Aging effects on DNA methylation modules in human brain and blood tissue
2012-01-01
Background Several recent studies reported aging effects on DNA methylation levels of individual CpG dinucleotides. But it is not yet known whether aging-related consensus modules, in the form of clusters of correlated CpG markers, can be found that are present in multiple human tissues. Such a module could facilitate the understanding of aging effects on multiple tissues. Results We therefore employed weighted correlation network analysis of 2,442 Illumina DNA methylation arrays from brain and blood tissues, which enabled the identification of an age-related co-methylation module. Module preservation analysis confirmed that this module can also be found in diverse independent data sets. Biological evaluation showed that module membership is associated with Polycomb group target occupancy counts, CpG island status and autosomal chromosome location. Functional enrichment analysis revealed that the aging-related consensus module comprises genes that are involved in nervous system development, neuron differentiation and neurogenesis, and that it contains promoter CpGs of genes known to be down-regulated in early Alzheimer's disease. A comparison with a standard, non-module based meta-analysis revealed that selecting CpGs based on module membership leads to significantly increased gene ontology enrichment, thus demonstrating that studying aging effects via consensus network analysis enhances the biological insights gained. Conclusions Overall, our analysis revealed a robustly defined age-related co-methylation module that is present in multiple human tissues, including blood and brain. We conclude that blood is a promising surrogate for brain tissue when studying the effects of age on DNA methylation profiles. PMID:23034122
NASA Astrophysics Data System (ADS)
Sokol, Anna M.; Cruet-Hennequart, Séverine; Pasero, Philippe; Carty, Michael P.
2013-11-01
Human cells lacking DNA polymerase η (polη) are sensitive to platinum-based cancer chemotherapeutic agents. Using DNA combing to directly investigate the role of polη in bypass of platinum-induced DNA lesions in vivo, we demonstrate that nascent DNA strands are up to 39% shorter in human cells lacking polη than in cells expressing polη. This provides the first direct evidence that polη modulates replication fork progression in vivo following cisplatin and carboplatin treatment. Severe replication inhibition in individual platinum-treated polη-deficient cells correlates with enhanced phosphorylation of the RPA2 subunit of replication protein A on serines 4 and 8, as determined using EdU labelling and immunofluorescence, consistent with formation of DNA strand breaks at arrested forks in the absence of polη. Polη-mediated bypass of platinum-induced DNA lesions may therefore represent one mechanism by which cancer cells can tolerate platinum-based chemotherapy.
Steinritz, Dirk; Schmidt, Annette; Balszuweit, Frank; Thiermann, Horst; Simons, Thilo; Striepling, Enno; Bölck, Birgit; Bloch, Wilhelm
2016-02-26
Victims that were exposed to the chemical warfare agent sulfur mustard (SM) suffer from chronic dermal and ocular lesions, severe pulmonary problems and cancer development. It has been proposed that epigenetic perturbations might be involved in that process but this has not been investigated so far. In this study, we investigated epigenetic modulations in vitro using early endothelial cells (EEC) that were exposed to different SM concentrations (0.5, 1.0, 23.5 and 50μM). A comprehensive analysis of 78 genes related to epigenetic pathways (i.e., DNA-methylation and post-translational histone modifications) was performed. Moreover, we analyzed global DNA methylation in vitro in EEC after SM exposure as a maker for epigenetic modulations and in vivo using human skin samples that were obtained from a patient 1 year after an accidently exposure to pure SM. SM exposure resulted in a complex regulation pattern of epigenetic modulators which was accompanied by a global increase of DNA methylation in vitro. Examination of the SM exposed human skin samples also revealed a significant increase of global DNA methylation in vivo, underlining the biological relevance of our findings. Thus, we demonstrated for the first time that SM affects epigenetic pathways and causes epigenetic modulations both in vivo and in vitro. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Folate, colorectal cancer and the involvement of DNA methylation.
Williams, Elizabeth A
2012-11-01
Diet is a major factor in the aetiology of colorectal cancer (CRC). Epidemiological evidence suggests that folate confers a modest protection against CRC risk. However, the relationship is complex, and evidence from human intervention trials and animal studies suggests that a high-dose of folic acid supplementation may enhance the risk of colorectal carcinogenesis in certain circumstances. The molecular mechanisms underlying the apparent dual modulatory effect of folate on colorectal carcinogenesis are not fully understood. Folate is central to C1 metabolism and is needed for both DNA synthesis and DNA methylation, providing plausible biological mechanisms through which folate could modulate cancer risk. Aberrant DNA methylation is an early event in colorectal carcinogenesis and is typically associated with the transcriptional silencing of tumour suppressor genes. Folate is required for the production of S-adenosyl methionine, which serves as a methyl donor for DNA methylation events; thereby folate availability is proposed to modulate DNA methylation status. The evidence for an effect of folate on DNA methylation in the human colon is limited, but a modulation of DNA methylation in response to folate has been demonstrated. More research is required to clarify the optimum intake of folate for CRC prevention and to elucidate the effect of folate availability on DNA methylation and the associated impact on CRC biology.
Zhao, Ming-Tao; Shao, Ning-Yi; Hu, Shijun; Ma, Ning; Srinivasan, Rajini; Jahanbani, Fereshteh; Lee, Jaecheol; Zhang, Sophia L; Snyder, Michael P; Wu, Joseph C
2017-11-10
Regulatory DNA elements in the human genome play important roles in determining the transcriptional abundance and spatiotemporal gene expression during embryonic heart development and somatic cell reprogramming. It is not well known how chromatin marks in regulatory DNA elements are modulated to establish cell type-specific gene expression in the human heart. We aimed to decipher the cell type-specific epigenetic signatures in regulatory DNA elements and how they modulate heart-specific gene expression. We profiled genome-wide transcriptional activity and a variety of epigenetic marks in the regulatory DNA elements using massive RNA-seq (n=12) and ChIP-seq (chromatin immunoprecipitation combined with high-throughput sequencing; n=84) in human endothelial cells (CD31 + CD144 + ), cardiac progenitor cells (Sca-1 + ), fibroblasts (DDR2 + ), and their respective induced pluripotent stem cells. We uncovered 2 classes of regulatory DNA elements: class I was identified with ubiquitous enhancer (H3K4me1) and promoter (H3K4me3) marks in all cell types, whereas class II was enriched with H3K4me1 and H3K4me3 in a cell type-specific manner. Both class I and class II regulatory elements exhibited stimulatory roles in nearby gene expression in a given cell type. However, class I promoters displayed more dominant regulatory effects on transcriptional abundance regardless of distal enhancers. Transcription factor network analysis indicated that human induced pluripotent stem cells and somatic cells from the heart selected their preferential regulatory elements to maintain cell type-specific gene expression. In addition, we validated the function of these enhancer elements in transgenic mouse embryos and human cells and identified a few enhancers that could possibly regulate the cardiac-specific gene expression. Given that a large number of genetic variants associated with human diseases are located in regulatory DNA elements, our study provides valuable resources for deciphering the epigenetic modulation of regulatory DNA elements that fine-tune spatiotemporal gene expression in human cardiac development and diseases. © 2017 American Heart Association, Inc.
Sequences in the intergenic spacer influence RNA Pol I transcription from the human rRNA promoter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, W.M.; Sylvester, J.E.
1994-09-01
In most eucaryotic species, ribosomal genes are tandemly repeated about 100-5000 times per haploid genome. The 43 Kb human rDNA repeat consists of a 13 Kb coding region for the 18S, 5.8S, 28S ribosomal RNAs (rRNAs) and transcribed spacers separated by a 30 Kb intergenic spacer. For species such as frog, mouse and rat, sequences in the intergenic spacer other than the gene promoter have been shown to modulate transcription of the ribosomal gene. These sequences are spacer promoters, enhancers and the terminator for spacer transcription. We are addressing whether the human ribosomal gene promoter is similarly influenced. In-vitro transcriptionmore » run-off assays have revealed that the 4.5 kb region (CBE), directly upstream of the gene promoter, has cis-stimulation and trans-competition properties. This suggests that the CBE fragment contains an enhancer(s) for ribosomal gene transcription. Further experiments have shown that a fragment ({approximately}1.6 kb) within the CBE fragment also has trans-competition function. Deletion subclones of this region are being tested to delineate the exact sequences responsible for these modulating activities. Previous sequence analysis and functional studies have revealed that CBE contains regions of DNA capable of adopting alternative structures such as bent DNA, Z-DNA, and triple-stranded DNA. Whether these structures are required for modulating transcription remains to be determined as does the specific DNA-protein interaction involved.« less
Modulation of DNA methylation by human papillomavirus E6 and E7 oncoproteins in cervical cancer
Sen, Prakriti; Ganguly, Pooja; Ganguly, Niladri
2018-01-01
Human papillomaviruses (HPVs) are double stranded circular DNA viruses that infect cutaneous and mucosal epithelial cells. Almost 99% of cervical cancer has a HPV infection. The early oncoproteins E6 and E7 are important in this cellular transformation process. Epigenetic mechanisms have long been known to result in decisive alterations in DNA, leading to alterations in DNA-protein interactions, alterations in chromatin structure and compaction and significant alterations in gene expression. The enzymes responsible for these epigenetic modifications are DNA methyl transferases (DNMTs), histone acetylases and deacetylases. Epigenetics has an important role in cancer development by modifying the cellular micro environment. In this review, the authors discuss the role of HPV oncoproteins E6 and E7 in modulating the epigenetic mechanisms inside the host cell. The oncoproteins induce the expression of DNMTs which lead to aberrant DNA methylations and disruption of the normal epigenetic processes. The E7 oncoprotein may additionally directly bind and induce methyl transferase activity of the enzyme. These modulations lead to altered gene expression levels, particularly the genes involved in apoptosis, cell cycle and cell adhesion. In addition, the present review discusses how epigenetic mechanisms may be targeted for possible therapeutic interventions for HPV mediated cervical cancer. PMID:29285184
Structures of transcription pre-initiation complex with TFIIH and Mediator.
Schilbach, S; Hantsche, M; Tegunov, D; Dienemann, C; Wigge, C; Urlaub, H; Cramer, P
2017-11-09
For the initiation of transcription, RNA polymerase II (Pol II) assembles with general transcription factors on promoter DNA to form the pre-initiation complex (PIC). Here we report cryo-electron microscopy structures of the Saccharomyces cerevisiae PIC and PIC-core Mediator complex at nominal resolutions of 4.7 Å and 5.8 Å, respectively. The structures reveal transcription factor IIH (TFIIH), and suggest how the core and kinase TFIIH modules function in the opening of promoter DNA and the phosphorylation of Pol II, respectively. The TFIIH core subunit Ssl2 (a homologue of human XPB) is positioned on downstream DNA by the 'E-bridge' helix in TFIIE, consistent with TFIIE-stimulated DNA opening. The TFIIH kinase module subunit Tfb3 (MAT1 in human) anchors the kinase Kin28 (CDK7), which is mobile in the PIC but preferentially located between the Mediator hook and shoulder in the PIC-core Mediator complex. Open spaces between the Mediator head and middle modules may allow access of the kinase to its substrate, the C-terminal domain of Pol II.
AP1 Keeps Chromatin Poised for Action | Center for Cancer Research
The human genome harbors gene-encoding DNA, the blueprint for building proteins that regulate cellular function. Embedded across the genome, in non-coding regions, are DNA elements to which regulatory factors bind. The interaction of regulatory factors with DNA at these sites modifies gene expression to modulate cell activity. In cells, DNA exists in a complex with proteins
[Transcription activator-like effectors(TALEs)based genome engineering].
Zhao, Mei-Wei; Duan, Cheng-Li; Liu, Jiang
2013-10-01
Systematic reverse-engineering of functional genome architecture requires precise modifications of gene sequences and transcription levels. The development and application of transcription activator-like effectors(TALEs) has created a wealth of genome engineering possibilities. TALEs are a class of naturally occurring DNA-binding proteins found in the plant pathogen Xanthomonas species. The DNA-binding domain of each TALE typically consists of tandem 34-amino acid repeat modules rearranged according to a simple cipher to target new DNA sequences. Customized TALEs can be used for a wide variety of genome engineering applications, including transcriptional modulation and genome editing. Such "genome engineering" has now been established in human cells and a number of model organisms, thus opening the door to better understanding gene function in model organisms, improving traits in crop plants and treating human genetic disorders.
Advances in the understanding of mitochondrial DNA as a pathogenic factor in inflammatory diseases
Boyapati, Ray K.; Tamborska, Arina; Dorward, David A.; Ho, Gwo-Tzer
2017-01-01
Mitochondrial DNA (mtDNA) has many similarities with bacterial DNA because of their shared common ancestry. Increasing evidence demonstrates mtDNA to be a potent danger signal that is recognised by the innate immune system and can directly modulate the inflammatory response. In humans, elevated circulating mtDNA is found in conditions with significant tissue injury such as trauma and sepsis and increasingly in chronic organ-specific and systemic illnesses such as steatohepatitis and systemic lupus erythematosus. In this review, we examine our current understanding of mtDNA-mediated inflammation and how the mechanisms regulating mitochondrial homeostasis and mtDNA release represent exciting and previously under-recognised important factors in many human inflammatory diseases, offering many new translational opportunities. PMID:28299196
Maternal nutrition at conception modulates DNA methylation of human metastable epialleles
USDA-ARS?s Scientific Manuscript database
In experimental animals, maternal diet during the periconceptional period influences the establishment of DNA methylation at metastable epialleles in the offspring, with permanent phenotypic consequences. Pronounced naturally occurring seasonal differences in the diet of rural Gambian women allowed ...
NASA Technical Reports Server (NTRS)
Chang, Dong Kyung; Metzgar, David; Wills, Christopher; Boland, C. Richard
2003-01-01
All "minor" components of the human DNA mismatch repair (MMR) system-MSH3, MSH6, PMS2, and the recently discovered MLH3-contain mononucleotide microsatellites in their coding sequences. This intriguing finding contrasts with the situation found in the major components of the DNA MMR system-MSH2 and MLH1-and, in fact, most human genes. Although eukaryotic genomes are rich in microsatellites, non-triplet microsatellites are rare in coding regions. The recurring presence of exonal mononucleotide repeat sequences within a single family of human genes would therefore be considered exceptional.
Hall, Amanda C.; Ostrowski, Lauren A.; Mekhail, Karim
2017-01-01
ABSTRACT Cells have evolved intricate mechanisms to maintain genome stability despite allowing mutational changes to drive evolutionary adaptation. Repetitive DNA sequences, which represent the bulk of most genomes, are a major threat to genome stability often driving chromosome rearrangements and disease. The major source of repetitive DNA sequences and thus the most vulnerable constituents of the genome are the rDNA (rDNA) repeats, telomeres, and transposable elements. Maintaining the stability of these loci is critical to overall cellular fitness and lifespan. Therefore, cells have evolved mechanisms to regulate rDNA copy number, telomere length and transposon activity, as well as DNA repair at these loci. In addition, non-canonical structure-forming DNA motifs can also modulate the function of these repetitive DNA loci by impacting their transcription, replication, and stability. Here, we discuss key mechanisms that maintain rDNA repeats, telomeres, and transposons in yeast and human before highlighting emerging roles for non-canonical DNA structures at these repetitive loci. PMID:28406751
Coufal, Nicole G.; Garcia-Perez, Josè Luis; Peng, Grace E.; Marchetto, Maria C. N.; Muotri, Alysson R.; Mu, Yangling; Carson, Christian T.; Macia, Angela; Moran, John V.; Gage, Fred H.
2011-01-01
Long interspersed element-1 (L1) retrotransposons compose ∼20% of the mammalian genome, and ongoing L1 retrotransposition events can impact genetic diversity by various mechanisms. Previous studies have demonstrated that endogenous L1 retrotransposition can occur in the germ line and during early embryonic development. In addition, recent data indicate that engineered human L1s can undergo somatic retrotransposition in human neural progenitor cells and that an increase in human-specific L1 DNA content can be detected in the brains of normal controls, as well as in Rett syndrome patients. Here, we demonstrate an increase in the retrotransposition efficiency of engineered human L1s in cells that lack or contain severely reduced levels of ataxia telangiectasia mutated, a serine/threonine kinase involved in DNA damage signaling and neurodegenerative disease. We demonstrate that the increase in L1 retrotransposition in ataxia telangiectasia mutated-deficient cells most likely occurs by conventional target-site primed reverse transcription and generate either longer, or perhaps more, L1 retrotransposition events per cell. Finally, we provide evidence suggesting an increase in human-specific L1 DNA copy number in postmortem brain tissue derived from ataxia telangiectasia patients compared with healthy controls. Together, these data suggest that cellular proteins involved in the DNA damage response may modulate L1 retrotransposition. PMID:22159035
Tamori, Akihiro; Yamanishi, Yoshihiro; Kawashima, Shuichi; Kanehisa, Minoru; Enomoto, Masaru; Tanaka, Hiromu; Kubo, Shoji; Shiomi, Susumu; Nishiguchi, Shuhei
2005-08-15
Integration of hepatitis B virus (HBV) DNA into the human genome is one of the most important steps in HBV-related carcinogenesis. This study attempted to find the link between HBV DNA, the adjoining cellular sequence, and altered gene expression in hepatocellular carcinoma (HCC) with integrated HBV DNA. We examined 15 cases of HCC infected with HBV by cassette ligation-mediated PCR. The human DNA adjacent to the integrated HBV DNA was sequenced. Protein coding sequences were searched for in the human sequence. In five cases with HBV DNA integration, from which good quality RNA was extracted, gene expression was examined by cDNA microarray analysis. The human DNA sequence successive to integrated HBV DNA was determined in the 15 HCCs. Eight protein-coding regions were involved: ras-responsive element binding protein 1, calmodulin 1, mixed lineage leukemia 2 (MLL2), FLJ333655, LOC220272, LOC255345, LOC220220, and LOC168991. The MLL2 gene was expressed in three cases with HBV DNA integrated into exon 3 of MLL2 and in one case with HBV DNA integrated into intron 3 of MLL2. Gene expression analysis suggested that two HCCs with HBV integrated into MLL2 had similar patterns of gene expression compared with three HCCs with HBV integrated into other loci of human chromosomes. HBV DNA was integrated at random sites of human DNA, and the MLL2 gene was one of the targets for integration. Our results suggest that HBV DNA might modulate human genes near integration sites, followed by integration site-specific expression of such genes during hepatocarcinogenesis.
Searching for statistically significant regulatory modules.
Bailey, Timothy L; Noble, William Stafford
2003-10-01
The regulatory machinery controlling gene expression is complex, frequently requiring multiple, simultaneous DNA-protein interactions. The rate at which a gene is transcribed may depend upon the presence or absence of a collection of transcription factors bound to the DNA near the gene. Locating transcription factor binding sites in genomic DNA is difficult because the individual sites are small and tend to occur frequently by chance. True binding sites may be identified by their tendency to occur in clusters, sometimes known as regulatory modules. We describe an algorithm for detecting occurrences of regulatory modules in genomic DNA. The algorithm, called mcast, takes as input a DNA database and a collection of binding site motifs that are known to operate in concert. mcast uses a motif-based hidden Markov model with several novel features. The model incorporates motif-specific p-values, thereby allowing scores from motifs of different widths and specificities to be compared directly. The p-value scoring also allows mcast to only accept motif occurrences with significance below a user-specified threshold, while still assigning better scores to motif occurrences with lower p-values. mcast can search long DNA sequences, modeling length distributions between motifs within a regulatory module, but ignoring length distributions between modules. The algorithm produces a list of predicted regulatory modules, ranked by E-value. We validate the algorithm using simulated data as well as real data sets from fruitfly and human. http://meme.sdsc.edu/MCAST/paper
Li, Junli; Li, Chunyan; Qiu, Rui; Yan, Congchong; Xie, Wenzhang; Wu, Zhen; Zeng, Zhi; Tung, Chuanjong
2015-09-01
The method of Monte Carlo simulation is a powerful tool to investigate the details of radiation biological damage at the molecular level. In this paper, a Monte Carlo code called NASIC (Nanodosimetry Monte Carlo Simulation Code) was developed. It includes physical module, pre-chemical module, chemical module, geometric module and DNA damage module. The physical module can simulate physical tracks of low-energy electrons in the liquid water event-by-event. More than one set of inelastic cross sections were calculated by applying the dielectric function method of Emfietzoglou's optical-data treatments, with different optical data sets and dispersion models. In the pre-chemical module, the ionised and excited water molecules undergo dissociation processes. In the chemical module, the produced radiolytic chemical species diffuse and react. In the geometric module, an atomic model of 46 chromatin fibres in a spherical nucleus of human lymphocyte was established. In the DNA damage module, the direct damages induced by the energy depositions of the electrons and the indirect damages induced by the radiolytic chemical species were calculated. The parameters should be adjusted to make the simulation results be agreed with the experimental results. In this paper, the influence study of the inelastic cross sections and vibrational excitation reaction on the parameters and the DNA strand break yields were studied. Further work of NASIC is underway. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Muellner, Mark G; Attene-Ramos, Matias S; Hudson, Matthew E; Wagner, Elizabeth D; Plewa, Michael J
2010-04-01
The disinfection of drinking water is a major achievement in protecting the public health. However, current disinfection methods also generate disinfection by-products (DBPs). Many DBPs are cytotoxic, genotoxic, teratogenic, and carcinogenic and represent an important class of environmentally hazardous chemicals that may carry long-term human health implications. The objective of this research was to integrate in vitro toxicology with focused toxicogenomic analysis of the regulated DBP, bromoacetic acid (BAA) and to evaluate modulation of gene expression involved in DNA damage/repair and toxic responses, with nontransformed human cells. We generated transcriptome profiles for 168 genes with 30 min and 4 hr exposure times that did not induce acute cytotoxicity. Using qRT-PCR gene arrays, the levels of 25 transcripts were modulated to a statistically significant degree in response to a 30 min treatment with BAA (16 transcripts upregulated and nine downregulated). The largest changes were observed for RAD9A and BRCA1. The majority of the altered transcript profiles are genes involved in DNA repair, especially the repair of double strand DNA breaks, and in cell cycle regulation. With 4 hr of treatment the expression of 28 genes was modulated (12 upregulated and 16 downregulated); the largest fold changes were in HMOX1 and FMO1. This work represents the first nontransformed human cell toxicogenomic study with a regulated drinking water disinfection by-product. These data implicate double strand DNA breaks as a feature of BAA exposure. Future toxicogenomic studies of DBPs will further strengthen our limited knowledge in this growing area of drinking water research. Copyright 2009 Wiley-Liss, Inc.
ERIC Educational Resources Information Center
McNamara-Schroeder, Kathleen; Olonan, Cheryl; Chu, Simon; Montoya, Maria C.; Alviri, Mahta; Ginty, Shannon; Love, John J.
2006-01-01
We have devised and implemented a DNA fingerprinting module for an upper division undergraduate laboratory based on the amplification and analysis of three of the 13 short tandem repeat loci that are required by the Federal Bureau of Investigation Combined DNA Index System (FBI CODIS) data base. Students first collect human epithelial (cheek)…
Modulation of DNA Damage and Repair Pathways by Human Tumour Viruses
Hollingworth, Robert; Grand, Roger J
2015-01-01
With between 10% and 15% of human cancers attributable to viral infection, there is great interest, from both a scientific and clinical viewpoint, as to how these pathogens modulate host cell functions. Seven human tumour viruses have been identified as being involved in the development of specific malignancies. It has long been known that the introduction of chromosomal aberrations is a common feature of viral infections. Intensive research over the past two decades has subsequently revealed that viruses specifically interact with cellular mechanisms responsible for the recognition and repair of DNA lesions, collectively known as the DNA damage response (DDR). These interactions can involve activation and deactivation of individual DDR pathways as well as the recruitment of specific proteins to sites of viral replication. Since the DDR has evolved to protect the genome from the accumulation of deleterious mutations, deregulation is inevitably associated with an increased risk of tumour formation. This review summarises the current literature regarding the complex relationship between known human tumour viruses and the DDR and aims to shed light on how these interactions can contribute to genomic instability and ultimately the development of human cancers. PMID:26008701
Sudan, B J
2000-08-01
This case study demonstrates that the normal human body frequency, which can be disturbed by electromagnetic influences of the environment, can be modulated by 0.9% sodium chloride solutions (physiological saline) and that occurrence of allergic reactions have subsequently been suppressed as a result of this modulation. The use of distilled water as control showed no effect on occurrence of allergic reactions. Further observations on the growth of various plants in a greenhouse exposed to various geomagnetic fields support the previous observations on humans. The neutralization of electromagnetic influences on humans using 0.9% sodium chloride solution or by enclosure of plants within a copper wire Faraday cage resulting in a normal and uniform growth of plants as compared with disturbed and irregular growth in unenclosed controls, is demonstrated. These original observations propose a new strategy to suppress or prevent allergic reactions and possibly other effects observed in various human pathologies in relation to a disturbance of human body frequencies. It is hypothesized that the double helix structure of desoxyribonucleic acid (DNA) could be modified by environmental electromagnetic fields and that disresonance between the two chains of DNA could lead to the expression of specific pathology. Copyright 2000 Harcourt Publishers Ltd.
Sumitani, Megumi; Kondo, Mari; Kasashima, Katsumi; Endo, Hitoshi; Nakamura, Kaoru; Misawa, Toshihiko; Tanaka, Hiromitsu; Sezutsu, Hideki
2017-04-15
In the present study, we initially cloned and characterized a mitochondrial transcription factor A (Tfam) homologue in the silkworm, Bombyx mori. Bombyx mori TFAM (BmTFAM) localized to mitochondria in cultured silkworm and human cells, and co-localized with mtDNA nucleoids in human HeLa cells. In an immunoprecipitation analysis, BmTFAM was found to associate with human mtDNA in mitochondria, indicating its feature as a non-specific DNA-binding protein. In spite of the low identity between BmTFAM and human TFAM (26.5%), the expression of BmTFAM rescued mtDNA copy number reductions and enlarged mtDNA nucleoids in HeLa cells, which were induced by human Tfam knockdown. Thus, BmTFAM compensates for the function of human TFAM in HeLa cells, demonstrating that the mitochondrial function of TFAM is highly conserved between silkworms and humans. BmTfam mRNA was strongly expressed in early embryos. Through double-stranded RNA (dsRNA)-based RNA interference (RNAi) in silkworm embryos, we found that the knockdown of BmTFAM reduced the amount of mtDNA and induced growth retardation at the larval stage. Collectively, these results demonstrate that BmTFAM is a highly conserved mtDNA regulator and may be a good candidate for investigating and modulating mtDNA metabolism in this model organism. Copyright © 2017 Elsevier B.V. All rights reserved.
Hudecova, A; Hasplova, K; Kellovska, L; Ikreniova, M; Miadokova, E; Galova, E; Horvathova, E; Vaculcikova, D; Gregan, F; Dusinska, M
2012-01-01
Zeocin is a member of bleomycin/phleomycin family of antibiotics isolated from Streptomyces verticullus. This unique radiomimetic antibiotic is known to bind to DNA and induce oxidative stress in different organisms producing predominantly single- and double- strand breaks, as well as a DNA base loss resulting in apurinic/apyrimidinic (AP) sites. The aim of this study was to induce an adaptive response (AR) by zeocin in freshly isolated human lymphocytes from blood and to observe whether plant extracts could modulate this response. The AR was evaluated by the comet assay. The optimal conditions for the AR induction and modulation were determined as: 2 h-intertreatment time (in PBS, at 4°C) given after a priming dose (50 µg/ml) of zeocin treatment. Genotoxic impact of zeocin to lymphocytes was modulated by plant extracts isolated from Gentiana asclepiadea (methanolic and aqueous haulm extracts, 0.25 mg/ml) and Armoracia rusticana (methanolic root extract, 0.025 mg/ml). These extracts enhanced the AR and also decreased DNA damage caused by zeocin (after 0, 1 and 4 h-recovery time after the test dose of zeocin application) to more than 50%. These results support important position of plants containing many biologically active compounds in the field of pharmacology and medicine.
Comte, Caroline; Tonin, Yann; Heckel-Mager, Anne-Marie; Boucheham, Abdeldjalil; Smirnov, Alexandre; Auré, Karine; Lombès, Anne; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan
2013-01-01
Mitochondrial mutations, an important cause of incurable human neuromuscular diseases, are mostly heteroplasmic: mutated mitochondrial DNA is present in cells simultaneously with wild-type genomes, the pathogenic threshold being generally >70% of mutant mtDNA. We studied whether heteroplasmy level could be decreased by specifically designed oligoribonucleotides, targeted into mitochondria by the pathway delivering RNA molecules in vivo. Using mitochondrially imported RNAs as vectors, we demonstrated that oligoribonucleotides complementary to mutant mtDNA region can specifically reduce the proportion of mtDNA bearing a large deletion associated with the Kearns Sayre Syndrome in cultured transmitochondrial cybrid cells. These findings may be relevant to developing of a new tool for therapy of mtDNA associated diseases. PMID:23087375
Human cytomegalovirus inhibits a DNA damage response by mislocalizing checkpoint proteins
NASA Astrophysics Data System (ADS)
Gaspar, Miguel; Shenk, Thomas
2006-02-01
The DNA damage checkpoint pathway responds to DNA damage and induces a cell cycle arrest to allow time for DNA repair. Several viruses are known to activate or modulate this cellular response. Here we show that the ataxia-telangiectasia mutated checkpoint pathway, which responds to double-strand breaks in DNA, is activated in response to human cytomegalovirus DNA replication. However, this activation does not propagate through the pathway; it is blocked at the level of the effector kinase, checkpoint kinase 2 (Chk2). Late after infection, several checkpoint proteins, including ataxia-telangiectasia mutated and Chk2, are mislocalized to a cytoplasmic virus assembly zone, where they are colocalized with virion structural proteins. This colocalization was confirmed by immunoprecipitation of virion proteins with an antibody that recognizes Chk2. Virus replication was resistant to ionizing radiation, which causes double-strand breaks in DNA. We propose that human CMV DNA replication activates the checkpoint response to DNA double-strand breaks, and the virus responds by altering the localization of checkpoint proteins to the cytoplasm and thereby inhibiting the signaling pathway. ionizing radiation | ataxia-telangiectasia mutated pathway
Detection of Streptococcus mutans Genomic DNA in Human DNA Samples Extracted from Saliva and Blood
Vieira, Alexandre R.; Deeley, Kathleen B.; Callahan, Nicholas F.; Noel, Jacqueline B.; Anjomshoaa, Ida; Carricato, Wendy M.; Schulhof, Louise P.; DeSensi, Rebecca S.; Gandhi, Pooja; Resick, Judith M.; Brandon, Carla A.; Rozhon, Christopher; Patir, Asli; Yildirim, Mine; Poletta, Fernando A.; Mereb, Juan C.; Letra, Ariadne; Menezes, Renato; Wendell, Steven; Lopez-Camelo, Jorge S.; Castilla, Eduardo E.; Orioli, Iêda M.; Seymen, Figen; Weyant, Robert J.; Crout, Richard; McNeil, Daniel W.; Modesto, Adriana; Marazita, Mary L.
2011-01-01
Caries is a multifactorial disease, and studies aiming to unravel the factors modulating its etiology must consider all known predisposing factors. One major factor is bacterial colonization, and Streptococcus mutans is the main microorganism associated with the initiation of the disease. In our studies, we have access to DNA samples extracted from human saliva and blood. In this report, we tested a real-time PCR assay developed to detect copies of genomic DNA from Streptococcus mutans in 1,424 DNA samples from humans. Our results suggest that we can determine the presence of genomic DNA copies of Streptococcus mutans in both DNA samples from caries-free and caries-affected individuals. However, we were not able to detect the presence of genomic DNA copies of Streptococcus mutans in any DNA samples extracted from peripheral blood, which suggests the assay may not be sensitive enough for this goal. Values of the threshold cycle of the real-time PCR reaction correlate with higher levels of caries experience in children, but this correlation could not be detected for adults. PMID:21731912
Maternal nutrition at conception modulates DNA methylation of human metastable epialleles.
Dominguez-Salas, Paula; Moore, Sophie E; Baker, Maria S; Bergen, Andrew W; Cox, Sharon E; Dyer, Roger A; Fulford, Anthony J; Guan, Yongtao; Laritsky, Eleonora; Silver, Matt J; Swan, Gary E; Zeisel, Steven H; Innis, Sheila M; Waterland, Robert A; Prentice, Andrew M; Hennig, Branwen J
2014-04-29
In experimental animals, maternal diet during the periconceptional period influences the establishment of DNA methylation at metastable epialleles in the offspring, with permanent phenotypic consequences. Pronounced naturally occurring seasonal differences in the diet of rural Gambian women allowed us to test this in humans. We show that significant seasonal variations in methyl-donor nutrient intake of mothers around the time of conception influence 13 relevant plasma biomarkers. The level of several of these maternal biomarkers predicts increased/decreased methylation at metastable epialleles in DNA extracted from lymphocytes and hair follicles in infants postnatally. Our results demonstrate that maternal nutritional status during early pregnancy causes persistent and systemic epigenetic changes at human metastable epialleles.
Dixon, Monica; Woodrick, Jordan; Gupta, Suhani; Karmahapatra, Soumendra Krishna; Devito, Stephen; Vasudevan, Sona; Dakshanamurthy, Sivanesan; Adhikari, Sanjay; Yenugonda, Venkata M.; Roy, Rabindra
2015-01-01
Interest in the mechanisms of DNA repair pathways, including the base excision repair (BER) pathway specifically, has heightened since these pathways have been shown to modulate important aspects of human disease. Modulation of the expression or activity of a particular BER enzyme, N-methylpurine DNA glycosylase (MPG), has been demonstrated to play a role in carcinogenesis and resistance to chemotherapy as well as neurodegenerative diseases, which has intensified the focus on studying MPG-related mechanisms of repair. A specific small molecule inhibitor for MPG activity would be a valuable biochemical tool for understanding these repair mechanisms. By screening several small molecule chemical libraries, we identified a natural polyphenolic compound, morin hydrate, which inhibits MPG activity specifically (IC50 = 2.6 µM). Detailed mechanism analysis showed that morin hydrate inhibited substrate DNA binding of MPG, and eventually the enzymatic activity of MPG. Computational docking studies with an x-ray derived MPG structure as well as comparison studies with other structurally-related flavanoids offer a rationale for the inhibitory activity of morin hydrate observed. The results of this study suggest that the morin hydrate could be an effective tool for studying MPG function and it is possible that morin hydrate and its derivatives could be utilized in future studies focused on the role of MPG in human disease. PMID:25650313
Modulation-frequency encoded multi-color fluorescent DNA analysis in an optofluidic chip.
Dongre, Chaitanya; van Weerd, Jasper; Besselink, Geert A J; Vazquez, Rebeca Martinez; Osellame, Roberto; Cerullo, Giulio; van Weeghel, Rob; van den Vlekkert, Hans H; Hoekstra, Hugo J W M; Pollnau, Markus
2011-02-21
We introduce a principle of parallel optical processing to an optofluidic lab-on-a-chip. During electrophoretic separation, the ultra-low limit of detection achieved with our set-up allows us to record fluorescence from covalently end-labeled DNA molecules. Different sets of exclusively color-labeled DNA fragments-otherwise rendered indistinguishable by spatio-temporal coincidence-are traced back to their origin by modulation-frequency-encoded multi-wavelength laser excitation, fluorescence detection with a single ultrasensitive, albeit color-blind photomultiplier, and Fourier analysis decoding. As a proof of principle, fragments obtained by multiplex ligation-dependent probe amplification from independent human genomic segments, associated with genetic predispositions to breast cancer and anemia, are simultaneously analyzed.
Dinicola, Simona; Proietti, Sara; Cucina, Alessandra; Bizzarri, Mariano; Fuso, Andrea
2017-09-26
Alpha-lipoic acid (ALA) is a pleiotropic molecule with antioxidant and anti-inflammatory properties, of which the effects are exerted through the modulation of NF-kB. This nuclear factor, in fact, modulates different inflammatory cytokines, including IL-1b and IL-6, in different tissues and cell types. We recently showed that IL-1b and IL-6 DNA methylation is modulated in the brain of Alzheimer's disease patients, and that IL-1b expression is associated to DNA methylation in the brain of patients with tuberous sclerosis complex. These results prompted us to ask whether ALA-induced repression of IL-1b and IL-6 was dependent on DNA methylation. Therefore, we profiled DNA methylation in the 5'-flanking region of the two aforementioned genes in SK-N-BE human neuroblastoma cells cultured in presence of ALA 0.5 mM. Our experimental data pointed out that the two promoters are hypermethylated in cells supplemented with ALA, both at CpG and non-CpG sites. Moreover, the observed hypermethylation is associated with decreased mRNA expression and decreased cytokine release. These results reinforce previous findings indicating that IL-1b and IL-6 undergo DNA methylation-dependent modulation in neural models and pave the road to study the epigenetic mechanisms triggered by ALA.
The Human Genome Project: Information access, management, and regulation. Final report
DOE Office of Scientific and Technical Information (OSTI.GOV)
McInerney, J.D.; Micikas, L.B.
The Human Genome Project is a large, internationally coordinated effort in biological research directed at creating a detailed map of human DNA. This report describes the access of information, management, and regulation of the project. The project led to the development of an instructional module titled The Human Genome Project: Biology, Computers, and Privacy, designed for use in high school biology classes. The module consists of print materials and both Macintosh and Windows versions of related computer software-Appendix A contains a copy of the print materials and discs containing the two versions of the software.
An ancient protein-DNA interaction underlying metazoan sex determination.
Murphy, Mark W; Lee, John K; Rojo, Sandra; Gearhart, Micah D; Kurahashi, Kayo; Banerjee, Surajit; Loeuille, Guy-André; Bashamboo, Anu; McElreavey, Kenneth; Zarkower, David; Aihara, Hideki; Bardwell, Vivian J
2015-06-01
DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. Here we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are used in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.
An ancient protein-DNA interaction underlying metazoan sex determination
Murphy, Mark W.; Lee, John K.; Rojo, Sandra; ...
2015-05-25
DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. In this paper, we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are usedmore » in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Finally, our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.« less
An ancient protein-DNA interaction underlying metazoan sex determination
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murphy, Mark W.; Lee, John K.; Rojo, Sandra
DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. In this paper, we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are usedmore » in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Finally, our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.« less
Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina
2018-01-01
Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion between mutant and wild type mtDNA molecules is not a consequence of a random repopulation of depleted pool of mtDNA genomes. The heteroplasmy change could be also modulated by cell growth conditions, namely increased by cells culturing in a carbohydrate-free medium, thus forcing them to use oxidative phosphorylation and providing a selective advantage for cells with improved respiration capacities. We discuss the advantages and limitations of this approach and propose further development of the anti-replicative strategy based on the RNA import into human mitochondria.
Global analysis of host-pathogen interactions that regulate early stage HIV-1 replication
König, Renate; Zhou, Yingyao; Elleder, Daniel; Diamond, Tracy L.; Bonamy, Ghislain M.C.; Irelan, Jeffrey T.; Chiang, Chih-yuan; Tu, Buu P.; De Jesus, Paul D.; Lilley, Caroline E.; Seidel, Shannon; Opaluch, Amanda M.; Caldwell, Jeremy S.; Weitzman, Matthew D.; Kuhen, Kelli L.; Bandyopadhyay, Sourav; Ideker, Trey; Orth, Anthony P.; Miraglia, Loren J.; Bushman, Frederic D.; Young, John A.; Chanda, Sumit K.
2008-01-01
Human Immunodeficiency Viruses (HIV-1 and HIV-2) rely upon host-encoded proteins to facilitate their replication. Here we combined genome-wide siRNA analyses with interrogation of human interactome databases to assemble a host-pathogen biochemical network containing 213 confirmed host cellular factors and 11 HIV-1-encoded proteins. Protein complexes that regulate ubiquitin conjugation, proteolysis, DNA damage response and RNA splicing were identified as important modulators of early stage HIV-1 infection. Additionally, over 40 new factors were shown to specifically influence initiation and/or kinetics of HIV-1 DNA synthesis, including cytoskeletal regulatory proteins, modulators of post-translational modification, and nucleic acid binding proteins. Finally, fifteen proteins with diverse functional roles, including nuclear transport, prostaglandin synthesis, ubiquitination, and transcription, were found to influence nuclear import or viral DNA integration. Taken together, the multi-scale approach described here has uncovered multiprotein virus-host interactions that likely act in concert to facilitate early steps of HIV-1 infection. PMID:18854154
A Polymerase With Potential: The Fe-S Cluster in Human DNA Primase.
Holt, Marilyn E; Salay, Lauren E; Chazin, Walter J
2017-01-01
Replication of DNA in eukaryotes is primarily executed by the combined action of processive DNA polymerases δ and ɛ. These enzymes cannot initiate synthesis of new DNA without the presence of a primer on the template ssDNA. The primers on both the leading and lagging strands are generated by DNA polymerase α-primase (pol-prim). DNA primase is a DNA-dependent RNA polymerase that synthesizes the first ~10 nucleotides and then transfers the substrate to polymerase α to complete primer synthesis. The mechanisms governing the coordination and handoff between primase and polymerase α are largely unknown. Isolated DNA primase contains a [4Fe-4S] 2+ cluster that has been shown to serve as a redox switch modulating DNA binding affinity. This discovery suggests a mechanism for modulating the priming activity of primase and handoff to polymerase α. In this chapter, we briefly discuss the current state of knowledge of primase structure and function, including the role of its iron-sulfur cluster. This is followed by providing the methods for expressing, purifying, and biophysically/structurally characterizing primase and its iron-sulfur cluster-containing domain, p58C. © 2017 Elsevier Inc. All rights reserved.
Gene expression analysis upon lncRNA DDSR1 knockdown in human fibroblasts
Jia, Li; Sun, Zhonghe; Wu, Xiaolin; Misteli, Tom; Sharma, Vivek
2015-01-01
Long non-coding RNAs (lncRNAs) play important roles in regulating diverse biological processes including DNA damage and repair. We have recently reported that the DNA damage inducible lncRNA DNA damage-sensitive RNA1 (DDSR1) regulates DNA repair by homologous recombination (HR). Since lncRNAs also modulate gene expression, we identified gene expression changes upon DDSR1 knockdown in human fibroblast cells. Gene expression analysis after RNAi treatment targeted against DDSR1 revealed 119 genes that show differential expression. Here we provide a detailed description of the microarray data (NCBI GEO accession number GSE67048) and the data analysis procedure associated with the publication by Sharma et al., 2015 in EMBO Reports [1]. PMID:26697398
Identifying Epigenetic Modulators of Resistance to ERK Signaling Inhibitors
2015-08-01
1.8 cal months 07/01/2014 - 05/31/2016 Bayer Hemophilia Award Program Targeted conection of hemophilia A using CRISPR -mediated editing The Specific...Aims of the project are to: (1) Inse1t a human FVIII eDNA into the Rosa26locus of the mouse genome using the CRISPR -Cas9 system, and (2) Inse1t a...human FVIII eDNA into the AA VS 1 locus of the human genome using the CRISPR -Cas9 system. Role: PI RGP009/2014 (Brown) 1.8 cal months 06/01/2014 - 05
Cruz-Gregorio, Alfredo; Manzo-Merino, Joaquín; Gonzaléz-García, María Cecilia; Pedraza-Chaverri, José; Medina-Campos, Omar Noel; Valverde, Mahara; Rojas, Emilio; Rodríguez-Sastre, María Alexandra; García-Cuellar, Claudia María; Lizano, Marcela
2018-01-01
Oxidative stress has been proposed as a risk factor for cervical cancer development. However, few studies have evaluated the redox state associated with human papillomavirus (HPV) infection. The aim of this work was to determine the role of the early expressed viral proteins E1, E2, E6 and E7 from HPV types 16 and 18 in the modulation of the redox state in an integral form. Therefore, generation of reactive oxygen species (ROS), concentration of reduced glutathione (GSH), levels and activity of the antioxidant enzymes catalase and superoxide dismutase (SOD) and deoxyribonucleic acid (DNA) damage, were analysed in epithelial cells ectopically expressing the viral proteins. Our research shows that E6 oncoproteins decreased GSH and catalase protein levels, as well as its enzymatic activity, which was associated with an increase in ROS production and DNA damage. In contrast, E7 oncoproteins increased GSH, as well as catalase protein levels and its activity, which correlated with a decrease in ROS without affecting DNA integrity. The co-expression of both E6 and E7 oncoproteins neutralized the effects that were independently observed for each of the viral proteins. Additionally, the combined expression of E1 and E2 proteins increased ROS levels with the subsequent increase in the marker for DNA damage phospho-histone 2AX (γH2AX). A decrease in GSH, as well as SOD2 levels and activity were also detected in the presence of E1 and E2, even though catalase activity increased. This study demonstrates that HPV early expressed proteins differentially modulate cellular redox state and DNA damage. PMID:29483822
Regulation and Modulation of Human DNA Polymerase δ Activity and Function
Wang, Xiaoxiao; Zhang, Sufang; Zhang, Zhongtao; Lee, Ernest Y. C.
2017-01-01
This review focuses on the regulation and modulation of human DNA polymerase δ (Pol δ). The emphasis is on the mechanisms that regulate the activity and properties of Pol δ in DNA repair and replication. The areas covered are the degradation of the p12 subunit of Pol δ, which converts it from a heterotetramer (Pol δ4) to a heterotrimer (Pol δ3), in response to DNA damage and also during the cell cycle. The biochemical mechanisms that lead to degradation of p12 are reviewed, as well as the properties of Pol δ4 and Pol δ3 that provide insights into their functions in DNA replication and repair. The second focus of the review involves the functions of two Pol δ binding proteins, polymerase delta interaction protein 46 (PDIP46) and polymerase delta interaction protein 38 (PDIP38), both of which are multi-functional proteins. PDIP46 is a novel activator of Pol δ4, and the impact of this function is discussed in relation to its potential roles in DNA replication. Several new models for the roles of Pol δ3 and Pol δ4 in leading and lagging strand DNA synthesis that integrate a role for PDIP46 are presented. PDIP38 has multiple cellular localizations including the mitochondria, the spliceosomes and the nucleus. It has been implicated in a number of cellular functions, including the regulation of specialized DNA polymerases, mitosis, the DNA damage response, mouse double minute 2 homolog (Mdm2) alternative splicing and the regulation of the NADPH oxidase 4 (Nox4). PMID:28737709
Kim, Yeo Jin; Kim, Hyoung-June; Kim, Hye Lim; Kim, Hyo Jeong; Kim, Hyun Soo; Lee, Tae Ryong; Shin, Dong Wook; Seo, Young Rok
2017-02-01
The phototherapeutic effects of visible red light on skin have been extensively investigated, but the underlying biological mechanisms remain poorly understood. We aimed to elucidate the protective mechanism of visible red light in terms of DNA repair of UV-induced oxidative damage in normal human dermal fibroblasts. The protective effect of visible red light on UV-induced DNA damage was identified by several assays in both two-dimensional and three-dimensional cell culture systems. With regard to the protective mechanism of visible red light, our data showed alterations in base excision repair mediated by growth arrest and DNA damage inducible, alpha (GADD45A). We also observed an enhancement of the physical activity of GADD45A and apurinic/apyrimidinic endonuclease 1 (APE1) by visible red light. Moreover, UV-induced DNA damages were diminished by visible red light in an APE1-dependent manner. On the basis of the decrease in GADD45A-APE1 interaction in the activating transcription factor-2 (ATF2)-knockdown system, we suggest a role for ATF2 modulation in GADD45A-mediated DNA repair upon visible red light exposure. Thus, the enhancement of GADD45A-mediated base excision repair modulated by ATF2 might be a potential protective mechanism of visible red light. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
House dust mite-induced asthma causes oxidative damage and DNA double-strand breaks in the lungs.
Chan, Tze Khee; Loh, Xin Yi; Peh, Hong Yong; Tan, W N Felicia; Tan, W S Daniel; Li, Na; Tay, Ian J J; Wong, W S Fred; Engelward, Bevin P
2016-07-01
Asthma is related to airway inflammation and oxidative stress. High levels of reactive oxygen and nitrogen species can induce cytotoxic DNA damage. Nevertheless, little is known about the possible role of allergen-induced DNA damage and DNA repair as modulators of asthma-associated pathology. We sought to study DNA damage and DNA damage responses induced by house dust mite (HDM) in vivo and in vitro. We measured DNA double-strand breaks (DSBs), DNA repair proteins, and apoptosis in an HDM-induced allergic asthma model and in lung samples from asthmatic patients. To study DNA repair, we treated mice with the DSB repair inhibitor NU7441. To study the direct DNA-damaging effect of HDM on human bronchial epithelial cells, we exposed BEAS-2B cells to HDM and measured DNA damage and reactive oxygen species levels. HDM challenge increased lung levels of oxidative damage to proteins (3-nitrotyrosine), lipids (8-isoprostane), and nucleic acid (8-oxoguanine). Immunohistochemical evidence for HDM-induced DNA DSBs was revealed by increased levels of the DSB marker γ Histone 2AX (H2AX) foci in bronchial epithelium. BEAS-2B cells exposed to HDM showed enhanced DNA damage, as measured by using the comet assay and γH2AX staining. In lung tissue from human patients with asthma, we observed increased levels of DNA repair proteins and apoptosis, as shown by caspase-3 cleavage, caspase-activated DNase levels, and terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling staining. Notably, NU7441 augmented DNA damage and cytokine production in the bronchial epithelium and apoptosis in the allergic airway, implicating DSBs as an underlying driver of asthma pathophysiology. This work calls attention to reactive oxygen and nitrogen species and HDM-induced cytotoxicity and to a potential role for DNA repair as a modulator of asthma-associated pathophysiology. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
The N-Terminal Domain of Human DNA Helicase Rtel1 Contains a Redox Active Iron-Sulfur Cluster
Landry, Aaron P.
2014-01-01
Human telomere length regulator Rtel1 is a superfamily II DNA helicase and is essential for maintaining proper length of telomeres in chromosomes. Here we report that the N-terminal domain of human Rtel1 (RtelN) expressed in Escherichia coli cells produces a protein that contains a redox active iron-sulfur cluster with the redox midpoint potential of −248 ± 10 mV (pH 8.0). The iron-sulfur cluster in RtelN is sensitive to hydrogen peroxide and nitric oxide, indicating that reactive oxygen/nitrogen species may modulate the DNA helicase activity of Rtel1 via modification of its iron-sulfur cluster. Purified RtelN retains a weak binding affinity for the single-stranded (ss) and double-stranded (ds) DNA in vitro. However, modification of the iron-sulfur cluster by hydrogen peroxide or nitric oxide does not significantly affect the DNA binding activity of RtelN, suggesting that the iron-sulfur cluster is not directly involved in the DNA interaction in the N-terminal domain of Rtel1. PMID:25147792
Gaidt, Moritz M.; Ebert, Thomas S.; Chauhan, Dhruv; Ramshorn, Katharina; Pinci, Francesca; Zuber, Sarah; O’Duill, Fionan; Schmid-Burgk, Jonathan L.; Hoss, Florian; Buhmann, Raymund; Wittmann, Georg; Latz, Eicke; Subklewe, Marion; Hornung, Veit
2018-01-01
Summary Detection of cytosolic DNA constitutes a central event in the context of numerous infectious and sterile inflammatory conditions. Recent studies have uncovered a bipartite mode of cytosolic DNA recognition, in which the cGAS-STING axis triggers antiviral immunity, whereas AIM2 triggers inflammasome activation. Here, we show that AIM2 is dispensable for DNA-mediated inflammasome activation in human myeloid cells. Instead, detection of cytosolic DNA by the cGAS-STING axis induces a cell death program initiating potassium efflux upstream of NLRP3. Forward genetics identified regulators of lysosomal trafficking to modulate this cell death program, and subsequent studies revealed that activated STING traffics to the lysosome, where it triggers membrane permeabilization and thus lysosomal cell death (LCD). Importantly, the cGAS-STING-NLRP3 pathway constitutes the default inflammasome response during viral and bacterial infections in human myeloid cells. We conclude that targeting the cGAS-STING-LCD-NLRP3 pathway will ameliorate pathology in inflammatory conditions that are associated with cytosolic DNA sensing. PMID:29033128
The N-terminal domain of human DNA helicase Rtel1 contains a redox active iron-sulfur cluster.
Landry, Aaron P; Ding, Huangen
2014-01-01
Human telomere length regulator Rtel1 is a superfamily II DNA helicase and is essential for maintaining proper length of telomeres in chromosomes. Here we report that the N-terminal domain of human Rtel1 (RtelN) expressed in Escherichia coli cells produces a protein that contains a redox active iron-sulfur cluster with the redox midpoint potential of -248 ± 10 mV (pH 8.0). The iron-sulfur cluster in RtelN is sensitive to hydrogen peroxide and nitric oxide, indicating that reactive oxygen/nitrogen species may modulate the DNA helicase activity of Rtel1 via modification of its iron-sulfur cluster. Purified RtelN retains a weak binding affinity for the single-stranded (ss) and double-stranded (ds) DNA in vitro. However, modification of the iron-sulfur cluster by hydrogen peroxide or nitric oxide does not significantly affect the DNA binding activity of RtelN, suggesting that the iron-sulfur cluster is not directly involved in the DNA interaction in the N-terminal domain of Rtel1.
Baribault, Carl; Ehrlich, Kenneth C.; Ponnaluri, V. K. Chaithanya; Pradhan, Sriharsa; Lacey, Michelle; Ehrlich, Melanie
2018-01-01
ABSTRACT DNA methylation can affect tissue-specific gene transcription in ways that are difficult to discern from studies focused on genome-wide analyses of differentially methylated regions (DMRs). To elucidate the variety of associations between differentiation-related DNA hypermethylation and transcription, we used available epigenomic and transcriptomic profiles from 38 human cell/tissue types to focus on such relationships in 94 genes linked to hypermethylated DMRs in myoblasts (Mb). For 19 of the genes, promoter-region hypermethylation in Mb (and often a few heterologous cell types) was associated with gene repression but, importantly, DNA hypermethylation was absent in many other repressed samples. In another 24 genes, DNA hypermethylation overlapped cryptic enhancers or super-enhancers and correlated with down-modulated, but not silenced, gene expression. However, such methylation was absent, surprisingly, in both non-expressing samples and highly expressing samples. This suggests that some genes need DMR hypermethylation to help repress cryptic enhancer chromatin only when they are actively transcribed. For another 11 genes, we found an association between intergenic hypermethylated DMRs and positive expression of the gene in Mb. DNA hypermethylation/transcription correlations similar to those of Mb were evident sometimes in diverse tissues, such as aorta and brain. Our findings have implications for the possible involvement of methylated DNA in Duchenne's muscular dystrophy, congenital heart malformations, and cancer. This epigenomic analysis suggests that DNA methylation is not simply the inevitable consequence of changes in gene expression but, instead, is often an active agent for fine-tuning transcription in association with development. PMID:29498561
Concerted copy number variation balances ribosomal DNA dosage in human and mouse genomes
Gibbons, John G.; Branco, Alan T.; Godinho, Susana A.; Yu, Shoukai; Lemos, Bernardo
2015-01-01
Tandemly repeated ribosomal DNA (rDNA) arrays are among the most evolutionary dynamic loci of eukaryotic genomes. The loci code for essential cellular components, yet exhibit extensive copy number (CN) variation within and between species. CN might be partly determined by the requirement of dosage balance between the 5S and 45S rDNA arrays. The arrays are nonhomologous, physically unlinked in mammals, and encode functionally interdependent RNA components of the ribosome. Here we show that the 5S and 45S rDNA arrays exhibit concerted CN variation (cCNV). Despite 5S and 45S rDNA elements residing on different chromosomes and lacking sequence similarity, cCNV between these loci is strong, evolutionarily conserved in humans and mice, and manifested across individual genotypes in natural populations and pedigrees. Finally, we observe that bisphenol A induces rapid and parallel modulation of 5S and 45S rDNA CN. Our observations reveal a novel mode of genome variation, indicate that natural selection contributed to the evolution and conservation of cCNV, and support the hypothesis that 5S CN is partly determined by the requirement of dosage balance with the 45S rDNA array. We suggest that human disease variation might be traced to disrupted rDNA dosage balance in the genome. PMID:25583482
Human β‐defensin 3 increases the TLR9‐dependent response to bacterial DNA
McGlasson, Sarah L.; Semple, Fiona; MacPherson, Heather; Gray, Mohini; Davidson, Donald J.
2017-01-01
Human β‐defensin 3 (hBD3) is a cationic antimicrobial peptide with potent bactericidal activity in vitro. HBD3 is produced in response to pathogen challenge and can modulate immune responses. The amplified recognition of self‐DNA by human plasmacytoid dendritic cells has been previously reported, but we show here that hBD3 preferentially enhances the response to bacterial DNA in mouse Flt‐3 induced dendritic cells (FLDCs) and in human peripheral blood mononuclear cells. We show the effect is mediated through TLR9 and although hBD3 significantly increases the cellular uptake of both E. coli and self‐DNA in mouse FLDCs, only the response to bacterial DNA is enhanced. Liposome transfection also increases uptake of bacterial DNA and amplifies the TLR9‐dependent response. In contrast to hBD3, lipofection of self‐DNA enhances inflammatory signaling, but the response is predominantly TLR9‐independent. Together, these data show that hBD3 has a role in the innate immune‐mediated response to pathogen DNA, increasing inflammatory signaling and promoting activation of the adaptive immune system via antigen presenting cells including dendritic cells. Therefore, our data identify an additional immunomodulatory role for this copy‐number variable defensin, of relevance to host defence against infection and indicate a potential for the inclusion of HBD3 in pathogen DNA‐based vaccines. PMID:28102569
[Ubiquitin-proteasome system and sperm DNA repair: An update].
Zhang, Guo-Wei; Cai, Hong-Cai; Shang, Xue-Jun
2016-09-01
The ubiquitin-proteasome system (UPS) is a proteasome system widely present in the human body, which is composed of ubiquitin (Ub), ubiquitin activating enzymes (E1), ubiquitin conjugating enzymes (E2), ubiquitin protein ligases (E3), 26S proteasome, and deubiquitinating enzymes (DUBs) and involved in cell cycle regulation, immune response, signal transduction, DNA repair as well as protein degradation. Sperm DNA is vulnerable to interference or damage in the progression of chromosome association and homologous recombination. Recent studies show that UPS participates in DNA repair in spermatogenesis by modulating DNA repair enzymes via ubiquitination, assisting in the identification of DNA damage sites, raising damage repair-related proteins, initiating the DNA repair pathway, maintaining chromosome stability, and ensuring the normal process of spermatogenesis.
Mestek, A; Hurley, J H; Bye, L S; Campbell, A D; Chen, Y; Tian, M; Liu, J; Schulman, H; Yu, L
1995-03-01
Opioids are some of the most efficacious analgesics used in humans. Prolonged administration of opioids, however, often causes the development of drug tolerance, thus limiting their effectiveness. To explore the molecular basis of those mechanisms that may contribute to opioid tolerance, we have isolated a cDNA for the human mu opioid receptor, the target of such opioid narcotics as morphine, codeine, methadone, and fentanyl. The receptor encoded by this cDNA is 400 amino acids long with 94% sequence similarity to the rat mu opioid receptor. Transient expression of this cDNA in COS-7 cells produced high-affinity binding sites to mu-selective agonists and antagonists. This receptor displays functional coupling to a recently cloned G-protein-activated K+ channel. When both proteins were expressed in Xenopus oocytes, functional desensitization developed upon repeated stimulation of the mu opioid receptor, as observed by a reduction in K+ current induced by the second mu receptor activation relative to that induced by the first. The extent of desensitization was potentiated by both the multifunctional calcium/calmodulin-dependent protein kinase and protein kinase C. These results demonstrate that kinase modulation is a molecular mechanism by which the desensitization of mu receptor signaling may be regulated at the cellular level, suggesting that this cellular mechanism may contribute to opioid tolerance in humans.
Sommariva, Michele; De Cecco, Loris; De Cesare, Michelandrea; Sfondrini, Lucia; Ménard, Sylvie; Melani, Cecilia; Delia, Domenico; Zaffaroni, Nadia; Pratesi, Graziella; Uva, Valentina; Tagliabue, Elda; Balsari, Andrea
2011-10-15
Synthetic oligodeoxynucleotides expressing CpG motifs (CpG-ODN) are a Toll-like receptor 9 (TLR9) agonist that can enhance the antitumor activity of DNA-damaging chemotherapy and radiation therapy in preclinical mouse models. We hypothesized that the success of these combinations is related to the ability of CpG-ODN to modulate genes involved in DNA repair. We conducted an in silico analysis of genes implicated in DNA repair in data sets obtained from murine colon carcinoma cells in mice injected intratumorally with CpG-ODN and from splenocytes in mice treated intraperitoneally with CpG-ODN. CpG-ODN treatment caused downregulation of DNA repair genes in tumors. Microarray analyses of human IGROV-1 ovarian carcinoma xenografts in mice treated intraperitoneally with CpG-ODN confirmed in silico findings. When combined with the DNA-damaging drug cisplatin, CpG-ODN significantly increased the life span of mice compared with individual treatments. In contrast, CpG-ODN led to an upregulation of genes involved in DNA repair in immune cells. Cisplatin-treated patients with ovarian carcinoma as well as anthracycline-treated patients with breast cancer who are classified as "CpG-like" for the level of expression of CpG-ODN modulated DNA repair genes have a better outcome than patients classified as "CpG-untreated-like," indicating the relevance of these genes in the tumor cell response to DNA-damaging drugs. Taken together, the findings provide evidence that the tumor microenvironment can sensitize cancer cells to DNA-damaging chemotherapy, thereby expanding the benefits of CpG-ODN therapy beyond induction of a strong immune response.
[Apoptosis of human leukemic cells induced by topoisomerase I and II inhibitors].
Solary, E; Dubrez, L; Eymin, B; Bertrand, R; Pommier, Y
1996-03-01
Comparison between five human leukemic lines (BV173, HL60, U937, K562, KCL22) suggest that the main determinant of their sensitivity to topoisomerase I (camptothecin) and II (VP-16) inhibitors is their ability to regulate cell cycle progression in response to specific DNA damage, then to die through apoptosis: the more the cells inhibit cell cycle progression, the less sensitive they are. The final pathway of apoptosis induction involves a cytoplasmic signal, active at neutral pH, needing magnesium, sensitive to various protease inhibitors and activated directly by staurosporine. Modulators of intracellular signaling (calcium chelators, calmodulin inhibitors, PKC modulators, kinase and phosphatase inhibitors) have no significant influence upon apoptosis induction. Conversely, apoptosis induction pathway is modified during monocytic differentiation of HL60 cells induced by phorbol esters. Lastly, poly(ADP-ribosyl)ation and chromatine structure should regulate apoptotic DNA fragmentation that is prevented by 3-aminobenzamide and spermine, respectively.
Human β-defensin 3 increases the TLR9-dependent response to bacterial DNA.
McGlasson, Sarah L; Semple, Fiona; MacPherson, Heather; Gray, Mohini; Davidson, Donald J; Dorin, Julia R
2017-04-01
Human β-defensin 3 (hBD3) is a cationic antimicrobial peptide with potent bactericidal activity in vitro. HBD3 is produced in response to pathogen challenge and can modulate immune responses. The amplified recognition of self-DNA by human plasmacytoid dendritic cells has been previously reported, but we show here that hBD3 preferentially enhances the response to bacterial DNA in mouse Flt-3 induced dendritic cells (FLDCs) and in human peripheral blood mononuclear cells. We show the effect is mediated through TLR9 and although hBD3 significantly increases the cellular uptake of both E. coli and self-DNA in mouse FLDCs, only the response to bacterial DNA is enhanced. Liposome transfection also increases uptake of bacterial DNA and amplifies the TLR9-dependent response. In contrast to hBD3, lipofection of self-DNA enhances inflammatory signaling, but the response is predominantly TLR9-independent. Together, these data show that hBD3 has a role in the innate immune-mediated response to pathogen DNA, increasing inflammatory signaling and promoting activation of the adaptive immune system via antigen presenting cells including dendritic cells. Therefore, our data identify an additional immunomodulatory role for this copy-number variable defensin, of relevance to host defence against infection and indicate a potential for the inclusion of HBD3 in pathogen DNA-based vaccines. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Integrative analysis of 111 reference human epigenomes
Kundaje, Anshul; Meuleman, Wouter; Ernst, Jason; Bilenky, Misha; Yen, Angela; Kheradpour, Pouya; Zhang, Zhizhuo; Heravi-Moussavi, Alireza; Liu, Yaping; Amin, Viren; Ziller, Michael J; Whitaker, John W; Schultz, Matthew D; Sandstrom, Richard S; Eaton, Matthew L; Wu, Yi-Chieh; Wang, Jianrong; Ward, Lucas D; Sarkar, Abhishek; Quon, Gerald; Pfenning, Andreas; Wang, Xinchen; Claussnitzer, Melina; Coarfa, Cristian; Harris, R Alan; Shoresh, Noam; Epstein, Charles B; Gjoneska, Elizabeta; Leung, Danny; Xie, Wei; Hawkins, R David; Lister, Ryan; Hong, Chibo; Gascard, Philippe; Mungall, Andrew J; Moore, Richard; Chuah, Eric; Tam, Angela; Canfield, Theresa K; Hansen, R Scott; Kaul, Rajinder; Sabo, Peter J; Bansal, Mukul S; Carles, Annaick; Dixon, Jesse R; Farh, Kai-How; Feizi, Soheil; Karlic, Rosa; Kim, Ah-Ram; Kulkarni, Ashwinikumar; Li, Daofeng; Lowdon, Rebecca; Mercer, Tim R; Neph, Shane J; Onuchic, Vitor; Polak, Paz; Rajagopal, Nisha; Ray, Pradipta; Sallari, Richard C; Siebenthall, Kyle T; Sinnott-Armstrong, Nicholas; Stevens, Michael; Thurman, Robert E; Wu, Jie; Zhang, Bo; Zhou, Xin; Beaudet, Arthur E; Boyer, Laurie A; De Jager, Philip; Farnham, Peggy J; Fisher, Susan J; Haussler, David; Jones, Steven; Li, Wei; Marra, Marco; McManus, Michael T; Sunyaev, Shamil; Thomson, James A; Tlsty, Thea D; Tsai, Li-Huei; Wang, Wei; Waterland, Robert A; Zhang, Michael; Chadwick, Lisa H; Bernstein, Bradley E; Costello, Joseph F; Ecker, Joseph R; Hirst, Martin; Meissner, Alexander; Milosavljevic, Aleksandar; Ren, Bing; Stamatoyannopoulos, John A; Wang, Ting; Kellis, Manolis
2015-01-01
The reference human genome sequence set the stage for studies of genetic variation and its association with human disease, but a similar reference has lacked for epigenomic studies. To address this need, the NIH Roadmap Epigenomics Consortium generated the largest collection to-date of human epigenomes for primary cells and tissues. Here, we describe the integrative analysis of 111 reference human epigenomes generated as part of the program, profiled for histone modification patterns, DNA accessibility, DNA methylation, and RNA expression. We establish global maps of regulatory elements, define regulatory modules of coordinated activity, and their likely activators and repressors. We show that disease and trait-associated genetic variants are enriched in tissue-specific epigenomic marks, revealing biologically-relevant cell types for diverse human traits, and providing a resource for interpreting the molecular basis of human disease. Our results demonstrate the central role of epigenomic information for understanding gene regulation, cellular differentiation, and human disease. PMID:25693563
Integrative analysis of 111 reference human epigenomes.
Kundaje, Anshul; Meuleman, Wouter; Ernst, Jason; Bilenky, Misha; Yen, Angela; Heravi-Moussavi, Alireza; Kheradpour, Pouya; Zhang, Zhizhuo; Wang, Jianrong; Ziller, Michael J; Amin, Viren; Whitaker, John W; Schultz, Matthew D; Ward, Lucas D; Sarkar, Abhishek; Quon, Gerald; Sandstrom, Richard S; Eaton, Matthew L; Wu, Yi-Chieh; Pfenning, Andreas R; Wang, Xinchen; Claussnitzer, Melina; Liu, Yaping; Coarfa, Cristian; Harris, R Alan; Shoresh, Noam; Epstein, Charles B; Gjoneska, Elizabeta; Leung, Danny; Xie, Wei; Hawkins, R David; Lister, Ryan; Hong, Chibo; Gascard, Philippe; Mungall, Andrew J; Moore, Richard; Chuah, Eric; Tam, Angela; Canfield, Theresa K; Hansen, R Scott; Kaul, Rajinder; Sabo, Peter J; Bansal, Mukul S; Carles, Annaick; Dixon, Jesse R; Farh, Kai-How; Feizi, Soheil; Karlic, Rosa; Kim, Ah-Ram; Kulkarni, Ashwinikumar; Li, Daofeng; Lowdon, Rebecca; Elliott, GiNell; Mercer, Tim R; Neph, Shane J; Onuchic, Vitor; Polak, Paz; Rajagopal, Nisha; Ray, Pradipta; Sallari, Richard C; Siebenthall, Kyle T; Sinnott-Armstrong, Nicholas A; Stevens, Michael; Thurman, Robert E; Wu, Jie; Zhang, Bo; Zhou, Xin; Beaudet, Arthur E; Boyer, Laurie A; De Jager, Philip L; Farnham, Peggy J; Fisher, Susan J; Haussler, David; Jones, Steven J M; Li, Wei; Marra, Marco A; McManus, Michael T; Sunyaev, Shamil; Thomson, James A; Tlsty, Thea D; Tsai, Li-Huei; Wang, Wei; Waterland, Robert A; Zhang, Michael Q; Chadwick, Lisa H; Bernstein, Bradley E; Costello, Joseph F; Ecker, Joseph R; Hirst, Martin; Meissner, Alexander; Milosavljevic, Aleksandar; Ren, Bing; Stamatoyannopoulos, John A; Wang, Ting; Kellis, Manolis
2015-02-19
The reference human genome sequence set the stage for studies of genetic variation and its association with human disease, but epigenomic studies lack a similar reference. To address this need, the NIH Roadmap Epigenomics Consortium generated the largest collection so far of human epigenomes for primary cells and tissues. Here we describe the integrative analysis of 111 reference human epigenomes generated as part of the programme, profiled for histone modification patterns, DNA accessibility, DNA methylation and RNA expression. We establish global maps of regulatory elements, define regulatory modules of coordinated activity, and their likely activators and repressors. We show that disease- and trait-associated genetic variants are enriched in tissue-specific epigenomic marks, revealing biologically relevant cell types for diverse human traits, and providing a resource for interpreting the molecular basis of human disease. Our results demonstrate the central role of epigenomic information for understanding gene regulation, cellular differentiation and human disease.
Mitochondrial DNA sequence characteristics modulate the size of the genetic bottleneck.
Wilson, Ian J; Carling, Phillipa J; Alston, Charlotte L; Floros, Vasileios I; Pyle, Angela; Hudson, Gavin; Sallevelt, Suzanne C E H; Lamperti, Costanza; Carelli, Valerio; Bindoff, Laurence A; Samuels, David C; Wonnapinij, Passorn; Zeviani, Massimo; Taylor, Robert W; Smeets, Hubert J M; Horvath, Rita; Chinnery, Patrick F
2016-03-01
With a combined carrier frequency of 1:200, heteroplasmic mitochondrial DNA (mtDNA) mutations cause human disease in ∼1:5000 of the population. Rapid shifts in the level of heteroplasmy seen within a single generation contribute to the wide range in the severity of clinical phenotypes seen in families transmitting mtDNA disease, consistent with a genetic bottleneck during transmission. Although preliminary evidence from human pedigrees points towards a random drift process underlying the shifting heteroplasmy, some reports describe differences in segregation pattern between different mtDNA mutations. However, based on limited observations and with no direct comparisons, it is not clear whether these observations simply reflect pedigree ascertainment and publication bias. To address this issue, we studied 577 mother-child pairs transmitting the m.11778G>A, m.3460G>A, m.8344A>G, m.8993T>G/C and m.3243A>G mtDNA mutations. Our analysis controlled for inter-assay differences, inter-laboratory variation and ascertainment bias. We found no evidence of selection during transmission but show that different mtDNA mutations segregate at different rates in human pedigrees. m.8993T>G/C segregated significantly faster than m.11778G>A, m.8344A>G and m.3243A>G, consistent with a tighter mtDNA genetic bottleneck in m.8993T>G/C pedigrees. Our observations support the existence of different genetic bottlenecks primarily determined by the underlying mtDNA mutation, explaining the different inheritance patterns observed in human pedigrees transmitting pathogenic mtDNA mutations. © The Author 2016. Published by Oxford University Press.
Human Endometrial DNA Methylome Is Cycle-Dependent and Is Associated With Gene Expression Regulation
Houshdaran, Sahar; Zelenko, Zara; Irwin, Juan C.
2014-01-01
Human endometrium undergoes major gene expression changes, resulting in altered cellular functions in response to cyclic variations in circulating estradiol and progesterone, largely mediated by transcription factors and nuclear receptors. In addition to classic modulators, epigenetic mechanisms regulate gene expression during development in response to environmental factors and in some diseases and have roles in steroid hormone action. Herein, we tested the hypothesis that DNA methylation plays a role in gene expression regulation in human endometrium in different hormonal milieux. High throughput, genome-wide DNA methylation profiling of endometrial samples in proliferative, early secretory, and midsecretory phases revealed dynamic DNA methylation patterns with segregation of proliferative from secretory phase samples by unsupervised cluster analysis of differentially methylated genes. Changes involved different frequencies of gain and loss of methylation within or outside CpG islands. Comparison of changes in transcriptomes and corresponding DNA methylomes from the same samples revealed association of DNA methylation and gene expression in a number of loci, some important in endometrial biology. Human endometrial stromal fibroblasts treated in vitro with estradiol and progesterone exhibited DNA methylation changes in several genes observed in proliferative and secretory phase tissues, respectively. Taken together, the data support the observation that epigenetic mechanisms are involved in gene expression regulation in human endometrium in different hormonal milieux, adding endometrium to a small number of normal adult tissues exhibiting dynamic DNA methylation. The data also raise the possibility that the interplay between steroid hormone and methylome dynamics regulates normal endometrial functions and, if abnormal, may result in endometrial dysfunction and associated disorders. PMID:24877562
Qian, Yufeng; Johnson, Kenneth A.
2017-01-01
The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB–ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB)30 and (SSB)60, defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB)60 and (SSB)30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 109 m−1 s−1) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. PMID:28615444
Variations in the Processing of DNA Double-Strand Breaks Along 60-MeV Therapeutic Proton Beams
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chaudhary, Pankaj; Marshall, Thomas I.; Currell, Frederick J.
Purpose: To investigate the variations in induction and repair of DNA damage along the proton path, after a previous report on the increasing biological effectiveness along clinically modulated 60-MeV proton beams. Methods and Materials: Human skin fibroblast (AG01522) cells were irradiated along a monoenergetic and a modulated spread-out Bragg peak (SOBP) proton beam used for treating ocular melanoma at the Douglas Cyclotron, Clatterbridge Centre for Oncology, Wirral, Liverpool, United Kingdom. The DNA damage response was studied using the 53BP1 foci formation assay. The linear energy transfer (LET) dependence was studied by irradiating the cells at depths corresponding to entrance, proximal, middle, andmore » distal positions of SOBP and the entrance and peak position for the pristine beam. Results: A significant amount of persistent foci was observed at the distal end of the SOBP, suggesting complex residual DNA double-strand break damage induction corresponding to the highest LET values achievable by modulated proton beams. Unlike the directly irradiated, medium-sharing bystander cells did not show any significant increase in residual foci. Conclusions: The DNA damage response along the proton beam path was similar to the response of X rays, confirming the low-LET quality of the proton exposure. However, at the distal end of SOBP our data indicate an increased complexity of DNA lesions and slower repair kinetics. A lack of significant induction of 53BP1 foci in the bystander cells suggests a minor role of cell signaling for DNA damage under these conditions.« less
Detection of type 2 diabetes related modules and genes based on epigenetic networks
2014-01-01
Background Type 2 diabetes (T2D) is one of the most common chronic metabolic diseases characterized by insulin resistance and the decrease of insulin secretion. Genetic variation can only explain part of the heritability of T2D, so there need new methods to detect the susceptibility genes of the disease. Epigenetics could establish the interface between the environmental factor and the T2D Pathological mechanism. Results Based on the network theory and by combining epigenetic characteristics with human interactome, the weighted human DNA methylation network (WMPN) was constructed, and a T2D-related subnetwork (TMSN) was obtained through T2D-related differentially methylated genes. It is found that TMSN had a T2D specific network structure that non-fatal metabolic disease causing genes were often located in the topological and functional periphery of network. Combined with chromatin modifications, the weighted chromatin modification network (WCPN) was built, and a T2D-related chromatin modification pattern subnetwork was obtained by the TMSN gene set. TCSN had a densely connected network community, indicating that TMSN and TCSN could represent a collection of T2D-related epigenetic dysregulated sub-pathways. Using the cumulative hypergeometric test, 24 interplay modules of DNA methylation and chromatin modifications were identified. By the analysis of gene expression in human T2D islet tissue, it is found that there existed genes with the variant expression level caused by the aberrant DNA methylation and (or) chromatin modifications, which might affect and promote the development of T2D. Conclusions Here we have detected the potential interplay modules of DNA methylation and chromatin modifications for T2D. The study of T2D epigenetic networks provides a new way for understanding the pathogenic mechanism of T2D caused by epigenetic disorders. PMID:24565181
AGT Activity Towards Intrastrand Crosslinked DNA is Modulated by the Alkylene Linker.
O'Flaherty, Derek K; Wilds, Christopher J
2017-12-05
DNA oligomers containing dimethylene and trimethylene intrastrand crosslinks (IaCLs) between the O4 and O6 atoms of neighboring thymidine (T) and 2'-deoxyguanosine (dG) residues were prepared by solid-phase synthesis. UV thermal denaturation (T m ) experiments revealed that these IaCLs had a destabilizing effect on the DNA duplex relative to the control. Circular dichroism spectroscopy suggested these IaCLs induced minimal structural distortions. Susceptibility to dealkylation by reaction with various O 6 -alkylguanine DNA alkyltransferases (AGTs) from human and Escherichia coli was evaluated. It was revealed that only human AGT displayed activity towards the IaCL DNA, with reduced efficiency as the IaCL shortened (from four to two methylene linkages). Changing the site of attachment of the ethylene linkage at the 5'-end of the IaCL to the N3 atom of T had minimal influence on duplex stability and structure, and was refractory to AGT activity. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng
2013-05-01
G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.
