The clinical presentations of viral diseases are too similar to differentiate. The aim is to clearly categorize the case patients of modified measles, rubella, and atypical measles in outbreak settings. Results: Four outbreaks are listed. In the first one, sixty case patients were identified from 1026 people in 5 villages. Of these, 41 were diagnosed by clinically, 8 were laboratory confirmed as measles and 11 were epidemiologically linked German measles case patients. Seventy percent of the cases were vaccinated for measles. In second case, we identified 29/35 measles and 6/35 were confirmed as epidemiologically linked unvaccinated chickenpox case patients. In third one, we identified 116 cases in eight villages (112/116 clinically and 04/116 laboratory confirmed). Majority of cases were immunized against measles, but only minor cases for rubella. In fourth case, we identified 505 case patients from mixed outbreaks of varicella, measles and rubella (30/505 clinically, 467/505 epidemiologically linked and 8/505 laboratory confirmed case patients from a study population of 3280). In all the four outbreaks, prima facie, the clinical presentations of both rubella and modified measles were difficult to differentiate. Discussion: On the basis of outbreak investigation and analytical inference, it has been observed that the symtomatology of modified measles and laboratory confirmed rubella case patients/epidemiologically linked cases are so similar placed that many a time, it becomes much difficult to line list the cases in one section of modified measles or rubella or atypical cases. Conclusion: Similarities of morphological symptoms between modified measles and rubella is the point of challenge and it causes debate between pediatrician and field epidemiologist to differentiate and classify them. PMID:26985417

Modified measles versus rubella versus atypical measles: One and same thing.

PubMed

Gupta, Surender Nikhil; Gupta, Naveen; Gupta, Shivani

2015-01-01

In outbreak settings, more than one virus may be infecting the given population. In twin or triple outbreak of measles, German measles (rubella), and varicella in highly immunized hilly areas, maximal number of the case patients in all the hilly villages belonged to the older age group. It suggested an obvious shift to the higher age group, warranting second dose opportunity in such case scenario. The clinical presentations of viral diseases are too similar to differentiate. The aim is to clearly categorize the case patients of modified measles, rubella, and atypical measles in outbreak settings. Four outbreaks are listed. In the first one, sixty case patients were identified from 1026 people in 5 villages. Of these, 41 were diagnosed by clinically, 8 were laboratory confirmed as measles and 11 were epidemiologically linked German measles case patients. Seventy percent of the cases were vaccinated for measles. In second case, we identified 29/35 measles and 6/35 were confirmed as epidemiologically linked unvaccinated chickenpox case patients. In third one, we identified 116 cases in eight villages (112/116 clinically and 04/116 laboratory confirmed). Majority of cases were immunized against measles, but only minor cases for rubella. In fourth case, we identified 505 case patients from mixed outbreaks of varicella, measles and rubella (30/505 clinically, 467/505 epidemiologically linked and 8/505 laboratory confirmed case patients from a study population of 3280). In all the four outbreaks, prima facie, the clinical presentations of both rubella and modified measles were difficult to differentiate. On the basis of outbreak investigation and analytical inference, it has been observed that the symtomatology of modified measles and laboratory confirmed rubella case patients/epidemiologically linked cases are so similar placed that many a time, it becomes much difficult to line list the cases in one section of modified measles or rubella or atypical cases. Similarities of morphological symptoms between modified measles and rubella is the point of challenge and it causes debate between pediatrician and field epidemiologist to differentiate and classify them.

Modifying sales summaries can aid forest products industries

Treesearch

G. B. Harpole

1976-01-01

This Note illustrates how a sales summary can be modified to separately identify changes in sales realization caused by changes in market prices and by changes in the product mix sold. With this information, a sales summary can become a helpful record to gage effects of past production and marketing decisions.

Modification of the Peabody Picture Vocabulary Test.

ERIC Educational Resources Information Center

Faizunisa, Ali; Costello, Joan

This study reports an attempt to improve the administration of the Peabody Picture Vocabulary Test (PPVT) by identifying and modifying aspects of the test which adversely affect disadvantaged preschoolers' performance. The resultant test was called the Modified Peabody Picture Vocabulary Test (M-PPVT). Two samples from the same lower class…

Chitinase modifying proteins from phylogenetically distinct lineages of Brassica pathogens

USDA-ARS?s Scientific Manuscript database

Chitinase modifying proteins (CMPs) are secreted fungal proteases that truncate specific plant class IV chitinases by cleaving peptide bonds in their amino termini. We recently identified a CMP from the Zea mays (maize) pathogen Fusarium verticillioides and found that it is a member of the fungalysi...

Quick-Reaction Report on Modifying C-26 Aircraft for Counterdrug Missions

DTIC Science & Technology

1994-03-23

National Guard was modifying 76 OH-58 helicopters with thermal imagery system sensors to identify indoor marijuana crops, drug processing laboratories, or...interdiction of aircraft crossing the U.S./Mexican border and detection of marijuana growing areas. The Director, ANG, decided that the C-26, a medium-size

40 CFR 721.9514 - Ethyl silicate, reaction products with modified alkoxysilane salt (generic).

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Ethyl silicate, reaction products with... Significant New Uses for Specific Chemical Substances § 721.9514 Ethyl silicate, reaction products with.... (1) The chemical substance identified generically as Ethyl silicate, reaction products with modified...

40 CFR 721.9514 - Ethyl silicate, reaction products with modified alkoxysilane salt (generic).

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Ethyl silicate, reaction products with... Significant New Uses for Specific Chemical Substances § 721.9514 Ethyl silicate, reaction products with.... (1) The chemical substance identified generically as Ethyl silicate, reaction products with modified...

21 CFR 178.3790 - Polymer modifiers in semirigid and rigid vinyl chloride plastics.

Code of Federal Regulations, 2012 CFR

2012-04-01

... chemical reactions, other than addition reactions, occur when they are mixed. (2) Polymers identified in...; provided that no chemical reactions, other than addition reactions, occur when they are combined. Such..., other than addition reactions, occur among the vinyl chloride polymers and the modifying polymers...

21 CFR 178.3790 - Polymer modifiers in semirigid and rigid vinyl chloride plastics.

Code of Federal Regulations, 2013 CFR

2013-04-01

... chemical reactions, other than addition reactions, occur when they are mixed. (2) Polymers identified in...; provided that no chemical reactions, other than addition reactions, occur when they are combined. Such..., other than addition reactions, occur among the vinyl chloride polymers and the modifying polymers...

Modifying Electroglottograph-Identified Intervals of Phonation: The Effect on Stuttering.

ERIC Educational Resources Information Center

Gow, Merrilyn L.; Ingham, Roger J.

1992-01-01

This study, involving an adolescent and adult male with stuttering problems, evaluated modification of the frequency of electroglottograph-measured phonation intervals on stuttering and speech naturalness. Both subjects demonstrated that stuttering could be controlled by modifying the frequency of phonation intervals within short duration ranges,…

Tool for assessing health and equity impacts of interventions modifying air quality in urban environments.

PubMed

Cartier, Yuri; Benmarhnia, Tarik; Brousselle, Astrid

2015-12-01

Urban outdoor air pollution (AP) is a major public health concern but the mechanisms by which interventions impact health and social inequities are rarely assessed. Health and equity impacts of policies and interventions are questioned, but managers and policy agents in various institutional contexts have very few practical tools to help them better orient interventions in sectors other than the health sector. Our objective was to create such a tool to facilitate the assessment of health impacts of urban outdoor AP interventions by non-public health experts. An iterative process of reviewing the academic literature, brainstorming, and consultation with experts was used to identify the chain of effects of urban outdoor AP and the major modifying factors. To test its applicability, the tool was applied to two interventions, the London Low Emission Zone and the Montréal BIXI public bicycle-sharing program. We identify the chain of effects, six categories of modifying factors: those controlling the source of emissions, the quantity of emissions, concentrations of emitted pollutants, their spatial distribution, personal exposure, and individual vulnerability. Modifiable and non-modifiable factors are also identified. Results are presented in the text but also graphically, as we wanted it to be a practical tool, from pollution sources to emission, exposure, and finally, health effects. The tool represents a practical first step to assessing AP-related interventions for health and equity impacts. Understanding how different factors affect health and equity through air pollution can provide insight to city policymakers pursuing Health in All Policies. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Genetic Modifiers and Oligogenic Inheritance

PubMed Central

Kousi, Maria; Katsanis, Nicholas

2015-01-01

Despite remarkable progress in the identification of mutations that drive genetic disorders, progress in understanding the effect of genetic background on the penetrance and expressivity of causal alleles has been modest, in part because of the methodological challenges in identifying genetic modifiers. Nonetheless, the progressive discovery of modifier alleles has improved both our interpretative ability and our analytical tools to dissect such phenomena. In this review, we analyze the genetic properties and behaviors of modifiers as derived from studies in patient populations and model organisms and we highlight conceptual and technological tools used to overcome some of the challenges inherent in modifier mapping and cloning. Finally, we discuss how the identification of these modifiers has facilitated the elucidation of biological pathways and holds the potential to improve the clinical predictive value of primary causal mutations and to develop novel drug targets. PMID:26033081

Common variants associated with breast cancer in genome-wide association studies are modifiers of breast cancer risk in BRCA1 and BRCA2 mutation carriers.

PubMed

Wang, Xianshu; Pankratz, V Shane; Fredericksen, Zachary; Tarrell, Robert; Karaus, Mary; McGuffog, Lesley; Pharaoh, Paul D P; Ponder, Bruce A J; Dunning, Alison M; Peock, Susan; Cook, Margaret; Oliver, Clare; Frost, Debra; Sinilnikova, Olga M; Stoppa-Lyonnet, Dominique; Mazoyer, Sylvie; Houdayer, Claude; Hogervorst, Frans B L; Hooning, Maartje J; Ligtenberg, Marjolijn J; Spurdle, Amanda; Chenevix-Trench, Georgia; Schmutzler, Rita K; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Domchek, Susan M; Nathanson, Katherine L; Rebbeck, Timothy R; Singer, Christian F; Gschwantler-Kaulich, Daphne; Dressler, Catherina; Fink, Anneliese; Szabo, Csilla I; Zikan, Michal; Foretova, Lenka; Claes, Kathleen; Thomas, Gilles; Hoover, Robert N; Hunter, David J; Chanock, Stephen J; Easton, Douglas F; Antoniou, Antonis C; Couch, Fergus J

2010-07-15

Recent studies have identified single nucleotide polymorphisms (SNPs) that significantly modify breast cancer risk in BRCA1 and BRCA2 mutation carriers. Since these risk modifiers were originally identified as genetic risk factors for breast cancer in genome-wide association studies (GWASs), additional risk modifiers for BRCA1 and BRCA2 may be identified from promising signals discovered in breast cancer GWAS. A total of 350 SNPs identified as candidate breast cancer risk factors (P < 1 x 10(-3)) in two breast cancer GWAS studies were genotyped in 3451 BRCA1 and 2006 BRCA2 mutation carriers from nine centers. Associations with breast cancer risk were assessed using Cox models weighted for penetrance. Eight SNPs in BRCA1 carriers and 12 SNPs in BRCA2 carriers, representing an enrichment over the number expected, were significantly associated with breast cancer risk (P(trend) < 0.01). The minor alleles of rs6138178 in SNRPB and rs6602595 in CAMK1D displayed the strongest associations in BRCA1 carriers (HR = 0.78, 95% CI: 0.69-0.90, P(trend) = 3.6 x 10(-4) and HR = 1.25, 95% CI: 1.10-1.41, P(trend) = 4.2 x 10(-4)), whereas rs9393597 in LOC134997 and rs12652447 in FBXL7 showed the strongest associations in BRCA2 carriers (HR = 1.55, 95% CI: 1.25-1.92, P(trend) = 6 x 10(-5) and HR = 1.37, 95% CI: 1.16-1.62, P(trend) = 1.7 x 10(-4)). The magnitude and direction of the associations were consistent with the original GWAS. In subsequent risk assessment studies, the loci appeared to interact multiplicatively for breast cancer risk in BRCA1 and BRCA2 carriers. Promising candidate SNPs from GWAS were identified as modifiers of breast cancer risk in BRCA1 and BRCA2 carriers. Upon further validation, these SNPs together with other genetic and environmental factors may improve breast cancer risk assessment in these populations.