Characterization of human septic sera induced gene expression modulation in human myocytes
Hussein, Shaimaa; Michael, Paul; Brabant, Danielle; Omri, Abdelwahab; Narain, Ravin; Passi, Kalpdrum; Ramana, Chilakamarti V.; Parrillo, Joseph E.; Kumar, Anand; Parissenti, Amadeo; Kumar, Aseem
2009-01-01
To gain a better understanding of the gene expression changes that occurs during sepsis, we have performed a cDNA microarray study utilizing a tissue culture model that mimics human sepsis. This study utilized an in vitro model of cultured human fetal cardiac myocytes treated with 10% sera from septic patients or 10% sera from healthy volunteers. A 1700 cDNA expression microarray was used to compare the transcription profile from human cardiac myocytes treated with septic sera vs normal sera. Septic sera treatment of myocytes resulted in the down-regulation of 178 genes and the up-regulation of 4 genes. Our data indicate that septic sera induced cell cycle, metabolic, transcription factor and apoptotic gene expression changes in human myocytes. Identification and characterization of gene expression changes that occur during sepsis may lead to the development of novel therapeutics and diagnostics. PMID:19684886
Diffusion modulation of DNA by toehold exchange
NASA Astrophysics Data System (ADS)
Rodjanapanyakul, Thanapop; Takabatake, Fumi; Abe, Keita; Kawamata, Ibuki; Nomura, Shinichiro M.; Murata, Satoshi
2018-05-01
We propose a method to control the diffusion speed of DNA molecules with a target sequence in a polymer solution. The interaction between solute DNA and diffusion-suppressing DNA that has been anchored to a polymer matrix is modulated by the concentration of the third DNA molecule called the competitor by a mechanism called toehold exchange. Experimental results show that the sequence-specific modulation of the diffusion coefficient is successfully achieved. The diffusion coefficient can be modulated up to sixfold by changing the concentration of the competitor. The specificity of the modulation is also verified under the coexistence of a set of DNA with noninteracting base sequences. With this mechanism, we are able to control the diffusion coefficient of individual DNA species by the concentration of another DNA species. This methodology introduces a programmability to a DNA-based reaction-diffusion system.
Mechanisms of DNA damage, repair and mutagenesis
Chatterjee, Nimrat; Walker, Graham C.
2017-01-01
Living organisms are continuously exposed to a myriad of DNA damaging agents that can impact health and modulate disease-states. However, robust DNA repair and damage-bypass mechanisms faithfully protect the DNA by either removing or tolerating the damage to ensure an overall survival. Deviations in this fine-tuning are known to destabilize cellular metabolic homeostasis, as exemplified in diverse cancers where disruption or deregulation of DNA repair pathways results in genome instability. Because routinely used biological, physical and chemical agents impact human health, testing their genotoxicity and regulating their use have become important. In this introductory review, we will delineate mechanisms of DNA damage and the counteracting repair/tolerance pathways to provide insights into the molecular basis of genotoxicity in cells that lays the foundation for subsequent articles in this issue. PMID:28485537
Tabassum, Sartaj; Afzal, Mohd; Arjmand, Farukh
2014-03-03
New carbohydrate-conjugate heterobimetallic complexes [C₂₂H₅₀N₆O₁₃CuSnCl₂] (3) and [C₂₂H₅₈N₆O₁₇NiSnCl₂] (4) were synthesized from their monometallic analogs [C₂₂H₅₂N₆O₁₃Cu] (1) and [C₂₂H₆₀N₆O₁₇Ni] (2) containing N-glycoside ligand (L). In vitro DNA binding studies of L and complexes (1-4) with CT DNA were carried out by employing various biophysical and molecular docking techniques which revealed that heterobimetallic complex 3 strongly binds to DNA in comparison to 4, monometallic complexes (1 and 2) and the free ligand. Complex 3 cleaves pBR322 DNA via hydrolytic pathway (confirmed by T4 DNA ligase assay) and inhibited Topo-II activity in a dose-dependent manner. Furthermore, complex 3 was docked into the ATPase domain of human-Topo-II in order to probe the possible mechanism of inhibition. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
AP1 Keeps Chromatin Poised for Action | Center for Cancer Research
The human genome harbors gene-encoding DNA, the blueprint for building proteins that regulate cellular function. Embedded across the genome, in non-coding regions, are DNA elements to which regulatory factors bind. The interaction of regulatory factors with DNA at these sites modifies gene expression to modulate cell activity. In cells, DNA exists in a complex with proteins called chromatin that compacts the DNA in the nucleus, strongly restricting access to DNA sequences. As a result, regulatory factors only interact with a small subset of their potential binding elements in a given cell to regulate genes. How factors recognize and select sites in chromatin across the genome is not well understood -- but several discoveries in CCR’s Laboratory of Receptor Biology and Gene Expression (LRBGE) have shed light on the mechanisms that direct factors to DNA.
RECQ-like helicases Sgs1 and BLM regulate R-loop–associated genome instability
Chang, Emily Yun-Chia; Novoa, Carolina A.; Aristizabal, Maria J.; Coulombe, Yan; Segovia, Romulo; Shen, Yaoqing; Keong, Christelle; Tam, Annie S.; Jones, Steven J.M.; Masson, Jean-Yves; Kobor, Michael S.
2017-01-01
Sgs1, the orthologue of human Bloom’s syndrome helicase BLM, is a yeast DNA helicase functioning in DNA replication and repair. We show that SGS1 loss increases R-loop accumulation and sensitizes cells to transcription–replication collisions. Yeast lacking SGS1 accumulate R-loops and γ-H2A at sites of Sgs1 binding, replication pausing regions, and long genes. The mutation signature of sgs1Δ reveals copy number changes flanked by repetitive regions with high R-loop–forming potential. Analysis of BLM in Bloom’s syndrome fibroblasts or by depletion of BLM from human cancer cells confirms a role for Sgs1/BLM in suppressing R-loop–associated genome instability across species. In support of a potential direct effect, BLM is found physically proximal to DNA:RNA hybrids in human cells, and can efficiently unwind R-loops in vitro. Together, our data describe a conserved role for Sgs1/BLM in R-loop suppression and support an increasingly broad view of DNA repair and replication fork stabilizing proteins as modulators of R-loop–mediated genome instability. PMID:29042409
RECQ-like helicases Sgs1 and BLM regulate R-loop-associated genome instability.
Chang, Emily Yun-Chia; Novoa, Carolina A; Aristizabal, Maria J; Coulombe, Yan; Segovia, Romulo; Chaturvedi, Richa; Shen, Yaoqing; Keong, Christelle; Tam, Annie S; Jones, Steven J M; Masson, Jean-Yves; Kobor, Michael S; Stirling, Peter C
2017-12-04
Sgs1, the orthologue of human Bloom's syndrome helicase BLM, is a yeast DNA helicase functioning in DNA replication and repair. We show that SGS1 loss increases R-loop accumulation and sensitizes cells to transcription-replication collisions. Yeast lacking SGS1 accumulate R-loops and γ-H2A at sites of Sgs1 binding, replication pausing regions, and long genes. The mutation signature of sgs1 Δ reveals copy number changes flanked by repetitive regions with high R-loop-forming potential. Analysis of BLM in Bloom's syndrome fibroblasts or by depletion of BLM from human cancer cells confirms a role for Sgs1/BLM in suppressing R-loop-associated genome instability across species. In support of a potential direct effect, BLM is found physically proximal to DNA:RNA hybrids in human cells, and can efficiently unwind R-loops in vitro. Together, our data describe a conserved role for Sgs1/BLM in R-loop suppression and support an increasingly broad view of DNA repair and replication fork stabilizing proteins as modulators of R-loop-mediated genome instability. © 2017 Chang et al.
Circadian Modulation of 8-Oxoguanine DNA Damage Repair
Manzella, Nicola; Bracci, Massimo; Strafella, Elisabetta; Staffolani, Sara; Ciarapica, Veronica; Copertaro, Alfredo; Rapisarda, Venerando; Ledda, Caterina; Amati, Monica; Valentino, Matteo; Tomasetti, Marco; Stevens, Richard G.; Santarelli, Lory
2015-01-01
The DNA base excision repair pathway is the main system involved in the removal of oxidative damage to DNA such as 8-Oxoguanine (8-oxoG) primarily via the 8-Oxoguanine DNA glycosylase (OGG1). Our goal was to investigate whether the repair of 8-oxoG DNA damage follow a circadian rhythm. In a group of 15 healthy volunteers, we found a daily variation of Ogg1 expression and activity with higher levels in the morning compared to the evening hours. Consistent with this, we also found lower levels of 8-oxoG in morning hours compared to those in the evening hours. Lymphocytes exposed to oxidative damage to DNA at 8:00 AM display lower accumulation of 8-oxoG than lymphocytes exposed at 8:00 PM. Furthermore, altered levels of Ogg1 expression were also observed in a group of shift workers experiencing a deregulation of circadian clock genes compared to a control group. Moreover, BMAL1 knockdown fibroblasts with a deregulated molecular clock showed an abolishment of circadian variation of Ogg1 expression and an increase of OGG1 activity. Our results suggest that the circadian modulation of 8-oxoG DNA damage repair, according to a variation of Ogg1 expression, could render humans less susceptible to accumulate 8-oxoG DNA damage in the morning hours. PMID:26337123
Peralta-Arrieta, Irlanda; Hernández-Sotelo, Daniel; Castro-Coronel, Yaneth; Leyva-Vázquez, Marco Antonio; Illades-Aguiar, Berenice
2017-01-01
Altered promoter DNA methylation is one of the most important epigenetic abnormalities in human cancer. DNMT3B, de novo methyltransferase, is clearly related to abnormal methylation of tumour suppressor genes, DNA repair genes and its overexpression contributes to oncogenic processes and tumorigenesis in vivo. The purpose of this study was to assess the effect of the overexpression of DNMT3B in HaCaT cells on global gene expression and on the methylation of selected genes to the identification of genes that can be target of DNMT3B. We found that the overexpression of DNMT3B in HaCaT cells, modulate the expression of genes related to cancer, downregulated the expression of 151 genes with CpG islands and downregulated the expression of the VAV3 gene via methylation of its promoter. These results highlight the importance of DNMT3B in gene expression and human cancer. PMID:28123849
Peralta-Arrieta, Irlanda; Hernández-Sotelo, Daniel; Castro-Coronel, Yaneth; Leyva-Vázquez, Marco Antonio; Illades-Aguiar, Berenice
2017-01-01
Altered promoter DNA methylation is one of the most important epigenetic abnormalities in human cancer. DNMT3B, de novo methyltransferase, is clearly related to abnormal methylation of tumour suppressor genes, DNA repair genes and its overexpression contributes to oncogenic processes and tumorigenesis in vivo . The purpose of this study was to assess the effect of the overexpression of DNMT3B in HaCaT cells on global gene expression and on the methylation of selected genes to the identification of genes that can be target of DNMT3B. We found that the overexpression of DNMT3B in HaCaT cells, modulate the expression of genes related to cancer, downregulated the expression of 151 genes with CpG islands and downregulated the expression of the VAV3 gene via methylation of its promoter. These results highlight the importance of DNMT3B in gene expression and human cancer.
Structure of the active form of human origin recognition complex and its ATPase motor module
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tocilj, Ante; On, Kin Fan; Yuan, Zuanning
Binding of the Origin Recognition Complex (ORC) to origins of replication marks the first step in the initiation of replication of the genome in all eukaryotic cells. Here, we report the structure of the active form of human ORC determined by X-ray crystallography and cryo-electron microscopy. The complex is composed of an ORC1/4/5 motor module lobe in an organization reminiscent of the DNA polymerase clamp loader complexes. A second lobe contains the ORC2/3 subunits. The complex is organized as a double-layered shallow corkscrew, with the AAA+ and AAA+-like domains forming one layer, and the winged-helix domains (WHDs) forming a topmore » layer. CDC6 fits easily between ORC1 and ORC2, completing the ring and the DNA-binding channel, forming an additional ATP hydrolysis site. Analysis of the ATPase activity of the complex provides a basis for understanding ORC activity as well as molecular defects observed in Meier-Gorlin Syndrome mutations.« less
Fine Tuning Gene Expression: The Epigenome
Mohtat, Davoud; Susztak, Katalin
2011-01-01
An epigenetic trait is a stably inherited phenotype resulting from changes in a chromosome without alterations in the DNA sequence. Epigenetic modifications, such as; DNA methylation, together with covalent modification of histones, are thought to alter chromatin density and accessibility of the DNA to cellular machinery, thereby modulating the transcriptional potential of the underlying DNA sequence. As epigenetic marks under environmental influence, epigenetics provides an added layer of variation that might mediate the relationship between genotype and internal and external environmental factors. Integration of our knowledge in genetics, epigenomics and genomics with the use of systems biology tools may present investigators with new powerful tools to study many complex human diseases such as kidney disease. PMID:21044758
Investigating the epigenetic effects of a prototype smoke-derived carcinogen in human cells.
Tommasi, Stella; Kim, Sang-in; Zhong, Xueyan; Wu, Xiwei; Pfeifer, Gerd P; Besaratinia, Ahmad
2010-05-12
Global loss of DNA methylation and locus/gene-specific gain of DNA methylation are two distinct hallmarks of carcinogenesis. Aberrant DNA methylation is implicated in smoking-related lung cancer. In this study, we have comprehensively investigated the modulation of DNA methylation consequent to chronic exposure to a prototype smoke-derived carcinogen, benzo[a]pyrene diol epoxide (B[a]PDE), in genomic regions of significance in lung cancer, in normal human cells. We have used a pulldown assay for enrichment of the CpG methylated fraction of cellular DNA combined with microarray platforms, followed by extensive validation through conventional bisulfite-based analysis. Here, we demonstrate strikingly similar patterns of DNA methylation in non-transformed B[a]PDE-treated cells vs control using high-throughput microarray-based DNA methylation profiling confirmed by conventional bisulfite-based DNA methylation analysis. The absence of aberrant DNA methylation in our model system within a timeframe that precedes cellular transformation suggests that following carcinogen exposure, other as yet unknown factors (secondary to carcinogen treatment) may help initiate global loss of DNA methylation and region-specific gain of DNA methylation, which can, in turn, contribute to lung cancer development. Unveiling the initiating events that cause aberrant DNA methylation in lung cancer has tremendous public health relevance, as it can help define future strategies for early detection and prevention of this highly lethal disease.
Investigating the Epigenetic Effects of a Prototype Smoke-Derived Carcinogen in Human Cells
Tommasi, Stella; Kim, Sang-in; Zhong, Xueyan; Wu, Xiwei; Pfeifer, Gerd P.; Besaratinia, Ahmad
2010-01-01
Global loss of DNA methylation and locus/gene-specific gain of DNA methylation are two distinct hallmarks of carcinogenesis. Aberrant DNA methylation is implicated in smoking-related lung cancer. In this study, we have comprehensively investigated the modulation of DNA methylation consequent to chronic exposure to a prototype smoke-derived carcinogen, benzo[a]pyrene diol epoxide (B[a]PDE), in genomic regions of significance in lung cancer, in normal human cells. We have used a pulldown assay for enrichment of the CpG methylated fraction of cellular DNA combined with microarray platforms, followed by extensive validation through conventional bisulfite-based analysis. Here, we demonstrate strikingly similar patterns of DNA methylation in non-transformed B[a]PDE-treated cells vs control using high-throughput microarray-based DNA methylation profiling confirmed by conventional bisulfite-based DNA methylation analysis. The absence of aberrant DNA methylation in our model system within a timeframe that precedes cellular transformation suggests that following carcinogen exposure, other as yet unknown factors (secondary to carcinogen treatment) may help initiate global loss of DNA methylation and region-specific gain of DNA methylation, which can, in turn, contribute to lung cancer development. Unveiling the initiating events that cause aberrant DNA methylation in lung cancer has tremendous public health relevance, as it can help define future strategies for early detection and prevention of this highly lethal disease. PMID:20485678
Glioblastoma cells deficient in DNA-dependent protein kinase are resistant to cell death.
Chen, George G; Sin, Fanny L F; Leung, Billy C S; Ng, Ho K; Poon, Wai S
2005-04-01
DNA-dependent protein kinase (DNA-PK), a nuclear serine/threonine kinase, is responsible for the DNA double-strand break repair. Cells lacking or with dysfunctional DNA-PK are often associated with mis-repair, chromosome aberrations, and complex exchanges, all of which are known to contribute to the development of human cancers including glioblastoma. Two human glioblastoma cell lines were used in the experiment, M059J cells lacking the catalytic subunit of DNA-PK, and their isogenic but DNA-PK proficient counterpart, M059K. We found that M059K cells were much more sensitive to staurosporine (STS) treatment than M059J cells, as demonstrated by MTT assay, TUNEL detection, and annexin-V and propidium iodide (PI) staining. A possible mechanism responsible for the different sensitivity in these two cell lines was explored by the examination of Bcl-2, Bax, Bak, and Fas. The cell death stimulus increased anti-apoptotic Bcl-2 and decreased pro-apoptotic Bcl-2 members (Bak and Bax) and Fas in glioblastoma cells deficient in DNA-PK. Activation of DNA-PK is known to promote cell death of human tumor cells via modulation of p53, which can down-regulate the anti-apoptotic Bcl-2 member proteins, induce pro-apoptotic Bcl-2 family members and promote a Bax-Bak interaction. Our experiment also demonstrated that the mode of glioblastoma cell death induced by STS consisted of both apoptosis and necrosis and the percentage of cell death in both modes was similar in glioblastoma cell lines either lacking DNA-PK or containing intact DNA-PK. Taken together, our findings suggest that DNA-PK has a positive role in the regulation of apoptosis in human glioblastomas. The aberrant expression of Bcl-2 family members and Fas was, at least in part, responsible for decreased sensitivity of DNA-PK deficient glioblastoma cells to cell death stimuli. 2004 Wiley-Liss, Inc.
Tang, Jiang-bo; Svilar, David; Trivedi, Ram N.; Wang, Xiao-hong; Goellner, Eva M.; Moore, Briana; Hamilton, Ronald L.; Banze, Lauren A.; Brown, Ashley R.; Sobol, Robert W.
2011-01-01
Temozolomide (TMZ) is the preferred chemotherapeutic agent in the treatment of glioma following surgical resection and/or radiation. Resistance to TMZ is attributed to efficient repair and/or tolerance of TMZ-induced DNA lesions. The majority of the TMZ-induced DNA base adducts are repaired by the base excision repair (BER) pathway and therefore modulation of this pathway can enhance drug sensitivity. N-methylpurine DNA glycosylase (MPG) initiates BER by removing TMZ-induced N3-methyladenine and N7-methylguanine base lesions, leaving abasic sites (AP sites) in DNA for further processing by BER. Using the human glioma cell lines LN428 and T98G, we report here that potentiation of TMZ via BER inhibition [methoxyamine (MX), the PARP inhibitors PJ34 and ABT-888 or depletion (knockdown) of PARG] is greatly enhanced by over-expression of the BER initiating enzyme MPG. We also show that methoxyamine-induced potentiation of TMZ in MPG expressing glioma cells is abrogated by elevated-expression of the rate-limiting BER enzyme DNA polymerase β (Polβ), suggesting that cells proficient for BER readily repair AP sites in the presence of MX. Further, depletion of Polβ increases PARP inhibitor-induced potentiation in the MPG over-expressing glioma cells, suggesting that expression of Polβ modulates the cytotoxic effect of combining increased repair initiation and BER inhibition. This study demonstrates that MPG overexpression, together with inhibition of BER, sensitizes glioma cells to the alkylating agent TMZ in a Polβ-dependent manner, suggesting that the expression level of both MPG and Polβ might be used to predict the effectiveness of MX and PARP-mediated potentiation of TMZ in cancer treatment. PMID:21377995
Yang, Di; Fletcher, Sally C.; Vendrell, Iolanda; Fischer, Roman; Legrand, Arnaud J.
2017-01-01
Abstract Ataxia telangiectasia (A-T) is a syndrome associated with loss of ATM protein function. Neurodegeneration and cancer predisposition, both hallmarks of A-T, are likely to emerge as a consequence of the persistent oxidative stress and DNA damage observed in this disease. Surprisingly however, despite these severe features, a lack of functional ATM is still compatible with early life, suggesting that adaptation mechanisms contributing to cell survival must be in place. Here we address this gap in our knowledge by analysing the process of human fibroblast adaptation to the lack of ATM. We identify profound rearrangement in cellular proteostasis occurring very early on after loss of ATM in order to counter protein damage originating from oxidative stress. Change in proteostasis, however, is not without repercussions. Modulating protein turnover in ATM-depleted cells also has an adverse effect on the DNA base excision repair pathway, the major DNA repair system that deals with oxidative DNA damage. As a consequence, the burden of unrepaired endogenous DNA lesions intensifies, progressively leading to genomic instability. Our study provides a glimpse at the cellular consequences of loss of ATM and highlights a previously overlooked role for proteostasis in maintaining cell survival in the absence of ATM function. PMID:28973444
Working the kinks out of nucleosomal DNA
Olson, Wilma K.; Zhurkin, Victor B.
2011-01-01
Condensation of DNA in the nucleosome takes advantage of its double-helical architecture. The DNA deforms at sites where the base pairs face the histone octamer. The largest so-called kink-and-slide deformations occur in the vicinity of arginines that penetrate the minor groove. Nucleosome structures formed from the 601 positioning sequence differ subtly from those incorporating an AT-rich human α-satellite DNA. Restraints imposed by the histone arginines on the displacement of base pairs can modulate the sequence-dependent deformability of DNA and potentially contribute to the unique features of the different nucleosomes. Steric barriers mimicking constraints found in the nucleosome induce the simulated large-scale rearrangement of canonical B-DNA to kink-and-slide states. The pathway to these states shows non-harmonic behavior consistent with bending profiles inferred from AFM measurements. PMID:21482100
In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.
Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E
2018-01-01
DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.
Lisowska, Halina; Cheng, Lei; Sollazzo, Alice; Lundholm, Lovisa; Wegierek-Ciuk, Aneta; Sommer, Sylwester; Lankoff, Anna; Wojcik, Andrzej
2018-06-01
Low temperature at exposure has been shown to act in a radioprotective manner at the level of cytogenetic damage. It was suggested to be due to an effective transformation of DNA damage to chromosomal damage at low temperature. The purpose of the study was to analyze the kinetics of aberration formation during the first hours after exposing human peripheral blood lymphocytes to ionizing radiation at 0.8 °C and 37 °C. To this end, we applied the technique of premature chromosome condensation. In addition, DNA damage response was analyzed by measuring the levels of phosphorylated DNA damage responsive proteins ATM, DNA-PK and p53 and mRNA levels of the radiation-responsive genes BBC3, FDXR, GADD45A, XPC, MDM2 and CDKN1A. A consistently lower frequency of chromosomal breaks was observed in cells exposed at 0.8 °C as compared to 37 °C already after 30 minutes postexposure. This effect was accompanied by elevated levels of phosphorylated ATM and DNA-PK proteins and a reduced immediate level of phosphorylated p53 and of the responsive genes. Low temperature at exposure appears to promote DNA repair leading to reduced transformation of DNA damage to chromosomal aberrations.
Lim, Hui Kheng; Gurung, Resham Lal; Hande, M Prakash
2017-12-01
Silver nanoparticles (Ag-np) were reported to be toxic to eukaryotic cells. These potentially detrimental effects of Ag-np can be advantageous in experimental therapeutics. They are currently being employed to enhance the therapeutic efficacy of cancer drugs. In this study, we demonstrate that Ag-np treatment trigger the activation of DNA-PKcs and JNK pathway at selected doses, presumably as a physiologic response to DNA damage and repair in normal and malignant cells. Ag-np altered the telomere dynamics by disrupting the shelterin complex located at the telomeres and telomere lengths. The genotoxic effect of Ag-np was not restricted to telomeres but the entire genome as Ag-np induced γ-H2AX foci formation, an indicator of global DNA damage. Inhibition of DNA-PKcs activity sensitised the cancer cells towards the cytotoxicity of Ag-np and substantiated the damaging effect of Ag-np at telomeres in human cancer cells. Abrogation of JNK mediated DNA repair and extensive damage of telomeres led to greater cell death following Ag-np treatment in DNA-PKcs inhibited cancer cells. Collectively, this study suggests that improved anti-proliferative and cytotoxic effects of Ag-np treatment in cancer cells can be achieved by the inhibition of DNA-PKcs. Copyright © 2017 Elsevier B.V. All rights reserved.
Oxidative stress signaling to chromatin in health and disease
Kreuz, Sarah; Fischle, Wolfgang
2016-01-01
Oxidative stress has a significant impact on the development and progression of common human pathologies, including cancer, diabetes, hypertension and neurodegenerative diseases. Increasing evidence suggests that oxidative stress globally influences chromatin structure, DNA methylation, enzymatic and non-enzymatic post-translational modifications of histones and DNA-binding proteins. The effects of oxidative stress on these chromatin alterations mediate a number of cellular changes, including modulation of gene expression, cell death, cell survival and mutagenesis, which are disease-driving mechanisms in human pathologies. Targeting oxidative stress-dependent pathways is thus a promising strategy for the prevention and treatment of these diseases. We summarize recent research developments connecting oxidative stress and chromatin regulation. PMID:27319358
Pivetta, Tiziana; Valletta, Elisa; Ferino, Giulio; Isaia, Francesco; Pani, Alessandra; Vascellari, Sarah; Castellano, Carlo; Demartin, Francesco; Cabiddu, Maria Grazia; Cadoni, Enzo
2017-12-01
Coumarins show biological activity and are widely exploited for their therapeutic effects. Although a great number of coumarins substituted by heterocyclic moieties have been prepared, few studies have been carried out on coumarins containing pyridine heterocycle, which is known to modulate their physiological activities. We prepared and characterized three novel 3-(pyridin-2-yl)coumarins and their corresponding copper(II) complexes. We extended our investigations also to three known similar coumarins, since no data about their biochemical activity was previously been reported. The antiproliferative activity of the studied compounds was tested against human derived tumor cell lines and one human normal cell line. The DNA binding constants were determined and docking studies with DNA carried out. Selected Quantitative Structure-Activity Relationship (QSAR) descriptors were calculated in order to relate a set of structural and topological descriptors of the studied compounds to their DNA interaction and cytotoxic activity. Copyright © 2017 Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Kohli, M.; Jorgensen, T. J.
1999-01-01
The p53 tumor suppressor gene has been shown to be involved in a variety of repair processes, and recent findings have suggested that p53 may be involved in DNA double strand break repair in irradiated cells. The role of p53 in DNA double strand break repair, however, has not been fully investigated. In this study, we have constructed a novel Epstein-Barr virus (EBV)-based shuttle vector, designated as pZEBNA, to explore the influence of p53 on DNA strand break repair in human lymphoblasts, since EBV-based vectors do not inactivate the p53 pathway. We have compared plasmid survival of irradiated, restriction enzyme linearized, and calf intestinal alkaline phosphatase (CIP)-treated pZEBNA with a Simian virus 40 (SV40)-based shuttle vector, pZ189, in TK6 (wild-type p53) and WTK1 (mutant p53) lymphoblasts and determined that p53 does not modulate DNA double strand break repair in these cell lines. Copyright 1999 Academic Press.
MicroRNA-203 Modulates the Radiation Sensitivity of Human Malignant Glioma Cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, Ji Hyun; Hwang, Yeo Hyun; Lee, David J.
Purpose: We investigated whether miR-203 could modulate the radiation sensitivity of glioblastoma (GBM) cells and which target gene(s) could be involved. Methods and Materials: Three human malignant glioma (MG) cell lines and normal human astrocytes were transfected with control microRNA, pre-miR-203, or antisense miR-203. Real-time PCR (RT-PCR), clonogenic assays, immunofluorescence, and invasion/migration assays were performed. To predict the target(s), bioinformatics analyses using microRNA target databases were performed. Results: Overexpression of miR-203 increased the radiation sensitivity of all 3 human MG cell lines and prolonged radiation-induced γ-H2AX foci formation. Bioinformatics analyses suggested that miR-203 could be involved in post-transcriptional control of DNAmore » repair, PI3K/AKT, SRC, and JAK/STAT3 and the vascular signaling pathway. Western blot analysis validated the fact that miR-203 downregulated ATM, RAD51, SRC, PLD2, PI3K-AKT, JAK-STAT3, VEGF, HIF-1α, and MMP2. Overexpression of miR-203 inhibited invasion and migration potentials, downregulated SLUG and Vimentin, and upregulated Claudin-1 and ZO1. Conclusions: These data demonstrate that miR-203 potentially controls DNA damage repair via the PI3K/AKT and JAK/STAT3 pathways and may collectively contribute to the modulation of radiation sensitivity in MG cells by inhibiting DNA damage repair, prosurvival signaling, and epithelium-mesenchyme transition. Taken together, these findings demonstrate that miR-203 could be a target for overcoming the radiation resistance of GBM.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tully, D.B.; Hillman, D.; Herbert, E.
1986-05-01
Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less
Chillemi, Giovanni; D'Annessa, Ilda; Fiorani, Paola; Losasso, Carmen; Benedetti, Piero; Desideri, Alessandro
2008-10-01
The role of Thr729 in modulating the enzymatic function of human topoisomerase I has been characterized by molecular dynamics (MD) simulation. In detail, the structural-dynamical behaviour of the Thr729Lys and the Thr729Pro mutants have been characterized because of their in vivo and in vitro functional properties evidenced in the accompanying paper. Both mutants can bind to the DNA substrate and are enzymatically active, but while Thr729Lys is resistant even at high concentration of the camptothecin (CPT) anti-cancer drug, Thr729Pro shows only a mild reduction in drug sensitivity and in DNA binding. MD simulations show that the Thr729Lys mutation provokes a structural perturbation of the CPT-binding pocket. On the other hand, the Thr729Pro mutant maintains the wild-type structural scaffold, only increasing its rigidity. The simulations also show the complete abolishment, in the Thr729Lys mutant, of the protein communications between the C-terminal domain (where the active Tyr723 is located) and the linker domain, that plays an essential role in the control of the DNA rotation, thus explaining the distributive mode of action displayed by this mutant.
Chillemi, Giovanni; D’Annessa, Ilda; Fiorani, Paola; Losasso, Carmen; Benedetti, Piero; Desideri, Alessandro
2008-01-01
The role of Thr729 in modulating the enzymatic function of human topoisomerase I has been characterized by molecular dynamics (MD) simulation. In detail, the structural–dynamical behaviour of the Thr729Lys and the Thr729Pro mutants have been characterized because of their in vivo and in vitro functional properties evidenced in the accompanying paper. Both mutants can bind to the DNA substrate and are enzymatically active, but while Thr729Lys is resistant even at high concentration of the camptothecin (CPT) anti-cancer drug, Thr729Pro shows only a mild reduction in drug sensitivity and in DNA binding. MD simulations show that the Thr729Lys mutation provokes a structural perturbation of the CPT-binding pocket. On the other hand, the Thr729Pro mutant maintains the wild-type structural scaffold, only increasing its rigidity. The simulations also show the complete abolishment, in the Thr729Lys mutant, of the protein communications between the C-terminal domain (where the active Tyr723 is located) and the linker domain, that plays an essential role in the control of the DNA rotation, thus explaining the distributive mode of action displayed by this mutant. PMID:18765473
Antonenkov, Vasily D; Isomursu, Antti; Mennerich, Daniela; Vapola, Miia H; Weiher, Hans; Kietzmann, Thomas; Hiltunen, J Kalervo
2015-05-29
The human MPV17-related mitochondrial DNA depletion syndrome is an inherited autosomal recessive disease caused by mutations in the inner mitochondrial membrane protein MPV17. Although more than 30 MPV17 gene mutations were shown to be associated with mitochondrial DNA depletion syndrome, the function of MPV17 is still unknown. Mice deficient in Mpv17 show signs of premature aging. In the present study, we used electrophysiological measurements with recombinant MPV17 to reveal that this protein forms a non-selective channel with a pore diameter of 1.8 nm and located the channel's selectivity filter. The channel was weakly cation-selective and showed several subconductance states. Voltage-dependent gating of the channel was regulated by redox conditions and pH and was affected also in mutants mimicking a phosphorylated state. Likewise, the mitochondrial membrane potential (Δψm) and the cellular production of reactive oxygen species were higher in embryonic fibroblasts from Mpv17(-/-) mice. However, despite the elevated Δψm, the Mpv17-deficient mitochondria showed signs of accelerated fission. Together, these observations uncover the role of MPV17 as a Δψm-modulating channel that apparently contributes to mitochondrial homeostasis under different conditions. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Antonenkov, Vasily D.; Isomursu, Antti; Mennerich, Daniela; Vapola, Miia H.; Weiher, Hans; Kietzmann, Thomas; Hiltunen, J. Kalervo
2015-01-01
The human MPV17-related mitochondrial DNA depletion syndrome is an inherited autosomal recessive disease caused by mutations in the inner mitochondrial membrane protein MPV17. Although more than 30 MPV17 gene mutations were shown to be associated with mitochondrial DNA depletion syndrome, the function of MPV17 is still unknown. Mice deficient in Mpv17 show signs of premature aging. In the present study, we used electrophysiological measurements with recombinant MPV17 to reveal that this protein forms a non-selective channel with a pore diameter of 1.8 nm and located the channel's selectivity filter. The channel was weakly cation-selective and showed several subconductance states. Voltage-dependent gating of the channel was regulated by redox conditions and pH and was affected also in mutants mimicking a phosphorylated state. Likewise, the mitochondrial membrane potential (Δψm) and the cellular production of reactive oxygen species were higher in embryonic fibroblasts from Mpv17−/− mice. However, despite the elevated Δψm, the Mpv17-deficient mitochondria showed signs of accelerated fission. Together, these observations uncover the role of MPV17 as a Δψm-modulating channel that apparently contributes to mitochondrial homeostasis under different conditions. PMID:25861990
Light Controlled Modulation of Gene Expression by Chemical Optoepigenetic Probes
Reis, Surya A.; Ghosh, Balaram; Hendricks, J. Adam; Szantai-Kis, D. Miklos; Törk, Lisa; Ross, Kenneth N.; Lamb, Justin; Read-Button, Willis; Zheng, Baixue; Wang, Hongtao; Salthouse, Christopher; Haggarty, Stephen J.; Mazitschek, Ralph
2016-01-01
Epigenetic gene regulation is a dynamic process orchestrated by chromatin-modifying enzymes. Many of these master regulators exert their function through covalent modification of DNA and histone proteins. Aberrant epigenetic processes have been implicated in the pathophysiology of multiple human diseases. Small-molecule inhibitors have been essential to advancing our understanding of the underlying molecular mechanisms of epigenetic processes. However, the resolution offered by small molecules is often insufficient to manipulate epigenetic processes with high spatio-temporal control. Here, we present a novel and generalizable approach, referred to as ‘Chemo-Optical Modulation of Epigenetically-regulated Transcription’ (COMET), enabling high-resolution, optical control of epigenetic mechanisms based on photochromic inhibitors of human histone deacetylases using visible light. COMET probes may translate into novel therapeutic strategies for diseases where conditional and selective epigenome modulation is required. PMID:26974814
Solomon, Jonathan M.; Pasupuleti, Rao; Xu, Lei; McDonagh, Thomas; Curtis, Rory; DiStefano, Peter S.; Huber, L. Julie
2006-01-01
Human SIRT1 is an enzyme that deacetylates the p53 tumor suppressor protein and has been suggested to modulate p53-dependent functions including DNA damage-induced cell death. In this report, we used EX-527, a novel, potent, and specific small-molecule inhibitor of SIRT1 catalytic activity to examine the role of SIRT1 in p53 acetylation and cell survival after DNA damage. Treatment with EX-527 dramatically increased acetylation at lysine 382 of p53 after different types of DNA damage in primary human mammary epithelial cells and several cell lines. Significantly, inhibition of SIRT1 catalytic activity by EX-527 had no effect on cell growth, viability, or p53-controlled gene expression in cells treated with etoposide. Acetyl-p53 was also increased by the histone deacetylase (HDAC) class I/II inhibitor trichostatin A (TSA). EX-527 and TSA acted synergistically to increase acetyl-p53 levels, confirming that p53 acetylation is regulated by both SIRT1 and HDACs. While TSA alone reduced cell survival after DNA damage, the combination of EX-527 and TSA had no further effect on cell viability and growth. These results show that, although SIRT1 deacetylates p53, this does not play a role in cell survival following DNA damage in certain cell lines and primary human mammary epithelial cells. PMID:16354677
Nilsson, Emil K; Boström, Adrian E; Mwinyi, Jessica; Schiöth, Helgi B
2016-06-01
Despite an established link between sleep deprivation and epigenetic processes in humans, it remains unclear to what extent sleep deprivation modulates DNA methylation. We performed a within-subject randomized blinded study with 16 healthy subjects to examine the effect of one night of total sleep deprivation (TSD) on the genome-wide methylation profile in blood compared with that in normal sleep. Genome-wide differences in methylation between both conditions were assessed by applying a paired regression model that corrected for monocyte subpopulations. In addition, the correlations between the methylation of genes detected to be modulated by TSD and gene expression were examined in a separate, publicly available cohort of 10 healthy male donors (E-GEOD-49065). Sleep deprivation significantly affected the DNA methylation profile both independently and in dependency of shifts in monocyte composition. Our study detected differential methylation of 269 probes. Notably, one CpG site was located 69 bp upstream of ING5, which has been shown to be differentially expressed after sleep deprivation. Gene set enrichment analysis detected the Notch and Wnt signaling pathways to be enriched among the differentially methylated genes. These results provide evidence that total acute sleep deprivation alters the methylation profile in healthy human subjects. This is, to our knowledge, the first study that systematically investigated the impact of total acute sleep deprivation on genome-wide DNA methylation profiles in blood and related the epigenomic findings to the expression data.
2017-01-01
Ribosomal RNAs (rRNAs) are transcribed from two multicopy DNA arrays: the 5S ribosomal DNA (rDNA) array residing in a single human autosome and the 45S rDNA array residing in five human autosomes. The arrays are among the most variable segments of the genome, exhibit concerted copy number variation (cCNV), encode essential components of the ribosome, and modulate global gene expression. Here we combined whole genome data from >700 tumors and paired normal tissues to provide a portrait of rDNA variation in human tissues and cancers of diverse mutational signatures, including stomach and lung adenocarcinomas, ovarian cancers, and others of the TCGA panel. We show that cancers undergo coupled 5S rDNA array expansion and 45S rDNA loss that is accompanied by increased estimates of proliferation rate and nucleolar activity. These somatic changes in rDNA CN occur in a background of over 10-fold naturally occurring rDNA CN variation across individuals and cCNV of 5S-45S arrays in some but not all tissues. Analysis of genetic context revealed associations between cancer rDNA CN amplification or loss and the presence of specific somatic alterations, including somatic SNPs and copy number gain/losses in protein coding genes across the cancer genome. For instance, somatic inactivation of the tumor suppressor gene TP53 emerged with a strong association with coupled 5S expansion / 45S loss in several cancers. Our results uncover frequent and contrasting changes in the 5S and 45S rDNA along rapidly proliferating cell lineages with high nucleolar activity. We suggest that 5S rDNA amplification facilitates increased proliferation, nucleolar activity, and ribosomal synthesis in cancer, whereas 45S rDNA loss emerges as a byproduct of transcription-replication conflict in rapidly replicating tumor cells. The observations raise the prospects of using the rDNA arrays as re-emerging targets for the design of novel strategies in cancer therapy. PMID:28880866
Grace, Marcy B.; Singh, Vijay K.; Rhee, Juong G.; Jackson, William E.; Kao, Tzu-Cheg; Whitnall, Mark H.
2012-01-01
The steroid androst-5-ene-3ß,17ß-diol (5-androstenediol, 5-AED) elevates circulating granulocytes and platelets in animals and humans, and enhances survival during the acute radiation syndrome (ARS) in mice and non-human primates. 5-AED promotes survival of irradiated human hematopoietic progenitors in vitro through induction of Nuclear Factor-κB (NFκB)-dependent Granulocyte Colony-Stimulating Factor (G-CSF) expression, and causes elevations of circulating G-CSF and interleukin-6 (IL-6). However, the in vivo cellular and molecular effects of 5-AED are not well understood. The aim of this study was to investigate the mechanisms of action of 5-AED administered subcutaneously (s.c.) to mice 24 h before total body γ- or X-irradiation (TBI). We used neutralizing antibodies, flow cytometric functional assays of circulating innate immune cells, analysis of expression of genes related to cell cycle progression, DNA repair and apoptosis, and assessment of DNA strand breaks with halo-comet assays. Neutralization experiments indicated endogenous G-CSF but not IL-6 was involved in survival enhancement by 5-AED. In keeping with known effects of G-CSF on the innate immune system, s.c. 5-AED stimulated phagocytosis in circulating granulocytes and oxidative burst in monocytes. 5-AED induced expression of both bax and bcl-2 in irradiated animals. Cdkn1a and ddb1, but not gadd45a expression, were upregulated by 5-AED in irradiated mice. S.c. 5-AED administration caused decreased DNA strand breaks in splenocytes from irradiated mice. Our results suggest 5-AED survival enhancement is G-CSF-dependent, and that it stimulates innate immune cell function and reduces radiation-induced DNA damage via induction of genes that modulate cell cycle progression and apoptosis. PMID:22843381
Grace, Marcy B; Singh, Vijay K; Rhee, Juong G; Jackson, William E; Kao, Tzu-Cheg; Whitnall, Mark H
2012-11-01
The steroid androst-5-ene-3ß,17ß-diol (5-androstenediol, 5-AED) elevates circulating granulocytes and platelets in animals and humans, and enhances survival during the acute radiation syndrome (ARS) in mice and non-human primates. 5-AED promotes survival of irradiated human hematopoietic progenitors in vitro through induction of Nuclear Factor-κB (NFκB)-dependent Granulocyte Colony-Stimulating Factor (G-CSF) expression, and causes elevations of circulating G-CSF and interleukin-6 (IL-6). However, the in vivo cellular and molecular effects of 5-AED are not well understood. The aim of this study was to investigate the mechanisms of action of 5-AED administered subcutaneously (s.c.) to mice 24 h before total body γ- or X-irradiation (TBI). We used neutralizing antibodies, flow cytometric functional assays of circulating innate immune cells, analysis of expression of genes related to cell cycle progression, DNA repair and apoptosis, and assessment of DNA strand breaks with halo-comet assays. Neutralization experiments indicated endogenous G-CSF but not IL-6 was involved in survival enhancement by 5-AED. In keeping with known effects of G-CSF on the innate immune system, s.c. 5-AED stimulated phagocytosis in circulating granulocytes and oxidative burst in monocytes. 5-AED induced expression of both bax and bcl-2 in irradiated animals. Cdkn1a and ddb1, but not gadd45a expression, were upregulated by 5-AED in irradiated mice. S.c. 5-AED administration caused decreased DNA strand breaks in splenocytes from irradiated mice. Our results suggest 5-AED survival enhancement is G-CSF-dependent, and that it stimulates innate immune cell function and reduces radiation-induced DNA damage via induction of genes that modulate cell cycle progression and apoptosis.
Helix Unwinding and Base Flipping Enable Human MTERF1 to Terminate Mitochondrial Transcription
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yakubovskaya, E.; Mejia, E; Byrnes, J
2010-01-01
Defects in mitochondrial gene expression are associated with aging and disease. Mterf proteins have been implicated in modulating transcription, replication and protein synthesis. We have solved the structure of a member of this family, the human mitochondrial transcriptional terminator MTERF1, bound to dsDNA containing the termination sequence. The structure indicates that upon sequence recognition MTERF1 unwinds the DNA molecule, promoting eversion of three nucleotides. Base flipping is critical for stable binding and transcriptional termination. Additional structural and biochemical results provide insight into the DNA binding mechanism and explain how MTERF1 recognizes its target sequence. Finally, we have demonstrated that themore » mitochondrial pathogenic G3249A and G3244A mutations interfere with key interactions for sequence recognition, eliminating termination. Our results provide insight into the role of mterf proteins and suggest a link between mitochondrial disease and the regulation of mitochondrial transcription.« less
Sequence and Structure Dependent DNA-DNA Interactions
NASA Astrophysics Data System (ADS)
Kopchick, Benjamin; Qiu, Xiangyun
Molecular forces between dsDNA strands are largely dominated by electrostatics and have been extensively studied. Quantitative knowledge has been accumulated on how DNA-DNA interactions are modulated by varied biological constituents such as ions, cationic ligands, and proteins. Despite its central role in biology, the sequence of DNA has not received substantial attention and ``random'' DNA sequences are typically used in biophysical studies. However, ~50% of human genome is composed of non-random-sequence DNAs, particularly repetitive sequences. Furthermore, covalent modifications of DNA such as methylation play key roles in gene functions. Such DNAs with specific sequences or modifications often take on structures other than the canonical B-form. Here we present series of quantitative measurements of the DNA-DNA forces with the osmotic stress method on different DNA sequences, from short repeats to the most frequent sequences in genome, and to modifications such as bromination and methylation. We observe peculiar behaviors that appear to be strongly correlated with the incurred structural changes. We speculate the causalities in terms of the differences in hydration shell and DNA surface structures.
Gafrikova, Michala; Galova, Eliska; Sevcovicova, Andrea; Imreova, Petronela; Mucaji, Pavel; Miadokova, Eva
2014-03-14
DNA damage prevention is an important mechanism involved in cancer prevention by dietary compounds. Armoracia rusticana is cultivated mainly for its roots that are used in the human diet as a pungent spice. The roots represent rich sources of biologically active phytocompounds, which are beneficial for humans. In this study we investigated the modulation of H₂O₂ genotoxicity using the A. rusticana root aqueous extract (AE) and two flavonoids (kaempferol or quercetin). Human lymphocytes pre-treated with AE, kaempferol and quercetin were challenged with H₂O₂ and the DNA damage was assessed by the comet assay. At first we assessed a non-genotoxic concentration of AE and flavonoids, respectively. In lymphocytes challenged with H₂O₂ we proved that the 0.0025 mg·mL⁻¹ concentration of AE protected human DNA. It significantly reduced H₂O₂-induced oxidative damage (from 78% to 35.75%). Similarly, a non-genotoxic concentration of kaempferol (5 μg·mL⁻¹) significantly diminished oxidative DNA damage (from 83.3% to 19.4%), and the same concentration of quercetin also reduced the genotoxic effect of H₂O₂ (from 83.3% to 16.2%). We conclude that AE, kaempferol and quercetin probably act as antimutagens. The molecular mechanisms underlying their antimutagenic activity might be explained by their antioxidant properties.
Epigenetics, epidemiology and mitochondrial DNA diseases
Chinnery, Patrick F; Elliott, Hannah R; Hudson, Gavin; Samuels, David C; Relton, Caroline L
2012-01-01
Over the last two decades, the mutation of mitochondrial DNA (mtDNA) has emerged as a major cause of inherited human disease. The disorders present clinically in at least 1 in 10 000 adults, but pathogenic mutations are found in approximately 1 in 200 of the background population. Mitochondrial DNA is maternally inherited and there can be marked phenotypic variability within the same family. Heteroplasmy is a significant factor and environmental toxins also appear to modulate the phenotype. Although genetic and biochemical studies have provided part of the explanation, a comprehensive understanding of the incomplete penetrance of these diseases is lacking—both at the population and family levels. Here, we review the potential role of epigenetic factors in the pathogenesis of mtDNA diseases and the contribution that epidemiological approaches can make to improve our understanding in this area. Despite being previously dismissed, there is an emerging evidence that mitochondria contain the machinery required to epigenetically modify mtDNA expression. In addition, the increased production of reactive oxygen species seen in several mtDNA diseases could lead to the epigenetic modification of the nuclear genome, including chromatin remodelling and alterations to DNA methylation and microRNA expression, thus contributing to the diverse pathophysiology observed in this group of diseases. These observations open the door to future studies investigating the role of mtDNA methylation in human disease. PMID:22287136
Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei
2015-08-01
DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.
Dietary Choline Deficiency causes DNA Strand Breaks and Alters Epigenetic Marks on DNA and Histones
Zeisel, Steven H.
2011-01-01
Dietary choline is an important modulator of gene expression (via epigenetic marks) and of DNA integrity. Choline was discovered to be an essential nutrient for some humans approximately one decade ago. This requirement is diminished in young women because estrogen drives endogenous synthesis of phosphatidylcholine, from which choline can be derived. Almost half of women have a single nucleotide polymorphism that abrogates estrogen-induction of endogenous synthesis, and these women require dietary choline just as do men. In the US, dietary intake of choline is marginal. Choline deficiency in people is associated with liver and muscle dysfunction and damage, with apoptosis, and with increased DNA strand breaks. Several mechanisms explain these modifications to DNA. Choline deficiency increases leakage of reactive oxygen species from mitochondria consequent to altered mitochondrial membrane composition and enhanced fatty acid oxidation. Choline deficiency impairs folate metabolism, resulting in decreased thymidylate synthesis and increased uracil misincorporation into DNA, with strand breaks resulting during error-prone repair attempts. Choline deficiency alters DNA methylation, which alters gene expression for critical genes involved in DNA mismatch repair, resulting in increased mutation rates. Any dietary deficiency which increases mutation rates should be associated with increased risk of cancers, and this is the case for choline deficiency. In rodent models, diets low in choline and methyl-groups result in spontaneous hepatocarcinomas. In human epidemiological studies, there are interesting data that suggest that this also may be the case for humans, especially those with SNPs that increase the dietary requirement for choline. PMID:22041500
Dietary choline deficiency causes DNA strand breaks and alters epigenetic marks on DNA and histones.
Zeisel, Steven H
2012-05-01
Dietary choline is an important modulator of gene expression (via epigenetic marks) and of DNA integrity. Choline was discovered to be an essential nutrient for some humans approximately one decade ago. This requirement is diminished in young women because estrogen drives endogenous synthesis of phosphatidylcholine, from which choline can be derived. Almost half of women have a single nucleotide polymorphism that abrogates estrogen-induction of endogenous synthesis, and these women require dietary choline just as do men. In the US, dietary intake of choline is marginal. Choline deficiency in people is associated with liver and muscle dysfunction and damage, with apoptosis, and with increased DNA strand breaks. Several mechanisms explain these modifications to DNA. Choline deficiency increases leakage of reactive oxygen species from mitochondria consequent to altered mitochondrial membrane composition and enhanced fatty acid oxidation. Choline deficiency impairs folate metabolism, resulting in decreased thymidylate synthesis and increased uracil misincorporation into DNA, with strand breaks resulting during error-prone repair attempts. Choline deficiency alters DNA methylation, which alters gene expression for critical genes involved in DNA mismatch repair, resulting in increased mutation rates. Any dietary deficiency which increases mutation rates should be associated with increased risk of cancers, and this is the case for choline deficiency. In rodent models, diets low in choline and methyl-groups result in spontaneous hepatocarcinomas. In human epidemiological studies, there are interesting data that suggest that this also may be the case for humans, especially those with SNPs that increase the dietary requirement for choline. Copyright © 2011 Elsevier B.V. All rights reserved.
Interaction of cholinesterase modulators with DNA and their cytotoxic activity.
Janockova, Jana; Gulasova, Zuzana; Plsikova, Jana; Musilek, Kamil; Kuca, Kamil; Mikes, Jaromir; Culka, Lubomir; Fedorocko, Peter; Kozurkova, Maria
2014-03-01
This research was focused on a study of the binding properties of a series of cholinesterase reactivators compounds K075 (1), K027 (2) and inhibitors compounds K524, K009 and 7-MEOTA (3-5) with calf thymus DNA. The nature of the interactions between compounds 1-5 and DNA were studied using spectroscopic techniques (UV-vis, fluorescence spectroscopy and circular dichroism). The binding constants for complexes of cholinesterase modulators with DNA were determined from UV-vis spectroscopic titrations (K=0.5 × 10(4)-8.9 × 10(5)M(-1)). The ability of the prepared analogues to relax topoisomerase I was studied with electrophoretic techniques and it was proved that ligands 4 and 5 inhibited this enzyme at a concentration of 30 μM. The biological activity of the novel compounds was assessed through an examination of changes in cell cycle distribution, mitochondrial membrane potential and cellular viability. Inhibitors 3-5 exhibited a cytotoxic effect on HL-60 (human acute promyelocytic leukaemia) cell culture, demonstrated a tendency to affect mitochondrial physiology and viability, and also forced cells to accumulate in the G1/G0-phase of the cell cycle. The cholinesterase reactivators 1 and 2 were found relatively save from the point of view of DNA binding, whereas cholinesterase inhibitors 3-5 resulted as strong DNA binding agents that limit their plausible use. Copyright © 2013 Elsevier B.V. All rights reserved.
Poletto, Mattia; Yang, Di; Fletcher, Sally C; Vendrell, Iolanda; Fischer, Roman; Legrand, Arnaud J; Dianov, Grigory L
2017-09-29
Ataxia telangiectasia (A-T) is a syndrome associated with loss of ATM protein function. Neurodegeneration and cancer predisposition, both hallmarks of A-T, are likely to emerge as a consequence of the persistent oxidative stress and DNA damage observed in this disease. Surprisingly however, despite these severe features, a lack of functional ATM is still compatible with early life, suggesting that adaptation mechanisms contributing to cell survival must be in place. Here we address this gap in our knowledge by analysing the process of human fibroblast adaptation to the lack of ATM. We identify profound rearrangement in cellular proteostasis occurring very early on after loss of ATM in order to counter protein damage originating from oxidative stress. Change in proteostasis, however, is not without repercussions. Modulating protein turnover in ATM-depleted cells also has an adverse effect on the DNA base excision repair pathway, the major DNA repair system that deals with oxidative DNA damage. As a consequence, the burden of unrepaired endogenous DNA lesions intensifies, progressively leading to genomic instability. Our study provides a glimpse at the cellular consequences of loss of ATM and highlights a previously overlooked role for proteostasis in maintaining cell survival in the absence of ATM function. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Structure of the active form of human origin recognition complex and its ATPase motor module
Tocilj, Ante; On, Kin Fan; Yuan, Zuanning; Sun, Jingchuan; Elkayam, Elad; Li, Huilin; Stillman, Bruce; Joshua-Tor, Leemor
2017-01-01
Binding of the Origin Recognition Complex (ORC) to origins of replication marks the first step in the initiation of replication of the genome in all eukaryotic cells. Here, we report the structure of the active form of human ORC determined by X-ray crystallography and cryo-electron microscopy. The complex is composed of an ORC1/4/5 motor module lobe in an organization reminiscent of the DNA polymerase clamp loader complexes. A second lobe contains the ORC2/3 subunits. The complex is organized as a double-layered shallow corkscrew, with the AAA+ and AAA+-like domains forming one layer, and the winged-helix domains (WHDs) forming a top layer. CDC6 fits easily between ORC1 and ORC2, completing the ring and the DNA-binding channel, forming an additional ATP hydrolysis site. Analysis of the ATPase activity of the complex provides a basis for understanding ORC activity as well as molecular defects observed in Meier-Gorlin Syndrome mutations. DOI: http://dx.doi.org/10.7554/eLife.20818.001 PMID:28112645
Unique structural modulation of a non-native substrate by cochaperone DnaJ.
Tiwari, Satyam; Kumar, Vignesh; Jayaraj, Gopal Gunanathan; Maiti, Souvik; Mapa, Koyeli
2013-02-12
The role of bacterial DnaJ protein as a cochaperone of DnaK is strongly appreciated. Although DnaJ unaccompanied by DnaK can bind unfolded as well as native substrate proteins, its role as an individual chaperone remains elusive. In this study, we demonstrate that DnaJ binds a model non-native substrate with a low nanomolar dissociation constant and, more importantly, modulates the structure of its non-native state. The structural modulation achieved by DnaJ is different compared to that achieved by the DnaK-DnaJ complex. The nature of structural modulation exerted by DnaJ is suggestive of a unique unfolding activity on the non-native substrate by the chaperone. Furthermore, we demonstrate that the zinc binding motif along with the C-terminal substrate binding domain of DnaJ is necessary and sufficient for binding and the subsequent binding-induced structural alterations of the non-native substrate. We hypothesize that this hitherto unknown structural alteration of non-native states by DnaJ might be important for its chaperoning activity by removing kinetic traps of the folding intermediates.
Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide
Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; ...
2014-11-17
Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2’-deoxyguanosine found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate E. coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerase discriminates between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities,more » nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine (Cy) and 8-oxodGTP(syn) utilizes its Hoogsteen edge to base pair with adenine (Ad). Here in this paper we utilized time-lapse crystallography to follow 8-oxo-dGTP insertion opposite Ad or Cy with human DNA pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxodGTP utilizes charge modulation during insertion that can lead to a blocked DNA repair intermediate.« less
He, Xiangyu; Zhu, Xiaoyu; Wang, Xuexiang; Wang, Wei; Dai, Yu; Yan, Qingfeng
2013-01-01
The phenotypic manifestations of mitochondrial DNA (mtDNA) mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R) or P(R) 454) mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we report that the deletion of the nuclear modifier gene MTO2 suppressed the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae. First, the strain with a single mtDNA C1477G mutation exhibited hypersensitivity to neomycin. Functional assays indicated that the steady-state transcription level of mitochondrial DNA, the mitochondrial respiratory rate, and the membrane potential decreased significantly after neomycin treatment. The impaired mitochondria could not produce sufficient energy to maintain cell viability. Second, when the mto2 null and the mitochondrial C1477G mutations co-existed (mto2(P(R))), the oxygen consumption rate in the double mutant decreased markedly compared to that of the control strains (MTO2(P(S)), mto2(P(S)) and MTO2(P(R))). The expression levels of the key glycolytic genes HXK2, PFK1 and PYK1 in the mto2(P(R)) strain were stimulated by neomycin and up-regulated by 89%, 112% and 55%, respectively. The enhanced glycolysis compensated for the respiratory energy deficits, and could be inhibited by the glycolytic enzyme inhibitor. Our findings in yeast will provide a new insight into the pathogenesis of human deafness.
Asymmetric segregation of template DNA strands in basal-like human breast cancer cell lines
2013-01-01
Background and methods Stem or progenitor cells from healthy tissues have the capacity to co-segregate their template DNA strands during mitosis. Here, we set out to test whether breast cancer cell lines also possess the ability to asymmetrically segregate their template DNA strands via non-random chromosome co-segregation, and whether this ability correlates with certain properties attributed to breast cancer stem cells (CSCs). We quantified the frequency of asymmetric segregation of template DNA strands in 12 human breast cancer cell lines, and correlated the frequency to molecular subtype, CD44+/CD24-/lo phenotype, and invasion/migration ability. We tested if co-culture with human mesenchymal stem cells, which are known to increase self-renewal, can alter the frequency of asymmetric segregation of template DNA in breast cancer. Results We found a positive correlation between asymmetric segregation of template DNA and the breast cancer basal-like and claudin-low subtypes. There was an inverse correlation between asymmetric segregation of template DNA and Her2 expression. Breast cancer samples with evidence of asymmetric segregation of template DNA had significantly increased invasion and borderline significantly increased migration abilities. Samples with high CD44+/CD24-/lo surface expression were more likely to harbor a consistent population of cells that asymmetrically segregated its template DNA; however, symmetric self-renewal was enriched in the CD44+/CD24-/lo population. Co-culturing breast cancer cells with human mesenchymal stem cells expanded the breast CSC pool and decreased the frequency of asymmetric segregation of template DNA. Conclusions Breast cancer cells within the basal-like subtype can asymmetrically segregate their template DNA strands through non-random chromosome segregation. The frequency of asymmetric segregation of template DNA can be modulated by external factors that influence expansion or self-renewal of CSC populations. Future studies to uncover the underlying mechanisms driving asymmetric segregation of template DNA and dictating cell fate at the time of cell division may explain how CSCs are maintained in tumors. PMID:24238140
Modulation of DNA binding by gene-specific transcription factors.
Schleif, Robert F
2013-10-01
The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.
Theriot, Corey A; Hegde, Muralidhar L; Hazra, Tapas K; Mitra, Sankar
2010-06-04
The human DNA glycosylase NEIL1, activated during the S-phase, has been shown to excise oxidized base lesions in single-strand DNA substrates. Furthermore, our previous work demonstrating functional interaction of NEIL1 with PCNA and flap endonuclease 1 (FEN1) suggested its involvement in replication-associated repair. Here we show interaction of NEIL1 with replication protein A (RPA), the heterotrimeric single-strand DNA binding protein that is essential for replication and other DNA transactions. The NEIL1 immunocomplex isolated from human cells contains RPA, and its abundance in the complex increases after exposure to oxidative stress. NEIL1 directly interacts with the large subunit of RPA (K(d) approximately 20 nM) via the common interacting interface (residues 312-349) in NEIL1's disordered C-terminal region. RPA inhibits the base excision activity of both wild-type NEIL1 (389 residues) and its C-terminal deletion CDelta78 mutant (lacking the interaction domain) for repairing 5-hydroxyuracil (5-OHU) in a primer-template structure mimicking the DNA replication fork. This inhibition is reduced when the damage is located near the primer-template junction. Contrarily, RPA moderately stimulates wild-type NEIL1 but not the CDelta78 mutant when 5-OHU is located within the duplex region. While NEIL1 is inhibited by both RPA and Escherichia coli single-strand DNA binding protein, only inhibition by RPA is relieved by PCNA. These results showing modulation of NEIL1's activity on single-stranded DNA substrate by RPA and PCNA support NEIL1's involvement in repairing the replicating genome. Copyright 2010 Elsevier B.V. All rights reserved.
Seager, Anna L.
2012-01-01
Oxidative stress contributes to many disease etiologies including ageing, neurodegeneration, and cancer, partly through DNA damage induction (genotoxicity). Understanding the i nteractions of free radicals with DNA is fundamental to discern mutation risks. In genetic toxicology, regulatory authorities consider that most genotoxins exhibit a linear relationship between dose and mutagenic response. Yet, homeostatic mechanisms, including DNA repair, that allow cells to tolerate low levels of genotoxic exposure exist. Acceptance of thresholds for genotoxicity has widespread consequences in terms of understanding cancer risk and regulating human exposure to chemicals/drugs. Three pro-oxidant chemicals, hydrogen peroxide (H2O2), potassium bromate (KBrO3), and menadione, were examined for low dose-response curves in human lymphoblastoid cells. DNA repair and antioxidant capacity were assessed as possible threshold mechanisms. H2O2 and KBrO3, but not menadione, exhibited thresholded responses, containing a range of nongenotoxic low doses. Levels of the DNA glycosylase 8-oxoguanine glycosylase were unchanged in response to pro- oxidant stress. DNA repair–focused gene expression arrays reported changes in ATM and BRCA1, involved in double-strand break repair, in response to low-dose pro-oxidant exposure; however, these alterations were not substantiated at the protein level. Determination of oxidatively induced DNA damage in H2O2-treated AHH-1 cells reported accumulation of thymine glycol above the genotoxic threshold. Further, the H2O2 dose-response curve was shifted by modulating the antioxidant glutathione. Hence, observed pro- oxidant thresholds were due to protective capacities of base excision repair enzymes and antioxidants against DNA damage, highlighting the importance of homeostatic mechanisms in “genotoxic tolerance.” PMID:22539617
DNA repair goes hip-hop: SMARCA and CHD chromatin remodellers join the break dance.
Rother, Magdalena B; van Attikum, Haico
2017-10-05
Proper signalling and repair of DNA double-strand breaks (DSB) is critical to prevent genome instability and diseases such as cancer. The packaging of DNA into chromatin, however, has evolved as a mere obstacle to these DSB responses. Posttranslational modifications and ATP-dependent chromatin remodelling help to overcome this barrier by modulating nucleosome structures and allow signalling and repair machineries access to DSBs in chromatin. Here we recap our current knowledge on how ATP-dependent SMARCA- and CHD-type chromatin remodellers alter chromatin structure during the signalling and repair of DSBs and discuss how their dysfunction impacts genome stability and human disease.This article is part of the themed issue 'Chromatin modifiers and remodellers in DNA repair and signalling'. © 2017 The Authors.
Microchip Module for Blood Sample Preparation and Nucleic Acid Amplification Reactions
Yuen, Po Ki; Kricka, Larry J.; Fortina, Paolo; Panaro, Nicholas J.; Sakazume, Taku; Wilding, Peter
2001-01-01
A computer numerical control-machined plexiglas-based microchip module was designed and constructed for the integration of blood sample preparation and nucleic acid amplification reactions. The microchip module is comprised of a custom-made heater-cooler for thermal cycling, a series of 254 μm × 254 μm microchannels for transporting human whole blood and reagents in and out of an 8–9 μL dual-purpose (cell isolation and PCR) glass-silicon microchip. White blood cells were first isolated from a small volume of human whole blood (<3 μL) in an integrated cell isolation–PCR microchip containing a series of 3.5-μm feature-sized “weir-type” filters, formed by an etched silicon dam spanning the flow chamber. A genomic target, a region in the human coagulation Factor V gene (226-bp), was subsequently directly amplified by microchip-based PCR on DNA released from white blood cells isolated on the filter section of the microchip mounted onto the microchip module. The microchip module provides a convenient means to simplify nucleic acid analyses by integrating two key steps in genetic testing procedures, cell isolation and PCR and promises to be adaptable for additional types of integrated assays. PMID:11230164
Karsli-Ceppioglu, Seher; Ngollo, Marjolaine; Adjakly, Mawussi; Dagdemir, Aslihan; Judes, Gaëlle; Lebert, André; Boiteux, Jean-Paul; Penault-LLorca, Frédérique; Bignon, Yves-Jean; Guy, Laurent; Bernard-Gallon, Dominique
2015-04-01
In prostate cancer, DNA methylation is significantly associated with tumor initiation, progression, and metastasis. Previous studies have suggested that soy phytoestrogens might regulate DNA methylation at individual candidate gene loci and that they play a crucial role as potential therapeutic agents for prostate cancer. The purpose of our study was to examine the modulation effects of phytoestrogens on a genome-wide scale in regards to DNA methylation in prostate cancer. Prostate cancer cell lines DU-145 and LNCaP were treated with 40 μM of genistein and 110 μM of daidzein. DNMT inhibitor 5-azacytidine (2 μM) and the methylating agent budesonide (2 μM) were used to compare their demethylation/methylation effects with phytoestrogens. The regulatory effects of phytoestrogens on DNA methylation were analyzed by using a methyl-DNA immunoprecipitation method coupled with Human DNA Methylation Microarrays (MeDIP-chip). We observed that the methylation profiles of 58 genes were altered by genistein and daidzein treatments in DU-145 and LNCaP prostate cancer cells. In addition, the methylation frequencies of the MAD1L1, TRAF7, KDM4B, and hTERT genes were remarkably modified by genistein treatment. Our results suggest that the modulation effects of phytoestrogens on DNA methylation essentially lead to inhibition of cell growth and induction of apoptosis. Genome-wide methylation profiling reported here suggests that epigenetic regulation mechanisms and, by extension, epigenetics-driven novel therapeutic candidates warrant further consideration in future "omics" studies of prostate cancer.
Bimodal regulation of p21waf1 protein as function of DNA damage levels
Buscemi, G; Ricci, C; Zannini, L; Fontanella, E; Plevani, P; Delia, D
2014-01-01
Human p21Waf1 protein is well known for being transcriptionally induced by p53 and activating the cell cycle checkpoint arrest in response to DNA breaks. Here we report that p21Waf1 protein undergoes a bimodal regulation, being upregulated in response to low doses of DNA damage but rapidly and transiently degraded in response to high doses of DNA lesions. Responsible for this degradation is the checkpoint kinase Chk1, which phosphorylates p21Waf1 on T145 and S146 residues and induces its proteasome-dependent proteolysis. The initial p21Waf1 degradation is then counteracted by the ATM-Chk2 pathway, which promotes the p53-dependent accumulation of p21Waf1 at any dose of damage. We also found that p21Waf1 ablation favors the activation of an apoptotic program to eliminate otherwise irreparable cells. These findings support a model in which in human cells a balance between ATM-Chk2-p53 and the ATR-Chk1 pathways modulates p21Waf1 protein levels in relation to cytostatic and cytotoxic doses of DNA damage. PMID:25486478
The major human AP endonuclease (Ape1) is involved in the nucleotide incision repair pathway
Gros, Laurent; Ishchenko, Alexander A.; Ide, Hiroshi; Elder, Rhoderick H.; Saparbaev, Murat K.
2004-01-01
In nucleotide incision repair (NIR), an endonuclease nicks oxidatively damaged DNA in a DNA glycosylase-independent manner, providing the correct ends for DNA synthesis coupled to the repair of the remaining 5′-dangling modified nucleotide. This mechanistic feature is distinct from DNA glycosylase-mediated base excision repair. Here we report that Ape1, the major apurinic/apyrimidinic endonuclease in human cells, is the damage- specific endonuclease involved in NIR. We show that Ape1 incises DNA containing 5,6-dihydro-2′-deoxyuridine, 5,6-dihydrothymidine, 5-hydroxy-2′-deoxyuridine, alpha-2′-deoxyadenosine and alpha-thymidine adducts, generating 3′-hydroxyl and 5′-phosphate termini. The kinetic constants indicate that Ape1-catalysed NIR activity is highly efficient. The substrate specificity and protein conformation of Ape1 is modulated by MgCl2 concentrations, thus providing conditions under which NIR becomes a major activity in cell-free extracts. While the N-terminal region of Ape1 is not required for AP endonuclease function, we show that it regulates the NIR activity. The physiological relevance of the mammalian NIR pathway is discussed. PMID:14704345
Cabarkapa, Andrea; Zivković, Lada; Zukovec, Dijana; Djelić, Ninoslav; Bajić, Vladan; Dekanski, Dragana; Spremo-Potparević, Biljana
2014-04-01
Excessive release of stress hormone adrenaline is accompanied by generation of reactive oxygen species which may cause disruption of DNA integrity leading to cancer and age-related disorders. Phenolic-rich plant product dry olive leaf extract (DOLE) is known to modulate effects of various oxidants in human cells. The aim was to evaluate the effect of commercial DOLE against adrenaline induced DNA damage in human leukocytes by using comet assay. Peripheral blood leukocytes from 6 healthy subjects were treated in vitro with three final concentrations of DOLE (0.125, 0.5, and 1mg/mL) for 30 min at 37°C under two different protocols, pretreatment and post-treatment. Protective effect of DOLE was assessed from its ability to attenuate formation of DNA lesions induced by adrenaline. Compared to cells exposed only to adrenaline, DOLE displayed significant reduction (P<0.001) of DNA damage at all three concentrations and under both experimental protocols. Pearson correlation analysis revealed a significant positive association between DOLE concentration and leukocytes DNA damage (P<0.05). Antigenotoxic effect of the extract was more pronounced at smaller concentrations. Post-treatment with 0.125 mg/mL DOLE was the most effective against adrenaline genotoxicity. Results indicate genoprotective and antioxidant properties in dry olive leaf extract, strongly supporting further explorations of its underlying mechanisms of action. Copyright © 2014 Elsevier Ltd. All rights reserved.
Vaghjiani, Vijesh; Cain, Jason E; Lee, William; Vaithilingam, Vijayaganapathy; Tuch, Bernard E; St John, Justin C
2017-10-15
Mitochondrial deoxyribonucleic acid (mtDNA) copy number is tightly regulated during pluripotency and differentiation. There is increased demand of cellular adenosine triphosphate (ATP) during differentiation for energy-intensive cell types such as hepatocytes and neurons to meet the cell's functional requirements. During hepatocyte differentiation, mtDNA copy number should be synchronously increased to generate sufficient ATP through oxidative phosphorylation. Unlike bone marrow mesenchymal cells, mtDNA copy number failed to increase by 28 days of differentiation of human amniotic epithelial cells (hAEC) into hepatocyte-like cells (HLC) despite their expression of some end-stage hepatic markers. This was due to higher levels of DNA methylation at exon 2 of POLGA, the mtDNA-specific replication factor. Treatment with a DNA demethylation agent, 5-azacytidine, resulted in increased mtDNA copy number, reduced DNA methylation at exon 2 of POLGA, and reduced hepatic gene expression. Depletion of mtDNA followed by subsequent differentiation did not increase mtDNA copy number, but reduced DNA methylation at exon 2 of POLGA and increased expression of hepatic and pluripotency genes. We encapsulated hAEC in barium alginate microcapsules and subsequently differentiated them into HLC. Encapsulation resulted in no net increase of mtDNA copy number but a significant reduction in DNA methylation of POLGA. RNAseq analysis showed that differentiated HLC express hepatocyte-specific genes but also increased expression of inflammatory interferon genes. Differentiation in encapsulated cells showed suppression of inflammatory genes as well as increased expression of genes associated with hepatocyte function pathways and networks. This study demonstrates that an increase in classical hepatic gene expression can be achieved in HLC through encapsulation, although they fail to effectively regulate mtDNA copy number.
Awate, Sanket; Brosh, Robert M
2017-06-08
Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies.
Awate, Sanket; Brosh, Robert M.
2017-01-01
Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies. PMID:28594346
Mitochondrial-Nuclear Epistasis: Implications for Human Aging and Longevity
Tranah, Gregory
2010-01-01
There is substantial evidence that mitochondria are involved in the aging process. Mitochondrial function requires the coordinated expression of hundreds of nuclear genes and a few dozen mitochondrial genes, many of which have been associated with either extended or shortened life span. Impaired mitochondrial function resulting from mtDNA and nuclear DNA variation is likely to contribute to an imbalance in cellular energy homeostasis, increased vulnerability to oxidative stress, and an increased rate of cellular senescence and aging. The complex genetic architecture of mitochondria suggests that there may be an equally complex set of gene interactions (epistases) involving genetic variation in the nuclear and mitochondrial genomes. Results from Drosophila suggest that the effects of mtDNA haplotypes on longevity vary among different nuclear allelic backgrounds, which could account for the inconsistent associations that have been observed between mitochondrial DNA (mtDNA) haplogroups and survival in humans. A diversity of pathways may influence the way mitochondria and nuclear – mitochondrial interactions modulate longevity, including: oxidative phosphorylation; mitochondrial uncoupling; antioxidant defenses; mitochondrial fission and fusion; and sirtuin regulation of mitochondrial genes. We hypothesize that aging and longevity, as complex traits having a significant genetic component, are likely to be controlled by nuclear gene variants interacting with both inherited and somatic mtDNA variability. PMID:20601194
DNA methylation, microRNAs, and their crosstalk as potential biomarkers in hepatocellular carcinoma
Anwar, Sumadi Lukman; Lehmann, Ulrich
2014-01-01
Epigenetic alterations have been identified as a major characteristic in human cancers. Advances in the field of epigenetics have contributed significantly in refining our knowledge of molecular mechanisms underlying malignant transformation. DNA methylation and microRNA expression are epigenetic mechanisms that are widely altered in human cancers including hepatocellular carcinoma (HCC), the third leading cause of cancer related mortality worldwide. Both DNA methylation and microRNA expression patterns are regulated in developmental stage specific-, cell type specific- and tissue-specific manner. The aberrations are inferred in the maintenance of cancer stem cells and in clonal cell evolution during carcinogenesis. The availability of genome-wide technologies for DNA methylation and microRNA profiling has revolutionized the field of epigenetics and led to the discovery of a number of epigenetically silenced microRNAs in cancerous cells and primary tissues. Dysregulation of these microRNAs affects several key signalling pathways in hepatocarcinogenesis suggesting that modulation of DNA methylation and/or microRNA expression can serve as new therapeutic targets for HCC. Accumulative evidence shows that aberrant DNA methylation of certain microRNA genes is an event specifically found in HCC which correlates with unfavorable outcomes. Therefore, it can potentially serve as a biomarker for detection as well as for prognosis, monitoring and predicting therapeutic responses in HCC. PMID:24976726
Phosphorylation of Exo1 modulates homologous recombination repair of DNA double-strand breaks
Bolderson, Emma; Tomimatsu, Nozomi; Richard, Derek J.; Boucher, Didier; Kumar, Rakesh; Pandita, Tej K.; Burma, Sandeep; Khanna, Kum Kum
2010-01-01
DNA double-strand break (DSB) repair via the homologous recombination pathway is a multi-stage process, which results in repair of the DSB without loss of genetic information or fidelity. One essential step in this process is the generation of extended single-stranded DNA (ssDNA) regions at the break site. This ssDNA serves to induce cell cycle checkpoints and is required for Rad51 mediated strand invasion of the sister chromatid. Here, we show that human Exonuclease 1 (Exo1) is required for the normal repair of DSBs by HR. Cells depleted of Exo1 show chromosomal instability and hypersensitivity to ionising radiation (IR) exposure. We find that Exo1 accumulates rapidly at DSBs and is required for the recruitment of RPA and Rad51 to sites of DSBs, suggesting a role for Exo1 in ssDNA generation. Interestingly, the phosphorylation of Exo1 by ATM appears to regulate the activity of Exo1 following resection, allowing optimal Rad51 loading and the completion of HR repair. These data establish a role for Exo1 in resection of DSBs in human cells, highlighting the critical requirement of Exo1 for DSB repair via HR and thus the maintenance of genomic stability. PMID:20019063
Kaempferol Modulates DNA Methylation and Downregulates DNMT3B in Bladder Cancer.
Qiu, Wei; Lin, Jun; Zhu, Yichen; Zhang, Jian; Zeng, Liping; Su, Ming; Tian, Ye
2017-01-01
Genomic DNA methylation plays an important role in both the occurrence and development of bladder cancer. Kaempferol (Kae), a natural flavonoid that is present in many fruits and vegetables, exhibits potent anti-cancer effects in bladder cancer. Similar to other flavonoids, Kae possesses a flavan nucleus in its structure. This structure was reported to inhibit DNA methylation by suppressing DNA methyltransferases (DNMTs). However, whether Kae can inhibit DNA methylation remains unclear. Nude mice bearing bladder cancer were treated with Kae for 31 days. The genomic DNA was extracted from xenografts and the methylation changes was determined using an Illumina Infinium HumanMethylation 450 BeadChip Array. The ubiquitination was detected using immuno-precipitation assay. Our data indicated that Kae modulated DNA methylation in bladder cancer, inducing 103 differential DNA methylation positions (dDMPs) associated with genes (50 hyper-methylated and 53 hypo-methylated). DNA methylation is mostly relied on the levels of DNMTs. We observed that Kae specifically inhibited the protein levels of DNMT3B without altering the expression of DNMT1 or DNMT3A. However, Kae did not downregulate the transcription of DNMT3B. Interestingly, we observed that Kae induced a premature degradation of DNMT3B by inhibiting protein synthesis with cycloheximide (CHX). By blocking proteasome with MG132, we observed that Kae induced an increased ubiquitination of DNMT3B. These results suggested that Kae could induce the degradation of DNMT3B through ubiquitin-proteasome pathway. Our data indicated that Kae is a novel DNMT3B inhibitor, which may promote the degradation of DNMT3B in bladder cancer. © 2017 The Author(s)Published by S. Karger AG, Basel.