Fingerprints of Modified RNA Bases from Deep Sequencing Profiles.

PubMed

Kietrys, Anna M; Velema, Willem A; Kool, Eric T

2017-11-29

Posttranscriptional modifications of RNA bases are not only found in many noncoding RNAs but have also recently been identified in coding (messenger) RNAs as well. They require complex and laborious methods to locate, and many still lack methods for localized detection. Here we test the ability of next-generation sequencing (NGS) to detect and distinguish between ten modified bases in synthetic RNAs. We compare ultradeep sequencing patterns of modified bases, including miscoding, insertions and deletions (indels), and truncations, to unmodified bases in the same contexts. The data show widely varied responses to modification, ranging from no response, to high levels of mutations, insertions, deletions, and truncations. The patterns are distinct for several of the modifications, and suggest the future use of ultradeep sequencing as a fingerprinting strategy for locating and identifying modifications in cellular RNAs.

Identifying criteria for the assessment of pharmacy students' communication skills with patients.

PubMed

Mackellar, Adele; Ashcroft, Darren M; Bell, Dawn; James, Delyth Higman; Marriott, John

2007-06-15

To identify criteria by which patients can assess the communication skills of pharmacy students. Potential assessment criteria were generated from 2 main sources: a literature review and a focus group discussion. A modified two-round Delphi survey was subsequently conducted with 35 professionals who were actively involved in teaching and assessing communication skills of pharmacy students to determine the importance and reliability of each criterion. Consensus ratings identified 7 criteria that were important measures of pharmacy students' communication skills and could be reliably assessed by patients. A modified two-round Delphi consultation survey successfully identified criteria that can be used by patients to assess the communication skills of pharmacy undergraduates. Future work will examine the feasibility of using patients as assessors of communication skills of pharmacy students, preregistration pharmacists, and qualified pharmacists.

Heuristics to Evaluate Interactive Systems for Children with Autism Spectrum Disorder (ASD).

PubMed

Khowaja, Kamran; Salim, Siti Salwah; Asemi, Adeleh

2015-01-01

In this paper, we adapted and expanded a set of guidelines, also known as heuristics, to evaluate the usability of software to now be appropriate for software aimed at children with autism spectrum disorder (ASD). We started from the heuristics developed by Nielsen in 1990 and developed a modified set of 15 heuristics. The first 5 heuristics of this set are the same as those of the original Nielsen set, the next 5 heuristics are improved versions of Nielsen's, whereas the last 5 heuristics are new. We present two evaluation studies of our new heuristics. In the first, two groups compared Nielsen's set with the modified set of heuristics, with each group evaluating two interactive systems. The Nielsen's heuristics were assigned to the control group while the experimental group was given the modified set of heuristics, and a statistical analysis was conducted to determine the effectiveness of the modified set, the contribution of 5 new heuristics and the impact of 5 improved heuristics. The results show that the modified set is significantly more effective than the original, and we found a significant difference between the five improved heuristics and their corresponding heuristics in the original set. The five new heuristics are effective in problem identification using the modified set. The second study was conducted using a system which was developed to ascertain if the modified set was effective at identifying usability problems that could be fixed before the release of software. The post-study analysis revealed that the majority of the usability problems identified by the experts were fixed in the updated version of the system.

Modified acyl-ACP desaturase

DOEpatents

Cahoon, E.B.; Shanklin, J.; Lindgvist, Y.; Schneider, G.

1998-01-06

Disclosed is a method for modifying the chain length and double bond positional specificities of a soluble plant fatty acid desaturase. More specifically, the method involves modifying amino acid contact residues in the substrate binding channel of the soluble fatty acid desaturase which contact the fatty acid. Specifically disclosed is the modification of an acyl-ACP desaturase. Amino acid contact residues which lie within the substrate binding channel are identified, and subsequently replaced with different residues to effect the modification of activity. 1 fig.

Modified Acyl-ACP desaturase

DOEpatents

Cahoon, E.B.; Shanklin, J.; Lindqvist, Y.; Schneider, G.

1999-03-30

Disclosed is a method for modifying the chain length and double bond positional specificities of a soluble plant fatty acid desaturase. More specifically, the method involves modifying amino acid contact residues in the substrate binding channel of the soluble fatty acid desaturase which contact the fatty acid. Specifically disclosed is the modification of an acyl-ACP desaturase. Amino acid contact residues which lie within the substrate binding channel are identified, and subsequently replaced with different residues to effect the modification of activity. 2 figs.

Entree Production Guides for Modified Diets at Walter Reed Army Medical Center. Part 4. Meat Substitute Entrees

DTIC Science & Technology

1979-06-01

numbers of vegetarian patients. Part V, Renal Diets , consists of eight very carefully weighed entrees and one dessert. These items are designed to give...WORDS (Conthmae an, revee side It nocesary and Identify by black number) \\ ~FOOD PREPARATION MEAT SUBSTITUTE MODIFIED DIETS COOK-FEEZE SYSTEMS SENSORY...Unsrfnounced I:! I *1C: -r Lii ENTREE PRODUCTION GUIDES FOR MODIFIED DIETS AT WALTER REED ARMY MEDICAL CENTER PART III: DENTAL LIQUID ENTREES FOREWORD

A Kinome RNAi Screen in Drosophila Identifies Novel Genes Interacting with Lgl, aPKC, and Crb Cell Polarity Genes in Epithelial Tissues.

PubMed

Parsons, Linda M; Grzeschik, Nicola A; Amaratunga, Kasun; Burke, Peter; Quinn, Leonie M; Richardson, Helena E

2017-08-07

In both Drosophila melanogaster and mammalian systems, epithelial structure and underlying cell polarity are essential for proper tissue morphogenesis and organ growth. Cell polarity interfaces with multiple cellular processes that are regulated by the phosphorylation status of large protein networks. To gain insight into the molecular mechanisms that coordinate cell polarity with tissue growth, we screened a boutique collection of RNAi stocks targeting the kinome for their capacity to modify Drosophila "cell polarity" eye and wing phenotypes. Initially, we identified kinase or phosphatase genes whose depletion modified adult eye phenotypes associated with the manipulation of cell polarity complexes (via overexpression of Crb or aPKC). We next conducted a secondary screen to test whether these cell polarity modifiers altered tissue overgrowth associated with depletion of Lgl in the wing. These screens identified Hippo, Jun kinase (JNK), and Notch signaling pathways, previously linked to cell polarity regulation of tissue growth. Furthermore, novel pathways not previously connected to cell polarity regulation of tissue growth were identified, including Wingless (Wg/Wnt), Ras, and lipid/Phospho-inositol-3-kinase (PI3K) signaling pathways. Additionally, we demonstrated that the "nutrient sensing" kinases Salt Inducible Kinase 2 and 3 ( SIK2 and 3 ) are potent modifiers of cell polarity phenotypes and regulators of tissue growth. Overall, our screen has revealed novel cell polarity-interacting kinases and phosphatases that affect tissue growth, providing a platform for investigating molecular mechanisms coordinating cell polarity and tissue growth during development. Copyright © 2017 Parsons et al.

[Clinical observation of modified Da Chaihu decoction in treating essential hypertension with anxiety].

PubMed

Zhang, Xiang-Dong; Cheng, Wang-Qiang; Wang, Yong-Gang; Zhang, Zheng

2017-06-01

To observe the clinical efficacy of modified Da Chaihu decoction in treating essential hypertension with anxiety, the randomized, controlled, clinical trial was performed in this study. One hundred and twenty-six hypertensive patients with anxiety meeting the inclusive criteria were randomized into the treatment group and the control group. All of the included patients in the above 2 groups were treated by amlodipine besylate tablets. Patients in the treatment group were given Chinese herbal medicine modified Da Chaihu decoction every day. And patients in the control group were given flupentixol and melitracen tablets. The treatment course was 4 weeks. Blood pressure, the score of traditional Chinese medicine syndrome, blood lipids, C reactive protein, the Hamilton anxiety scale score and adverse effects were observed. It has been identified that, both systolic and diastolic blood pressure were significantly reduced (P<0.05). However, no significant difference between the treatment group and the control group was identified. For traditional Chinese medicine syndrome, it was significantly improved in the treatment group (P<0.05). For blood lipids, TC, TG, HDL-C, and LDL-C were significantly improved in the treatment group (P<0.05). After treatment, only TC was significantly reduced in the treatment group when compared to the control group (P<0.05). For C reactive protein, it was significantly reduced in the treatment group after treatment (P<0.05). For anxiety, no significant difference between the treatment group and the control group on the Hamilton anxiety scale score was identified. For adverse effect, no severe adverse effect was identified in this study. The modified Da Chaihu decoction maybe effective in the treatment of essential hypertension with anxiety. In addition to a certain role in lowering blood pressure, the modified Da Chaihu decoction was also effective in improving traditional Chinese medicine syndrome and blood lipids, reducing the level of C reactive protein, relieving anxiety with little adverse effect. Copyright© by the Chinese Pharmaceutical Association.

40 CFR 174.529 - Bacillus thuringiensis modified Cry1Ab protein as identified under OECD Unique Identifier SYN...

Code of Federal Regulations, 2011 CFR

2011-07-01

... protein as identified under OECD Unique Identifier SYN-IR67B-1 in cotton; exemption from the requirement... Unique Identifier SYN-IR67B-1 in cotton; exemption from the requirement of a tolerance. Residues of... exempt from the requirement of a tolerance when used as a plant-incorporated protectant in cotton; cotton...

40 CFR 174.529 - Bacillus thuringiensis modified Cry1Ab protein as identified under OECD Unique Identifier SYN...

Code of Federal Regulations, 2013 CFR

2013-07-01

... protein as identified under OECD Unique Identifier SYN-IR67B-1 in cotton; exemption from the requirement... Unique Identifier SYN-IR67B-1 in cotton; exemption from the requirement of a tolerance. Residues of... exempt from the requirement of a tolerance when used as a plant-incorporated protectant in cotton; cotton...

40 CFR 174.529 - Bacillus thuringiensis modified Cry1Ab protein as identified under OECD Unique Identifier SYN...

Code of Federal Regulations, 2014 CFR

2014-07-01

... protein as identified under OECD Unique Identifier SYN-IR67B-1 in cotton; exemption from the requirement... Unique Identifier SYN-IR67B-1 in cotton; exemption from the requirement of a tolerance. Residues of... exempt from the requirement of a tolerance when used as a plant-incorporated protectant in cotton; cotton...

40 CFR 174.529 - Bacillus thuringiensis modified Cry1Ab protein as identified under OECD Unique Identifier SYN...

Code of Federal Regulations, 2012 CFR

2012-07-01

... protein as identified under OECD Unique Identifier SYN-IR67B-1 in cotton; exemption from the requirement... Unique Identifier SYN-IR67B-1 in cotton; exemption from the requirement of a tolerance. Residues of... exempt from the requirement of a tolerance when used as a plant-incorporated protectant in cotton; cotton...