Izzotti, Alberto; Balansky, Roumen; D'Agostini, Francesco; Longobardi, Mariagrazia; Cartiglia, Cristina; Micale, Rosanna T; La Maestra, Sebastiano; Camoirano, Anna; Ganchev, Gancho; Iltcheva, Marietta; Steele, Vernon E; De Flora, Silvio
2014-01-01
The anti-diabetic drug metformin is endowed with anti-cancer properties. Epidemiological and experimental studies, however, did not provide univocal results regarding its role in pulmonary carcinogenesis. We used Swiss H mice of both genders in order to detect early molecular alterations and tumors induced by mainstream cigarette smoke. Based on a subchronic toxicity study, oral metformin was used at a dose of 800 mg/kg diet, which is 3.2 times higher than the therapeutic dose in humans. Exposure of mice to smoke for 4 months, starting at birth, induced a systemic clastogenic damage, formation of DNA adducts, oxidative DNA damage, and extensive downregulation of microRNAs in lung after 10 weeks. Preneoplastic lesions were detectable after 7.5 months in both lung and urinary tract along with lung tumors, both benign and malignant. Modulation by metformin of 42 of 1281 pulmonary microRNAs in smoke-free mice highlighted a variety of mechanisms, including modulation of AMPK, stress response, inflammation, NFκB, Tlr9, Tgf, p53, cell cycle, apoptosis, antioxidant pathways, Ras, Myc, Dicer, angiogenesis, stem cell recruitment, and angiogenesis. In smoke-exposed mice, metformin considerably decreased DNA adduct levels and oxidative DNA damage, and normalized the expression of several microRNAs. It did not prevent smoke-induced lung tumors but inhibited preneoplastic lesions in both lung and kidney. In conclusion, metformin was able to protect the mouse lung from smoke-induced DNA and microRNA alterations and to inhibit preneoplastic lesions in lung and kidney but failed to prevent lung adenomas and malignant tumors induced by this complex mixture. PMID:24683044
O’Connor, Sean Timothy Francis; Lan, Jiaqi; North, Matthew; Loguinov, Alexandre; Zhang, Luoping; Smith, Martyn T.; Gu, April Z.; Vulpe, Chris
2012-01-01
Benzo[a]pyrene (BaP) is a ubiquitous, potent, and complete carcinogen resulting from incomplete organic combustion. BaP can form DNA adducts but other mechanisms may play a role in toxicity. We used a functional toxicology approach in S. cerevisiae to assess the genetic requirements for cellular resistance to BaP. In addition, we examined translational activities of key genes involved in various stress response pathways. We identified multiple genes and processes involved in modulating BaP toxicity in yeast which support DNA damage as a primary mechanism of toxicity, but also identify other potential toxicity pathways. Gene ontology enrichment analysis indicated that DNA damage and repair as well as redox homeostasis and oxidative stress are key processes in cellular response to BaP suggesting a similar mode of action of BaP in yeast and mammals. Interestingly, toxicant export is also implicated as a potential novel modulator of cellular susceptibility. In particular, we identified several transporters with human orthologs (solute carrier family 22) which may play a role in mammalian systems. PMID:23403841
Utani, Koichi; Fu, Haiqing; Jang, Sang-Min; Marks, Anna B.; Smith, Owen K.; Zhang, Ya; Redon, Christophe E.; Shimizu, Noriaki
2017-01-01
Abstract Chromatin structure affects DNA replication patterns, but the role of specific chromatin modifiers in regulating the replication process is yet unclear. We report that phosphorylation of the human SIRT1 deacetylase on Threonine 530 (T530-pSIRT1) modulates DNA synthesis. T530-pSIRT1 associates with replication origins and inhibits replication from a group of ‘dormant’ potential replication origins, which initiate replication only when cells are subject to replication stress. Although both active and dormant origins bind T530-pSIRT1, active origins are distinguished from dormant origins by their unique association with an open chromatin mark, histone H3 methylated on lysine 4. SIRT1 phosphorylation also facilitates replication fork elongation. SIRT1 T530 phosphorylation is essential to prevent DNA breakage upon replication stress and cells harboring SIRT1 that cannot be phosphorylated exhibit a high prevalence of extrachromosomal elements, hallmarks of perturbed replication. These observations suggest that SIRT1 phosphorylation modulates the distribution of replication initiation events to insure genomic stability. PMID:28549174
HEMD: an integrated tool of human epigenetic enzymes and chemical modulators for therapeutics.
Huang, Zhimin; Jiang, Haiming; Liu, Xinyi; Chen, Yingyi; Wong, Jiemin; Wang, Qi; Huang, Wenkang; Shi, Ting; Zhang, Jian
2012-01-01
Epigenetic mechanisms mainly include DNA methylation, post-translational modifications of histones, chromatin remodeling and non-coding RNAs. All of these processes are mediated and controlled by enzymes. Abnormalities of the enzymes are involved in a variety of complex human diseases. Recently, potent natural or synthetic chemicals are utilized to establish the quantitative contributions of epigenetic regulation through the enzymes and provide novel insight for developing new therapeutics. However, the development of more specific and effective epigenetic therapeutics requires a more complete understanding of the chemical epigenomic landscape. Here, we present a human epigenetic enzyme and modulator database (HEMD), the database which provides a central resource for the display, search, and analysis of the structure, function, and related annotation for human epigenetic enzymes and chemical modulators focused on epigenetic therapeutics. Currently, HEMD contains 269 epigenetic enzymes and 4377 modulators in three categories (activators, inhibitors, and regulators). Enzymes are annotated with detailed description of epigenetic mechanisms, catalytic processes, and related diseases, and chemical modulators with binding sites, pharmacological effect, and therapeutic uses. Integrating the information of epigenetic enzymes in HEMD should allow for the prediction of conserved features for proteins and could potentially classify them as ideal targets for experimental validation. In addition, modulators curated in HEMD can be used to investigate potent epigenetic targets for the query compound and also help chemists to implement structural modifications for the design of novel epigenetic drugs. HEMD could be a platform and a starting point for biologists and medicinal chemists for furthering research on epigenetic therapeutics. HEMD is freely available at http://mdl.shsmu.edu.cn/HEMD/.
Shinde, Rahul; Hezaveh, Kebria; Halaby, Marie Jo; Kloetgen, Andreas; Chakravarthy, Ankur; da Silva Medina, Tiago; Deol, Reema; Manion, Kieran P; Baglaenko, Yuriy; Eldh, Maria; Lamorte, Sara; Wallace, Drew; Chodisetti, Sathi Babu; Ravishankar, Buvana; Liu, Haiyun; Chaudhary, Kapil; Munn, David H; Tsirigos, Aristotelis; Madaio, Michael; Gabrielsson, Susanne; Touma, Zahi; Wither, Joan; De Carvalho, Daniel D; McGaha, Tracy L
2018-06-01
The transcription factor AhR modulates immunity at multiple levels. Here we report that phagocytes exposed to apoptotic cells exhibited rapid activation of AhR, which drove production of the cytokine IL-10. Activation of AhR was dependent on interactions between apoptotic-cell DNA and the pattern-recognition receptor TLR9 that was required for the prevention of immune responses to DNA and histones in vivo. Moreover, disease progression in mouse systemic lupus erythematosus (SLE) correlated with strength of the AhR signal, and the disease course could be altered by modulation of AhR activity. Deletion of AhR in the myeloid lineage caused systemic autoimmunity in mice, and an enhanced AhR transcriptional signature correlated with disease in patients with SLE. Thus, AhR activity induced by apoptotic cell phagocytes maintains peripheral tolerance.
Nacerddine, Karim; Beaudry, Jean-Bernard; Ginjala, Vasudeva; Westerman, Bart; Mattiroli, Francesca; Song, Ji-Ying; van der Poel, Henk; Ponz, Olga Balagué; Pritchard, Colin; Cornelissen-Steijger, Paulien; Zevenhoven, John; Tanger, Ellen; Sixma, Titia K.; Ganesan, Shridar; van Lohuizen, Maarten
2012-01-01
Prostate cancer (PCa) is a major lethal malignancy in men, but the molecular events and their interplay underlying prostate carcinogenesis remain poorly understood. Epigenetic events and the upregulation of polycomb group silencing proteins including Bmi1 have been described to occur during PCa progression. Here, we found that conditional overexpression of Bmi1 in mice induced prostatic intraepithelial neoplasia, and elicited invasive adenocarcinoma when combined with PTEN haploinsufficiency. In addition, Bmi1 and the PI3K/Akt pathway were coactivated in a substantial fraction of human high-grade tumors. We found that Akt mediated Bmi1 phosphorylation, enhancing its oncogenic potential in an Ink4a/Arf-independent manner. This process also modulated the DNA damage response and affected genomic stability. Together, our findings demonstrate the etiological role of Bmi1 in PCa, unravel an oncogenic collaboration between Bmi1 and the PI3K/Akt pathway, and provide mechanistic insights into the modulation of Bmi1 function by phosphorylation during prostate carcinogenesis. PMID:22505453
DNA methylation in complex disease: applications in nursing research, practice, and policy.
Wright, Michelle L; Ralph, Jody L; Ohm, Joyce E; Anderson, Cindy M
2013-01-01
DNA methylation is an epigenomic modification that is essential to normal human development and biological processes. DNA methylation patterns are heritable and dynamic throughout the life span. Environmental exposures can alter DNA methylation patterns, contributing to the development of complex disease. Identification and modulation of environmental factors influencing disease susceptibility through alterations in DNA methylation are amenable to nursing intervention and form the basis for individualized patient care. Here we describe the evidence supporting the translation of DNA methylation analyses as a tool for screening, diagnosis, and treatment of complex disease in nursing research and practice. The ethical, legal, social, and economic considerations of advances in genomics are considered as a model for epigenomic policy. We conclude that contemporary and informed nurse scientists and clinicians are uniquely poised to apply innovations in epigenomic research to clinical populations and develop appropriate policies that guide equitable and ethical use of new strategies to improve patient care. Copyright © 2013 Elsevier Inc. All rights reserved.
Hamperl, Stephan; Bocek, Michael J; Saldivar, Joshua C; Swigut, Tomek; Cimprich, Karlene A
2017-08-10
Conflicts between transcription and replication are a potent source of DNA damage. Co-transcriptional R-loops could aggravate such conflicts by creating an additional barrier to replication fork progression. Here, we use a defined episomal system to investigate how conflict orientation and R-loop formation influence genome stability in human cells. R-loops, but not normal transcription complexes, induce DNA breaks and orientation-specific DNA damage responses during conflicts with replication forks. Unexpectedly, the replisome acts as an orientation-dependent regulator of R-loop levels, reducing R-loops in the co-directional (CD) orientation but promoting their formation in the head-on (HO) orientation. Replication stress and deregulated origin firing increase the number of HO collisions leading to genome-destabilizing R-loops. Our findings connect DNA replication to R-loop homeostasis and suggest a mechanistic basis for genome instability resulting from deregulated DNA replication, observed in cancer and other disease states. Copyright © 2017 Elsevier Inc. All rights reserved.
Enhancement of DNA ligase I level by gemcitabine in human cancer cells.
Sun, Daekyu; Urrabaz, Rheanna; Kelly, Susan; Nguyen, Myhanh; Weitman, Steve
2002-04-01
DNA ligase I is an essential enzyme for completing DNA replication and DNA repair by ligating Okazaki fragments and by joining single-strand breaks formed either directly by DNA-damaging agents or indirectly by DNA repair enzymes, respectively. In this study, we examined whether the DNA ligase I level could be modulated in human tumor cell lines by treatment with gemcitabine (2', 2'-difluoro-2'-deoxycytidine), which is a nucleoside analogue of cytidine with proven antitumor activity against a broad spectrum of human cancers in clinical studies. To determine the effect of gemcitabine on DNA ligase I expression, Western blot analysis was used to measure the DNA ligase I levels in MiaPaCa, NGP, and SK-N-BE cells treated with different concentrations of gemcitabine and harvested at different time intervals. Cell cycle analysis was also performed to determine the underlying mechanism of DNA ligase I level enhancement in response to gemcitabine. In addition, other agents that share the same mechanism of action with gemcitabine were used to elucidate further details. When different types of tumor cell lines, including MiaPaCa, NGP, and SK-N-BE, were treated with gemcitabine, the level of DNA ligase I increased severalfold despite significant cell growth inhibition. In contrast, other DNA ligases (III and IV) either remained unchanged or decreased with treatment. Cell cycle analysis showed that arrest in S-phase corresponded to an increase of DNA ligase I levels in gemcitabine treated cells. Other agents, such as 1-beta-D-arabinofuranosylcytosine and hydroxyurea, which partly share mechanisms of action with gemcitabine by targeting DNA polymerases and ribonucleotide reductase, respectively, also caused an increase of DNA ligase I levels. However, 5-fluorouracil, which predominantly targets thymidylate synthase, did not cause an increase of DNA ligase I level. Our results suggest that an arrest of DNA replication caused by gemcitabine treatment through incorporation of gemcitabine triphosphate into replicating DNA and inhibition of ribonucleotide reductase would trigger an increase in DNA ligase I levels in cancer cells. The elevated presence of DNA ligase I in S-phase-arrested cells leads us to speculate that DNA ligase I might have an important role in repairing DNA damage caused by stalled replication forks.
Charles, Michelle A; Johnson, Ian T; Belshaw, Nigel J
2012-07-01
The micronutrients folate and selenium may modulate DNA methylation patterns by affecting intracellular levels of the methyl donor S-adenosylmethionine (SAM) and/or the product of methylation reactions S-adenosylhomocysteine (SAH). WI-38 fibroblasts and FHC colon epithelial cells were cultured in the presence of two forms of folate or four forms of selenium at physiologically-relevant doses, and their effects on LINE-1 methylation, gene-specific CpG island (CGI) methylation and intracellular SAM:SAH were determined. At physiologically-relevant doses the forms of folate or selenium had no effect on LINE-1 or CGI methylation, nor on intracellular SAM:SAH. However the commercial cell culture media used for the selenium studies, containing supra-physiological concentrations of folic acid, induced LINE-1 hypomethylation, CGI hypermethylation and decreased intracellular SAM:SAH in both cell lines. We conclude that the exposure of normal human cells to supra-physiological folic acid concentrations present in commercial cell culture media perturbs the intracellular SAM:SAH ratio and induces aberrant DNA methylation.
Lactase non-persistence is directed by DNA variation-dependent epigenetic aging
Labrie, Viviane; Buske, Orion J; Oh, Edward; Jeremian, Richie; Ptak, Carolyn; Gasiūnas, Giedrius; Maleckas, Almantas; Petereit, Rūta; Žvirbliene, Aida; Adamonis, Kęstutis; Kriukienė, Edita; Koncevičius, Karolis; Gordevičius, Juozas; Nair, Akhil; Zhang, Aiping; Ebrahimi, Sasha; Oh, Gabriel; Šikšnys, Virginijus; Kupčinskas, Limas; Brudno, Michael; Petronis, Arturas
2016-01-01
Inability to digest lactose due to lactase non-persistence is a common trait in adult mammals, with the exception of certain human populations that exhibit lactase persistence. It is not clear how the lactase gene can be dramatically downregulated with age in most individuals, but remains active in some. We performed a comprehensive epigenetic study of the human and mouse intestine using chromosome-wide DNA modification profiling and targeted bisulfite sequencing. Epigenetically-controlled regulatory elements were found to account for the differences in lactase mRNA levels between individuals, intestinal cell types and species. The importance of these regulatory elements in modulating lactase mRNA levels was confirmed by CRISPR-Cas9-induced deletions. Genetic factors contribute to epigenetic changes occurring with age at the regulatory elements, as lactase persistence- and non-persistence-DNA haplotypes demonstrated markedly different epigenetic aging. Thus, genetic factors facilitate a gradual accumulation of epigenetic changes with age to affect phenotypic outcome. PMID:27159559
Somjen, D; Katzburg, S; Sharon, O; Grafi-Cohen, M; Knoll, E; Stern, N
2011-02-01
In cultured human osteoblasts estradiol-17β (E2) modulated DNA synthesis, the specific activity of creatine kinase BB (CK), 12 and 15 lipoxygenase (LO) mRNA expression and formation of 12- and 15-hydroxyeicosatetraenoic acid (HETE). We now investigate the response of human bone cell line (SaOS2) to phytoestrogens and estrogen receptors (ER)-specific agonists and antagonists. Treatment of SaSO2 with E2, 2,3-bis (4-hydroxyphenyl)-propionitrile (DPN; ERβ-specific agonist), 4,4',4″-[4-propyl-(1H)-pyrazol-1,3,5-triyl] tris-phenol (PPT; ERα-specific agonist), biochainin A (BA), daidzein (D), genistein (G) and raloxifene (Ral) showed increased DNA synthesis and CK. Ral inhibited completely all stimulations except DPN and to some extent D. The ERα-specific antagonist methyl-piperidino-pyrazole (MPP) and the ERβ-specific antagonist 4-[2-phenyl-5,7-bis (tri-fluoro-methyl) pyrazolo [1,5-a]pyrimidin-3-yl] phenol (PTHPP) inhibited DNA synthesis, CK and reactive oxygen species (ROS) formation induced by estrogens according to their receptors affinity. The LO inhibitor baicaleine inhibited only E2, DPN and G's effects. E2 and Ral unlike all other compounds had no effect on ERα mRNA expression, while ERβ mRNA expression was stimulated by all compounds. All compounds modulated the expression of 12LO and 15LO mRNA, except E2, PPT and Ral for 12LO, and 12- and 15-HETE productions and stimulated ROS formation which was inhibited by NADPH oxidase inhibitors diphenyleneiodonium chloride (DPI) and N-acetyl cysteine and the estrogen inhibitor ICI. DPI did not affect hormonal-induced DNA and CK. In conclusion, we provide evidence for the separation of mediation via ERα and ERβ pathways in the effects of estrogenic compounds on osteoblasts, but the role of LO/HETE/ROS is unclear. Copyright © 2010 Wiley-Liss, Inc.
Acetylation of hMOF Modulates H4K16ac to Regulate DNA Repair Genes in Response to Oxidative Stress.
Zhong, Jianing; Ji, Liying; Chen, Huiqian; Li, Xianfeng; Zhang, Jian'an; Wang, Xingxing; Wu, Weilin; Xu, Ying; Huang, Fei; Cai, Wanshi; Sun, Zhong Sheng
2017-01-01
Oxidative stress is considered to be a key risk state for a variety of human diseases. In response to oxidative stress, the regulation of transcriptional expression of DNA repair genes would be important to DNA repair and genomic stability. However, the overall pattern of transcriptional expression of DNA repair genes and the underlying molecular response mechanism to oxidative stress remain unclear. Here, by employing colorectal cancer cell lines following exposure to hydrogen peroxide, we generated expression profiles of DNA repair genes via RNA-seq and identified gene subsets that are induced or repressed following oxidative stress exposure. RRBS-seq analyses further indicated that transcriptional regulation of most of the DNA repair genes that were induced or repressed is independent of their DNA methylation status. Our analyses also indicate that hydrogen peroxide induces deacetylase SIRT1 which decreases chromatin affinity and the activity of histone acetyltransferase hMOF toward H4K16ac and results in decreased transcriptional expression of DNA repair genes. Taken together, our findings provide a potential mechanism by which oxidative stress suppresses DNA repair genes which is independent of the DNA methylation status of their promoters.
Swaminathan, Santhanam; Torino, Jennifer L; Burger, Melissa S
2002-01-29
The effect of the tumor suppressor gene TP53 on repair of genomic DNA damage was examined in human urinary bladder transitional cell carcinoma (TCC) cell lines. Utilizing TCC10 containing wild-type p53 (wt-p53) as the parental line, an isogenic set of cell lines was derived by retroviral infection that expressed a transdominant mutant p53 (Arg --> His at codon 273, TDM273-TCC10), or the human papilloma virus 16-E6 oncoprotein (E6-TCC10). 32P-postlabeling analyses were performed on DNA from TCC cultures obtained after treatment with N-hydroxy-4-aminobiphenyl (N-OH-ABP), N-hydroxy-4-acetylaminobiphenyl (N-OH-AABP) and N-acetoxy-4-acetylaminobiphenyl (N-OAc-AABP). The major adduct was identified as N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-ABP) with all three chemicals. The amount of adducts in urothelial DNA ranged between 0.1 and 20 per 10(6) nucleotides, N-OAc-AABP yielding the highest levels, followed by N-OH-ABP and N-OH-AABP. To determine, if the functional status of p53 affects the rate of repair of dG-C8-ABP in genomic DNA, TCC10 and the TDM273-TCC10 and E6-TCC10 isotypes were exposed to N-OH-AABP for 12h and the DNA damage was allowed to repair up to 24h. The adduct levels were quantified and compared between the TCC10 isotypes. The amounts of dG-C8-ABP that remained in genomic DNA from E6-TCC10 and TDM273-TCC10 were approximately two-fold higher, as compared to the parental TCC10. At the dose used for DNA repair studies, N-OH-AABP or N-OAc-AABP did not induce apoptosis in TCC10. However, N-OAc-AABP at high doses (>5 microM) induced apoptosis, as evidenced by DNA fragmentation analyses. Furthermore, N-OAc-AABP-mediated apoptosis was independent of the functional status of wt-p53, since both E6-TCC10 and the parental TCC10 exhibited DNA fragmentation following treatment. These results suggest that p53 might modulate the repair of DNA adducts generated from the human bladder carcinogen ABP in its target human uroepithelial cells. This implies that in p53 null cells the unrepaired DNA damage could cause accumulation of mutation, which might contribute to increased genomic instability and neoplastic progression.
Direct and indirect roles of RECQL4 in modulating base excision repair capacity
Schurman, Shepherd H.; Hedayati, Mohammad; Wang, ZhengMing; Singh, Dharmendra K.; Speina, Elzbieta; Zhang, Yongqing; Becker, Kevin; Macris, Margaret; Sung, Patrick; Wilson, David M.; Croteau, Deborah L.; Bohr, Vilhelm A.
2009-01-01
RECQL4 is a human RecQ helicase which is mutated in approximately two-thirds of individuals with Rothmund–Thomson syndrome (RTS), a disease characterized at the cellular level by chromosomal instability. BLM and WRN are also human RecQ helicases, which are mutated in Bloom and Werner's syndrome, respectively, and associated with chromosomal instability as well as premature aging. Here we show that primary RTS and RECQL4 siRNA knockdown human fibroblasts accumulate more H2O2-induced DNA strand breaks than control cells, suggesting that RECQL4 may stimulate repair of H2O2-induced DNA damage. RTS primary fibroblasts also accumulate more XRCC1 foci than control cells in response to endogenous or induced oxidative stress and have a high basal level of endogenous formamidopyrimidines. In cells treated with H2O2, RECQL4 co-localizes with APE1, and FEN1, key participants in base excision repair. Biochemical experiments indicate that RECQL4 specifically stimulates the apurinic endonuclease activity of APE1, the DNA strand displacement activity of DNA polymerase β, and incision of a 1- or 10-nucleotide flap DNA substrate by Flap Endonuclease I. Additionally, RTS cells display an upregulation of BER pathway genes and fail to respond like normal cells to oxidative stress. The data herein support a model in which RECQL4 regulates both directly and indirectly base excision repair capacity. PMID:19567405
Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide
NASA Astrophysics Data System (ADS)
Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.
2015-01-01
Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.
Euro, Liliya; Farnum, Gregory A.; Palin, Eino; Suomalainen, Anu; Kaguni, Laurie S.
2011-01-01
Mutations in Pol γ represent a major cause of human mitochondrial diseases, especially those affecting the nervous system in adults and in children. Recessive mutations in Pol γ represent nearly half of those reported to date, and they are nearly uniformly distributed along the length of the POLG1 gene (Human DNA Polymerase gamma Mutation Database); the majority of them are linked to the most severe form of POLG syndrome, Alpers–Huttenlocher syndrome. In this report, we assess the structure–function relationships for recessive disease mutations by reviewing existing biochemical data on site-directed mutagenesis of the human, Drosophila and yeast Pol γs, and their homologs from the family A DNA polymerase group. We do so in the context of a molecular model of Pol γ in complex with primer–template DNA, which we have developed based upon the recently solved crystal structure of the apoenzyme form. We present evidence that recessive mutations cluster within five distinct functional modules in the catalytic core of Pol γ. Our results suggest that cluster prediction can be used as a diagnosis-supporting tool to evaluate the pathogenic role of new Pol γ variants. PMID:21824913
Zhou, Ying; Wang, Haijun; Zhang, Han; Chai, Yaqin; Yuan, Ruo
2018-03-06
The DNA nanocrane with functionalized manipulator and fixed-size base offered a programmable approach to modulate the luminous efficiency of copper nanoclusters (Cu NCs) for achieving remarkable electrochemiluminescence (ECL) enhancement, further the Cu NCs as signal label was constructed in biosensor for ultrasensitive detection of microRNA-155. Herein, the DNA nanocrane was first constructed by combining binding-induced DNA assembly as manipulator and tetrahedral DNA nanostructure (TDN) as base, which harnessed a small quantity of specific target (microRNA (miRNA)-155) binding to trigger assembly of separate DNA components for producing numerous AT-rich double-stranded DNA (dsDNA) on the vertex of TDN. Upon the incubation of Cu 2+ on the AT-rich dsDNA, each DNA-stabilized Cu NCs probe could be in situ electrochemically generated on an individual TDN owing to the A-Cu 2+ -T bond. Thus, the generation of Cu NCs was highly regulated with AT-rich dsDNA as the template, and its lateral distance was tuned by the TDN size, which were two key factors to influence the luminous efficiency of Cu NCs. By coordinate modulation, the detection limit of the ultrasensitive biosensor for miRNA-155 down to 36 aM and the programmable modulation strategy paved the way for comprehensive applications of DNA nanomachines and metal nanoclusters in biosensing and clinical diagnosis.
An autonomous molecular computer for logical control of gene expression.
Benenson, Yaakov; Gil, Binyamin; Ben-Dor, Uri; Adar, Rivka; Shapiro, Ehud
2004-05-27
Early biomolecular computer research focused on laboratory-scale, human-operated computers for complex computational problems. Recently, simple molecular-scale autonomous programmable computers were demonstrated allowing both input and output information to be in molecular form. Such computers, using biological molecules as input data and biologically active molecules as outputs, could produce a system for 'logical' control of biological processes. Here we describe an autonomous biomolecular computer that, at least in vitro, logically analyses the levels of messenger RNA species, and in response produces a molecule capable of affecting levels of gene expression. The computer operates at a concentration of close to a trillion computers per microlitre and consists of three programmable modules: a computation module, that is, a stochastic molecular automaton; an input module, by which specific mRNA levels or point mutations regulate software molecule concentrations, and hence automaton transition probabilities; and an output module, capable of controlled release of a short single-stranded DNA molecule. This approach might be applied in vivo to biochemical sensing, genetic engineering and even medical diagnosis and treatment. As a proof of principle we programmed the computer to identify and analyse mRNA of disease-related genes associated with models of small-cell lung cancer and prostate cancer, and to produce a single-stranded DNA molecule modelled after an anticancer drug.
Modulators of inhibitor of growth (ING) family expression in development and disease.
Maher, Stacey K; Helbing, Caren C
2009-05-01
The inhibitor of growth (ING) gene family proteins regulate many critical cellular processes such as cell proliferation and growth, apoptosis, DNA repair, senescence, angiogenesis, and drug resistance. Their transcripts and proteins are differentially expressed in health and disease and there is evidence for developmental regulation. The vast majority of studies have characterized ING levels in the context of cancer. However, relatively little attention has been paid to the expression of ING family members in other contexts. This review summarizes the findings from human and animal model systems that provide insight into the factors influencing the expression of these important proteins. We examine the influence of cell cycle and aging as well as genotoxic stress on ING expression levels and evaluate several emerging areas of inquiry demonstrating that ING gene activity may be modulated by factors such as the p53 tumor suppressor, DNA methylation, and ING proteins themselves with external factors such as hormones, reactive oxygen species, TGFbeta signalling, and other proteins of pathological significance also influencing ING levels. We then briefly discuss the influence of post-translational modification and changes in subcellular localization as it pertains to modulation of ING expression. Understanding how ING expression is modulated represents a vital aspect of effective drug targeting strategies.
Topalović, Dijana Žukovec; Živković, Lada; Čabarkapa, Andrea; Djelić, Ninoslav; Bajić, Vladan; Dekanski, Dragana; Spremo-Potparević, Biljana
2015-01-01
The thyroid hormones change the rate of basal metabolism, modulating the consumption of oxygen and causing production of reactive oxygen species, which leads to the development of oxidative stress and DNA strand breaks. Olive (Olea europaea L.) leaf contains many potentially bioactive compounds, making it one of the most potent natural antioxidants. The objective of this study was to evaluate the genotoxicity of L-thyroxine and to investigate antioxidative and antigenotoxic potential of the standardized oleuropein-rich dry olive leaf extract (DOLE) against hydrogen peroxide and L-thyroxine-induced DNA damage in human peripheral blood leukocytes by using the comet assay. Various concentrations of the extract were tested with both DNA damage inducers, under two different experimental conditions, pretreatment and posttreatment. Results indicate that L-thyroxine exhibited genotoxic effect and that DOLE displayed protective effect against thyroxine-induced genotoxicity. The number of cells with DNA damage, was significantly reduced, in both pretreated and posttreated samples (P < 0.05). Comparing the beneficial effect of all tested concentrations of DOLE, in both experimental protocols, it appears that extract was more effective in reducing DNA damage in the pretreatment, exhibiting protective role against L-thyroxine effect. This feature of DOLE can be explained by its capacity to act as potent free radical scavenger.
Li, Bowen; Sun, Lingbin; Cai, Jiali; Wang, Chonggang; Wang, Mengmeng; Qiu, Huiling; Zuo, Zhenghong
2015-01-01
The toxic effects of tributyltin (TBT) have been extensively documented in several types of cells, but the molecular mechanisms related to the genotoxic effects of TBT have still not been fully elucidated. Our study showed that exposure of human hepatoma G2 cells to 1-4 μmol/L TBT for 3 hr caused severe DNA damage in a concentration-dependent manner. Moreover, the expression levels of key DNA damage sensor genes such as the replication factor C, proliferating cell nuclear antigen and poly (ADP-ribose) polymerase-1 were inhabited in a concentration-dependent manner. We further demonstrated that TBT induced cell apoptosis via the p53-mediated pathway, which was most likely activated by the ataxia telangiectasia mutated and rad-3 related (ATR) protein kinase. The results also showed that cytochrome c, caspase-3, caspase-8, caspase-9, and the B-cell lymphoma 2 were involved in this process. Taken together, we demonstrated for the first time that the inhibition of the DNA repair system might be more responsible for TBT-induced genotoxic effects in cells. Then the generated DNA damage induced by TBT initiated ATR-p53-mediated apoptosis. Copyright © 2014. Published by Elsevier B.V.
Žukovec Topalović, Dijana; Živković, Lada; Čabarkapa, Andrea; Djelić, Ninoslav; Bajić, Vladan; Spremo-Potparević, Biljana
2015-01-01
The thyroid hormones change the rate of basal metabolism, modulating the consumption of oxygen and causing production of reactive oxygen species, which leads to the development of oxidative stress and DNA strand breaks. Olive (Olea europaea L.) leaf contains many potentially bioactive compounds, making it one of the most potent natural antioxidants. The objective of this study was to evaluate the genotoxicity of L-thyroxine and to investigate antioxidative and antigenotoxic potential of the standardized oleuropein-rich dry olive leaf extract (DOLE) against hydrogen peroxide and L-thyroxine-induced DNA damage in human peripheral blood leukocytes by using the comet assay. Various concentrations of the extract were tested with both DNA damage inducers, under two different experimental conditions, pretreatment and posttreatment. Results indicate that L-thyroxine exhibited genotoxic effect and that DOLE displayed protective effect against thyroxine-induced genotoxicity. The number of cells with DNA damage, was significantly reduced, in both pretreated and posttreated samples (P < 0.05). Comparing the beneficial effect of all tested concentrations of DOLE, in both experimental protocols, it appears that extract was more effective in reducing DNA damage in the pretreatment, exhibiting protective role against L-thyroxine effect. This feature of DOLE can be explained by its capacity to act as potent free radical scavenger. PMID:25789081
Pavanello, S; Pulliero, A; Lai, A; Gaiardo, A; Mastrangelo, G; Clonfero, E
2005-01-01
[Anti-B[a]PDE-DNA formation in lymphomonocytes of humans environmentally exposed to polycyclic aromatic hydrocarbons] We are currently evaluating anti-benzo[a]pyrenediolepoxide-(B[a]PDE)-DNA adduct levels in lymphomonocytes of humans exposed to polycyclic aromatic hydrocarbons (PAHs) to validate this indicator of biologically effective dose in a surrogate tissue. The study protocol (October 2002-June 2005) implies: (a) a signed informed consent by each participant; (b) recruitment of 600 Padua municipal workers during visits at our outpatient clinic; (c) administration of a questionnaire regarding non occupational sources of PAH (B[a]P) exposure; (d) collection of blood (15 ml) and urine (200 ml) samples. Anti-B[a]PDE-DNA adduct levels in lymphomonocytes are detected by HPLC-fluorescence analysis. To date, 438 subjects have been examined (age range 20-62 years; 52% males). We found that: (i) anti-B[a]PDE-DNA adduct levels are significantly lower than those we previously found in coke-oven workers (N=95) occupationally exposed to high levels of PAHs (1.51 +/- 2.68 versus 4.07 +/- 3.78 anti-B[a]PDE-adduct/10(8) nucleotides, p < 0.001; 37% versus 97% positive subjects with > or =1 adduct/10(8) nucleotides; p < 0.001); (ii) smokers (23%) have significantly higher adduct levels than non smokers (p < 0.001); iii) non smokers who consume PAH-rich meals > or =52 times/year (142 subjects, 42%) have significantly increased adduct levels than those <52 times/year (p < 0.01). Dietary and smoking habits did not influence the occupationally-induced adduct levels in coke-oven workers. This is the first study that examines anti-B[a]PDE-DNA adduct levels in a large cohort showing that anti-B[a]PDE-DNA adducts can be detected in humans environmentally exposed to low doses of PAH (B[a]P and are modulated by smoke and dietary habits.
Winter, S; Weller, M
2000-06-16
Poly(ADP-ribose) polymerase is a zinc-finger DNA-binding protein that detects specifically DNA strand breaks generated by genotoxic agents and is thought to be involved in DNA repair. Here, we examined the effects of 3-aminobenzamide, a poly(ADP-ribose) polymerase inhibitor, on the chemosensitivity of human malignant glioma cells. 3-Aminobenzamide selectively potentiated the cytotoxicity of the nitrosoureas, nimustine, carmustine and lomustine in 10 of 12 human malignant glioma cell lines. In contrast, 3-aminobenzamide did not modulate the cytotoxic effects of doxorubicine, teniposide, vincristine, camptothecin or cytarabine. The nitrosoureas did not induce poly(ADP-ribose) polymerase activity in the glioma cells. Ectopic expression of truncated poly(ADP-ribose) polymerase containing the poly(ADP-ribose) polymerase DNA-binding domain, which acts as a dominant-negative mutant, in LN-18 or LN-229 cells did not alter the 3-aminobenzamide effect on nitrosourea-mediated cytotoxicity. Thus, 3-aminobenzamide may target another nicotinamide adenine dinucleotide (NAD)-requiring enzyme, but not poly(ADP-ribose) polymerase, when enhancing nitrosourea cytotoxicity in human malignant glioma cells. Carmustine cytotoxicity was associated with a G2/M arrest. Coexposure to carmustine and 3-aminobenzamide overcame this G2/M arrest in T98G cells, which are sensitized to carmustine by 3-aminobenzamide, but not in U251MG cells, which are refractory to 3-aminobenzamide-mediated sensitization to carmustine. Thus, 3-aminobenzamide-mediated sensitization to carmustine cytotoxicity may result from interference with the stable G2/M arrest response to carmustine in human glioma cells.
APE1 incision activity at abasic sites in tandem repeat sequences.
Li, Mengxia; Völker, Jens; Breslauer, Kenneth J; Wilson, David M
2014-05-29
Repetitive DNA sequences, such as those present in microsatellites and minisatellites, telomeres, and trinucleotide repeats (linked to fragile X syndrome, Huntington disease, etc.), account for nearly 30% of the human genome. These domains exhibit enhanced susceptibility to oxidative attack to yield base modifications, strand breaks, and abasic sites; have a propensity to adopt non-canonical DNA forms modulated by the positions of the lesions; and, when not properly processed, can contribute to genome instability that underlies aging and disease development. Knowledge on the repair efficiencies of DNA damage within such repetitive sequences is therefore crucial for understanding the impact of such domains on genomic integrity. In the present study, using strategically designed oligonucleotide substrates, we determined the ability of human apurinic/apyrimidinic endonuclease 1 (APE1) to cleave at apurinic/apyrimidinic (AP) sites in a collection of tandem DNA repeat landscapes involving telomeric and CAG/CTG repeat sequences. Our studies reveal the differential influence of domain sequence, conformation, and AP site location/relative positioning on the efficiency of APE1 binding and strand incision. Intriguingly, our data demonstrate that APE1 endonuclease efficiency correlates with the thermodynamic stability of the DNA substrate. We discuss how these results have both predictive and mechanistic consequences for understanding the success and failure of repair protein activity associated with such oxidatively sensitive, conformationally plastic/dynamic repetitive DNA domains. Published by Elsevier Ltd.
High expression of DNA methyltransferases in primary human medulloblastoma.
Pócza, T; Krenács, T; Turányi, E; Csáthy, J; Jakab, Z; Hauser, P
2016-01-01
Epigenetic alterations have been implicated in cancer development. DNA methylation modulates gene expression, which is catalyzed by DNA methyltransferases (DNMTs). The objective of our study was to evaluate expression of DNMTs in medulloblastoma and analyze its correlation with clinical features. Nuclear expression of DNMT1, DNMT3A and DNMT3B was analyzed in human primary medulloblastoma of 44 patients using immunohistochemistry. Correlation of expression of DNMT levels with classical histological subtypes, novel molecular subgroups and survival of patients was analyzed. Elevated expression of DNMT1, DNMT3A and DNMT3B was observed in 63.64%, 68.18% and 72.73% of all cases, respectively. None of them showed a correlation with classical histology or survival. Concerning molecular subtypes, significantly higher expression of DNMT1 was observed in the SHH group compared to non-SHH samples (p = 0.02), but without significant difference in DNMT3A or DNMT3B levels between any subtypes. In conclusion, DNMT1, DNMT3A and DNMT3B are highly expressed in human medulloblastoma samples, suggesting that promoter hypermethylation may play a role in medulloblastoma development. Demethylation of tumor suppressor gene promoters may be considered as a possible future target in therapy of medulloblastoma.
Marinovic-Terzic, Ivana; Yoshioka-Yamashita, Atsuko; Shimodaira, Hideki; Avdievich, Elena; Hunton, Irina C.; Kolodner, Richard D.; Edelmann, Winfried; Wang, Jean Y. J.
2008-01-01
Mismatch repair (MMR) corrects replication errors during DNA synthesis. The mammalian MMR proteins also activate cell cycle checkpoints and apoptosis in response to persistent DNA damage. MMR-deficient cells are resistant to cisplatin, a DNA cross-linking agent used in chemotherapy, because of impaired activation of apoptotic pathways. It is shown that postmeiotic segregation 2 (PMS2), an MMR protein, is required for cisplatin-induced activation of p73, a member of the p53 family of transcription factors with proapoptotic activity. The human PMS2 is highly polymorphic, with at least 12 known nonsynonymous codon changes identified. We show here that the PMS2(R20Q) variant is defective in activating p73-dependent apoptotic response to cisplatin. When expressed in Pms2-deficient mouse fibroblasts, human PMS2(R20Q) but not PMS2 interfered with the apoptotic response to cisplatin. Correspondingly, PMS2 but not PMS2(R20Q) enhanced the cytotoxic effect of cisplatin measured by clonogenic survival. Because PMS2(R20Q) lacks proapoptotic activity, this polymorphic allele may modulate tumor responses to cisplatin among cancer patients. PMID:18768816
Marinovic-Terzic, Ivana; Yoshioka-Yamashita, Atsuko; Shimodaira, Hideki; Avdievich, Elena; Hunton, Irina C; Kolodner, Richard D; Edelmann, Winfried; Wang, Jean Y J
2008-09-16
Mismatch repair (MMR) corrects replication errors during DNA synthesis. The mammalian MMR proteins also activate cell cycle checkpoints and apoptosis in response to persistent DNA damage. MMR-deficient cells are resistant to cisplatin, a DNA cross-linking agent used in chemotherapy, because of impaired activation of apoptotic pathways. It is shown that postmeiotic segregation 2 (PMS2), an MMR protein, is required for cisplatin-induced activation of p73, a member of the p53 family of transcription factors with proapoptotic activity. The human PMS2 is highly polymorphic, with at least 12 known nonsynonymous codon changes identified. We show here that the PMS2(R20Q) variant is defective in activating p73-dependent apoptotic response to cisplatin. When expressed in Pms2-deficient mouse fibroblasts, human PMS2(R20Q) but not PMS2 interfered with the apoptotic response to cisplatin. Correspondingly, PMS2 but not PMS2(R20Q) enhanced the cytotoxic effect of cisplatin measured by clonogenic survival. Because PMS2(R20Q) lacks proapoptotic activity, this polymorphic allele may modulate tumor responses to cisplatin among cancer patients.
Allosteric Pathways in the PPARγ-RXRα nuclear receptor complex
NASA Astrophysics Data System (ADS)
Ricci, Clarisse G.; Silveira, Rodrigo L.; Rivalta, Ivan; Batista, Victor S.; Skaf, Munir S.
2016-01-01
Understanding the nature of allostery in DNA-nuclear receptor (NR) complexes is of fundamental importance for drug development since NRs regulate the transcription of a myriad of genes in humans and other metazoans. Here, we investigate allostery in the peroxisome proliferator-activated/retinoid X receptor heterodimer. This important NR complex is a target for antidiabetic drugs since it binds to DNA and functions as a transcription factor essential for insulin sensitization and lipid metabolism. We find evidence of interdependent motions of Ω-loops and PPARγ-DNA binding domain with contacts susceptible to conformational changes and mutations, critical for regulating transcriptional functions in response to sequence-dependent DNA dynamics. Statistical network analysis of the correlated motions, observed in molecular dynamics simulations, shows preferential allosteric pathways with convergence centers comprised of polar amino acid residues. These findings are particularly relevant for the design of allosteric modulators of ligand-dependent transcription factors.
Ionic modulation of QPX stability as a nano-switch regulating gene expression in neurons
NASA Astrophysics Data System (ADS)
Baghaee Ravari, Soodeh
G-quadruplexes (G-QPX) have been the subject of intense research due to their unique structural configuration and potential applications, particularly their functionality in biological process as a novel type of nano--switch. They have been found in critical regions of the human genome such as telomeres, promoter regions, and untranslated regions of RNA. About 50% of human DNA in promoters has G-rich regions with the potential to form G-QPX structures. A G-QPX might act mechanistically as an ON/OFF switch, regulating gene expression, meaning that the formation of G-QPX in a single strand of DNA disrupts double stranded DNA, prevents the binding of transcription factors (TF) to their recognition sites, resulting in gene down-regulation. Although there are numerous studies on biological roles of G-QPXs in oncogenes, their potential formation in neuronal cells, in particular upstream of transcription start sites, is poorly investigated. The main focus of this research is to identify stable G-QPXs in the 97bp active promoter region of the choline acetyltransferase (ChAT) gene, the terminal enzyme involved in synthesis of the neurotransmitter acetylcholine, and to clarify ionic modulation of G-QPX nanostructures through the mechanism of neural action potentials. Different bioinformatics analyses (in silico), including the QGRS, quadparser and G4-Calculator programs, have been used to predict stable G-QPX in the active promoter region of the human ChAT gene, located 1000bp upstream from the TATA box. The results of computational studies (using those three different algorithms) led to the identification of three consecutive intramolecular G-QPX structures in the negative strand (ChAT G17-2, ChAT G17, and ChAT G29) and one intramolecular G-QPX structure in the positive strand (ChAT G30). Also, the results suggest the possibility that nearby G-runs in opposed DNA strands with a short distance of each other may be able to form a stable intermolecular G-QPX involving two DNA complementary strands (ds ChAT G21). Formation of G-QPX structures, by blocking the availability of the transcription factor binding site (TFBS) on double stranded DNA, can interfere with transcriptional activation. This suggests that there is competition between TFBS binding to dsDNA and the conversion to high order non-B form secondary structures (G-QPXs) in the active promoter region. TFBS mapping analysis of the active promoter region of the human ChAT gene revealed that it contains multiple consensus AP-2alpha and Sp1 binding sites and consensus sites for other TF, including multiple sites for GR-alpha, Pax-5, p53 and GC box proteins. (Abstract shortened by ProQuest.).
Hannigan, Geoffrey D; Meisel, Jacquelyn S; Tyldsley, Amanda S; Zheng, Qi; Hodkinson, Brendan P; SanMiguel, Adam J; Minot, Samuel; Bushman, Frederic D; Grice, Elizabeth A
2015-10-20
Viruses make up a major component of the human microbiota but are poorly understood in the skin, our primary barrier to the external environment. Viral communities have the potential to modulate states of cutaneous health and disease. Bacteriophages are known to influence the structure and function of microbial communities through predation and genetic exchange. Human viruses are associated with skin cancers and a multitude of cutaneous manifestations. Despite these important roles, little is known regarding the human skin virome and its interactions with the host microbiome. Here we evaluated the human cutaneous double-stranded DNA virome by metagenomic sequencing of DNA from purified virus-like particles (VLPs). In parallel, we employed metagenomic sequencing of the total skin microbiome to assess covariation and infer interactions with the virome. Samples were collected from 16 subjects at eight body sites over 1 month. In addition to the microenviroment, which is known to partition the bacterial and fungal microbiota, natural skin occlusion was strongly associated with skin virome community composition. Viral contigs were enriched for genes indicative of a temperate phage replication style and also maintained genes encoding potential antibiotic resistance and virulence factors. CRISPR spacers identified in the bacterial DNA sequences provided a record of phage predation and suggest a mechanism to explain spatial partitioning of skin phage communities. Finally, we modeled the structure of bacterial and phage communities together to reveal a complex microbial environment with a Corynebacterium hub. These results reveal the previously underappreciated diversity, encoded functions, and viral-microbial dynamic unique to the human skin virome. To date, most cutaneous microbiome studies have focused on bacterial and fungal communities. Skin viral communities and their relationships with their hosts remain poorly understood despite their potential to modulate states of cutaneous health and disease. Previous studies employing whole-metagenome sequencing without purification for virus-like particles (VLPs) have provided some insight into the viral component of the skin microbiome but have not completely characterized these communities or analyzed interactions with the host microbiome. Here we present an optimized virus purification technique and corresponding analysis tools for gaining novel insights into the skin virome, including viral "dark matter," and its potential interactions with the host microbiome. The work presented here establishes a baseline of the healthy human skin virome and is a necessary foundation for future studies examining viral perturbations in skin health and disease. Copyright © 2015 Hannigan et al.
Merino, Felipe; Bouvier, Benjamin; Cojocaru, Vlad
2015-01-01
Highly specific transcriptional regulation depends on the cooperative association of transcription factors into enhanceosomes. Usually, their DNA-binding cooperativity originates from either direct interactions or DNA-mediated allostery. Here, we performed unbiased molecular simulations followed by simulations of protein-DNA unbinding and free energy profiling to study the cooperative DNA recognition by OCT4 and SOX2, key components of enhanceosomes in pluripotent cells. We found that SOX2 influences the orientation and dynamics of the DNA-bound configuration of OCT4. In addition SOX2 modifies the unbinding free energy profiles of both DNA-binding domains of OCT4, the POU specific and POU homeodomain, despite interacting directly only with the first. Thus, we demonstrate that the OCT4-SOX2 cooperativity is modulated by an interplay between protein-protein interactions and DNA-mediated allostery. Further, we estimated the change in OCT4-DNA binding free energy due to the cooperativity with SOX2, observed a good agreement with experimental measurements, and found that SOX2 affects the relative DNA-binding strength of the two OCT4 domains. Based on these findings, we propose that available interaction partners in different biological contexts modulate the DNA exploration routes of multi-domain transcription factors such as OCT4. We consider the OCT4-SOX2 cooperativity as a paradigm of how specificity of transcriptional regulation is achieved through concerted modulation of protein-DNA recognition by different types of interactions. PMID:26067358
Merino, Felipe; Bouvier, Benjamin; Cojocaru, Vlad
2015-06-01
Highly specific transcriptional regulation depends on the cooperative association of transcription factors into enhanceosomes. Usually, their DNA-binding cooperativity originates from either direct interactions or DNA-mediated allostery. Here, we performed unbiased molecular simulations followed by simulations of protein-DNA unbinding and free energy profiling to study the cooperative DNA recognition by OCT4 and SOX2, key components of enhanceosomes in pluripotent cells. We found that SOX2 influences the orientation and dynamics of the DNA-bound configuration of OCT4. In addition SOX2 modifies the unbinding free energy profiles of both DNA-binding domains of OCT4, the POU specific and POU homeodomain, despite interacting directly only with the first. Thus, we demonstrate that the OCT4-SOX2 cooperativity is modulated by an interplay between protein-protein interactions and DNA-mediated allostery. Further, we estimated the change in OCT4-DNA binding free energy due to the cooperativity with SOX2, observed a good agreement with experimental measurements, and found that SOX2 affects the relative DNA-binding strength of the two OCT4 domains. Based on these findings, we propose that available interaction partners in different biological contexts modulate the DNA exploration routes of multi-domain transcription factors such as OCT4. We consider the OCT4-SOX2 cooperativity as a paradigm of how specificity of transcriptional regulation is achieved through concerted modulation of protein-DNA recognition by different types of interactions.
Choline nutrition programs brain development via DNA and histone methylation.
Blusztajn, Jan Krzysztof; Mellott, Tiffany J
2012-06-01
Choline is an essential nutrient for humans. Metabolically choline is used for the synthesis of membrane phospholipids (e.g. phosphatidylcholine), as a precursor of the neurotransmitter acetylcholine, and, following oxidation to betaine, choline functions as a methyl group donor in a pathway that produces S-adenosylmethionine. As a methyl donor choline influences DNA and histone methylation--two central epigenomic processes that regulate gene expression. Because the fetus and neonate have high demands for choline, its dietary intake during pregnancy and lactation is particularly important for normal development of the offspring. Studies in rodents have shown that high choline intake during gestation improves cognitive function in adulthood and prevents memory decline associated with old age. These behavioral changes are accompanied by electrophysiological, neuroanatomical, and neurochemical changes and by altered patterns of expression of multiple cortical and hippocampal genes including those encoding key proteins that contribute to the biochemical mechanisms of learning and memory. These actions of choline are observed long after the exposure to the nutrient ended (months) and correlate with fetal hepatic and cerebral cortical choline-evoked changes in global- and gene-specific DNA cytosine methylation and with dramatic changes of the methylation pattern of lysine residues 4, 9 and 27 of histone H3. Moreover, gestational choline modulates the expression of DNA (Dnmt1, Dnmt3a) and histone (G9a/Ehmt2/Kmt1c, Suv39h1/Kmt1a) methyltransferases. In addition to the central role of DNA and histone methylation in brain development, these processes are highly dynamic in adult brain, modulate the expression of genes critical for synaptic plasticity, and are involved in mechanisms of learning and memory. A recent study documented that in a cohort of normal elderly people, verbal and visual memory function correlated positively with the amount of dietary choline consumption. It will be important to determine if these actions of choline on human cognition are mediated by epigenomic mechanisms or by its influence on acetylcholine or phospholipid synthesis.
Choline nutrition programs brain development via DNA and histone methylation
Blusztajn, Jan Krzysztof; Mellott, Tiffany J.
2017-01-01
Choline is an essential nutrient for humans. Metabolically choline is used for the synthesis of membrane phospholipids (e.g. phosphatidylcholine), as a precursor of the neurotransmitter acetylcholine, and, following oxidation to betaine, choline functions as a methyl group donor in a pathway that produces S-adenosylmethionine. As a methyl donor choline influences DNA and histone methylation – two central epigenomic processes that regulate gene expression. Because the fetus and neonate have high demands for choline, its dietary intake during pregnancy and lactation is particularly important for normal development of the offspring. Studies in rodents have shown that high choline intake during gestation improves cognitive function in adulthood and prevents memory decline associated with old age. These behavioral changes are accompanied by electrophysiological, neuroanatomical, and neurochemical changes and by altered patterns of expression of multiple cortical and hippocampal genes including those encoding key proteins that contribute to the biochemical mechanisms of learning and memory. These actions of choline are observed long after the exposure to the nutrient ended (months) and correlate with fetal hepatic and cerebral cortical choline-evoked changes in global- and gene-specific DNA cytosine methylation and with dramatic changes of the methylation pattern of lysine residues 4, 9 and 27 of histone H3. Moreover, gestational choline modulates the expression of DNA (Dnmt1, Dnmt3a) and histone (G9a/Ehmt2/Kmt1c, Suv39h1/Kmt1a) methyltransferases. In addition to the central role of DNA and histone methylation in brain development, these processes are highly dynamic in adult brain, modulate the expression of genes critical for synaptic plasticity, and are involved in mechanisms of learning and memory. A recent study documented that in a cohort of normal elderly people, verbal and visual memory function correlated positively with the amount of dietary choline consumption. It will be important to determine if these actions of choline on human cognition are mediated by epigenomic mechanisms or by its influence on acetylcholine or phospholipid synthesis. PMID:22483275
Modulating the DNA polymerase β reaction equilibrium to dissect the reverse reaction
Shock, David D.; Freudenthal, Bret D.; Beard, William A.; Wilson, Samuel H.
2017-01-01
DNA polymerases catalyze efficient and high fidelity DNA synthesis. While this reaction favors nucleotide incorporation, polymerases also catalyze a reverse reaction, pyrophosphorolysis, removing the DNA primer terminus and generating deoxynucleoside triphosphates. Since pyrophosphorolysis can influence polymerase fidelity and sensitivity to chain-terminating nucleosides, we analyzed pyrophosphorolysis with human DNA polymerase β and found the reaction to be inefficient. The lack of a thio-elemental effect indicated that it was limited by a non-chemical step. Utilizing a pyrophosphate analog, where the bridging oxygen is replaced with an imido-group (PNP), increased the rate of the reverse reaction and displayed a large thio-elemental effect indicating that chemistry was now rate determining. Time-lapse crystallography with PNP captured structures consistent with a chemical equilibrium that favored the reverse reaction. These results highlight the importance of the bridging atom between the β- and γ-phosphates of the incoming nucleotide in reaction chemistry, enzyme conformational changes, and overall reaction equilibrium. PMID:28759020
Kozuka, Chisayo; Kaname, Tadashi; Shimizu-Okabe, Chigusa; Takayama, Chitoshi; Tsutsui, Masato; Matsushita, Masayuki; Abe, Keiko; Masuzaki, Hiroaki
2017-08-01
Overeating of dietary fats causes obesity in humans and rodents. Recent studies in humans and rodents have demonstrated that addiction to fats shares a common mechanism with addiction to alcohol, nicotine and narcotics in terms of a dysfunction of brain reward systems. It has been highlighted that a high-fat diet (HFD) attenuates dopamine D2 receptor (D2R) signalling in the striatum, a pivotal regulator of the brain reward system, resulting in hedonic overeating. We previously reported that the brown rice-specific bioactive constituent γ-oryzanol attenuated the preference for an HFD via hypothalamic control. We therefore explored the possibility that γ-oryzanol would modulate functioning of the brain reward system in mice. Male C57BL/6J mice fed an HFD were orally treated with γ-oryzanol, and striatal levels of molecules involved in D2R signalling were evaluated. The impact of γ-oryzanol on DNA methylation of the D2R promoter and subsequent changes in preferences for dietary fat was examined. In addition, the effects of 5-aza-2'-deoxycytidine, a potent inhibitor of DNA methyltransferases (DNMTs), on food preference, D2R signalling and the levels of DNMTs in the striatum were investigated. The inhibitory effects of γ-oryzanol on the activity of DNMTs were enzymatically evaluated in vitro. In striatum from mice fed an HFD, the production of D2Rs was decreased via an increase in DNA methylation of the promoter region of the D2R. Oral administration of γ-oryzanol decreased the expression and activity of DNMTs, thereby restoring the level of D2Rs in the striatum. Pharmacological inhibition of DNMTs by 5-aza-2'-deoxycytidine also ameliorated the preference for dietary fat. Consistent with these findings, enzymatic in vitro assays demonstrated that γ-oryzanol inhibited the activity of DNMTs. We demonstrated that γ-oryzanol ameliorates HFD-induced DNA hypermethylation of the promoter region of D2R in the striatum of mice. Our experimental paradigm highlights γ-oryzanol as a promising antiobesity substance with the distinct property of being a novel epigenetic modulator.
Transient Delivery of Adenosine as a Novel Therapy to Prevent Epileptogenesis
2013-08-01
rats characterized by the development of SRS triggered by systemic kainic acid–induced (KA-induced) status epilepticus (SE) (Figure 3A). Using...to modulate DNA methylation status , have not been studied to date. Based on ADO’s role as an obligatory end product of DNA methylation, we...1E). Together, these findings show that modulating ADO tone either directly or via modulation of ADK expression can affect DNA methylation status in
Schrell, Adrian M.; Roper, Michael G.
2014-01-01
A frequency-modulated fluorescence encoding method was used as a means to increase the number of fluorophores monitored during infrared-mediated polymerase chain reaction. Laser lines at 488-nm and 561-nm were modulated at 73- and 137-Hz, respectively, exciting fluorescence from the dsDNA intercalating dye, EvaGreen, and the temperature insensitive dye, ROX. Emission was collected in a color-blind manner using a single photomultiplier tube for detection and demodulated by frequency analysis. The resulting frequency domain signal resolved the contribution from the two fluorophores as well as the background from the IR lamp. The detection method was successfully used to measure amplification of DNA samples containing 104 – 107 starting copies of template producing an amplification efficiency of 96%. The utility of this methodology was further demonstrated by simultaneous amplification of two genes from human genomic DNA using different color TaqMan probes. This method of multiplexing fluorescence detection with IR-qPCR is ideally suited as it allowed isolation of the signals of interest from the background in the frequency domain and is expected to further reduce the complexity of multiplexed microfluidic IR-qPCR instrumentation. PMID:24448431
Polyphenol Compound as a Transcription Factor Inhibitor.
Park, Seyeon
2015-10-30
A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor-DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein-protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1), c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and β-catenin/T cell factor (Tcf)).
NASA Astrophysics Data System (ADS)
Ghita, Mihaela; Coffey, Caroline B.; Butterworth, Karl T.; McMahon, Stephen J.; Schettino, Giuseppe; Prise, Kevin M.
2016-01-01
To limit toxicity to normal tissues adjacent to the target tumour volume, radiotherapy is delivered using fractionated regimes whereby the total prescribed dose is given as a series of sequential smaller doses separated by specific time intervals. The impact of fractionation on out-of-field survival and DNA damage responses was determined in AGO-1522 primary human fibroblasts and MCF-7 breast tumour cells using uniform and modulated exposures delivered using a 225 kVp x-ray source. Responses to fractionated schedules (two equal fractions delivered with time intervals from 4 h to 48 h) were compared to those following acute exposures. Cell survival and DNA damage repair measurements indicate that cellular responses to fractionated non-uniform exposures differ from those seen in uniform exposures for the investigated cell lines. Specifically, there is a consistent lack of repair observed in the out-of-field populations during intervals between fractions, confirming the importance of cell signalling to out-of-field responses in a fractionated radiation schedule, and this needs to be confirmed for a wider range of cell lines and conditions.
TALE-PvuII fusion proteins--novel tools for gene targeting.
Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang
2013-01-01
Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity.
Arlt, Volker M; Meinl, Walter; Florian, Simone; Nagy, Eszter; Barta, Frantisek; Thomann, Marlies; Mrizova, Iveta; Krais, Annette M; Liu, Maggie; Richards, Meirion; Mirza, Amin; Kopka, Klaus; Phillips, David H; Glatt, Hansruedi; Stiborova, Marie; Schmeiser, Heinz H
2017-04-01
Exposure to aristolochic acid (AA) causes aristolochic acid nephropathy (AAN) and Balkan endemic nephropathy (BEN). Conflicting results have been found for the role of human sulfotransferase 1A1 (SULT1A1) contributing to the metabolic activation of aristolochic acid I (AAI) in vitro. We evaluated the role of human SULT1A1 in AA bioactivation in vivo after treatment of transgenic mice carrying a functional human SULT1A1-SULT1A2 gene cluster (i.e. hSULT1A1/2 mice) and Sult1a1(-/-) mice with AAI and aristolochic acid II (AAII). Both compounds formed characteristic DNA adducts in the intact mouse and in cytosolic incubations in vitro. However, we did not find differences in AAI-/AAII-DNA adduct levels between hSULT1A1/2 and wild-type (WT) mice in all tissues analysed including kidney and liver despite strong enhancement of sulfotransferase activity in both kidney and liver of hSULT1A1/2 mice relative to WT, kidney and liver being major organs involved in AA metabolism. In contrast, DNA adduct formation was strongly increased in hSULT1A1/2 mice compared to WT after treatment with 3-nitrobenzanthrone (3-NBA), another carcinogenic aromatic nitro compound where human SULT1A1/2 is known to contribute to genotoxicity. We found no differences in AAI-/AAII-DNA adduct formation in Sult1a1(-/-) and WT mice in vivo. Using renal and hepatic cytosolic fractions of hSULT1A1/2, Sult1a1(-/-) and WT mice, we investigated AAI-DNA adduct formation in vitro but failed to find a contribution of human SULT1A1/2 or murine Sult1a1 to AAI bioactivation. Our results indicate that sulfo-conjugation catalysed by human SULT1A1 does not play a role in the activation pathways of AAI and AAII in vivo, but is important in 3-NBA bioactivation.
Research on Image Encryption Based on DNA Sequence and Chaos Theory
NASA Astrophysics Data System (ADS)
Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin
2018-04-01
Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.
2010-01-01
Background The modular approach to analysis of genetically modified organisms (GMOs) relies on the independence of the modules combined (i.e. DNA extraction and GM quantification). The validity of this assumption has to be proved on the basis of specific performance criteria. Results An experiment was conducted using, as a reference, the validated quantitative real-time polymerase chain reaction (PCR) module for detection of glyphosate-tolerant Roundup Ready® GM soybean (RRS). Different DNA extraction modules (CTAB, Wizard and Dellaporta), were used to extract DNA from different food/feed matrices (feed, biscuit and certified reference material [CRM 1%]) containing the target of the real-time PCR module used for validation. Purity and structural integrity (absence of inhibition) were used as basic criteria that a DNA extraction module must satisfy in order to provide suitable template DNA for quantitative real-time (RT) PCR-based GMO analysis. When performance criteria were applied (removal of non-compliant DNA extracts), the independence of GMO quantification from the extraction method and matrix was statistically proved, except in the case of Wizard applied to biscuit. A fuzzy logic-based procedure also confirmed the relatively poor performance of the Wizard/biscuit combination. Conclusions For RRS, this study recognises that modularity can be generally accepted, with the limitation of avoiding combining highly processed material (i.e. biscuit) with a magnetic-beads system (i.e. Wizard). PMID:20687918
Daughdrill, Gary W; Buchko, Garry W; Botuyan, Maria V; Arrowsmith, Cheryl; Wold, Marc S; Kennedy, Michael A; Lowry, David F
2003-07-15
Replication protein A (RPA) is a heterotrimeric single-stranded DNA- (ssDNA) binding protein that can form a complex with the xeroderma pigmentosum group A protein (XPA). This complex can preferentially recognize UV-damaged DNA over undamaged DNA and has been implicated in the stabilization of open complex formation during nucleotide excision repair. In this report, nuclear magnetic resonance (NMR) spectroscopy was used to investigate the interaction between a fragment of the 70 kDa subunit of human RPA, residues 1-326 (hRPA70(1-326)), and a fragment of the human XPA protein, residues 98-219 (XPA-MBD). Intensity changes were observed for amide resonances in the (1)H-(15)N correlation spectrum of uniformly (15)N-labeled hRPA70(1-326) after the addition of unlabeled XPA-MBD. The intensity changes observed were restricted to an ssDNA-binding domain that is between residues 183 and 296 of the hRPA70(1-326) fragment. The hRPA70(1-326) residues with the largest resonance intensity reductions were mapped onto the structure of the ssDNA-binding domain to identify the binding surface with XPA-MBD. The XPA-MBD-binding surface showed significant overlap with an ssDNA-binding surface that was previously identified using NMR spectroscopy and X-ray crystallography. Overlapping XPA-MBD- and ssDNA-binding sites on hRPA70(1-326) suggests that a competitive binding mechanism mediates the formation of the RPA-XPA complex. To determine whether a ternary complex could form between hRPA70(1-326), XPA-MBD and ssDNA, a (1)H-(15)N correlation spectrum was acquired for uniformly (15)N-labeled hRPA70(1-326) after the simultaneous addition of unlabeled XPA-MBD and ssDNA. In this experiment, the same chemical shift perturbations were observed for hRPA70(1-326) in the presence of XPA-MBD and ssDNA as was previously observed in the presence of ssDNA alone. The ability of ssDNA to compete with XPA-MBD for an overlapping binding site on hRPA70(1-326) suggests that any complex formation between RPA and XPA that involves the interaction between XPA-MBD and hRPA70(1-326) may be modulated by ssDNA.
Daughdrill, Gary W.; Buchko, Garry W.; Botuyan, Maria V.; Arrowsmith, Cheryl; Wold, Marc S.; Kennedy, Michael A.; Lowry, David F.
2003-01-01
Replication protein A (RPA) is a heterotrimeric single-stranded DNA- (ssDNA) binding protein that can form a complex with the xeroderma pigmentosum group A protein (XPA). This complex can preferentially recognize UV-damaged DNA over undamaged DNA and has been implicated in the stabilization of open complex formation during nucleotide excision repair. In this report, nuclear magnetic resonance (NMR) spectroscopy was used to investigate the interaction between a fragment of the 70 kDa subunit of human RPA, residues 1–326 (hRPA701–326), and a fragment of the human XPA protein, residues 98–219 (XPA-MBD). Intensity changes were observed for amide resonances in the 1H–15N correlation spectrum of uniformly 15N-labeled hRPA701–326 after the addition of unlabeled XPA-MBD. The intensity changes observed were restricted to an ssDNA-binding domain that is between residues 183 and 296 of the hRPA701–326 fragment. The hRPA701–326 residues with the largest resonance intensity reductions were mapped onto the structure of the ssDNA-binding domain to identify the binding surface with XPA-MBD. The XPA-MBD-binding surface showed significant overlap with an ssDNA-binding surface that was previously identified using NMR spectroscopy and X-ray crystallography. Overlapping XPA-MBD- and ssDNA-binding sites on hRPA701–326 suggests that a competitive binding mechanism mediates the formation of the RPA–XPA complex. To determine whether a ternary complex could form between hRPA701–326, XPA-MBD and ssDNA, a 1H–15N correlation spectrum was acquired for uniformly 15N-labeled hRPA701–326 after the simultaneous addition of unlabeled XPA-MBD and ssDNA. In this experiment, the same chemical shift perturbations were observed for hRPA701–326 in the presence of XPA-MBD and ssDNA as was previously observed in the presence of ssDNA alone. The ability of ssDNA to compete with XPA-MBD for an overlapping binding site on hRPA701–326 suggests that any complex formation between RPA and XPA that involves the interaction between XPA-MBD and hRPA701–326 may be modulated by ssDNA. PMID:12853635
Suwa, Yoshiaki; Gu, Jianyou; Baranovskiy, Andrey G.; Babayeva, Nigar D.; Pavlov, Youri I.; Tahirov, Tahir H.
2015-01-01
In eukaryotic DNA replication, short RNA-DNA hybrid primers synthesized by primase-DNA polymerase α (Prim-Pol α) are needed to start DNA replication by the replicative DNA polymerases, Pol δ and Pol ϵ. The C terminus of the Pol α catalytic subunit (p180C) in complex with the B subunit (p70) regulates the RNA priming and DNA polymerizing activities of Prim-Pol α. It tethers Pol α and primase, facilitating RNA primer handover from primase to Pol α. To understand these regulatory mechanisms and to reveal the details of human Pol α organization, we determined the crystal structure of p70 in complex with p180C. The structured portion of p70 includes a phosphodiesterase (PDE) domain and an oligonucleotide/oligosaccharide binding (OB) domain. The N-terminal domain and the linker connecting it to the PDE domain are disordered in the reported crystal structure. The p180C adopts an elongated asymmetric saddle shape, with a three-helix bundle in the middle and zinc-binding modules (Zn1 and Zn2) on each side. The extensive p180C-p70 interactions involve 20 hydrogen bonds and a number of hydrophobic interactions resulting in an extended buried surface of 4080 Å2. Importantly, in the structure of the p180C-p70 complex with full-length p70, the residues from the N-terminal to the OB domain contribute to interactions with p180C. The comparative structural analysis revealed both the conserved features and the differences between the human and yeast Pol α complexes. PMID:25847248
Klattenhoff, Alex W.; Thakur, Megha; Chu, Christopher S.; Ray, Debolina; Habib, Samy L.; Kidane, Dawit
2017-01-01
DNA endonuclease eight-like glycosylase 3 (NEIL3) is one of the DNA glycosylases that removes oxidized DNA base lesions from single-stranded DNA (ssDNA) and non-B DNA structures. Approximately seven percent of human tumors have an altered NEIL3 gene. However, the role of NEIL3 in replication-associated repair and its impact on modulating treatment response is not known. Here, we report that NEIL3 is localized at the DNA double-strand break (DSB) sites during oxidative DNA damage and replication stress. Loss of NEIL3 significantly increased spontaneous replication-associated DSBs and recruitment of replication protein A (RPA). In contrast, we observed a marked decrease in Rad51 on nascent DNA strands at the replication fork, suggesting that HR-dependent repair is compromised in NEIL3-deficient cells. Interestingly, NEIL3-deficient cells were sensitive to ataxia–telangiectasia and Rad3 related protein (ATR) inhibitor alone or in combination with PARP1 inhibitor. This study elucidates the mechanism by which NEIL3 is critical to overcome oxidative and replication-associated genotoxic stress. Our findings may have important clinical implications to utilize ATR and PARP1 inhibitors to enhance cytotoxicity in tumors that carry altered levels of NEIL3. PMID:29348879
Giráldez, Servando; Herrero-Ruiz, Joaquín; Mora-Santos, Mar; Japón, Miguel Á; Tortolero, Maria; Romero, Francisco
2014-06-30
The intra-S-checkpoint is essential to control cell progression through S phase under normal conditions and in response to replication stress. When DNA lesions are detected, replication fork progression is blocked allowing time for repair to avoid genomic instability and the risk of cancer. DNA replication initiates at many origins of replication in eukaryotic cells, where a series of proteins form pre-replicative complexes (pre-RCs) that are activated to become pre-initiation complexes and ensure a single round of replication in each cell cycle. PLK1 plays an important role in the regulation of DNA replication, contributing to the regulation of pre-RCs formation by phosphorylating several proteins, under both normal and stress conditions. Here we report that PLK1 is ubiquitinated and degraded by SCFFBXW7α/proteasome. Moreover, we identified a new Cdc4 phosphodegron in PLK1, conserved from yeast to humans, whose mutation prevents PLK1 destruction. We established that endogenous SCFFBXW7α degrades PLK1 in the G1 and S phases of an unperturbed cell cycle and in S phase following UV irradiation. Furthermore, we showed that FBXW7α overexpression or UV irradiation prevented the loading of proteins onto chromatin to form pre-RCs and, accordingly, reduced cell proliferation. We conclude that PLK1 degradation mediated by SCFFBXW7α modulates the intra-S-phase checkpoint.
Giráldez, Servando; Herrero-Ruiz, Joaquín; Mora-Santos, Mar; Japón, Miguel Á.; Tortolero, Maria; Romero, Francisco
2014-01-01
The intra-S-checkpoint is essential to control cell progression through S phase under normal conditions and in response to replication stress. When DNA lesions are detected, replication fork progression is blocked allowing time for repair to avoid genomic instability and the risk of cancer. DNA replication initiates at many origins of replication in eukaryotic cells, where a series of proteins form pre-replicative complexes (pre-RCs) that are activated to become pre-initiation complexes and ensure a single round of replication in each cell cycle. PLK1 plays an important role in the regulation of DNA replication, contributing to the regulation of pre-RCs formation by phosphorylating several proteins, under both normal and stress conditions. Here we report that PLK1 is ubiquitinated and degraded by SCFFBXW7α/proteasome. Moreover, we identified a new Cdc4 phosphodegron in PLK1, conserved from yeast to humans, whose mutation prevents PLK1 destruction. We established that endogenous SCFFBXW7α degrades PLK1 in the G1 and S phases of an unperturbed cell cycle and in S phase following UV irradiation. Furthermore, we showed that FBXW7α overexpression or UV irradiation prevented the loading of proteins onto chromatin to form pre-RCs and, accordingly, reduced cell proliferation. We conclude that PLK1 degradation mediated by SCFFBXW7α modulates the intra-S-phase checkpoint. PMID:24970797
Hong, Kun-Jing; Hsu, Ming-Chuan; Hung, Wen-Chun
2015-01-01
The reversion-inducing cysteine-rich protein with kazal motif (RECK) is an endogenous matrix metalloproteinase (MMP) inhibitor and a tumor suppressor. Its expression is dramatically down-regulated in human cancers. Our recent results suggest a novel MMP-independent anti-cancer activity of RECK by inhibiting the erbB signaling. Activation of the erbB signaling is associated with chemotherapeutic resistance, however, whether RECK could modulate drug sensitivity is still unknown. Here we demonstrated that expression of RECK induced the activation of ATM and ATR pathways, and the formation of γ-H2AX foci in breast cancer cells. RECK inhibited the erbB signaling and attenuated the expression of the downstream molecules Jun activation domain-binding protein 1 (JAB1) and the DNA repair protein RAD51 to impede DNA repair and to increase drug sensitivity. Treatment of epidermal growth factor or over-expression of HER-2 effectively reversed the inhibitory effect of RECK. In addition, ectopic expression of JAB1 counteracted RECK-induced RAD51 reduction and drug sensitization. Our results elucidate a novel function of RECK to modulate DNA damage response and drug resistance by inhibiting the erbB/Jab1/RAD51 signaling axis. Restoration of RECK expression in breast cancer cells may increase sensitivity to chemotherapeutic agents. PMID:26396917
Cdc7 kinase - a new target for drug development.
Swords, Ronan; Mahalingam, Devalingam; O'Dwyer, Michael; Santocanale, Corrado; Kelly, Kevin; Carew, Jennifer; Giles, Francis
2010-01-01
The cell division cycle 7 (Cdc7) is a serine threonine kinase that is of critical importance in the regulation of normal cell cycle progression. Cdc7 kinase is highly conserved during evolution and much has been learned about its biological roles in humans through the study of lower eukaryotes, particularly yeasts. Two important regulator proteins, Dbf4 and Drf1, bind to and modulate the kinase activity of human Cdc7 which phosphorylates several sites on Mcm2 (minichromosome maintenance protein 2), one of the six subunits of the replicative DNA helicase needed for duplication of the genome. Through regulation of both DNA synthesis and DNA damage response, both key functions in the survival of tumour cells, Cdc7 becomes an attractive target for pharmacological inhibition. There are much data available on the pre-clinical anti-cancer effects of Cdc7 depletion and although there are no available Cdc7 inhibitors in clinical trials as yet, several lead compounds are being optimised for this purpose. In this review, we will address the current status of Cdc7 as an important target for new drug development.
Fazio, V M; Ria, F; Franco, E; Rosati, P; Cannelli, G; Signori, E; Parrella, P; Zaratti, L; Iannace, E; Monego, G; Blogna, S; Fioretti, D; Iurescia, S; Filippetti, R; Rinaldi, M
2004-03-01
Infections occurring at the end of pregnancy, during birth or by breastfeeding are responsible for the high toll of death among first-week infants. In-utero DNA immunization has demonstrated the effectiveness in inducing specific immunity in newborns. A major contribution to infant immunization would be achieved if a vaccine proved able to be protective as early as at the birth, preventing the typical 'first-week infections'. To establish its potential for use in humans, in-utero DNA vaccination efficiency has to be evaluated for short- and long-term safety, protection at delivery, efficacy of boosts in adults and effective window/s for modulation of immune response during pregnancy, in an animal model suitable with human development. Here we show that a single intramuscular in-utero anti-HBV DNA immunization at two-thirds of pig gestation produces, at birth, antibody titers considered protective in humans. The boost of antibody titers in every animal following recall at 4 and 10 months demonstrates the establishment of immune memory. The safety of in-utero fetus manipulation is guaranteed by short-term (no fetus loss, lack of local alterations, at-term spontaneous delivery, breastfeeding) and long-term (2 years) monitoring. Treatment of fetuses closer to delivery results in immune ignorance without induction of tolerance. This result highlights the repercussion of selecting the appropriate time point when this approach is used to deliver therapeutic genes. All these findings illustrate the relevance of naked DNA-based vaccination technology in therapeutic efforts aimed to prevent the high toll of death among first-week infants.
Latimer, Jean J.; Majekwana, Vongai J.; Pabon-Padin, Yashira R.; ...
2014-12-19
Nucleotide excision repair (NER) is important as a modulator of disease, especially in constitutive deficiencies, such as the cancer predisposition syndrome Xeroderma pigmentosum. We have found profound variation of NER capacity among normal individuals, between cell-types and during carcinogenesis. NER is a repair system for many types of DNA damage, and therefore many types of genotoxic carcinogenic exposures, including ultraviolet light, products of organic combustion, metals, oxidative stress, etc. Since NER is intimately related to cellular metabolism, requiring components of both the DNA replicative and transcription machinery, it has a narrow range of functional viability. Thus, genes in the NERmore » pathway are expressed at the low levels manifested by, for example, nuclear transcription factors. Since NER activity and gene expression vary by cell-type, it is inherently epigenetically regulated. Furthermore, this epigenetic regulation is disregulated during sporadic breast carcinogenesis. Loss of NER is one basis of genomic instability, a required element in cellular transformation, and one that potentially modulates response to therapy. In this article, we demonstrate differences in NER capacity in eight adult mouse tissues, and place this result into the context of our previous work on mouse extraembryonic tissues, normal human tissues and sporadic early stage human breast cancer.« less
TALE-PvuII Fusion Proteins – Novel Tools for Gene Targeting
Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang
2013-01-01
Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity. PMID:24349308
Blanch, Marta; Mosquera, Jose Luis; Ansoleaga, Belén; Ferrer, Isidre; Barrachina, Marta
2016-02-01
Mitochondrial dysfunction is linked with the etiopathogenesis of Alzheimer disease and Parkinson disease. Mitochondria are intracellular organelles essential for cell viability and are characterized by the presence of the mitochondrial (mt)DNA. DNA methylation is a well-known epigenetic mechanism that regulates nuclear gene transcription. However, mtDNA methylation is not the subject of the same research attention. The present study shows the presence of mitochondrial 5-methylcytosine in CpG and non-CpG sites in the entorhinal cortex and substantia nigra of control human postmortem brains, using the 454 GS FLX Titanium pyrosequencer. Moreover, increased mitochondrial 5-methylcytosine levels are found in the D-loop region of mtDNA in the entorhinal cortex in brain samples with Alzheimer disease-related pathology (stages I to II and stages III to IV of Braak and Braak; n = 8) with respect to control cases. Interestingly, this region shows a dynamic pattern in the content of mitochondrial 5-methylcytosine in amyloid precursor protein/presenilin 1 mice along with Alzheimer disease pathology progression (3, 6, and 12 months of age). Finally, a loss of mitochondrial 5-methylcytosine levels in the D-loop region is found in the substantia nigra in Parkinson disease (n = 10) with respect to control cases. In summary, the present findings suggest mtDNA epigenetic modulation in human brain is vulnerable to neurodegenerative disease states. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Takayanagi-Kiya, Seika; Jin, Yishi
2016-07-07
The highly conserved cochaperone DnaJ/Hsp40 family proteins are known to interact with molecular chaperone Hsp70, and can regulate many cellular processes including protein folding, translocation, and degradation. In studies of Caenorhabditis elegans locomotion mutants, we identified a gain-of-function (gf) mutation in dnj-17 closely linked to the widely used e156 null allele of C. elegans GAD (glutamic acid decarboxylase) unc-25 dnj-17 encodes a DnaJ protein orthologous to human DNAJA5. In C. elegans DNJ-17 is a cytosolic protein and is broadly expressed in many tissues. dnj-17(gf) causes a single amino acid substitution in a conserved domain, and behaves as a hypermorphic mutation. The effect of this dnj-17(gf) is most prominent in mutants lacking GABA synaptic transmission. In a seizure model caused by a mutation in the ionotropic acetylcholine receptor acr-2(gf), dnj-17(gf) exacerbates the convulsion phenotype in conjunction with absence of GABA. Null mutants of dnj-17 show mild resistance to aldicarb, while dnj-17(gf) is hypersensitive. These results highlight the importance of DnaJ proteins in regulation of C. elegans locomotor circuit, and provide insights into the in vivo roles of DnaJ proteins in humans. Copyright © 2016 Takayanagi-Kiya and Jin.
An integratable microfluidic cartridge for forensic swab samples lysis.
Yang, Jianing; Brooks, Carla; Estes, Matthew D; Hurth, Cedric M; Zenhausern, Frederic
2014-01-01
Fully automated rapid forensic DNA analysis requires integrating several multistep processes onto a single microfluidic platform, including substrate lysis, extraction of DNA from the released lysate solution, multiplexed PCR amplification of STR loci, separation of PCR products by capillary electrophoresis, and analysis for allelic peak calling. Over the past several years, most of the rapid DNA analysis systems developed started with the reference swab sample lysate and involved an off-chip lysis of collected substrates. As a result of advancement in technology and chemistry, addition of a microfluidic module for swab sample lysis has been achieved in a few of the rapid DNA analysis systems. However, recent reports on integrated rapid DNA analysis systems with swab-in and answer-out capability lack any quantitative and qualitative characterization of the swab-in sample lysis module, which is important for downstream forensic sample processing. Maximal collection and subsequent recovery of the biological material from the crime scene is one of the first and critical steps in forensic DNA technology. Herein we present the design, fabrication and characterization of an integratable swab lysis cartridge module and the test results obtained from different types of commonly used forensic swab samples, including buccal, saliva, and blood swab samples, demonstrating the compatibility with different downstream DNA extraction chemistries. This swab lysis cartridge module is easy to operate, compatible with both forensic and microfluidic requirements, and ready to be integrated with our existing automated rapid forensic DNA analysis system. Following the characterization of the swab lysis module, an integrated run from buccal swab sample-in to the microchip CE electropherogram-out was demonstrated on the integrated prototype instrument. Therefore, in this study, we demonstrate that this swab lysis cartridge module is: (1) functionally, comparable with routine benchtop lysis, (2) compatible with various types of swab samples and chemistries, and (3) integratable to achieve a micro total analysis system (μTAS) for rapid DNA analysis. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Liao, Ching-Lung; Hsu, Shu-Chun; Yu, Chien-Chih; Yang, Jai-Sing; Tang, Nou-Ying; Wood, Wellington Gibson; Lin, Jaung-Geng; Chung, Jing-Gung
2014-09-01
Crude extract of Corni Fructus (CECF) has been used in Traditional Chinese medicine for the treatment of different diseases for hundreds of years. The purpose of this study was to investigate the cytotoxic effects of CECF on U-2 OS human osteosarcoma cells. Flow cytometry was used for measuring the percentage of viable cells, cell-cycle distribution, apoptotic cells in sub-G1 phase, reactive oxygen species (ROS), Ca(2+) levels, and mitochondrial membrane potential (ΔΨm ). Comet assay and 4'-6-diamidino-2-phenylindole staining were used for examining DNA damage and condensation. Western blotting was used to examine apoptosis-associated protein levels in U-2 OS cells after exposed to CECF. Immunostaining and confocal laser system microscope were used to examine protein translocation after CECF incubation. CECF decreased the percentage of viability, induced DNA damage and DNA condensation, G₀/G₁ arrest, and apoptosis in U-2 OS cells. CECF-stimulated activities of caspase-8, caspase-9, and caspase-3, ROS, and Ca(2+) production, decreased ΔΨm levels of in U-2 OS cells. CECF increased protein levels of caspase-3, caspase-9, Bax, cytochrome c, GRP78, AIF, ATF-6α, Fas, TRAIL, p21, p27, and p16 which were associated with cell-cycle arrest and apoptosis. These findings suggest that CECF triggers apoptosis in U-2 OS cells via ROS-modulated caspase-dependent and -independent pathways. Copyright © 2012 Wiley Periodicals, Inc., a Wiley company.
DNA repair phenotype and dietary antioxidant supplementation.
Guarnieri, Serena; Loft, Steffen; Riso, Patrizia; Porrini, Marisa; Risom, Lotte; Poulsen, Henrik E; Dragsted, Lars O; Møller, Peter
2008-05-01
Phytochemicals may protect cellular DNA by direct antioxidant effect or modulation of the DNA repair activity. We investigated the repair activity towards oxidised DNA in human mononuclear blood cells (MNBC) in two placebo-controlled antioxidant intervention studies as follows: (1) well-nourished subjects who ingested 600 g fruits and vegetables, or tablets containing the equivalent amount of vitamins and minerals, for 24 d; (2) poorly nourished male smokers who ingested 500 mg vitamin C/d as slow- or plain-release formulations together with 182 mg vitamin E/d for 4 weeks. The mean baseline levels of DNA repair incisions were 65.2 (95 % CI 60.4, 70.0) and 86.1 (95 % CI 76.2, 99.9) among the male smokers and well-nourished subjects, respectively. The male smokers also had high baseline levels of oxidised guanines in MNBC. After supplementation, only the male smokers supplemented with slow-release vitamin C tablets had increased DNA repair activity (27 (95 % CI 12, 41) % higher incision activity). These subjects also benefited from the supplementation by reduced levels of oxidised guanines in MNBC. In conclusion, nutritional status, DNA repair activity and DNA damage are linked, and beneficial effects of antioxidants might only be observed among poorly nourished subjects with high levels of oxidised DNA damage and low repair activity.
Alleva, Renata; Manzella, Nicola; Gaetani, Simona; Ciarapica, Veronica; Bracci, Massimo; Caboni, Maria Fiorenza; Pasini, Federica; Monaco, Federica; Amati, Monica; Borghi, Battista; Tomasetti, Marco
2016-10-01
Glyphosate (GLY) and organophosphorus insecticides such as chlorpyrifos (CPF) may cause DNA damage and cancer in exposed individuals through mitochondrial dysfunction. Polyphenols ubiquitously present in fruits and vegetables, have been viewed as antioxidant molecules, but also influence mitochondrial homeostasis. Here, honey containing polyphenol compounds was evaluated for its potential protective effect on pesticide-induced genotoxicity. Honey extracts from four floral organic sources were evaluated for their polyphenol content, antioxidant activity, and potential protective effects on pesticide-related mitochondrial destabilization, reactive oxygen and nitrogen species formation, and DNA damage response in human bronchial epithelial and neuronal cells. The protective effect of honey was, then evaluated in a residential population chronically exposed to pesticides. The four honey types showed a different polyphenol profile associated with a different antioxidant power. The pesticide-induced mitochondrial dysfunction parallels ROS formation from mitochondria (mtROS) and consequent DNA damage. Honey extracts efficiently inhibited pesticide-induced mtROS formation, and reduced DNA damage by upregulation of DNA repair through NFR2. Honey supplementation enhanced DNA repair activity in a residential population chronically exposed to pesticides, which resulted in a marked reduction of pesticide-induced DNA lesions. These results provide new insight regarding the effect of honey containing polyphenols on pesticide-induced DNA damage response. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
An autonomous molecular computer for logical control of gene expression
Benenson, Yaakov; Gil, Binyamin; Ben-Dor, Uri; Adar, Rivka; Shapiro, Ehud
2013-01-01
Early biomolecular computer research focused on laboratory-scale, human-operated computers for complex computational problems1–7. Recently, simple molecular-scale autonomous programmable computers were demonstrated8–15 allowing both input and output information to be in molecular form. Such computers, using biological molecules as input data and biologically active molecules as outputs, could produce a system for ‘logical’ control of biological processes. Here we describe an autonomous biomolecular computer that, at least in vitro, logically analyses the levels of messenger RNA species, and in response produces a molecule capable of affecting levels of gene expression. The computer operates at a concentration of close to a trillion computers per microlitre and consists of three programmable modules: a computation module, that is, a stochastic molecular automaton12–17; an input module, by which specific mRNA levels or point mutations regulate software molecule concentrations, and hence automaton transition probabilities; and an output module, capable of controlled release of a short single-stranded DNA molecule. This approach might be applied in vivo to biochemical sensing, genetic engineering and even medical diagnosis and treatment. As a proof of principle we programmed the computer to identify and analyse mRNA of disease-related genes18–22 associated with models of small-cell lung cancer and prostate cancer, and to produce a single-stranded DNA molecule modelled after an anticancer drug. PMID:15116117
Methylation of Notch3 modulates chemoresistance via P-glycoprotein.
Gu, Xiaoting; Lu, Yangfan; He, Dongxu; Lu, Chunxiao; Jin, Jian; Lu, Xiaojie; Ma, Xin
2016-12-05
The global gene expression and DNA methylation of genes in adriamycin-resistant human breast cancer cells (MCF-7/ADM cells) are similar to those in paclitaxel-resistant MCF-7 cells (MCF-7/PTX) and are significantly different from those in wild-type MCF-7 cells. DNA methylation is associated with chemoresistance in breast cancer and changes the characteristics of chemoresistant and chemosensitive cells. Here, we showed that the tumor-suppressor gene Notch3 was inactivated due to epigenetic silencing DNA hypermethylation in MCF-7/ADM cells. In addition, the drug efflux pump P-glycoprotein was negatively regulated by Notch3 and highly expressed in MCF-7/ADM cells. Taken together, our findings demonstrated that hypermethylation of Notch3 causes activation of P-glycoprotein in adriamycin-resistant cells. Copyright © 2016 Elsevier B.V. All rights reserved.
α-Fetoprotein as a modulator of the pro-inflammatory response of human keratinocytes
Potapovich, AI; Pastore, S; Kostyuk, VA; Lulli, D; Mariani, V; De Luca, C; Dudich, EI; Korkina, LG
2009-01-01
Background and purpose: The immunomodulatory effects of α-fetoprotein (AFP) on lymphocytes and macrophages have been described in vitro and in vivo. Recombinant forms of human AFP have been proposed as potential therapeutic entities for the treatment of autoimmune diseases. We examined the effects of embryonic and recombinant human AFP on the spontaneous, UVA- and cytokine-induced pro-inflammatory responses of human keratinocytes. Experimental approach: Cultures of primary and immortalized human keratinocytes (HaCaT) and human blood T lymphocytes were used. The effects of AFP on cytokine expression were studied by bioplexed elisa and quantitative reverse transcriptase polymerase chain reaction assay. Kinase and nuclear factor kappa B (NFκB) phosphorylation were quantified by intracellular elisa. Nuclear activator protein 1 and NFκB DNA binding activity was measured by specific assays. Nitric oxide and H2O2 production and redox status were assessed by fluorescent probe and biochemical methods. Key results: All forms of AFP enhanced baseline expression of cytokines, chemokines and growth factors. AFP dose-dependently increased tumour necrosis factor alpha-stimulated granulocyte macrophage colony stimulating factor and interleukin 8 expression and decreased tumour necrosis factor alpha-induced monocyte chemotactic protein 1 and IP-10 (interferon gamma-produced protein of 10 kDa) expression. AFP induced a marked activator protein 1 activation in human keratinocytes. AFP also increased H2O2 and modulated nitrite/nitrate levels in non-stimulated keratinocytes whereas it did not affect these parameters or cytokine release from UVA-stimulated cells. Phosphorylation of extracellular signal-regulated kinase (ERK1/2) and Akt1 but not NFκB was activated by AFP alone or by its combination with UVA. Conclusions and implications: Exogenous AFP induces activation of human keratinocytes, with de novo expression of a number of pro-inflammatory mediators and modulation of their pro-inflammatory response to cytokines or UVA. AFP may modulate inflammatory events in human skin. PMID:19785658
Guo, Fang; Zhao, Qiong; Sheraz, Muhammad; Cheng, Junjun; Qi, Yonghe; Su, Qing; Cuconati, Andrea; Wei, Lai; Du, Yanming; Li, Wenhui; Chang, Jinhong; Guo, Ju-Tao
2017-09-01
Hepatitis B virus (HBV) core protein assembles viral pre-genomic (pg) RNA and DNA polymerase into nucleocapsids for reverse transcriptional DNA replication to take place. Several chemotypes of small molecules, including heteroaryldihydropyrimidines (HAPs) and sulfamoylbenzamides (SBAs), have been discovered to allosterically modulate core protein structure and consequentially alter the kinetics and pathway of core protein assembly, resulting in formation of irregularly-shaped core protein aggregates or "empty" capsids devoid of pre-genomic RNA and viral DNA polymerase. Interestingly, in addition to inhibiting nucleocapsid assembly and subsequent viral genome replication, we have now demonstrated that HAPs and SBAs differentially modulate the biosynthesis of covalently closed circular (ccc) DNA from de novo infection and intracellular amplification pathways by inducing disassembly of nucleocapsids derived from virions as well as double-stranded DNA-containing progeny nucleocapsids in the cytoplasm. Specifically, the mistimed cuing of nucleocapsid uncoating prevents cccDNA formation during de novo infection of hepatocytes, while transiently accelerating cccDNA synthesis from cytoplasmic progeny nucleocapsids. Our studies indicate that elongation of positive-stranded DNA induces structural changes of nucleocapsids, which confers ability of mature nucleocapsids to bind CpAMs and triggers its disassembly. Understanding the molecular mechanism underlying the dual effects of the core protein allosteric modulators on nucleocapsid assembly and disassembly will facilitate the discovery of novel core protein-targeting antiviral agents that can more efficiently suppress cccDNA synthesis and cure chronic hepatitis B.
Nie, Jianhui; Liu, Jianhua; Xie, Hui; Sun, Zhengrong; Zhao, Juan; Chen, Qingqing; Liu, Yangyang; Huang, Weijin; Ruan, Qiang; Wang, Youchun
2016-11-01
To investigate the multi-infection patterns and type competition for human papillomavirus (HPV) in Chinese clinic attending women and evaluate the association between the infection status and cancer risk. Three hundred and thirty-two HPV-DNA-positive samples were genotyped for 21 HPVs and tested for 13 types of HPV neutralizing antibody using pseudoviron-based assay. Odds ratios (ORs) were calculated to evaluate the coinfection patterns for both DNA and neutralizing antibody (NAb), and the associations of HSIL+ with HPV DNA and NAb. Of the 332 HPV-DNA-positive subjects, 279 (84.0%) were detected as NAb positive. Multi-positive results were identified in 23.2% (77/332) HPV DNA tests and 60.2% (168/279) HPV NAb assays. The NAb titers for the multiple-positive samples (geometric mean 214) were significantly higher than the single-positive samples (geometric mean 114) (P < 0.01). HPV16-HPV52 was identified as a type-competition pair for both HPV DNA (OR = 0.09; 95%CI = 0.02-0.42) and NAb (OR = 0.27; 95%CI = 0.11-0.69) data. Compared to other types, HPV16 DNA was associated significantly with high risk of HSIL+ (OR = 2.57; 95%CI = 1.23-5.38). HPV16-HPV52 was identified as a potential type-competition pair, which might result in the type modulation with the implementation of the approved bi- or quadri-valent vaccines. J. Med. Virol. 88:1989-1998, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
H3K4me1 marks DNA regions hypomethylated during aging in human stem and differentiated cells
Fernández, Agustín F.; Bayón, Gustavo F.; Urdinguio, Rocío G.; Toraño, Estela G.; García, María G.; Carella, Antonella; Petrus-Reurer, Sandra; Ferrero, Cecilia; Martinez-Camblor, Pablo; Cubillo, Isabel; García-Castro, Javier; Delgado-Calle, Jesús; Pérez-Campo, Flor M.; Riancho, José A.; Bueno, Clara; Menéndez, Pablo; Mentink, Anouk; Mareschi, Katia; Claire, Fabian; Fagnani, Corrado; Medda, Emanuela; Toccaceli, Virgilia; Brescianini, Sonia; Moran, Sebastián; Esteller, Manel; Stolzing, Alexandra; de Boer, Jan; Nisticò, Lorenza; Stazi, Maria A.
2015-01-01
In differentiated cells, aging is associated with hypermethylation of DNA regions enriched in repressive histone post-translational modifications. However, the chromatin marks associated with changes in DNA methylation in adult stem cells during lifetime are still largely unknown. Here, DNA methylation profiling of mesenchymal stem cells (MSCs) obtained from individuals aged 2 to 92 yr identified 18,735 hypermethylated and 45,407 hypomethylated CpG sites associated with aging. As in differentiated cells, hypermethylated sequences were enriched in chromatin repressive marks. Most importantly, hypomethylated CpG sites were strongly enriched in the active chromatin mark H3K4me1 in stem and differentiated cells, suggesting this is a cell type–independent chromatin signature of DNA hypomethylation during aging. Analysis of scedasticity showed that interindividual variability of DNA methylation increased during aging in MSCs and differentiated cells, providing a new avenue for the identification of DNA methylation changes over time. DNA methylation profiling of genetically identical individuals showed that both the tendency of DNA methylation changes and scedasticity depended on nongenetic as well as genetic factors. Our results indicate that the dynamics of DNA methylation during aging depend on a complex mixture of factors that include the DNA sequence, cell type, and chromatin context involved and that, depending on the locus, the changes can be modulated by genetic and/or external factors. PMID:25271306
Modulating nanoparticle superlattice structure using proteins with tunable bond distributions
McMillan, Janet R.; Brodin, Jeffrey D.; Millan, Jaime A.; ...
2017-01-25
Here, we investigate the use of proteins with tunable DNA modification distributions to modulate nanoparticle superlattice structure. Using Beta-galactosidase (βgal) as a model system, we have employed the orthogonal chemical reactivities of surface amines and thiols to synthesize protein-DNA conjugates with 36 evenly distributed or 8 specifically positioned oligonucleotides. When assembled into crystalline superlattices with AuNPs, we find that the distribution of DNA modifications modulates the favored structure: βgal with uniformly distributed DNA bonding elements results in body-centered cubic crystals, whereas DNA functionalization of cysteines results in AB 2 packing. We probe the role of protein oligonucleotide number and conjugatemore » size on this observation, which revealed the importance of oligonucleotide distribution and number in this observed assembly behavior. These results indicate that proteins with defined DNA-modification patterns are powerful tools to control the nanoparticle superlattices architecture, and establish the importance of oligonucleotide distribution in the assembly behavior of protein-DNA conjugates.« less
Dietary factors and epigenetic regulation for prostate cancer prevention.
Ho, Emily; Beaver, Laura M; Williams, David E; Dashwood, Roderick H
2011-11-01
The role of epigenetic alterations in various human chronic diseases has gained increasing attention and has resulted in a paradigm shift in our understanding of disease susceptibility. In the field of cancer research, e.g., genetic abnormalities/mutations historically were viewed as primary underlying causes; however, epigenetic mechanisms that alter gene expression without affecting DNA sequence are now recognized as being of equal or greater importance for oncogenesis. Methylation of DNA, modification of histones, and interfering microRNA (miRNA) collectively represent a cadre of epigenetic elements dysregulated in cancer. Targeting the epigenome with compounds that modulate DNA methylation, histone marks, and miRNA profiles represents an evolving strategy for cancer chemoprevention, and these approaches are starting to show promise in human clinical trials. Essential micronutrients such as folate, vitamin B-12, selenium, and zinc as well as the dietary phytochemicals sulforaphane, tea polyphenols, curcumin, and allyl sulfur compounds are among a growing list of agents that affect epigenetic events as novel mechanisms of chemoprevention. To illustrate these concepts, the current review highlights the interactions among nutrients, epigenetics, and prostate cancer susceptibility. In particular, we focus on epigenetic dysregulation and the impact of specific nutrients and food components on DNA methylation and histone modifications that can alter gene expression and influence prostate cancer progression.
Duale, Nur; Olsen, Ann-Karin; Christensen, Terje; Butt, Shamas T.; Brunborg, Gunnar
2010-01-01
Octyl methoxycinnamate (OMC) is one of the most widely used sunscreen ingredients. To analyze biological effects of OMC, an in vitro approach was used implying ultraviolet (UV) exposure of two human cell lines, a primary skin fibroblast (GM00498) and a breast cancer (MCF-7) cell lines. End points include cell viability assessment, assay of cyclobutane pyrimidine dimers (CPDs) and oxidated DNA lesions using alkaline elution and lesion-specific enzymes, and gene expression analysis of a panel of 17 DNA damage–responsive genes. We observed that OMC provided protection against CPDs, and the degree of protection correlated with the OMC-mediated reduction in UV dose. No such protection was found with respect to oxidative DNA lesions. Upon UV exposure in the presence of OMC, the gene expression studies showed significant differential changes in some of the genes studied and the expression of p53 protein was also changed. For some genes, the change in expression seemed to be delayed in time by OMC. The experimental approach applied in this study, using a panel of 17 genes in an in vitro cellular system together with genotoxicity assays, may be useful in the initial screening of active ingredients in sunscreens. PMID:20071424
Wang, Kesai; Taylor, John-Stephen A
2017-07-07
Cyclobutane pyrimidine dimers (CPDs) are DNA photoproducts linked to skin cancer, whose mutagenicity depends in part on their frequency of formation and deamination. Nucleosomes modulate CPD formation, favoring outside facing sites and disfavoring inward facing sites. A similar pattern of CPD formation in protein-free DNA loops suggests that DNA bending causes the modulation in nucleosomes. To systematically study the cause and effect of nucleosome structure on CPD formation and deamination, we have developed a circular permutation synthesis strategy for positioning a target sequence at different superhelix locations (SHLs) across a nucleosome in which the DNA has been rotationally phased with respect to the histone octamer by TG motifs. We have used this system to show that the nucleosome dramatically modulates CPD formation in a T11-tract that covers one full turn of the nucleosome helix at seven different SHLs, and that the position of maximum CPD formation at all locations is shifted to the 5΄-side of that found in mixed-sequence nucleosomes. We also show that an 80-mer minicircle DNA using the same TG-motifs faithfully reproduces the CPD pattern in the nucleosome, indicating that it is a good model for protein-free rotationally phased bent DNA of the same curvature as in a nucleosome, and that bending is modulating CPD formation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
2013-01-01
Background Houttuynia cordata Thunb (HCT) is commonly used in Taiwan and other Asian countries as an anti-inflammatory, antibacterial and antiviral herbal medicine. In this study, we investigated the anti-human lung cancer activity and growth inhibition mechanisms of HCT in human lung cancer A549 cells. Results In order to investigate effects of HCT on A549 cells, MTT assay was used to evaluate cell viability. Flow cytometry was employed for cell cycle analysis, DAPI staining, and the Comet assay was used for DNA fragmentation and DNA condensation. Western blot analysis was used to analyze cell cycle and apoptotic related protein levels. HCT induced morphological changes including cell shrinkage and rounding. HCT increased the G0/G1 and Sub-G1 cell (apoptosis) populations and HCT increased DNA fragmentation and DNA condensation as revealed by DAPI staining and the Comet assay. HCT induced activation of caspase-8 and caspase-3. Fas/CD95 protein levels were increased in HCT-treated A549 cells. The G0/G1 phase and apoptotic related protein levels of cyclin D1, cyclin A, CDK 4 and CDK 2 were decreased, and p27, caspase-8 and caspase-3 were increased in A549 cells after HCT treatment. Conclusions The results demonstrated that HCT-induced G0/G1 phase arrest and Fas/CD95-dependent apoptotic cell death in A549 cells PMID:23506616
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ondovcik, Stephanie L.; Preston, Thomas J.; McCallum, Gordon P.
Exposure to methylmercury (MeHg) acutely at high levels, or via chronic low-level dietary exposure from daily fish consumption, can lead to adverse neurological effects in both the adult and developing conceptus. To determine the impact of variable DNA repair capacity, and the role of reactive oxygen species (ROS) and oxidatively damaged DNA in the mechanism of toxicity, transgenic human embryonic kidney (HEK) 293 cells that stably express either human oxoguanine glycosylase 1 (hOgg1) or its bacterial homolog, formamidopyrimidine glycosylase (Fpg), which primarily repair the oxidative lesion 8-oxo-2′-deoxyguanosine (8-oxodG), were used to assess the in vitro effects of MeHg. Western blottingmore » confirmed the expression of hOgg1 or Fpg in both the nuclear and mitochondrial compartments of their respective cell lines. Following acute (1–2 h) incubations with 0–10 μM MeHg, concentration-dependent decreases in clonogenic survival and cell growth accompanied concentration-dependent increases in lactate dehydrogenase (LDH) release, ROS formation, 8-oxodG levels and apurinic/apyrimidinic (AP) sites, consistent with the onset of cytotoxicity. Paradoxically, hOgg1- and Fpg-expressing HEK 293 cells were more sensitive than wild-type cells stably transfected with the empty vector control to MeHg across all cellular and biochemical parameters, exhibiting reduced clonogenic survival and cell growth, and increased LDH release and DNA damage. Accordingly, upregulation of specific components of the base excision repair (BER) pathway may prove deleterious potentially due to the absence of compensatory enhancement of downstream processes to repair toxic intermediary abasic sites. Thus, interindividual variability in DNA repair activity may constitute an important risk factor for environmentally-initiated, oxidatively damaged DNA and its pathological consequences. - Highlights: • hOgg1 and Fpg repair oxidatively damaged DNA. • hOgg1- and Fpg-expressing cells are more sensitive to MeHg toxicity. • Enhanced sensitivity is likely due to an accumulation of toxic repair intermediates. • Interindividual variability in DNA repair activity may modulate toxicological risk.« less
Two sides of the same coin: TFIIH complexes in transcription and DNA repair.
Zhovmer, Alexander; Oksenych, Valentyn; Coin, Frédéric
2010-04-13
TFIIH is organized into a seven-subunit core associated with a three-subunit Cdk-activating kinase (CAK) module. TFIIH has roles in both transcription initiation and DNA repair. During the last 15 years, several studies have been conducted to identify the composition of the TFIIH complex involved in DNA repair. Recently, a new technique combining chromatin immunoprecipitation and western blotting resolved the hidden nature of the TFIIH complex participating in DNA repair. Following the recruitment of TFIIH to the damaged site, the CAK module is released from the core TFIIH, and the core subsequently associates with DNA repair factors. The release of the CAK is specifically driven by the recruitment of the DNA repair factor XPA and is required to promote the incision/excision of the damaged DNA. Once the DNA lesions have been repaired, the CAK module returns to the core TFIIH on the chromatin, together with the release of the repair factors. These data highlight the dynamic composition of a fundamental cellular factor that adapts its subunit composition to the cell needs.
2015-01-01
A study of structure-based modulation of known ligands of hTopoIIα, an important enzyme involved in DNA processes, coupled with synthesis and in vitro assays led to the establishment of a strategy of rational switch in mode of inhibition of the enzyme’s catalytic cycle. 6-Arylated derivatives of known imidazopyridine ligands were found to be selective inhibitors of hTopoIIα, while not showing TopoI inhibition and DNA binding. Interestingly, while the parent imidazopyridines acted as ATP-competitive inhibitors, arylated derivatives inhibited DNA cleavage similar to merbarone, indicating a switch in mode of inhibition from ATP-hydrolysis to the DNA-cleavage stage of catalytic cycle of the enzyme. The 6-aryl-imidazopyridines were relatively more cytotoxic than etoposide in cancer cells and less toxic to normal cells. Such unprecedented strategy will encourage research on “choice-based change” in target-specific mode of action for rapid drug discovery. PMID:25941559
Role of promoter DNA sequence variations on the binding of EGR1 transcription factor.
Mikles, David C; Schuchardt, Brett J; Bhat, Vikas; McDonald, Caleb B; Farooq, Amjad
2014-05-01
In response to a wide variety of stimuli such as growth factors and hormones, EGR1 transcription factor is rapidly induced and immediately exerts downstream effects central to the maintenance of cellular homeostasis. Herein, our biophysical analysis reveals that DNA sequence variations within the target gene promoters tightly modulate the energetics of binding of EGR1 and that nucleotide substitutions at certain positions are much more detrimental to EGR1-DNA interaction than others. Importantly, the reduction in binding affinity poorly correlates with the loss of enthalpy and gain of entropy-a trend indicative of a complex interplay between underlying thermodynamic factors due to the differential role of water solvent upon nucleotide substitution. We also provide a rationale for the physical basis of the effect of nucleotide substitutions on the EGR1-DNA interaction at atomic level. Taken together, our study bears important implications on understanding the molecular determinants of a key protein-DNA interaction at the cross-roads of human health and disease. Copyright © 2014 Elsevier Inc. All rights reserved.
Franz, André; Pirson, Paul A; Pilger, Domenic; Halder, Swagata; Achuthankutty, Divya; Kashkar, Hamid; Ramadan, Kristijan; Hoppe, Thorsten
2016-02-04
The coordinated activity of DNA replication factors is a highly dynamic process that involves ubiquitin-dependent regulation. In this context, the ubiquitin-directed ATPase CDC-48/p97 recently emerged as a key regulator of chromatin-associated degradation in several of the DNA metabolic pathways that assure genome integrity. However, the spatiotemporal control of distinct CDC-48/p97 substrates in the chromatin environment remained unclear. Here, we report that progression of the DNA replication fork is coordinated by UBXN-3/FAF1. UBXN-3/FAF1 binds to the licensing factor CDT-1 and additional ubiquitylated proteins, thus promoting CDC-48/p97-dependent turnover and disassembly of DNA replication factor complexes. Consequently, inactivation of UBXN-3/FAF1 stabilizes CDT-1 and CDC-45/GINS on chromatin, causing severe defects in replication fork dynamics accompanied by pronounced replication stress and eventually resulting in genome instability. Our work identifies a critical substrate selection module of CDC-48/p97 required for chromatin-associated protein degradation in both Caenorhabditis elegans and humans, which is relevant to oncogenesis and aging.
Franz, André; Pirson, Paul A.; Pilger, Domenic; Halder, Swagata; Achuthankutty, Divya; Kashkar, Hamid; Ramadan, Kristijan; Hoppe, Thorsten
2016-01-01
The coordinated activity of DNA replication factors is a highly dynamic process that involves ubiquitin-dependent regulation. In this context, the ubiquitin-directed ATPase CDC-48/p97 recently emerged as a key regulator of chromatin-associated degradation in several of the DNA metabolic pathways that assure genome integrity. However, the spatiotemporal control of distinct CDC-48/p97 substrates in the chromatin environment remained unclear. Here, we report that progression of the DNA replication fork is coordinated by UBXN-3/FAF1. UBXN-3/FAF1 binds to the licensing factor CDT-1 and additional ubiquitylated proteins, thus promoting CDC-48/p97-dependent turnover and disassembly of DNA replication factor complexes. Consequently, inactivation of UBXN-3/FAF1 stabilizes CDT-1 and CDC-45/GINS on chromatin, causing severe defects in replication fork dynamics accompanied by pronounced replication stress and eventually resulting in genome instability. Our work identifies a critical substrate selection module of CDC-48/p97 required for chromatin-associated protein degradation in both Caenorhabditis elegans and humans, which is relevant to oncogenesis and aging. PMID:26842564
Environmental Impact on DNA Methylation in the Germline: State of the Art and Gaps of Knowledge
Pacchierotti, Francesca; Spanò, Marcello
2015-01-01
The epigenome consists of chemical changes in DNA and chromatin that without modifying the DNA sequence modulate gene expression and cellular phenotype. The epigenome is highly plastic and reacts to changing external conditions with modifications that can be inherited to daughter cells and across generations. Whereas this innate plasticity allows for adaptation to a changing environment, it also implies the potential of epigenetic derailment leading to so-called epimutations. DNA methylation is the most studied epigenetic mark. DNA methylation changes have been associated with cancer, infertility, cardiovascular, respiratory, metabolic, immunologic, and neurodegenerative pathologies. Experiments in rodents demonstrate that exposure to a variety of chemical stressors, occurring during the prenatal or the adult life, may induce DNA methylation changes in germ cells, which may be transmitted across generations with phenotypic consequences. An increasing number of human biomonitoring studies show environmentally related DNA methylation changes mainly in blood leukocytes, whereas very few data have been so far collected on possible epigenetic changes induced in the germline, even by the analysis of easily accessible sperm. In this paper, we review the state of the art on factors impinging on DNA methylation in the germline, highlight gaps of knowledge, and propose priorities for future studies. PMID:26339587
BuD, a helix–loop–helix DNA-binding domain for genome modification
Stella, Stefano; Molina, Rafael; López-Méndez, Blanca; Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza; Campos-Olivas, Ramon; Duchateau, Phillippe; Montoya, Guillermo
2014-01-01
DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing. PMID:25004980
Reid, Dylan A; Conlin, Michael P; Yin, Yandong; Chang, Howard H; Watanabe, Go; Lieber, Michael R; Ramsden, Dale A; Rothenberg, Eli
2017-02-28
The nonhomologous end-joining (NHEJ) pathway is the primary repair pathway for DNA double strand breaks (DSBs) in humans. Repair is mediated by a core complex of NHEJ factors that includes a ligase (DNA Ligase IV; L4) that relies on juxtaposition of 3΄ hydroxyl and 5΄ phosphate termini of the strand breaks for catalysis. However, chromosome breaks arising from biological sources often have different end chemistries, and how these different end chemistries impact the way in which the core complex directs the necessary transitions from end pairing to ligation is not known. Here, using single-molecule FRET (smFRET), we show that prior to ligation, differences in end chemistry strongly modulate the bridging of broken ends by the NHEJ core complex. In particular, the 5΄ phosphate group is a recognition element for L4 and is critical for the ability of NHEJ factors to promote stable pairing of ends. Moreover, other chemical incompatibilities, including products of aborted ligation, are sufficient to disrupt end pairing. Based on these observations, we propose a mechanism for iterative repair of DSBs by NHEJ. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Chromatin- and temperature-dependent modulation of radiation-induced double-strand breaks.
Elmroth, K; Nygren, J; Stenerlöw, B; Hultborn, R
2003-10-01
To investigate the influence of chromatin organization and scavenging capacity in relation to irradiation temperature on the induction of double-strand breaks (DSB) in structures derived from human diploid fibroblasts. Agarose plugs with different chromatin structures (intact cells+/-wortmannin, permeabilized cells with condensed chromatin, nucleoids and DNA) were prepared and irradiated with X-rays at 2 or 37 degrees C and lysed using two different lysis protocols (new ice-cold lysis or standard lysis at 37 degrees C). Induction of DSB was determined by constant-field gel electrophoresis. The dose-modifying factor (DMF(temp)) for irradiation at 37 compared with 2 degrees C was 0.92 in intact cells (i.e. more DSB induced at 2 degrees C), but gradually increased to 1.5 in permeabilized cells, 2.2 in nucleoids and 2.6 in naked DNA, suggesting a role of chromatin organization for temperature modulation of DNA damage. In addition, DMF(temp) was influenced by the presence of 0.1 M DMSO or 30 mM glutathione, but not by post-irradiation temperature. The protective effect of low temperature was correlated to the indirect effects of ionizing radiation and was not dependent on post-irradiation temperature. Reasons for a dose modifying factor <1 in intact cells are discussed.
2014-01-01
Background DNA repeats, such as transposable elements, minisatellites and palindromic sequences, are abundant in sequences and have been shown to have significant and functional roles in the evolution of the host genomes. In a previous study, we introduced the concept of a repeat DNA module, a flexible motif present in at least two occurences in the sequences. This concept was embedded into ModuleOrganizer, a tool allowing the detection of repeat modules in a set of sequences. However, its implementation remains difficult for larger sequences. Results Here we present Visual ModuleOrganizer, a Java graphical interface that enables a new and optimized version of the ModuleOrganizer tool. To implement this version, it was recoded in C++ with compressed suffix tree data structures. This leads to less memory usage (at least 120-fold decrease in average) and decreases by at least four the computation time during the module detection process in large sequences. Visual ModuleOrganizer interface allows users to easily choose ModuleOrganizer parameters and to graphically display the results. Moreover, Visual ModuleOrganizer dynamically handles graphical results through four main parameters: gene annotations, overlapping modules with known annotations, location of the module in a minimal number of sequences, and the minimal length of the modules. As a case study, the analysis of FoldBack4 sequences clearly demonstrated that our tools can be extended to comparative and evolutionary analyses of any repeat sequence elements in a set of genomic sequences. With the increasing number of sequences available in public databases, it is now possible to perform comparative analyses of repeated DNA modules in a graphic and friendly manner within a reasonable time period. Availability Visual ModuleOrganizer interface and the new version of the ModuleOrganizer tool are freely available at: http://lcb.cnrs-mrs.fr/spip.php?rubrique313. PMID:24678954
Bagchi, D; Bagchi, M; Stohs, S J
2001-06-01
Chromium (VI) is a widely used industrial chemical, extensively used in paints, metal finishes, steel including stainless steel manufacturing, alloy cast irons, chrome, and wood treatment. On the contrary, chromium (III) salts such as chromium polynicotinate, chromium chloride and chromium picolinate, are used as micronutrients and nutritional supplements, and have been demonstrated to exhibit a significant number of health benefits in rodents and humans. However, the cause for the hexavalent chromium to induce cytotoxicity is not entirely understood. A series of in vitro and in vivo studies have demonstrated that chromium (VI) induces an oxidative stress through enhanced production of reactive oxygen species (ROS) leading to genomic DNA damage and oxidative deterioration of lipids and proteins. A cascade of cellular events occur following chromium (VI)-induced oxidative stress including enhanced production of superoxide anion and hydroxyl radicals, increased lipid peroxidation and genomic DNA fragmentation, modulation of intracellular oxidized states, activation of protein kinase C, apoptotic cell death and altered gene expression. In this paper, we have demonstrated concentration- and time-dependent effects of sodium dichromate (chromium (VI) or Cr (VI)) on enhanced production of superoxide anion and hydroxyl radicals, changes in intracellular oxidized states as determined by laser scanning confocal microscopy, DNA fragmentation and apoptotic cell death (by flow cytometry) in human peripheral blood mononuclear cells. These results were compared with the concentration-dependent effects of chromium (VI) on chronic myelogenous leukemic K562 cells and J774A.1 murine macrophage cells. Chromium (VI)-induced enhanced production of ROS, as well as oxidative tissue and DNA damage were observed in these cells. More pronounced effect was observed on chronic myelogenous leukemic K562 cells and J774A.1 murine macrophage cells. Furthermore, we have assessed the effect of a single oral LD50 dose of chromium (VI) on female C57BL/6Ntac and p53-deficient C57BL/6TSG p53 mice on enhanced production of superoxide anion, lipid peroxidation and DNA fragmentation in the hepatic and brain tissues. Chromium (VI)-induced more pronounced oxidative damage in p53 deficient mice. This in vivo study highlighted that apoptotic regulatory protein p53 may play a major role in chromium (VI)-induced oxidative stress and toxicity. Taken together, oxidative stress and oxidative tissue damage, and a cascade of cellular events including modulation of apoptotic regulatory gene p53 are involved in chromium (VI)-induced toxicity and carcinogenesis.
Novel cholinesterase modulators and their ability to interact with DNA
NASA Astrophysics Data System (ADS)
Janockova, Jana; Gulasova, Zuzana; Musilek, Kamil; Kuca, Kamil; Kozurkova, Maria
2013-11-01
In the present work, an interaction of four cholinesterase modulators (1-4) with calf thymus DNA was studied via spectroscopic techniques (UV-Vis, fluorescent spectroscopy and circular dichroism). From UV-Vis spectroscopic analysis, the binding constants for DNA-pyridinium oximes complexes were calculated (K = 3.5 × 104 to 1.4 × 105 M-1). All these measurements indicated that the compounds behave as effective DNA-interacting agents. Electrophoretic techniques proved that ligand 2 inhibited topoisomerase I at a concentration 5 μM.
Stein, B; Rahmsdorf, H J; Steffen, A; Litfin, M; Herrlich, P
1989-01-01
UV irradiation of human and murine cells enhances the transcription of several genes. Here we report on the primary target of relevant UV absorption, on pathways leading to gene activation, and on the elements receiving the UV-induced signal in the human immunodeficiency virus type 1 (HIV-1) long terminal repeat, in the gene coding for collagenase, and in the cellular oncogene fos. In order to induce the expression of genes. UV radiation needs to be absorbed by DNA and to cause DNA damage of the kind that cannot be repaired by cells from patients with xeroderma pigmentosum group A. UV-induced activation of the three genes is mediated by the major enhancer elements (located between nucleotide positions -105 and -79 of HIV-1, between positions -72 and -65 of the collagenase gene, and between positions -320 and -299 of fos). These elements share no apparent sequence motif and bind different trans-acting proteins; a member of the NF kappa B family binds to the HIV-1 enhancer, the heterodimer of Jun and Fos (AP-1) binds to the collagenase enhancer, and the serum response factors p67 and p62 bind to fos. DNA-binding activities of the factors recognizing the HIV-1 and collagenase enhancers are augmented in extracts from UV-treated cells. The increase in activity is due to posttranslational modification. While AP-1 resides in the nucleus and must be modulated there, NF kappa B is activated in the cytoplasm, indicating the existence of a cytoplasmic signal transduction pathway triggered by UV-induced DNA damage. In addition to activation, new synthesis of AP-1 is induced by UV radiation. Images PMID:2557547
Wang, Haiyan; Cai, Shanbao; Bailey, Barbara J; Reza Saadatzadeh, M; Ding, Jixin; Tonsing-Carter, Eva; Georgiadis, Taxiarchis M; Zachary Gunter, T; Long, Eric C; Minto, Robert E; Gordon, Kevin R; Sen, Stephanie E; Cai, Wenjing; Eitel, Jacob A; Waning, David L; Bringman, Lauren R; Wells, Clark D; Murray, Mary E; Sarkaria, Jann N; Gelbert, Lawrence M; Jones, David R; Cohen-Gadol, Aaron A; Mayo, Lindsey D; Shannon, Harlan E; Pollok, Karen E
2017-02-01
OBJECTIVE Improvement in treatment outcome for patients with glioblastoma multiforme (GBM) requires a multifaceted approach due to dysregulation of numerous signaling pathways. The murine double minute 2 (MDM2) protein may fulfill this requirement because it is involved in the regulation of growth, survival, and invasion. The objective of this study was to investigate the impact of modulating MDM2 function in combination with front-line temozolomide (TMZ) therapy in GBM. METHODS The combination of TMZ with the MDM2 protein-protein interaction inhibitor nutlin3a was evaluated for effects on cell growth, p53 pathway activation, expression of DNA repair proteins, and invasive properties. In vivo efficacy was assessed in xenograft models of human GBM. RESULTS In combination, TMZ/nutlin3a was additive to synergistic in decreasing growth of wild-type p53 GBM cells. Pharmacodynamic studies demonstrated that inhibition of cell growth following exposure to TMZ/nutlin3a correlated with: 1) activation of the p53 pathway, 2) downregulation of DNA repair proteins, 3) persistence of DNA damage, and 4) decreased invasion. Pharmacokinetic studies indicated that nutlin3a was detected in human intracranial tumor xenografts. To assess therapeutic potential, efficacy studies were conducted in a xenograft model of intracranial GBM by using GBM cells derived from a recurrent wild-type p53 GBM that is highly TMZ resistant (GBM10). Three 5-day cycles of TMZ/nutlin3a resulted in a significant increase in the survival of mice with GBM10 intracranial tumors compared with single-agent therapy. CONCLUSIONS Modulation of MDM2/p53-associated signaling pathways is a novel approach for decreasing TMZ resistance in GBM. To the authors' knowledge, this is the first study in a humanized intracranial patient-derived xenograft model to demonstrate the efficacy of combining front-line TMZ therapy and an inhibitor of MDM2 protein-protein interactions.
Macé, K; Aguilar, F; Wang, J S; Vautravers, P; Gómez-Lechón, M; Gonzalez, F J; Groopman, J; Harris, C C; Pfeifer, A M
1997-07-01
Epidemiological evidence has been supporting a relationship between dietary aflatoxin B1 (AFB1) exposure, development of human primary hepatocellular carcinoma (HCC) and mutations in the p53 tumor suppressor gene. However, the correlation between the observed p53 mutations, the AFB1 DNA adducts and their activation pathways has not been elucidated. Development of relevant cellular in vitro models, taking into account species and tissue specificity, could significantly contribute to the knowledge of cytotoxicity and genotoxicity mechanisms of chemical procarcinogens, such as AFB1, in humans. For this purpose a non-tumorigenic SV40-immortalized human liver epithelial cell line (THLE cells) which retained most of the phase II enzymes, but had markedly reduced phase I activities was used for stable expression of the human CYP1A2, CYP2A6, CYP2B6 and CYP3A4 cDNA. The four genetically engineered cell lines (T5-1A2, T5-2A6, T5-2B6 and T5-3A4) produced high levels of the specific CYP450 proteins and showed comparable or higher catalytic activities related to the CYP450 expression when compared to human hepatocytes. The T5-1A2, T5-2A6, T5-2B6 and T5-3A4 cell lines exhibited a very high sensitivity to the cytotoxic effects of AFB1 and were approximately 125-, 2-, 2- and 15-fold, respectively, more sensitive than the control T5-neo cells, transfected with an expressing vector which does not contain CYP450 cDNA. In the CYP450-expressing cells, nanomolar doses of AFB1-induced DNA adduct formation including AFB1-N7-guanine, -pyrimidyl and -diol adducts. In addition, the T5-1A2 cells showed AFM1-DNA adducts. At similar levels of total DNA adducts, both the T5-1A2 and T5-3A4 cells showed, at codon 249 of the p53 gene, AGG to AGT transversions at a relative frequency of 15x10(-6). In contrast, only the T5-3A4 cells showed CCC to ACC transversion at codon 250 at a high frequency, whereas the second most frequent mutations found in the T5-1A2 cells were C to T transitions at the first and second position of the codon 250. No significant AFB1-induced p53 mutations could be detected in the T5-2A6 cells. Therefore, the differential expression of specific CYP450 genes in human hepatocytes can modulate the cytotoxicity, DNA adduct levels and frequency of p53 mutations produced by AFB1.
Baltussen, Tim J H; Coolen, Jordy P M; Zoll, Jan; Verweij, Paul E; Melchers, Willem J G
2018-04-26
Aspergillus fumigatus is a saprophytic fungus that extensively produces conidia. These microscopic asexually reproductive structures are small enough to reach the lungs. Germination of conidia followed by hyphal growth inside human lungs is a key step in the establishment of infection in immunocompromised patients. RNA-Seq was used to analyze the transcriptome of dormant and germinating A. fumigatus conidia. Construction of a gene co-expression network revealed four gene clusters (modules) correlated with a growth phase (dormant, isotropic growth, polarized growth). Transcripts levels of genes encoding for secondary metabolites were high in dormant conidia. During isotropic growth, transcript levels of genes involved in cell wall modifications increased. Two modules encoding for growth and cell cycle/DNA processing were associated with polarized growth. In addition, the co-expression network was used to identify highly connected intermodular hub genes. These genes may have a pivotal role in the respective module and could therefore be compelling therapeutic targets. Generally, cell wall remodeling is an important process during isotropic and polarized growth, characterized by an increase of transcripts coding for hyphal growth and cell cycle/DNA processing when polarized growth is initiated. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Gavrovic-Jankulovic, Marija; Poulsen, Knud; Brckalo, Tamara; Bobic, Sonja; Lindner, Buko; Petersen, Arnd
2008-01-01
Lectins as carbohydrate-binding proteins have been employed in various biological assays for the detection and characterization of glycan structures on glycoproteins, including clinical biomarkers in disease states. A mannose-specific banana lectin (BanLec) is unique in its specificity for internal alpha1,3 linkages as well as beta1,3 linkages at the reducing termini. The immunomodulatory potential of natural BanLec was recognized by a strong immunoglobulin G4 antibody response and T cell mitogen activity in humans. To explore its applicability in glycoproteomics and its modulatory potential, the gene of banana lectin was cloned, sequenced and a recombinant protein was produced in Escherichia coli. The obtained cDNA revealed a novel banana lectin isoform, with an open reading frame of 426 nucleotides, encoding a cytoplasmatic protein of 141 amino acids. The molecular mass of rBanLec determined by ESI FT-MS and N-terminal sequencing confirmed the cDNA at the protein level. The specificity of rBanLec for detection glycan structures was the same as for natural BanLec as examined with five protein extracts rich in glycoprotein content, as well as with horseradish peroxidase glycoprotein. Besides, the immunomodulatory potential of rBanLec and nBanLec were comparable as assessed by an inhibition assay and a human T cell proliferation assay where they induced a strong proliferation response in CD3+, CD4+, and CD8+ populations of human PBMCs. This recombinant BanLec is a useful reagent for glycoproteomics and lectin microarrays, with a potential for modulation of the immune response.
PR-PR: Cross-Platform Laboratory Automation System
DOE Office of Scientific and Technical Information (OSTI.GOV)
Linshiz, G; Stawski, N; Goyal, G
To enable protocol standardization, sharing, and efficient implementation across laboratory automation platforms, we have further developed the PR-PR open-source high-level biology-friendly robot programming language as a cross-platform laboratory automation system. Beyond liquid-handling robotics, PR-PR now supports microfluidic and microscopy platforms, as well as protocol translation into human languages, such as English. While the same set of basic PR-PR commands and features are available for each supported platform, the underlying optimization and translation modules vary from platform to platform. Here, we describe these further developments to PR-PR, and demonstrate the experimental implementation and validation of PR-PR protocols for combinatorial modified Goldenmore » Gate DNA assembly across liquid-handling robotic, microfluidic, and manual platforms. To further test PR-PR cross-platform performance, we then implement and assess PR-PR protocols for Kunkel DNA mutagenesis and hierarchical Gibson DNA assembly for microfluidic and manual platforms.« less
SPOP mutation leads to genomic instability in prostate cancer
Boysen, Gunther; Barbieri, Christopher E; Prandi, Davide; Blattner, Mirjam; Chae, Sung-Suk; Dahija, Arun; Nataraj, Srilakshmi; Huang, Dennis; Marotz, Clarisse; Xu, Limei; Huang, Julie; Lecca, Paola; Chhangawala, Sagar; Liu, Deli; Zhou, Pengbo; Sboner, Andrea; de Bono, Johann S
2015-01-01
Genomic instability is a fundamental feature of human cancer often resulting from impaired genome maintenance. In prostate cancer, structural genomic rearrangements are a common mechanism driving tumorigenesis. However, somatic alterations predisposing to chromosomal rearrangements in prostate cancer remain largely undefined. Here, we show that SPOP, the most commonly mutated gene in primary prostate cancer modulates DNA double strand break (DSB) repair, and that SPOP mutation is associated with genomic instability. In vivo, SPOP mutation results in a transcriptional response consistent with BRCA1 inactivation resulting in impaired homology-directed repair (HDR) of DSB. Furthermore, we found that SPOP mutation sensitizes to DNA damaging therapeutic agents such as PARP inhibitors. These results implicate SPOP as a novel participant in DSB repair, suggest that SPOP mutation drives prostate tumorigenesis in part through genomic instability, and indicate that mutant SPOP may increase response to DNA-damaging therapeutics. DOI: http://dx.doi.org/10.7554/eLife.09207.001 PMID:26374986
PR-PR: cross-platform laboratory automation system.
Linshiz, Gregory; Stawski, Nina; Goyal, Garima; Bi, Changhao; Poust, Sean; Sharma, Monica; Mutalik, Vivek; Keasling, Jay D; Hillson, Nathan J
2014-08-15
To enable protocol standardization, sharing, and efficient implementation across laboratory automation platforms, we have further developed the PR-PR open-source high-level biology-friendly robot programming language as a cross-platform laboratory automation system. Beyond liquid-handling robotics, PR-PR now supports microfluidic and microscopy platforms, as well as protocol translation into human languages, such as English. While the same set of basic PR-PR commands and features are available for each supported platform, the underlying optimization and translation modules vary from platform to platform. Here, we describe these further developments to PR-PR, and demonstrate the experimental implementation and validation of PR-PR protocols for combinatorial modified Golden Gate DNA assembly across liquid-handling robotic, microfluidic, and manual platforms. To further test PR-PR cross-platform performance, we then implement and assess PR-PR protocols for Kunkel DNA mutagenesis and hierarchical Gibson DNA assembly for microfluidic and manual platforms.
Grabocka, Elda; Pylayeva-Gupta, Yuliya; Jones, Mathew JK; Lubkov, Veronica; Yemanaberhan, Eyoel; Taylor, Laura; Jeng, Hao Hsuan; Bar-Sagi, Dafna
2014-01-01
SUMMARY Mutations in KRAS are prevalent in human cancers and universally predictive of resistance to anti-cancer therapeutics. Although it is widely accepted that acquisition of an activating mutation endows RAS genes with functional autonomy, recent studies suggest that the wild-type forms of Ras may contribute to mutant Ras-driven tumorigenesis. Here we show that downregulation of wild-type H-Ras or N-Ras in mutant K-Ras cancer cells leads to hyperactivation of the Erk/p90RSK and PI3K/Akt pathways, and consequently, the phosphorylation of Chk1 at an inhibitory site, Ser 280. The resulting inhibition of ATR/Chk1 signaling abrogates the activation of the G2 DNA damage checkpoint and confers specific sensitization of mutant K-Ras cancer cells to DNA damage chemotherapeutic agents in vitro and in vivo. PMID:24525237
Pan, Min-Hsiung; Hsieh, Min-Chi; Kuo, Jen-Min; Lai, Ching-Shu; Wu, Hou; Sang, Shengmin; Ho, Chi-Tang
2008-05-01
Ginger, the rhizome of Zingiber officinale, is a traditional medicine with anti-inflammatory and anticarcinogenic properties. This study examined the growth inhibitory effects of the structurally related compounds 6-gingerol and 6-shogaol on human cancer cells. 6-Shogaol [1-(4-hydroxy-3-methoxyphenyl)-4-decen-3-one] inhibits the growth of human cancer cells and induces apoptosis in COLO 205 cells through modulation of mitochondrial functions regulated by reactive oxygen species (ROS). ROS generation occurs in the early stages of 6-shogaol-induced apoptosis, preceding cytochrome c release, caspase activation, and DNA fragmentation. Up-regulation of Bax, Fas, and FasL, as well as down-regulation of Bcl-2 and Bcl-X(L )were observed in 6-shogaol-treated COLO 205 cells. N-acetylcysteine (NAC), but not by other antioxidants, suppress 6-shogaol-induced apoptosis. The growth arrest and DNA damage (GADD)-inducible transcription factor 153 (GADD153) mRNA and protein is markedly induced in a time- and concentration-dependent manner in response to 6-shogaol.
Monitoring regulation of DNA repair activities of cultured cells in-gel using the comet assay
Nickson, Catherine M.; Parsons, Jason L.
2014-01-01
Base excision repair (BER) is the predominant cellular mechanism by which human cells repair DNA base damage, sites of base loss, and DNA single strand breaks of various complexity, that are generated in their thousands in every human cell per day as a consequence of cellular metabolism and exogenous agents, including ionizing radiation. Over the last three decades the comet assay has been employed in scientific research to examine the cellular response to these types of DNA damage in cultured cells, therefore revealing the efficiency and capacity of BER. We have recently pioneered new research demonstrating an important role for post-translational modifications (particularly ubiquitylation) in the regulation of cellular levels of BER proteins, and that subtle changes (∼20–50%) in protein levels following siRNA knockdown of E3 ubiquitin ligases or deubiquitylation enzymes can manifest in significant changes in DNA repair capacity monitored using the comet assay. For example, we have shown that the E3 ubiquitin ligase Mule, the tumor suppressor protein ARF, and the deubiquitylation enzyme USP47 modulate DNA repair by controlling cellular levels of DNA polymerase β, and also that polynucleotide kinase phosphatase levels are controlled by ATM-dependant phosphorylation and Cul4A–DDB1–STRAP-dependent ubiquitylation. In these studies we employed a modification of the comet assay whereby cultured cells, following DNA damage treatment, are embedded in agarose and allowed to repair in-gel prior to lysis and electrophoresis. Whilst this method does have its limitations, it avoids the extensive cell culture-based processing associated with the traditional approach using attached cells and also allows for the examination of much more precise DNA repair kinetics. In this review we will describe, using this modified comet assay, our accumulating evidence that ubiquitylation-dependant regulation of BER proteins has important consequences for overall cellular DNA repair capacity. PMID:25076968
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vaid, Mudit; Prasad, Ram; Singh, Tripti
Grape seed proanthocyanidins (GSPs) have been shown to have anti-skin carcinogenic effects in in vitro and in vivo models. However, the precise epigenetic molecular mechanisms remain unexplored. This study was designed to investigate whether GSPs reactivate silenced tumor suppressor genes following epigenetic modifications in skin cancer cells. For this purpose, A431 and SCC13 human squamous cell carcinoma cell lines were used as in vitro models. The effects of GSPs on DNA methylation, histone modifications and tumor suppressor gene expressions were studied in these cell lines using enzyme activity assays, western blotting, dot-blot analysis and real-time polymerase chain reaction (RT-PCR). Wemore » found that treatment of A431 and SCC13 cells with GSPs decreased the levels of: (i) global DNA methylation, (ii) 5-methylcytosine, (iii) DNA methyltransferase (DNMT) activity and (iv) messenger RNA (mRNA) and protein levels of DNMT1, DNMT3a and DNMT3b in these cells. Similar effects were noted when these cancer cells were treated identically with 5-aza-2′-deoxycytidine, an inhibitor of DNA methylation. GSPs decreased histone deacetylase activity, increased levels of acetylated lysines 9 and 14 on histone H3 (H3-Lys 9 and 14) and acetylated lysines 5, 12 and 16 on histone H4, and reduced the levels of methylated H3-Lys 9. Further, GSP treatment resulted in re-expression of the mRNA and proteins of silenced tumor suppressor genes, RASSF1A, p16{sup INK4a} and Cip1/p21. Together, this study provides a new insight into the epigenetic mechanisms of GSPs and may have significant implications for epigenetic therapy in the treatment/prevention of skin cancers in humans. -- Highlights: ►Epigenetic modulations have been shown to have a role in cancer risk. ►Proanthocyanidins decrease the levels of DNA methylation and histone deacetylation. ►Proanthocyanidins inhibit histone deacetylase activity in skin cancer cells. ►Proanthocyanidins reactivate tumor suppressor genes in skin cancer cells. ►Grape seed proanthocyanidins can prevent skin cancer through epigenetic modulation.« less
Low power lasers on genomic stability.
Trajano, Larissa Alexsandra da Silva Neto; Sergio, Luiz Philippe da Silva; Stumbo, Ana Carolina; Mencalha, Andre Luiz; Fonseca, Adenilson de Souza da
2018-03-01
Exposure of cells to genotoxic agents causes modifications in DNA, resulting to alterations in the genome. To reduce genomic instability, cells have DNA damage responses in which DNA repair proteins remove these lesions. Excessive free radicals cause DNA damages, repaired by base excision repair and nucleotide excision repair pathways. When non-oxidative lesions occur, genomic stability is maintained through checkpoints in which the cell cycle stops and DNA repair occurs. Telomere shortening is related to the development of various diseases, such as cancer. Low power lasers are used for treatment of a number of diseases, but they are also suggested to cause DNA damages at sub-lethal levels and alter transcript levels from DNA repair genes. This review focuses on genomic and telomere stabilization modulation as possible targets to improve therapeutic protocols based on low power lasers. Several studies have been carried out to evaluate the laser-induced effects on genome and telomere stabilization suggesting that exposure to these lasers modulates DNA repair mechanisms, telomere maintenance and genomic stabilization. Although the mechanisms are not well understood yet, low power lasers could be effective against DNA harmful agents by induction of DNA repair mechanisms and modulation of telomere maintenance and genomic stability. Copyright © 2018 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Amin, Md Ruhul; Ghannad, Leda; Othman, Ahmad
2009-05-08
Serotonin (5-HT) decreases NHE2 and NHE3 activities under acute conditions in human intestinal epithelial cells. Here, we have investigated the effects of 5-HT on expression of the human NHE3 gene and the mechanisms underlying its transcriptional regulation in differentiated C2BBe1 cells. Treatment of the human intestinal epithelial cell line, C2BBe1, with 5-HT (20 {mu}M) resulted in a significant decrease in NHE3 mRNA and protein expression. In transient transfection studies, 5-HT repressed the NHE3 promoter activity by {approx}55%. The repression of the NHE3 promoter activity in response to 5-HT was accompanied by reduced DNA-binding activity of transcription factors Sp1 and Sp3more » to the NHE3 promoter without alteration in their nuclear levels. Pharmacological inhibitors of protein kinase C reversed the inhibitory effect of 5-HT on the promoter activity. Our data indicate that 5-HT suppresses the transcriptional activity of the NHE3 promoter and this effect may be mediated by PKC{alpha} and modulation of DNA-binding affinities of Sp1 and Sp3.« less
Proteolytic dissection of Zab, the Z-DNA-binding domain of human ADAR1
NASA Technical Reports Server (NTRS)
Schwartz, T.; Lowenhaupt, K.; Kim, Y. G.; Li, L.; Brown, B. A. 2nd; Herbert, A.; Rich, A.
1999-01-01
Zalpha is a peptide motif that binds to Z-DNA with high affinity. This motif binds to alternating dC-dG sequences stabilized in the Z-conformation by means of bromination or supercoiling, but not to B-DNA. Zalpha is part of the N-terminal region of double-stranded RNA adenosine deaminase (ADAR1), a candidate enzyme for nuclear pre-mRNA editing in mammals. Zalpha is conserved in ADAR1 from many species; in each case, there is a second similar motif, Zbeta, separated from Zalpha by a more divergent linker. To investigate the structure-function relationship of Zalpha, its domain structure was studied by limited proteolysis. Proteolytic profiles indicated that Zalpha is part of a domain, Zab, of 229 amino acids (residues 133-361 in human ADAR1). This domain contains both Zalpha and Zbeta as well as a tandem repeat of a 49-amino acid linker module. Prolonged proteolysis revealed a minimal core domain of 77 amino acids (positions 133-209), containing only Zalpha, which is sufficient to bind left-handed Z-DNA; however, the substrate binding is strikingly different from that of Zab. The second motif, Zbeta, retains its structural integrity only in the context of Zab and does not bind Z-DNA as a separate entity. These results suggest that Zalpha and Zbeta act as a single bipartite domain. In the presence of substrate DNA, Zab becomes more resistant to proteases, suggesting that it adopts a more rigid structure when bound to its substrate, possibly with conformational changes in parts of the protein.
Balmus, Gabriel; Zhu, Min; Mukherjee, Sucheta; Lyndaker, Amy M.; Hume, Kelly R.; Lee, Jaesung; Riccio, Mark L.; Reeves, Anthony P.; Sutter, Nathan B.; Noden, Drew M.; Peters, Rachel M.; Weiss, Robert S.
2012-01-01
The human genomic instability syndrome ataxia telangiectasia (A-T), caused by mutations in the gene encoding the DNA damage checkpoint kinase ATM, is characterized by multisystem defects including neurodegeneration, immunodeficiency and increased cancer predisposition. ATM is central to a pathway that responds to double-strand DNA breaks, whereas the related kinase ATR leads a parallel signaling cascade that is activated by replication stress. To dissect the physiological relationship between the ATM and ATR pathways, we generated mice defective for both. Because complete ATR pathway inactivation causes embryonic lethality, we weakened the ATR mechanism to different degrees by impairing HUS1, a member of the 911 complex that is required for efficient ATR signaling. Notably, simultaneous ATM and HUS1 defects caused synthetic lethality. Atm/Hus1 double-mutant embryos showed widespread apoptosis and died mid-gestationally. Despite the underlying DNA damage checkpoint defects, increased DNA damage signaling was observed, as evidenced by H2AX phosphorylation and p53 accumulation. A less severe Hus1 defect together with Atm loss resulted in partial embryonic lethality, with the surviving double-mutant mice showing synergistic increases in genomic instability and specific developmental defects, including dwarfism, craniofacial abnormalities and brachymesophalangy, phenotypes that are observed in several human genomic instability disorders. In addition to identifying tissue-specific consequences of checkpoint dysfunction, these data highlight a robust, cooperative configuration for the mammalian DNA damage response network and further suggest HUS1 and related genes in the ATR pathway as candidate modifiers of disease severity in A-T patients. PMID:22575700
Cho, Eun-Ah; Juhnn, Yong-Sung
2012-06-01
Cyclic AMP is involved in the regulation of metabolism, gene expression, cellular growth and proliferation. Recently, the cAMP signaling system was found to modulate DNA-damaging agent-induced apoptosis by regulating the expression of Bcl-2 family proteins and inhibitors of apoptosis. Thus, we hypothesized that the cAMP signaling may modulate DNA repair activity, and we investigated the effects of the cAMP signaling system on γ-ray-induced DNA damage repair in lung cancer cells. Transient expression of a constitutively active mutant of stimulatory G protein (GαsQL) or treatment with forskolin, an adenylyl cyclase activator, augmented radiation-induced DNA damage and inhibited repair of the damage in H1299 lung cancer cells. Expression of GαsQL or treatment with forskolin or isoproterenol inhibited the radiation-induced expression of the XRCC1 protein, and exogenous expression of XRCC1 abolished the DNA repair-inhibiting effect of forskolin. Forskolin treatment promoted the ubiquitin and proteasome-dependent degradation of the XRCC1 protein, resulting in a significant decrease in the half-life of the protein after γ-ray irradiation. The effect of forskolin on XRCC1 expression was not inhibited by PKA inhibitor, but 8-pCPT-2'-O-Me-cAMP, an Epac-selective cAMP analog, increased ubiquitination of XRCC1 protein and decreased XRCC1 expression. Knockdown of Epac1 abolished the effect of 8-pCPT-2'-O-Me-cAMP and restored XRCC1 protein level following γ-ray irradiation. From these results, we conclude that the cAMP signaling system inhibits the repair of γ-ray-induced DNA damage by promoting the ubiquitin-proteasome dependent degradation of XRCC1 in an Epac-dependent pathway in lung cancer cells. Copyright © 2012 Elsevier Inc. All rights reserved.
Wu, Wei; Wang, KaiJun; Ni, Shuang; Ye, PanPan; Yu, YiBo; Ye, Juan; Sun, LiXia
2008-01-01
Purpose The goal of this study was to investigate whether superposing of electromagnetic noise could block or attenuate DNA damage and intracellular reactive oxygen species (ROS) increase of cultured human lens epithelial cells (HLECs) induced by acute exposure to 1.8 GHz radiofrequency field (RF) of the Global System for Mobile Communications (GSM). Methods An sXc-1800 RF exposure system was used to produce a GSM signal at 1.8 GHz (217 Hz amplitude-modulated) with the specific absorption rate (SAR) of 1, 2, 3, and 4 W/kg. After 2 h of intermittent exposure, the ROS level was assessed by the fluorescent probe, 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA). DNA damage to HLECs was examined by alkaline comet assay and the phosphorylated form of histone variant H2AX (γH2AX) foci formation assay. Results After exposure to 1.8 GHz RF for 2 h, HLECs exhibited significant intracellular ROS increase in the 2, 3, and 4 W/kg groups. RF radiation at the SAR of 3 W/kg and 4 W/kg could induce significant DNA damage, examined by alkaline comet assay, which was used to detect mainly single strand breaks (SSBs), while no statistical difference in double strand breaks (DSBs), evaluated by γH2AX foci, was found between RF exposure (SAR: 3 and 4 W/kg) and sham exposure groups. When RF was superposed with 2 μT electromagnetic noise could block RF-induced ROS increase and DNA damage. Conclusions DNA damage induced by 1.8 GHz radiofrequency field for 2 h, which was mainly SSBs, may be associated with the increased ROS production. Electromagnetic noise could block RF-induced ROS formation and DNA damage. PMID:18509546
Yao, Ke; Wu, Wei; Wang, KaiJun; Ni, Shuang; Ye, PanPan; Yu, YiBo; Ye, Juan; Sun, LiXia
2008-05-19
The goal of this study was to investigate whether superposing of electromagnetic noise could block or attenuate DNA damage and intracellular reactive oxygen species (ROS) increase of cultured human lens epithelial cells (HLECs) induced by acute exposure to 1.8 GHz radiofrequency field (RF) of the Global System for Mobile Communications (GSM). An sXc-1800 RF exposure system was used to produce a GSM signal at 1.8 GHz (217 Hz amplitude-modulated) with the specific absorption rate (SAR) of 1, 2, 3, and 4 W/kg. After 2 h of intermittent exposure, the ROS level was assessed by the fluorescent probe, 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA). DNA damage to HLECs was examined by alkaline comet assay and the phosphorylated form of histone variant H2AX (gammaH2AX) foci formation assay. After exposure to 1.8 GHz RF for 2 h, HLECs exhibited significant intracellular ROS increase in the 2, 3, and 4 W/kg groups. RF radiation at the SAR of 3 W/kg and 4 W/kg could induce significant DNA damage, examined by alkaline comet assay, which was used to detect mainly single strand breaks (SSBs), while no statistical difference in double strand breaks (DSBs), evaluated by gammaH2AX foci, was found between RF exposure (SAR: 3 and 4 W/kg) and sham exposure groups. When RF was superposed with 2 muT electromagnetic noise could block RF-induced ROS increase and DNA damage. DNA damage induced by 1.8 GHz radiofrequency field for 2 h, which was mainly SSBs, may be associated with the increased ROS production. Electromagnetic noise could block RF-induced ROS formation and DNA damage.
Rein, Katrin; Yanez, Diana A.; Terré, Berta; Palenzuela, Lluís; Aivio, Suvi; Wei, Kaichun; Edelmann, Winfried; Stark, Jeremy M.; Stracker, Travis H.
2015-01-01
The maintenance of genome stability is critical for the suppression of diverse human pathologies that include developmental disorders, premature aging, infertility and predisposition to cancer. The DNA damage response (DDR) orchestrates the appropriate cellular responses following the detection of lesions to prevent genomic instability. The MRE11 complex is a sensor of DNA double strand breaks (DSBs) and plays key roles in multiple aspects of the DDR, including DNA end resection that is critical for signaling and DNA repair. The MRE11 complex has been shown to function both upstream and in concert with the 5′-3′ exonuclease EXO1 in DNA resection, but it remains unclear to what extent EXO1 influences DSB responses independently of the MRE11 complex. Here we examine the genetic relationship of the MRE11 complex and EXO1 during mammalian development and in response to DNA damage. Deletion of Exo1 in mice expressing a hypomorphic allele of Nbs1 leads to severe developmental impairment, embryonic death and chromosomal instability. While EXO1 plays a minimal role in normal cells, its loss strongly influences DNA replication, DNA repair, checkpoint signaling and damage sensitivity in NBS1 hypomorphic cells. Collectively, our results establish a key role for EXO1 in modulating the severity of hypomorphic MRE11 complex mutations. PMID:26160886
Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A
2015-01-01
A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; http://ttsmi.bii.a-star.edu.sg) database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Human cytomegalovirus UL76 induces chromosome aberrations
2009-01-01
Background Human cytomegalovirus (HCMV) is known to induce chromosome aberrations in infected cells, which can lead to congenital abnormalities in infected fetuses. HCMV UL76 belongs to a conserved protein family from herpesviruses. Some reported roles among UL76 family members include involvement in virulence determination, lytic replication, reactivation of latent virus, modulation of gene expression, induction of apoptosis, and perturbation of cell cycle progression, as well as potential nuclease activity. Previously, we have shown that stable expression of UL76 inhibits HCMV replication in glioblastoma cells. Methods To examine chromosomal integrity and the DNA damage signal γ-H2AX in cells constitutively expressing UL76, immunofluorescent cell staining and Western blotting were performed. The comet assay was employed to assess DNA breaks in cells transiently expressing UL76. Results We report that stably transfected cells expressing UL76 developed chromosome aberrations including micronuclei and misaligned chromosomes, lagging and bridging. In mitotic cells expressing UL76, aberrant spindles were increased compared to control cells. However, cells with supernumerary centrosomes were marginally increased in UL76-expressing cells relative to control cells. We further demonstrated that UL76-expressing cells activated the DNA damage signal γ-H2AX and caused foci formation in nuclei. In addition, the number of cells with DNA breaks increased in proportion to UL76 protein levels. Conclusion Our findings suggest that the virus-associated protein UL76 induces DNA damage and the accumulation of chromosome aberrations. PMID:19930723
Rivière, Guillaume; Lienhard, Daniel; Andrieu, Thomas; Vieau, Didier; Frey, Brigitte M; Frey, Felix J
2011-04-01
Somatic angiotensin-converting enzyme (sACE) is crucial in cardiovascular homeostasis and displays a tissue-specific profile. Epigenetic patterns modulate genes expression and their alterations were implied in pathologies including hypertension. However, the influence of DNA methylation and chromatin condensation state on the expression of sACE is unknown. We examined whether such epigenetic mechanisms could participate in the control of sACE expression in vitro and in vivo. We identified two CpG islands in the human ace-1 gene 3 kb proximal promoter region. Their methylation abolished the luciferase activity of ace-1 promoter/reporter constructs transfected into human liver (HepG2), colon (HT29), microvascular endothelial (HMEC-1) and lung (SUT) cell lines (p < 0.001). Bisulphite sequencing revealed a cell-type specific basal methylation pattern of the ace-1 gene -1,466/+25 region. As assessed by RT-qPCR, inhibition of DNA methylation by 5-aza-2'-deoxycytidine and/or of histone deacetylation by trichostatin A highly stimulated sACE mRNA expression cell-type specifically (p < 0.001 vs. vehicle treated cells). In the rat, in vivo 5-aza-cytidine injections demethylated the ace-1 promoter and increased sACE mRNA expression in the lungs and liver (p = 0.05), but not in the kidney. In conclusion, the expression level of somatic ACE is modulated by CpG-methylation and histone deacetylases inhibition. The basal methylation pattern of the promoter of the ace-1 gene is cell-type specific and correlates to sACE transcription. DNMT inhibition is associated with altered methylation of the ace-1 promoter and a cell-type and tissue-specific increase of sACE mRNA levels. This study indicates a strong influence of epigenetic mechanisms on sACE expression.
Gieß, Mario; Witte, Anna; Jasper, Julia; Koch, Oliver; Summerer, Daniel
2018-05-09
5-Methylcytosine (5mC) and its oxidized derivatives are regulatory elements of mammalian genomes involved in development and disease. These nucleobases do not selectively modulate Watson-Crick pairing, preventing their programmable targeting and analysis by traditional hybridization probes. Transcription-activator-like effectors (TALEs) can be engineered for use as programmable probes with epigenetic nucleobase selectivity. However, only partial selectivities for oxidized 5mC have been achieved so far, preventing unambiguous target binding. We overcome this limitation by destroying and re-inducing nucleobase selectivity in TALEs via protein engineering and chemoselective nucleobase blocking. We engineer cavities in TALE repeats and identify a cavity that accommodates all eight human DNA nucleobases. We then introduce substituents with varying size, flexibility, and branching degree at each oxidized 5mC. Depending on the nucleobase, substituents with distinct properties effectively block TALE-binding and induce full nucleobase selectivity in the universal repeat. Successful transfer to affinity enrichment in a human genome background indicates that this approach enables the fully selective detection of each oxidized 5mC in complex DNA by programmable probes.
Exploring protein structure and dynamics through a project-oriented biochemistry laboratory module.
Lipchock, James M; Ginther, Patrick S; Douglas, Bonnie B; Bird, Kelly E; Patrick Loria, J
2017-09-01
Here, we present a 10-week project-oriented laboratory module designed to provide a course-based undergraduate research experience in biochemistry that emphasizes the importance of biomolecular structure and dynamics in enzyme function. This module explores the impact of mutagenesis on an important active site loop for a biomedically-relevant human enzyme, protein tyrosine phosphatase 1B (PTP1B). Over the course of the semester students guide their own mutant of PTP1B from conception to characterization in a cost-effective manner and gain exposure to fundamental techniques in biochemistry, including site-directed DNA mutagenesis, bacterial recombinant protein expression, affinity column purification, protein quantitation, SDS-PAGE, and enzyme kinetics. This project-based approach allows an instructor to simulate a research setting and prepare students for productive research beyond the classroom. Potential modifications to expand or contract this module are also provided. © 2017 by The International Union of Biochemistry and Molecular Biology, 45(5):403-410, 2017. © 2017 The International Union of Biochemistry and Molecular Biology.
H3K4me1 marks DNA regions hypomethylated during aging in human stem and differentiated cells.