40 CFR 174.529 - Bacillus thuringiensis modified Cry1Ab protein as identified under OECD Unique Identifier SYN...

Code of Federal Regulations, 2010 CFR

2010-07-01

... protein as identified under OECD Unique Identifier SYN-IR67B-1 in cotton; exemption from the requirement... Unique Identifier SYN-IR67B-1 in cotton; exemption from the requirement of a tolerance. Residues of... exempt from the requirement of a tolerance when used as a plant-incorporated protectant in cotton; cotton...

Presenilin-Based Genetic Screens in Drosophila melanogaster Identify Novel Notch Pathway Modifiers

PubMed Central

Mahoney, Matt B.; Parks, Annette L.; Ruddy, David A.; Tiong, Stanley Y. K.; Esengil, Hanife; Phan, Alexander C.; Philandrinos, Panos; Winter, Christopher G.; Chatterjee, Runa; Huppert, Kari; Fisher, William W.; L'Archeveque, Lynn; Mapa, Felipa A.; Woo, Wendy; Ellis, Michael C.; Curtis, Daniel

2006-01-01

Presenilin is the enzymatic component of γ-secretase, a multisubunit intramembrane protease that processes several transmembrane receptors, such as the amyloid precursor protein (APP). Mutations in human Presenilins lead to altered APP cleavage and early-onset Alzheimer's disease. Presenilins also play an essential role in Notch receptor cleavage and signaling. The Notch pathway is a highly conserved signaling pathway that functions during the development of multicellular organisms, including vertebrates, Drosophila, and C. elegans. Recent studies have shown that Notch signaling is sensitive to perturbations in subcellular trafficking, although the specific mechanisms are largely unknown. To identify genes that regulate Notch pathway function, we have performed two genetic screens in Drosophila for modifiers of Presenilin-dependent Notch phenotypes. We describe here the cloning and identification of 19 modifiers, including nicastrin and several genes with previously undescribed involvement in Notch biology. The predicted functions of these newly identified genes are consistent with extracellular matrix and vesicular trafficking mechanisms in Presenilin and Notch pathway regulation and suggest a novel role for γ-tubulin in the pathway. PMID:16415372

Presenilin-based genetic screens in Drosophila melanogaster identify novel notch pathway modifiers.

PubMed

Mahoney, Matt B; Parks, Annette L; Ruddy, David A; Tiong, Stanley Y K; Esengil, Hanife; Phan, Alexander C; Philandrinos, Panos; Winter, Christopher G; Chatterjee, Runa; Huppert, Kari; Fisher, William W; L'Archeveque, Lynn; Mapa, Felipa A; Woo, Wendy; Ellis, Michael C; Curtis, Daniel

2006-04-01

Presenilin is the enzymatic component of gamma-secretase, a multisubunit intramembrane protease that processes several transmembrane receptors, such as the amyloid precursor protein (APP). Mutations in human Presenilins lead to altered APP cleavage and early-onset Alzheimer's disease. Presenilins also play an essential role in Notch receptor cleavage and signaling. The Notch pathway is a highly conserved signaling pathway that functions during the development of multicellular organisms, including vertebrates, Drosophila, and C. elegans. Recent studies have shown that Notch signaling is sensitive to perturbations in subcellular trafficking, although the specific mechanisms are largely unknown. To identify genes that regulate Notch pathway function, we have performed two genetic screens in Drosophila for modifiers of Presenilin-dependent Notch phenotypes. We describe here the cloning and identification of 19 modifiers, including nicastrin and several genes with previously undescribed involvement in Notch biology. The predicted functions of these newly identified genes are consistent with extracellular matrix and vesicular trafficking mechanisms in Presenilin and Notch pathway regulation and suggest a novel role for gamma-tubulin in the pathway.

Identifying Critical Issues and Problems in Technology Education Using a Modified-Delphi Technique.

ERIC Educational Resources Information Center

Wicklein, Robert C.

1993-01-01

Critical issues for technology education (TE) identified by a 25-member Delphi panel were identification of the knowledge base, curriculum development approaches, interdisciplinary approaches, and teacher education reform. Problems identified included inadequate marketing/public relations, teacher shortage, lack of content consensus, and…

Association of modifiable and nonmodifiable factors with vitamin D status in pregnant women and neonates in Oakland, CA

USDA-ARS?s Scientific Manuscript database

There is little information on the contribution of modifiable vs nonmodifiable factors to maternal and neonatal vitamin D status in temperate regions of the United States. The purpose of this cross-sectional observation study conducted between December 2006 and February 2008 was to identify associat...

Effects of a Modified Thinking Science Program for Year 8 Students of Various Abilities

ERIC Educational Resources Information Center

Mobbs, Ellen

2016-01-01

The aim of this research was to identify whether students of various academic abilities would achieve positive gains in cognitive ability after completing a modified cognitive acceleration program based on the Cognitive Acceleration through Science Education (CASE) program. This research was quasi-experimental in design, with small samples of…

Food Allergy - Basic Mechanisms and Applications to Identifying Risks Associated with Plant Incorporated Pesticides and Other Genetically Modified Crops

EPA Science Inventory

Food allergy is a relatively new concern for toxicologists as a result of the incorporation of novel proteins into food crops in order to promote resistance to pests and other stresses, improve nutrition, or otherwise modify the phenotype. Food allergy can manifest as inflammatio...

Genetic modifiers of muscular dystrophy act on sarcolemmal resealing and recovery from injury

PubMed Central

Quattrocelli, Mattia; Capote, Joanna; Ohiri, Joyce C.; Warner, James L.; Vo, Andy H.; Hadhazy, Michele; Demonbreun, Alexis R.; Spencer, Melissa J.; McNally, Elizabeth M.

2017-01-01

Genetic disruption of the dystrophin complex produces muscular dystrophy characterized by a fragile muscle plasma membrane leading to excessive muscle degeneration. Two genetic modifiers of Duchenne Muscular Dystrophy implicate the transforming growth factor β (TGFβ) pathway, osteopontin encoded by the SPP1 gene and latent TGFβ binding protein 4 (LTBP4). We now evaluated the functional effect of these modifiers in the context of muscle injury and repair to elucidate their mechanisms of action. We found that excess osteopontin exacerbated sarcolemmal injury, and correspondingly, that loss of osteopontin reduced injury extent both in isolated myofibers and in muscle in vivo. We found that ablation of osteopontin was associated with reduced expression of TGFβ and TGFβ-associated pathways. We identified that increased TGFβ resulted in reduced expression of Anxa1 and Anxa6, genes encoding key components of the muscle sarcolemma resealing process. Genetic manipulation of Ltbp4 in dystrophic muscle also directly modulated sarcolemmal resealing, and Ltbp4 alleles acted in concert with Anxa6, a distinct modifier of muscular dystrophy. These data provide a model in which a feed forward loop of TGFβ and osteopontin directly impacts the capacity of muscle to recover from injury, and identifies an intersection of genetic modifiers on muscular dystrophy. PMID:29065150

Genetic modifiers of muscular dystrophy act on sarcolemmal resealing and recovery from injury.

PubMed

Quattrocelli, Mattia; Capote, Joanna; Ohiri, Joyce C; Warner, James L; Vo, Andy H; Earley, Judy U; Hadhazy, Michele; Demonbreun, Alexis R; Spencer, Melissa J; McNally, Elizabeth M

2017-10-01

Genetic disruption of the dystrophin complex produces muscular dystrophy characterized by a fragile muscle plasma membrane leading to excessive muscle degeneration. Two genetic modifiers of Duchenne Muscular Dystrophy implicate the transforming growth factor β (TGFβ) pathway, osteopontin encoded by the SPP1 gene and latent TGFβ binding protein 4 (LTBP4). We now evaluated the functional effect of these modifiers in the context of muscle injury and repair to elucidate their mechanisms of action. We found that excess osteopontin exacerbated sarcolemmal injury, and correspondingly, that loss of osteopontin reduced injury extent both in isolated myofibers and in muscle in vivo. We found that ablation of osteopontin was associated with reduced expression of TGFβ and TGFβ-associated pathways. We identified that increased TGFβ resulted in reduced expression of Anxa1 and Anxa6, genes encoding key components of the muscle sarcolemma resealing process. Genetic manipulation of Ltbp4 in dystrophic muscle also directly modulated sarcolemmal resealing, and Ltbp4 alleles acted in concert with Anxa6, a distinct modifier of muscular dystrophy. These data provide a model in which a feed forward loop of TGFβ and osteopontin directly impacts the capacity of muscle to recover from injury, and identifies an intersection of genetic modifiers on muscular dystrophy.

Modifier genes in Mendelian disorders: the example of cystic fibrosis

PubMed Central

Cutting, Garry R.

2011-01-01

In the past three decades, scientists have had immense success in identifying genes and their variants that contribute to an array of diseases. While the identification of such genetic variants has informed our knowledge of the etiologic bases of diseases, there continues to be a substantial gap in our understanding of the factors that modify disease severity. Monogenic diseases provide an opportunity to identify modifiers as they have uniform etiology, detailed phenotyping of affected individuals, and familial clustering. Cystic fibrosis (CF) is among the more common life-shortening recessive disorders that displays wide variability in clinical features and survival. Considerable progress has been made in elucidating the contribution of genetic and nongenetic factors to CF. Allelic variation in CFTR, the gene responsible for CF, correlates with some aspects of the disease. However, lung function, neonatal intestinal obstruction, diabetes, and anthropometry display strong genetic control independent of CFTR, and candidate gene studies have revealed genetic modifiers underlying these traits. The application of genome-wide techniques holds great promise for the identification of novel genetic variants responsible for the heritable features and complications of CF. Since the genetic modifiers are known to alter the course of disease, their protein products become immediate targets for therapeutic intervention. PMID:21175684

Metabolic labeling enables selective photocrosslinking of O-GlcNAc-modified proteins to their binding partners

PubMed Central

Yu, Seok-Ho; Boyce, Michael; Wands, Amberlyn M.; Bond, Michelle R.; Bertozzi, Carolyn R.; Kohler, Jennifer J.

2012-01-01

O-linked β-N-acetylglucosamine (O-GlcNAc) is a reversible posttranslational modification found on hundreds of nuclear and cytoplasmic proteins in higher eukaryotes. Despite its ubiquity and essentiality in mammals, functional roles for the O-GlcNAc modification remain poorly defined. Here we develop a combined genetic and chemical approach that enables introduction of the diazirine photocrosslinker onto the O-GlcNAc modification in cells. We engineered mammalian cells to produce diazirine-modified O-GlcNAc by expressing a mutant form of UDP-GlcNAc pyrophosphorylase and subsequently culturing these cells with a cell-permeable, diazirine-modified form of GlcNAc-1-phosphate. Irradiation of cells with UV light activated the crosslinker, resulting in formation of covalent bonds between O-GlcNAc-modified proteins and neighboring molecules, which could be identified by mass spectrometry. We used this method to identify interaction partners for the O-GlcNAc-modified FG-repeat nucleoporins. We observed crosslinking between FG-repeat nucleoporins and nuclear transport factors, suggesting that O-GlcNAc residues are intimately associated with essential recognition events in nuclear transport. Further, we propose that the method reported here could find widespread use in investigating the functional consequences of O-GlcNAcylation. PMID:22411826

Modifiable worker risk factors contributing to workplace absence: a stakeholder-centred best-evidence synthesis of systematic reviews.