Fernández, Agustín F; Bayón, Gustavo F; Urdinguio, Rocío G; Toraño, Estela G; García, María G; Carella, Antonella; Petrus-Reurer, Sandra; Ferrero, Cecilia; Martinez-Camblor, Pablo; Cubillo, Isabel; García-Castro, Javier; Delgado-Calle, Jesús; Pérez-Campo, Flor M; Riancho, José A; Bueno, Clara; Menéndez, Pablo; Mentink, Anouk; Mareschi, Katia; Claire, Fabian; Fagnani, Corrado; Medda, Emanuela; Toccaceli, Virgilia; Brescianini, Sonia; Moran, Sebastián; Esteller, Manel; Stolzing, Alexandra; de Boer, Jan; Nisticò, Lorenza; Stazi, Maria A; Fraga, Mario F
2015-01-01
In differentiated cells, aging is associated with hypermethylation of DNA regions enriched in repressive histone post-translational modifications. However, the chromatin marks associated with changes in DNA methylation in adult stem cells during lifetime are still largely unknown. Here, DNA methylation profiling of mesenchymal stem cells (MSCs) obtained from individuals aged 2 to 92 yr identified 18,735 hypermethylated and 45,407 hypomethylated CpG sites associated with aging. As in differentiated cells, hypermethylated sequences were enriched in chromatin repressive marks. Most importantly, hypomethylated CpG sites were strongly enriched in the active chromatin mark H3K4me1 in stem and differentiated cells, suggesting this is a cell type-independent chromatin signature of DNA hypomethylation during aging. Analysis of scedasticity showed that interindividual variability of DNA methylation increased during aging in MSCs and differentiated cells, providing a new avenue for the identification of DNA methylation changes over time. DNA methylation profiling of genetically identical individuals showed that both the tendency of DNA methylation changes and scedasticity depended on nongenetic as well as genetic factors. Our results indicate that the dynamics of DNA methylation during aging depend on a complex mixture of factors that include the DNA sequence, cell type, and chromatin context involved and that, depending on the locus, the changes can be modulated by genetic and/or external factors. © 2015 Fernández et al.; Published by Cold Spring Harbor Laboratory Press.
NDR1 modulates the UV-induced DNA-damage checkpoint and nucleotide excision repair
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Jeong-Min; Choi, Ji Ye; Yi, Joo Mi
2015-06-05
Nucleotide excision repair (NER) is the sole mechanism of UV-induced DNA lesion repair in mammals. A single round of NER requires multiple components including seven core NER factors, xeroderma pigmentosum A–G (XPA–XPG), and many auxiliary effector proteins including ATR serine/threonine kinase. The XPA protein helps to verify DNA damage and thus plays a rate-limiting role in NER. Hence, the regulation of XPA is important for the entire NER kinetic. We found that NDR1, a novel XPA-interacting protein, modulates NER by modulating the UV-induced DNA-damage checkpoint. In quiescent cells, NDR1 localized mainly in the cytoplasm. After UV irradiation, NDR1 accumulated inmore » the nucleus. The siRNA knockdown of NDR1 delayed the repair of UV-induced cyclobutane pyrimidine dimers in both normal cells and cancer cells. It did not, however, alter the expression levels or the chromatin association levels of the core NER factors following UV irradiation. Instead, the NDR1-depleted cells displayed reduced activity of ATR for some set of its substrates including CHK1 and p53, suggesting that NDR1 modulates NER indirectly via the ATR pathway. - Highlights: • NDR1 is a novel XPA-interacting protein. • NDR1 accumulates in the nucleus in response to UV irradiation. • NDR1 modulates NER (nucleotide excision repair) by modulating the UV-induced DNA-damage checkpoint response.« less
Gapeyev, A B; Lukyanova, N A
2015-01-01
Using a comet assay technique, we investigated protective effects of. extremely high frequency electromagnetic radiation in combination with the damaging effect of X-ray irradiation, the effect of damaging agents hydrogen peroxide and methyl methanesulfonate on DNA in mouse whole blood leukocytes. It was shown that the preliminary exposure of the cells to low intensity pulse-modulated electromagnetic radiation (42.2 GHz, 0.1 mW/cm2, 20-min exposure, modulation frequencies of 1 and 16 Hz) caused protective effects decreasing the DNA damage by 20-45%. The efficacy of pulse-modulated electromagnetic radiation depended on the type of genotoxic agent and increased in a row methyl methanesulfonate--X-rays--hydrogen peroxide. Continuous electromagnetic radiation was ineffective. The mechanisms of protective effects may be connected with an induction of the adaptive response by nanomolar concentrations of reactive oxygen species formed by pulse-modulated electromagnetic radiation.
Formation and processing of DNA damage substrates for the hNEIL enzymes.
Fleming, Aaron M; Burrows, Cynthia J
2017-06-01
Reactive oxygen species (ROS) are harnessed by the cell for signaling at the same time as being detrimental to cellular components such as DNA. The genome and transcriptome contain instructions that can alter cellular processes when oxidized. The guanine (G) heterocycle in the nucleotide pool, DNA, or RNA is the base most prone to oxidation. The oxidatively-derived products of G consistently observed in high yields from hydroxyl radical, carbonate radical, or singlet oxygen oxidations under conditions modeling the cellular reducing environment are discussed. The major G base oxidation products are 8-oxo-7,8-dihydroguanine (OG), 5-carboxamido-5-formamido-2-iminohydantoin (2Ih), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). The yields of these products show dependency on the oxidant and the reaction context that includes nucleoside, single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), and G-quadruplex DNA (G4-DNA) structures. Upon formation of these products in cells, they are recognized by the DNA glycosylases in the base excision repair (BER) pathway. This review focuses on initiation of BER by the mammalian Nei-like1-3 (NEIL1-3) glycosylases for removal of 2Ih, Sp, and Gh. The unique ability of the human NEILs to initiate removal of the hydantoins in ssDNA, bulge-DNA, bubble-DNA, dsDNA, and G4-DNA is outlined. Additionally, when Gh exists in a G4 DNA found in a gene promoter, NEIL-mediated repair is modulated by the plasticity of the G4-DNA structure provided by additional G-runs flanking the sequence. On the basis of these observations and cellular studies from the literature, the interplay between DNA oxidation and BER to alter gene expression is discussed. Copyright © 2017 Elsevier Inc. All rights reserved.
Bedini, Andrea; Baiula, Monica; Spampinato, Santi
2008-06-01
The human mu-opioid receptor gene (OPRM1) promoter contains a DNA sequence binding the repressor element 1 silencing transcription factor (REST) that is implicated in transcriptional repression. We investigated whether insulin-like growth factor I (IGF-I), which affects various aspects of neuronal induction and maturation, regulates OPRM1 transcription in neuronal cells in the context of the potential influence of REST. A series of OPRM1-luciferase promoter/reporter constructs were transfected into two neuronal cell models, neuroblastoma-derived SH-SY5Y cells and PC12 cells. In the former, endogenous levels of human mu-opioid receptor (hMOPr) mRNA were evaluated by real-time PCR. IGF-I up-regulated OPRM1 transcription in: PC12 cells lacking REST, in SH-SY5Y cells transfected with constructs deficient in the REST DNA binding element, or when REST was down-regulated in retinoic acid-differentiated cells. IGF-I activates the signal transducer and activator of transcription-3 signaling pathway and this transcription factor, binding to the signal transducer and activator of transcription-1/3 DNA element located in the promoter, increases OPRM1 transcription. We propose that a reduction in REST is a critical switch enabling IGF-I to up-regulate hMOPr. These findings help clarify how hMOPr expression is regulated in neuronal cells.
Shrestha, Bimmi; Ng, Terry; Chu, Hsien-Jue; Noll, Michelle; Diamond, Michael S
2008-04-07
West Nile virus (WNV) is a mosquito borne, neurotropic flavivirus that causes a severe central nervous system (CNS) infection in humans and animals. Although commercial vaccines are available for horses, none is currently approved for human use. In this study, we evaluated the efficacy and mechanism of immune protection of two candidate WNV vaccines in mice. A formalin-inactivated WNV vaccine induced higher levels of specific and neutralizing antibodies compared to a DNA plasmid vaccine that produces virus-like particles. Accordingly, partial and almost complete protection against a highly stringent lethal intracranial WNV challenge were observed in mice 60 days after single dose immunization with the DNA plasmid and inactivated virus vaccines, respectively. In mice immunized with a single dose of DNA plasmid or inactivated vaccine, antigen-specific CD8(+) T cells were induced and contributed to protective immunity as acquired or genetic deficiencies of CD8(+) T cells lowered the survival rates. In contrast, in boosted animals, WNV-specific antibody titers were higher, survival rates after challenge were greater, and an absence of CD8(+) T cells did not appreciably affect mortality. Overall, our experiments suggest that in mice, both inactivated WNV and DNA plasmid vaccines are protective after two doses, and the specific contribution of antibody and CD8(+) T cells to vaccine immunity against WNV is modulated by the prime-boost strategy.
Jayakumar, Asha; Castilho, Tiago M; Park, Esther; Goldsmith-Pestana, Karen; Blackwell, Jenefer M; McMahon-Pratt, Diane
2011-06-01
Leishmania (Viannia) parasites present particular challenges, as human and murine immune responses to infection are distinct from other Leishmania species, indicating a unique interaction with the host. Further, vaccination studies utilizing small animal models indicate that modalities and antigens that prevent infection by other Leishmania species are generally not protective. Using a newly developed mouse model of chronic L. (Viannia) panamensis infection and the heterologous DNA prime - modified vaccinia virus Ankara (MVA) boost vaccination modality, we examined whether the conserved vaccine candidate antigen tryparedoxin peroxidase (TRYP) could provide protection against infection/disease. Heterologous prime - boost (DNA/MVA) vaccination utilizing TRYP antigen can provide protection against disease caused by L. (V.) panamensis. However, protection is dependent on modulating the innate immune response using the TLR1/2 agonist Pam3CSK4 during DNA priming. Prime-boost vaccination using DNA alone fails to protect. Prior to infection protectively vaccinated mice exhibit augmented CD4 and CD8 IFNγ and memory responses as well as decreased IL-10 and IL-13 responses. IL-13 and IL-10 have been shown to be independently critical for disease in this model. CD8 T cells have an essential role in mediating host defense, as CD8 depletion reversed protection in the vaccinated mice; vaccinated mice depleted of CD4 T cells remained protected. Hence, vaccine-induced protection is dependent upon TLR1/2 activation instructing the generation of antigen specific CD8 cells and restricting IL-13 and IL-10 responses. Given the general effectiveness of prime-boost vaccination, the recalcitrance of Leishmania (Viannia) to vaccine approaches effective against other species of Leishmania is again evident. However, prime-boost vaccination modality can with modulation induce protective responses, indicating that the delivery system is critical. Moreover, these results suggest that CD8 T cells should be targeted for the development of a vaccine against infection caused by Leishmania (Viannia) parasites. Further, TLR1/2 modulation may be useful in vaccines where CD8 T cell responses are critical.
Sulfolobus chromatin proteins modulate strand displacement by DNA polymerase B1
Sun, Fei; Huang, Li
2013-01-01
Strand displacement by a DNA polymerase serves a key role in Okazaki fragment maturation, which involves displacement of the RNA primer of the preexisting Okazaki fragment into a flap structure, and subsequent flap removal and fragment ligation. We investigated the role of Sulfolobus chromatin proteins Sso7d and Cren7 in strand displacement by DNA polymerase B1 (PolB1) from the hyperthermophilic archaeon Sulfolobus solfataricus. PolB1 showed a robust strand displacement activity and was capable of synthesizing thousands of nucleotides on a DNA-primed 72-nt single-stranded circular DNA template. This activity was inhibited by both Sso7d and Cren7, which limited the flap length to 3–4 nt at saturating concentrations. However, neither protein inhibited RNA displacement on an RNA-primed single-stranded DNA minicircle by PolB1. Strand displacement remained sensitive to modulation by the chromatin proteins when PolB1 was in association with proliferating cell nuclear antigen. Inhibition of DNA instead of RNA strand displacement by the chromatin proteins is consistent with the finding that double-stranded DNA was more efficiently bound and stabilized than an RNA:DNA duplex by these proteins. Our results suggest that Sulfolobus chromatin proteins modulate strand displacement by PolB1, permitting efficient removal of the RNA primer while inhibiting excessive displacement of the newly synthesized DNA strand during Okazaki fragment maturation. PMID:23821667
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stella, Stefano; University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen; Molina, Rafael
Crystal structures of BurrH and the BurrH–DNA complex are reported. DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-bindingmore » domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing.« less
Genome-wide colonization of gene regulatory elements by G4 DNA motifs
Du, Zhuo; Zhao, Yiqiang; Li, Ning
2009-01-01
G-quadruplex (or G4 DNA), a stable four-stranded structure found in guanine-rich regions, is implicated in the transcriptional regulation of genes involved in growth and development. Previous studies on the role of G4 DNA in gene regulation mostly focused on genomic regions proximal to transcription start sites (TSSs). To gain a more comprehensive understanding of the regulatory role of G4 DNA, we examined the landscape of potential G4 DNA (PG4Ms) motifs in the human genome and found that G4 motifs, not restricted to those found in the TSS-proximal regions, are bias toward gene-associated regions. Significantly, analyses of G4 motifs in seven types of well-known gene regulatory elements revealed a constitutive enrichment pattern and the clusters of G4 motifs tend to be colocalized with regulatory elements. Considering our analysis from a genome evolutionary perspective, we found evidence that the occurrence and accumulation of certain progenitors and canonical G4 DNA motifs within regulatory regions were progressively favored by natural selection. Our results suggest that G4 DNA motifs are ‘colonized’ in regulatory regions, supporting a likely genome-wide role of G4 DNA in gene regulation. We hypothesize that G4 DNA is a regulatory apparatus situated in regulatory elements, acting as a molecular switch that can modulate the role of the host functional regions, by transition in DNA structure. PMID:19759215
Wang, Li-Shu; Arnold, Mark; Huang, Yi-Wen; Sardo, Christine; Seguin, Claire; Martin, Edward; Huang, Tim H.-M.; Riedl, Ken; Schwartz, Steven; Frankel, Wendy; Pearl, Dennis; Xu, Yiqing; Winston, John; Yang, Guang-Yu; Stoner, Gary
2010-01-01
Purpose This study evaluated the effects of black raspberries (BRBs) on biomarkers of tumor development in the human colon and rectum including methylation of relevant tumor suppressor genes, cell proliferation, apoptosis, angiogenesis and expression of Wnt pathway genes. Experimental Design Biopsies of adjacent normal tissues and colorectal adenocarcinomas were taken from 20 patients before and after oral consumption of BRB powder (60g/day) for 1-to-9 wks. Methylation status of promoter regions of five tumor suppressor genes was quantified. Protein expression of DNA methyltransferase 1 (DNMT1) and genes associated with cell proliferation, apoptosis, angiogenesis, and Wnt signaling were measured. Results The methylation of three Wnt inhibitors, SFRP2, SFRP5, and WIF1, upstream genes in Wnt pathway, and PAX6a, a developmental regulator, was modulated in a protective direction by BRBs in normal tissues and in colorectal tumors only in patients who received an average of 4 wks of BRB treatment, but not in all 20 patients with 1-to-9 wks of BRB treatment. This was associated with decreased expression of DNMT1. BRBs modulated expression of genes associated with Wnt pathway, proliferation, apoptosis and angiogenesis in a protective direction. Conclusions These data provide evidence of the ability of BRBs to demethylate tumor suppressor genes and to modulate other biomarkers of tumor development in the human colon and rectum. While demethylation of genes did not occur in colorectal tissues from all treated patients, the positive results with the secondary endpoints suggest that additional studies of BRBs for the prevention of colorectal cancer in humans now appear warranted. PMID:21123457
Comparative analysis of prophages in Streptococcus mutans genomes
Fu, Tiwei; Fan, Xiangyu; Long, Quanxin; Deng, Wanyan; Song, Jinlin
2017-01-01
Prophages have been considered genetic units that have an intimate association with novel phenotypic properties of bacterial hosts, such as pathogenicity and genomic variation. Little is known about the genetic information of prophages in the genome of Streptococcus mutans, a major pathogen of human dental caries. In this study, we identified 35 prophage-like elements in S. mutans genomes and performed a comparative genomic analysis. Comparative genomic and phylogenetic analyses of prophage sequences revealed that the prophages could be classified into three main large clusters: Cluster A, Cluster B, and Cluster C. The S. mutans prophages in each cluster were compared. The genomic sequences of phismuN66-1, phismuNLML9-1, and phismu24-1 all shared similarities with the previously reported S. mutans phages M102, M102AD, and ϕAPCM01. The genomes were organized into seven major gene clusters according to the putative functions of the predicted open reading frames: packaging and structural modules, integrase, host lysis modules, DNA replication/recombination modules, transcriptional regulatory modules, other protein modules, and hypothetical protein modules. Moreover, an integrase gene was only identified in phismuNLML9-1 prophages. PMID:29158986
Tolmachov, Oleg E
2012-05-01
The cell-specific and long-term expression of therapeutic transgenes often requires a full array of native gene control elements including distal enhancers, regulatory introns and chromatin organisation sequences. The delivery of such extended gene expression modules to human cells can be accomplished with non-viral high-molecular-weight DNA vectors, in particular with several classes of linear DNA vectors. All high-molecular-weight DNA vectors are susceptible to damage by shear stress, and while for some of the vectors the harmful impact of shear stress can be minimised through the transformation of the vectors to compact topological configurations by supercoiling and/or knotting, linear DNA vectors with terminal loops or covalently attached terminal proteins cannot be self-compacted in this way. In this case, the only available self-compacting option is self-entangling, which can be defined as the folding of single DNA molecules into a configuration with mutual restriction of molecular motion by the individual segments of bent DNA. A negatively charged phosphate backbone makes DNA self-repulsive, so it is reasonable to assume that a certain number of 'sticky points' dispersed within DNA could facilitate the entangling by bringing DNA segments into proximity and by interfering with the DNA slipping away from the entanglement. I propose that the spontaneous entanglement of vector DNA can be enhanced by the interlacing of the DNA with sites capable of mutual transient attachment through the formation of non-B-DNA forms, such as interacting cruciform structures, inter-segment triplexes, slipped-strand DNA, left-handed duplexes (Z-forms) or G-quadruplexes. It is expected that the non-B-DNA based entanglement of the linear DNA vectors would consist of the initial transient and co-operative non-B-DNA mediated binding events followed by tight self-ensnarement of the vector DNA. Once in the nucleoplasm of the target human cells, the DNA can be disentangled by type II topoisomerases. The technology for such self-entanglement can be an avenue for the improvement of gene delivery with high-molecular-weight naked DNA using therapeutically important methods associated with considerable shear stress. Priority applications include in vivo muscle electroporation and sonoporation for Duchenne muscular dystrophy patients, aerosol inhalation to reach the target lung cells of cystic fibrosis patients and bio-ballistic delivery to skin melanomas with the vector DNA adsorbed on gold or tungsten projectiles. Copyright © 2012 Elsevier Ltd. All rights reserved.
Histone Code Modulation by Oncogenic PWWP-Domain Protein in Breast Cancers
2014-08-01
discs, the Drosophila melanogaster homo- logue of human retinoblastoma binding protein 2. Genetics 2000; 156: 645-663. [10] Zeng J, Ge Z, Wang L...in breast cancer patients (7-11). Earlier, we used genomic analysis of copy number and gene expression to perform a detailed analysis of the 8p11-12...from the 8p11-12 region (14). Very recently, we searched the Cancer Genome Atlas database that contains 744 breast invasive carcinomas. We found DNA or
Herrero-Barbudo, Carmen; Soldevilla, Beatriz; Pérez-Sacristán, Belén; Blanco-Navarro, Inmaculada; Herrera, Mercedes; Granado-Lorencio, Fernando; Domínguez, Gemma
2013-01-01
Dietary factors provide protection against several forms of DNA damage. Additionally, consumer demand for natural products favours the development of bioactive food ingredients with health benefits. Lutein is a promising biologically active component in the food industry. The EFSA Panel on Dietetic Products, Nutrition and Allergies considers that protection from oxidative damage may be a beneficial physiological effect but that a cause and effect relationship has not been established. Thus, our aim was to evaluate the safety and potential functional effect of a lutein-enriched milk product using the Comet Assay in order to analyze the baseline, the induced DNA-damage and the repair capacity in the lymphocytes of 10 healthy donors before and after the intake of the mentioned product. Our data suggest that the regular consumption of lutein-enriched fermented milk results in a significant increase in serum lutein levels and this change is associated with an improvement in the resistance of DNA to damage and the capacity of DNA repair in lymphocytes. Our results also support the lack of a genotoxic effect at the doses supplied as well as the absence of interactions and side effects on other nutritional and biochemicals markers. PMID:24040187
Le, Thi Thu Thuy; Zhang, Shijun; Hayashi, Naoyuki; Yasukawa, Mami; Delgermaa, Luvsanjav; Murakami, Seishi
2005-09-01
RNA polymerase II (RNAPII) subunit 5 (RPB5) is positioned close to DNA downstream of the initiation site and is the site of interaction with several regulators. Hepatitis B virus X protein (HBx) binds the central part of RPB5 to modulate activated transcription, and TFIIF subunit RAP30 interacts with the same part of RPB5 that is critical for the association between TFIIF and RNAPII. However the residues necessary for these interactions remain unknown. Here we report systematic mutagenesis of the central part of RPB5 using two-step alanine scanning libraries to pinpoint critical residues for its binding to RAP30 in the TFIIF complex and/or to HBx, and identified these residues in both mammalian cells and in an in vitro binding assay. Four residues, F76, I104, T111 and S113, are critical for both TFIIF- and HBx-binding, indicating the overlapping nature of the sites of interaction. In addition, V74 and N98 are required for HBx-binding, and T56 and L58 are needed for RAP30-binding. Interestingly the residues exposed to solvent, T111 and S113, are very close to the DNA, implying that two factors may modulate the interaction between DNA and RPB5.
Inhibition of N-Myc down regulated gene 1 in in vitro cultured human glioblastoma cells
Said, Harun M; Polat, Buelent; Stein, Susanne; Guckenberger, Mathias; Hagemann, Carsten; Staab, Adrian; Katzer, Astrid; Anacker, Jelena; Flentje, Michael; Vordermark, Dirk
2012-01-01
AIM: To study short dsRNA oligonucleotides (siRNA) as a potent tool for artificially modulating gene expression of N-Myc down regulated gene 1 (NDRG1) gene induced under different physiological conditions (Normoxia and hypoxia) modulating NDRG1 transcription, mRNA stability and translation. METHODS: A cell line established from a patient with glioblastoma multiforme. Plasmid DNA for transfections was prepared with the Endofree Plasmid Maxi kit. From plates containing 5 × 107 cells, nuclear extracts were prepared according to previous protocols. The pSUPER-NDRG1 vectors were designed, two sequences were selected from the human NDRG1 cDNA (5’-GCATTATTGGCATGGGAAC-3’ and 5’-ATGCAGAGTAACGTGGAAG-3’. reverse transcription polymerase chain reaction was performed using primers designed using published information on β-actin and hypoxia-inducible factor (HIF)-1α mRNA sequences in GenBank. NDRG1 mRNA and protein level expression results under different conditions of hypoxia or reoxygenation were compared to aerobic control conditions using the Mann-Whitney U test. Reoxygenation values were also compared to the NDRG1 levels after 24 h of hypoxia (P < 0.05 was considered significant). RESULTS: siRNA- and iodoacetate (IAA)-mediated downregulation of NDRG1 mRNA and protein expression in vitro in human glioblastoma cell lines showed a nearly complete inhibition of NDRG1 expression when compared to the results obtained due to the inhibitory role of glycolysis inhibitor IAA. Hypoxia responsive elements bound by nuclear HIF-1 in human glioblastoma cells in vitro under different oxygenation conditions and the clearly enhanced binding of nuclear extracts from glioblastoma cell samples exposed to extreme hypoxic conditions confirmed the HIF-1 Western blotting results. CONCLUSION: NDRG1 represents an additional diagnostic marker for brain tumor detection, due to the role of hypoxia in regulating this gene, and it can represent a potential target for tumor treatment in human glioblastoma. The siRNA method can represent an elegant alternative to modulate the expression of the hypoxia induced NDRG1 gene and can help to monitor the development of the cancer disease treatment outcome through monitoring the expression of this gene in the patients undergoing the different therapeutic treatment alternatives available nowadays. PMID:22787578
Kemp, Michael G.; Lindsey-Boltz, Laura A.; Sancar, Aziz
2015-01-01
The mechanism by which ultraviolet (UV) wavelengths of sunlight trigger or exacerbate the symptoms of the autoimmune disorder lupus erythematosus is not known but may involve a role for the innate immune system. Here we show that UV radiation potentiates STING (stimulator of interferon genes)-dependent activation of the immune signaling transcription factor interferon regulatory factor 3 (IRF3) in response to cytosolic DNA and cyclic dinucleotides in keratinocytes and other human cells. Furthermore, we find that modulation of this innate immune response also occurs with UV-mimetic chemical carcinogens and in a manner that is independent of DNA repair and several DNA damage and cell stress response signaling pathways. Rather, we find that the stimulation of STING-dependent IRF3 activation by UV is due to apoptotic signaling-dependent disruption of ULK1 (Unc51-like kinase 1), a pro-autophagic protein that negatively regulates STING. Thus, deregulation of ULK1 signaling by UV-induced DNA damage may contribute to the negative effects of sunlight UV exposure in patients with autoimmune disorders. PMID:25792739
Woo, Jun-Myung; Kim, Seok Hyang; Chun, Honnggu; Kim, Sung Jae; Ahn, Jinhong; Park, Young June
2013-09-21
In this paper, we investigate the effect of electrical pulse bias on DNA hybridization events in a biosensor platform, using a Carbon Nanotube Network (CNN) and Gold Nano Particles (GNP) as an electrical channel. The scheme provides both hybridization rate enhancement of bio molecules, and electrical measurement in a transient state to avoid the charge screening effect, thereby significantly improving the sensitivity. As an example, the probe DNA molecules oscillate with pulse trains, resulting in the enhancement of DNA hybridization efficiency, and accordingly of the sensor performances in Tris-EDTA (TE) buffer solution, by as much as over three times, compared to the non-biasing conditions. More importantly, a wide dynamic range of 10(6) (target-DNA concentration from 5 pM to 5 μM) is achieved in human serum. In addition, the pulse biasing method enables one to obtain the conductance change, before the ions within the Electrical Double Layer (EDL) are redistributed, to avoid the charge screening effect, leading to an additional sensitivity enhancement.
Isalan, M; Klug, A; Choo, Y
2001-07-01
DNA-binding domains with predetermined sequence specificity are engineered by selection of zinc finger modules using phage display, allowing the construction of customized transcription factors. Despite remarkable progress in this field, the available protein-engineering methods are deficient in many respects, thus hampering the applicability of the technique. Here we present a rapid and convenient method that can be used to design zinc finger proteins against a variety of DNA-binding sites. This is based on a pair of pre-made zinc finger phage-display libraries, which are used in parallel to select two DNA-binding domains each of which recognizes given 5 base pair sequences, and whose products are recombined to produce a single protein that recognizes a composite (9 base pair) site of predefined sequence. Engineering using this system can be completed in less than two weeks and yields proteins that bind sequence-specifically to DNA with Kd values in the nanomolar range. To illustrate the technique, we have selected seven different proteins to bind various regions of the human immunodeficiency virus 1 (HIV-1) promoter.
Seper, Andrea; Fengler, Vera H I; Roier, Sandro; Wolinski, Heimo; Kohlwein, Sepp D; Bishop, Anne L; Camilli, Andrew; Reidl, Joachim; Schild, Stefan
2011-01-01
Biofilms are a preferred mode of survival for many microorganisms including Vibrio cholerae, the causative agent of the severe secretory diarrhoeal disease cholera. The ability of the facultative human pathogen V. cholerae to form biofilms is a key factor for persistence in aquatic ecosystems and biofilms act as a source for new outbreaks. Thus, a better understanding of biofilm formation and transmission of V. cholerae is an important target to control the disease. So far the Vibrio exopolysaccharide was the only known constituent of the biofilm matrix. In this study we identify and characterize extracellular DNA as a component of the Vibrio biofilm matrix. Furthermore, we show that extracellular DNA is modulated and controlled by the two extracellular nucleases Dns and Xds. Our results indicate that extracellular DNA and the extracellular nucleases are involved in diverse processes including the development of a typical biofilm architecture, nutrient acquisition, detachment from biofilms and the colonization fitness of biofilm clumps after ingestion by the host. This study provides new insights into biofilm development and transmission of biofilm-derived V. cholerae. PMID:22032623
Detection of benzo[a]pyrene-guanine adducts in single-stranded DNA using the α-hemolysin nanopore
NASA Astrophysics Data System (ADS)
Perera, Rukshan T.; Fleming, Aaron M.; Johnson, Robert P.; Burrows, Cynthia J.; White, Henry S.
2015-02-01
The carcinogenic precursor benzo[a]pyrene (BP), a polycyclic aromatic hydrocarbon, is released into the environment through the incomplete combustion of hydrocarbons. Metabolism of BP in the human body yields a potent alkylating agent (benzo[a]pyrene diol epoxide, BPDE) that reacts with guanine (G) in DNA to form an adduct implicated in cancer initiation. We report that the α-hemolysin (αHL) nanopore platform can be used to detect a BPDE adduct to G in synthetic oligodeoxynucleotides. Translocation of a 41-mer poly-2‧-deoxycytidine strand with a centrally located BPDE adduct to G through αHL in 1 M KCl produces a unique multi-level current signature allowing the adduct to be detected. This readily distinguishable current modulation was observed when the BPDE-adducted DNA strand translocated from either the 5‧ or 3‧ directions. This study suggests that BPDE adducts and other large aromatic biomarkers can be detected with αHL, presenting opportunities for the monitoring, quantification, and sequencing of mutagenic compounds from cellular DNA samples.
Wu, Xiaoming; Shell, Steven M.; Yang, Zhengguan; Zou, Yue
2006-01-01
DNA damage triggers complex cellular responses in eukaryotic cells, including initiation of DNA repair and activation of cell cycle checkpoints. In addition to inducing cell cycle arrest, checkpoint also has been suggested to modulate a variety of other cellular processes in response to DNA damage. In this study, we present evidence showing that the cellular function of xeroderma pigmentosum group A (XPA), a major nucleotide excision repair (NER) factor, could be modulated by checkpoint kinase ataxia-telangiectasia mutated and Rad3-related (ATR) in response to UV irradiation. We observed the apparent interaction and colocalization of XPA with ATR in response to UV irradiation. We showed that XPA was a substrate for in vitro phosphorylation by phosphatidylinositol-3-kinase-related kinase family kinases whereas in cells XPA was phosphorylated in an ATR-dependent manner and stimulated by UV irradiation. The Ser196 of XPA was identified as a biologically significant residue to be phosphorylated in vivo. The XPA-deficient cells complemented with XPA-S196A mutant, in which Ser196 was substituted with an alanine, displayed significantly higher UV sensitivity compared with the XPA cells complemented with wild-type XPA. Moreover, substitution of Ser196 with aspartic acid for mimicking the phosphorylation of XPA increased the cell survival to UV irradiation. Taken together, our results revealed a potential physical and functional link between NER and the ATR-dependent checkpoint pathway in human cells and suggested that the ATR checkpoint pathway could modulate the cellular activity of NER through phosphorylation of XPA at Ser196 on UV irradiation. PMID:16540648
Helicases as Prospective Targets for Anti-Cancer Therapy
Gupta, Rigu; Brosh, Robert M.
2008-01-01
It has been proposed that selective inactivation of a DNA repair pathway may enhance anti-cancer therapies that eliminate cancerous cells through the cytotoxic effects of DNA damaging agents or radiation. Given the unique and critically important roles of DNA helicases in the DNA damage response, DNA repair, and maintenance of genomic stability, a number of strategies currently being explored or in use to combat cancer may be either mediated or enhanced through the modulation of helicase function. The focus of this review will be to examine the roles of helicases in DNA repair that might be suitably targeted by cancer therapeutic approaches. Treatment of cancers with anti-cancer drugs such as small molecule compounds that modulate helicase expression or function is a viable approach to selectively kill cancer cells through the inactivation of helicase-dependent DNA repair pathways, particularly those associated with DNA recombination, replication restart, and cell cycle checkpoint. PMID:18473724
The protein arginine methyltransferase PRMT5 promotes D2-like dopamine receptor signaling
Likhite, Neah; Jackson, Christopher A.; Liang, Mao-Shih; Krzyzanowski, Michelle C.; Lei, Pedro; Wood, Jordan F.; Birkaya, Barbara; Michaels, Kerry L.; Andreadis, Stelios T.; Clark, Stewart D.; Yu, Michael C.; Ferkey, Denise M.
2017-01-01
Protein arginine methylation regulates diverse functions of eukaryotic cells, including gene expression, the DNA damage response, and circadian rhythms. We showed that arginine residues within the third intracellular loop of the human D2 dopamine receptor, which are conserved in the DOP-3 receptor in the nematode Caenorhabditis elegans, were methylated by protein arginine methyl-transferase 5 (PRMT5). By mutating these arginine residues, we further showed that their methylation enhanced the D2 receptor–mediated inhibition of cyclic adenosine monophosphate (cAMP) signaling in cultured human embryonic kidney (HEK) 293T cells. Analysis of prmt-5–deficient worms indicated that methylation promoted the dopamine-mediated modulation of chemosensory and locomotory behaviors in C. elegans through the DOP-3 receptor. In addition to delineating a previously uncharacterized means of regulating GPCR (heterotrimeric guanine nucleotide–binding protein–coupled receptor) signaling, these findings may lead to the development of a new class of pharmacological therapies that modulate GPCR signaling by changing the methylation status of these key proteins. PMID:26554819
Espinal, Allyson C; Wang, Dan; Yan, Li; Liu, Song; Tang, Li; Hu, Qiang; Morrison, Carl D; Ambrosone, Christine B; Higgins, Michael J; Sucheston-Campbell, Lara E
2017-02-28
DNA from archival formalin-fixed and paraffin embedded (FFPE) tissue is an invaluable resource for genome-wide methylation studies although concerns about poor quality may limit its use. In this study, we compared DNA methylation profiles of breast tumors using DNA from fresh-frozen (FF) tissues and three types of matched FFPE samples. For 9/10 patients, correlation and unsupervised clustering analysis revealed that the FF and FFPE samples were consistently correlated with each other and clustered into distinct subgroups. Greater than 84% of the top 100 loci previously shown to differentiate ER+ and ER- tumors in FF tissues were also FFPE DML. Weighted Correlation Gene Network Analyses (WCGNA) grouped the DML loci into 16 modules in FF tissue, with ~85% of the module membership preserved across tissue types. Restored FFPE and matched FF samples were profiled using the Illumina Infinium HumanMethylation450K platform. Methylation levels (β-values) across all loci and the top 100 loci previously shown to differentiate tumors by estrogen receptor status (ER+ or ER-) in a larger FF study, were compared between matched FF and FFPE samples using Pearson's correlation, hierarchical clustering and WCGNA. Positive predictive values and sensitivity levels for detecting differentially methylated loci (DML) in FF samples were calculated in an independent FFPE cohort. FFPE breast tumors samples show lower overall detection of DMLs versus FF, however FFPE and FF DMLs compare favorably. These results support the emerging consensus that the 450K platform can be employed to investigate epigenetics in large sets of archival FFPE tissues.
Efficient targeted DNA methylation with chimeric dCas9–Dnmt3a–Dnmt3L methyltransferase
Stepper, Peter; Kungulovski, Goran; Jurkowska, Renata Z.; Chandra, Tamir; Krueger, Felix; Reinhardt, Richard
2017-01-01
Abstract DNA methylation plays a critical role in the regulation and maintenance of cell-type specific transcriptional programs. Targeted epigenome editing is an emerging technology to specifically regulate cellular gene expression in order to modulate cell phenotypes or dissect the epigenetic mechanisms involved in their control. In this work, we employed a DNA methyltransferase Dnmt3a–Dnmt3L construct fused to the nuclease-inactivated dCas9 programmable targeting domain to introduce DNA methylation into the human genome specifically at the EpCAM, CXCR4 and TFRC gene promoters. We show that targeting of these loci with single gRNAs leads to efficient and widespread methylation of the promoters. Multiplexing of several guide RNAs does not increase the efficiency of methylation. Peaks of targeted methylation were observed around 25 bp upstream and 40 bp downstream of the PAM site, while 20–30 bp of the binding site itself are protected against methylation. Potent methylation is dependent on the multimerization of Dnmt3a/Dnmt3L complexes on the DNA. Furthermore, the introduced methylation causes transcriptional repression of the targeted genes. These new programmable epigenetic editors allow unprecedented control of the DNA methylation status in cells and will lead to further advances in the understanding of epigenetic signaling. PMID:27899645
Evaluation of Downstream Regulatory Element Antagonistic Modulator Gene in Human Multinodular Goiter
Shinzato, Amanda; Lerario, Antonio M.; Lin, Chin J.; Danilovic, Debora S.; Marui, Suemi; Trarbach, Ericka B.
2015-01-01
Background DREAM (Downstream Regulatory Element Antagonistic Modulator) is a neuronal calcium sensor that was suggested to modulate TSH receptor activity and whose overexpression provokes an enlargement of the thyroid gland in transgenic mice. The aim of this study was to investigate somatic mutations and DREAM gene expression in human multinodular goiter (MNG). Material/Methods DNA and RNA samples were obtained from hyperplastic thyroid glands of 60 patients (54 females) with benign MNG. DREAM mutations were evaluated by PCR and direct automatic sequencing, whereas relative quantification of mRNA was performed by real-time PCR. Over- and under-expression were defined as a 2-fold increase and decrease in comparison to normal thyroid tissue, respectively. RQ M (relative quantification mean); SD (standard deviation). Results DREAM expression was detected in all nodules evaluated. DREAM mRNA was overexpressed in 31.7% of MNG (RQ M=6.26; SD=5.08), whereas 53.3% and 15% had either normal (RQ M=1.16; SD=0.46) or underexpression (RQ M=0.30; SD=0.10), respectively. Regarding DREAM mutations analysis, only previously described intronic polymorphisms were observed. Conclusions We report DREAM gene expression in the hyperplastic thyroid gland of MNG patients. However, DREAM expression did not vary significantly, and was somewhat underexpressed in most patients, suggesting that DREAM upregulation does not significantly affect nodular development in human goiter. PMID:26319784
Accurate quantitation of circulating cell-free mitochondrial DNA in plasma by droplet digital PCR.
Ye, Wei; Tang, Xiaojun; Liu, Chu; Wen, Chaowei; Li, Wei; Lyu, Jianxin
2017-04-01
To establish a method for accurate quantitation of circulating cell-free mitochondrial DNA (ccf-mtDNA) in plasma by droplet digital PCR (ddPCR), we designed a ddPCR method to determine the copy number of ccf-mtDNA by amplifying mitochondrial ND1 (MT-ND1). To evaluate the sensitivity and specificity of the method, a recombinant pMD18-T plasmid containing MT-ND1 sequences and mtDNA-deleted (ρ 0 ) HeLa cells were used, respectively. Subsequently, different plasma samples were prepared for ddPCR to evaluate the feasibility of detecting plasma ccf-mtDNA. In the results, the ddPCR method showed high sensitivity and specificity. When the DNA was extracted from plasma prior to ddPCR, the ccf-mtDNA copy number was higher than that measured without extraction. This difference was not due to a PCR inhibitor, such as EDTA-Na 2 , an anti-coagulant in plasma, because standard EDTA-Na 2 concentration (5 mM) did not significantly inhibit ddPCR reactions. The difference might be attributable to plasma exosomal mtDNA, which was 4.21 ± 0.38 copies/μL of plasma, accounting for ∼19% of plasma ccf-mtDNA. Therefore, ddPCR can quickly and reliably detect ccf-mtDNA from plasma with a prior DNA extraction step, providing for a more accurate detection of ccf-mtDNA. The direct use of plasma as a template in ddPCR is suitable for the detection of exogenous cell-free nucleic acids within plasma, but not of nucleic acids that have a vesicle-associated form, such as exosomal mtDNA. Graphical Abstract Designs of the present work. *: Module 1, #: Module 2, &: Module 3.
Rein, Katrin; Yanez, Diana A; Terré, Berta; Palenzuela, Lluís; Aivio, Suvi; Wei, Kaichun; Edelmann, Winfried; Stark, Jeremy M; Stracker, Travis H
2015-09-03
The maintenance of genome stability is critical for the suppression of diverse human pathologies that include developmental disorders, premature aging, infertility and predisposition to cancer. The DNA damage response (DDR) orchestrates the appropriate cellular responses following the detection of lesions to prevent genomic instability. The MRE11 complex is a sensor of DNA double strand breaks (DSBs) and plays key roles in multiple aspects of the DDR, including DNA end resection that is critical for signaling and DNA repair. The MRE11 complex has been shown to function both upstream and in concert with the 5'-3' exonuclease EXO1 in DNA resection, but it remains unclear to what extent EXO1 influences DSB responses independently of the MRE11 complex. Here we examine the genetic relationship of the MRE11 complex and EXO1 during mammalian development and in response to DNA damage. Deletion of Exo1 in mice expressing a hypomorphic allele of Nbs1 leads to severe developmental impairment, embryonic death and chromosomal instability. While EXO1 plays a minimal role in normal cells, its loss strongly influences DNA replication, DNA repair, checkpoint signaling and damage sensitivity in NBS1 hypomorphic cells. Collectively, our results establish a key role for EXO1 in modulating the severity of hypomorphic MRE11 complex mutations. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Josse, Rozenn; Dumont, Julie; Fautrel, Alain
Gene expression profiling has recently emerged as a promising approach to identify early target genes and discriminate genotoxic carcinogens from non-genotoxic carcinogens and non-carcinogens. However, early gene changes induced by genotoxic compounds in human liver remain largely unknown. Primary human hepatocytes and differentiated HepaRG cells were exposed to aflatoxin B1 (AFB1) that induces DNA damage following enzyme-mediated bioactivation. Gene expression profile changes induced by a 24 h exposure of these hepatocyte models to 0.05 and 0.25 μM AFB1 were analyzed by using oligonucleotide pangenomic microarrays. The main altered signaling pathway was the p53 pathway and related functions such as cellmore » cycle, apoptosis and DNA repair. Direct involvement of the p53 protein in response to AFB1 was verified by using siRNA directed against p53. Among the 83 well-annotated genes commonly modulated in two pools of three human hepatocyte populations and HepaRG cells, several genes were identified as altered by AFB1 for the first time. In addition, a subset of 10 AFB1-altered genes, selected upon basis of their function or tumor suppressor role, was tested in four human hepatocyte populations and in response to other chemicals. Although they exhibited large variable inter-donor fold-changes, several of these genes, particularly FHIT, BCAS3 and SMYD3, were found to be altered by various direct and other indirect genotoxic compounds and unaffected by non-genotoxic compounds. Overall, this comprehensive analysis of early gene expression changes induced by AFB1 in human hepatocytes identified a gene subset that included several genes representing potential biomarkers of genotoxic compounds. -- Highlights: ► Gene expression profile changes induced by aflatoxin B1 in human hepatocytes. ► AFB1 modulates various genes including tumor suppressor genes and proto-oncogenes. ► Important inter-individual variations in the response to AFB1. ► Some genes also altered by other genotoxic compounds requiring or not bioactivation.« less
Smoke-induced microRNA and related proteome alterations. Modulation by chemopreventive agents.
De Flora, Silvio; Balansky, Roumen; D'Agostini, Francesco; Cartiglia, Cristina; Longobardi, Mariagrazia; Steele, Vernon E; Izzotti, Alberto
2012-12-15
Dysregulation of microRNAs (miRNAs) has important consequences on gene and protein expression since a single miRNA targets a number of genes simultaneously. This article provides a review of published data and ongoing studies regarding the effects of cigarette smoke (CS), either mainstream (MCS) or environmental (ECS), on the expression of miRNAs and related proteins. The results generated in mice, rats, and humans provided evidence that exposure to CS results in an intense dysregulation of miRNA expression in the respiratory tract, which is mainly oriented in the sense of downregulation. In parallel, there was an upregulation of proteins targeted by the downregulated miRNAs. These trends reflect an attempt to defend the respiratory tract by means of antioxidant mechanisms, detoxification of carcinogens, DNA repair, anti-inflammatory pathways, apoptosis, etc. However, a long-lasting exposure to CS causes irreversible miRNA alterations that activate carcinogenic mechanisms, such as modulation of oncogenes and oncosuppressor genes, cell proliferation, recruitment of undifferentiated stem cells, inflammation, inhibition of intercellular communications, angiogenesis, invasion, and metastasis. The miRNA alterations induced by CS in the lung of mice and rats are similar to those observed in the human respiratory tract. Since a number of miRNAs that are modulated by CS and/or chemopreventive agents are subjected to single nucleotide polymorphisms in humans, they can be evaluated according to toxicogenomic/pharmacogenomics approaches. A variety of cancer chemopreventive agents tested in our laboratory modulated both baseline and CS-related miRNA and proteome alterations, thus contributing to evaluate both safety and efficacy of dietary and pharmacological agents. Copyright © 2012 UICC.
NASA Technical Reports Server (NTRS)
Wiese, Claudia; Pierce, Andrew J.; Gauny, Stacey S.; Jasin, Maria; Kronenberg, Amy; Chatterjee, A. (Principal Investigator)
2002-01-01
Homology-directed repair (HDR) of DNA double-strand breaks (DSBs) contributes to the maintenance of genomic stability in rodent cells, and it has been assumed that HDR is of similar importance in DSB repair in human cells. However, some outcomes of homologous recombination can be deleterious, suggesting that factors exist to regulate HDR. We demonstrated previously that overexpression of BCL-2 or BCL-x(L) enhanced the frequency of X-ray-induced TK1 mutations, including loss of heterozygosity events presumed to arise by mitotic recombination. The present study was designed to test whether HDR is a prominent DSB repair pathway in human cells and to determine whether ectopic expression of BCL-x(L) affects HDR. Using TK6-neo cells, we find that a single DSB in an integrated HDR reporter stimulates gene conversion 40-50-fold, demonstrating efficient DSB repair by gene conversion in human cells. Significantly, DSB-induced gene conversion events are 3-4-fold more frequent in TK6 cells that stably overexpress the antiapoptotic protein BCL-X(L). Thus, HDR plays an important role in maintaining genomic integrity in human cells, and ectopic expression of BCL-x(L) enhances HDR of DSBs. This is the first study to highlight a function for BCL-x(L) in modulating DSB repair in human cells.
De La Rosa, Vanessa Y; Asfaha, Jonathan; Fasullo, Michael; Loguinov, Alex; Li, Peng; Moore, Lee E; Rothman, Nathaniel; Nakamura, Jun; Swenberg, James A; Scelo, Ghislaine; Zhang, Luoping; Smith, Martyn T; Vulpe, Chris D
2017-11-01
Trichloroethylene (TCE), an industrial chemical and environmental contaminant, is a human carcinogen. Reactive metabolites are implicated in renal carcinogenesis associated with TCE exposure, yet the toxicity mechanisms of these metabolites and their contribution to cancer and other adverse effects remain unclear. We employed an integrated functional genomics approach that combined functional profiling studies in yeast and avian DT40 cell models to provide new insights into the specific mechanisms contributing to toxicity associated with TCE metabolites. Genome-wide profiling studies in yeast identified the error-prone translesion synthesis (TLS) pathway as an import mechanism in response to TCE metabolites. The role of TLS DNA repair was further confirmed by functional profiling in DT40 avian cell lines, but also revealed that TLS and homologous recombination DNA repair likely play competing roles in cellular susceptibility to TCE metabolites in higher eukaryotes. These DNA repair pathways are highly conserved between yeast, DT40, and humans. We propose that in humans, mutagenic TLS is favored over homologous recombination repair in response to TCE metabolites. The results of these studies contribute to the body of evidence supporting a mutagenic mode of action for TCE-induced renal carcinogenesis mediated by reactive metabolites in humans. Our approach illustrates the potential for high-throughput in vitro functional profiling in yeast to elucidate toxicity pathways (molecular initiating events, key events) and candidate susceptibility genes for focused study. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Generation of knockout rabbits using transcription activator-like effector nucleases.
Wang, Yu; Fan, Nana; Song, Jun; Zhong, Juan; Guo, Xiaogang; Tian, Weihua; Zhang, Quanjun; Cui, Fenggong; Li, Li; Newsome, Philip N; Frampton, Jon; Esteban, Miguel A; Lai, Liangxue
2014-01-01
Zinc-finger nucleases and transcription activator-like effector nucleases are novel gene-editing platforms contributing to redefine the boundaries of modern biological research. They are composed of a non-specific cleavage domain and a tailor made DNA-binding module, which enables a broad range of genetic modifications by inducing efficient DNA double-strand breaks at desired loci. Among other remarkable uses, these nucleases have been employed to produce gene knockouts in mid-size and large animals, such as rabbits and pigs, respectively. This approach is cost effective, relatively quick, and can produce invaluable models for human disease studies, biotechnology or agricultural purposes. Here we describe a protocol for the efficient generation of knockout rabbits using transcription activator-like effector nucleases, and a perspective of the field.
The fractal based analysis of human face and DNA variations during aging.
Namazi, Hamidreza; Akrami, Amin; Hussaini, Jamal; Silva, Osmar N; Wong, Albert; Kulish, Vladimir V
2017-01-16
Human DNA is the main unit that shapes human characteristics and features such as behavior. Thus, it is expected that changes in DNA (DNA mutation) influence human characteristics and features. Face is one of the human features which is unique and also dependent on his gen. In this paper, for the first time we analyze the variations of human DNA and face simultaneously. We do this job by analyzing the fractal dimension of DNA walk and face during human aging. The results of this study show the human DNA and face get more complex by aging. These complexities are mapped on fractal exponents of DNA walk and human face. The method discussed in this paper can be further developed in order to investigate the direct influence of DNA mutation on the face variations during aging, and accordingly making a model between human face fractality and the complexity of DNA walk.
A python module to normalize microarray data by the quantile adjustment method.
Baber, Ibrahima; Tamby, Jean Philippe; Manoukis, Nicholas C; Sangaré, Djibril; Doumbia, Seydou; Traoré, Sekou F; Maiga, Mohamed S; Dembélé, Doulaye
2011-06-01
Microarray technology is widely used for gene expression research targeting the development of new drug treatments. In the case of a two-color microarray, the process starts with labeling DNA samples with fluorescent markers (cyanine 635 or Cy5 and cyanine 532 or Cy3), then mixing and hybridizing them on a chemically treated glass printed with probes, or fragments of genes. The level of hybridization between a strand of labeled DNA and a probe present on the array is measured by scanning the fluorescence of spots in order to quantify the expression based on the quality and number of pixels for each spot. The intensity data generated from these scans are subject to errors due to differences in fluorescence efficiency between Cy5 and Cy3, as well as variation in human handling and quality of the sample. Consequently, data have to be normalized to correct for variations which are not related to the biological phenomena under investigation. Among many existing normalization procedures, we have implemented the quantile adjustment method using the python computer language, and produced a module which can be run via an HTML dynamic form. This module is composed of different functions for data files reading, intensity and ratio computations and visualization. The current version of the HTML form allows the user to visualize the data before and after normalization. It also gives the option to subtract background noise before normalizing the data. The output results of this module are in agreement with the results of other normalization tools. Published by Elsevier B.V.
Alcohol-Derived Acetaldehyde Exposure in the Oral Cavity
Guidolin, Valeria; Balbo, Silvia
2018-01-01
Alcohol is classified by the International Agency for Research on Cancer (IARC) as a human carcinogen and its consumption has been associated to an increased risk of liver, breast, colorectum, and upper aerodigestive tract (UADT) cancers. Its mechanisms of carcinogenicity remain unclear and various hypotheses have been formulated depending on the target organ considered. In the case of UADT cancers, alcohol’s major metabolite acetaldehyde seems to play a crucial role. Acetaldehyde reacts with DNA inducing modifications, which, if not repaired, can result in mutations and lead to cancer development. Despite alcohol being mainly metabolized in the liver, several studies performed in humans found higher levels of acetaldehyde in saliva compared to those found in blood immediately after alcohol consumption. These results suggest that alcohol-derived acetaldehyde exposure may occur in the oral cavity independently from liver metabolism. This hypothesis is supported by our recent results showing the presence of acetaldehyde-related DNA modifications in oral cells of monkeys and humans exposed to alcohol, overall suggesting that the alcohol metabolism in the oral cavity is an independent cancer risk factor. This review article will focus on illustrating the factors modulating alcohol-derived acetaldehyde exposure and effects in the oral cavity. PMID:29342885
Intestinal Epithelial Cells Modulate Antigen-Presenting Cell Responses to Bacterial DNA
Campeau, J. L.; Salim, S. Y.; Albert, E. J.; Hotte, N.
2012-01-01
Intestinal epithelial cells and antigen-presenting cells orchestrate mucosal innate immunity. This study investigated the role of bacterial DNA in modulating epithelial and bone marrow-derived antigen-presenting cells (BM-APCs) and subsequent T-lymphocyte responses. Murine MODE-K epithelial cells and BM-APCs were treated with DNA from either Bifidobacterium breve or Salmonella enterica serovar Dublin directly and under coculture conditions with CD4+ T cells. Apical stimulation of MODE-K cells with S. Dublin DNA enhanced secretion of cytokines from underlying BM-APCs and induced interleukin-17 (IL-17) and gamma interferon (IFN-γ) secretion from CD4+ T cells. Bacterial DNA isolated from either strain induced maturation and increased cytokine secretion from BM-APCs. Conditioned medium from S. Dublin-treated MODE-K cells elicited an increase in cytokine secretion similar to that seen for S. Dublin DNA. Treatment of conditioned medium from MODE-K cells with RNase and protease prevented the S. Dublin-induced increased cytokine secretion. Oral feeding of mice with B. breve DNA resulted in enhanced levels of colonic IL-10 and transforming growth factor β (TGFβ) compared with what was seen for mice treated with S. Dublin DNA. In contrast, feeding mice with S. Dublin DNA increased levels of colonic IL-17 and IL-12p70. T cells from S. Dublin DNA-treated mice secreted high levels of IL-12 and IFN-γ compared to controls and B. breve DNA-treated mice. These results demonstrate that intestinal epithelial cells are able to modulate subsequent antigen-presenting and T-cell responses to bacterial DNA with pathogenic but not commensal bacterial DNA inducing effector CD4+ T lymphocytes. PMID:22615241
Mishra, Manish; Kowluru, Renu A
2018-04-21
In the development of diabetic retinopathy, retinal mitochondria are dysfunctional, and mitochondrial DNA (mtDNA) is damaged with increased base mismatches and hypermethylated cytosines. DNA methylation is also a potential source of mutation, and in diabetes, the noncoding region, the displacement loop (D-loop), experiences more methylation and base mismatches than other regions of the mtDNA. Our aim was to investigate a possible crosstalk between mtDNA methylation and base mismatches in the development of diabetic retinopathy. The effect of inhibition of Dnmts (by 5-aza-2'-deoxycytidine or Dnmt1-siRNA) on glucose-induced mtDNA base mismatches was investigated in human retinal endothelial cells by surveyor endonuclease digestion and validated by Sanger sequencing. The role of deamination factors on increased base mismatches was determined in the cells genetically modulated for mitochondrial superoxide dismutase (Sod2) or cytidine-deaminase (APOBEC3A). The results were confirmed in an in vivo model using retinal microvasculature from diabetic mice overexpressing Sod2. Inhibition of DNA methylation, or regulation of cytosine deamination, significantly inhibited an increase in base mismatches at the D-loop and prevented mitochondrial dysfunction. Overexpression of Sod2 in mice also prevented diabetes-induced D-loop hypermethylation and increase in base mismatches. The crosstalk between DNA methylation and base mismatches continued even after termination of hyperglycemia, suggesting its role in the metabolic memory phenomenon associated with the progression of diabetic retinopathy. Inhibition of DNA methylation limits the availability of methylated cytosine for deamination, suggesting a crosstalk between DNA methylation and base mismatches. Thus, regulation of DNA methylation, or its deamination, should impede the development of diabetic retinopathy by preventing formation of base mismatches and mitochondrial dysfunction.
Peripheral infrastructure vectors and an extended set of plant parts for the Modular Cloning system
Kretschmer, Carola; Gruetzner, Ramona; Löfke, Christian; Dagdas, Yasin; Bürstenbinder, Katharina; Marillonnet, Sylvestre
2018-01-01
Standardized DNA assembly strategies facilitate the generation of multigene constructs from collections of building blocks in plant synthetic biology. A common syntax for hierarchical DNA assembly following the Golden Gate principle employing Type IIs restriction endonucleases was recently developed, and underlies the Modular Cloning and GoldenBraid systems. In these systems, transcriptional units and/or multigene constructs are assembled from libraries of standardized building blocks, also referred to as phytobricks, in several hierarchical levels and by iterative Golden Gate reactions. Here, a toolkit containing further modules for the novel DNA assembly standards was developed. Intended for use with Modular Cloning, most modules are also compatible with GoldenBraid. Firstly, a collection of approximately 80 additional phytobricks is provided, comprising e.g. modules for inducible expression systems, promoters or epitope tags. Furthermore, DNA modules were developed for connecting Modular Cloning and Gateway cloning, either for toggling between systems or for standardized Gateway destination vector assembly. Finally, first instances of a “peripheral infrastructure” around Modular Cloning are presented: While available toolkits are designed for the assembly of plant transformation constructs, vectors were created to also use coding sequence-containing phytobricks directly in yeast two hybrid interaction or bacterial infection assays. The presented material will further enhance versatility of hierarchical DNA assembly strategies. PMID:29847550
A HLA class I cis-regulatory element whose activity can be modulated by hormones.
Sim, B C; Hui, K M
1994-12-01
To elucidate the basis of the down-regulation in major histocompatibility complex (MHC) class I gene expression and to identify possible DNA-binding regulatory elements that have the potential to interact with class I MHC genes, we have studied the transcriptional regulation of class I HLA genes in human breast carcinoma cells. A 9 base pair (bp) negative cis-regulatory element (NRE) has been identified using band-shift assays employing DNA sequences derived from the 5'-flanking region of HLA class I genes. This 9-bp element, GTCATGGCG, located within exon I of the HLA class I gene, can potently inhibit the expression of a heterologous thymidine kinase (TK) gene promoter and the HLA enhancer element. Furthermore, this regulatory element can exert its suppressive function in either the sense or anti-sense orientation. More interestingly, NRE can suppress dexamethasone-mediated gene activation in the context of the reported glucocorticoid-responsive element (GRE) in MCF-7 cells but has no influence on the estrogen-mediated transcriptional activation of MCF-7 cells in the context of the reported estrogen-responsive element (ERE). Furthermore, the presence of such a regulatory element within the HLA class I gene whose activity can be modulated by hormones correlates well with our observation that the level of HLA class I gene expression can be down-regulated by hormones in human breast carcinoma cells. Such interactions between negative regulatory elements and specific hormone trans-activators are novel and suggest a versatile form of transcriptional control.
Lactococci and lactobacilli as mucosal delivery vectors for therapeutic proteins and DNA vaccines
2011-01-01
Food-grade Lactic Acid Bacteria (LAB) have been safely consumed for centuries by humans in fermented foods. Thus, they are good candidates to develop novel oral vectors, constituting attractive alternatives to attenuated pathogens, for mucosal delivery strategies. Herein, this review summarizes our research, up until now, on the use of LAB as mucosal delivery vectors for therapeutic proteins and DNA vaccines. Most of our work has been based on the model LAB Lactococcus lactis, for which we have developed efficient genetic tools, including expression signals and host strains, for the heterologous expression of therapeutic proteins such as antigens, cytokines and enzymes. Resulting recombinant lactococci strains have been tested successfully for their prophylactic and therapeutic effects in different animal models: i) against human papillomavirus type 16 (HPV-16)-induced tumors in mice, ii) to partially prevent a bovine β-lactoglobulin (BLG)-allergic reaction in mice and iii) to regulate body weight and food consumption in obese mice. Strikingly, all of these tools have been successfully transposed to the Lactobacillus genus, in recent years, within our laboratory. Notably, anti-oxidative Lactobacillus casei strains were constructed and tested in two chemically-induced colitis models. In parallel, we also developed a strategy based on the use of L. lactis to deliver DNA at the mucosal level, and were able to show that L. lactis is able to modulate the host response through DNA delivery. Today, we consider that all of our consistent data, together with those obtained by other groups, demonstrate and reinforce the interest of using LAB, particularly lactococci and lactobacilli strains, to develop novel therapeutic protein mucosal delivery vectors which should be tested now in human clinical trials. PMID:21995317
EMSA Analysis of DNA Binding By Rgg Proteins
LaSarre, Breah; Federle, Michael J.
2016-01-01
In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function (e.g. interruption of DNA-binding in some cases). PMID:27430004
EMSA Analysis of DNA Binding By Rgg Proteins.
LaSarre, Breah; Federle, Michael J
2013-08-20
In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function ( e.g. interruption of DNA-binding in some cases).
mir-24 activity propagates stress-induced senescence by down regulating DNA topoisomerase 1.
Bu, Huajie; Baraldo, Giorgia; Lepperdinger, Günter; Jansen-Dürr, Pidder
2016-03-01
MicroRNAs (miRNAs) are a group of small non-coding executor RNAs. Their function as key modulators of cellular senescence has been widely recognized recently. By cross-comparing several human aging models we previously identified dozens of miRNAs being differentially regulated during aging. Here the functions of two miRNAs, mir-24 and mir-424, were investigated in an oxidative stress-induced fibroblast premature senescence model. Using pre-miRNA precursors, miRNAs were overexpressed in cells undergoing premature senescence induced by oxidative stress. More senescent cells were observed in mir-24 transfected cells. p53 was upregulated in mir-24 overexpressing cells, but downregulated in mir-424 overexpressing cells. DNA topoisomerase I (TOP1), an enzyme controlling DNA topology, was identified as a target of mir-24, whose expression was induced by oxidative stress. Knocking down TOP1 induced cellular senescence. These results suggest that mir-24 activity propagates stress-induced senescence by down regulating TOP1. Copyright © 2016 Elsevier Inc. All rights reserved.
Sequence variation between 462 human individuals fine-tunes functional sites of RNA processing
NASA Astrophysics Data System (ADS)
Ferreira, Pedro G.; Oti, Martin; Barann, Matthias; Wieland, Thomas; Ezquina, Suzana; Friedländer, Marc R.; Rivas, Manuel A.; Esteve-Codina, Anna; Estivill, Xavier; Guigó, Roderic; Dermitzakis, Emmanouil; Antonarakis, Stylianos; Meitinger, Thomas; Strom, Tim M.; Palotie, Aarno; François Deleuze, Jean; Sudbrak, Ralf; Lerach, Hans; Gut, Ivo; Syvänen, Ann-Christine; Gyllensten, Ulf; Schreiber, Stefan; Rosenstiel, Philip; Brunner, Han; Veltman, Joris; Hoen, Peter A. C. T.; Jan van Ommen, Gert; Carracedo, Angel; Brazma, Alvis; Flicek, Paul; Cambon-Thomsen, Anne; Mangion, Jonathan; Bentley, David; Hamosh, Ada; Rosenstiel, Philip; Strom, Tim M.; Lappalainen, Tuuli; Guigó, Roderic; Sammeth, Michael
2016-09-01
Recent advances in the cost-efficiency of sequencing technologies enabled the combined DNA- and RNA-sequencing of human individuals at the population-scale, making genome-wide investigations of the inter-individual genetic impact on gene expression viable. Employing mRNA-sequencing data from the Geuvadis Project and genome sequencing data from the 1000 Genomes Project we show that the computational analysis of DNA sequences around splice sites and poly-A signals is able to explain several observations in the phenotype data. In contrast to widespread assessments of statistically significant associations between DNA polymorphisms and quantitative traits, we developed a computational tool to pinpoint the molecular mechanisms by which genetic markers drive variation in RNA-processing, cataloguing and classifying alleles that change the affinity of core RNA elements to their recognizing factors. The in silico models we employ further suggest RNA editing can moonlight as a splicing-modulator, albeit less frequently than genomic sequence diversity. Beyond existing annotations, we demonstrate that the ultra-high resolution of RNA-Seq combined from 462 individuals also provides evidence for thousands of bona fide novel elements of RNA processing—alternative splice sites, introns, and cleavage sites—which are often rare and lowly expressed but in other characteristics similar to their annotated counterparts.
Effects of environmental noise exposure on DNA methylation in the brain and metabolic health.
Guo, Liqiong; Li, Peng-Hui; Li, Hua; Colicino, Elena; Colicino, Silvia; Wen, Yi; Zhang, Ruiping; Feng, Xiaotian; Barrow, Timothy M; Cayir, Akin; Baccarelli, Andrea A; Byun, Hyang-Min
2017-02-01
Environmental noise exposure is associated with adverse effects on human health including hearing loss, heart disease, and changes in stress-related hormone levels. Alteration in DNA methylation in response to environmental exposures is a well-known phenomenon and it is implicated in many human diseases. Understanding how environmental noise exposures affect DNA methylation patterns may help to elucidate the link between noise and adverse effects on health. In this pilot study we examined the effects of environmental noise exposure on DNA methylation of genes related to brain function and investigated whether these changes are related with metabolic health. We exposed four groups of male Wistar rats to moderate intensity noise (70-75dB with 20-4000Hz) at night for three days as short-term exposure, and for three weeks as long-term exposure. Noise exposure was limited to 45dB during the daytime. Control groups were exposed to only 45dB, day and night. We measured DNA methylation in the Bdnf, Comt, Crhr1, Mc2r, and Snca genes in tissue from four brain regions of the rats (hippocampus, frontal lobe, medulla oblongata, and inferior colliculus). Further, we measured blood pressure and body weight after long-term noise exposure. We found that environmental noise exposure is associated with gene-specific DNA methylation changes in specific regions of the brain. Changes in DNA methylation are significantly associated with changes in body weight (between Bdnf DNA methylation and Δ body weight: r=0.59, p=0.018; and between LINE-1 ORF DNA methylation and Δ body weight: =-0.80, p=0.0004). We also observed that noise exposure decreased blood pressure (p=0.038 for SBP, p=0.017 for DBP and p 0. 017 for MAP) and decreased body weight (β=-26g, p=0.008). In conclusion, environmental noise exposures can induce changes in DNA methylation in the brain, which may be associated with adverse effects upon metabolic health through modulation of response to stress-related hormones. Copyright © 2016 Elsevier Inc. All rights reserved.
Bloom, Michelle S; Koshland, Douglas; Guacci, Vincent
2018-01-01
Cohesin tethers DNA to mediate sister chromatid cohesion, chromosome condensation, and DNA repair. How the cell regulates cohesin to perform these distinct functions remains to be elucidated. One cohesin regulator, Wpl1p, was characterized in Saccharomyces cerevisiae as a promoter of efficient cohesion and an inhibitor of condensation. Wpl1p is also required for resistance to DNA-damaging agents. Here, we provide evidence that Wpl1p promotes the timely repair of DNA damage induced during S-phase. Previous studies have indicated that Wpl1p destabilizes cohesin's binding to DNA by modulating the interface between the cohesin subunits Mcd1p and Smc3p Our results suggest that Wpl1p likely modulates this interface to regulate all of cohesin's biological functions. Furthermore, we show that Wpl1p regulates cohesion and condensation through the formation of a functional complex with another cohesin-associated factor, Pds5p In contrast, Wpl1p regulates DNA repair independently of its interaction with Pds5p Together, these results suggest that Wpl1p regulates distinct biological functions of cohesin by Pds5p-dependent and -independent modulation of the Smc3p/Mcd1p interface. Copyright © 2018 by the Genetics Society of America.
Bloom, Michelle S.; Koshland, Douglas; Guacci, Vincent
2018-01-01
Cohesin tethers DNA to mediate sister chromatid cohesion, chromosome condensation, and DNA repair. How the cell regulates cohesin to perform these distinct functions remains to be elucidated. One cohesin regulator, Wpl1p, was characterized in Saccharomyces cerevisiae as a promoter of efficient cohesion and an inhibitor of condensation. Wpl1p is also required for resistance to DNA-damaging agents. Here, we provide evidence that Wpl1p promotes the timely repair of DNA damage induced during S-phase. Previous studies have indicated that Wpl1p destabilizes cohesin’s binding to DNA by modulating the interface between the cohesin subunits Mcd1p and Smc3p. Our results suggest that Wpl1p likely modulates this interface to regulate all of cohesin’s biological functions. Furthermore, we show that Wpl1p regulates cohesion and condensation through the formation of a functional complex with another cohesin-associated factor, Pds5p. In contrast, Wpl1p regulates DNA repair independently of its interaction with Pds5p. Together, these results suggest that Wpl1p regulates distinct biological functions of cohesin by Pds5p-dependent and -independent modulation of the Smc3p/Mcd1p interface. PMID:29158426
Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio
2008-01-01
Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101
Galvão, C.W.; Souza, E.M.; Etto, R.M.; Pedrosa, F.O.; Chubatsu, L.S.; Yates, M.G.; Schumacher, J.; Buck, M.; Steffens, M.B.R.
2012-01-01
DNA repair is crucial to the survival of all organisms. The bacterial RecA protein is a central component in the SOS response and in recombinational and SOS DNA repairs. The RecX protein has been characterized as a negative modulator of RecA activity in many bacteria. The recA and recX genes of Herbaspirillum seropedicae constitute a single operon, and evidence suggests that RecX participates in SOS repair. In the present study, we show that the H. seropedicae RecX protein (RecXHs) can interact with the H. seropedicae RecA protein (RecAHs) and that RecAHs possesses ATP binding, ATP hydrolyzing and DNA strand exchange activities. RecXHs inhibited 90% of the RecAHs DNA strand exchange activity even when present in a 50-fold lower molar concentration than RecAHs. RecAHs ATP binding was not affected by the addition of RecX, but the ATPase activity was reduced. When RecXHs was present before the formation of RecA filaments (RecA-ssDNA), inhibition of ATPase activity was substantially reduced and excess ssDNA also partially suppressed this inhibition. The results suggest that the RecXHs protein negatively modulates the RecAHs activities by protein-protein interactions and also by DNA-protein interactions. PMID:23044625
Strauch, Bettina Maria; Niemand, Rebecca Katharina; Winkelbeiner, Nicola Lisa; Hartwig, Andrea
2017-08-01
Nano- and microscale copper oxide particles (CuO NP, CuO MP) are applied for manifold purposes, enhancing exposure and thus the potential risk of adverse health effects. Based on the pronounced in vitro cytotoxicity of CuO NP, systematic investigations on the mode of action are required. Therefore, the impact of CuO NP, CuO MP and CuCl 2 on the DNA damage response on transcriptional level was investigated by quantitative gene expression profiling via high-throughput RT-qPCR. Cytotoxicity, copper uptake and the impact on the oxidative stress response, cell cycle regulation and apoptosis were further analysed on the functional level. Cytotoxicity of CuO NP was more pronounced when compared to CuO MP and CuCl 2 in human bronchial epithelial BEAS-2B cells. Uptake studies revealed an intracellular copper overload in the soluble fractions of both cytoplasm and nucleus, reaching up to millimolar concentrations in case of CuO NP and considerably lower levels in case of CuO MP and CuCl 2 . Moreover, CuCl 2 caused copper accumulation in the nucleus only at cytotoxic concentrations. Gene expression analysis in BEAS-2B and A549 cells revealed a strong induction of uptake-related metallothionein genes, oxidative stress-sensitive and pro-inflammatory genes, anti-oxidative defense-associated genes as well as those coding for the cell cycle inhibitor p21 and the pro-apoptotic Noxa and DR5. While DNA damage inducible genes were activated, genes coding for distinct DNA repair factors were down-regulated. Modulation of gene expression was most pronounced in case of CuO NP as compared to CuO MP and CuCl 2 and more distinct in BEAS-2B cells. GSH depletion and activation of Nrf2 in HeLa S3 cells confirmed oxidative stress induction, mainly restricted to CuO NP. Also, cell cycle arrest and apoptosis induction were most distinct for CuO NP. The high cytotoxicity and marked impact on gene expression by CuO NP can be ascribed to the strong intracellular copper ion release, with subsequent copper accumulation in the cytoplasm and the nucleus. Modulation of gene expression by CuO NP appeared to be primarily oxidative stress-related and was more pronounced in redox-sensitive BEAS-2B cells. Regarding CuCl 2 , relevant modulations of gene expression were restricted to cytotoxic concentrations provoking impaired copper homoeostasis.
Human homolog of the mouse sperm receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chamberlin, M.E.; Dean, J.
1990-08-01
The human zona pellucida, composed of three glycoproteins (ZP1, ZP2, and ZP3), forms an extracellular matrix that surrounds ovulated eggs and mediates species-specific fertilization. The genes that code for at least two of the zona proteins (ZP2 and ZP3) cross-hybridize with other mammalian DNA. The recently characterized mouse sperm receptor gene (Zp-3) was used to isolate its human homolog. The human homolog spans {approx}18.3 kilobase pairs (kbp) (compared to 8.6 kbp for the mouse gene) and contains eight exons, the sizes of which are strictly conserved between the two species. Four short (8-15 bp) sequences within the first 250 bpmore » of the 5{prime} flanking region in the human Zp-3 homolog are also present upstream of mouse Zp-3. These elements may modulate oocyte-specific gene expression. By using the polymerase chain reaction, a full-length cDNA of human ZP3 was isolated from human ovarian poly(A){sup +} RNA and used to deduce the structure of human ZP3 mRNA. Certain features of the human and mouse ZP3 transcripts are conserved. Both have unusually short 5{prime} and 3{prime} untranslated regions, both contain a single open reading frame that is 74% identical, and both code for 424 amino acid polypeptides that are 67% the same. The similarity between the two proteins may define domains that are important in maintaining the structural integrity of the zona pellucida, while the differences may play a role in mediating the species-specific events of mammalian fertilization.« less
Multi-tissue DNA methylation age predictor in mouse.
Stubbs, Thomas M; Bonder, Marc Jan; Stark, Anne-Katrien; Krueger, Felix; von Meyenn, Ferdinand; Stegle, Oliver; Reik, Wolf
2017-04-11
DNA methylation changes at a discrete set of sites in the human genome are predictive of chronological and biological age. However, it is not known whether these changes are causative or a consequence of an underlying ageing process. It has also not been shown whether this epigenetic clock is unique to humans or conserved in the more experimentally tractable mouse. We have generated a comprehensive set of genome-scale base-resolution methylation maps from multiple mouse tissues spanning a wide range of ages. Many CpG sites show significant tissue-independent correlations with age which allowed us to develop a multi-tissue predictor of age in the mouse. Our model, which estimates age based on DNA methylation at 329 unique CpG sites, has a median absolute error of 3.33 weeks and has similar properties to the recently described human epigenetic clock. Using publicly available datasets, we find that the mouse clock is accurate enough to measure effects on biological age, including in the context of interventions. While females and males show no significant differences in predicted DNA methylation age, ovariectomy results in significant age acceleration in females. Furthermore, we identify significant differences in age-acceleration dependent on the lipid content of the diet. Here we identify and characterise an epigenetic predictor of age in mice, the mouse epigenetic clock. This clock will be instrumental for understanding the biology of ageing and will allow modulation of its ticking rate and resetting the clock in vivo to study the impact on biological age.
Cancer Chemoprevention by Dietary Polyphenols: Promising Role for Epigenetics
Link, Alexander; Balaguer, Francesc; Goel, Ajay
2010-01-01
Epigenetics refers to heritable changes that are not encoded in the DNA sequence itself, but play an important role in the control of gene expression. In mammals, epigenetic mechanisms include changes in DNA methylation, histone modifications and non-coding RNAs. Although epigenetic changes are heritable in somatic cells, these modifications are also potentially reversible, which makes them attractive and promising avenues for tailoring cancer preventive and therapeutic strategies. Burgeoning evidence in the last decade has provided unprecedented clues that diet and environmental factors directly influence epigenetic mechanisms in humans. Dietary polyphenols from green tea, turmeric, soybeans, broccoli and others have shown to possess multiple cell-regulatory activities within cancer cells. More recently, we have begun to understand that some of the dietary polyphenols may exert their chemopreventive effects in part by modulating various components of the epigenetic machinery in humans. In this article, we first discuss the contribution of diet and environmental factors on epigenetic alterations; subsequently, we provide a comprehensive review of literature on the role of various dietary polyphenols. In particular, we summarize the current knowledge on a large number of dietary agents and their effects on DNA methylation, histone modifications and regulation of expression of non-coding miRNAs in various in vitro and in vivo models. We emphasize how increased understanding of the chemopreventive effects of dietary polyphenols on specific epigenetic alterations may provide unique and yet unexplored novel and highly effective chemopreventive strategies for reducing the health burden of cancer and other diseases in humans. PMID:20599773
Seco, Elena M.
2017-01-01
Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448
Mariani, Luca; Weinand, Kathryn; Vedenko, Anastasia; Barrera, Luis A; Bulyk, Martha L
2017-09-27
Transcription factors (TFs) control cellular processes by binding specific DNA motifs to modulate gene expression. Motif enrichment analysis of regulatory regions can identify direct and indirect TF binding sites. Here, we created a glossary of 108 non-redundant TF-8mer "modules" of shared specificity for 671 metazoan TFs from publicly available and new universal protein binding microarray data. Analysis of 239 ENCODE TF chromatin immunoprecipitation sequencing datasets and associated RNA sequencing profiles suggest the 8mer modules are more precise than position weight matrices in identifying indirect binding motifs and their associated tethering TFs. We also developed GENRE (genomically equivalent negative regions), a tunable tool for construction of matched genomic background sequences for analysis of regulatory regions. GENRE outperformed four state-of-the-art approaches to background sequence construction. We used our TF-8mer glossary and GENRE in the analysis of the indirect binding motifs for the co-occurrence of tethering factors, suggesting novel TF-TF interactions. We anticipate that these tools will aid in elucidating tissue-specific gene-regulatory programs. Copyright © 2017 Elsevier Inc. All rights reserved.
Substrate sequence selectivity of APOBEC3A implicates intra-DNA interactions.
Silvas, Tania V; Hou, Shurong; Myint, Wazo; Nalivaika, Ellen; Somasundaran, Mohan; Kelch, Brian A; Matsuo, Hiroshi; Kurt Yilmaz, Nese; Schiffer, Celia A
2018-05-14
The APOBEC3 (A3) family of human cytidine deaminases is renowned for providing a first line of defense against many exogenous and endogenous retroviruses. However, the ability of these proteins to deaminate deoxycytidines in ssDNA makes A3s a double-edged sword. When overexpressed, A3s can mutate endogenous genomic DNA resulting in a variety of cancers. Although the sequence context for mutating DNA varies among A3s, the mechanism for substrate sequence specificity is not well understood. To characterize substrate specificity of A3A, a systematic approach was used to quantify the affinity for substrate as a function of sequence context, length, secondary structure, and solution pH. We identified the A3A ssDNA binding motif as (T/C)TC(A/G), which correlated with enzymatic activity. We also validated that A3A binds RNA in a sequence specific manner. A3A bound tighter to substrate binding motif within a hairpin loop compared to linear oligonucleotide, suggesting A3A affinity is modulated by substrate structure. Based on these findings and previously published A3A-ssDNA co-crystal structures, we propose a new model with intra-DNA interactions for the molecular mechanism underlying A3A sequence preference. Overall, the sequence and structural preferences identified for A3A leads to a new paradigm for identifying A3A's involvement in mutation of endogenous or exogenous DNA.
Disabling Cas9 by an anti-CRISPR DNA mimic.
Shin, Jiyung; Jiang, Fuguo; Liu, Jun-Jie; Bray, Nicolas L; Rauch, Benjamin J; Baik, Seung Hyun; Nogales, Eva; Bondy-Denomy, Joseph; Corn, Jacob E; Doudna, Jennifer A
2017-07-01
CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 gene editing technology is derived from a microbial adaptive immune system, where bacteriophages are often the intended target. Natural inhibitors of CRISPR-Cas9 enable phages to evade immunity and show promise in controlling Cas9-mediated gene editing in human cells. However, the mechanism of CRISPR-Cas9 inhibition is not known, and the potential applications for Cas9 inhibitor proteins in mammalian cells have not been fully established. We show that the anti-CRISPR protein AcrIIA4 binds only to assembled Cas9-single-guide RNA (sgRNA) complexes and not to Cas9 protein alone. A 3.9 Å resolution cryo-electron microscopy structure of the Cas9-sgRNA-AcrIIA4 complex revealed that the surface of AcrIIA4 is highly acidic and binds with a 1:1 stoichiometry to a region of Cas9 that normally engages the DNA protospacer adjacent motif. Consistent with this binding mode, order-of-addition experiments showed that AcrIIA4 interferes with DNA recognition but has no effect on preformed Cas9-sgRNA-DNA complexes. Timed delivery of AcrIIA4 into human cells as either protein or expression plasmid allows on-target Cas9-mediated gene editing while reducing off-target edits. These results provide a mechanistic understanding of AcrIIA4 function and demonstrate that inhibitors can modulate the extent and outcomes of Cas9-mediated gene editing.
Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA
2005-09-01
tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such
Jawhari, Anass; Boussert, Stéphanie; Lamour, Valérie; Atkinson, R Andrew; Kieffer, Bruno; Poch, Olivier; Potier, Noelle; van Dorsselaer, Alain; Moras, Dino; Poterszman, Arnaud
2004-11-16
TFIIH is a multiprotein complex that plays a central role in both transcription and DNA repair. The subunit p62 is a structural component of the TFIIH core that is known to interact with VP16, p53, Eralpha, and E2F1 in the context of activated transcription, as well as with the endonuclease XPG in DNA repair. We used limited proteolysis experiments coupled to mass spectrometry to define structural domains within the conserved N-terminal part of the molecule. The first domain identified resulted from spontaneous proteolysis and corresponds to residues 1-108. The second domain encompasses residues 186-240, and biophysical characterization by fluorescence studies and NMR analysis indicated that it is at least partially folded and thus may correspond to a structural entity. This module contains a region of high sequence conservation with an invariant FWxxPhiPhi motif (Phi representing either tyrosine or phenylalanine), which was also found in other protein families and could play a key role as a protein-protein recognition module within TFIIH. The approach used in this study is general and can be straightforwardly applied to other multidomain proteins and/or multiprotein assemblies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Potier, M.C.; Dutriaux, A.; Lambolez, B.
1993-03-01
Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boothman, D.A.
Transformed Chinese hamster embryo fibroblasts (CHEF), which gradually increase in tumor-forming ability in nude mice, were isolated from normal diploid CHEF/18 cells. Transformed CHEF cells (i.e., T30-4 > 21-2M3 > 21-2 > normal CHEF/18) showed gradual increases in potentially lethal damage (PLD) survival recovery. {beta}-Lapachone and camptothecin, modulators of topoisomerase I (Topo I) activity, not only prevented survival recovery in normal as well as in tumor cells, but enhanced unscheduled DNA synthesis. These seemingly conflicting results are due to the fact that Topo I activity can be modulated by inhibitors to convert single-stranded DNA lesions into double-stranded breaks. Increases inmore » unscheduled DNA synthesis may result from a continual supply of free ends, on which DNA repair processes may act. Altering Topo I activity with modulators appears to increase X-ray lethality via a DNA lesion modification suicide pathway. Cells down-regulate Topo I immediately after ionizing radiation to prevent Topo I-mediated lesion modification and to enhance survival recovery. 16 refs., 3 figs., 1 tab.« less
Selvi B, Ruthrotha; Pradhan, Suman Kalyan; Shandilya, Jayasha; Das, Chandrima; Sailaja, Badi Sri; Shankar G, Naga; Gadad, Shrikanth S; Reddy, Ashok; Dasgupta, Dipak; Kundu, Tapas K
2009-02-27
DNA-binding anticancer agents cause alteration in chromatin structure and dynamics. We report the dynamic interaction of the DNA intercalator and potential anticancer plant alkaloid, sanguinarine (SGR), with chromatin. Association of SGR with different levels of chromatin structure was enthalpy driven with micromolar dissociation constant. Apart from DNA, it binds with comparable affinity with core histones and induces chromatin aggregation. The dual binding property of SGR leads to inhibition of core histone modifications. Although it potently inhibits H3K9 methylation by G9a in vitro, H3K4 and H3R17 methylation are more profoundly inhibited in cells. SGR inhibits histone acetylation both in vitro and in vivo. It does not affect the in vitro transcription from DNA template but significantly represses acetylation-dependent chromatin transcription. SGR-mediated repression of epigenetic marks and the alteration of chromatin geography (nucleography) also result in the modulation of global gene expression. These data, conclusively, show an anticancer DNA binding intercalator as a modulator of chromatin modifications and transcription in the chromatin context.
Risk assessment of DNA-reactive carcinogens in food.
Jeffrey, A M; Williams, G M
2005-09-01
Risk assessment of DNA-reactive carcinogens in food requires knowledge of the extent of DNA damage in the target organ which results from the competition between DNA adduct formation and repair. Estimates of DNA adduct levels can be made by direct measurement or indirectly as a consequence of their presence, for example, by tumor formation in animal models or exposed populations epidemiologically. Food-borne DNA-reactive carcinogens are present from a variety of sources. They are generally not intrinsically DNA-reactive but require bioactivation to DNA-reactive metabolites a process which may be modulated by the compound itself or the presence of other xenobiotics. A single DNA reactant may form several distinct DNA adducts each undergoing different rates of repair. Some DNA reactants may be photochemically activated or produce reactive oxygen species and thus indirect oxidative DNA damage. The levels of DNA adducts arising from exposures influenced by variations in the doses, the frequency with which an individual is exposed, and rates of DNA repair for specific adducts. Each adduct has a characteristic efficiency with which it induces mutations. Based on experience with the well-studied DNA-reactive food carcinogen aflatoxin B(1) (AFB(1)), a limit of 20 ppb or approximately 30 microg/day has been set and is considered a tolerable daily intake (TDI). Since AFB(1) is considered a potent carcinogen, doses of <1.5 microg of unknown compounds are considered TDIs. Most DNA-reactants, including acrylamide, heterocyclic amines, and alpha,beta-unsaturated carbonyl are below this value. Above that value, measurement of actual DNA adducts levels in either experimental animals with a risk assessment, or, when this occurs, exposed humans are needed. A number of approaches to undertake this are described including immunological, mass spectrometric and (32)P-postlabeling or the use of surrogates such as hemoglobin adducts, together with approaches to evaluate the results. A discussion of approaches to estimating possible threshold effects for DNA-reactive carcinogens is made.
Risk assessment of DNA-reactive carcinogens in food
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jeffrey, A.M.; Williams, G.M.
2005-09-01
Risk assessment of DNA-reactive carcinogens in food requires knowledge of the extent of DNA damage in the target organ which results from the competition between DNA adduct formation and repair. Estimates of DNA adduct levels can be made by direct measurement or indirectly as a consequence of their presence, for example, by tumor formation in animal models or exposed populations epidemiologically. Food-borne DNA-reactive carcinogens are present from a variety of sources. They are generally not intrinsically DNA-reactive but require bioactivation to DNA-reactive metabolites a process which may be modulated by the compound itself or the presence of other xenobiotics. Amore » single DNA reactant may form several distinct DNA adducts each undergoing different rates of repair. Some DNA reactants may be photochemically activated or produce reactive oxygen species and thus indirect oxidative DNA damage. The levels of DNA adducts arising from exposures influenced by variations in the doses, the frequency with which an individual is exposed, and rates of DNA repair for specific adducts. Each adduct has a characteristic efficiency with which it induces mutations. Based on experience with the well-studied DNA-reactive food carcinogen aflatoxin B{sub 1} (AFB{sub 1}), a limit of 20 ppb or {approx}30 {mu}g/day has been set and is considered a tolerable daily intake (TDI). Since AFB{sub 1} is considered a potent carcinogen, doses of <1.5 {mu}g of unknown compounds are considered TDIs. Most DNA-reactants, including acrylamide, heterocyclic amines, and {alpha},{beta}-unsaturated carbonyl are below this value. Above that value, measurement of actual DNA adducts levels in either experimental animals with a risk assessment, or, when this occurs, exposed humans are needed. A number of approaches to undertake this are described including immunological, mass spectrometric and {sup 32}P-postlabeling or the use of surrogates such as hemoglobin adducts, together with approaches to evaluate the results. A discussion of approaches to estimating possible threshold effects for DNA-reactive carcinogens is made.« less
Yan, Li; Liu, Song; Tang, Li; Hu, Qiang; Morrison, Carl D.; Ambrosone, Christine B.; Higgins, Michael J.; Sucheston-Campbell, Lara E.
2017-01-01
Background DNA from archival formalin-fixed and paraffin embedded (FFPE) tissue is an invaluable resource for genome-wide methylation studies although concerns about poor quality may limit its use. In this study, we compared DNA methylation profiles of breast tumors using DNA from fresh-frozen (FF) tissues and three types of matched FFPE samples. Results For 9/10 patients, correlation and unsupervised clustering analysis revealed that the FF and FFPE samples were consistently correlated with each other and clustered into distinct subgroups. Greater than 84% of the top 100 loci previously shown to differentiate ER+ and ER– tumors in FF tissues were also FFPE DML. Weighted Correlation Gene Network Analyses (WCGNA) grouped the DML loci into 16 modules in FF tissue, with ~85% of the module membership preserved across tissue types. Materials and Methods Restored FFPE and matched FF samples were profiled using the Illumina Infinium HumanMethylation450K platform. Methylation levels (β-values) across all loci and the top 100 loci previously shown to differentiate tumors by estrogen receptor status (ER+ or ER−) in a larger FF study, were compared between matched FF and FFPE samples using Pearson's correlation, hierarchical clustering and WCGNA. Positive predictive values and sensitivity levels for detecting differentially methylated loci (DML) in FF samples were calculated in an independent FFPE cohort. Conclusions FFPE breast tumors samples show lower overall detection of DMLs versus FF, however FFPE and FF DMLs compare favorably. These results support the emerging consensus that the 450K platform can be employed to investigate epigenetics in large sets of archival FFPE tissues. PMID:28118602
Copine-I: Modulator of NF-kappa B Transcription and Prostate Cancer Survival
2008-01-01
that are evolutionally conserved from Arabidopsis to Homo sapiens . Nine human copine family members have been identified (Tomsig and Creutz, 2002...Although p65:p65 homodimers are not believed to display the same high affinity for DNA as the p65:p50 heterodimer, both homo - and heterodimers...Stables VC Co pi ne M yr -C op in e Copine-I TNF Treatment (hr) R el at iv e C o p y 0 400 800 1200 1600 2000 0 0.5 1 2 4 IL-8 :VC :Copine-I
Wang, Yihan; Zhang, Jingyu; Xiao, Xingjun; Liu, Hongbo; Wang, Fang; Li, Song; Wen, Yanhua; Wei, Yanjun; Su, Jianzhong; Zhang, Yunming; Zhang, Yan
2016-03-07
As one of the most widely studied epigenetic modifications, DNA methylation has an important influence on human traits and cancers. Dynamic variations in DNA methylation have been reported in malignant neoplasm and aging; however, the mechanisms remain poorly understood. By constructing an age-associated and cancer-related weighted network (ACWN) based on the correlation of the methylation level and the protein-protein interaction, we found that DNA methylation changes associated with age were closely related to the occurrence of cancer. Additional analysis of 102 module genes mined from the ACWN revealed discrimination based on two main patterns. One pattern involved methylation levels that increased with aging and were higher in cancer patients compared with normal controls (HH pattern). The other pattern involved methylation levels that decreased with aging and were lower in cancer compared with normal (LL pattern). Upon incorporation with gene expression levels, 25 genes were filtered based on negative regulation by DNA methylation. These genes were regarded as potential cancer risk markers that were influenced by age in the process of carcinogenesis. Our results will facilitate further studies regarding the impact of the epigenetic effects of aging on diseases and will aid in the development of tailored cancer preventive strategies.
Wang, Yihan; Zhang, Jingyu; Xiao, Xingjun; Liu, Hongbo; Wang, Fang; Li, Song; Wen, Yanhua; Wei, Yanjun; Su, Jianzhong; Zhang, Yunming; Zhang, Yan
2016-01-01
As one of the most widely studied epigenetic modifications, DNA methylation has an important influence on human traits and cancers. Dynamic variations in DNA methylation have been reported in malignant neoplasm and aging; however, the mechanisms remain poorly understood. By constructing an age-associated and cancer-related weighted network (ACWN) based on the correlation of the methylation level and the protein-protein interaction, we found that DNA methylation changes associated with age were closely related to the occurrence of cancer. Additional analysis of 102 module genes mined from the ACWN revealed discrimination based on two main patterns. One pattern involved methylation levels that increased with aging and were higher in cancer patients compared with normal controls (HH pattern). The other pattern involved methylation levels that decreased with aging and were lower in cancer compared with normal (LL pattern). Upon incorporation with gene expression levels, 25 genes were filtered based on negative regulation by DNA methylation. These genes were regarded as potential cancer risk markers that were influenced by age in the process of carcinogenesis. Our results will facilitate further studies regarding the impact of the epigenetic effects of aging on diseases and will aid in the development of tailored cancer preventive strategies. PMID:26949191
GoldenBraid: An Iterative Cloning System for Standardized Assembly of Reusable Genetic Modules
Sarrion-Perdigones, Alejandro; Falconi, Erica Elvira; Zandalinas, Sara I.; Juárez, Paloma; Fernández-del-Carmen, Asun; Granell, Antonio; Orzaez, Diego
2011-01-01
Synthetic Biology requires efficient and versatile DNA assembly systems to facilitate the building of new genetic modules/pathways from basic DNA parts in a standardized way. Here we present GoldenBraid (GB), a standardized assembly system based on type IIS restriction enzymes that allows the indefinite growth of reusable gene modules made of standardized DNA pieces. The GB system consists of a set of four destination plasmids (pDGBs) designed to incorporate multipartite assemblies made of standard DNA parts and to combine them binarily to build increasingly complex multigene constructs. The relative position of type IIS restriction sites inside pDGB vectors introduces a double loop (“braid”) topology in the cloning strategy that allows the indefinite growth of composite parts through the succession of iterative assembling steps, while the overall simplicity of the system is maintained. We propose the use of GoldenBraid as an assembly standard for Plant Synthetic Biology. For this purpose we have GB-adapted a set of binary plasmids for A. tumefaciens-mediated plant transformation. Fast GB-engineering of several multigene T-DNAs, including two alternative modules made of five reusable devices each, and comprising a total of 19 basic parts are also described. PMID:21750718
GoldenBraid: an iterative cloning system for standardized assembly of reusable genetic modules.
Sarrion-Perdigones, Alejandro; Falconi, Erica Elvira; Zandalinas, Sara I; Juárez, Paloma; Fernández-del-Carmen, Asun; Granell, Antonio; Orzaez, Diego
2011-01-01
Synthetic Biology requires efficient and versatile DNA assembly systems to facilitate the building of new genetic modules/pathways from basic DNA parts in a standardized way. Here we present GoldenBraid (GB), a standardized assembly system based on type IIS restriction enzymes that allows the indefinite growth of reusable gene modules made of standardized DNA pieces. The GB system consists of a set of four destination plasmids (pDGBs) designed to incorporate multipartite assemblies made of standard DNA parts and to combine them binarily to build increasingly complex multigene constructs. The relative position of type IIS restriction sites inside pDGB vectors introduces a double loop ("braid") topology in the cloning strategy that allows the indefinite growth of composite parts through the succession of iterative assembling steps, while the overall simplicity of the system is maintained. We propose the use of GoldenBraid as an assembly standard for Plant Synthetic Biology. For this purpose we have GB-adapted a set of binary plasmids for A. tumefaciens-mediated plant transformation. Fast GB-engineering of several multigene T-DNAs, including two alternative modules made of five reusable devices each, and comprising a total of 19 basic parts are also described.
Bonham, Andrew J.; Wenta, Nikola; Osslund, Leah M.; Prussin, Aaron J.; Vinkemeier, Uwe; Reich, Norbert O.
2013-01-01
The DNA-binding specificity and affinity of the dimeric human transcription factor (TF) STAT1, were assessed by total internal reflectance fluorescence protein-binding microarrays (TIRF-PBM) to evaluate the effects of protein phosphorylation, higher-order polymerization and small-molecule inhibition. Active, phosphorylated STAT1 showed binding preferences consistent with prior characterization, whereas unphosphorylated STAT1 showed a weak-binding preference for one-half of the GAS consensus site, consistent with recent models of STAT1 structure and function in response to phosphorylation. This altered-binding preference was further tested by use of the inhibitor LLL3, which we show to disrupt STAT1 binding in a sequence-dependent fashion. To determine if this sequence-dependence is specific to STAT1 and not a general feature of human TF biology, the TF Myc/Max was analysed and tested with the inhibitor Mycro3. Myc/Max inhibition by Mycro3 is sequence independent, suggesting that the sequence-dependent inhibition of STAT1 may be specific to this system and a useful target for future inhibitor design. PMID:23180800
Substrate Specificity of Human Protein Arginine Methyltransferase 7 (PRMT7)
Feng, You; Hadjikyriacou, Andrea; Clarke, Steven G.
2014-01-01
Protein arginine methyltransferase 7 (PRMT7) methylates arginine residues on various protein substrates and is involved in DNA transcription, RNA splicing, DNA repair, cell differentiation, and metastasis. The substrate sequences it recognizes in vivo and the enzymatic mechanism behind it, however, remain to be explored. Here we characterize methylation catalyzed by a bacterially expressed GST-tagged human PRMT7 fusion protein with a broad range of peptide and protein substrates. After confirming its type III activity generating only ω-NG-monomethylarginine and its distinct substrate specificity for RXR motifs surrounded by basic residues, we performed site-directed mutagenesis studies on this enzyme, revealing that two acidic residues within the double E loop, Asp-147 and Glu-149, modulate the substrate preference. Furthermore, altering a single acidic residue, Glu-478, on the C-terminal domain to glutamine nearly abolished the activity of the enzyme. Additionally, we demonstrate that PRMT7 has unusual temperature dependence and salt tolerance. These results provide a biochemical foundation to understanding the broad biological functions of PRMT7 in health and disease. PMID:25294873
Deegan, Brian J.; Bona, Anna M.; Bhat, Vikas; Mikles, David C.; McDonald, Caleb B.; Seldeen, Kenneth L.; Farooq, Amjad
2011-01-01
Estrogen receptor α (ERα) acts as a transcription factor by virtue of the ability of its DNA-binding (DB) domain, comprised of a tandem pair of zinc fingers, to recognize the estrogen response element (ERE) within the promoters of target genes. Herein, using an array of biophysical methods, we probe structural consequences of the replacement of zinc within the DB domain of ERα with various environmental metals and their effects on the thermodynamics of binding to DNA. Our data reveal that while the DB domain reconstituted with divalent ions of zinc, cadmium, mercury and cobalt binds to DNA with affinities in the nanomolar range, divalent ions of barium, copper, iron, lead, manganese, nickel and tin are unable to regenerate DB domain with DNA-binding potential though they can compete with zinc for coordinating the cysteine ligands within the zinc fingers. We also show that the metal-free DB domain is a homodimer in solution and that the binding of various metals only results in subtle secondary and tertiary structural changes, implying that metal-coordination may only be essential for DNA-binding. Collectively, our findings provide mechanistic insights into how environmental metals may modulate the physiological function of a key nuclear receptor involved in mediating a plethora of cellular functions central to human health and disease. PMID:22038807
Cui, Shanshan; Li, Wen; Lv, Xin; Wang, Pengyan; Gao, Yuxia; Huang, Guowei
2017-01-01
The pathogenesis of atherosclerosis has been partly acknowledged to result from aberrant epigenetic mechanisms. Accordingly, low folate levels are considered to be a contributing factor to promoting vascular disease because of deregulation of DNA methylation. We hypothesized that increasing the levels of folic acid may act via an epigenetic gene silencing mechanism to ameliorate atherosclerosis. Here, we investigated the atheroprotective effects of folic acid and the resultant methylation status in high-fat diet-fed ApoE knockout mice and in oxidized low-density lipoprotein-treated human umbilical vein endothelial cells. We analyzed atherosclerotic lesion histology, folate concentration, homocysteine concentration, S-adenosylmethionine (SAM) and S-adenosylhomocysteine (SAH), and DNA methyltransferase activity, as well as monocyte chemotactic protein-1 (MCP1) and vascular endothelial growth factor (VEGF) expression and promoter methylation. Folic acid reduced atherosclerotic lesion size in ApoE knockout mice. The underlying folic acid protective mechanism appears to operate through regulating the normal homocysteine state, upregulating the SAM: SAH ratio, elevating DNA methyltransferase activity and expression, altering MCP1 and VEGF promoter methylation, and inhibiting MCP1 and VEGF expression. We conclude that folic acid supplementation effectively prevented atherosclerosis by modifying DNA methylation through the methionine cycle, improving DNA methyltransferase activity and expression, and thus changing the expression of atherosclerosis-related genes. PMID:28475147
Attenuated DNA damage repair by trichostatin A through BRCA1 suppression.
Zhang, Yin; Carr, Theresa; Dimtchev, Alexandre; Zaer, Naghmeh; Dritschilo, Anatoly; Jung, Mira
2007-07-01
Recent studies have demonstrated that some histone deacetylase (HDAC) inhibitors enhance cellular radiation sensitivity. However, the underlying mechanism for such a radiosensitizing effect remains unexplored. Here we show evidence that treatment with the HDAC inhibitor trichostatin A (TSA) impairs radiation-induced repair of DNA damage. The effect of TSA on the kinetics of DNA damage repair was measured by performing the comet assay and gamma-H2AX focus analysis in radioresistant human squamous carcinoma cells (SQ-20B). TSA exposure increased the amount of radiation-induced DNA damage and slowed the repair kinetics. Gene expression profiling also revealed that a majority of the genes that control cell cycle, DNA replication and damage repair processes were down-regulated after TSA exposure, including BRCA1. The involvement of BRCA1 was further demonstrated by expressing ectopic wild-type BRCA1 in a BRCA1 null cell line (HCC-1937). TSA treatment enhanced radiation sensitivity of HCC-1937/wtBRCA1 clonal cells, which restored cellular radiosensitivity (D(0) = 1.63 Gy), to the control level (D(0) = 1.03 Gy). However, TSA had no effect on the level of radiosensitivity of BRCA1 null cells. Our data demonstrate for the first time that TSA treatment modulates the radiation-induced DNA damage repair process, in part by suppressing BRCA1 gene expression, suggesting that BRCA1 is one of molecular targets of TSA.
Efficient targeted DNA methylation with chimeric dCas9-Dnmt3a-Dnmt3L methyltransferase.
Stepper, Peter; Kungulovski, Goran; Jurkowska, Renata Z; Chandra, Tamir; Krueger, Felix; Reinhardt, Richard; Reik, Wolf; Jeltsch, Albert; Jurkowski, Tomasz P
2017-02-28
DNA methylation plays a critical role in the regulation and maintenance of cell-type specific transcriptional programs. Targeted epigenome editing is an emerging technology to specifically regulate cellular gene expression in order to modulate cell phenotypes or dissect the epigenetic mechanisms involved in their control. In this work, we employed a DNA methyltransferase Dnmt3a-Dnmt3L construct fused to the nuclease-inactivated dCas9 programmable targeting domain to introduce DNA methylation into the human genome specifically at the EpCAM, CXCR4 and TFRC gene promoters. We show that targeting of these loci with single gRNAs leads to efficient and widespread methylation of the promoters. Multiplexing of several guide RNAs does not increase the efficiency of methylation. Peaks of targeted methylation were observed around 25 bp upstream and 40 bp downstream of the PAM site, while 20-30 bp of the binding site itself are protected against methylation. Potent methylation is dependent on the multimerization of Dnmt3a/Dnmt3L complexes on the DNA. Furthermore, the introduced methylation causes transcriptional repression of the targeted genes. These new programmable epigenetic editors allow unprecedented control of the DNA methylation status in cells and will lead to further advances in the understanding of epigenetic signaling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Chang, Lun-Ching; Jamain, Stephane; Lin, Chien-Wei; Rujescu, Dan; Tseng, George C; Sibille, Etienne
2014-01-01
Large scale gene expression (transcriptome) analysis and genome-wide association studies (GWAS) for single nucleotide polymorphisms have generated a considerable amount of gene- and disease-related information, but heterogeneity and various sources of noise have limited the discovery of disease mechanisms. As systematic dataset integration is becoming essential, we developed methods and performed meta-clustering of gene coexpression links in 11 transcriptome studies from postmortem brains of human subjects with major depressive disorder (MDD) and non-psychiatric control subjects. We next sought enrichment in the top 50 meta-analyzed coexpression modules for genes otherwise identified by GWAS for various sets of disorders. One coexpression module of 88 genes was consistently and significantly associated with GWAS for MDD, other neuropsychiatric disorders and brain functions, and for medical illnesses with elevated clinical risk of depression, but not for other diseases. In support of the superior discriminative power of this novel approach, we observed no significant enrichment for GWAS-related genes in coexpression modules extracted from single studies or in meta-modules using gene expression data from non-psychiatric control subjects. Genes in the identified module encode proteins implicated in neuronal signaling and structure, including glutamate metabotropic receptors (GRM1, GRM7), GABA receptors (GABRA2, GABRA4), and neurotrophic and development-related proteins [BDNF, reelin (RELN), Ephrin receptors (EPHA3, EPHA5)]. These results are consistent with the current understanding of molecular mechanisms of MDD and provide a set of putative interacting molecular partners, potentially reflecting components of a functional module across cells and biological pathways that are synchronously recruited in MDD, other brain disorders and MDD-related illnesses. Collectively, this study demonstrates the importance of integrating transcriptome data, gene coexpression modules and GWAS results for providing novel and complementary approaches to investigate the molecular pathology of MDD and other complex brain disorders.
Poirier, Enzo Z; Goic, Bertsy; Tomé-Poderti, Lorena; Frangeul, Lionel; Boussier, Jérémy; Gausson, Valérie; Blanc, Hervé; Vallet, Thomas; Loyd, Hyelee; Levi, Laura I; Lanciano, Sophie; Baron, Chloé; Merkling, Sarah H; Lambrechts, Louis; Mirouze, Marie; Carpenter, Susan; Vignuzzi, Marco; Saleh, Maria-Carla
2018-03-14
The RNAi pathway confers antiviral immunity in insects. Virus-specific siRNA responses are amplified via the reverse transcription of viral RNA to viral DNA (vDNA). The nature, biogenesis, and regulation of vDNA are unclear. We find that vDNA produced during RNA virus infection of Drosophila and mosquitoes is present in both linear and circular forms. Circular vDNA (cvDNA) is sufficient to produce siRNAs that confer partially protective immunity when challenged with a cognate virus. cvDNAs bear homology to defective viral genomes (DVGs), and DVGs serve as templates for vDNA and cvDNA synthesis. Accordingly, DVGs promote the amplification of vDNA-mediated antiviral RNAi responses in infected Drosophila. Furthermore, vDNA synthesis is regulated by the DExD/H helicase domain of Dicer-2 in a mechanism distinct from its role in siRNA generation. We suggest that, analogous to mammalian RIG-I-like receptors, Dicer-2 functions like a pattern recognition receptor for DVGs to modulate antiviral immunity in insects. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Downregulation of VRK1 by p53 in Response to DNA Damage Is Mediated by the Autophagic Pathway
Valbuena, Alberto; Castro-Obregón, Susana; Lazo, Pedro A.
2011-01-01
Human VRK1 induces a stabilization and accumulation of p53 by specific phosphorylation in Thr18. This p53 accumulation is reversed by its downregulation mediated by Hdm2, requiring a dephosphorylated p53 and therefore also needs the removal of VRK1 as stabilizer. This process requires export of VRK1 to the cytosol and is inhibited by leptomycin B. We have identified that downregulation of VRK1 protein levels requires DRAM expression, a p53-induced gene. DRAM is located in the endosomal-lysosomal compartment. Induction of DNA damage by UV, IR, etoposide and doxorubicin stabilizes p53 and induces DRAM expression, followed by VRK1 downregulation and a reduction in p53 Thr18 phosphorylation. DRAM expression is induced by wild-type p53, but not by common human p53 mutants, R175H, R248W and R273H. Overexpression of DRAM induces VRK1 downregulation and the opposite effect was observed by its knockdown. LC3 and p62 were also downregulated, like VRK1, in response to UV-induced DNA damage. The implication of the autophagic pathway was confirmed by its requirement for Beclin1. We propose a model with a double regulatory loop in response to DNA damage, the accumulated p53 is removed by induction of Hdm2 and degradation in the proteasome, and the p53-stabilizer VRK1 is eliminated by the induction of DRAM that leads to its lysosomal degradation in the autophagic pathway, and thus permitting p53 degradation by Hdm2. This VRK1 downregulation is necessary to modulate the block in cell cycle progression induced by p53 as part of its DNA damage response. PMID:21386980
HPV-18 E6 mutants reveal p53 modulation of viral DNA amplification in organotypic cultures
Kho, Eun-Young; Wang, Hsu-Kun; Banerjee, N. Sanjib; Broker, Thomas R.; Chow, Louise T.
2013-01-01
Human papillomaviruses (HPVs) amplify in differentiated strata of a squamous epithelium. The HPV E7 protein destabilizes the p130/retinoblastoma susceptibility protein family of tumor suppressors and reactivates S-phase reentry, thereby facilitating viral DNA amplification. The high-risk HPV E6 protein destabilizes the p53 tumor suppressor and many other host proteins. However, the critical E6 targets relevant to viral DNA amplification have not been identified, because functionally significant E6 mutants are not stably maintained in transfected cells. Using Cre-loxP recombination, which efficiently generates HPV genomic plasmids in transfected primary human keratinocytes, we have recapitulated a highly productive infection of HPV-18 in organotypic epithelial cultures. By using this system, we now report the characterization of four HPV-18 E6 mutations. An E6 null mutant accumulated high levels of p53 and amplified very poorly. p53 siRNA or ectopic WT E6 partially restored amplification, whereas three missense E6 mutations that did not effectively destabilize p53 complemented the null mutant poorly. Unexpectedly, in cis, two of the missense mutants amplified, albeit to a lower extent than the WT and only in cells with undetectable p53. These observations and others implicate p53 and additional host proteins in regulating viral DNA amplification and also suggest an inhibitory effect of E6 overexpression. We show that high levels of viral DNA amplification are critical for late protein expression and report several previously undescribed viral RNAs, including bicistronic transcripts predicted to encode E5 and L2 or an alternative form of E1^E4 and L1. PMID:23572574
Kacprzyk, Lukasz A; Laible, Mark; Andrasiuk, Tatjana; Brase, Jan C; Börno, Stefan T; Fälth, Maria; Kuner, Ruprecht; Lehrach, Hans; Schweiger, Michal R; Sültmann, Holger
2013-01-01
Overexpression of ERG transcription factor due to genomic ERG-rearrangements defines a separate molecular subtype of prostate tumors. One of the consequences of ERG accumulation is modulation of the cell's gene expression profile. Tudor domain-containing protein 1 gene (TDRD1) was reported to be differentially expressed between TMPRSS2:ERG-negative and TMPRSS2:ERG-positive prostate cancer. The aim of our study was to provide a mechanistic explanation for the transcriptional activation of TDRD1 in ERG rearrangement-positive prostate tumors. Gene expression measurements by real-time quantitative PCR revealed a remarkable co-expression of TDRD1 and ERG (r(2) = 0.77) but not ETV1 (r(2)<0.01) in human prostate cancer in vivo. DNA methylation analysis by MeDIP-Seq and bisulfite sequencing showed that TDRD1 expression is inversely correlated with DNA methylation at the TDRD1 promoter in vitro and in vivo (ρ = -0.57). Accordingly, demethylation of the TDRD1 promoter in TMPRSS2:ERG-negative prostate cancer cells by DNA methyltransferase inhibitors resulted in TDRD1 induction. By manipulation of ERG dosage through gene silencing and forced expression we show that ERG governs loss of DNA methylation at the TDRD1 promoter-associated CpG island, leading to TDRD1 overexpression. We demonstrate that ERG is capable of disrupting a tissue-specific DNA methylation pattern at the TDRD1 promoter. As a result, TDRD1 becomes transcriptionally activated in TMPRSS2:ERG-positive prostate cancer. Given the prevalence of ERG fusions, TDRD1 overexpression is a common alteration in human prostate cancer which may be exploited for diagnostic or therapeutic procedures.
Dietary modulation of the biotransformation and genotoxicity of aflatoxin B(1).
Gross-Steinmeyer, Kerstin; Eaton, David L
2012-09-28
Diet and its various components are consistently identified as among the most important 'risk factors' for cancer worldwide, yet great uncertainty remains regarding the relative contribution of nutritive (e.g., vitamins, calories) vs. non-nutritive (e.g., phytochemicals, fiber, contaminants) factors in both cancer induction and cancer prevention. Among the most potent known human dietary carcinogens is the mycotoxin, aflatoxin B(1) (AFB). AFB and related aflatoxins are produced as secondary metabolites by the molds Aspergillus flavus and Aspergillus parasiticus that commonly infect poorly stored foods including peanuts, pistachios, corn, and rice. AFB is a potent hepatocarcinogenic agent in numerous animal species, and has been implicated in the etiology of human hepatocellular carcinoma. Recent research has shown that many diet-derived factors have great potential to influence AFB biotransformation, and some efficiently protect from AFB-induced genotoxicity. One key mode of action for reducing AFB-induced carcinogenesis in experimental animals was shown to be the induction of detoxification enzymes such as certain glutathione-S-transferases that are regulated through the Keap1-Nrf2-ARE signaling pathway. Although initial studies utilized the dithiolthione drug, oltipraz, as a prototypical inducer of antioxidant response, dietary components such as suforaphane (SFN) are also effective inducers of this pathway in rodent models. However, human GSTs in general do not appear to be extensively induced by SFN, and GSTM1 - the only human GST with measurable catalytic activity toward aflatoxin B(1)-8,9-epoxide (AFBO; the genotoxic metabolite of AFB), does not appear to be induced by SFN, at least in human hepatocytes, even though its expression in human liver cells does appear to offer considerable protection against AFB-DNA damage. Although induction of detoxification pathways has served as the primary mechanistic focus of chemoprevention studies, protective effects of chemoprotective dietary components may also arise through a decrease in the rate of activation of AFB to AFBO. Dietary consumption of apiaceous vegetables inhibits CYP1A2 activity in humans, and it has been demonstrated that some compounds in those vegetables act as potent inhibitors of human CYP1A2 and cause reduced hCYP1A2-mediated mutagenicity of AFB. Other dietary compounds of different origin (e.g., constituents of brassica vegetables and hops) have been shown to modify expression of human hepatic enzymes involved in the oxidation of AFB. SFN has been shown to protect animals from AFB-induced tumors, to reduce AFB biomarkers in humans in vivo and to reduce efficiently AFB adduct formation in human hepatocytes, although it appears that this protective effect is the result of repression of human hepatic CYP3A4 expression, rather than induction of protective GSTs, at least in human hepatocytes. If this mechanism were to occur in vivo in humans, it would raise safety concerns for the use of SFN as a chemoprotective agent as it may have important implications for drug-drug interactions in humans. A dietary chemoprevention pathway that is independent of AFB biotransformation is represented by the potential for dietary components, such as chlorophyllin, to tightly bind to and reduce the bioavailability of aflatoxins. Chlorophyllin has been shown to significantly reduce genotoxic AFB biomarkers in humans, and it therefore holds promise as a practical means of reducing the incidence of AFB-induced liver cancer. Recent reports have demonstrated that DNA repair mechanisms are inducible in mammalian systems and some diet-derived compounds elevated significantly the gene expression of enzymes potentially involved in nucleotide excision repair of AFB-DNA adducts. However, these are initial observations and more research is needed to determine if dietary modulation of DNA repair is a safe and effective approach to chemoprevention of AFB-induced liver cancer. Copyright © 2012. Published by Elsevier Ireland Ltd.
Galvão, C W; Souza, E M; Etto, R M; Pedrosa, F O; Chubatsu, L S; Yates, M G; Schumacher, J; Buck, M; Steffens, M B R
2012-12-01
DNA repair is crucial to the survival of all organisms. The bacterial RecA protein is a central component in the SOS response and in recombinational and SOS DNA repairs. The RecX protein has been characterized as a negative modulator of RecA activity in many bacteria. The recA and recX genes of Herbaspirillum seropedicae constitute a single operon, and evidence suggests that RecX participates in SOS repair. In the present study, we show that the H. seropedicae RecX protein (RecX Hs) can interact with the H. seropedicaeRecA protein (RecA Hs) and that RecA Hs possesses ATP binding, ATP hydrolyzing and DNA strand exchange activities. RecX Hs inhibited 90% of the RecA Hs DNA strand exchange activity even when present in a 50-fold lower molar concentration than RecA Hs. RecA Hs ATP binding was not affected by the addition of RecX, but the ATPase activity was reduced. When RecX Hs was present before the formation of RecA filaments (RecA-ssDNA), inhibition of ATPase activity was substantially reduced and excess ssDNA also partially suppressed this inhibition. The results suggest that the RecX Hs protein negatively modulates the RecA Hs activities by protein-protein interactions and also by DNA-protein interactions.
Manova, Vasilissa; Singh, Satyendra K; Iliakis, George
2012-08-22
Mammalian cells employ at least two subpathways of non-homologous end-joining for the repair of ionizing radiation induced DNA double strand breaks: The canonical DNA-PK-dependent form of non-homologous end-joining (D-NHEJ) and an alternative, slowly operating, error-prone backup pathway (B-NHEJ). In contrast to D-NHEJ, which operates with similar efficiency throughout the cell cycle, B-NHEJ operates more efficiently in G2-phase. Notably, B-NHEJ also shows strong and as of yet unexplained dependency on growth activity and is markedly compromised in serum-deprived cells, or in cells that enter the plateau-phase of growth. The molecular mechanisms underpinning this response remain unknown. Since chromatin structure or changes in chromatin structure are prime candidate-B-NHEJ-modulators, we study here the role of chromatin hyperacetylation, either by HDAC2 knockdown or treatment with the HDAC inhibitor TSA, on the repair by B-NHEJ of IR-induced DSBs. siRNA-mediated knockdown of HDAC2 fails to provoke histone hyperacetylation in Lig4-/- MEFs and has no detectable effect on B-NHEJ function. Treatment with TSA that inhibits multiple HDACs causes efficient, reversible chromatin hyperacetylation in Lig4-/- MEFs, as well as in human HCT116 Lig4-/- cells and the human glioma cell line M059K. The IR yield of DSBs in TSA-treated cells remains similar to that of untreated cells despite the expected chromatin relaxation. In addition, chromatin hyperacetylation leaves unchanged repair of DSBs by B-NHEJ in irradiated exponentially growing, or plateau-phase cells. Notably, under the experimental conditions employed here, chromatin hyperacetylation fails to detectably modulate B-NHEJ in M059K cells as well. In summary, the results show that chromatin acetylation or deacetylation does not affect the kinetics of alternative NHEJ in all types of cells examined both in exponentially growing and serum deprived cultures. We conclude that parameters beyond chromatin acetylation determine B-NHEJ efficiency in the plateau-phase of growth.
Nagaraju, Ganji Purnachandra; Wu, Christina; Merchant, Neha; Chen, Zhengjia; Lesinski, Gregory B; El-Rayes, Bassel F
2017-08-28
Silencing of tumor suppressor and DNA repair genes through methylation plays a role in cancer development, growth and response to therapy in colorectal and pancreatic cancers. Heat shock protein 90 (HSP90) regulates transcription of DNA methyltransferase enzymes (DNMT). In addition, DNMTs are client proteins of HSP90. The aim of this study is to evaluate the effects of HSP90 inhibition on DNA methylation in colorectal and pancreatic cancer cell lines. Our data shows that inhibition of HSP90 using ganetespib resulted in downregulation of mRNA and protein expression of DNMT1, DNMT3A, and DNMT3B in HT-29 and MIA PaCa-2 cell lines. This in turn was associated with a drop in the fraction of methylated cytosine residues and re-expression of silenced genes including MLH-1, P16 and SPARC. These effects were validated in HT-29 tumors implanted subcutaneously in mice following in vivo administration of ganetespib. This work demonstrates the effectiveness of ganetespib, an HSP90 inhibitor in modulating DNA methylation through downregulation of DNMT expression. Copyright © 2017 Elsevier B.V. All rights reserved.
Protective effect of gangliosides on DNA in human spermatozoa exposed to cryopreservation.
Gavella, Mirjana; Lipovac, Vaskresenija; Garaj-Vrhovac, Verica; Gajski, Goran
2012-01-01
Gangliosides, the sialic acid-containing glycosphyngolipids, are amphiphilic compounds which in micellar form affect the properties and functions of a cellular membrane. The aim of this study was to test whether exogenous gangliosides supplied to cryopreservation media before freezing could protect sperm cells from cryopreservation-induced DNA damage assessed by Comet assay. Additionally, to investigate whether gangliosides were also able to reduce membrane integrity damage, malonaldialdehyde as a measure of lipid peroxidation and sperm-specific lactate dehydrogenase-C4 activity as an enzyme marker of sperm membrane leakage were determined. The monosialogangliosides (GM1) and trisialogangliosides (GT1b) were examined at a concentration of 100 μM, which was above their respective critical micellar concentrations. Exogenous gangliosides were not found to protect sperm membrane from lipid peroxidation. However, a freezing-/thawing-induced increase in Comet parameters was equally significantly prevented by the presence of both GM1 and GT1b (P < .05), indicating that the ceramide moiety, rather than the polar groups, is involved in the protective ability of gangliosides. The observed phenomena suggest that ganglioside micelles could modulate hydrophobic properties of the sperm membrane responsible for better tolerance to DNA fragmentation, thus protecting DNA integrity from cryopreservation-induced damage.
Boswell, William T; Boswell, Mikki; Walter, Dylan J; Navarro, Kaela L; Chang, Jordan; Lu, Yuan; Savage, Markita G; Shen, Jianjun; Walter, Ronald B
2018-06-01
It has been reported that exposure to artificial light may affect oxygen intake, heart rate, absorption of vitamins and minerals, and behavioral responses in humans. We have reported specific gene expression responses in the skin of Xiphophorus fish after exposure to ultraviolet light (UV), as well as, both broad spectrum and narrow waveband visible light. In regard to fluorescent light (FL), we have shown that male X. maculatus exposed to 4100K FL (i.e. "cool white") rapidly suppress transcription of many genes involved with DNA replication and repair, chromosomal segregation, and cell cycle progression in skin. We have also detailed sex specific transcriptional responses of Xiphophorus skin after exposure to UVB. However, investigation of gender differences in global gene expression response after exposure to 4100K FL has not been reported, despite common use of this FL source for residential, commercial, and animal facility illumination. Here, we compare RNA-Seq results analyzed to assess changes in the global transcription profiles of female and male X. maculatus skin in response to 4100K FL exposure. Our results suggest 4100K FL exposure incites a sex-biased genetic response including up-modulation of inflammation in females and down modulation of DNA repair/replication in males. In addition, we identify clusters of genes that become oppositely modulated in males and females after FL exposure that are principally involved in cell death and cell proliferation. Copyright © 2017 Elsevier Inc. All rights reserved.
Oxidative stress and its implications in female infertility - a clinician's perspective.
Agarwal, Ashok; Gupta, Sajal; Sharma, Rakesh
2005-11-01
Reactive oxygen species (ROS) have a role in the modulation of gamete quality and gamete interaction. Generation of ROS is inherent in spermatozoa and contaminating leukocytes. ROS influence spermatozoa, oocytes, embryos and their environment. Oxidative stress (OS) mediates peroxidative damage to the sperm membrane and induces nuclear DNA damage. ROS can modulate the fertilizing capabilities of the spermatozoa. There is extensive literature on OS and its role in male infertility and sperm DNA damage and its effects on assisted reproductive techniques. Evidence is accumulating on the role of ROS in female reproduction. Many animal and human studies have elucidated a role for ROS in oocyte development, maturation, follicular atresia, corpus luteum function and luteolysis. OS-mediated precipitation of pathologies in the female reproductive tract is similar to those involved in male infertility. OS influences the oocyte and embryo quality and thus the fertilization rates. ROS appears to play a significant role in the modulation of gamete interaction and also for successful fertilization to take place. ROS in culture media may impact post-fertilization development, i.e. cleavage rate, blastocyst yield and quality (indicators of assisted reproduction outcomes). OS is reported to affect both natural and assisted fertility. Antioxidant strategies should be able to intercept both extracellular and intracellular ROS. This review discusses the sources of ROS in media used in IVF-embryo transfer and strategies to overcome OS in oocyte in-vitro maturation, in-vitro culture and sperm preparation techniques.
Effects of 2G on Gene Expression of Stress-Related Hormones in Rat Placenta
NASA Technical Reports Server (NTRS)
Benson, S.; Talyansky, Y.; Moyer, E. L.; Lowe, M.; Baer, L. A.; Ronca, A. E.
2017-01-01
Understanding the effects of spaceflight on mammalian reproductive and developmental physiology is important to future human space exploration and permanent settlement beyond Earth orbit. Fetal developmental programming, including modulation of the HPA axis, is thought to originate at the placental-uterine interface, where both transfer of maternal hormones to the fetus and synthesis of endogenous hormones occurs. In healthy rats, fetal corticosterone levels are kept significantly lower by 11BetaHSD-2, which inactivates corticosterone by conversion into cortisone. Placental tissues express endogenous HPA axis-associated hormones including corticotropin-releasing hormone (CRH), pre-opiomelanocortin (POMC), and vasopressin, which may contribute to fetal programming alongside maternal hormones. DNA methylase 3A, 11BetaHSD-2, and 11BetaHSD-1, which are involved in the regulation of maternal cortisol transfer and modulation of the HPA axis, are also expressed in placental tissues along with glucocorticoid receptor and may be affected by differential gravity exposure during pregnancy. Fetuses may respond differently to maternal glucocorticoid exposure during gestation through sexually dimorphic expression of corticosterone-modulating hormones. To elucidate effects of altered gravity on placental gene expression, here we present a ground-based analogue study involving continuous centrifugation to produce 2g hypergravity. We hypothesized that exposure to 2g would induce a decrease in 11BetaHSD-2 expression through the downregulation of DNA methylase 3a and GC receptor, along with concurrent upregulation in endogenous CRH, POMC, and vasopressin expression. Timed pregnant female rats were exposed to 2G from Gestational day 6 to Gestational day 20, and comparisons made with Stationary Control (SC) and Vivarium Control (VC) dams at 1G. Dams were euthanized and placentas harvested on G20. We homogenized placental tissues, extracted and purified RNA, synthesized cDNA, and quantified the expression levels of the genes of interest relative to the GAPDH housekeeping gene, using RT-qPCR and gene-specific cDNA probes. Elucidation of glucocorticoid transfer and synthesis in the placenta can provide new insights into the unique dynamics of mammalian development in microgravity and guide future multi-generational studies in space.
Organophosphorus pesticides enhance the genotoxicity of benzo(a)pyrene by modulating its metabolism.
Hreljac, Irena; Filipic, Metka
2009-12-01
Organophosphorus compounds (OPs) are widely used as pesticides. They act primarily as neurotoxins, but there is increasing evidence for secondary mechanisms of their toxicity. We have shown that the model OPs, methyl parathion (PT) and methyl paraoxon (PO), are genotoxic. Benzo(a)pyrene (BaP) is a widespread environmental genotoxin found in cigarette smoke, polluted air and grilled food. As people are constantly exposed to low concentrations of BaP and also to OPs, the aim of this study was to determine possible synergistic effects of PT and PO on BaP-induced genotoxicity. In the bacterial reverse mutation assay, PT and PO increased the number of BaP-induced mutations. The comet assay with human hepatoma HepG2 cells showed that BaP-induced DNA strand breaks were increased by PT but slightly decreased by PO. Using the acellular comet assay with UVC-induced DNA strand breaks, we observed a decrease in DNA migration, indicating that OPs cause cross-linking, thus interfering with comet assay results. In HepG2 cells the two OPs induced micronuclei formation at very low doses (0.01 microg/ml) and together with BaP, a more than additive increase of micronuclei was observed, confirming their co-genotoxic effect. We demonstrated for the first time that PT and PO modulate the metabolic activation of BaP. Addition of PT or PO increased aldo-keto reductase (AKR1C1/2) levels in the presence of BaP, while cytochrome 1A (CYP1A) mRNA expression and activity were decreased. Further, specific inhibition of CYP1A had no effect on BaP or OP+BaP-induced micronuclei, whereas inhibition of AKR1C dramatically decreased the number of micronuclei induced by BaP or OP+BaP. Based on these results we propose that co-genotoxicity results from OPs mediated modulation of BaP metabolism, favouring the induction of AKR1C enzymes known to catalyse the formation of DNA reactive BaP o-quinones and the production of reactive oxygen species.
The Double-Stranded DNA Virosphere as a Modular Hierarchical Network of Gene Sharing
Iranzo, Jaime
2016-01-01
ABSTRACT Virus genomes are prone to extensive gene loss, gain, and exchange and share no universal genes. Therefore, in a broad-scale study of virus evolution, gene and genome network analyses can complement traditional phylogenetics. We performed an exhaustive comparative analysis of the genomes of double-stranded DNA (dsDNA) viruses by using the bipartite network approach and found a robust hierarchical modularity in the dsDNA virosphere. Bipartite networks consist of two classes of nodes, with nodes in one class, in this case genomes, being connected via nodes of the second class, in this case genes. Such a network can be partitioned into modules that combine nodes from both classes. The bipartite network of dsDNA viruses includes 19 modules that form 5 major and 3 minor supermodules. Of these modules, 11 include tailed bacteriophages, reflecting the diversity of this largest group of viruses. The module analysis quantitatively validates and refines previously proposed nontrivial evolutionary relationships. An expansive supermodule combines the large and giant viruses of the putative order “Megavirales” with diverse moderate-sized viruses and related mobile elements. All viruses in this supermodule share a distinct morphogenetic tool kit with a double jelly roll major capsid protein. Herpesviruses and tailed bacteriophages comprise another supermodule, held together by a distinct set of morphogenetic proteins centered on the HK97-like major capsid protein. Together, these two supermodules cover the great majority of currently known dsDNA viruses. We formally identify a set of 14 viral hallmark genes that comprise the hubs of the network and account for most of the intermodule connections. PMID:27486193
Nucleosome-free DNA regions differentially affect distant communication in chromatin
Nizovtseva, Ekaterina V.; Clauvelin, Nicolas; Todolli, Stefjord; Kulaeva, Olga I.; Wengrzynek, Scott
2017-01-01
Abstract Communication between distantly spaced genomic regions is one of the key features of gene regulation in eukaryotes. Chromatin per se can stimulate efficient enhancer-promoter communication (EPC); however, the role of chromatin structure and dynamics in this process remains poorly understood. Here we show that nucleosome spacing and the presence of nucleosome-free DNA regions can modulate chromatin structure/dynamics and, in turn, affect the rate of EPC in vitro and in silico. Increasing the length of internucleosomal linker DNA from 25 to 60 bp results in more efficient EPC. The presence of longer nucleosome-free DNA regions can positively or negatively affect the rate of EPC, depending upon the length and location of the DNA region within the chromatin fiber. Thus the presence of histone-free DNA regions can differentially affect the efficiency of EPC, suggesting that gene regulation over a distance could be modulated by changes in the length of internucleosomal DNA spacers. PMID:27940560
Zinc ion enhances GABA tea-mediated oxidative DNA damage.
Chuang, Show-Mei; Wang, Hsueh-Fang; Hsiao, Ching-Chuan; Cherng, Shur-Hueih
2012-02-15
GABA tea is a tea product that contains a high level of γ-aminobutyric acid (GABA). Previous study has demonstrated a synergistic effect of GABA tea and copper ions on DNA breakage. This study further explored whether zinc (Zn), a nonredox metal, modulated DNA cleavage induced by GABA tea extract. In a cell-free system, Zn(2+) significantly enhanced GABA tea extract and (-)-epigallocatechin-3-gallate (EGCG)- or H(2)O(2)-induced DNA damage at 24 h of incubation. Additionally, low dosages of GABA tea extract (1-10 μg/mL) possessed pro-oxidant activity to increase H(2)O(2)/Zn(2+)-induced DNA cleavage in a dose-dependent profile. By use of various reactive oxygen scavengers, it was observed that glutathione, catalase, and potassium iodide effectively inhibited DNA degradation caused by the GABA tea extract/H(2)O(2)/Zn(2+) system. Moreover, the data showed that the GABA tea extract itself (0.5-5 mg/mL) could induce DNA cleavage in a long-term exposure (48 h). EGCG, but not the GABA tea extract, enhanced H(2)O(2)-induced DNA cleavage. In contrast, GABA decreased H(2)O(2)- and EGCG-induced DNA cleavage, suggesting that GABA might contribute the major effect on the antioxidant activity of GABA tea extract. Furthermore, a comet assay revealed that GABA tea extract (0.25 mg/mL) and GABA had antioxidant activity on H(2)O(2)-induced DNA breakage in human peripheral lymphocytes. Taken together, these findings indicate that GABA tea has the potential of both pro-oxidant and antioxidant. It is proposed that a balance between EGCG-induced pro-oxidation and GABA-mediated antioxidation may occur in a complex mixture of GABA tea extract.
Siaud, Nicolas; Lam, Isabel; Christ, Nicole; Schlacher, Katharina; Xia, Bing; Jasin, Maria
2011-01-01
The breast cancer suppressor BRCA2 is essential for the maintenance of genomic integrity in mammalian cells through its role in DNA repair by homologous recombination (HR). Human BRCA2 is 3,418 amino acids and is comprised of multiple domains that interact with the RAD51 recombinase and other proteins as well as with DNA. To gain insight into the cellular function of BRCA2 in HR, we created fusions consisting of various BRCA2 domains and also introduced mutations into these domains to disrupt specific protein and DNA interactions. We find that a BRCA2 fusion peptide deleted for the DNA binding domain and active in HR is completely dependent on interaction with the PALB2 tumor suppressor for activity. Conversely, a BRCA2 fusion peptide deleted for the PALB2 binding domain is dependent on an intact DNA binding domain, providing a role for this conserved domain in vivo; mutagenesis suggests that both single-stranded and double-stranded DNA binding activities in the DNA binding domain are required for its activity. Given that PALB2 itself binds DNA, these results suggest alternative mechanisms to deliver RAD51 to DNA. In addition, the BRCA2 C terminus contains both RAD51-dependent and -independent activities which are essential to HR in some contexts. Finally, binding the small peptide DSS1 is essential for activity when its binding domain is present, but not when it is absent. Our results reveal functional redundancy within the BRCA2 protein and emphasize the plasticity of this large protein built for optimal HR function in mammalian cells. The occurrence of disease-causing mutations throughout BRCA2 suggests sub-optimal HR from a variety of domain modulations. PMID:22194698
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cho, Eun-Ah; Juhnn, Yong-Sung, E-mail: juhnn@snu.ac.kr
2012-06-01
Highlights: Black-Right-Pointing-Pointer cAMP signaling system inhibits repair of {gamma}-ray-induced DNA damage. Black-Right-Pointing-Pointer cAMP signaling system inhibits DNA damage repair by decreasing XRCC1 expression. Black-Right-Pointing-Pointer cAMP signaling system decreases XRCC1 expression by promoting its proteasomal degradation. Black-Right-Pointing-Pointer The promotion of XRCC1 degradation by cAMP signaling system is mediated by Epac1. -- Abstract: Cyclic AMP is involved in the regulation of metabolism, gene expression, cellular growth and proliferation. Recently, the cAMP signaling system was found to modulate DNA-damaging agent-induced apoptosis by regulating the expression of Bcl-2 family proteins and inhibitors of apoptosis. Thus, we hypothesized that the cAMP signaling may modulate DNAmore » repair activity, and we investigated the effects of the cAMP signaling system on {gamma}-ray-induced DNA damage repair in lung cancer cells. Transient expression of a constitutively active mutant of stimulatory G protein (G{alpha}sQL) or treatment with forskolin, an adenylyl cyclase activator, augmented radiation-induced DNA damage and inhibited repair of the damage in H1299 lung cancer cells. Expression of G{alpha}sQL or treatment with forskolin or isoproterenol inhibited the radiation-induced expression of the XRCC1 protein, and exogenous expression of XRCC1 abolished the DNA repair-inhibiting effect of forskolin. Forskolin treatment promoted the ubiquitin and proteasome-dependent degradation of the XRCC1 protein, resulting in a significant decrease in the half-life of the protein after {gamma}-ray irradiation. The effect of forskolin on XRCC1 expression was not inhibited by PKA inhibitor, but 8-pCPT-2 Prime -O-Me-cAMP, an Epac-selective cAMP analog, increased ubiquitination of XRCC1 protein and decreased XRCC1 expression. Knockdown of Epac1 abolished the effect of 8-pCPT-2 Prime -O-Me-cAMP and restored XRCC1 protein level following {gamma}-ray irradiation. From these results, we conclude that the cAMP signaling system inhibits the repair of {gamma}-ray-induced DNA damage by promoting the ubiquitin-proteasome dependent degradation of XRCC1 in an Epac-dependent pathway in lung cancer cells.« less
Wang, Xiaohong; Liu, Haibin; Ge, Hui; Ajiro, Masahiko; Sharma, Nishi R; Meyers, Craig; Morozov, Pavel; Tuschl, Thomas; Klar, Amar; Court, Donald; Zheng, Zhi-Ming
2017-05-30
The life cycle of human papillomaviruses (HPVs) is tightly linked to keratinocyte differentiation. Although expression of viral early genes is initiated immediately upon virus infection of undifferentiated basal cells, viral DNA amplification and late gene expression occur only in the mid to upper strata of the keratinocytes undergoing terminal differentiation. In this report, we show that the relative activity of HPV18 TATA-less late promoter P 811 depends on its orientation relative to that of the origin (Ori) of viral DNA replication and is sensitive to the eukaryotic DNA polymerase inhibitor aphidicolin. Additionally, transfected 70-nucleotide (nt)-long single-strand DNA oligonucleotides that are homologous to the region near Ori induce late promoter activity. We also found that promoter activation in raft cultures leads to production of the late promoter-associated, sense-strand transcription initiation RNAs (tiRNAs) and splice-site small RNAs (spliRNAs). Finally, a cis -acting AAGTATGCA core element that functions as a repressor to the promoter was identified. This element interacts with hnRNP D0B and hnRNP A/B factors. Point mutations in the core prevented binding of hnRNPs and increased the promoter activity. Confirming this result, knocking down the expression of both hnRNPs in keratinocytes led to increased promoter activity. Taking the data together, our study revealed the mechanism of how the HPV18 late promoter is regulated by DNA replication and host factors. IMPORTANCE It has been known for decades that the activity of viral late promoters is associated with viral DNA replication among almost all DNA viruses. However, the mechanism of how DNA replication activates the viral late promoter and what components of the replication machinery are involved remain largely unknown. In this study, we characterized the P 811 promoter region of HPV18 and demonstrated that its activation depends on the orientation of DNA replication. Using single-stranded oligonucleotides targeting the replication fork on either leading or lagging strands, we showed that viral lagging-strand replication activates the promoter. We also identified a transcriptional repressor element located upstream of the promoter transcription start site which interacts with cellular proteins hnRNP D0B and hnRNP A/B and modulates the late promoter activity. This is the first report on how DNA replication activates a viral late promoter. Copyright © 2017 Wang et al.
7SK-BAF axis controls pervasive transcription at enhancers
Flynn, Ryan A.; Do, Brian T.; Rubin, Adam J.; Calo, Eliezer; Lee, Byron; Kuchelmeister, Hannes; Rale, Michael; Chu, Ci; Kool, Eric T.; Wysocka, Joanna; Khavari, Paul A.
2016-01-01
RNA functions at enhancers remain mysterious. Here we show that the 7SK small nuclear RNA (snRNA) inhibits enhancer transcription by modulating nucleosome position. 7SK occupies enhancers and super enhancers genome-wide in mouse and human cells, and 7SK is required to limit eRNA initiation and synthesis in a manner distinct from promoter pausing. Clustered elements at super enhancers uniquely require 7SK to prevent convergent transcription and DNA damage signaling. 7SK physically interacts with the BAF chromatin remodeling complex, recruit BAF to enhancers, and inhibits enhancer transcription by modulating chromatin structure. In turn, 7SK occupancy at enhancers coincides with Brd4 and is exquisitely sensitive to the bromodomain inhibitor JQ1. Thus, 7SK employs distinct mechanisms to counteract diverse consequences of pervasive transcription that distinguish super enhancers, enhancers, and promoters. PMID:26878240
Engineered TAL Effector modulators for the large-scale gain-of-function screening
Zhang, Hanshuo; Li, Juan; Hou, Sha; Wang, Gancheng; Jiang, Mingjun; Sun, Changhong; Hu, Xiongbing; Zhuang, Fengfeng; Dai, Zhifei; Dai, Junbiao; Xi, Jianzhong Jeff
2014-01-01
Recent effective use of TAL Effectors (TALEs) has provided an important approach to the design and synthesis of sequence-specific DNA-binding proteins. However, it is still a challenging task to design and manufacture effective TALE modulators because of the limited knowledge of TALE–DNA interactions. Here we synthesized more than 200 TALE modulators and identified two determining factors of transcription activity in vivo: chromatin accessibility and the distance from the transcription start site. The implementation of these modulators in a gain-of-function screen was successfully demonstrated for four cell lines in migration/invasion assays and thus has broad relevance in this field. Furthermore, a novel TALE–TALE modulator was developed to transcriptionally inhibit target genes. Together, these findings underscore the huge potential of these TALE modulators in the study of gene function, reprogramming of cellular behaviors, and even clinical investigation. PMID:24939900
Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription
Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.
2016-01-01
Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002
Chen, Haorong; Zhang, Hanyu; Pan, Jing; Cha, Tae-Gon; Li, Shiming; Andréasson, Joakim; Choi, Jong Hyun
2016-05-24
DNA origami has received enormous attention for its ability to program complex nanostructures with a few nanometer precision. Dynamic origami structures that change conformation in response to environmental cues or external signals hold great promises in sensing and actuation at the nanoscale. The reconfiguration mechanism of existing dynamic origami structures is mostly limited to single-stranded hinges and relies almost exclusively on DNA hybridization or strand displacement. Here, we show an alternative approach by demonstrating on-demand conformation changes with DNA-binding molecules, which intercalate between base pairs and unwind DNA double helices. The unwinding effect modulates the helicity mismatch in DNA origami, which significantly influences the internal stress and the global conformation of the origami structure. We demonstrate the switching of a polymerized origami nanoribbon between different twisting states and a well-constrained torsional deformation in a monomeric origami shaft. The structural transformation is shown to be reversible, and binding isotherms confirm the reconfiguration mechanism. This approach provides a rapid and reversible means to change DNA origami conformation, which can be used for dynamic and progressive control at the nanoscale.
Ursini, Gianluca; Bollati, Valentina; Fazio, Leonardo; Porcelli, Annamaria; Iacovelli, Luisa; Catalani, Assia; Sinibaldi, Lorenzo; Gelao, Barbara; Romano, Raffaella; Rampino, Antonio; Taurisano, Paolo; Mancini, Marina; Di Giorgio, Annabella; Popolizio, Teresa; Baccarelli, Andrea; De Blasi, Antonio; Blasi, Giuseppe; Bertolino, Alessandro
2011-05-04
DNA methylation at CpG dinucleotides is associated with gene silencing, stress, and memory. The catechol-O-methyltransferase (COMT) Val(158) allele in rs4680 is associated with differential enzyme activity, stress responsivity, and prefrontal activity during working memory (WM), and it creates a CpG dinucleotide. We report that methylation of the Val(158) allele measured from peripheral blood mononuclear cells (PBMCs) of Val/Val humans is associated negatively with lifetime stress and positively with WM performance; it interacts with stress to modulate prefrontal activity during WM, such that greater stress and lower methylation are related to reduced cortical efficiency; and it is inversely related to mRNA expression and protein levels, potentially explaining the in vivo effects. Finally, methylation of COMT in prefrontal cortex and that in PBMCs of rats are correlated. The relationship of methylation of the COMT Val(158) allele with stress, gene expression, WM performance, and related brain activity suggests that stress-related methylation is associated with silencing of the gene, which partially compensates the physiological role of the high-activity Val allele in prefrontal cognition and activity. Moreover, these results demonstrate how stress-related DNA methylation of specific functional alleles impacts directly on human brain physiology beyond sequence variation.
Coffee Consumption and Oxidative Stress: A Review of Human Intervention Studies.
Martini, Daniela; Del Bo', Cristian; Tassotti, Michele; Riso, Patrizia; Del Rio, Daniele; Brighenti, Furio; Porrini, Marisa
2016-07-28
Research on the potential protective effects of coffee and its bioactives (caffeine, chlorogenic acids and diterpenes) against oxidative stress and related chronic disease risk has been increasing in the last years. The present review summarizes the main findings on the effect of coffee consumption on protection against lipid, protein and DNA damage, as well as on the modulation of antioxidant capacity and antioxidant enzymes in human studies. Twenty-six dietary intervention studies (involving acute and chronic coffee intake) have been considered. Overall, the results suggest that coffee consumption can increase glutathione levels and improve protection against DNA damage, especially following regular/repeated intake. On the contrary, the effects of coffee on plasma antioxidant capacity and antioxidant enzymes, as well as on protein and lipid damage, are unclear following both acute and chronic exposure. The high heterogeneity in terms of type of coffee, doses and duration of the studies, the lack of information on coffee and/or brew bioactive composition, as well as the choice of biomarkers and the methods used for their evaluation, may partially explain the variability observed among findings. More robust and well-controlled intervention studies are necessary for a thorough understanding of the effect of coffee on oxidative stress markers in humans.
p38 MAPK protects human monocytes from postprandial triglyceride-rich lipoprotein-induced toxicity.
Lopez, Sergio; Jaramillo, Sara; Varela, Lourdes M; Ortega, Almudena; Bermudez, Beatriz; Abia, Rocio; Muriana, Francisco J G
2013-05-01
Postprandial triglyceride (TG)-rich lipoproteins (TRLs) transport dietary fatty acids through the circulatory system to satisfy the energy and structural needs of the tissues. However, fatty acids are also able to modulate gene expression and/or induce cell death. We investigated the underlying mechanism by which postprandial TRLs of different fatty acid compositions can induce cell death in human monocytes. Three types of dietary fat [refined olive oil (ROO), high-palmitic sunflower oil (HPSO), and butter] with progressively increasing SFA:MUFA ratios (0.18, 0.41, and 2.08, respectively) were used as a source of postprandial TRLs (TRL-ROO, TRL-HPSO, and TRL-BUTTER) from healthy men. The monocytic cell line THP-1 was used as a model for this study. We demonstrated that postprandial TRLs increased intracellular lipid accumulation (31-106%), reactive oxygen species production (268-349%), DNA damage (133-1467%), poly(ADP-ribose) polymerase 1 (800-1710%) and caspase-3 (696-1244%) activities, and phosphorylation of c-Jun NH2-terminal kinase (JNK) (54 kDa, 141-288%) and p38 (24-92%). These effects were significantly greater with TRL-BUTTER, and TRL-ROO did not induce DNA damage, DNA fragmentation, or p38 phosphorylation. In addition, blockade of p38, but not of JNK, significantly decreased intracellular lipid accumulation and increased cell death in postprandial TRL-treated cells. These results suggest that in human monocytes, p38 is involved in survival signaling pathways that protect against the lipid-mediated cytotoxicity induced by postprandial TRLs that are abundant in saturated fatty acids.
Wang, Xinyi; Liu, Denghui; He, Dajian; Suo, Shengbao; Xia, Xian; He, Xiechao; Han, Jing-Dong J.; Zheng, Ping
2017-01-01
Preimplantation embryogenesis encompasses several critical events including genome reprogramming, zygotic genome activation (ZGA), and cell-fate commitment. The molecular basis of these processes remains obscure in primates in which there is a high rate of embryo wastage. Thus, understanding the factors involved in genome reprogramming and ZGA might help reproductive success during this susceptible period of early development and generate induced pluripotent stem cells with greater efficiency. Moreover, explaining the molecular basis responsible for embryo wastage in primates will greatly expand our knowledge of species evolution. By using RNA-seq in single and pooled oocytes and embryos, we defined the transcriptome throughout preimplantation development in rhesus monkey. In comparison to archival human and mouse data, we found that the transcriptome dynamics of monkey oocytes and embryos were very similar to those of human but very different from those of mouse. We identified several classes of maternal and zygotic genes, whose expression peaks were highly correlated with the time frames of genome reprogramming, ZGA, and cell-fate commitment, respectively. Importantly, comparison of the ZGA-related network modules among the three species revealed less robust surveillance of genomic instability in primate oocytes and embryos than in rodents, particularly in the pathways of DNA damage signaling and homology-directed DNA double-strand break repair. This study highlights the utility of monkey models to better understand the molecular basis for genome reprogramming, ZGA, and genomic stability surveillance in human early embryogenesis and may provide insights for improved homologous recombination-mediated gene editing in monkey. PMID:28223401
Maddukuri, Leena; Ketkar, Amit; Eddy, Sarah; Zafar, Maroof K.; Eoff, Robert L.
2014-01-01
Human DNA polymerase kappa (hpol κ) is the only Y-family member to preferentially insert dAMP opposite 7,8-dihydro-8-oxo-2′-deoxyguanosine (8-oxo-dG) during translesion DNA synthesis. We have studied the mechanism of action by which hpol κ activity is modulated by the Werner syndrome protein (WRN), a RecQ helicase known to influence repair of 8-oxo-dG. Here we show that WRN stimulates the 8-oxo-dG bypass activity of hpol κ in vitro by enhancing the correct base insertion opposite the lesion, as well as extension from dC:8-oxo-dG base pairs. Steady-state kinetic analysis reveals that WRN improves hpol κ-catalyzed dCMP insertion opposite 8-oxo-dG ∼10-fold and extension from dC:8-oxo-dG by 2.4-fold. Stimulation is primarily due to an increase in the rate constant for polymerization (kpol), as assessed by pre-steady-state kinetics, and it requires the RecQ C-terminal (RQC) domain. In support of the functional data, recombinant WRN and hpol κ were found to physically interact through the exo and RQC domains of WRN, and co-localization of WRN and hpol κ was observed in human cells treated with hydrogen peroxide. Thus, WRN limits the error-prone bypass of 8-oxo-dG by hpol κ, which could influence the sensitivity to oxidative damage that has previously been observed for Werner's syndrome cells. PMID:25294835
The persistence of human DNA in soil following surface decomposition.
Emmons, Alexandra L; DeBruyn, Jennifer M; Mundorff, Amy Z; Cobaugh, Kelly L; Cabana, Graciela S
2017-09-01
Though recent decades have seen a marked increase in research concerning the impact of human decomposition on the grave soil environment, the fate of human DNA in grave soil has been relatively understudied. With the purpose of supplementing the growing body of literature in forensic soil taphonomy, this study assessed the relative persistence of human DNA in soil over the course of decomposition. Endpoint PCR was used to assess the presence or absence of human nuclear and mitochondrial DNA, while qPCR was used to evaluate the quantity of human DNA recovered from the soil beneath four cadavers at the University of Tennessee's Anthropology Research Facility (ARF). Human nuclear DNA from the soil was largely unrecoverable, while human mitochondrial DNA was detectable in the soil throughout all decomposition stages. Mitochondrial DNA copy abundances were not significantly different between decomposition stages and were not significantly correlated to soil edaphic parameters tested. There was, however, a significant positive correlation between mitochondrial DNA copy abundances and the human associated bacteria, Bacteroides, as estimated by 16S rRNA gene abundances. These results show that human mitochondrial DNA can persist in grave soil and be consistently detected throughout decomposition. Copyright © 2017 The Chartered Society of Forensic Sciences. Published by Elsevier B.V. All rights reserved.
Rager, Julia E; Auerbach, Scott S; Chappell, Grace A; Martin, Elizabeth; Thompson, Chad M; Fry, Rebecca C
2017-10-16
Prenatal inorganic arsenic (iAs) exposure influences the expression of critical genes and proteins associated with adverse outcomes in newborns, in part through epigenetic mediators. The doses at which these genomic and epigenomic changes occur have yet to be evaluated in the context of dose-response modeling. The goal of the present study was to estimate iAs doses that correspond to changes in transcriptomic, proteomic, epigenomic, and integrated multi-omic signatures in human cord blood through benchmark dose (BMD) modeling. Genome-wide DNA methylation, microRNA expression, mRNA expression, and protein expression levels in cord blood were modeled against total urinary arsenic (U-tAs) levels from pregnant women exposed to varying levels of iAs. Dose-response relationships were modeled in BMDExpress, and BMDs representing 10% response levels were estimated. Overall, DNA methylation changes were estimated to occur at lower exposure concentrations in comparison to other molecular endpoints. Multi-omic module eigengenes were derived through weighted gene co-expression network analysis, representing co-modulated signatures across transcriptomic, proteomic, and epigenomic profiles. One module eigengene was associated with decreased gestational age occurring alongside increased iAs exposure. Genes/proteins within this module eigengene showed enrichment for organismal development, including potassium voltage-gated channel subfamily Q member 1 (KCNQ1), an imprinted gene showing differential methylation and expression in response to iAs. Modeling of this prioritized multi-omic module eigengene resulted in a BMD(BMDL) of 58(45) μg/L U-tAs, which was estimated to correspond to drinking water arsenic concentrations of 51(40) μg/L. Results are in line with epidemiological evidence supporting effects of prenatal iAs occurring at levels <100 μg As/L urine. Together, findings present a variety of BMD measures to estimate doses at which prenatal iAs exposure influences neonatal outcome-relevant transcriptomic, proteomic, and epigenomic profiles.
Hutchins, Andrew Paul; Pei, Duanqing
Transposable elements (TEs) are mobile genomic sequences of DNA capable of autonomous and non-autonomous duplication. TEs have been highly successful, and nearly half of the human genome now consists of various families of TEs. Originally thought to be non-functional, these elements have been co-opted by animal genomes to perform a variety of physiological functions ranging from TE-derived proteins acting directly in normal biological functions, to innovations in transcription factor logic and influence on epigenetic control of gene expression. During embryonic development, when the genome is epigenetically reprogrammed and DNA-demethylated, TEs are released from repression and show embryonic stage-specific expression, and in human and mouse embryos, intact TE-derived endogenous viral particles can even be detected. A similar process occurs during the reprogramming of somatic cells to pluripotent cells: When the somatic DNA is demethylated, TEs are released from repression. In embryonic stem cells (ESCs), where DNA is hypomethylated, an elaborate system of epigenetic control is employed to suppress TEs, a system that often overlaps with normal epigenetic control of ESC gene expression. Finally, many long non-coding RNAs (lncRNAs) involved in normal ESC function and those assisting or impairing reprogramming contain multiple TEs in their RNA. These TEs may act as regulatory units to recruit RNA-binding proteins and epigenetic modifiers. This review covers how TEs are interlinked with the epigenetic machinery and lncRNAs, and how these links influence each other to modulate aspects of ESCs, embryogenesis, and somatic cell reprogramming.
Gajski, Goran; Domijan, Ana-Marija; Žegura, Bojana; Štern, Alja; Gerić, Marko; Novak Jovanović, Ivana; Vrhovac, Ivana; Madunić, Josip; Breljak, Davorka; Filipič, Metka; Garaj-Vrhovac, Vera
2016-02-01
Melittin (MEL) is the main constituent and principal toxin of bee venom. It is a small basic peptide, consisting of a known amino acid sequence, with powerful haemolytic activity. Since MEL is a nonspecific cytolytic peptide that attacks lipid membranes thus leading to toxicity, the presumption is that it could have significant therapeutic benefits. The aim was to evaluate the cyto/genotoxic effects of MEL in human peripheral blood lymphocytes (HPBLs) and the molecular mechanisms involved using a multi-biomarker approach. We found that MEL was cytotoxic for HPBLs in a dose- and time-dependent manner. It also induced morphological changes in the cell membrane, granulation and lysis of exposed cells. After treating HPBLs with non-cytotoxic concentrations of MEL, we observed increased DNA damage including oxidative DNA damage as well as increased formation of micronuclei and nuclear buds, and decreased lymphocyte proliferation determined by comet and micronucleus assays. The observed genotoxicity coincided with increased formation of reactive oxygen species, reduction of glutathione level, increased lipid peroxidation and phospholipase C activity, showing the induction of oxidative stress. MEL also modulated the expression of selected genes involved in DNA damage response (TP53, CDKN1A, GADD45α, MDM), oxidative stress (CAT, SOD1, GPX1, GSR and GCLC) and apoptosis (BAX, BCL-2, CAS-3 and CAS-7). Results indicate that MEL is genotoxic to HPBLs and provide evidence that oxidative stress is involved in its DNA damaging effects. MEL toxicity towards normal cells has to be considered if used for potential therapeutic purposes. Copyright © 2015 Elsevier Ltd. All rights reserved.
Repair of DNA-polypeptide crosslinks by human excision nuclease
NASA Astrophysics Data System (ADS)
Reardon, Joyce T.; Sancar, Aziz
2006-03-01
DNA-protein crosslinks are relatively common DNA lesions that form during the physiological processing of DNA by replication and recombination proteins, by side reactions of base excision repair enzymes, and by cellular exposure to bifunctional DNA-damaging agents such as platinum compounds. The mechanism by which pathological DNA-protein crosslinks are repaired in humans is not known. In this study, we investigated the mechanism of recognition and repair of protein-DNA and oligopeptide-DNA crosslinks by the human excision nuclease. Under our assay conditions, the human nucleotide excision repair system did not remove a 16-kDa protein crosslinked to DNA at a detectable level. However, 4- and 12-aa-long oligopeptides crosslinked to the DNA backbone were recognized by some of the damage recognition factors of the human excision nuclease with moderate selectivity and were excised from DNA at relatively efficient rates. Our data suggest that, if coupled with proteolytic degradation of the crosslinked protein, the human excision nuclease may be the major enzyme system for eliminating protein-DNA crosslinks from the genome. damage recognition | nucleotide excision repair
Dunachie, Susanna; Berthoud, Tamara; Hill, Adrian V.S.; Fletcher, Helen A.