PubMed

Wagner, Shannon; White, Marc; Schultz, Izabela; Murray, Eleanor; Bradley, Susan M; Hsu, Vernita; McGuire, Lisa; Schulz, Werner

2014-01-01

A challenge facing stakeholders is the identification and translation of relevant high quality research to inform policy and practice. This study engaged academic and community stakeholders in conducting a best evidence-synthesis to identify modifiable risk and protective worker factors across health conditions impacting work-related absence. To identify modifiable worker disability risk and protective factors across common health conditions impacting work-related absence. We searched Medline, Embase, CINHAL, The Cochrane Library, PsycINFO, BusinessSourceComplete, and ABI/Inform from 2000 to 2011. Quantitative, qualitative, or mixed methods systematic reviews of work-focused population were considered for inclusion. Two or more reviewers independently reviewed articles for inclusion and methodological screening. The search strategy, expert input and grey literature identified 2,467 unique records. One hundred and forty-two full text articles underwent comprehensive review. Twenty-four systematic reviews met eligibility criteria. Modifiable worker factors found to have consistent evidence across two or more health conditions included emotional distress, negative enduring psychology/personality factors, negative health and disability perception, decreased physical activity, lack of family support, poor general health, increased functional disability, increased pain, increased fatigue and lack of motivation to return to work. Systematic reviews are limited by availability of high quality studies, lack of consistency of methodological screening and reporting, and variability of outcome measures used.

A rapid review to identify physical activity accrued while playing golf

PubMed Central

Luscombe, Jack; Murray, Andrew D; Jenkins, Evan; Archibald, Daryll

2017-01-01

Objective To identify physical activity (PA) accrued while playing golf and modifiers of PA accrued. Design A rapid review of primary research studies. Quality was assessed using the National Heart, Lung, and Blood Institute quality assessment tool for cohort and cross-sectional studies. Methods and outcomes The following databases were searched from 1900 to March 2017: SPORTDiscus, Web of Science, PsycINFO, MEDLINE, Google Scholar, Google Advanced Search, ProQuest, WHO International Clinical Trials Registry Platform. All primary research investigating golf or golfers with any of the following outcomes was included: metabolic equivalent of task, oxygen uptake, energy expenditure, heart rate, step count, distance covered, strength, flexibility, balance, sedentary behaviour. Results Phase one searching identified 4944 citations and phase two searching identified 170 citations. In total, 19 articles met inclusion criteria. Golf is primarily a moderate intensity PA, but may be low intensity depending on the playing population and various modifiers. Less PA is accrued by those who ride a golf cart compared with those walking the course. Conclusions Golf can be encouraged in order to attain PA recommendations. Further research is required into the relationship between golf and strength and flexibility PA recommendations and how modifiers affect PA accrued. PROSPERO registration number CRD42017058237. PMID:29187418

A public health approach to the impact of climate change on health in southern Africa - identifying priority modifiable risks.

PubMed

Myers, J; Young, T; Galloway, M; Manyike, P; Tucker, T

2011-11-01

Anthropogenic climate change and anticipated adverse impacts on human health as outlined by the Intergovernmental Panel on Climate Change (IPCC) are taken as given. A conceptual model for thinking about the spectrum of climate-related health risks ranging from distal and infrastructural to proximal and behavioural and their relation to the burden of disease pattern typical of sub-Saharan Africa is provided. The model provides a tool for identifying modifiable risk factors with a view to future research, specifically into the performance of interventions to reduce the impact of climate change.

A modified reverse one-hybrid screen identifies transcriptional activation in Phyochrome-Interacting Factor 3

USDA-ARS?s Scientific Manuscript database

Transcriptional activation domains (TAD) are difficult to predict and identify, since they are not conserved and have little consensus. Here, we describe a yeast-based screening method that is able to identify individual amino acid residues involved in transcriptional activation in a high throughput...

Insulin non-persistence among people with type 2 diabetes: how to get your patients to stay on insulin therapy.

PubMed

Garnero, Theresa L; Davis, Nichola J; Perez-Nieves, Magaly; Hadjiyianni, Irene; Cao, Dachuang; Ivanova, Jasmina I; Peyrot, Mark

2018-05-01

Continuing use of medication is key to effective treatment and positive health outcomes, particularly in chronic conditions such as diabetes. However, in primary care, non-persistence (i.e. discontinuing or interrupting treatment) with insulin therapy is a common problem among patients with type 2 diabetes. To help primary care physicians manage patients who are non-persistent or likely not to be persistent, this review aimed to provide an overview of modifiable and non-modifiable factors associated with insulin non-persistence as well as practical strategies to address them. Data were extracted from published studies evaluating factors associated with non-persistence among patients with type 2 diabetes. A targeted literature review was performed using PubMed to identify recent studies (2000-2016) reporting measures of non-persistence with insulin therapy. Practical strategies to identify and prevent non-persistence were based on the authors' direct experience in primary care. Non-modifiable factors associated with non-persistence included gender, age, prior treatments, and cost of therapy. Before/at insulin initiation, modifiable factors included patients' perception of diabetes, preference for oral medication, and concerns/expectations about treatment complexity, inconvenience, or side effects. After initiation, modifiable factors included syringe use, difficulties during the first week of therapy, side effects, and insufficient glycemic control. Open-ended and patient-centered questions and a blame-free environment can help physicians identify, prevent, and reduce non-persistence behaviors. Possible questions to start a conversation with patients are provided. Effective physician-patient communication is essential to the management of diabetes. Primary care physicians should be familiar with the most common reasons for insulin non-persistence.

Modifying Older Adults' Daily Sedentary Behaviour Using an Asset-based Solution: Views from Older Adults.

PubMed

Leask, Calum F; Sandlund, Marlene; Skelton, Dawn A; Tulle, Emmanuelle; Chastin, Sebastien Fm

2016-01-01

There is a growing public health focus on the promotion of successful and active ageing. Interventions to reduce sedentary behaviour (SB) in older adults are feasible and are improved by tailoring to individuals' context and circumstances. SB is ubiquitous; therefore part of the tailoring process is to ensure individuals' daily sedentary routine can be modified. The aim of this study was to understand the views of older adults and identify important considerations when creating a solution to modify daily sedentary patterns. This was a qualitative research study. Fifteen older adult volunteers (mean age = 78 years) participated in 1 of 4 focus groups to identify solutions to modify daily sedentary routine. Two researchers conducted the focus groups whilst a third took detailed fieldnotes on a flipchart to member check the findings. Data were recorded and analysed thematically. Participants wanted a solution with a range of options which could be tailored to individual needs and circumstances. The strategy suggested was to use the activities of daily routine and reasons why individuals already naturally interrupting their SB, collectively framed as assets. These assets were categorised into 5 sub-themes: physical assets (eg. standing up to reduce stiffness); psychological assets (eg. standing up to reduce feelings of guilt); interpersonal assets (eg. standing up to answer the phone); knowledge assets (eg. standing up due to knowing the benefits of breaking SB) and activities of daily living assets (eg. standing up to get a drink). This study provides important considerations from older adults' perspectives to modify their daily sedentary patterns. The assets identified by participants could be used to co-create a tailored intervention with older adults to reduce SB, which may increase effectiveness and adherence.

Metabolic signature of breast cancer cell line MCF-7: profiling of modified nucleosides via LC-IT MS coupling.

PubMed

Bullinger, Dino; Neubauer, Hans; Fehm, Tanja; Laufer, Stefan; Gleiter, Christoph H; Kammerer, Bernd

2007-11-29

Cancer, like other diseases accompanied by strong metabolic disorders, shows characteristic effects on cell turnover rate, activity of modifying enzymes and DNA/RNA modifications, resulting also in elevated amounts of excreted modified nucleosides. For a better understanding of the impaired RNA metabolism in breast cancer cells, we screened these metabolites in the cell culture supernatants of the breast cancer cell line MCF-7 and compared it to the human mammary epithelial cells MCF-10A. The nucleosides were isolated and analyzed via 2D-chromatographic techniques: In the first dimension by cis-diol specific boronate affinity extraction and subsequently by reversed phase chromatography coupled to an ion trap mass spectrometer. Besides the determination of ribonucleosides, additional compounds with cis-diol structure, deriving from cross-linked biochemical pathways, like purine-, histidine- and polyamine metabolism were detected. In total, 36 metabolites were identified by comparison of fragmentation patterns and retention time. Relation to the internal standard isoguanosine yielded normalized area ratios for each identified compound and enabled a semi-quantitative metabolic signature of both analyzed cell lines.13 of the identified 26 modified ribonucleosides were elevated in the cell culture supernatants of MCF-7 cells, with 5-methyluridine, N2,N2,7-trimethylguanosine, N6-methyl-N6-threonylcarbamoyladenosine and 3-(3-aminocarboxypropyl)-uridine showing the most significant differences. 1-ribosylimidazole-4-acetic acid, a histamine metabolite, was solely found in the supernatants of MCF-10A cells, whereas 1-ribosyl-4-carboxamido-5-aminoimidazole and S-adenosylmethionine occurred only in supernatants of MCF-7 cells. The obtained results are discussed against the background of pathological changes in cell metabolism, resulting in new perspectives for modified nucleosides and related metabolites as possible biomedical markers for breast carcinoma in vivo.

Behavioral Health Services Following Implementation of Screening in Massachusetts Medicaid Children

PubMed Central

Penfold, Robert B.; Arsenault, Lisa N.; Zhang, Fang; Murphy, Michael; Wissow, Lawrence S.

2014-01-01

OBJECTIVES: To determine the relationship of child behavioral health (BH) screening results to receipt of BH services in Massachusetts Medicaid (MassHealth) children. METHODS: After a court decision, Massachusetts primary care providers were mandated to conduct BH screening at well-child visits and use a Current Procedural Terminology code along with a modifier indicating whether a BH need was identified. Using MassHealth claims data, a cohort of continuously enrolled (July 2007–June 2010) children was constructed. The salient visit (first use of the modifier, screening code, or claim in fiscal year 2009) was considered a reference point to examine BH history and postscreening BH services. Bivariate and multivariate logistic regression analyses were performed to determine predictors of postscreening BH services. RESULTS: Of 261 160 children in the cohort, 45% (118 464) were screened and 37% had modifiers. Fifty-seven percent of children screening positive received postscreening BH services compared with 22% of children screening negative. However, only 30% of newly identified children received BH services. The strongest predictors of postscreening BH services for children without a BH history were being in foster care (odds ratio, 10.38; 95% confidence interval, 9.22–11.68) and having a positive modifier (odds ratio, 3.79; 95% confidence interval, 3.53–4.06). CONCLUSIONS: Previous BH history, a positive modifier, and foster care predicted postscreening BH services. Only one-third of newly identified children received services. Thus although screening is associated with an increase in BH recognition, it may be insufficient to improve care. Additional strategies may be needed to enhance engagement in BH services. PMID:25225135

Modified multiplex PCR for identification of Bacillus Calmette-Guérin substrain Tokyo among clinical isolates.

PubMed

Seki, Masaaki; Sato, Akimasa; Honda, Ikuro; Yamazaki, Toshio; Yano, Ikuya; Koyama, Akira; Toida, Ichiro

2005-05-02

When an adverse reaction occurs and a mycobacterial species is isolated from a person vaccinated with Bacillus Calmette-Guérin (BCG) or a patient receiving BCG immunotherapy, it is essential to identify whether the isolate is BCG or another mycobacterial species. However, differentiation of BCG from other members of Mycobacterium tuberculosis complex has been very difficult. Using several specific primer-pairs, Bedwell et al. [Bedwell J, Kairo SK, Behr MA, Bygraves JA. Identification of substrains of BCG vaccine using multiplex PCR. Vaccine 2001; 19: 2146-51] recently reported that they could distinguish BCG substrains. We modified their method to improve differentiation of Tokyo 172 from other members of the M. tuberculosis complex, and examined whether this modified method could be applied to clinical isolates. Our method clearly identified BCG substrain (BCG Tokyo 172) among clinical isolates and easily distinguished between M. tuberculosis and wild-type Mycobacterium bovis.

Research Funding: the Case for a Modified Lottery.

PubMed

Fang, Ferric C; Casadevall, Arturo

2016-04-12

The time-honored mechanism of allocating funds based on ranking of proposals by scientific peer review is no longer effective, because review panels cannot accurately stratify proposals to identify the most meritorious ones. Bias has a major influence on funding decisions, and the impact of reviewer bias is magnified by low funding paylines. Despite more than a decade of funding crisis, there has been no fundamental reform in the mechanism for funding research. This essay explores the idea of awarding research funds on the basis of a modified lottery in which peer review is used to identify the most meritorious proposals, from which funded applications are selected by lottery. We suggest that a modified lottery for research fund allocation would have many advantages over the current system, including reducing bias and improving grantee diversity with regard to seniority, race, and gender. Copyright © 2016 Fang and Casadevall.

Genetic association studies in β-hemoglobinopathies.

PubMed

Thein, Swee Lay

2013-01-01

Characterization of the molecular basis of the β-thalassemias and sickle cell disease (SCD) clearly showed that individuals with the same β-globin genotypes can have extremely diverse clinical severity. Two key modifiers, an innate ability to produce fetal hemoglobin and coinheritance of α-thalassemia, both derived from family and population studies, affect the pathophysiology of both disorders at the primary level. In the past 2 decades, scientific research had applied genetic approaches to identify additional genetic modifiers. The review summarizes recent genetic studies and key genetic modifiers identified and traces the story of fetal hemoglobin genetics, which has led to an emerging network of globin gene regulation. The discoveries have provided insights on new targets for therapeutic intervention and raise possibilities of developing fetal hemoglobin predictive diagnostics for predicting disease severity in the newborn and for integration into prenatal diagnosis to better inform genetic counseling.

Research Funding: the Case for a Modified Lottery

PubMed Central

Casadevall, Arturo

2016-01-01

ABSTRACT The time-honored mechanism of allocating funds based on ranking of proposals by scientific peer review is no longer effective, because review panels cannot accurately stratify proposals to identify the most meritorious ones. Bias has a major influence on funding decisions, and the impact of reviewer bias is magnified by low funding paylines. Despite more than a decade of funding crisis, there has been no fundamental reform in the mechanism for funding research. This essay explores the idea of awarding research funds on the basis of a modified lottery in which peer review is used to identify the most meritorious proposals, from which funded applications are selected by lottery. We suggest that a modified lottery for research fund allocation would have many advantages over the current system, including reducing bias and improving grantee diversity with regard to seniority, race, and gender. PMID:27073093

Title VI-G, ESEA, Proposal for a Modified Primary Program for Children with Learning Disabilities. (Abstract and Narrative Sections).

ERIC Educational Resources Information Center

Anchorage Borough School District, AK.

A project emphasizing prevention of learning disabilities through early identification and individualized educational prescriptions was conducted. Children identified through a screening process will go from kindergarten to a modified primary class. Here, they will be provided with a curriculum designed to develop the skills needed for successful…

Identification of Core Competencies for an Undergraduate Food Safety Curriculum Using a Modified Delphi Approach

ERIC Educational Resources Information Center

Johnston, Lynette M.; Wiedmann, Martin; Orta-Ramirez, Alicia; Oliver, Haley F.; Nightingale, Kendra K.; Moore, Christina M.; Stevenson, Clinton D.; Jaykus, Lee-Ann

2014-01-01

Identification of core competencies for undergraduates in food safety is critical to assure courses and curricula are appropriate in maintaining a well-qualified food safety workforce. The purpose of this study was to identify and refine core competencies relevant to postsecondary food safety education using a modified Delphi method. Twenty-nine…

Neuropsychiatric Symptoms in Latino Elders with Dementia or Cognitive Impairment without Dementia and Factors that Modify Their Association with Caregiver Depression

ERIC Educational Resources Information Center

Hinton, Ladson; Haan, Mary; Geller, Sue; Mungas, Dan

2003-01-01

Purpose: The purpose of this study was to determine neuropsychiatric symptom frequency and intensity in demented and cognitively impaired but not demented Latino elderly persons, evaluate whether overall neuropsychiatric symptom intensity is associated with higher levels of caregiver depression, and identify factors that modify the relationship…

Variables Affecting Secondary School Students' Willingness to Eat Genetically Modified Food Crops

ERIC Educational Resources Information Center

Maes, Jasmien; Bourgonjon, Jeroen; Gheysen, Godelieve; Valcke, Martin

2018-01-01

A large-scale cross-sectional study (N = 4002) was set up to determine Flemish secondary school students' willingness to eat genetically modified food (WTE) and to link students' WTE to previously identified key variables from research on the acceptance of genetic modification (GM). These variables include subjective and objective knowledge about…

21 CFR 177.1635 - Poly(p-methylstyrene) and rubber-modified poly(p-methyl-styrene).

Code of Federal Regulations, 2010 CFR

2010-04-01

...-modified poly(p-methylstyrene) identified in this section may be safely used as components of articles... are available from the Center for Food Safety and Applied Nutrition (HFS-200), Food and Drug... complying with this section, when used as components of the food-contact surface of any article that is the...

Quantitative Microbial Risk Assessment Tutorial - SDMProjectBuilder: Import Local Data Files to Identify and Modify Contamination Sources and Input ParametersUpdated 2017

EPA Science Inventory

Twelve example local data support files are automatically downloaded when the SDMProjectBuilder is installed on a computer. They allow the user to modify values to parameters that impact the release, migration, fate, and transport of microbes within a watershed, and control delin...

Quantitative Microbial Risk Assessment Tutorial – SDMProjectBuilder: Import Local Data Files to Identify and Modify Contamination Sources and Input Parameters

EPA Science Inventory

Twelve example local data support files are automatically downloaded when the SDMProjectBuilder is installed on a computer. They allow the user to modify values to parameters that impact the release, migration, fate, and transport of microbes within a watershed, and control delin...

Using a Modified Pyramidal Training Model to Teach Special Education Teachers to Conduct Trial-Based Functional Analyses

ERIC Educational Resources Information Center

Kunnavatana, S. Shanun; Bloom, Sarah E.; Samaha, Andrew L.; Lignugaris/Kraft, Benjamin; Dayton, Elizabeth; Harris, Shannon K.

2013-01-01

Functional behavioral assessments are commonly used in school settings to assess and develop interventions for problem behavior. The trial-based functional analysis is an approach that teachers can use in their classrooms to identify the function of problem behavior. The current study evaluates the effectiveness of a modified pyramidal training…

Systematic review: Tumor-associated antigen autoantibodies and ovarian cancer early detection.

PubMed

Fortner, Renée Turzanski; Damms-Machado, Antje; Kaaks, Rudolf

2017-11-01

Tumor-associated autoantibodies (AAbs), produced as an immune response to tumor-associated antigens (TAAs), are a novel pathway of early detection markers. We conducted a systematic review on AAbs and ovarian cancer to summarize the diagnostic performance of individual AAbs and AAb panels. A total of 29 studies including 85 AAbs were included; 27 of the studies were conducted in prevalent cases and cancer-free controls and 2 investigations included pre-diagnosis samples. The majority of studies were hypothesis-driven, evaluating AAbs to target TAAs; 10 studies used screening approaches such as serological expression cloning (SEREX) and nucleic acid-programmable protein arrays (NAPPA). The highest sensitivities for individual AAbs were reported for RhoGDI-AAbs (89.5%) and TUBA1C-AAbs (89%); however, specificity levels were relatively low (80% and 75%, respectively). High sensitivities at high specificities were reported for HOXA7-AAbs for detection of moderately differentiated ovarian tumors (66.7% sensitivity at 100% specificity) and IL8-AAbs in stage I-II ovarian cancer (65.5% sensitivity at 98% specificity). A panel of 11 AAbs (ICAM3, CTAG2, p53, STYXL1, PVR, POMC, NUDT11, TRIM39, UHMK1, KSR1, and NXF3) provided 45% sensitivity at 98% specificity for serous ovarian cancer, when at least 2 AAbs were above a threshold of 95% specificity. Twelve of the AAbs identified in this review were investigated in more than one study. Data on diagnostic discrimination by tumor histology and stage at diagnosis are sparse. Limited data suggest select AAb markers improve diagnostic discrimination when combined with markers such as CA125 and HE4. AAbs for ovarian cancer early detection is an emerging area, and large-scale, prospective investigations considering histology and stage are required for discovery and validation. However, data to date suggests panels of AAbs may eventually reach sufficient diagnostic discrimination to allow earlier detection of disease as a complement to existing markers and transvaginal ultrasound. Copyright © 2017. Published by Elsevier Inc.

Modifiable and non-modifiable factors associated with employment outcomes following spinal cord injury: A systematic review

PubMed Central

Trenaman, Logan; Miller, William C; Querée, Matthew; Escorpizo, Reuben

2015-01-01

Context Employment rates in individuals with spinal cord injury (SCI) are approximately 35%, which is considerably lower than that of the general population. In order to improve employment outcomes a clear understanding of what factors influence employment outcomes is needed. Objective To systematically review factors that are consistently and independently associated with employment outcomes in individuals with SCI, and to understand the magnitude of their influence. Methods Through an electronic search of MEDLINE/PubMed, EMBASE, CINAHL, PsycINFO, Social Science Abstracts and Social Work databases, we identified studies published between 1952–2014 that investigated factors associated with employment outcomes following SCI. Exclusion criteria included: (1) reviews (2) studies not published in English (3) studies not controlling for potential confounders through a regression analysis, or (4) studies not providing an effect measure in the form of OR, RR, or HR. Data were categorized based on the International Classification of Functioning, Disability and Health framework, with each domain sub-categorized by modifiability. First author, year of publication, sample size, explanatory and outcome variables, and effect measures were extracted. Results Thirty-nine studies met the inclusion criteria. Twenty modifiable and twelve non-modifiable factors have been investigated in the context of employment following SCI. Education, vocational rehabilitation, functional independence, social support, and financial disincentives were modifiable factors that have been consistently and independently associated with employment outcomes. Conclusion A number of key modifiable factors have been identified and can inform interventions aimed at improving employment outcomes for individuals with SCI. Future research should focus on determining which factors have the greatest effect on employment outcomes, in addition to developing and evaluating interventions targeted at these factors. PMID:25989899

Heuristics to Evaluate Interactive Systems for Children with Autism Spectrum Disorder (ASD)

PubMed Central

Khowaja, Kamran; Salim, Siti Salwah

2015-01-01

In this paper, we adapted and expanded a set of guidelines, also known as heuristics, to evaluate the usability of software to now be appropriate for software aimed at children with autism spectrum disorder (ASD). We started from the heuristics developed by Nielsen in 1990 and developed a modified set of 15 heuristics. The first 5 heuristics of this set are the same as those of the original Nielsen set, the next 5 heuristics are improved versions of Nielsen's, whereas the last 5 heuristics are new. We present two evaluation studies of our new heuristics. In the first, two groups compared Nielsen’s set with the modified set of heuristics, with each group evaluating two interactive systems. The Nielsen’s heuristics were assigned to the control group while the experimental group was given the modified set of heuristics, and a statistical analysis was conducted to determine the effectiveness of the modified set, the contribution of 5 new heuristics and the impact of 5 improved heuristics. The results show that the modified set is significantly more effective than the original, and we found a significant difference between the five improved heuristics and their corresponding heuristics in the original set. The five new heuristics are effective in problem identification using the modified set. The second study was conducted using a system which was developed to ascertain if the modified set was effective at identifying usability problems that could be fixed before the release of software. The post-study analysis revealed that the majority of the usability problems identified by the experts were fixed in the updated version of the system. PMID:26196385