2015-01-01
Introduction The complexity of immunity to malaria is well known, and clear correlates of protection against malaria have not been established. A better understanding of immune markers induced by candidate malaria vaccines would greatly enhance vaccine development, immunogenicity monitoring and estimation of vaccine efficacy in the field. We have previously reported complete or partial efficacy against experimental sporozoite challenge by several vaccine regimens in healthy malaria-naïve subjects in Oxford. These include a prime-boost regimen with RTS,S/AS02A and modified vaccinia virus Ankara (MVA) expressing the CSP antigen, and a DNA-prime, MVA-boost regimen expressing the ME TRAP antigens. Using samples from these trials we performed transcriptional profiling, allowing a global assessment of responses to vaccination. Methods We used Human RefSeq8 Bead Chips from Illumina to examine gene expression using PBMC (peripheral blood mononuclear cells) from 16 human volunteers. To focus on antigen-specific changes, comparisons were made between PBMC stimulated with CSP or TRAP peptide pools and unstimulated PBMC post vaccination. We then correlated gene expression with protection against malaria in a human Plasmodium falciparum malaria challenge model. Results Differentially expressed genes induced by both vaccine regimens were predominantly in the IFN-γ pathway. Gene set enrichment analysis revealed antigen-specific effects on genes associated with IFN induction and proteasome modules after vaccination. Genes associated with IFN induction and antigen presentation modules were positively enriched in subjects with complete protection from malaria challenge, while genes associated with haemopoietic stem cells, regulatory monocytes and the myeloid lineage modules were negatively enriched in protected subjects. Conclusions These results represent novel insights into the immune repertoires involved in malaria vaccination. PMID:26256523
Dunachie, Susanna; Berthoud, Tamara; Hill, Adrian V S; Fletcher, Helen A
2015-09-29
The complexity of immunity to malaria is well known, and clear correlates of protection against malaria have not been established. A better understanding of immune markers induced by candidate malaria vaccines would greatly enhance vaccine development, immunogenicity monitoring and estimation of vaccine efficacy in the field. We have previously reported complete or partial efficacy against experimental sporozoite challenge by several vaccine regimens in healthy malaria-naïve subjects in Oxford. These include a prime-boost regimen with RTS,S/AS02A and modified vaccinia virus Ankara (MVA) expressing the CSP antigen, and a DNA-prime, MVA-boost regimen expressing the ME TRAP antigens. Using samples from these trials we performed transcriptional profiling, allowing a global assessment of responses to vaccination. We used Human RefSeq8 Bead Chips from Illumina to examine gene expression using PBMC (peripheral blood mononuclear cells) from 16 human volunteers. To focus on antigen-specific changes, comparisons were made between PBMC stimulated with CSP or TRAP peptide pools and unstimulated PBMC post vaccination. We then correlated gene expression with protection against malaria in a human Plasmodium falciparum malaria challenge model. Differentially expressed genes induced by both vaccine regimens were predominantly in the IFN-γ pathway. Gene set enrichment analysis revealed antigen-specific effects on genes associated with IFN induction and proteasome modules after vaccination. Genes associated with IFN induction and antigen presentation modules were positively enriched in subjects with complete protection from malaria challenge, while genes associated with haemopoietic stem cells, regulatory monocytes and the myeloid lineage modules were negatively enriched in protected subjects. These results represent novel insights into the immune repertoires involved in malaria vaccination. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Modulation of electronic structures of bases through DNA recognition of protein.
Hagiwara, Yohsuke; Kino, Hiori; Tateno, Masaru
2010-04-21
The effects of environmental structures on the electronic states of functional regions in a fully solvated DNA·protein complex were investigated using combined ab initio quantum mechanics/molecular mechanics calculations. A complex of a transcriptional factor, PU.1, and the target DNA was used for the calculations. The effects of solvent on the energies of molecular orbitals (MOs) of some DNA bases strongly correlate with the magnitude of masking of the DNA bases from the solvent by the protein. In the complex, PU.1 causes a variation in the magnitude among DNA bases by means of directly recognizing the DNA bases through hydrogen bonds and inducing structural changes of the DNA structure from the canonical one. Thus, the strong correlation found in this study is the first evidence showing the close quantitative relationship between recognition modes of DNA bases and the energy levels of the corresponding MOs. Thus, it has been revealed that the electronic state of each base is highly regulated and organized by the DNA recognition of the protein. Other biological macromolecular systems can be expected to also possess similar modulation mechanisms, suggesting that this finding provides a novel basis for the understanding for the regulation functions of biological macromolecular systems.
Singh, Satyender; Kumar, Vivek; Vashisht, Kapil; Singh, Priyanka; Banerjee, Basu Dev; Rautela, Rajender Singh; Grover, Shyam Sunder; Rawat, Devendra Singh; Pasha, Syed Tazeen; Jain, Sudhir Kumar; Rai, Arvind
2011-11-15
Organophosphate pesticides (OPs) are primarily metabolized by several xenobiotic metabolizing enzymes (XMEs). Very few studies have explored genetic polymorphisms of XMEs and their association with DNA damage in pesticide-exposed workers. The present study was designed to determine the role of genetic polymorphisms of CYP1A1, CYP3A5, CYP2C9, CYP2D6, and PON1 in the modulation of DNA damage in workers occupationally exposed to OPs. We examined 284 subjects including 150 workers occupationally exposed to OPs and 134 normal healthy controls. The DNA damage was evaluated using the alkaline comet assay and genotyping was done using PCR-RFLP. The results revealed that the PONase activity toward paraoxonase and AChE activity was found significantly lowered in workers as compared to control subjects (p<0.001). Workers showed significantly higher DNA damage compared to control subjects (14.37±2.15 vs. 6.24±1.37 tail% DNA, p<0.001). Further, the workers with CYP2D6*3PM and PON1 (QQ and MM) genotypes were found to have significantly higher DNA damage when compared to other genotypes (p<0.05). In addition, significant increase in DNA damage was also observed in workers with concomitant presence of certain CYP2D6 and PON1 (Q192R and L55M) genotypes which need further extensive studies. In conclusion, the results indicate that the PON1 and CYP2D6 genotypes can modulate DNA damage elicited by some OPs possibly through gene-environment interactions. Copyright © 2011 Elsevier Inc. All rights reserved.
Miller, Mark P.; Knaus, Brian J.; Mullins, Thomas D.; Haig, Susan M.
2013-01-01
SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (e.g., microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains 3 analysis modules along with a fourth control module that can automate analyses of large volumes of data. The modules are used to 1) identify the subset of paired-end sequences that pass Illumina quality standards, 2) align paired-end reads into a single composite DNA sequence, and 3) identify sequences that possess microsatellites (both simple and compound) conforming to user-specified parameters. The microsatellite search algorithm is extremely efficient, and we have used it to identify repeats with motifs from 2 to 25bp in length. Each of the 3 analysis modules can also be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc.). We demonstrate use of the program with data from the brine fly Ephydra packardi (Diptera: Ephydridae) and provide empirical timing benchmarks to illustrate program performance on a common desktop computer environment. We further show that the Illumina platform is capable of identifying large numbers of microsatellites, even when using unenriched sample libraries and a very small percentage of the sequencing capacity from a single DNA sequencing run. All modules from SSR_pipeline are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, and Windows).
Miller, Mark P; Knaus, Brian J; Mullins, Thomas D; Haig, Susan M
2013-01-01
SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (e.g., microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains 3 analysis modules along with a fourth control module that can automate analyses of large volumes of data. The modules are used to 1) identify the subset of paired-end sequences that pass Illumina quality standards, 2) align paired-end reads into a single composite DNA sequence, and 3) identify sequences that possess microsatellites (both simple and compound) conforming to user-specified parameters. The microsatellite search algorithm is extremely efficient, and we have used it to identify repeats with motifs from 2 to 25 bp in length. Each of the 3 analysis modules can also be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc.). We demonstrate use of the program with data from the brine fly Ephydra packardi (Diptera: Ephydridae) and provide empirical timing benchmarks to illustrate program performance on a common desktop computer environment. We further show that the Illumina platform is capable of identifying large numbers of microsatellites, even when using unenriched sample libraries and a very small percentage of the sequencing capacity from a single DNA sequencing run. All modules from SSR_pipeline are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, and Windows).
Rybchyn, Mark Stephen; De Silva, Warusavithana Gunawardena Manori; Sequeira, Vanessa Bernadette; McCarthy, Bianca Yuko; Dilley, Anthony Vincent; Dixon, Katie Marie; Halliday, Gary Mark; Mason, Rebecca Sara
2018-05-01
Inadequately repaired post-UV DNA damage results in skin cancers. DNA repair requires energy but skin cells have limited capacity to produce energy after UV insult. We examined whether energy supply is important for DNA repair after UV exposure, in the presence of 1α,25-dihydroxyvitamin D 3 (1,25(OH) 2 D 3 ), which reduces UV-induced DNA damage and photocarcinogenesis in a variety of models. After UV exposure of primary human keratinocytes, the addition of 1,25(OH) 2 D 3 increased unscheduled DNA synthesis, a measure of DNA repair. Oxidative phosphorylation was depleted in UV-irradiated keratinocytes to undetectable levels within an hour of UV irradiation. Treatment with 1,25(OH) 2 D 3 but not vehicle increased glycolysis after UV. 2-Deoxyglucose-dependent inhibition of glycolysis abolished the reduction in cyclobutane pyrimidine dimers by 1,25(OH) 2 D 3 , whereas inhibition of oxidative phosphorylation had no effect. 1,25(OH) 2 D 3 increased autophagy and modulated PINK1/Parkin consistent with enhanced mitophagy. These data confirm that energy availability is limited in keratinocytes after exposure to UV. In the presence of 1,25(OH) 2 D 3 , glycolysis is enhanced along with energy-conserving processes such as autophagy and mitophagy, resulting in increased repair of cyclobutane pyrimidine dimers and decreased oxidative DNA damage. Increased energy availability in the presence of 1,25(OH) 2 D 3 is an important contributor to DNA repair in skin after UV exposure. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Zhang, Jing; Kan, Shu; Huang, Brian; Hao, Zhenyue; Mak, Tak W.; Zhong, Qing
2011-01-01
Histone deacetylases (HDACs) are major epigenetic modulators involved in a broad spectrum of human diseases including cancers. Administration of HDAC inhibitors (HDACis) leads to growth inhibition, differentiation, and apoptosis of cancer cells. Understanding the regulatory mechanism of HDACs is imperative to harness the therapeutic potentials of HDACis. Here we show that HDACi- and DNA damage-induced apoptosis are severely compromised in mouse embryonic fibroblasts lacking a HECT domain ubiquitin ligase, Mule (Mcl-1 ubiquitin ligase E3). Mule specifically targets HDAC2 for ubiquitination and degradation. Accumulation of HDAC2 in Mule-deficient cells leads to compromised p53 acetylation as well as crippled p53 transcriptional activation, accumulation, and apoptotic response upon DNA damage and Nutlin-3 treatments. These defects in Mule-null cells can be partially reversed by HDACis and fully rescued by lowering the elevated HDAC2 in Mule-null cells to the normal levels as in wild-type cells. Taken together, our results reveal a critical regulatory mechanism of HDAC2 by Mule and suggest this pathway determines the cellular response to HDACis and DNA damage. PMID:22016339
Ubiquitin-like protein UBL5 promotes the functional integrity of the Fanconi anemia pathway.
Oka, Yasuyoshi; Bekker-Jensen, Simon; Mailand, Niels
2015-05-12
Ubiquitin and ubiquitin-like proteins (UBLs) function in a wide array of cellular processes. UBL5 is an atypical UBL that does not form covalent conjugates with cellular proteins and which has a known role in modulating pre-mRNA splicing. Here, we report an unexpected involvement of human UBL5 in promoting the function of the Fanconi anemia (FA) pathway for repair of DNA interstrand crosslinks (ICLs), mediated by a specific interaction with the central FA pathway component FANCI. UBL5-deficient cells display spliceosome-independent reduction of FANCI protein stability, defective FANCI function in response to DNA damage and hypersensitivity to ICLs. By mapping the sequence determinants underlying UBL5-FANCI binding, we generated separation-of-function mutants to demonstrate that key aspects of FA pathway function, including FANCI-FANCD2 heterodimerization, FANCD2 and FANCI monoubiquitylation and maintenance of chromosome stability after ICLs, are compromised when the UBL5-FANCI interaction is selectively inhibited by mutations in either protein. Together, our findings establish UBL5 as a factor that promotes the functionality of the FA DNA repair pathway. © 2015 The Authors.
Han, Xiaozhe; LaRosa, Karen B; Kawai, Toshihisa; Taubman, Martin A
2014-01-03
Porphyromonas gingivalis (Pg) is one of a constellation of oral organisms associated with human chronic periodontitis. While adaptive immunity to periodontal pathogen proteins has been investigated and is an important component of periodontal bone resorption, the effect of periodontal pathogen DNA in eliciting systemic and mucosal antibody and modulating immune responses has not been investigated. Rowett rats were locally injected with whole genomic Pg DNA in alum. Escherichia coli (Ec) genomic DNA, Fusobacterium nucleatum (Fn) genomic DNA, and saline/alum injected rats served as controls. After various time points, serum IgG and salivary IgA antibody to Ec, Fn or Pg were detected by ELISA. Serum and salivary antibody reactions with Pg surface antigens were determined by Western blot analyses and the specific antigen was identified by mass spectrometry. Effects of genomic DNA immunization on Pg bacterial colonization and experimental periodontal bone resorption were also evaluated. Sera from Pg DNA, Ec DNA and Fn DNA-injected rats did not react with Ec or Fn bacteria. Serum IgG antibody levels to Pg and Pg surface extracts were significantly higher in animals immunized with Pg DNA as compared to the control groups. Rats injected with Pg DNA demonstrated a strong serum IgG and salivary IgA antibody reaction solely to Pg fimbrillin (41kDa), the major protein component of Pg fimbriae. In the Pg DNA-immunized group, the numbers of Pg bacteria in oral cavity and the extent of periodontal bone resorption were significantly reduced after Pg infection. This study suggests that infected hosts may select specific genes from whole genomic DNA of the periodontal pathogen for transcription and presentation. The results indicate that the unique gene selected can initiate a host protective immune response to the parent bacterium. Copyright © 2013 Elsevier Ltd. All rights reserved.
Busch, Robert; Qiu, Weiliang; Lasky-Su, Jessica; Morrow, Jarrett; Criner, Gerard; DeMeo, Dawn
2016-11-05
Chronic obstructive pulmonary disease (COPD) is the third-leading cause of death worldwide. Identifying COPD-associated DNA methylation marks in African-Americans may contribute to our understanding of racial disparities in COPD susceptibility. We determined differentially methylated genes and co-methylation network modules associated with COPD in African-Americans recruited during exacerbations of COPD and smoking controls from the Pennsylvania Study of Chronic Obstructive Pulmonary Exacerbations (PA-SCOPE) cohort. We assessed DNA methylation from whole blood samples in 362 African-American smokers in the PA-SCOPE cohort using the Illumina Infinium HumanMethylation27 BeadChip Array. Final analysis included 19302 CpG probes annotated to the nearest gene transcript after quality control. We tested methylation associations with COPD case-control status using mixed linear models. Weighted gene comethylation networks were constructed using weighted gene coexpression network analysis (WGCNA) and network modules were analyzed for association with COPD. There were five differentially methylated CpG probes significantly associated with COPD among African-Americans at an FDR less than 5 %, and seven additional probes that approached significance at an FDR less than 10 %. The top ranked gene association was MAML1, which has been shown to affect NOTCH-dependent angiogenesis in murine lung. Network modeling yielded the "yellow" and "blue" comethylation modules which were significantly associated with COPD (p-value 4 × 10 -10 and 4 × 10 -9 , respectively). The yellow module was enriched for gene sets related to inflammatory pathways known to be relevant to COPD. The blue module contained the top ranked genes in the concurrent differential methylation analysis (FXYD1/LGI4, gene significance p-value 1.2 × 10 -26 ; MAML1, p-value 2.0 × 10 -26 ; CD72, p-value 2.1 × 10 -25 ; and LPO, p-value 7.2 × 10 -25 ), and was significantly associated with lung development processes in Gene Ontology gene-set enrichment analysis. We identified 12 differentially methylated CpG sites associated with COPD that mapped to biologically plausible genes. Network module comethylation patterns have identified candidate genes that may be contributing to racial differences in COPD susceptibility and severity. COPD-associated comethylation modules contained genes previously associated with lung disease and inflammation and recapitulated known COPD-associated genes. The genes implicated by differential methylation and WGCNA analysis may provide mechanistic targets contributing to COPD susceptibility, exacerbations, and outcomes among African-Americans. Trial Registration: NCT00774176 , Registry: ClinicalTrials.gov, URL: www.clinicaltrials.gov , Date of Enrollment of First Participant: June 2004, Date Registered: 04 January 2008 (retrospectively registered).
Thiol reductive stress induces cellulose-anchored biofilm formation in Mycobacterium tuberculosis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trivedi, Abhishek; Mavi, Parminder Singh; Bhatt, Deepak
Mycobacterium tuberculosis (Mtb) forms biofilms harbouring antibiotic-tolerant bacilli in vitro, but the factors that induce biofilm formation and the nature of the extracellular material that holds the cells together are poorly understood. Here we show that intracellular thiol reductive stress (TRS) induces formation of Mtb biofilms in vitro, which harbour drug-tolerant but metabolically active bacteria with unchanged levels of ATP/ADP, NAD +/NADH and NADP +/NADPH. The development of these biofilms requires DNA, RNA and protein synthesis. Transcriptional analysis suggests that Mtb modulates only similar to 7% of its genes for survival in biofilms. In addition to proteins, lipids and DNA,more » the extracellular material in these biofilms is primarily composed of polysaccharides, with cellulose being a key component. Lastly, our results contribute to a better understanding of the mechanisms underlying Mtb biofilm formation, although the clinical relevance of Mtb biofilms in human tuberculosis remains unclear.« less
Thiol reductive stress induces cellulose-anchored biofilm formation in Mycobacterium tuberculosis
Trivedi, Abhishek; Mavi, Parminder Singh; Bhatt, Deepak; ...
2016-04-25
Mycobacterium tuberculosis (Mtb) forms biofilms harbouring antibiotic-tolerant bacilli in vitro, but the factors that induce biofilm formation and the nature of the extracellular material that holds the cells together are poorly understood. Here we show that intracellular thiol reductive stress (TRS) induces formation of Mtb biofilms in vitro, which harbour drug-tolerant but metabolically active bacteria with unchanged levels of ATP/ADP, NAD +/NADH and NADP +/NADPH. The development of these biofilms requires DNA, RNA and protein synthesis. Transcriptional analysis suggests that Mtb modulates only similar to 7% of its genes for survival in biofilms. In addition to proteins, lipids and DNA,more » the extracellular material in these biofilms is primarily composed of polysaccharides, with cellulose being a key component. Lastly, our results contribute to a better understanding of the mechanisms underlying Mtb biofilm formation, although the clinical relevance of Mtb biofilms in human tuberculosis remains unclear.« less
Epigenomics, Pharmacoepigenomics, and Personalized Medicine in Cervical Cancer.
Kabekkodu, Shama Prasada; Chakrabarty, Sanjiban; Ghosh, Supriti; Brand, Angela; Satyamoorthy, Kapaettu
2017-01-01
Epigenomics encompasses the study of genome-wide changes in DNA methylation, histone modifications and noncoding RNAs leading to altered transcription, chromatin structure, and posttranscription RNA processing, respectively, resulting in an altered rate of gene expression. The role of epigenetic modifications facilitating human diseases is well established. Previous studies have identified histone and cytosine code during normal and pathological conditions with special emphasis on how these modifications regulate transcriptional events. Recent studies have also mapped these epigenetic modification and pathways leading to carcinogenesis. Discovery of drugs that target proteins/enzymes in the epigenetic pathways may provide better therapeutic opportunities, and identification of such modulators for DNA methylation, histone modifications, and expression of noncoding RNAs for several cancer types is underway. In this review, we provide a detailed description of recent developments in the field of epigenetics and its impact on personalized medicine to manage cervical cancer. © 2017 S. Karger AG, Basel.
In vitro and in vivo models of colorectal cancer: antigenotoxic activity of berries.
Brown, Emma M; Latimer, Cheryl; Allsopp, Philip; Ternan, Nigel G; McMullan, Geoffery; McDougall, Gordon J; Stewart, Derek; Crozier, Alan; Rowland, Ian; Gill, Chris I R
2014-05-07
The etiology of colorectal cancer (CRC), a common cause of cancer-related mortality globally, has strong associations with diet. There is considerable epidemiological evidence that fruits and vegetables are associated with reduced risk of CRC. This paper reviews the extensive evidence, both from in vitro studies and animal models, that components of berry fruits can modulate biomarkers of DNA damage and that these effects may be potentially chemoprotective, given the likely role that oxidative damage plays in mutation rate and cancer risk. Human intervention trials with berries are generally consistent in indicating a capacity to significantly decrease oxidative damage to DNA, but represent limited evidence for anticarcinogenicity, relying as they do on surrogate risk markers. To understand the effects of berry consumption on colorectal cancer risk, future studies will need to be well controlled, with defined berry extracts, using suitable and clinically relevant end points and considering the importance of the gut microbiota.
Thiol reductive stress induces cellulose-anchored biofilm formation in Mycobacterium tuberculosis
Trivedi, Abhishek; Mavi, Parminder Singh; Bhatt, Deepak; Kumar, Ashwani
2016-01-01
Mycobacterium tuberculosis (Mtb) forms biofilms harbouring antibiotic-tolerant bacilli in vitro, but the factors that induce biofilm formation and the nature of the extracellular material that holds the cells together are poorly understood. Here we show that intracellular thiol reductive stress (TRS) induces formation of Mtb biofilms in vitro, which harbour drug-tolerant but metabolically active bacteria with unchanged levels of ATP/ADP, NAD+/NADH and NADP+/NADPH. The development of these biofilms requires DNA, RNA and protein synthesis. Transcriptional analysis suggests that Mtb modulates only ∼7% of its genes for survival in biofilms. In addition to proteins, lipids and DNA, the extracellular material in these biofilms is primarily composed of polysaccharides, with cellulose being a key component. Our results contribute to a better understanding of the mechanisms underlying Mtb biofilm formation, although the clinical relevance of Mtb biofilms in human tuberculosis remains unclear. PMID:27109928
Thiol reductive stress induces cellulose-anchored biofilm formation in Mycobacterium tuberculosis.
Trivedi, Abhishek; Mavi, Parminder Singh; Bhatt, Deepak; Kumar, Ashwani
2016-04-25
Mycobacterium tuberculosis (Mtb) forms biofilms harbouring antibiotic-tolerant bacilli in vitro, but the factors that induce biofilm formation and the nature of the extracellular material that holds the cells together are poorly understood. Here we show that intracellular thiol reductive stress (TRS) induces formation of Mtb biofilms in vitro, which harbour drug-tolerant but metabolically active bacteria with unchanged levels of ATP/ADP, NAD(+)/NADH and NADP(+)/NADPH. The development of these biofilms requires DNA, RNA and protein synthesis. Transcriptional analysis suggests that Mtb modulates only ∼7% of its genes for survival in biofilms. In addition to proteins, lipids and DNA, the extracellular material in these biofilms is primarily composed of polysaccharides, with cellulose being a key component. Our results contribute to a better understanding of the mechanisms underlying Mtb biofilm formation, although the clinical relevance of Mtb biofilms in human tuberculosis remains unclear.
Evidence supporting the conceptual framework of cancer chemoprevention in canines
Kondratyuk, Tamara P.; Adrian, Julie Ann Luiz; Wright, Brian; Park, Eun-Jung; van Breemen, Richard B.; Morris, Kenneth R.; Pezzuto, John M.
2016-01-01
As with human beings, dogs suffer from the consequences of cancer. We investigated the potential of a formulation comprised of resveratrol, ellagic acid, genistein, curcumin and quercetin to modulate biomarkers indicative of disease prevention. Dog biscuits were evaluated for palatability and ability to deliver the chemopreventive agents. The extent of endogenous DNA damage in peripheral blood lymphocytes from dogs given the dietary supplement or placebo showed no change. However, H2O2-inducible DNA damage was significantly decreased after consumption of the supplement. The expression of 11 of 84 genes related to oxidative stress was altered. Hematological parameters remained in the reference range. The concept of chemoprevention for the explicit benefit of the canine is compelling since dogs are an important part of our culture. Our results establish a proof-of-principle and provide a framework for improving the health and well-being of “man’s best friend”. PMID:27216246
MicroRNAs in large herpesvirus DNA genomes: recent advances.
Sorel, Océane; Dewals, Benjamin G
2016-08-01
MicroRNAs (miRNAs) are small non-coding RNAs (ncRNAs) that regulate gene expression. They alter mRNA translation through base-pair complementarity, leading to regulation of genes during both physiological and pathological processes. Viruses have evolved mechanisms to take advantage of the host cells to multiply and/or persist over the lifetime of the host. Herpesviridae are a large family of double-stranded DNA viruses that are associated with a number of important diseases, including lymphoproliferative diseases. Herpesviruses establish lifelong latent infections through modulation of the interface between the virus and its host. A number of reports have identified miRNAs in a very large number of human and animal herpesviruses suggesting that these short non-coding transcripts could play essential roles in herpesvirus biology. This review will specifically focus on the recent advances on the functions of herpesvirus miRNAs in infection and pathogenesis.
Shewale, Jaiprakash G; Schneida, Elaine; Wilson, Jonathan; Walker, Jerilyn A; Batzer, Mark A; Sinha, Sudhir K
2007-03-01
The human DNA quantification (H-Quant) system, developed for use in human identification, enables quantitation of human genomic DNA in biological samples. The assay is based on real-time amplification of AluYb8 insertions in hominoid primates. The relatively high copy number of subfamily-specific Alu repeats in the human genome enables quantification of very small amounts of human DNA. The oligonucleotide primers present in H-Quant are specific for human DNA and closely related great apes. During the real-time PCR, the SYBR Green I dye binds to the DNA that is synthesized by the human-specific AluYb8 oligonucleotide primers. The fluorescence of the bound SYBR Green I dye is measured at the end of each PCR cycle. The cycle at which the fluorescence crosses the chosen threshold correlates to the quantity of amplifiable DNA in that sample. The minimal sensitivity of the H-Quant system is 7.6 pg/microL of human DNA. The amplicon generated in the H-Quant assay is 216 bp, which is within the same range of the common amplifiable short tandem repeat (STR) amplicons. This size amplicon enables quantitation of amplifiable DNA as opposed to a quantitation of degraded or nonamplifiable DNA of smaller sizes. Development and validation studies were performed on the 7500 real-time PCR system following the Quality Assurance Standards for Forensic DNA Testing Laboratories.
Polymerase chain reaction system
Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.
2004-03-02
A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.
Polymorphic design of DNA origami structures through mechanical control of modular components.
Lee, Chanseok; Lee, Jae Young; Kim, Do-Nyun
2017-12-12
Scaffolded DNA origami enables the bottom-up fabrication of diverse DNA nanostructures by designing hundreds of staple strands, comprised of complementary sequences to the specific binding locations of a scaffold strand. Despite its exceptionally high design flexibility, poor reusability of staples has been one of the major hurdles to fabricate assorted DNA constructs in an effective way. Here we provide a rational module-based design approach to create distinct bent shapes with controllable geometries and flexibilities from a single, reference set of staples. By revising the staple connectivity within the desired module, we can control the location, stiffness, and included angle of hinges precisely, enabling the construction of dozens of single- or multiple-hinge structures with the replacement of staple strands up to 12.8% only. Our design approach, combined with computational shape prediction and analysis, can provide a versatile and cost-effective procedure in the design of DNA origami shapes with stiffness-tunable units.
Computational Design of DNA-Binding Proteins.
Thyme, Summer; Song, Yifan
2016-01-01
Predicting the outcome of engineered and naturally occurring sequence perturbations to protein-DNA interfaces requires accurate computational modeling technologies. It has been well established that computational design to accommodate small numbers of DNA target site substitutions is possible. This chapter details the basic method of design used in the Rosetta macromolecular modeling program that has been successfully used to modulate the specificity of DNA-binding proteins. More recently, combining computational design and directed evolution has become a common approach for increasing the success rate of protein engineering projects. The power of such high-throughput screening depends on computational methods producing multiple potential solutions. Therefore, this chapter describes several protocols for increasing the diversity of designed output. Lastly, we describe an approach for building comparative models of protein-DNA complexes in order to utilize information from homologous sequences. These models can be used to explore how nature modulates specificity of protein-DNA interfaces and potentially can even be used as starting templates for further engineering.
Integrative analyses shed new light on human ribosomal protein gene regulation
Li, Xin; Zheng, Yiyu; Hu, Haiyan; Li, Xiaoman
2016-01-01
Ribosomal protein genes (RPGs) are important house-keeping genes that are well-known for their coordinated expression. Previous studies on RPGs are largely limited to their promoter regions. Recent high-throughput studies provide an unprecedented opportunity to study how human RPGs are transcriptionally modulated and how such transcriptional regulation may contribute to the coordinate gene expression in various tissues and cell types. By analyzing the DNase I hypersensitive sites under 349 experimental conditions, we predicted 217 RPG regulatory regions in the human genome. More than 86.6% of these computationally predicted regulatory regions were partially corroborated by independent experimental measurements. Motif analyses on these predicted regulatory regions identified 31 DNA motifs, including 57.1% of experimentally validated motifs in literature that regulate RPGs. Interestingly, we observed that the majority of the predicted motifs were shared by the predicted distal and proximal regulatory regions of the same RPGs, a likely general mechanism for enhancer-promoter interactions. We also found that RPGs may be differently regulated in different cells, indicating that condition-specific RPG regulatory regions still need to be discovered and investigated. Our study advances the understanding of how RPGs are coordinately modulated, which sheds light to the general principles of gene transcriptional regulation in mammals. PMID:27346035
Integrative analyses shed new light on human ribosomal protein gene regulation.
Li, Xin; Zheng, Yiyu; Hu, Haiyan; Li, Xiaoman
2016-06-27
Ribosomal protein genes (RPGs) are important house-keeping genes that are well-known for their coordinated expression. Previous studies on RPGs are largely limited to their promoter regions. Recent high-throughput studies provide an unprecedented opportunity to study how human RPGs are transcriptionally modulated and how such transcriptional regulation may contribute to the coordinate gene expression in various tissues and cell types. By analyzing the DNase I hypersensitive sites under 349 experimental conditions, we predicted 217 RPG regulatory regions in the human genome. More than 86.6% of these computationally predicted regulatory regions were partially corroborated by independent experimental measurements. Motif analyses on these predicted regulatory regions identified 31 DNA motifs, including 57.1% of experimentally validated motifs in literature that regulate RPGs. Interestingly, we observed that the majority of the predicted motifs were shared by the predicted distal and proximal regulatory regions of the same RPGs, a likely general mechanism for enhancer-promoter interactions. We also found that RPGs may be differently regulated in different cells, indicating that condition-specific RPG regulatory regions still need to be discovered and investigated. Our study advances the understanding of how RPGs are coordinately modulated, which sheds light to the general principles of gene transcriptional regulation in mammals.
Prototype Biology-Based Radiation Risk Module Project
NASA Technical Reports Server (NTRS)
Terrier, Douglas; Clayton, Ronald G.; Patel, Zarana; Hu, Shaowen; Huff, Janice
2015-01-01
Biological effects of space radiation and risk mitigation are strategic knowledge gaps for the Evolvable Mars Campaign. The current epidemiology-based NASA Space Cancer Risk (NSCR) model contains large uncertainties (HAT #6.5a) due to lack of information on the radiobiology of galactic cosmic rays (GCR) and lack of human data. The use of experimental models that most accurately replicate the response of human tissues is critical for precision in risk projections. Our proposed study will compare DNA damage, histological, and cell kinetic parameters after irradiation in normal 2D human cells versus 3D tissue models, and it will use a multi-scale computational model (CHASTE) to investigate various biological processes that may contribute to carcinogenesis, including radiation-induced cellular signaling pathways. This cross-disciplinary work, with biological validation of an evolvable mathematical computational model, will help reduce uncertainties within NSCR and aid risk mitigation for radiation-induced carcinogenesis.
Regulation of DNA methylation patterns by CK2-mediated phosphorylation of Dnmt3a.
Deplus, Rachel; Blanchon, Loïc; Rajavelu, Arumugam; Boukaba, Abdelhalim; Defrance, Matthieu; Luciani, Judith; Rothé, Françoise; Dedeurwaerder, Sarah; Denis, Hélène; Brinkman, Arie B; Simmer, Femke; Müller, Fabian; Bertin, Benjamin; Berdasco, Maria; Putmans, Pascale; Calonne, Emilie; Litchfield, David W; de Launoit, Yvan; Jurkowski, Tomasz P; Stunnenberg, Hendrik G; Bock, Christoph; Sotiriou, Christos; Fraga, Mario F; Esteller, Manel; Jeltsch, Albert; Fuks, François
2014-08-07
DNA methylation is a central epigenetic modification that is established by de novo DNA methyltransferases. The mechanisms underlying the generation of genomic methylation patterns are still poorly understood. Using mass spectrometry and a phosphospecific Dnmt3a antibody, we demonstrate that CK2 phosphorylates endogenous Dnmt3a at two key residues located near its PWWP domain, thereby downregulating the ability of Dnmt3a to methylate DNA. Genome-wide DNA methylation analysis shows that CK2 primarily modulates CpG methylation of several repeats, most notably of Alu SINEs. This modulation can be directly attributed to CK2-mediated phosphorylation of Dnmt3a. We also find that CK2-mediated phosphorylation is required for localization of Dnmt3a to heterochromatin. By revealing phosphorylation as a mode of regulation of de novo DNA methyltransferase function and by uncovering a mechanism for the regulation of methylation at repetitive elements, our results shed light on the origin of DNA methylation patterns. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
The past and presence of gene targeting: from chemicals and DNA via proteins to RNA.
Geel, T M; Ruiters, M H J; Cool, R H; Halby, L; Voshart, D C; Andrade Ruiz, L; Niezen-Koning, K E; Arimondo, P B; Rots, M G
2018-06-05
The ability to target DNA specifically at any given position within the genome allows many intriguing possibilities and has inspired scientists for decades. Early gene-targeting efforts exploited chemicals or DNA oligonucleotides to interfere with the DNA at a given location in order to inactivate a gene or to correct mutations. We here describe an example towards correcting a genetic mutation underlying Pompe's disease using a nucleotide-fused nuclease (TFO-MunI). In addition to the promise of gene correction, scientists soon realized that genes could be inactivated or even re-activated without inducing potentially harmful DNA damage by targeting transcriptional modulators to a particular gene. However, it proved difficult to fuse protein effector domains to the first generation of programmable DNA-binding agents. The engineering of gene-targeting proteins (zinc finger proteins (ZFPs), transcription activator-like effectors (TALEs)) circumvented this problem. The disadvantage of protein-based gene targeting is that a fusion protein needs to be engineered for every locus. The recent introduction of CRISPR/Cas offers a flexible approach to target a (fusion) protein to the locus of interest using cheap designer RNA molecules. Many research groups now exploit this platform and the first human clinical trials have been initiated: CRISPR/Cas has kicked off a new era of gene targeting and is revolutionizing biomedical sciences.This article is part of a discussion meeting issue 'Frontiers in epigenetic chemical biology'. © 2018 The Author(s).
Fish, Trevor J; Benninghoff, Abby D
2017-11-01
Polycyclic aromatic hydrocarbons (PAHs) comprise an important class of environmental pollutants that are known to cause lung cancer in animals and are suspected lung carcinogens in humans. Moreover, evidence from cell-based studies points to PAHs as modulators of the epigenome. The objective of this work was to assess patterns of genome-wide DNA methylation in lung tissues of adult offspring initiated in utero with the transplacental PAH carcinogens dibenzo [def,p]chrysene (DBC) or benzo [a]pyrene (BaP). Genome-wide methylation patterns for normal (not exposed), normal adjacent and lung tumor tissues obtained from adult offspring were determined using methylated DNA immunoprecipitation (MeDIP) with the NimbleGen mouse DNA methylation CpG island array. Lung tumor incidence in 45-week old mice initiated with BaP was 32%, much lower than that of the DBC-exposed offspring at 96%. Also, male offspring appeared more susceptible to BaP as compared to females. Distinct patterns of DNA methylation were associated with non-exposed, normal adjacent and adenocarcinoma lung tissues, as determined by principal components, hierarchical clustering and gene ontology analyses. From these methylation profiles, a set of genes of interest was identified that includes potential important targets for epigenetic modification during the process of lung tumorigenesis in animals exposed to environmental PAHs. Copyright © 2017 Elsevier Ltd. All rights reserved.
A novel function of adenomatous polyposis coli (APC) in regulating DNA repair
Jaiswal, Aruna S.; Narayan, Satya
2008-01-01
Prevailing literature suggests diversified cellular functions for the adenomatous polyposis coli (APC) gene. Among them a recently discovered unique role of APC is in DNA repair. The APC gene can modulate the base excision repair (BER) pathway through an interaction with DNA polymerase β (Pol-β) and flap endonuclease 1 (Fen-1). Taken together with the transcriptional activation of APC gene by alkylating agents and modulation of BER activity, APC may play an important role in carcinogenesis and chemotherapy by determining whether cells with DNA damage survive or undergo apoptosis. In this review, we summarize the evidence supporting this novel concept and suggest that these results will have implications for the development of more effective strategies for chemoprevention, prognosis, and chemotherapy of certain types of tumors. PMID:18662849
Miller, Mark P.; Knaus, Brian J.; Mullins, Thomas D.; Haig, Susan M.
2013-01-01
SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (SSRs; for example, microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains three analysis modules along with a fourth control module that can be used to automate analyses of large volumes of data. The modules are used to (1) identify the subset of paired-end sequences that pass quality standards, (2) align paired-end reads into a single composite DNA sequence, and (3) identify sequences that possess microsatellites conforming to user specified parameters. Each of the three separate analysis modules also can be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc). All modules are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, Windows). The program suite relies on a compiled Python extension module to perform paired-end alignments. Instructions for compiling the extension from source code are provided in the documentation. Users who do not have Python installed on their computers or who do not have the ability to compile software also may choose to download packaged executable files. These files include all Python scripts, a copy of the compiled extension module, and a minimal installation of Python in a single binary executable. See program documentation for more information.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio
The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less
Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...
2016-03-09
The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less
Dingley, Stephen D.; Polyak, Erzsebet; Ostrovsky, Julian; Srinivasan, Satish; Lee, Icksoo; Rosenfeld, Amy B.; Tsukikawa, Mai; Xiao, Rui; Selak, Mary A.; Coon, Joshua J.; Hebert, Alexander S.; Grimsrud, Paul A.; Kwon, Young Joon; Pagliarini, David J.; Gai, Xiaowu; Schurr, Theodore G.; Hüttemann, Maik; Nakamaru-Ogiso, Eiko; Falk, Marni J.
2014-01-01
Mitochondrial DNA (mtDNA) sequence variation can influence the penetrance of complex diseases and climatic adaptation. While studies in geographically defined human populations suggest that mtDNA mutations become fixed when they have conferred metabolic capabilities optimally suited for a specific environment, it has been challenging to definitively assign adaptive functions to specific mtDNA sequence variants in mammals. We investigated whether mtDNA genome variation functionally influences Caenorhabditis elegans wild isolates of distinct mtDNA lineages and geographic origins. We found that, relative to N2 (England) wild-type nematodes, CB4856 wild isolates from a warmer native climate (Hawaii) had a unique p.A12S amino acid substitution in the mtDNA-encoded COX1 core catalytic subunit of mitochondrial complex IV (CIV). Relative to N2, CB4856 worms grown at 20 °C had significantly increased CIV enzyme activity, mitochondrial matrix oxidant burden, and sensitivity to oxidative stress but had significantly reduced lifespan and mitochondrial membrane potential. Interestingly, mitochondrial membrane potential was significantly increased in CB4856 grown at its native temperature of 25 °C. A transmitochondrial cybrid worm strain, chpIR (M, CB4856 > N2), was bred as homoplasmic for the CB4856 mtDNA genome in the N2 nuclear background. The cybrid strain also displayed significantly increased CIV activity, demonstrating that this difference results from the mtDNA-encoded p.A12S variant. However, chpIR (M, CB4856 > N2) worms had significantly reduced median and maximal lifespan relative to CB4856, which may relate to their nuclear– mtDNA genome mismatch. Overall, these data suggest that C. elegans wild isolates of varying geographic origins may adapt to environmental challenges through mtDNA variation to modulate critical aspects of mitochondrial energy metabolism. PMID:24534730
Poorebrahim, Mansour; Salarian, Ali; Najafi, Saeideh; Abazari, Mohammad Foad; Aleagha, Maryam Nouri; Dadras, Mohammad Nasr; Jazayeri, Seyed Mohammad; Ataei, Atousa; Poortahmasebi, Vahdat
2017-05-01
Epstein-Barr virus (EBV) is the most common cause of infectious mononucleosis (IM) and establishes lifetime infection associated with a variety of cancers and autoimmune diseases. The aim of this study was to develop an integrative gene regulatory network (GRN) approach and overlying gene expression data to identify the representative subnetworks for IM and EBV latent infection (LI). After identifying differentially expressed genes (DEGs) in both IM and LI gene expression profiles, functional annotations were applied using gene ontology (GO) and BiNGO tools, and construction of GRNs, topological analysis and identification of modules were carried out using several plugins of Cytoscape. In parallel, a human-EBV GRN was generated using the Hu-Vir database for further analyses. Our analysis revealed that the majority of DEGs in both IM and LI were involved in cell-cycle and DNA repair processes. However, these genes showed a significant negative correlation in the IM and LI states. Furthermore, cyclin-dependent kinase 2 (CDK2) - a hub gene with the highest centrality score - appeared to be the key player in cell cycle regulation in IM disease. The most significant functional modules in the IM and LI states were involved in the regulation of the cell cycle and apoptosis, respectively. Human-EBV network analysis revealed several direct targets of EBV proteins during IM disease. Our study provides an important first report on the response to IM/LI EBV infection in humans. An important aspect of our data was the upregulation of genes associated with cell cycle progression and proliferation.
Lever, Mark A.; Torti, Andrea; Eickenbusch, Philip; Michaud, Alexander B.; Šantl-Temkiv, Tina; Jørgensen, Bo Barker
2015-01-01
A method for the extraction of nucleic acids from a wide range of environmental samples was developed. This method consists of several modules, which can be individually modified to maximize yields in extractions of DNA and RNA or separations of DNA pools. Modules were designed based on elaborate tests, in which permutations of all nucleic acid extraction steps were compared. The final modular protocol is suitable for extractions from igneous rock, air, water, and sediments. Sediments range from high-biomass, organic rich coastal samples to samples from the most oligotrophic region of the world's oceans and the deepest borehole ever studied by scientific ocean drilling. Extraction yields of DNA and RNA are higher than with widely used commercial kits, indicating an advantage to optimizing extraction procedures to match specific sample characteristics. The ability to separate soluble extracellular DNA pools without cell lysis from intracellular and particle-complexed DNA pools may enable new insights into the cycling and preservation of DNA in environmental samples in the future. A general protocol is outlined, along with recommendations for optimizing this general protocol for specific sample types and research goals. PMID:26042110
Yu, Seon-Mi; Kim, Song-Ja
2015-10-01
The cytosine analogue 5'-azacytidine (5'-aza) induces DNA hypomethylation by inhibiting DNA methyltransferase. In clinical trials, 5'-aza is widely used in epigenetic anticancer treatments. Accumulated evidence shows that cyclooxygenase-2 (COX-2) is overexpressed in various cancers, indicating that it may play a critical role in carcinogenesis. However, few studies have been performed to explore the molecular mechanism underlying the increased COX-2 expression. Therefore, we tested the hypothesis that 5'-aza regulates COX-2 expression and prostaglandin E2 (PGE2) production. The human fibrosarcoma cell line HT1080, was treated with various concentrations of 5'-aza for different time periods. Protein expressions of COX-2, DNA (cytosine-5)-methyltransferase 1 (DNMT1), pAkt, Akt, extracellular signal-regulated kinase (ERK), and phosphorylated ERK (pERK) were determined using western blot analysis, and COX-2 mRNA expression was determined using RT-PCR. PGE2 production was evaluated using the PGE2 assay kit. The localization and expression of COX-2 were determined using immunofluorescence staining. Treatment with 5'-aza induces protein and mRNA expression of COX-2. We also observed that 5'-aza-induced COX-2 expression and PGE2 production were inhibited by S-adenosylmethionine (SAM), a methyl donor. Treatment with 5'-aza phosphorylates PI3-kinase/Akt and ERK-1/2; inhibition of these pathways by LY294002, an inhibitor of PI3-kinase/Akt, or PD98059, an inhibitor of ERK-1/2, respectively, prevents 5'-aza-induced COX-2 expression and PGE2 production. Overall, these observations indicate that the hypomethylating agent 5'-aza modulates COX-2 expression via the PI3-kinase/Akt and ERK-1/2 pathways in human HT1080 fibrosarcoma cells.
DNA Double-Strand Break Repair Genes and Oxidative Damage in Brain Metastasis of Breast Cancer
Evans, Lynda; Duchnowska, Renata; Reed, L. Tiffany; Palmieri, Diane; Qian, Yongzhen; Badve, Sunil; Sledge, George; Gril, Brunilde; Aladjem, Mirit I.; Fu, Haiqing; Flores, Natasha M.; Gökmen-Polar, Yesim; Biernat, Wojciech; Szutowicz-Zielińska, Ewa; Mandat, Tomasz; Trojanowski, Tomasz; Och, Waldemar; Czartoryska-Arlukowicz, Bogumiła; Jassem, Jacek; Mitchell, James B.
2014-01-01
Background Breast cancer frequently metastasizes to the brain, colonizing a neuro-inflammatory microenvironment. The molecular pathways facilitating this colonization remain poorly understood. Methods Expression profiling of 23 matched sets of human resected brain metastases and primary breast tumors by two-sided paired t test was performed to identify brain metastasis–specific genes. The implicated DNA repair genes BARD1 and RAD51 were modulated in human (MDA-MB-231-BR) and murine (4T1-BR) brain-tropic breast cancer cell lines by lentiviral transduction of cDNA or short hairpin RNA (shRNA) coding sequences. Their functional contribution to brain metastasis development was evaluated in mouse xenograft models (n = 10 mice per group). Results Human brain metastases overexpressed BARD1 and RAD51 compared with either matched primary tumors (1.74-fold, P < .001; 1.46-fold, P < .001, respectively) or unlinked systemic metastases (1.49-fold, P = .01; 1.44-fold, P = .008, respectively). Overexpression of either gene in MDA-MB-231-BR cells increased brain metastases by threefold to fourfold after intracardiac injections, but not lung metastases upon tail-vein injections. In 4T1-BR cells, shRNA-mediated RAD51 knockdown reduced brain metastases by 2.5-fold without affecting lung metastasis development. In vitro, BARD1- and RAD51-overexpressing cells showed reduced genomic instability but only exhibited growth and colonization phenotypes upon DNA damage induction. Reactive oxygen species were present in tumor cells and elevated in the metastatic neuro-inflammatory microenvironment and could provide an endogenous source of genotoxic stress. Tempol, a brain-permeable oxygen radical scavenger suppressed brain metastasis promotion induced by BARD1 and RAD51 overexpression. Conclusions BARD1 and RAD51 are frequently overexpressed in brain metastases from breast cancer and may constitute a mechanism to overcome reactive oxygen species–mediated genotoxic stress in the metastatic brain. PMID:24948741
DNA double-strand break repair genes and oxidative damage in brain metastasis of breast cancer.
Woditschka, Stephan; Evans, Lynda; Duchnowska, Renata; Reed, L Tiffany; Palmieri, Diane; Qian, Yongzhen; Badve, Sunil; Sledge, George; Gril, Brunilde; Aladjem, Mirit I; Fu, Haiqing; Flores, Natasha M; Gökmen-Polar, Yesim; Biernat, Wojciech; Szutowicz-Zielińska, Ewa; Mandat, Tomasz; Trojanowski, Tomasz; Och, Waldemar; Czartoryska-Arlukowicz, Bogumiła; Jassem, Jacek; Mitchell, James B; Steeg, Patricia S
2014-07-01
Breast cancer frequently metastasizes to the brain, colonizing a neuro-inflammatory microenvironment. The molecular pathways facilitating this colonization remain poorly understood. Expression profiling of 23 matched sets of human resected brain metastases and primary breast tumors by two-sided paired t test was performed to identify brain metastasis-specific genes. The implicated DNA repair genes BARD1 and RAD51 were modulated in human (MDA-MB-231-BR) and murine (4T1-BR) brain-tropic breast cancer cell lines by lentiviral transduction of cDNA or short hairpin RNA (shRNA) coding sequences. Their functional contribution to brain metastasis development was evaluated in mouse xenograft models (n = 10 mice per group). Human brain metastases overexpressed BARD1 and RAD51 compared with either matched primary tumors (1.74-fold, P < .001; 1.46-fold, P < .001, respectively) or unlinked systemic metastases (1.49-fold, P = .01; 1.44-fold, P = .008, respectively). Overexpression of either gene in MDA-MB-231-BR cells increased brain metastases by threefold to fourfold after intracardiac injections, but not lung metastases upon tail-vein injections. In 4T1-BR cells, shRNA-mediated RAD51 knockdown reduced brain metastases by 2.5-fold without affecting lung metastasis development. In vitro, BARD1- and RAD51-overexpressing cells showed reduced genomic instability but only exhibited growth and colonization phenotypes upon DNA damage induction. Reactive oxygen species were present in tumor cells and elevated in the metastatic neuro-inflammatory microenvironment and could provide an endogenous source of genotoxic stress. Tempol, a brain-permeable oxygen radical scavenger suppressed brain metastasis promotion induced by BARD1 and RAD51 overexpression. BARD1 and RAD51 are frequently overexpressed in brain metastases from breast cancer and may constitute a mechanism to overcome reactive oxygen species-mediated genotoxic stress in the metastatic brain. Published by Oxford University Press 2014.
Barbolina, Maria V; Adley, Brian P; Kelly, David L; Shepard, Jaclyn; Fought, Angela J; Scholtens, Denise; Penzes, Peter; Shea, Lonnie D; Stack, M Sharon
2009-08-15
Epithelial ovarian carcinoma (EOC) is a leading cause of death from gynecologic malignancies, due mainly to the prevalence of undetected metastatic disease. The process of cell invasion during intraperitoneal anchoring of metastatic lesions requires concerted regulation of many processes, including modulation of adhesion to the extracellular matrix and localized invasion. Exploratory cDNA microarray analysis of early response genes (altered after 4 hr of 3D collagen culture) coupled with confirmatory real-time reverse-transcriptase polymerase chain reaction, multiple 3D cell culture matrices, Western blot, immunostaining, adhesion, migration and invasion assays were used to identify modulators of adhesion pertinent to EOC progression and metastasis. cDNA microarray analysis indicated a dramatic downregulation of connective tissue growth factor (CTGF) in EOC cells placed in invasion- mimicking conditions (3D Type I collagen). Examination of human EOC specimens revealed that CTGF expression was absent in 46% of the tested samples (n = 41), but was present in 100% of normal ovarian epithelium samples (n = 7). Reduced CTGF expression occurs in many types of cells and may be a general phenomenon displayed by cells encountering a 3D environment. CTGF levels were inversely correlated with invasion such that downregulation of CTGF increased, while its upregulation reduced collagen invasion. Cells adhered preferentially to a surface comprised of both collagen I and CTGF relative to either component alone using alpha6beta1 and alpha3beta1 integrins. Together these data suggest that downregulation of CTGF in EOC cells may be important for cell invasion through modulation of cell-matrix adhesion.
Barbolina, Maria V.; Adley, Brian P.; Kelly, David L.; Shepard, Jaclyn; Fought, Angela J.; Scholtens, Denise; Penzes, Peter; Shea, Lonnie D.; Sharon Stack, M
2010-01-01
Epithelial ovarian carcinoma (EOC) is a leading cause of death from gynecologic malignancy, due mainly to the prevalence of undetected metastatic disease. The process of cell invasion during intra-peritoneal anchoring of metastatic lesions requires concerted regulation of many processes, including modulation of adhesion to the extracellular matrix and localized invasion. Exploratory cDNA microarray analysis of early response genes (altered after 4 hours of 3-dimensional collagen culture) coupled with confirmatory real-time RT-PCR, multiple three-dimensional cell culture matrices, Western blot, immunostaining, adhesion, migration, and invasion assays were used to identify modulators of adhesion pertinent to EOC progression and metastasis. cDNA microarray analysis indicated a dramatic downregulation of connective tissue growth factor (CTGF) in EOC cells placed in invasion-mimicking conditions (3-dimensional type I collagen). Examination of human EOC specimens revealed that CTGF expression was absent in 46% of the tested samples (n=41), but was present in 100% of normal ovarian epithelium samples (n=7). Reduced CTGF expression occurs in many types of cells and may be a general phenomenon displayed by cells encountering a 3D environment. CTGF levels were inversely correlated with invasion such that downregulation of CTGF increased, while its upregulation reduced, collagen invasion. Cells adhered preferentially to a surface comprised of both collagen I and CTGF relative to either component alone using α6β1 and α3β1 integrins. Together these data suggest that downregulation of CTGF in EOC cells may be important for cell invasion through modulation of cell-matrix adhesion. PMID:19382180
DOE Office of Scientific and Technical Information (OSTI.GOV)
Panning, B.; Smiley, J.R.
1993-06-01
Alu elements are the single most abundant class of dispersed repeated sequences in the human genome, comprising 5-10% of the mass of human DNA. This report demonstrates that Ad5 infection strongly stimulates Pol III transcription of human Alu elements in HeLa and 293 cells. In contrast to the cases of Ad5-induced Pol III transcriptional activation, this process requires the E1b 58-kDa protein and the products of E4 open reading frames (ORFs) 3 and 6 in addition to the E1a 289-residue product. These findings suggest novel regulatory properties of the Ad5 E1b and E4 proteins and raise the possibility that analogousmore » cellular trans-acting factors serve to modulate Alu expression in vivo.« less
Mohamed, Mohamed R; Rahman, Masmudur M; Lanchbury, Jerry S; Shattuck, Donna; Neff, Chris; Dufford, Max; van Buuren, Nick; Fagan, Katharine; Barry, Michele; Smith, Scott; Damon, Inger; McFadden, Grant
2009-06-02
Identification of the binary interactions between viral and host proteins has become a valuable tool for investigating viral tropism and pathogenesis. Here, we present the first systematic protein interaction screening of the unique variola virus proteome by using yeast 2-hybrid screening against a variety of human cDNA libraries. Several protein-protein interactions were identified, including an interaction between variola G1R, an ankryin/F-box containing protein, and human nuclear factor kappa-B1 (NF-kappaB1)/p105. This represents the first direct interaction between a pathogen-encoded protein and NF-kappaB1/p105. Orthologs of G1R are present in a variety of pathogenic orthopoxviruses, but not in vaccinia virus, and expression of any one of these viral proteins blocks NF-kappaB signaling in human cells. Thus, proteomic screening of variola virus has the potential to uncover modulators of the human innate antiviral responses.
van Oers, Johanna M. M.; Edwards, Yasmin; Chahwan, Richard; Zhang, Weijia; Smith, Cameron; Pechuan, Joaquín; Schaetzlein, Sonja; Jin, Bo; Wang, Yuxun; Bergman, Aviv; Scharff, Matthew D.; Edelmann, Winfried
2014-01-01
Loss of the DNA mismatch repair protein MSH3 leads to the development of a variety of tumors in mice without significantly affecting survival rates, suggesting a modulating role for the MutSβ (MSH2-MSH3) complex in late onset tumorigenesis. To better study the role of MSH3 in tumor progression, we crossed Msh3−/− mice onto a tumor predisposing p53-deficient background. Survival of Msh3/p53 mice was not reduced compared to single p53 mutant mice; however, the tumor spectrum changed significantly from lymphoma to sarcoma, indicating MSH3 as a potent modulator of p53-driven tumorigenesis. Interestingly, Msh3−/− mouse embryonic fibroblasts displayed increased chromatid breaks and persistence of γH2AX foci following ionizing radiation, indicating a defect in DNA double strand break repair. Msh3/p53 tumors showed increased loss of heterozygosity, elevated genome-wide copy number variation, and a moderate microsatellite instability phenotype compared to Msh2/p53 tumors, revealing that MSH2-MSH3 suppresses tumorigenesis by maintaining chromosomal stability. Our results show that the MSH2-MSH3 complex is important for the suppression of late onset tumors due to its role in DNA double strand break repair as well as in DNA mismatch repair. Furthermore, they demonstrate that MSH2-MSH3 suppresses chromosomal instability and modulates the tumor spectrum in p53-deficient tumorigenesis, and possibly plays a role in other chromosomally unstable tumors as well. PMID:24013230
van Oers, J M M; Edwards, Y; Chahwan, R; Zhang, W; Smith, C; Pechuan, X; Schaetzlein, S; Jin, B; Wang, Y; Bergman, A; Scharff, M D; Edelmann, W
2014-07-24
Loss of the DNA mismatch repair (MMR) protein MSH3 leads to the development of a variety of tumors in mice without significantly affecting survival rates, suggesting a modulating role for the MutSβ (MSH2-MSH3) complex in late-onset tumorigenesis. To better study the role of MSH3 in tumor progression, we crossed Msh3(-/-) mice onto a tumor predisposing p53-deficient background. Survival of Msh3/p53 mice was not reduced compared with p53 single mutant mice; however, the tumor spectrum changed significantly from lymphoma to sarcoma, indicating MSH3 as a potent modulator of p53-driven tumorigenesis. Interestingly, Msh3(-/-) mouse embryonic fibroblasts displayed increased chromatid breaks and persistence of γH2AX foci following ionizing radiation, indicating a defect in DNA double-strand break repair (DSBR). Msh3/p53 tumors showed increased loss of heterozygosity, elevated genome-wide copy-number variation and a moderate microsatellite instability phenotype compared with Msh2/p53 tumors, revealing that MSH2-MSH3 suppresses tumorigenesis by maintaining chromosomal stability. Our results show that the MSH2-MSH3 complex is important for the suppression of late-onset tumors due to its roles in DNA DSBR as well as in DNA MMR. Further, they demonstrate that MSH2-MSH3 suppresses chromosomal instability and modulates the tumor spectrum in p53-deficient tumorigenesis and possibly has a role in other chromosomally unstable tumors as well.
Fortin, Connor H; Schulze, Katharina V; Babbitt, Gregory A
2015-01-01
It is now widely-accepted that DNA sequences defining DNA-protein interactions functionally depend upon local biophysical features of DNA backbone that are important in defining sites of binding interaction in the genome (e.g. DNA shape, charge and intrinsic dynamics). However, these physical features of DNA polymer are not directly apparent when analyzing and viewing Shannon information content calculated at single nucleobases in a traditional sequence logo plot. Thus, sequence logos plots are severely limited in that they convey no explicit information regarding the structural dynamics of DNA backbone, a feature often critical to binding specificity. We present TRX-LOGOS, an R software package and Perl wrapper code that interfaces the JASPAR database for computational regulatory genomics. TRX-LOGOS extends the traditional sequence logo plot to include Shannon information content calculated with regard to the dinucleotide-based BI-BII conformation shifts in phosphate linkages on the DNA backbone, thereby adding a visual measure of intrinsic DNA flexibility that can be critical for many DNA-protein interactions. TRX-LOGOS is available as an R graphics module offered at both SourceForge and as a download supplement at this journal. To demonstrate the general utility of TRX logo plots, we first calculated the information content for 416 Saccharomyces cerevisiae transcription factor binding sites functionally confirmed in the Yeastract database and matched to previously published yeast genomic alignments. We discovered that flanking regions contain significantly elevated information content at phosphate linkages than can be observed at nucleobases. We also examined broader transcription factor classifications defined by the JASPAR database, and discovered that many general signatures of transcription factor binding are locally more information rich at the level of DNA backbone dynamics than nucleobase sequence. We used TRX-logos in combination with MEGA 6.0 software for molecular evolutionary genetics analysis to visually compare the human Forkhead box/FOX protein evolution to its binding site evolution. We also compared the DNA binding signatures of human TP53 tumor suppressor determined by two different laboratory methods (SELEX and ChIP-seq). Further analysis of the entire yeast genome, center aligned at the start codon, also revealed a distinct sequence-independent 3 bp periodic pattern in information content, present only in coding region, and perhaps indicative of the non-random organization of the genetic code. TRX-LOGOS is useful in any situation in which important information content in DNA can be better visualized at the positions of phosphate linkages (i.e. dinucleotides) where the dynamic properties of the DNA backbone functions to facilitate DNA-protein interaction.
Kenyon, Lesley; Moraes, Carlos T.
1997-01-01
The nuclear and mitochondrial genomes coevolve to optimize approximately 100 different interactions necessary for an efficient ATP-generating system. This coevolution led to a species-specific compatibility between these genomes. We introduced mitochondrial DNA (mtDNA) from different primates into mtDNA-less human cells and selected for growth of cells with a functional oxidative phosphorylation system. mtDNA from common chimpanzee, pigmy chimpanzee, and gorilla were able to restore oxidative phosphorylation in the context of a human nuclear background, whereas mtDNA from orangutan, and species representative of Old-World monkeys, New-World monkeys, and lemurs were not. Oxygen consumption, a sensitive index of respiratory function, showed that mtDNA from chimpanzee, pigmy chimpanzee, and gorilla replaced the human mtDNA and restored respiration to essentially normal levels. Mitochondrial protein synthesis was also unaltered in successful “xenomitochondrial cybrids.” The abrupt failure of mtDNA from primate species that diverged from humans as recently as 8–18 million years ago to functionally replace human mtDNA suggests the presence of one or a few mutations affecting critical nuclear–mitochondrial genome interactions between these species. These cellular systems provide a demonstration of intergenus mtDNA transfer, expand more than 20-fold the number of mtDNA polymorphisms that can be analyzed in a human nuclear background, and provide a novel model for the study of nuclear–mitochondrial interactions. PMID:9256447
Liu, Hong; Bolton, Judy L.; Thatcher, Gregory R. J.
2008-01-01
The benzothiophene SERMs raloxifene and arzoxifene, in the clinic or clinical trials for treatment of breast cancer and postmenopausal symptoms, are highly susceptible to oxidative metabolism and formation of electrophilic metabolites. 4′F-DMA, fluoro-substituted desmethyl arzoxifene (DMA), showed attenuated oxidation to quinoids in incubation with rat hepatocytes as well as in rat and human liver microsomes. Incubations of 4′F-DMA with hepatocytes yielded only one glucuronide conjugate and no GSH conjugates; whereas DMA underwent greater metabolism giving two glucuronide conjugates, one sulfate conjugate, and two GSH conjugates. Phase I and phase II metabolism was further evaluated in human small intestine microsomes and in human intestinal Caco-2 cells. In comparison to DMA, 4′F-DMA formed significantly less glucuronide and sulfate conjugates. The formation of quinoids was futher explored in hepatocytes in which DMA was observed to give concentration and time dependent depletion of GSH accompanied by damage to DNA which showed inverse dependence on GSH; in contrast, GSH depletion and DNA damage were almost completely abrogated in incubations with 4′F-DMA. 4′F-DMA shows ligand binding affinity to ERα and ERβ with similarity to both raloxifene and to DMA. ER-mediated biological activity was measured with the ERE-luciferase reporter system in transfected MCF-7 cells and Ishikawa cells, and in MCF-7 cells proliferation was measured. In all systems, 4′F-DMA exhibited anitestrogenic acitivty of comparable potency to raloxifene, but did not manifest estrogenic properties, mirroring previous results on inhibition of estradiol-mediated induction of alkaline phosphatase activity in Ishikawa cells. These results suggest that 4′F-DMA might be an improved benzothiophene SERM with similar antiestrogenic activity to raloxifene, but improved metabolic stability and attenuated toxicity; showing that simple chemical modification can abrogate oxidative bioactivation to potentially toxic metabolites without loss of activity. PMID:16780356
Lowery, Caitlin D; VanWye, Alle B; Dowless, Michele; Blosser, Wayne; Falcon, Beverly L; Stewart, Julie; Stephens, Jennifer; Beckmann, Richard P; Bence Lin, Aimee; Stancato, Louis F
2017-08-01
Purpose: Checkpoint kinase 1 (CHK1) is a key regulator of the DNA damage response and a mediator of replication stress through modulation of replication fork licensing and activation of S and G 2 -M cell-cycle checkpoints. We evaluated prexasertib (LY2606368), a small-molecule CHK1 inhibitor currently in clinical testing, in multiple preclinical models of pediatric cancer. Following an initial assessment of prexasertib activity, this study focused on the preclinical models of neuroblastoma. Experimental Design: We evaluated the antiproliferative activity of prexasertib in a panel of cancer cell lines; neuroblastoma cell lines were among the most sensitive. Subsequent Western blot and immunofluorescence analyses measured DNA damage and DNA repair protein activation. Prexasertib was investigated in several cell line-derived xenograft mouse models of neuroblastoma. Results: Within 24 hours, single-agent prexasertib promoted γH2AX-positive double-strand DNA breaks and phosphorylation of DNA damage sensors ATM and DNA-PKcs, leading to neuroblastoma cell death. Knockdown of CHK1 and/or CHK2 by siRNA verified that the double-strand DNA breaks and cell death elicited by prexasertib were due to specific CHK1 inhibition. Neuroblastoma xenografts rapidly regressed following prexasertib administration, independent of starting tumor volume. Decreased Ki67 and increased immunostaining of endothelial and pericyte markers were observed in xenografts after only 6 days of exposure to prexasertib, potentially indicating a swift reduction in tumor volume and/or a direct effect on tumor vasculature. Conclusions: Overall, these data demonstrate that prexasertib is a specific inhibitor of CHK1 in neuroblastoma and leads to DNA damage and cell death in preclinical models of this devastating pediatric malignancy. Clin Cancer Res; 23(15); 4354-63. ©2017 AACR . ©2017 American Association for Cancer Research.
Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo
2016-04-15
The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.
Conformation of Tax-response elements in the human T-cell leukemia virus type I promoter.
Cox, J M; Sloan, L S; Schepartz, A
1995-12-01
HTLV-I Tax is believed to activate viral gene expression by binding bZIP proteins (such as CREB) and increasing their affinities for proviral TRE target sites. Each 21 bp TRE target site contains an imperfect copy of the intrinsically bent CRE target site (the TRE core) surrounded by highly conserved flanking sequences. These flanking sequences are essential for maximal increases in DNA affinity and transactivation, but they are not, apparently, contacted by protein. Here we employ non-denaturing gel electrophoresis to evaluate TRE conformation in the presence and absence of bZIP proteins, and to explore the role of DNA conformation in viral transactivation. Our results show that the TRE-1 flanking sequences modulate the structure and modestly increase the affinity of a CREB bZIP peptide for the TRE-1 core recognition sequence. These flanking sequences are also essential for a maximal increase in stability of the CREB-DNA complex in the presence of Tax. The CRE-like TRE core and the TRE flanking sequences are both essential for formation of stable CREB-TRE-1 and Tax-CREB-TRE-1 complexes. These two DNA segments may have co-evolved into a unique structure capable of recognizing Tax and a bZIP protein.
Sex differences in DNA methylation of the cord blood are related to sex-bias psychiatric diseases
NASA Astrophysics Data System (ADS)
Maschietto, Mariana; Bastos, Laura Caroline; Tahira, Ana Carolina; Bastos, Elen Pereira; Euclydes, Veronica Luiza Vale; Brentani, Alexandra; Fink, Günther; de Baumont, Angelica; Felipe-Silva, Aloísio; Francisco, Rossana Pulcineli Vieira; Gouveia, Gisele; Grisi, Sandra Josefina Ferraz Ellero; Escobar, Ana Maria Ulhoa; Moreira-Filho, Carlos Alberto; Polanczyk, Guilherme Vanoni; Miguel, Euripedes Constantino; Brentani, Helena
2017-03-01
Sex differences in the prevalence of psychiatric disorders are well documented, with exposure to stress during gestation differentially impacting females and males. We explored sex-specific DNA methylation in the cord blood of 39 females and 32 males born at term and with appropriate weight at birth regarding their potential connection to psychiatric outcomes. Mothers were interviewed to gather information about environmental factors (gestational exposure) that could interfere with the methylation profiles in the newborns. Bisulphite converted DNA was hybridized to Illumina HumanMethylation450 BeadChips. Excluding XYS probes, there were 2,332 differentially methylated CpG sites (DMSs) between sexes, which were enriched within brain modules of co-methylated CpGs during brain development and also differentially methylated in the brains of boys and girls. Genes associated with the DMSs were enriched for neurodevelopmental disorders, particularly for CpG sites found differentially methylated in brain tissue between patients with schizophrenia and controls. Moreover, the DMS had an overlap of 890 (38%) CpG sites with a cohort submitted to toxic exposition during gestation. This study supports the evidences that sex differences in DNA methylation of autosomes act as a primary driver of sex differences that are found in psychiatric outcomes.
Sex differences in DNA methylation of the cord blood are related to sex-bias psychiatric diseases
Maschietto, Mariana; Bastos, Laura Caroline; Tahira, Ana Carolina; Bastos, Elen Pereira; Euclydes, Veronica Luiza Vale; Brentani, Alexandra; Fink, Günther; de Baumont, Angelica; Felipe-Silva, Aloísio; Francisco, Rossana Pulcineli Vieira; Gouveia, Gisele; Grisi, Sandra Josefina Ferraz Ellero; Escobar, Ana Maria Ulhoa; Moreira-Filho, Carlos Alberto; Polanczyk, Guilherme Vanoni; Miguel, Euripedes Constantino; Brentani, Helena
2017-01-01
Sex differences in the prevalence of psychiatric disorders are well documented, with exposure to stress during gestation differentially impacting females and males. We explored sex-specific DNA methylation in the cord blood of 39 females and 32 males born at term and with appropriate weight at birth regarding their potential connection to psychiatric outcomes. Mothers were interviewed to gather information about environmental factors (gestational exposure) that could interfere with the methylation profiles in the newborns. Bisulphite converted DNA was hybridized to Illumina HumanMethylation450 BeadChips. Excluding XYS probes, there were 2,332 differentially methylated CpG sites (DMSs) between sexes, which were enriched within brain modules of co-methylated CpGs during brain development and also differentially methylated in the brains of boys and girls. Genes associated with the DMSs were enriched for neurodevelopmental disorders, particularly for CpG sites found differentially methylated in brain tissue between patients with schizophrenia and controls. Moreover, the DMS had an overlap of 890 (38%) CpG sites with a cohort submitted to toxic exposition during gestation. This study supports the evidences that sex differences in DNA methylation of autosomes act as a primary driver of sex differences that are found in psychiatric outcomes. PMID:28303968
Sadeghi, Sara; García-Molina, Almudena; Celma, Ferran; Valverde, Anthony; Fereidounfar, Sogol; Soler, Carles
2016-01-01
DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm® and SDFA) were evaluated by the use of the DNA fragmentation module of the ISAS® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal–Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained), and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001). In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA). The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor. PMID:27678463
Sadeghi, Sara; García-Molina, Almudena; Celma, Ferran; Valverde, Anthony; Fereidounfar, Sogol; Soler, Carles
2016-01-01
DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA) were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained), and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001). In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA). The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.
MiR-2964a-5p binding site SNP regulates ATM expression contributing to age-related cataract risk.
Rong, Han; Gu, Shanshan; Zhang, Guowei; Kang, Lihua; Yang, Mei; Zhang, Junfang; Shen, Xinyue; Guan, Huaijin
2017-10-17
This study was to explore the involvement of DNA repair genes in the pathogenesis of age-related cataract (ARC). We genotyped nine single nucleotide polymorphisms (SNPs) of genes responsible to DNA double strand breaks (DSBs) in 804 ARC cases and 804 controls in a cohort of eye diseases in Chinese population and found that the ataxia telangiectasia mutated ( ATM ) gene-rs4585:G>T was significantly associated with ARC risk. An in vitro functional test found that miR-2964a-5p specifically down-regulated luciferase reporter expression and ATM expression in the cell lines transfected with rs4585 T allele compared to rs4585 G allele. The molecular assay on human tissue samples discovered that ATM expression was down-regulated in majority of ARC tissues and correlated with ATM genotypes. In addition, the Comet assay of cellular DNA damage of peripheral lymphocytes indicated that individuals carrying the G allele (GG/GT) of ATM -rs4585 had lower DNA breaks compared to individuals with TT genotype. These findings suggested that the SNP rs4585 in ATM might affect ARC risk through modulating the regulatory affinity of miR-2964a-5p. The reduced DSBs repair might be involved in ARC pathogenesis.
Wnt-Mediated Repression via Bipartite DNA Recognition by TCF in the Drosophila Hematopoietic System
Zhang, Chen U.; Blauwkamp, Timothy A.; Burby, Peter E.; Cadigan, Ken M.
2014-01-01
The Wnt/β-catenin signaling pathway plays many important roles in animal development, tissue homeostasis and human disease. Transcription factors of the TCF family mediate many Wnt transcriptional responses, promoting signal-dependent activation or repression of target gene expression. The mechanism of this specificity is poorly understood. Previously, we demonstrated that for activated targets in Drosophila, TCF/Pangolin (the fly TCF) recognizes regulatory DNA through two DNA binding domains, with the High Mobility Group (HMG) domain binding HMG sites and the adjacent C-clamp domain binding Helper sites. Here, we report that TCF/Pangolin utilizes a similar bipartite mechanism to recognize and regulate several Wnt-repressed targets, but through HMG and Helper sites whose sequences are distinct from those found in activated targets. The type of HMG and Helper sites is sufficient to direct activation or repression of Wnt regulated cis-regulatory modules, and protease digestion studies suggest that TCF/Pangolin adopts distinct conformations when bound to either HMG-Helper site pair. This repressive mechanism occurs in the fly lymph gland, the larval hematopoietic organ, where Wnt/β-catenin signaling controls prohemocytic differentiation. Our study provides a paradigm for direct repression of target gene expression by Wnt/β-catenin signaling and allosteric regulation of a transcription factor by DNA. PMID:25144371
Gagnon, David; Lehoux, Michaël
2015-01-01
ABSTRACT The E1 helicase from anogenital human papillomavirus (HPV) types interacts with the cellular WD repeat-containing protein UAF1 in complex with the deubiquitinating enzyme USP1, USP12, or USP46. This interaction stimulates viral DNA replication and is required for maintenance of the viral episome in keratinocytes. E1 associates with UAF1 through a short UAF1-binding site (UBS) located within the N-terminal 40 residues of the protein. Here, we investigated if the E1 UBS could be replaced by the analogous domain from an unrelated protein, the pleckstrin homology domain and leucine-rich repeat protein phosphatase 1 (PHLPP1). We found that PHLPP1 and E1 interact with UAF1 in a mutually exclusive manner and mapped the minimal PHLPP1 UBS (PUBS) to a 100-amino-acid region sufficient for assembly into UAF1-USP complexes. Similarly to the E1 UBS, overexpression of PUBS in trans inhibited HPV DNA replication, albeit less efficiently. Characterization of a PHLPP1-E1 chimeric helicase revealed that PUBS could partially substitute for the E1 UBS in enhancing viral DNA replication and that the stimulatory effect of PUBS likely involves recruitment of UAF1-USP complexes, as it was abolished by mutations that weaken UAF1-binding and by overexpression of catalytically inactive USPs. Although functionally similar to the E1 UBS, PUBS is larger in size and requires both the WD repeat region and C-terminal ubiquitin-like domain of UAF1 for interaction, in contrast to E1, which does not contact the latter. Overall, this comparison of two heterologous UBSs indicates that these domains function as transferable protein interaction modules and provide further evidence that the association of E1 with UAF1-containing deubiquitinating complexes stimulates HPV DNA replication. IMPORTANCE The E1 protein from anogenital HPV types interacts with the UAF1-associated deubiquitinating enzymes USP1, USP12, and USP46 to stimulate replication of the viral genome. Little is known about the molecular nature of the E1-UAF1 interaction and, more generally, how UAF1-USP complexes recognize their substrate proteins. To address this question, we characterized the UAF1-binding site (UBS) of PHLPP1, a protein unrelated to E1. Using a PHLPP1-E1 chimeric helicase, we show that the PHLPP1 UBS (PUBS) can partially substitute for the E1 UBS in stimulating HPV DNA replication. This stimulation required conserved sequences in PUBS that meditate its interaction with UAF1, including a motif common to the E1 UBS. These results indicate that UAF1-binding sequences function as transferable protein interaction modules and provide further evidence that UAF1-USP complexes stimulate HPV DNA replication. PMID:25833051
Gagnon, David; Lehoux, Michaël; Archambault, Jacques
2015-06-01
The E1 helicase from anogenital human papillomavirus (HPV) types interacts with the cellular WD repeat-containing protein UAF1 in complex with the deubiquitinating enzyme USP1, USP12, or USP46. This interaction stimulates viral DNA replication and is required for maintenance of the viral episome in keratinocytes. E1 associates with UAF1 through a short UAF1-binding site (UBS) located within the N-terminal 40 residues of the protein. Here, we investigated if the E1 UBS could be replaced by the analogous domain from an unrelated protein, the pleckstrin homology domain and leucine-rich repeat protein phosphatase 1 (PHLPP1). We found that PHLPP1 and E1 interact with UAF1 in a mutually exclusive manner and mapped the minimal PHLPP1 UBS (PUBS) to a 100-amino-acid region sufficient for assembly into UAF1-USP complexes. Similarly to the E1 UBS, overexpression of PUBS in trans inhibited HPV DNA replication, albeit less efficiently. Characterization of a PHLPP1-E1 chimeric helicase revealed that PUBS could partially substitute for the E1 UBS in enhancing viral DNA replication and that the stimulatory effect of PUBS likely involves recruitment of UAF1-USP complexes, as it was abolished by mutations that weaken UAF1-binding and by overexpression of catalytically inactive USPs. Although functionally similar to the E1 UBS, PUBS is larger in size and requires both the WD repeat region and C-terminal ubiquitin-like domain of UAF1 for interaction, in contrast to E1, which does not contact the latter. Overall, this comparison of two heterologous UBSs indicates that these domains function as transferable protein interaction modules and provide further evidence that the association of E1 with UAF1-containing deubiquitinating complexes stimulates HPV DNA replication. The E1 protein from anogenital HPV types interacts with the UAF1-associated deubiquitinating enzymes USP1, USP12, and USP46 to stimulate replication of the viral genome. Little is known about the molecular nature of the E1-UAF1 interaction and, more generally, how UAF1-USP complexes recognize their substrate proteins. To address this question, we characterized the UAF1-binding site (UBS) of PHLPP1, a protein unrelated to E1. Using a PHLPP1-E1 chimeric helicase, we show that the PHLPP1 UBS (PUBS) can partially substitute for the E1 UBS in stimulating HPV DNA replication. This stimulation required conserved sequences in PUBS that meditate its interaction with UAF1, including a motif common to the E1 UBS. These results indicate that UAF1-binding sequences function as transferable protein interaction modules and provide further evidence that UAF1-USP complexes stimulate HPV DNA replication. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Kim, Kwang Soon; Jin, Dong Bin; Ahn, So Shin; Park, Ki Seok; Seo, Sang Hwan; Suh, You Suk; Sung, Young Chul
2010-08-01
HIV protease (PR) mediates the processing of human immunodeficiency virus (HIV) polyproteins and is necessary for the viral production. Recently, HIV PR was shown to possess both cytotoxic and chaperone like activity. We demonstrate here that HIV PR can serve as a genetic adjuvant that enhances the HIV Env and human papillomavirus (HPV) DNA vaccine-induced T-cell response in a dose-dependent manner, only when codelivered with DNA vaccine. Interestingly, the T-cell adjuvant effects of HIV PR were increased by introducing several mutations that inhibited its proteolytic activity, indicating that the adjuvant properties were inversely correlated with its proteolytic activity. Conversely, the introduction of a mutation in the flap region of HIV PR limiting the access to the core domain of HIV PR inhibited the T-cell adjuvant effect, suggesting that the HIV PR chaperone like activity may play a role in mediating T-cell adjuvant properties. A similar adjuvant effect was also observed in adenovirus vaccine, indicating vaccine type independency. These findings suggest that HIV PR can modulate T-cell responses elicited by a gene-based vaccine positively by inherent chaperone like activity and negatively by its proteolytic activity.