The V471A Polymorphism in Autophagy-Related Gene ATG7 Modifies Age at Onset Specifically in Italian Huntington Disease Patients

PubMed Central

Metzger, Silke; Walter, Carolin; Riess, Olaf; Roos, Raymund A. C.; Nielsen, Jørgen E.; Craufurd, David; Nguyen, Huu Phuc

2013-01-01

The cause of Huntington disease (HD) is a polyglutamine repeat expansion of more than 36 units in the huntingtin protein, which is inversely correlated with the age at onset of the disease. However, additional genetic factors are believed to modify the course and the age at onset of HD. Recently, we identified the V471A polymorphism in the autophagy-related gene ATG7, a key component of the autophagy pathway that plays an important role in HD pathogenesis, to be associated with the age at onset in a large group of European Huntington disease patients. To confirm this association in a second independent patient cohort, we analysed the ATG7 V471A polymorphism in additional 1,464 European HD patients of the “REGISTRY” cohort from the European Huntington Disease Network (EHDN). In the entire REGISTRY cohort we could not confirm a modifying effect of the ATG7 V471A polymorphism. However, analysing a modifying effect of ATG7 in these REGISTRY patients and in patients of our previous HD cohort according to their ethnic origin, we identified a significant effect of the ATG7 V471A polymorphism on the HD age at onset only in the Italian population (327 patients). In these Italian patients, the polymorphism is associated with a 6-years earlier disease onset and thus seems to have an aggravating effect. We could specify the role of ATG7 as a genetic modifier for HD particularly in the Italian population. This result affirms the modifying influence of the autophagic pathway on the course of HD, but also suggests population-specific modifying mechanisms in HD pathogenesis. PMID:23894380

Clinical relevance of the modified physical performance test versus the short physical performance battery for detecting mobility impairments in older men with peripheral arterial disease.

PubMed

Addison, Odessa; Kundi, Rishi; Ryan, Alice S; Goldberg, Andrew P; Patel, Richa; Lal, Brajesh K; Prior, Steven J

2017-08-23

The study is to compare the Modified Physical Performance Test (MPPT) and Short Physical Performance Battery (SPPB) as metrics of mobility and function in older men with peripheral arterial disease (PAD). A total of 51 men (55-87 years) with PAD underwent functional testing including the SPPB, MPPT, Walking Impairment Questionnaire (WIQ), stair ascent, and 6-min walk distance. Individuals were grouped according to SPPB and MPPT scores as not limited on either, limited only on the MPPT, or limited on both. The MPPT identified a higher proportion of patients as being functionally limited than the SPPB (p < 0.001). Men identified as limited only by the MPPT, and not the SPPB, were subsequently confirmed to have lower function on all measures compared to those not identified as limited by either the SPPB or the MPPT (p < 0.02). These findings suggest the MPPT is an appropriate measure to identify early declines in men with PAD and may identify global disability better than SPPB. Implications for rehabilitation Individuals with peripheral arterial disease have low activity levels and are at risk for a loss of independence and global disability. Early detection of decline in mobility and global function would allow for interventions before large changes in ambulatory ability or a loss of functional independence occur. This study shows the Modified Physical Performance Test may be an appropriate test to identify early decline in function in men with peripheral arterial disease.

Fisher: a program for the detection of H/ACA snoRNAs using MFE secondary structure prediction and comparative genomics - assessment and update.

PubMed

Freyhult, Eva; Edvardsson, Sverker; Tamas, Ivica; Moulton, Vincent; Poole, Anthony M

2008-07-21

The H/ACA family of small nucleolar RNAs (snoRNAs) plays a central role in guiding the pseudouridylation of ribosomal RNA (rRNA). In an effort to systematically identify the complete set of rRNA-modifying H/ACA snoRNAs from the genome sequence of the budding yeast, Saccharomyces cerevisiae, we developed a program - Fisher - and previously presented several candidate snoRNAs based on our analysis 1. In this report, we provide a brief update of this work, which was aborted after the publication of experimentally-identified snoRNAs 2 identical to candidates we had identified bioinformatically using Fisher. Our motivation for revisiting this work is to report on the status of the candidate snoRNAs described in 1, and secondly, to report that a modified version of Fisher together with the available multiple yeast genome sequences was able to correctly identify several H/ACA snoRNAs for modification sites not identified by the snoGPS program 3. While we are no longer developing Fisher, we briefly consider the merits of the Fisher algorithm relative to snoGPS, which may be of use for workers considering pursuing a similar search strategy for the identification of small RNAs. The modified source code for Fisher is made available as supplementary material. Our results confirm the validity of using minimum free energy (MFE) secondary structure prediction to guide comparative genomic screening for RNA families with few sequence constraints.

Autonomic nervous system involvement in pulmonary arterial hypertension.

PubMed

Vaillancourt, Mylène; Chia, Pamela; Sarji, Shervin; Nguyen, Jason; Hoftman, Nir; Ruffenach, Gregoire; Eghbali, Mansoureh; Mahajan, Aman; Umar, Soban

2017-12-04

Pulmonary arterial hypertension (PAH) is a chronic pulmonary vascular disease characterized by increased pulmonary vascular resistance (PVR) leading to right ventricular (RV) failure. Autonomic nervous system involvement in the pathogenesis of PAH has been demonstrated several years ago, however the extent of this involvement is not fully understood. PAH is associated with increased sympathetic nervous system (SNS) activation, decreased heart rate variability, and presence of cardiac arrhythmias. There is also evidence for increased renin-angiotensin-aldosterone system (RAAS) activation in PAH patients associated with clinical worsening. Reduction of neurohormonal activation could be an effective therapeutic strategy for PAH. Although therapies targeting adrenergic receptors or RAAS signaling pathways have been shown to reverse cardiac remodeling and improve outcomes in experimental pulmonary hypertension (PH)-models, the effectiveness and safety of such treatments in clinical settings have been uncertain. Recently, novel direct methods such as cervical ganglion block, pulmonary artery denervation (PADN), and renal denervation have been employed to attenuate SNS activation in PAH. In this review, we intend to summarize the multiple aspects of autonomic nervous system involvement in PAH and overview the different pharmacological and invasive strategies used to target autonomic nervous system for the treatment of PAH.

Robust low-bias negative differential resistance in graphene superlattices

NASA Astrophysics Data System (ADS)

Sattari-Esfahlan, S. M.; Fouladi-Oskuei, J.; Shojaei, S.

2017-06-01

In this work, we present a detailed theoretical study on the low bias current-voltage (I-V) characteristic of biased planar graphene superlattice (PGSL), provided by a heterostructured substrate and a series of grounded metallic planes placed over a graphene sheet, which induce a periodically modulated Dirac gap and Fermi velocity barrier, respectively. We investigate the effect of PGSL parameters on the I-V characteristic and the appearance of multipeak negative differential resistance (NDR) in the proposed device within the Landauer-Buttiker formalism and adopted transfer matrix method. Moreover‚ we propose a novel venue to control the NDR in PGSL with Fermi velocity barrier. Different regimes of NDR have been recognized, based on the PGSL parameters and external bias. From this viewpoint‚ we obtain multipeak NDR through miniband aligning in PGSL. The maximum pick to valley ratio (PVR) up to 167 obtained for ~{{\\upsilon}c} , the Fermi velocity correlation (ratio of Fermi velocity in barrier and well region), is 1.9 at bias voltages between 70-130 mV. Our findings have good agreement with experiments and can be considered in designing multi-valued memory‚ functional circuit, low power and high-speed nanoelectronic device applications.

Designing an Effective In-School Suspension Program.

ERIC Educational Resources Information Center

Morris, Robert C.; Howard, Angela C.

2003-01-01

Identifies four popular models of in-school suspension (ISS) and discusses research on modifying the behaviors of ISS students. Hopes that by identifying and analyzing successful ones educators can develop more insightful and effective programs. Considers how counseling makes a difference. (SG)

Estimating prefledging survival: Allowing for brood mixing and dependence among brood mates

USGS Publications Warehouse

Flint, Paul L.; Pollock, Kenneth H.; Thomas, Dana; Sedinger, James S.

1995-01-01

Estimates of juvenile survival from hatch to fledging provide important information on waterfowl productivity. We develop a model for estimating survival of young waterfowl from hatch to fledging. Our model enables interchange of individuals among broods and relaxes the assumption that individuals within broods have independent survival probabilities. The model requires repeated observations of individually identifiable adults and their offspring that are not individually identifiable. A modified Kaplan-Meier procedure (Pollock et al. 1989a,b) and a modified Mayfield procedure (Mayfield 1961, 1975; Johnson 1979) can be used under this general modeling framework, and survival rates and corresponding variances of the point estimators can be determined.

Identification of Swallowing Tasks from a Modified Barium Swallow Study That Optimize the Detection of Physiological Impairment

ERIC Educational Resources Information Center

Hazelwood, R. Jordan; Armeson, Kent E.; Hill, Elizabeth G.; Bonilha, Heather Shaw; Martin-Harris, Bonnie

2017-01-01

Purpose: The purpose of this study was to identify which swallowing task(s) yielded the worst performance during a standardized modified barium swallow study (MBSS) in order to optimize the detection of swallowing impairment. Method: This secondary data analysis of adult MBSSs estimated the probability of each swallowing task yielding the derived…

How To Modify a Trailer for Accessibility (Up to a Point) [and] Accessibility Considerations for Home Buyers. Key Notes.

ERIC Educational Resources Information Center

Access Group, Atlanta, GA.

Two brief fact sheets for people with disabilities provide information on: (1) modifying a trailer to make it accessible for persons with mobility impairments, especially those in wheelchairs, and (2) accessibility considerations for home buyers or home owners with mobility impairments. The first fact sheet identifies inherent problems in…

LABORATORY EVALUATION OF SIX NEW/MODIFIED PORTABLE X-RAY FLUORESCENCE SPECTROMETERS FOR THE MEASUREMENT OF LEAD IN CHARACTERIZED PAINT FILMS AND RESEARCH MATERIAL BOARDS (TECHNICAL REPORT)

EPA Science Inventory

A laboratory study was performed in 1994-1995 to identify and estimate the influence of key characteristics for evaluating the performance of portable X-ray fluorescence (XRF) spectrometers. Six new/modified spectrometers, including HNU SEFA-Pb, Metorex X-MET, Niton X-L, Radiat...

LABORATORY EVALUATION OF SIX NEW/MODIFIED PORTABLE X-RAY FLUORESCENCE SPECTROMETERS FOR THE MEASUREMENT OF LEAD IN CHARACTERIZED PAINT FILMS AND RESEARCH MATERIAL BOARDS (APPENDICES)

EPA Science Inventory

A laboratory study was performed in 1994-1995 to identify and estimate the influence of key characteristics for evaluating the performance of portable X-ray fluorescence (XRF) spectrometers. Six new/modified spectrometers, including HNU SEFA-Pb, Metorex X-MET, Niton X-L, Radiat...

The Concepts of PPBS and Approaches to Their Application.

ERIC Educational Resources Information Center

Fielden, John

The basic concepts of the classic PPBS are summarized, and then attention is directed toward the process by which this has been modified by its collision with the values of the university. The form taken by the new modified PPBS is examined and its component concepts and techniques are identified. It is concluded that the new PPBS has limitations…

Human Lamin B Contains a Farnesylated Cysteine Residue*

PubMed Central

Farnsworth, Christopher C.; Wolda, Sharon L.; Gelb, Michael H.; Glomset, John A.

2012-01-01

We recently showed that HeLa cell lamin B is modified by a mevalonic acid derivative. Here we identified the modified amino acid, determined its mode of link-age to the mevalonic acid derivative, and established the derivative’s structure. A cysteine residue is modified because experiments with lamin B that had been biosynthetically labeled with [3H] mevalonic acid or [35S] cysteine and then extensively digested with proteases yielded 3H- or 35S-labeled products that co-chromatographed in five successive systems. A thioether linkage rather than a thioester linkage is involved because the mevalonic acid derivative could be released from the 3H-labeled products in a pentane-extractable form by treatment with Raney nickel but not with methanolic KOH. The derivative is a farnesyl moiety because the Raney nickel-released material was identified as 2,6,10-trimethyl-2,6,10-dodecatriene by a combination of gas chromatography and mass spectrometry. The thioether-modified cysteine residue appears to be located near the carboxyl end of lamin B because treatment of 3H-labeled lamin B with cyanogen bromide yielded a single labeled polypeptide that mapped toward this end of the cDNA-inferred sequence of human lamin B. PMID:2684976

A risk-based classification scheme for genetically modified foods. I: Conceptual development.

PubMed

Chao, Eunice; Krewski, Daniel

2008-12-01

The predominant paradigm for the premarket assessment of genetically modified (GM) foods reflects heightened public concern by focusing on foods modified by recombinant deoxyribonucleic acid (rDNA) techniques, while foods modified by other methods of genetic modification are generally not assessed for safety. To determine whether a GM product requires less or more regulatory oversight and testing, we developed and evaluated a risk-based classification scheme (RBCS) for crop-derived GM foods. The results of this research are presented in three papers. This paper describes the conceptual development of the proposed RBCS that focuses on two categories of adverse health effects: (1) toxic and antinutritional effects, and (2) allergenic effects. The factors that may affect the level of potential health risks of GM foods are identified. For each factor identified, criteria for differentiating health risk potential are developed. The extent to which a GM food satisfies applicable criteria for each factor is rated separately. A concern level for each category of health effects is then determined by aggregating the ratings for the factors using predetermined aggregation rules. An overview of the proposed scheme is presented, as well as the application of the scheme to a hypothetical GM food.

Identification of liver protein targets modified by tienilic acid metabolites using a two-dimensional Western blot-mass spectrometry approach

NASA Astrophysics Data System (ADS)

Methogo, Ruth Menque; Dansette, Patrick M.; Klarskov, Klaus

2007-12-01

A combined approach based on two-dimensional electrophoresis-immuno-blotting and nanoliquid chromatography coupled on-line with electrospray ionization mass spectrometry (nLC-MS/MS) was used to identify proteins modified by a reactive intermediate of tienilic acid (TA). Liver homogenates from rats exposed to TA were fractionated using ultra centrifugation; four fractions were obtained and subjected to 2D electrophoresis. Following transfer to PVDF membranes, modified proteins were visualized after India ink staining, using an anti-serum raised against TA and ECL detection. Immuno-reactive spots were localized on the PVDF membrane by superposition of the ECL image, protein spots of interest were excised, digested on the membrane with trypsin followed by nLC-MS/MS analysis and protein identification. A total of 15 proteins were identified as likely targets modified by a TA reactive metabolite. These include selenium binding protein 2, senescence marker protein SMP-30, adenosine kinase, Acy1 protein, adenosylhomocysteinase, capping protein (actin filament), protein disulfide isomerase, fumarylacetoacetase, arginase chain A, ketohexokinase, proteasome endopeptidase complex, triosephosphate isomerase, superoxide dismutase, dna-type molecular chaperone hsc73 and malate dehydrogenase.

Identification of transformer fault based on dissolved gas analysis using hybrid support vector machine-modified evolutionary particle swarm optimisation

PubMed Central

2018-01-01

Early detection of power transformer fault is important because it can reduce the maintenance cost of the transformer and it can ensure continuous electricity supply in power systems. Dissolved Gas Analysis (DGA) technique is commonly used to identify oil-filled power transformer fault type but utilisation of artificial intelligence method with optimisation methods has shown convincing results. In this work, a hybrid support vector machine (SVM) with modified evolutionary particle swarm optimisation (EPSO) algorithm was proposed to determine the transformer fault type. The superiority of the modified PSO technique with SVM was evaluated by comparing the results with the actual fault diagnosis, unoptimised SVM and previous reported works. Data reduction was also applied using stepwise regression prior to the training process of SVM to reduce the training time. It was found that the proposed hybrid SVM-Modified EPSO (MEPSO)-Time Varying Acceleration Coefficient (TVAC) technique results in the highest correct identification percentage of faults in a power transformer compared to other PSO algorithms. Thus, the proposed technique can be one of the potential solutions to identify the transformer fault type based on DGA data on site. PMID:29370230

Identification of transformer fault based on dissolved gas analysis using hybrid support vector machine-modified evolutionary particle swarm optimisation.

PubMed

Illias, Hazlee Azil; Zhao Liang, Wee

2018-01-01

Early detection of power transformer fault is important because it can reduce the maintenance cost of the transformer and it can ensure continuous electricity supply in power systems. Dissolved Gas Analysis (DGA) technique is commonly used to identify oil-filled power transformer fault type but utilisation of artificial intelligence method with optimisation methods has shown convincing results. In this work, a hybrid support vector machine (SVM) with modified evolutionary particle swarm optimisation (EPSO) algorithm was proposed to determine the transformer fault type. The superiority of the modified PSO technique with SVM was evaluated by comparing the results with the actual fault diagnosis, unoptimised SVM and previous reported works. Data reduction was also applied using stepwise regression prior to the training process of SVM to reduce the training time. It was found that the proposed hybrid SVM-Modified EPSO (MEPSO)-Time Varying Acceleration Coefficient (TVAC) technique results in the highest correct identification percentage of faults in a power transformer compared to other PSO algorithms. Thus, the proposed technique can be one of the potential solutions to identify the transformer fault type based on DGA data on site.

The low chamber pancreatic cancer cells had stem-like characteristics in modified transwell system: is it a novel method to identify and enrich cancer stem-like cells?

PubMed

Wang, Dongqing; Zhu, Haitao; Liu, Yanfang; Liu, Qing; Xie, Xiaodong; Zhou, Yuepeng; Zhang, Lirong; Zhu, Yan; Zhang, Zhijian; Su, Zhaoliang

2014-01-01

Cancer stem cells (CSCs) or cancer-initiating cells (CICs) play an important role in tumor initiation, progression, metastasis, chemoresistance, and recurrence. It is important to construct an effective method to identify and isolate CSCs for biotherapy of cancer. During the past years, many researchers had paid more attention to it; however, this method was still on seeking. Therefore, compared to the former methods that were used to isolate the cancer stem cell, in the present study, we tried to use modified transwell system to isolate and enrich CSCs from human pancreatic cancer cell lines (Panc-1). Our results clearly showed that the lower chamber cells in modified transwell system were easily forming spheres; furthermore, these spheres expressed high levels of stem cell markers (CD133/CD44/CD24/Oct-4/ESA) and exhibited chemoresistance, underwent epithelial-to-mesenchymal transition (EMT), and possessed the properties of self-renewal in vitro and tumorigenicity in vivo. Therefore, we speculated that modified transwell assay system, as a rapid and effective method, can be used to isolate and enrich CSCs.

Modified screening and ranking algorithm for copy number variation detection.

PubMed

Xiao, Feifei; Min, Xiaoyi; Zhang, Heping

2015-05-01

Copy number variation (CNV) is a type of structural variation, usually defined as genomic segments that are 1 kb or larger, which present variable copy numbers when compared with a reference genome. The screening and ranking algorithm (SaRa) was recently proposed as an efficient approach for multiple change-points detection, which can be applied to CNV detection. However, some practical issues arise from application of SaRa to single nucleotide polymorphism data. In this study, we propose a modified SaRa on CNV detection to address these issues. First, we use the quantile normalization on the original intensities to guarantee that the normal mean model-based SaRa is a robust method. Second, a novel normal mixture model coupled with a modified Bayesian information criterion is proposed for candidate change-point selection and further clustering the potential CNV segments to copy number states. Simulations revealed that the modified SaRa became a robust method for identifying change-points and achieved better performance than the circular binary segmentation (CBS) method. By applying the modified SaRa to real data from the HapMap project, we illustrated its performance on detecting CNV segments. In conclusion, our modified SaRa method improves SaRa theoretically and numerically, for identifying CNVs with high-throughput genotyping data. The modSaRa package is implemented in R program and freely available at http://c2s2.yale.edu/software/modSaRa. Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Large-scale functional RNAi screen in C. elegans identifies genes that regulate the dysfunction of mutant polyglutamine neurons

PubMed Central

2012-01-01

Background A central goal in Huntington's disease (HD) research is to identify and prioritize candidate targets for neuroprotective intervention, which requires genome-scale information on the modifiers of early-stage neuron injury in HD. Results Here, we performed a large-scale RNA interference screen in C. elegans strains that express N-terminal huntingtin (htt) in touch receptor neurons. These neurons control the response to light touch. Their function is strongly impaired by expanded polyglutamines (128Q) as shown by the nearly complete loss of touch response in adult animals, providing an in vivo model in which to manipulate the early phases of expanded-polyQ neurotoxicity. In total, 6034 genes were examined, revealing 662 gene inactivations that either reduce or aggravate defective touch response in 128Q animals. Several genes were previously implicated in HD or neurodegenerative disease, suggesting that this screen has effectively identified candidate targets for HD. Network-based analysis emphasized a subset of high-confidence modifier genes in pathways of interest in HD including metabolic, neurodevelopmental and pro-survival pathways. Finally, 49 modifiers of 128Q-neuron dysfunction that are dysregulated in the striatum of either R/2 or CHL2 HD mice, or both, were identified. Conclusions Collectively, these results highlight the relevance to HD pathogenesis, providing novel information on the potential therapeutic targets for neuroprotection in HD. PMID:22413862

Large-scale functional RNAi screen in C. elegans identifies genes that regulate the dysfunction of mutant polyglutamine neurons.

PubMed

Lejeune, François-Xavier; Mesrob, Lilia; Parmentier, Frédéric; Bicep, Cedric; Vazquez-Manrique, Rafael P; Parker, J Alex; Vert, Jean-Philippe; Tourette, Cendrine; Neri, Christian

2012-03-13

A central goal in Huntington's disease (HD) research is to identify and prioritize candidate targets for neuroprotective intervention, which requires genome-scale information on the modifiers of early-stage neuron injury in HD. Here, we performed a large-scale RNA interference screen in C. elegans strains that express N-terminal huntingtin (htt) in touch receptor neurons. These neurons control the response to light touch. Their function is strongly impaired by expanded polyglutamines (128Q) as shown by the nearly complete loss of touch response in adult animals, providing an in vivo model in which to manipulate the early phases of expanded-polyQ neurotoxicity. In total, 6034 genes were examined, revealing 662 gene inactivations that either reduce or aggravate defective touch response in 128Q animals. Several genes were previously implicated in HD or neurodegenerative disease, suggesting that this screen has effectively identified candidate targets for HD. Network-based analysis emphasized a subset of high-confidence modifier genes in pathways of interest in HD including metabolic, neurodevelopmental and pro-survival pathways. Finally, 49 modifiers of 128Q-neuron dysfunction that are dysregulated in the striatum of either R/2 or CHL2 HD mice, or both, were identified. Collectively, these results highlight the relevance to HD pathogenesis, providing novel information on the potential therapeutic targets for neuroprotection in HD. © 2012 Lejeune et al; licensee BioMed Central Ltd.

A Novel Proteomics Approach to Identify SUMOylated Proteins and Their Modification Sites in Human Cells*

PubMed Central

Galisson, Frederic; Mahrouche, Louiza; Courcelles, Mathieu; Bonneil, Eric; Meloche, Sylvain; Chelbi-Alix, Mounira K.; Thibault, Pierre

2011-01-01

The small ubiquitin-related modifier (SUMO) is a small group of proteins that are reversibly attached to protein substrates to modify their functions. The large scale identification of protein SUMOylation and their modification sites in mammalian cells represents a significant challenge because of the relatively small number of in vivo substrates and the dynamic nature of this modification. We report here a novel proteomics approach to selectively enrich and identify SUMO conjugates from human cells. We stably expressed different SUMO paralogs in HEK293 cells, each containing a His6 tag and a strategically located tryptic cleavage site at the C terminus to facilitate the recovery and identification of SUMOylated peptides by affinity enrichment and mass spectrometry. Tryptic peptides with short SUMO remnants offer significant advantages in large scale SUMOylome experiments including the generation of paralog-specific fragment ions following CID and ETD activation, and the identification of modified peptides using conventional database search engines such as Mascot. We identified 205 unique protein substrates together with 17 precise SUMOylation sites present in 12 SUMO protein conjugates including three new sites (Lys-380, Lys-400, and Lys-497) on the protein promyelocytic leukemia. Label-free quantitative proteomics analyses on purified nuclear extracts from untreated and arsenic trioxide-treated cells revealed that all identified SUMOylated sites of promyelocytic leukemia were differentially SUMOylated upon stimulation. PMID:21098080

Pharmacological profiling of zebrafish behavior using chemical and genetic classification of sleep-wake modifiers.

PubMed

Nishimura, Yuhei; Okabe, Shiko; Sasagawa, Shota; Murakami, Soichiro; Ashikawa, Yoshifumi; Yuge, Mizuki; Kawaguchi, Koki; Kawase, Reiko; Tanaka, Toshio

2015-01-01

Sleep-wake states are impaired in various neurological disorders. Impairment of sleep-wake states can be an early condition that exacerbates these disorders. Therefore, treating sleep-wake dysfunction may prevent or slow the development of these diseases. Although many gene products are likely to be involved in the sleep-wake disturbance, hypnotics and psychostimulants clinically used are limited in terms of their mode of action and are not without side effects. Therefore, there is a growing demand for developing new hypnotics and psychostimulants with high efficacy and few side effects. Toward this end, animal models are indispensable for use in genetic and chemical screens to identify sleep-wake modifiers. As a proof-of-concept study, we performed behavioral profiling of zebrafish treated with chemical and genetic sleep-wake modifiers. We were able to demonstrate that behavioral profiling of zebrafish treated with hypnotics or psychostimulants from 9 to 10 days post-fertilization was sufficient to identify drugs with specific modes of action. We were also able to identify behavioral endpoints distinguishing GABA-A modulators and hypocretin (hcrt) receptor antagonists and between sympathomimetic and non-sympathomimetic psychostimulants. This behavioral profiling can serve to identify genes related to sleep-wake disturbance associated with various neuropsychiatric diseases and novel therapeutic compounds for insomnia and excessive daytime sleep with fewer adverse side effects.

Identification of prohibitin 1 as a potential prognostic biomarker in human pancreatic carcinoma using modified aqueous two-phase partition system combined with 2D-MALDI-TOF-TOF-MS/MS.

PubMed

Zhong, Ning; Cui, Yazhou; Zhou, Xiaoyan; Li, Tianliang; Han, Jinxiang

2015-02-01

Membrane proteins are an important source of potential targets for anticancer drugs or biomarkers for early diagnosis. In this study, we used a modified aqueous two-phase partition system combined with two-dimensional (2D) matrix-assisted laser desorption ionization (MALDI) time of flight (TOF) mass spectrometry (MS, 2D-MALDI-TOF-TOF-MS/MS) analysis to isolate and identify membrane proteins in PANC-1 pancreatic cancer cells. Using this method, we identified 55 proteins, of which 31 (56.4 %) were membrane proteins, which, according to gene ontology annotation, are associated with various cellular processes including cell signal transduction, differentiation, and apoptosis. Immunohistochemical analysis showed that the expression level of one of the identified mitochondria membrane proteins, prohibitin 1 (PHB1), is correlated with pancreatic carcinoma differentiation; PHB1 is expressed at a higher level in normal pancreatic tissue than in well-differentiated carcinoma tissue. Further studies showed that PHB1 plays a proapoptotic role in human pancreatic cancer cells, which suggests that PHB1 has antitumorigenic properties. In conclusion, we have provided a modified method for isolating and identifying membrane proteins and demonstrated that PHB1 may be a promising biomarker for early diagnosis and therapy of pancreatic (and potentially other) cancers.

Using spiritually modified cognitive-behavioral therapy in substance dependence treatment: therapists' and clients' perceptions of the presumed benefits and limitations.

PubMed

Hodge, David R; Lietz, Cynthia A

2014-11-01

Cognitive-behavioral therapy (CBT) that has been modified to incorporate clients' spiritual beliefs and practices has been used to treat a variety of problems. This study examines the utility of this modality with the treatment of alcohol dependence and other forms of substance abuse. Toward this end, six focus groups (three therapist groups and three client groups) were conducted to identify the presumed benefits and limitations of using spiritually modified CBT in substance dependence treatment. In terms of benefits, spiritually modified CBT was perceived to enhance outcomes through operationalizing horizontal and vertical sources of social support, divine coping resources, and spiritual motivation. Potential challenges include the risk of therapists inadvertently imposing their own beliefs during the modification process and the possibility of offending clients when conflicts in belief systems emerge, particularly in group setting. The article concludes by providing suggestions for incorporating spiritually modified CBT into treatment and develops a number of illustrative examples of spiritually modified CBT self-statements.

[Safety and effect of transurethral holmium laser enucleation of the prostate versus bipolar transurethral plasmakinetic prostatectomy for benign prostatic hyperplasia: A meta-analysis].

PubMed

Guo, Qiang; Xiao, Yi; Li, Jian-Wen; Zhang, Jian-Dong; Zhang, Yan-Gang

2016-10-01

To evaluate the safety and effect of transurethral holmium laser enucleation of the prostate (HoLEP) in comparison with bipolar transurethral plasmakinetic prostatectomy (TUPKP) in the treatment of benign prostatic hyperplasia (BPH). We searched the databases of PubMed, SCI, Ovid, The Cochrane Library, CNKI, CBM, VIP, and Wangfang Data for controlled clinical trials about HoLEP versus TUPKP in the treatment of BPH published up to April 2016. The studies were screened according to the inclusion and exclusion criteria, the data extracted, and their quality evaluated by 2 reviewers independently, followed by a meta-analysis using the RevMan 5.3 software. A total of 7 studies were included, involving 2031 cases. In comparison with TUPKP, HoLEP showed significantly longer operation time (WMD = 24.61, 95% CI 11.88, 37.34, P lt; 0.001), shorter hospital stay (WMD =－1.91, 95% CI －3.74, －0.07, P = 0.04), shorter bladder irrigation time (WMD = －21.50, 95% CI －34.95, －8.06, P = 0.002), shorter catheter-indwelling time (WMD = －27.60, 95% CI －48.17, －7.03, P = 0.009), less hemoglobin loss (WMD = － 0.42, 95% CI －0.78, －0.07, P = 0.02); lower postvoid residual urine (PVR) at 3 months (WMD = －3.35, 95% CI －4.46, －2.23, P<0.001) and 6 months after surgery (WMD =－1.11, 95% CI －2.18, －0.05, P = 0.04); higher maximum urinary flow rate (Qmax) (WMD = 0.42, 95% CI 0.04, 0.80, P = 0.03) and fewer urinary tract irritation symptoms (OR =0.58, 95% CI 0.41, 0.81, P = 0.002) at 12 months after surgery. No statistically significant differences were found between the two groups in the volume of resected tissue, serum sodium reduction, urethral stricture, erectile dysfunction, retrograde ejaculation, or transient urinary incontinence (P>0.05), or in the improvement of the quality of life (QoL) at 1, 3 and 12 months, International Prostate Symptom Score (IPSS) at 1, 3, 6 and 12 months, Qmax at 1, 3 and 6 months, or International Index of Erectile Function-5 (IIEF-5) at 6 months after surgery (P>0.05). HoLEP is preferred to TUPKP in clinical application for its advantages of higher Qmax at 12 months after surgery, lower PVR at 3 and 6 months, higher peri-operative safety, faster recovery, and fewer urinary tract irritation symptoms. However, for the quantity and quality limitations of the included publications, our findings are to be further supported by large-sample, multi-center, and high-quality prospective controlled clinical studies.

The Influence of Genetics on Cystic Fibrosis Phenotypes

PubMed Central

Knowles, Michael R.; Drumm, Mitchell

2012-01-01

Technological advances in genetics have made feasible and affordable large studies to identify genetic variants that cause or modify a trait. Genetic studies have been carried out to assess variants in candidate genes, as well as polymorphisms throughout the genome, for their associations with heritable clinical outcomes of cystic fibrosis (CF), such as lung disease, meconium ileus, and CF-related diabetes. The candidate gene approach has identified some predicted relationships, while genome-wide surveys have identified several genes that would not have been obvious disease-modifying candidates, such as a methionine sulfoxide transferase gene that influences intestinal obstruction, or a region on chromosome 11 proximate to genes encoding a transcription factor and an apoptosis controller that associates with lung function. These unforeseen associations thus provide novel insight into disease pathophysiology, as well as suggesting new therapeutic strategies for CF. PMID:23209180

The Interrater Reliability of the Modified Gait Abnormality Rating Scale for Use with People with Intellectual Disability

ERIC Educational Resources Information Center

Hale, Leigh; McIlraith, Lucy; Miller, Clare; Stanley-Clarke, Terri; George, Rebecca

2010-01-01

Background: Researching falls in persons with ID is limited by difficulties in applying standardised balance outcome measures. The modified Gait Abnormality Rating Scale (GARS-M), developed to identify falls risk in older adults, requires only that the participant walks and thus may be a feasible falls research tool to use with people with ID. In…

The Effect of Modifying the Traditional Public School Calendar on Student Achievement in English and Mathematics in Selected School Populations in Hawaii

ERIC Educational Resources Information Center

Anderson, John Albert

2009-01-01

This quasi-experimental study strives to ascertain whether the change from a public school traditional calendar to a modified or year-round calendar effects academic achievement in English and mathematics. The twelve public elementary schools, not U.S. Department of Defense schools, in the core of this research are identified only as serving…

Convective and stratiform components of a Winter Monsoon Cloud Cluster determined from geosynchronous infrared satellite data

NASA Technical Reports Server (NTRS)

Goldenberg, Stanley B.; Houze, Robert A., Jr.; Churchill, Dean D.

1990-01-01

The horizontal precipitation structure of cloud clusters observed over the South China Sea during the Winter Monsoon Experiment (WMONEX) is analyzed using a convective-stratiform technique (CST) developed by Adler and Negri (1988). The technique was modified by altering the method for identifying convective cells in the satellite data, accounting for the extremely cold cloud tops characteristic of the WMONEX region, and modifying the threshold infrared temperature for the boundary of the stratiform rain area. The precipitation analysis was extended to the entire history of the cloud cluster by applying the modified CST to IR imagery from geosynchronous-satellite observations. The ship and aircraft data from the later period of the cluster's lifetime make it possible to check the locations of convective and stratiform precipitation identified by the CST using in situ observations. The extended CST is considered to be effective for determining the climatology of the convective-stratiform structure of tropical cloud clusters.