Feng, You; Hadjikyriacou, Andrea; Clarke, Steven G
2014-11-21
Protein arginine methyltransferase 7 (PRMT7) methylates arginine residues on various protein substrates and is involved in DNA transcription, RNA splicing, DNA repair, cell differentiation, and metastasis. The substrate sequences it recognizes in vivo and the enzymatic mechanism behind it, however, remain to be explored. Here we characterize methylation catalyzed by a bacterially expressed GST-tagged human PRMT7 fusion protein with a broad range of peptide and protein substrates. After confirming its type III activity generating only ω-N(G)-monomethylarginine and its distinct substrate specificity for RXR motifs surrounded by basic residues, we performed site-directed mutagenesis studies on this enzyme, revealing that two acidic residues within the double E loop, Asp-147 and Glu-149, modulate the substrate preference. Furthermore, altering a single acidic residue, Glu-478, on the C-terminal domain to glutamine nearly abolished the activity of the enzyme. Additionally, we demonstrate that PRMT7 has unusual temperature dependence and salt tolerance. These results provide a biochemical foundation to understanding the broad biological functions of PRMT7 in health and disease. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
The Conjugative Relaxase TrwC Promotes Integration of Foreign DNA in the Human Genome.
González-Prieto, Coral; Gabriel, Richard; Dehio, Christoph; Schmidt, Manfred; Llosa, Matxalen
2017-06-15
Bacterial conjugation is a mechanism of horizontal DNA transfer. The relaxase TrwC of the conjugative plasmid R388 cleaves one strand of the transferred DNA at the oriT gene, covalently attaches to it, and leads the single-stranded DNA (ssDNA) into the recipient cell. In addition, TrwC catalyzes site-specific integration of the transferred DNA into its target sequence present in the genome of the recipient bacterium. Here, we report the analysis of the efficiency and specificity of the integrase activity of TrwC in human cells, using the type IV secretion system of the human pathogen Bartonella henselae to introduce relaxase-DNA complexes. Compared to Mob relaxase from plasmid pBGR1, we found that TrwC mediated a 10-fold increase in the rate of plasmid DNA transfer to human cells and a 100-fold increase in the rate of chromosomal integration of the transferred DNA. We used linear amplification-mediated PCR and plasmid rescue to characterize the integration pattern in the human genome. DNA sequence analysis revealed mostly reconstituted oriT sequences, indicating that TrwC is active and recircularizes transferred DNA in human cells. One TrwC-mediated site-specific integration event was detected, proving that TrwC is capable of mediating site-specific integration in the human genome, albeit with very low efficiency compared to the rate of random integration. Our results suggest that TrwC may stabilize the plasmid DNA molecules in the nucleus of the human cell, probably by recircularization of the transferred DNA strand. This stabilization would increase the opportunities for integration of the DNA by the host machinery. IMPORTANCE Different biotechnological applications, including gene therapy strategies, require permanent modification of target cells. Long-term expression is achieved either by extrachromosomal persistence or by integration of the introduced DNA. Here, we studied the utility of conjugative relaxase TrwC, a bacterial protein with site-specific integrase activity in bacteria, as an integrase in human cells. Although it is not efficient as a site-specific integrase, we found that TrwC is active in human cells and promotes random integration of the transferred DNA in the human genome, probably acting as a DNA chaperone until it is integrated by host mechanisms. TrwC-DNA complexes can be delivered to human cells through a type IV secretion system involved in pathogenesis. Thus, TrwC could be used in vivo to transfer the DNA of interest into the appropriate cell and promote its integration. If used in combination with a site-specific nuclease, it could lead to site-specific integration of the incoming DNA by homologous recombination. Copyright © 2017 American Society for Microbiology.
The Conjugative Relaxase TrwC Promotes Integration of Foreign DNA in the Human Genome
González-Prieto, Coral; Gabriel, Richard; Dehio, Christoph; Schmidt, Manfred
2017-01-01
ABSTRACT Bacterial conjugation is a mechanism of horizontal DNA transfer. The relaxase TrwC of the conjugative plasmid R388 cleaves one strand of the transferred DNA at the oriT gene, covalently attaches to it, and leads the single-stranded DNA (ssDNA) into the recipient cell. In addition, TrwC catalyzes site-specific integration of the transferred DNA into its target sequence present in the genome of the recipient bacterium. Here, we report the analysis of the efficiency and specificity of the integrase activity of TrwC in human cells, using the type IV secretion system of the human pathogen Bartonella henselae to introduce relaxase-DNA complexes. Compared to Mob relaxase from plasmid pBGR1, we found that TrwC mediated a 10-fold increase in the rate of plasmid DNA transfer to human cells and a 100-fold increase in the rate of chromosomal integration of the transferred DNA. We used linear amplification-mediated PCR and plasmid rescue to characterize the integration pattern in the human genome. DNA sequence analysis revealed mostly reconstituted oriT sequences, indicating that TrwC is active and recircularizes transferred DNA in human cells. One TrwC-mediated site-specific integration event was detected, proving that TrwC is capable of mediating site-specific integration in the human genome, albeit with very low efficiency compared to the rate of random integration. Our results suggest that TrwC may stabilize the plasmid DNA molecules in the nucleus of the human cell, probably by recircularization of the transferred DNA strand. This stabilization would increase the opportunities for integration of the DNA by the host machinery. IMPORTANCE Different biotechnological applications, including gene therapy strategies, require permanent modification of target cells. Long-term expression is achieved either by extrachromosomal persistence or by integration of the introduced DNA. Here, we studied the utility of conjugative relaxase TrwC, a bacterial protein with site-specific integrase activity in bacteria, as an integrase in human cells. Although it is not efficient as a site-specific integrase, we found that TrwC is active in human cells and promotes random integration of the transferred DNA in the human genome, probably acting as a DNA chaperone until it is integrated by host mechanisms. TrwC-DNA complexes can be delivered to human cells through a type IV secretion system involved in pathogenesis. Thus, TrwC could be used in vivo to transfer the DNA of interest into the appropriate cell and promote its integration. If used in combination with a site-specific nuclease, it could lead to site-specific integration of the incoming DNA by homologous recombination. PMID:28411218
Smaczniak, Cezary; Muiño, Jose M; Chen, Dijun; Angenent, Gerco C; Kaufmann, Kerstin
2017-08-01
Floral organ identities in plants are specified by the combinatorial action of homeotic master regulatory transcription factors. However, how these factors achieve their regulatory specificities is still largely unclear. Genome-wide in vivo DNA binding data show that homeotic MADS domain proteins recognize partly distinct genomic regions, suggesting that DNA binding specificity contributes to functional differences of homeotic protein complexes. We used in vitro systematic evolution of ligands by exponential enrichment followed by high-throughput DNA sequencing (SELEX-seq) on several floral MADS domain protein homo- and heterodimers to measure their DNA binding specificities. We show that specification of reproductive organs is associated with distinct binding preferences of a complex formed by SEPALLATA3 and AGAMOUS. Binding specificity is further modulated by different binding site spacing preferences. Combination of SELEX-seq and genome-wide DNA binding data allows differentiation between targets in specification of reproductive versus perianth organs in the flower. We validate the importance of DNA binding specificity for organ-specific gene regulation by modulating promoter activity through targeted mutagenesis. Our study shows that intrafamily protein interactions affect DNA binding specificity of floral MADS domain proteins. Differential DNA binding of MADS domain protein complexes plays a role in the specificity of target gene regulation. © 2017 American Society of Plant Biologists. All rights reserved.
Altering DNA-Programmable Colloidal Crystallization Paths by Modulating Particle Repulsion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Mary X.; Brodin, Jeffrey D.; Millan, Jaime A.
Colloidal crystal engineering with DNA can be used to realize precise control over nanoparticle (NP) arrangement. Here, we investigate a case of DNA-based assembly where the properties of DNA as a polyelectrolyte brush are employed to alter a hybridization-driven NP crystallization pathway. Using the co-assembly of DNA-conjugated proteins and spherical gold 2 nanoparticles (AuNPs) as a model system, we explore how steric repulsion between non-complementary, neighboring DNA-NPs due to overlapping DNA shells can influence their ligand-directed behavior. Specifically, our experimental data coupled with coarse-grained molecular dynamics (MD) simulations reveal that by changing factors related to NP repulsion, two structurally distinctmore » outcomes can be achieved. When steric repulsion between DNA-AuNPs is significantly greater than that between DNA-proteins, a lower packing density crystal lattice is favored over the structure that is predicted by design rules based on DNA-hybridization considerations alone. This is enabled by the large difference in DNA density on AuNPs versus proteins and can be tuned by modulating the flexibility, and thus conformational entropy, of the DNA on the constituent particles. At intermediate ligand flexibility, the crystallization pathways are energetically similar and the structural outcome can be adjusted using the density of DNA duplexes on DNA-AuNPs and by screening the Coulomb potential between them. Such lattices are shown to undergo dynamic reorganization upon changing salt concentration. These data help elucidate the structural considerations necessary for understanding repulsive forces in DNA-assembly and lay the groundwork for using them to increase architectural diversity in engineering colloidal crystals.« less
Human SUV3 helicase regulates growth rate of the HeLa cells and can localize in the nucleoli.
Szewczyk, Maciej; Fedoryszak-Kuśka, Natalia; Tkaczuk, Katarzyna; Dobrucki, Jurek; Waligórska, Agnieszka; Stępień, Piotr P
2017-01-01
The human SUV3 helicase (SUV3, hSUV3, SUPV3L1) is a DNA/RNA unwinding enzyme belonging to the class of DexH-box helicases. It localizes predominantly in the mitochondria, where it forms an RNA-degrading complex called mitochondrial degradosome with exonuclease PNP (polynucleotide phosphorylase). Association of this complex with the polyA polymerase can modulate mitochondrial polyA tails. Silencing of the SUV3 gene was shown to inhibit the cell cycle and to induce apoptosis in human cell lines. However, since small amounts of the SUV3 helicase were found in the cell nuclei, it was not clear whether the observed phenotypes of SUV3 depletion were of mitochondrial or nuclear origin. In order to answer this question we have designed gene constructs able to inhibit the SUV3 activity exclusively in the cell nuclei. The results indicate that the observed growth rate impairment upon SUV3 depletion is due to its nuclear function(s). Unexpectedly, overexpression of the nuclear-targeted wild-type copies of the SUV3 gene resulted in a higher growth rate. In addition, we demonstrate that the SUV3 helicase can be found in the HeLa cell nucleoli, but it is not detectable in the DNA-repair foci. Our results indicate that the nucleolar-associated human SUV3 protein is an important factor in regulation of the cell cycle.
DNA Microarray Wet Lab Simulation Brings Genomics into the High School Curriculum
ERIC Educational Resources Information Center
Campbell, A. Malcolm; Zanta, Carolyn A.; Heyer, Laurie J.; Kittinger, Ben; Gabric, Kathleen M.; Adler, Leslie
2006-01-01
We have developed a wet lab DNA microarray simulation as part of a complete DNA microarray module for high school students. The wet lab simulation has been field tested with high school students in Illinois and Maryland as well as in workshops with high school teachers from across the nation. Instead of using DNA, our simulation is based on pH…
Sanches, Larissa Juliani; Marinello, Poliana Camila; Panis, Carolina; Fagundes, Tatiane Renata; Morgado-Díaz, José Andrés; de-Freitas-Junior, Julio Cesar Madureira; Cecchini, Rubens; Cecchini, Alessandra Lourenço; Luiz, Rodrigo Cabral
2017-03-01
Citral is a natural compound that has shown cytotoxic and antiproliferative effects on breast and hematopoietic cancer cells; however, there are few studies on melanoma cells. Oxidative stress is known to be involved in all stages of melanoma development and is able to modulate intracellular pathways related to cellular proliferation and death. In this study, we hypothesize that citral exerts its cytotoxic effect on melanoma cells by the modulation of cellular oxidative status and/or intracellular signaling. To test this hypothesis, we investigated the antiproliferative and cytotoxic effects of citral on B16F10 murine melanoma cells evaluating its effects on cellular oxidative stress, DNA damage, cell death, and important signaling pathways, as these pathways, namely, extracellular signal-regulated kinases 1/2 (ERK1/2), AKT, and phosphatidylinositol-3 kinase, are involved in cell proliferation and differentiation. The p53 and nuclear factor kappa B were also investigated due to their ability to respond to intracellular stress. We observed that citral exerted antiproliferative and cytotoxic effects in B16F10; induced oxidative stress, DNA lesions, and p53 nuclear translocation; and reduced nitric oxide levels and nuclear factor kappa B, ERK1/2, and AKT. To investigate citral specificity, we used non-neoplastic human and murine cells, HaCaT (human skin keratinocytes) and NIH-3T3 cells (murine fibroblasts), and observed that although citral effects were not specific for cancer cells, non-neoplastic cells were more resistant to citral than B16F10. These findings highlight the potential clinical utility of citral in melanoma, with a mechanism of action involving the oxidative stress generation, nitric oxide depletion, and interference in signaling pathways related to cell proliferation.
TLR signaling modulates side effects of anticancer therapy in the small intestine
Frank, Magdalena; Hennenberg, Eva Maria; Eyking, Annette; Rünzi, Michael; Gerken, Guido; Scott, Paul; Parkhill, Julian; Walker, Alan W.; Cario, Elke
2014-01-01
Intestinal mucositis represents the most common complication of intensive chemotherapy, which has a severe adverse impact on quality of life of cancer patients. However, the precise pathophysiology remains to be clarified and there is so far no successful therapeutic intervention. Here, we investigated the role of innate immunity through TLR signaling in modulating genotoxic chemotherapy-induced small intestinal injury in vitro and in vivo. Genetic deletion of TLR2, but not MD-2, in mice resulted in severe chemotherapy-induced intestinal mucositis in the proximal jejunum with villous atrophy, accumulation of damaged DNA, CD11b+-myeloid cell infiltration and significant gene alterations in xenobiotic metabolism, including a decrease in ABCB1/MDR1 p-glycoprotein (p-gp) expression. Functionally, stimulation of TLR2 induced synthesis and drug efflux activity of ABCB1/MDR1 p-gp in murine and human CD11b+-myeloid cells, thus inhibiting chemotherapy-mediated cytotoxicity. Conversely, TLR2 activation failed to protect small intestinal tissues genetically deficient in MDR1A against DNA-damaging drug-induced apoptosis. Gut microbiota depletion by antibiotics led to increased susceptibility to chemotherapy-induced mucosal injury in wildtype mice, which was suppressed by administration of a TLR2 ligand, preserving ABCB1/MDR1 p-gp expression. Findings were confirmed in a preclinical model of human chemotherapy-induced intestinal mucositis using duodenal biopsies, by demonstrating that TLR2 activation limited the toxic-inflammatory reaction and maintained assembly of the drug transporter p-gp. In conclusion, this study identifies a novel molecular link between innate immunity and xenobiotic metabolism. TLR2 acts as a central regulator of xenobiotic defense via the multidrug transporter ABCB1/MDR1 p-gp. Targeting TLR2 may represent a novel therapeutic approach in chemotherapy-induced intestinal mucositis. PMID:25589072
Gagné, Jean-Philippe; Lachapelle, Sophie; Garand, Chantal; Tsofack, Serges P.; Coulombe, Yan; Caron, Marie-Christine; Poirier, Guy G.; Masson, Jean-Yves; Lebel, Michel
2016-01-01
Werner syndrome (WS) is characterized by the premature onset of several age-associated pathologies including cancer. The protein defective in WS patients (WRN) is a helicase/exonuclease involved in DNA replication and repair. Here, we present the results of a large-scale proteome analysis that has been undertaken to determine protein partners of different polymorphic WRN proteins found with relatively high prevalence in the human population. We expressed different fluorescently tagged-WRN (eYFP-WRN) variants in human 293 embryonic kidney cells (HEK293) and used a combination of affinity-purification and mass spectrometry to identify different compositions of WRN-associated protein complexes. We found that a WRN variant containing a phenylalanine residue at position 1074 and an arginine at position 1367 (eYFP-WRN(F-R)) possesses more affinity for DNA-PKc, KU86, KU70, and PARP1 than a variant containing a leucine at position 1074 and a cysteine at position 1367 (eYFP-WRN(L-C)). Such results were confirmed in a WRN-deficient background using WS fibroblasts. Interestingly, the exonuclase activity of WRN recovered from immunoprecipitated eYFP-WRN(L-C) variant was lower than the eYFP-WRN(F-R) in WS cells. Finally, HEK293 cells and WS fibroblasts overexpressing the eYFP-WRN(F-R) variant were more resistant to the benzene metabolite hydroquinone than cells expressing the eYFP-WRN(L-C) variant. These results indicate that the protein-protein interaction landscape of WRN is subject to modulation by polymorphic amino acids, a characteristic associated with distinctive cell survival outcome. PMID:27863399
Software-assisted stacking of gene modules using GoldenBraid 2.0 DNA-assembly framework.
Vazquez-Vilar, Marta; Sarrion-Perdigones, Alejandro; Ziarsolo, Peio; Blanca, Jose; Granell, Antonio; Orzaez, Diego
2015-01-01
GoldenBraid (GB) is a modular DNA assembly technology for plant multigene engineering based on type IIS restriction enzymes. GB speeds up the assembly of transcriptional units from standard genetic parts and facilitates the stacking of several genes within the same T-DNA in few days. GBcloning is software-assisted with a set of online tools. The GBDomesticator tool assists in the adaptation of DNA parts to the GBstandard. The combination of GB-adapted parts to build new transcriptional units is assisted by the GB TU Assembler tool. Finally, the assembly of multigene modules is simulated by the GB Binary Assembler. All the software tools are available at www.gbcloning.org . Here, we describe in detail the assembly methodology to create a multigene construct with three transcriptional units for polyphenol metabolic engineering in plants.
Mund, Andreas; Schubert, Tobias; Staege, Hannah; Kinkley, Sarah; Reumann, Kerstin; Kriegs, Malte; Fritsch, Lauriane; Battisti, Valentine; Ait-Si-Ali, Slimane; Hoffbeck, Anne-Sophie; Soutoglou, Evi; Will, Hans
2012-01-01
Survival time-associated plant homeodomain (PHD) finger protein in Ovarian Cancer 1 (SPOC1, also known as PHF13) is known to modulate chromatin structure and is essential for testicular stem-cell differentiation. Here we show that SPOC1 is recruited to DNA double-strand breaks (DSBs) in an ATM-dependent manner. Moreover, SPOC1 localizes at endogenous repair foci, including OPT domains and accumulates at large DSB repair foci characteristic for delayed repair at heterochromatic sites. SPOC1 depletion enhances the kinetics of ionizing radiation-induced foci (IRIF) formation after γ-irradiation (γ-IR), non-homologous end-joining (NHEJ) repair activity, and cellular radioresistance, but impairs homologous recombination (HR) repair. Conversely, SPOC1 overexpression delays IRIF formation and γH2AX expansion, reduces NHEJ repair activity and enhances cellular radiosensitivity. SPOC1 mediates dose-dependent changes in chromatin association of DNA compaction factors KAP-1, HP1-α and H3K9 methyltransferases (KMT) GLP, G9A and SETDB1. In addition, SPOC1 interacts with KAP-1 and H3K9 KMTs, inhibits KAP-1 phosphorylation and enhances H3K9 trimethylation. These findings provide the first evidence for a function of SPOC1 in DNA damage response (DDR) and repair. SPOC1 acts as a modulator of repair kinetics and choice of pathways. This involves its dose-dependent effects on DNA damage sensors, repair mediators and key regulators of chromatin structure. PMID:23034801
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yi Fuming; Saha, Abhik; Murakami, Masanao
The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3Cmore » with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF{sup Skp2}, cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53{sup -/-}) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fowler, TL; Martin, JA; Shepard, AJ
2014-06-15
Purpose: The large dose-response variation in both tumor and normal cells between individual patients has led to the recent implementation of predictive bioassays of patient-specific radiation sensitivity in order to personalize radiation therapy. This exciting new clinical paradigm has led us to develop a novel high-throughput, variable dose-rate irradiator to accompany these efforts. Here we present the biological validation of this irradiator through the use of human cells as a relative dosimeter assessed by two metrics, DNA double-strand break repair pathway modulation and intercellular reactive oxygen species production. Methods: Immortalized human tonsilar epithelial cells were cultured in 96-well micro titermore » plates and irradiated in groups of eight wells to absorbed doses of 0, 0.5, 1, 2, 4, and 8 Gy. High-throughput immunofluorescent microscopy was used to detect γH2AX, a DNA double-strand break repair mechanism recruiter. The same analysis was performed with the cells stained with CM-H2DCFDA that produces a fluorescent adduct when exposed to reactive oxygen species during the irradiation cycle. Results: Irradiations of the immortalized human tonsilar epithelial cells at absorbed doses of 0, 0.5, 1, 2, 4, and 8 Gy produced excellent linearity in γH2AX and CM-H2DCFDA with R2 values of 0.9939 and 0.9595 respectively. Single cell gel electrophoresis experimentation for the detection of physical DNA double-strand breaks in ongoing. Conclusions: This work indicates significant potential for our high-throughput variable dose rate irradiator for patient-specific predictive radiation sensitivity bioassays. This irradiator provides a powerful tool by increasing the efficiency and number of assay techniques available to help personalize radiation therapy.« less
Ruiz, Zandra; D'Abramo, Anthony; Tattersall, Peter
2006-06-05
The MVM NS2 proteins are required for viral replication in cells of its normal murine host, but are dispensable in transformed human 324K cells. Alternate splicing at the minor intron controls synthesis of three forms of this protein, which differ in their C-terminal hexapeptides and in their relative abundance, with NS2P and NS2Y, the predominant isoforms, being expressed at a 5:1 ratio. Mutant genomes were constructed with premature termination codons in the C-terminal exons of either NS2P or NS2Y, which resulted in their failure to accumulate in vivo. To modulate their expression levels, we also introduced a mutation at the putative splice branch point of the large intron, dubbed NS2(lo), that reduced total NS2 expression in murine A9 cells such that NS2P accumulated to approximately half the level normally seen for NS2Y. All mutants replicated productively in human 324K cells. In A9 cells, NS2Y(-) mutants replicated like wildtype, and the NS2(lo) mutants expressed NS1 and replicated duplex viral DNA like wildtype, although their progeny single-strand DNA synthesis was reduced. However, while NS2P(-) and NS2-null viruses initiated infection efficiently in A9 cells, they gave diminished NS1 levels, and viral macromolecular synthesis appeared to become paralyzed shortly after the onset of viral duplex DNA amplification, such that no progeny single-strand DNA could be detected. Thus, the NS2P isoform, even when expressed at a level lower than that of NS2Y, performs a critical role in infection of A9 cells that cannot be accomplished by the NS2Y isoform alone.
Žegura, B; Gajski, G; Štraser, A; Garaj-Vrhovac, V
2011-11-01
Cylindrospermopsin (CYN), a potent cyanobacterial cytototoxin produced by certain freshwater cyanobacteria, is regularly found in water supplies in many parts of the world, and has been associated with the intoxication of humans and livestock. The few genotoxicity studies available indicate that CYN is genotoxic, generally implying that it is pro-genotoxic. In human peripheral blood lymphocytes (HPBLs) CYN (0, 0.05, 0.1 and 0.5 μg/ml) induced the formation of DNA single strand breaks, applying the comet assay. Time and dose dependent significant increase in the frequency of micronuclei and nuclear buds was observed after the exposure of HPBLs to CYN, while there was only slight increase in the number of nucleoplasmic bridges. For the first time the modulation of gene expression in HPBLs was studied after the exposure to CYN (0.5 μg/ml), using the quantitative real-time PCR. The genes presumably involved in CYN metabolism (CYP1A1 and CYP1A2) were up-regulated after the exposure. CYN induced changes in the mRNA expression of P53 and its downstream regulated DNA damage responsive genes MDM2, GADD45α and apoptosis genes, BCL-2 and BAX, as well as oxidative stress responsive genes (GPX1, SOD1, GSR, GCLC), while no changes in the expression of genes CDKN1A and CAT were observed. These results provide strong evidence that CYN should be considered as genotoxic and that lymphocytes can also be a target of cylindrospermopsin induced genotoxicity. Copyright © 2011 Elsevier Ltd. All rights reserved.
Therapeutic modulation of epigenetic drivers of drug resistance in ovarian cancer
Zeller, Constanze; Brown, Robert
2010-01-01
Epigenetic changes in tumours are associated not only with cancer development and progression, but also with resistance to chemotherapy. Aberrant DNA methylation at CpG islands and associated epigenetic silencing are observed during the acquisition of drug resistance. However, it remains unclear whether all of the observed changes are drivers of drug resistance, causally associated with response of tumours to chemotherapy, or are passenger events representing chance DNA methylation changes. Systematic approaches that link DNA methylation and expression with chemosensitivity will be required to identify key drivers. Such drivers will be important prognostic or predicitive biomarkers, both to existing chemotherapies, but also to epigenetic therapies used to modulate drug resistance. PMID:21789144
Pohjoismäki, Jaakko L. O.; Goffart, Steffi; Tyynismaa, Henna; Willcox, Smaranda; Ide, Tomomi; Kang, Dongchon; Suomalainen, Anu; Karhunen, Pekka J.; Griffith, Jack D.; Holt, Ian J.; Jacobs, Howard T.
2009-01-01
Analysis of human heart mitochondrial DNA (mtDNA) by electron microscopy and agarose gel electrophoresis revealed a complete absence of the θ-type replication intermediates seen abundantly in mtDNA from all other tissues. Instead only Y- and X-junctional forms were detected after restriction digestion. Uncut heart mtDNA was organized in tangled complexes of up to 20 or more genome equivalents, which could be resolved to genomic monomers, dimers, and linear fragments by treatment with the decatenating enzyme topoisomerase IV plus the cruciform-cutting T7 endonuclease I. Human and mouse brain also contained a population of such mtDNA forms, which were absent, however, from mouse, rabbit, or pig heart. Overexpression in transgenic mice of two proteins involved in mtDNA replication, namely human mitochondrial transcription factor A or the mouse Twinkle DNA helicase, generated abundant four-way junctions in mtDNA of heart, brain, and skeletal muscle. The organization of mtDNA of human heart as well as of mouse and human brain in complex junctional networks replicating via a presumed non-θ mechanism is unprecedented in mammals. PMID:19525233
Purcell, Maureen K.; Nichols, Krista M.; Winton, James R.; Kurath, Gael; Thorgaard, Gary H.; Wheeler, Paul; Hansen, John D.; Herwig, Russell P.; Park, Linda K.
2006-01-01
The DNA vaccine based on the glycoprotein gene of Infectious hematopoietic necrosis virus induces a non-specific anti-viral immune response and long-term specific immunity against IHNV. This study characterized gene expression responses associated with the early anti-viral response. Homozygous rainbow trout were injected intra-muscularly (I.M.) with vector DNA or the IHNV DNA vaccine. Gene expression in muscle tissue (I.M. site) was evaluated using a 16,008 feature salmon cDNA microarray. Eighty different genes were significantly modulated in the vector DNA group while 910 genes were modulated in the IHNV DNA vaccinate group relative to control group. Quantitative reverse-transcriptase PCR was used to examine expression of selected immune genes at the I.M. site and in other secondary tissues. In the localized response (I.M. site), the magnitudes of gene expression changes were much greater in the vaccinate group relative to the vector DNA group for the majority of genes analyzed. At secondary systemic sites (e.g. gill, kidney and spleen), type I IFN-related genes were up-regulated in only the IHNV DNA vaccinated group. The results presented here suggest that the IHNV DNA vaccine induces up-regulation of the type I IFN system across multiple tissues, which is the functional basis of early anti-viral immunity.
Mg2+ in the Major Groove Modulates B-DNA Structure and Dynamics
Guéroult, Marc; Boittin, Olivier; Mauffret, Oliver; Etchebest, Catherine; Hartmann, Brigitte
2012-01-01
This study investigates the effect of Mg2+ bound to the DNA major groove on DNA structure and dynamics. The analysis of a comprehensive dataset of B-DNA crystallographic structures shows that divalent cations are preferentially located in the DNA major groove where they interact with successive bases of (A/G)pG and the phosphate group of 5′-CpA or TpG. Based on this knowledge, molecular dynamics simulations were carried out on a DNA oligomer without or with Mg2+ close to an ApG step. These simulations showed that the hydrated Mg2+ forms a stable intra-strand cross-link between the two purines in solution. ApG generates an electrostatic potential in the major groove that is particularly attractive for cations; its intrinsic conformation is well-adapted to the formation of water-mediated hydrogen bonds with Mg2+. The binding of Mg2+ modulates the behavior of the 5′-neighboring step by increasing the BII (ε-ζ>0°) population of its phosphate group. Additional electrostatic interactions between the 5′-phosphate group and Mg2+ strengthen both the DNA-cation binding and the BII character of the 5′-step. Cation binding in the major groove may therefore locally influence the DNA conformational landscape, suggesting a possible avenue for better understanding how strong DNA distortions can be stabilized in protein-DNA complexes. PMID:22844516
The future of human DNA vaccines
Li, Lei; Saade, Fadi; Petrovsky, Nikolai
2012-01-01
DNA vaccines have evolved greatly over the last 20 years since their invention, but have yet to become a competitive alternative to conventional protein or carbohydrate based human vaccines. Whilst safety concerns were an initial barrier, the Achilles heel of DNA vaccines remains their poor immunogenicity when compared to protein vaccines. A wide variety of strategies have been developed to optimize DNA vaccine immunogenicity, including codon optimization, genetic adjuvants, electroporation and sophisticated prime-boost regimens, with each of these methods having its advantages and limitations. Whilst each of these methods has contributed to incremental improvements in DNA vaccine efficacy, more is still needed if human DNA vaccines are to succeed commercially. This review foresees a final breakthrough in human DNA vaccines will come from application of the latest cutting-edge technologies, including “epigenetics” and “omics” approaches, alongside traditional techniques to improve immunogenicity such as adjuvants and electroporation, thereby overcoming the current limitations of DNA vaccines in humans PMID:22981627
Montecucco, A; Lestingi, M; Rossignol, J M; Elder, R H; Ciarrocchi, G
1993-04-06
We have measured the effects of eight distamycin and two anthracycline derivatives on polynucleotide joining and self-adenylating activities of human DNA ligase I and rat DNA ligases I and III. All test drugs show good inhibitory activity against the three enzymes in the poly[d(A-T)] joining assay. Several distamycins also inhibit the DNA-independent self-adenylation reaction catalysed by the human enzyme and, to a lesser extent, by rat DNA ligases. These results confirm that anthracyclines and distamycins express their inhibitory action against DNA joining activities mainly via specific interactions with the substrate, and suggest that the three test DNA ligases utilize similar, if not identical, mechanisms of recognition and interaction with DNA-drug complexes. Our findings also indicate that distamycins have a greater affinity for human DNA ligase I than for rat enzymes, suggesting that, in this respect, rat DNA ligase I is more similar to rat DNA ligase III than to human DNA ligase I.
Casanova-Moreno, J; Bizzotto, D
2015-02-17
Electrostatic control of the orientation of fluorophore-labeled DNA strands immobilized on an electrode surface has been shown to be an effective bioanalytical tool. Modulation techniques and later time-resolved measurements were used to evaluate the kinetics of the switching between lying and standing DNA conformations. These measurements, however, are the result of a convolution between the DNA "switching" response time and the other frequency limited responses in the measurement. In this work, a method for analyzing the response of a potential driven DNA sensor is presented by calculating the potential effectively dropped across the electrode interface (using electrochemical impedance spectroscopy) as opposed to the potential applied to the electrochemical cell. This effectively deconvolutes the effect of the charging time on the observed frequency response. The corrected response shows that DNA is able to switch conformation faster than previously reported using modulation techniques. This approach will ensure accurate measurements independent of the electrochemical system, removing the uncertainty in the analysis of the switching response, enabling comparison between samples and measurement systems.
Structural and Functional Assessment of APOBEC3G Macromolecular Complexes
Polevoda, Bogdan; McDougall, William M.; Bennett, Ryan P.; Salter, Jason D.; Smith, Harold C.
2016-01-01
There are eleven members in the human APOBEC family of proteins that are evolutionarily related through their zinc-dependent cytidine deaminase domains. The human APOBEC gene clusters arose on chromosome 6 and 22 through gene duplication and divergence to where current day APOBEC proteins are functionally diverse and broadly expressed in tissues. APOBEC serve enzymatic and non enzymatic functions in cells. In both cases, formation of higher-order structures driven by APOBEC protein-protein interactions and binding to RNA and/or single stranded DNA are integral to their function. In some circumstances, these interactions are regulatory and modulate APOBEC activities. We are just beginning to understand how macromolecular interactions drive processes such as APOBEC subcellular compartmentalization, formation of holoenzyme complexes, gene targeting, foreign DNA restriction, anti-retroviral activity, formation of ribonucleoprotein particles and APOBEC degradation. Protein-protein and protein-nucleic acid cross-linking methods coupled with mass spectrometry, electrophoretic mobility shift assays, glycerol gradient sedimentation, fluorescence anisotropy and APOBEC deaminase assays are enabling mapping of interacting surfaces that are essential for these functions. The goal of this methods review is through example of our research on APOBEC3G, describe the application of cross-linking methods to characterize and quantify macromolecular interactions and their functional implications. Given the homology in structure and function, it is proposed that these methods will be generally applicable to the discovery process for other APOBEC and RNA and DNA editing and modifying proteins. PMID:26988126
Human FEN1 Expression and Solubility Patterson in DNA Replication and Repair
1999-11-03
following DNA replication from the simian virus 40 (SV40) origin of replication in vitro. Human FEN1, and FEN1 homologues from yeast to mammals, are...also implicated in different forms of DNA repair. In this thesis, I provide additional evidence supporting human FEN1’s role in nuclear DNA replication in...coincident with S phase DNA replication in both primary and transformed cells. Using novel antibodies that recognize human FEN1, I further show that very
Imbert, Isabelle; Botto, Jean-Marie; Farra, Claude D; Domloge, Nouha
2012-06-01
Telomere shortening is considered as one of the main characteristics of cellular aging by limiting cellular division. Besides the fundamental advances through the discoveries of telomere and telomerase, which were recognized by a Nobel Prize, telomere protection remains an essential area of research. Recently, it was evidenced that studying the cross-talks between the proteins associated with telomere should provide a better understanding of the mechanistic basis for telomere-associated aging phenotypes. In this review, we discuss the current knowledge on telomere shortening, telomerase activity, and the essential role of telomere binding proteins in telomere stabilization and telomere-end protection. This review highlights the capacity of telomere binding proteins to limit cellular senescence and to maintain skin tissue homeostasis, which is of key importance to reduce accelerated tissue aging. Future studies addressing telomere protection and limitation of DNA damage response in human skin should include investigations on telomere binding proteins. As little is known about the expression of telomere binding proteins in human skin and modulation of their expression with aging, it remains an interesting field of skin research and a key area for future skin protection and anti-aging developments. © 2012 Wiley Periodicals, Inc.
eShadow: A tool for comparing closely related sequences
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ovcharenko, Ivan; Boffelli, Dario; Loots, Gabriela G.
2004-01-15
Primate sequence comparisons are difficult to interpret due to the high degree of sequence similarity shared between such closely related species. Recently, a novel method, phylogenetic shadowing, has been pioneered for predicting functional elements in the human genome through the analysis of multiple primate sequence alignments. We have expanded this theoretical approach to create a computational tool, eShadow, for the identification of elements under selective pressure in multiple sequence alignments of closely related genomes, such as in comparisons of human to primate or mouse to rat DNA. This tool integrates two different statistical methods and allows for the dynamic visualizationmore » of the resulting conservation profile. eShadow also includes a versatile optimization module capable of training the underlying Hidden Markov Model to differentially predict functional sequences. This module grants the tool high flexibility in the analysis of multiple sequence alignments and in comparing sequences with different divergence rates. Here, we describe the eShadow comparative tool and its potential uses for analyzing both multiple nucleotide and protein alignments to predict putative functional elements. The eShadow tool is publicly available at http://eshadow.dcode.org/« less
The PARTRAC code: Status and recent developments
NASA Astrophysics Data System (ADS)
Friedland, Werner; Kundrat, Pavel
Biophysical modeling is of particular value for predictions of radiation effects due to manned space missions. PARTRAC is an established tool for Monte Carlo-based simulations of radiation track structures, damage induction in cellular DNA and its repair [1]. Dedicated modules describe interactions of ionizing particles with the traversed medium, the production and reactions of reactive species, and score DNA damage determined by overlapping track structures with multi-scale chromatin models. The DNA repair module describes the repair of DNA double-strand breaks (DSB) via the non-homologous end-joining pathway; the code explicitly simulates the spatial mobility of individual DNA ends in parallel with their processing by major repair enzymes [2]. To simulate the yields and kinetics of radiation-induced chromosome aberrations, the repair module has been extended by tracking the information on the chromosome origin of ligated fragments as well as the presence of centromeres [3]. PARTRAC calculations have been benchmarked against experimental data on various biological endpoints induced by photon and ion irradiation. The calculated DNA fragment distributions after photon and ion irradiation reproduce corresponding experimental data and their dose- and LET-dependence. However, in particular for high-LET radiation many short DNA fragments are predicted below the detection limits of the measurements, so that the experiments significantly underestimate DSB yields by high-LET radiation [4]. The DNA repair module correctly describes the LET-dependent repair kinetics after (60) Co gamma-rays and different N-ion radiation qualities [2]. First calculations on the induction of chromosome aberrations have overestimated the absolute yields of dicentrics, but correctly reproduced their relative dose-dependence and the difference between gamma- and alpha particle irradiation [3]. Recent developments of the PARTRAC code include a model of hetero- vs euchromatin structures to enable accounting for variations in DNA damage yields, complexity and repair between these regions. Second, the applicability of the code to low-energy ions has been extended to full stopping by using a modified Barkas scaling of proton cross sections for ions heavier than helium. Third, ongoing studies aim at hitherto unprecedented benchmarking of the code against experiments with sub-muµm focused bunches of low-LET ions mimicking single high-LET ion tracks [5] which separate effects of damage clustering on a sub-mum scale from DNA damage complexity on a nanometer scale. Fourth, motivated by implications for the involvement of mitochondria in intercellular signaling and radiation-induced bystander effects, ongoing work extends the range of PARTRAC DNA models to radiation effects on mitochondrial DNA. The contribution will discuss the PARTRAC modules, benchmarks to experimental data, recent and ongoing developments of the code, with special attention to its implications and potential applications in radiation protection and space research. Acknowledgement. This work was partially funded by the EU (Contract FP7-249689 ‘DoReMi’). References 1. Friedland et al., Mutat. Res. 711, 28 (2011) 2. Friedland et al., Int. J. Radiat. Biol. 88, 129 (2012) 3. Friedland et al., Mutat. Res. 756, 213 (2013) 4. Alloni et al., Radiat. Res. 179, 690 (2013) 5. Schmid et al., Phys. Med. Biol. 57, 5889 (2012)
da Silva, Regiane Pereira; Jacociunas, Laura Vicedo; de Carli, Raíne Fogliati; de Abreu, Bianca Regina Ribas; Lehmann, Mauricio; da Silva, Juliana; Ferraz, Alexandre de Barros Falcão; Dihl, Rafael Rodrigues
2017-10-01
Cynara scolymus L., popularly known as artichoke, is consumed as food and used as tea infusions for pharmacological purposes to treat liver dysfunctions and other conditions. Scientific data on the safety and protective effect of artichoke in human-derived liver cells is missing. This study investigated the genotoxic and modulatory effect of a liophilized extract suspended in water of C. scolymus L. leaves. Four extract concentrations (0.62, 1.25, 2.5 and 5.0 mg/mL) were evaluated using the comet assay on human hepatocyte cultures, HepG2 cells. Genotoxicity was assessed after two treatment periods, 1 and 24 h. Antigenotoxicity was evaluated against oxidative lesions induced by hydrogen peroxide in pre-, simultaneous and post-treatment protocols. Artichoke leaves aqueous extract induced genotoxic effects in HepG2 cells after 1- and 24-h treatments. In turn, extract concentrations of 0.62, 1.25 and 2.5 mg/mL, exhibited a protective effect in pretreatment, compared to hydrogen peroxide alone. However, in simultaneous and post-treatment protocols, only the lowest concentration reduced the frequency of DNA damage induced by hydrogen peroxide. In addition, in the simultaneous treatment protocol, the highest artichoke extract concentration increased hydrogen peroxide genotoxicity. It can be concluded that artichoke is genotoxic, in vitro, to HepG2 cells, but can also modulate hydrogen peroxide DNA damage.
dNTP pool levels modulate mutator phenotypes of error-prone DNA polymerase ε variants.
Williams, Lindsey N; Marjavaara, Lisette; Knowels, Gary M; Schultz, Eric M; Fox, Edward J; Chabes, Andrei; Herr, Alan J
2015-05-12
Mutator phenotypes create genetic diversity that fuels tumor evolution. DNA polymerase (Pol) ε mediates leading strand DNA replication. Proofreading defects in this enzyme drive a number of human malignancies. Here, using budding yeast, we show that mutator variants of Pol ε depend on damage uninducible (Dun)1, an S-phase checkpoint kinase that maintains dNTP levels during a normal cell cycle and up-regulates dNTP synthesis upon checkpoint activation. Deletion of DUN1 (dun1Δ) suppresses the mutator phenotype of pol2-4 (encoding Pol ε proofreading deficiency) and is synthetically lethal with pol2-M644G (encoding altered Pol ε base selectivity). Although pol2-4 cells cycle normally, pol2-M644G cells progress slowly through S-phase. The pol2-M644G cells tolerate deletions of mediator of the replication checkpoint (MRC) 1 (mrc1Δ) and radiation sensitive (Rad) 9 (rad9Δ), which encode mediators of checkpoint responses to replication stress and DNA damage, respectively. The pol2-M644G mutator phenotype is partially suppressed by mrc1Δ but not rad9Δ; neither deletion suppresses the pol2-4 mutator phenotype. Thus, checkpoint activation augments the Dun1 effect on replication fidelity but is not required for it. Deletions of genes encoding key Dun1 targets that negatively regulate dNTP synthesis, suppress the dun1Δ pol2-M644G synthetic lethality and restore the mutator phenotype of pol2-4 in dun1Δ cells. DUN1 pol2-M644G cells have constitutively high dNTP levels, consistent with checkpoint activation. In contrast, pol2-4 and POL2 cells have similar dNTP levels, which decline in the absence of Dun1 and rise in the absence of the negative regulators of dNTP synthesis. Thus, dNTP pool levels correlate with Pol ε mutator severity, suggesting that treatments targeting dNTP pools could modulate mutator phenotypes for therapy.
NASA Technical Reports Server (NTRS)
Zhang, Ye; Rohde, Larry H.; Emami, Kamal; Casey, Rachael; Wu, Honglu
2008-01-01
Changes of gene expression profile are one of the most important biological responses in living cells after ionizing radiation (IR) exposure. Although some studies have shown that genes up-regulated by IR may play important roles in DNA damage repair, the relationship between the regulation of gene expression by IR, particularly genes not known for their roles in DSB repair, and its impact on cytogenetic responses has not been systematically studied. In the present study, the expression of 25 genes selected on the basis of their transcriptional changes in response to IR was individually knocked down by transfection with small interfering RNA in human fibroblast cells. The purpose of this study is to identify new roles of these selected genes on regulating DSB repair and cell cycle progression , as measured in the micronuclei formation and chromosome aberration. In response to IR, the formation of MN was significantly increased by suppressed expression of 5 genes: Ku70 in the DSB repair pathway, XPA in the NER pathway, RPA1 in the MMR pathway, and RAD17 and RBBP8 in cell cycle control. Knocked-down expression of 4 genes (MRE11A, RAD51 in the DSB pathway, SESN1, and SUMO1) significantly inhibited cell cycle progression, possibly because of severe impairment of DNA damage repair. Furthermore, loss of XPA, P21, or MLH1 expression resulted in both significantly enhanced cell cycle progression and increased yields of chromosome aberrations, indicating that these gene products modulate both cell cycle control and DNA damage repair. Most of the 11 genes that affected cytogenetic responses are not known to have clear roles influencing DBS repair. Nine of these 11 genes were up-regulated in cells exposed to gamma radiation, suggesting that genes transcriptionally modulated by IR were critical to regulate the biological consequences after IR.
Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.
Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard
2007-10-30
We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.
Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets
Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard
2007-01-01
We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 × 108 bound targets per cm2 sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format. PMID:17951434
Cruz-Gallardo, Isabel; Del Conte, Rebecca; Velázquez-Campoy, Adrián; García-Mauriño, Sofía M; Díaz-Moreno, Irene
2015-05-11
A useful (2) J(N-H) coupling-based NMR spectroscopic approach is proposed to unveil, at the molecular level, the contribution of the imidazole groups of histidines from RNA/DNA-binding proteins on the modulation of binding to nucleic acids by pH. Such protonation/deprotonation events have been monitored on the single His96 located at the second RNA/DNA recognition motif (RRM2) of T-cell intracellular antigen-1 (TIA-1) protein. The pKa values of the His96 ionizable groups were substantially higher in the complexes with short U-rich RNA and T-rich DNA oligonucleotides than those of the isolated TIA-1 RRM2. Herein, the methodology applied to determine changes in pKa of histidine side chains upon DNA/RNA binding, gives valuable information to understand the pH effect on multidomain DNA/RNA-binding proteins that shuttle among different cellular compartments. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Structure of the SANT domain from the Xenopus chromatin remodeling factor ISWI
DOE Office of Scientific and Technical Information (OSTI.GOV)
Horton, John R.; Elgar, Stuart J.; Khan, Seema I.
2008-09-17
The SANT (Swi3, Ada2, N-Cor, and TFIIIB) module was first described as a putative DNA-binding domain with strong similarity to the helix-turn-helix DNA binding domain of Myb-related proteins. The X-ray structure of the C-terminal one third portion of the ATPase ISWI of Drosophila melangoaster, containing both SANT and SLIDE (SANT-Like ISWI Domain), confirmed the overall helix-turn-helix structural architecture of SANT as well as SLIDE. However, the DNA-contacting residues in Myb are not conserved in SANT and the structurally corresponding residues in the ISWI SANT domain are acidic, and therefore incompatible with DNA interaction. Recent studies suggested that SANT domains mightmore » be a histone-tail-binding module, including the DNA binding SANT domain of c-Myb. Here they present the X-ray structure of Xenopus laevis ISWI SANT domain, derived from limited proteolysis of a C-terminal fragment of ISWI protein.« less
Sachse, Benjamin; Meinl, Walter; Glatt, Hansruedi; Monien, Bernhard H
2016-03-01
Furfuryl alcohol (FFA) is a carcinogenic food contaminant, which is formed by acid- and heat-catalyzed degradation of fructose and glucose. The activation by sulfotransferases (SULTs) yields a DNA reactive and mutagenic sulfate ester. The most prominent DNA adduct, N(2)-((furan-2-yl)methyl)-2'-deoxyguanosine (N(2)-MF-dG), was detected in FFA-treated mice and also in human tissue samples. The dominant pathway of FFA detoxification is the oxidation via alcohol dehydrogenases (ADHs) and aldehyde dehydrogenases (ALDHs). The activity of these enzymes may be greatly altered in the presence of inhibitors or competitive substrates. Here, we investigated the impact of ethanol and the ADH inhibitor 4-methylpyrazole (4MP) on the DNA adduct formation by FFA in wild-type and in humanized mice that were transgenic for human SULT1A1/1A2 and deficient in the mouse (m) Sult1a1 and Sult1d1 genes (h1A1/1A2/1a1(-)/1d1(-)). The administration of FFA alone led to hepatic adduct levels of 4.5 N(2)-MF-dG/10(8) nucleosides and 33.6 N(2)-MF-dG/10(8) nucleosides in male and female wild-type mice, respectively, and of 19.6 N(2)-MF-dG/10(8) nucleosides and 95.4 N(2)-MF-dG/10(8) nucleosides in male and female h1A1/1A2/1a1(-)/1d1(-) mice. The coadministration of 1.6g ethanol/kg body weight increased N(2)-MF-dG levels by 2.3-fold in male and by 1.7-fold in female wild-type mice and by 2.5-fold in male and by 1.5-fold in female h1A1/1A2/1a1(-)/1d1(-) mice. The coadministration of 100mg 4MP/kg body weight had a similar effect on the adduct levels. These findings indicate that modulators of the oxidative metabolism, e.g. the drug 4MP or consumption of alcoholic beverages, may increase the genotoxic effects of FFA also in humans. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Human mitochondrial DNA replication machinery and disease
Young, Matthew J.; Copeland, William C.
2016-01-01
The human mitochondrial genome is replicated by DNA polymerase γ in concert with key components of the mitochondrial DNA (mtDNA) replication machinery. Defects in mtDNA replication or nucleotide metabolism cause deletions, point mutations, or depletion of mtDNA. The resulting loss of cellular respiration ultimately induces mitochondrial genetic diseases, including mtDNA depletion syndromes such as Alpers or early infantile hepatocerebral syndromes, and mtDNA deletion disorders such as progressive external ophthalmoplegia, ataxia-neuropathy, or mitochondrial neurogastrointestinal encephalomyopathy. Here we review the current literature regarding human mtDNA replication and heritable disorders caused by genetic changes of the POLG, POLG2, Twinkle, RNASEH1, DNA2 and MGME1 genes. PMID:27065468
Human DNA adduct measurements: State of the art
DOE Office of Scientific and Technical Information (OSTI.GOV)
Poirier, M.C.; Weston, A.
1996-10-01
Human DNA adduct formation (covalent modification of DNA with chemical carcinogens) is a promising biomarker for elucidating the molecular epidemiology of cancer. Classes of compounds for which human DNA adducts have been observed include polycyclic aromatic hydrocarbons (PAHs), nitrosamines, mycotoxins, aromatic amines, heterocyclic amines, ultraviolet light, and alkylating cancer chemotherapeutic agents. Most human DNA adduct exposure monitoring has been performed with either {sup 32}P-postlabeling or immunoassays, neither of which is able to chemically characterize specific DNA adducts. Recently developed combinations of methods with chemical and physical end points have allowed identification of specific adducts in human tissues. Studies are presentedmore » that demonstrate that high ambient levels of benzo[a]pyrene are associated with high levels of DNA adducts in human blood cell DNA and that the same DNA adduct levels drop when the ambient PAH levels decrease significantly. DNA adduct dosimetry, which has been achieved with some dietary carcinogens and cancer chemotherapeutic agents, is described, as well as studies correlating DNA adducts with other biomarkers. It is likely that some toxic, noncarcinogenic compounds may have genotoxic effects, including oxidative damage, and that adverse health outcomes other than cancer may be correlated with DNA adduct formation. The studies presented here may serve as useful prototypes for exploration of other toxicological end points. 156 refs., 1 fig., 3 tabs.« less
NASA Technical Reports Server (NTRS)
Ballarini, F.; Biaggi, M.; De Biaggi, L.; Ferrari, A.; Ottolenghi, A.; Panzarasa, A.; Paretzke, H. G.; Pelliccioni, M.; Sala, P.; Scannicchio, D.;
2004-01-01
Distributions of absorbed dose and DNA clustered damage yields in various organs and tissues following the October 1989 solar particle event (SPE) were calculated by coupling the FLUKA Monte Carlo transport code with two anthropomorphic phantoms (a mathematical model and a voxel model), with the main aim of quantifying the role of the shielding features in modulating organ doses. The phantoms, which were assumed to be in deep space, were inserted into a shielding box of variable thickness and material and were irradiated with the proton spectra of the October 1989 event. Average numbers of DNA lesions per cell in different organs were calculated by adopting a technique already tested in previous works, consisting of integrating into "condensed-history" Monte Carlo transport codes--such as FLUKA--yields of radiobiological damage, either calculated with "event-by-event" track structure simulations, or taken from experimental works available in the literature. More specifically, the yields of "Complex Lesions" (or "CL", defined and calculated as a clustered DNA damage in a previous work) per unit dose and DNA mass (CL Gy-1 Da-1) due to the various beam components, including those derived from nuclear interactions with the shielding and the human body, were integrated in FLUKA. This provided spatial distributions of CL/cell yields in different organs, as well as distributions of absorbed doses. The contributions of primary protons and secondary hadrons were calculated separately, and the simulations were repeated for values of Al shielding thickness ranging between 1 and 20 g/cm2. Slight differences were found between the two phantom types. Skin and eye lenses were found to receive larger doses with respect to internal organs; however, shielding was more effective for skin and lenses. Secondary particles arising from nuclear interactions were found to have a minor role, although their relative contribution was found to be larger for the Complex Lesions than for the absorbed dose, due to their higher LET and thus higher biological effectiveness. c2004 COSPAR. Published by Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Ballarini, F.; Biaggi, M.; De Biaggi, L.; Ferrari, A.; Ottolenghi, A.; Panzarasa, A.; Paretzke, H. G.; Pelliccioni, M.; Sala, P.; Scannicchio, D.; Zankl, M.
2004-01-01
Distributions of absorbed dose and DNA clustered damage yields in various organs and tissues following the October 1989 solar particle event (SPE) were calculated by coupling the FLUKA Monte Carlo transport code with two anthropomorphic phantoms (a mathematical model and a voxel model), with the main aim of quantifying the role of the shielding features in modulating organ doses. The phantoms, which were assumed to be in deep space, were inserted into a shielding box of variable thickness and material and were irradiated with the proton spectra of the October 1989 event. Average numbers of DNA lesions per cell in different organs were calculated by adopting a technique already tested in previous works, consisting of integrating into "condensed-history" Monte Carlo transport codes - such as FLUKA - yields of radiobiological damage, either calculated with "event-by-event" track structure simulations, or taken from experimental works available in the literature. More specifically, the yields of "Complex Lesions" (or "CL", defined and calculated as a clustered DNA damage in a previous work) per unit dose and DNA mass (CL Gy -1 Da -1) due to the various beam components, including those derived from nuclear interactions with the shielding and the human body, were integrated in FLUKA. This provided spatial distributions of CL/cell yields in different organs, as well as distributions of absorbed doses. The contributions of primary protons and secondary hadrons were calculated separately, and the simulations were repeated for values of Al shielding thickness ranging between 1 and 20 g/cm 2. Slight differences were found between the two phantom types. Skin and eye lenses were found to receive larger doses with respect to internal organs; however, shielding was more effective for skin and lenses. Secondary particles arising from nuclear interactions were found to have a minor role, although their relative contribution was found to be larger for the Complex Lesions than for the absorbed dose, due to their higher LET and thus higher biological effectiveness.
Wang, Zheng; Yin, Hao; Lv, Lei; Feng, Yingying; Chen, Shaopeng; Liang, Junting; Huang, Yun; Jiang, Xiaohua; Jiang, Hanwei; Bukhari, Ihtisham; Wu, Lijun; Cooke, Howard J; Shi, Qinghua
2014-01-01
Elimination of uniparental chromosomes occurs frequently in interspecific hybrid cells. For example, human chromosomes are always eliminated during clone formation when human cells are fused with mouse cells. However, the underlying mechanisms are still elusive. Here, we show that the elimination of human chromosomes in human–mouse hybrid cells is accompanied by continued cell division at the presence of DNA damage on human chromosomes. Deficiency in DNA damage repair on human chromosomes occurs after cell fusion. Furthermore, increasing the level of DNA damage on human chromosomes by irradiation accelerates human chromosome loss in hybrid cells. Our results indicate that the elimination of human chromosomes in human–mouse hybrid cells results from unrepaired DNA damage on human chromosomes. We therefore provide a novel mechanism underlying chromosome instability which may facilitate the understanding of carcinogenesis. PMID:24608870
2013-01-01
Background Mitochondrial DNA (mtDNA) typing can be a useful aid for identifying people from compromised samples when nuclear DNA is too damaged, degraded or below detection thresholds for routine short tandem repeat (STR)-based analysis. Standard mtDNA typing, focused on PCR amplicon sequencing of the control region (HVS I and HVS II), is limited by the resolving power of this short sequence, which misses up to 70% of the variation present in the mtDNA genome. Methods We used in-solution hybridisation-based DNA capture (using DNA capture probes prepared from modern human mtDNA) to recover mtDNA from post-mortem human remains in which the majority of DNA is both highly fragmented (<100 base pairs in length) and chemically damaged. The method ‘immortalises’ the finite quantities of DNA in valuable extracts as DNA libraries, which is followed by the targeted enrichment of endogenous mtDNA sequences and characterisation by next-generation sequencing (NGS). Results We sequenced whole mitochondrial genomes for human identification from samples where standard nuclear STR typing produced only partial profiles or demonstrably failed and/or where standard mtDNA hypervariable region sequences lacked resolving power. Multiple rounds of enrichment can substantially improve coverage and sequencing depth of mtDNA genomes from highly degraded samples. The application of this method has led to the reliable mitochondrial sequencing of human skeletal remains from unidentified World War Two (WWII) casualties approximately 70 years old and from archaeological remains (up to 2,500 years old). Conclusions This approach has potential applications in forensic science, historical human identification cases, archived medical samples, kinship analysis and population studies. In particular the methodology can be applied to any case, involving human or non-human species, where whole mitochondrial genome sequences are required to provide the highest level of maternal lineage discrimination. Multiple rounds of in-solution hybridisation-based DNA capture can retrieve whole mitochondrial genome sequences from even the most challenging samples. PMID:24289217
Senba, Masachika; Mori, Naoki; Wada, Akihiro; Fujita, Shuichi; Yasunami, Michio; Irie, Sumiko; Hayashi, Tomayoshi; Igawa, Tsukasa; Kanetake, Hiroshi; Takahara, Osamu; Toriyama, Kan
2010-03-01
The causal relationship between chronic inflammation and cancer is widely accepted. Numerous investigations have identified nuclear factor-κB (NF-κB) as an important modulator in driving chronic inflammation to cancer. This study aimed to determine the prevalence of human papillomavirus (HPV) in penile cancer in Japanese patients and whether NF-κB is subsequently overexpressed in penile cancer. Thirty-four specimens of penile tissue (16 malignant and 18 benign cases) were examined to determine the association of HPV infection. An in situ hybridization (ISH) method was used to detect and localize HPV-DNA. A sensitive HPV polymerase chain reaction (PCR) procedure was used for the detection of HPV-DNA, and DNA sequencing was used to identify the HPV genotype. HPV-DNA was detected in 37.5 and 75% of cases of penile cancer, using ISH and PCR, respectively. Our efforts to detect HPV genotypes were unsuccessful as HPV-DNA could not be extracted from these materials. Using ISH, a prevalence of 68.2% of HPV infection was found in penile cancer in Kenyan patients in east Africa. In the present study, all 9 HPV-positive cases, (100%) were NF-κB-positive in the nucleus and/or cytoplasm. In contrast, of the 25 HPV-negative cases, 15 (60%) were NF-κB-positive in the nucleus and/or cytoplasm. Therefore, ISH is a method which is able to prove infection of a large quantity of HPV more effectively when compared with PCR. Thus, a large quantity of HPV infection leads to the activity of NF-κB. The most prevalent genotype was the HPV-22 found in 83.3% of the penile cancer cases. In addition, HPV-11 was found in 81.8% of the non-cancer cases. For cases with a high level of infection, the activity of NF-κB increased compared with those with a low level of HPV infection.
NASA Astrophysics Data System (ADS)
Tabassum, Sartaj; Sharma, Girish Chandra; Arjmand, Farukh
2012-05-01
A new chiral ligand scaffold L derived from (R)-2-amino-2-phenyl ethanol and diethyl oxalate was isolated and thoroughly characterized by various spectroscopic methods. The ligand L was allowed to react with CuCl2·2H2O and NiCl2·6H2O to achieve monometallic complexes 1 and 2, respectively. Subsequently modulation of 1 and 2 was carried out in the presence of SnCl4·5H2O to obtain heterobimetallic potential drug candidates 3 and 4 possessing (CuII/SnIV and NiII/SnIV) metallic cores, respectively and characterized by elemental analysis and spectroscopic data including 1H, 13C and 119Sn NMR in case of 3 and 4. In vitro DNA binding studies revealed that complex 3 avidly binds to DNA as quantified by Kb and Ksv values. Complex 3 exhibits a remarkable DNA cleavage activity (concentration dependent) with pBR322 DNA and the cleavage activity of 3 was significantly enhanced in the presence of activators and follows the order H2O2 > Asc > MPA > GSH. Complex 3 cleave pBR322 DNA via hydrolytic pathway and accessible to major groove of DNA.
Liang, Le; Li, Jiang; Li, Qian; Huang, Qing; Shi, Jiye; Yan, Hao; Fan, Chunhai
2014-07-21
DNA is typically impermeable to the plasma membrane due to its polyanionic nature. Interestingly, several different DNA nanostructures can be readily taken up by cells in the absence of transfection agents, which suggests new opportunities for constructing intelligent cargo delivery systems from these biocompatible, nonviral DNA nanocarriers. However, the underlying mechanism of entry of the DNA nanostructures into the cells remains unknown. Herein, we investigated the endocytotic internalization and subsequent transport of tetrahedral DNA nanostructures (TDNs) by mammalian cells through single-particle tracking. We found that the TDNs were rapidly internalized by a caveolin-dependent pathway. After endocytosis, the TDNs were transported to the lysosomes in a highly ordered, microtubule-dependent manner. Although the TDNs retained their structural integrity within cells over long time periods, their localization in the lysosomes precludes their use as effective delivery agents. To modulate the cellular fate of the TDNs, we functionalized them with nuclear localization signals that directed their escape from the lysosomes and entry into the cellular nuclei. This study improves our understanding of the entry into cells and transport pathways of DNA nanostructures, and the results can be used as a basis for designing DNA-nanostructure-based drug delivery nanocarriers for targeted therapy. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fetterman, Jessica L.; Zelickson, Blake R.; Johnson, Larry W.; Moellering, Douglas R.; Westbrook, David G.; Pompilius, Melissa; Sammy, Melissa J.; Johnson, Michelle; Dunham-Snary, Kimberly J.; Cao, Xuemei; Bradley, Wayne E.; Zhang, Jinju; Wei, Chih-Chang; Chacko, Balu; Schurr, Theodore G.; Kesterson, Robert A.; Dell’Italia, Louis J.; Darley-Usmar, Victor M.; Welch, Danny R.; Ballinger, Scott W.
2013-01-01
Synopsis Dysfunctional bioenergetics has emerged as a key feature in many chronic pathologies such as diabetes and cardiovascular disease. This has led to the mitochondrial paradigm in which it has been proposed that mitochondrial DNA (mtDNA) sequence variation contributes to disease susceptibility. In this study we present a novel animal model of mtDNA polymorphisms, the mitochondrial nuclear exchange mouse (MNX), in which the mtDNA from C3H/HeN mouse has been inserted onto the C57/BL6 nuclear background and vice versa to test this concept. Our data show a major contribution of the C57/BL6 mtDNA to the susceptibility to the pathological stress of cardiac volume overload which is independent of the nuclear background. Mitochondria harboring the C57/BL6J mtDNA generate more reactive oxygen species (ROS) and have a higher mitochondrial membrane potential relative to those having the C3H/HeN mtDNA, independent of nuclear background. We propose this is the primary mechanism associated with increased bioenergetic dysfunction in response to volume overload. In summary, these studies support the “mitochondrial paradigm” for the development of disease susceptibility, and show that the mtDNA modulates, cellular bioenergetics, mitochondrial reactive oxygen species generation and susceptibility to cardiac stress. PMID:23924350
Brown, Jessica A.; Pack, Lindsey R.; Fowler, Jason D.; Suo, Zucai
2011-01-01
Antiviral nucleoside analogs have been developed to inhibit the enzymatic activities of the hepatitis B virus (HBV) polymerase, thereby preventing the replication and production of HBV. However, the usage of these analogs can be limited by drug toxicity because the 5′-triphosphates of these nucleoside analogs (nucleotide analogs) are potential substrates for human DNA polymerases to incorporate into host DNA. Although they are poor substrates for human replicative DNA polymerases, it remains to be established whether these nucleotide analogs are substrates for the recently discovered human X- and Y-family DNA polymerases. Using pre-steady state kinetic techniques, we have measured the substrate specificity values for human DNA polymerases β, λ, η, ι, κ, and Rev1 incorporating the active forms of the following anti-HBV nucleoside analogs approved for clinical use: adefovir, tenofovir, lamivudine, telbivudine, and entecavir. Compared to the incorporation of a natural nucleotide, most of the nucleotide analogs were incorporated less efficiently (2 to >122,000) by the six human DNA polymerases. In addition, the potential for entecavir and telbivudine, two drugs which possess a 3′-hydroxyl, to become embedded into human DNA was examined by primer extension and DNA ligation assays. These results suggested that telbivudine functions as a chain terminator while entecavir was efficiently extended by the six enzymes and was a substrate for human DNA ligase I. Our findings suggested that incorporation of anti-HBV nucleotide analogs catalyzed by human X- and Y-family polymerases may contribute to clinical toxicity. PMID:22132702
Rehosting of Bacterial Chaperones for High-Quality Protein Production▿
Martínez-Alonso, Mónica; Toledo-Rubio, Verónica; Noad, Rob; Unzueta, Ugutz; Ferrer-Miralles, Neus; Roy, Polly; Villaverde, Antonio
2009-01-01
Coproduction of DnaK/DnaJ in Escherichia coli enhances solubility but promotes proteolytic degradation of their substrates, minimizing the yield of unstable polypeptides. Higher eukaryotes have orthologs of DnaK/DnaJ but lack the linked bacterial proteolytic system. By coexpression of DnaK and DnaJ in insect cells with inherently misfolding-prone recombinant proteins, we demonstrate simultaneous improvement of soluble protein yield and quality and proteolytic stability. Thus, undesired side effects of bacterial folding modulators can be avoided by appropriate rehosting in heterologous cell expression systems. PMID:19820142
Linacre, A; Gusmão, L; Hecht, W; Hellmann, A P; Mayr, W R; Parson, W; Prinz, M; Schneider, P M; Morling, N
2011-11-01
The use of non-human DNA typing in forensic science investigations, and specifically that from animal DNA, is ever increasing. The term animal DNA in this document refers to animal species encountered in a forensic science examination but does not include human DNA. Non-human DNA may either be: the trade and possession of a species, or products derived from a species, which is contrary to legislation; as evidence where the crime is against a person or property; instances of animal cruelty; or where the animal is the offender. The first instance is addressed by determining the species present, and the other scenarios can often be addressed by assigning a DNA sample to a particular individual organism. Currently there is little standardization of methodologies used in the forensic analysis of animal DNA or in reporting styles. The recommendations in this document relate specifically to animal DNA that is integral to a forensic science investigation and are not relevant to the breeding of animals for commercial purposes. This DNA commission was formed out of discussions at the International Society for Forensic Genetics 23rd Congress in Buenos Aires to outline recommendations on the use of non-human DNA in a forensic science investigation. Due to the scope of non-human DNA typing that is possible, the remit of this commission is confined to animal DNA typing only. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
A DEK Domain-Containing Protein Modulates Chromatin Structure and Function in Arabidopsis[W][OPEN
Waidmann, Sascha; Kusenda, Branislav; Mayerhofer, Juliane; Mechtler, Karl; Jonak, Claudia
2014-01-01
Chromatin is a major determinant in the regulation of virtually all DNA-dependent processes. Chromatin architectural proteins interact with nucleosomes to modulate chromatin accessibility and higher-order chromatin structure. The evolutionarily conserved DEK domain-containing protein is implicated in important chromatin-related processes in animals, but little is known about its DNA targets and protein interaction partners. In plants, the role of DEK has remained elusive. In this work, we identified DEK3 as a chromatin-associated protein in Arabidopsis thaliana. DEK3 specifically binds histones H3 and H4. Purification of other proteins associated with nuclear DEK3 also established DNA topoisomerase 1α and proteins of the cohesion complex as in vivo interaction partners. Genome-wide mapping of DEK3 binding sites by chromatin immunoprecipitation followed by deep sequencing revealed enrichment of DEK3 at protein-coding genes throughout the genome. Using DEK3 knockout and overexpressor lines, we show that DEK3 affects nucleosome occupancy and chromatin accessibility and modulates the expression of DEK3 target genes. Furthermore, functional levels of DEK3 are crucial for stress tolerance. Overall, data indicate that DEK3 contributes to modulation of Arabidopsis chromatin structure and function. PMID:25387881
NASA Technical Reports Server (NTRS)
Zhang, Ye; Rohde, Larry H.; Emami, Kamal; Hammond, Dianne; Mehta, Satish K.; Jeevarajan, Antony S.; Pierson, Duane L.; Wu, Honglu
2009-01-01
Changes of gene expression profile are one of the most important biological responses in living cells after ionizing radiation (IR) exposure. Although some studies have shown that genes up-regulated by IR may play important roles in DNA damage repair, the relationship between the regulation of gene expression by IR, particularly genes not known for their roles in double-strand break (DSB) repair, and its impact on cytogenetic responses has not been well studied. The purpose of this study is to identify new roles of IR inducible genes in radiation-induced chromosome aberrations and micronuclei formation. In the study, the expression of 25 genes selected on the basis of their transcriptional changes in response to IR was individually knocked down by small interfering RNA in human fibroblast cells. Frequencies of micronuclei (MN) formation and chromosome aberrations were measured to determine the efficiency of cytogenetic repair, and the fraction of bi-nucleated cells in the MN analysis was used as a marker for cell cycle progression. In response to gamma radiation, the formation of MN was significantly increased by suppressed expression of five genes: Ku70 (DSB repair pathway), XPA (nucleotide excision repair pathway), RPA1 (mismatch repair pathway), RAD17 and RBBP8 (cell cycle control). Knocked-down expression of four genes (MRE11A, RAD51 in the DSB pathway, SESN1, and SUMO1) significantly inhibited cell cycle progression, possibly because of severe impairment of DNA damage repair. Moreover, decreased XPA, p21, or MLH1 expression resulted in both significantly enhanced cell cycle progression and increased yields of chromosome aberrations, indicating that these gene products modulate both cell cycle control and DNA damage repair. Nine of these eleven genes, whose knock-down expression affected cytogenetic repair, were up-regulated in cells exposed to gamma radiation, suggesting that genes transcriptionally modulated by IR were critical to regulate IR-induced biological consequences. Furthermore, eight non-DBS repair genes showed involvement in regulating DSB repair, indicating that successful DSB repair requires both DSB repair mechanisms and non-DSB repair systems.
2012-01-01
Background Mammalian cells employ at least two subpathways of non-homologous end-joining for the repair of ionizing radiation induced DNA double strand breaks: The canonical DNA-PK-dependent form of non-homologous end-joining (D-NHEJ) and an alternative, slowly operating, error-prone backup pathway (B-NHEJ). In contrast to D-NHEJ, which operates with similar efficiency throughout the cell cycle, B-NHEJ operates more efficiently in G2-phase. Notably, B-NHEJ also shows strong and as of yet unexplained dependency on growth activity and is markedly compromised in serum-deprived cells, or in cells that enter the plateau-phase of growth. The molecular mechanisms underpinning this response remain unknown. Since chromatin structure or changes in chromatin structure are prime candidate-B-NHEJ-modulators, we study here the role of chromatin hyperacetylation, either by HDAC2 knockdown or treatment with the HDAC inhibitor TSA, on the repair by B-NHEJ of IR-induced DSBs. Results siRNA-mediated knockdown of HDAC2 fails to provoke histone hyperacetylation in Lig4-/- MEFs and has no detectable effect on B-NHEJ function. Treatment with TSA that inhibits multiple HDACs causes efficient, reversible chromatin hyperacetylation in Lig4-/- MEFs, as well as in human HCT116 Lig4-/- cells and the human glioma cell line M059K. The IR yield of DSBs in TSA-treated cells remains similar to that of untreated cells despite the expected chromatin relaxation. In addition, chromatin hyperacetylation leaves unchanged repair of DSBs by B-NHEJ in irradiated exponentially growing, or plateau-phase cells. Notably, under the experimental conditions employed here, chromatin hyperacetylation fails to detectably modulate B-NHEJ in M059K cells as well. Conclusions In summary, the results show that chromatin acetylation or deacetylation does not affect the kinetics of alternative NHEJ in all types of cells examined both in exponentially growing and serum deprived cultures. We conclude that parameters beyond chromatin acetylation determine B-NHEJ efficiency in the plateau-phase of growth. PMID:22908892
Rudnizky, Sergei; Khamis, Hadeel; Malik, Omri; Squires, Allison H; Meller, Amit; Melamed, Philippa
2018-01-01
Abstract Most functional transcription factor (TF) binding sites deviate from their ‘consensus’ recognition motif, although their sites and flanking sequences are often conserved across species. Here, we used single-molecule DNA unzipping with optical tweezers to study how Egr-1, a TF harboring three zinc fingers (ZF1, ZF2 and ZF3), is modulated by the sequence and context of its functional sites in the Lhb gene promoter. We find that both the core 9 bp bound to Egr-1 in each of the sites, and the base pairs flanking them, modulate the affinity and structure of the protein–DNA complex. The effect of the flanking sequences is asymmetric, with a stronger effect for the sequence flanking ZF3. Characterization of the dissociation time of Egr-1 revealed that a local, mechanical perturbation of the interactions of ZF3 destabilizes the complex more effectively than a perturbation of the ZF1 interactions. Our results reveal a novel role for ZF3 in the interaction of Egr-1 with other proteins and the DNA, providing insight on the regulation of Lhb and other genes by Egr-1. Moreover, our findings reveal the potential of small changes in DNA sequence to alter transcriptional regulation, and may shed light on the organization of regulatory elements at promoters. PMID:29253225
Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.
2010-05-04
A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.
Relatively well preserved DNA is present in the crystal aggregates of fossil bones
Salamon, Michal; Tuross, Noreen; Arensburg, Baruch; Weiner, Steve
2005-01-01
DNA from fossil human bones could provide invaluable information about population migrations, genetic relations between different groups and the spread of diseases. The use of ancient DNA from bones to study the genetics of past populations is, however, very often compromised by the altered and degraded state of preservation of the extracted material. The universally observed postmortem degradation, together with the real possibility of contamination with modern human DNA, makes the acquisition of reliable data, from humans in particular, very difficult. We demonstrate that relatively well preserved DNA is occluded within clusters of intergrown bone crystals that are resistant to disaggregation by the strong oxidant NaOCl. We obtained reproducible authentic sequences from both modern and ancient animal bones, including humans, from DNA extracts of crystal aggregates. The treatment with NaOCl also minimizes the possibility of modern DNA contamination. We thus demonstrate the presence of a privileged niche within fossil bone, which contains DNA in a better state of preservation than the DNA present in the total bone. This counterintuitive approach to extracting relatively well preserved DNA from bones significantly improves the chances of obtaining authentic ancient DNA sequences, especially from human bones. PMID:16162675
Tea and coffee consumption in relation to DNA methylation in four European cohorts.
Ek, Weronica E; Tobi, Elmar W; Ahsan, Muhammad; Lampa, Erik; Ponzi, Erica; Kyrtopoulos, Soterios A; Georgiadis, Panagiotis; Lumey, L H; Heijmans, Bastiaan T; Botsivali, Maria; Bergdahl, Ingvar A; Karlsson, Torgny; Rask-Andersen, Mathias; Palli, Domenico; Ingelsson, Erik; Hedman, Åsa K; Nilsson, Lena M; Vineis, Paolo; Lind, Lars; Flanagan, James M; Johansson, Åsa
2017-08-15
Lifestyle factors, such as food choices and exposure to chemicals, can alter DNA methylation and lead to changes in gene activity. Two such exposures with pharmacologically active components are coffee and tea consumption. Both coffee and tea have been suggested to play an important role in modulating disease-risk in humans by suppressing tumour progression, decreasing inflammation and influencing estrogen metabolism. These mechanisms may be mediated by changes in DNA methylation. To investigate if DNA methylation in blood is associated with coffee and tea consumption, we performed a genome-wide DNA methylation study for coffee and tea consumption in four European cohorts (N = 3,096). DNA methylation was measured from whole blood at 421,695 CpG sites distributed throughout the genome and analysed in men and women both separately and together in each cohort. Meta-analyses of the results and additional regional-level analyses were performed. After adjusting for multiple testing, the meta-analysis revealed that two individual CpG-sites, mapping to DNAJC16 and TTC17, were differentially methylated in relation to tea consumption in women. No individual sites were associated with men or with the sex-combined analysis for tea or coffee. The regional analysis revealed that 28 regions were differentially methylated in relation to tea consumption in women. These regions contained genes known to interact with estradiol metabolism and cancer. No significant regions were found in the sex-combined and male-only analysis for either tea or coffee consumption. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
A novel chimeric prophage vB_LdeS-phiJB from commercial Lactobacillus delbrueckii subsp. bulgaricus.
Guo, Tingting; Zhang, Chenchen; Xin, Yongping; Xin, Min; Kong, Jian
2016-05-01
Prophage vB_LdeS-phiJB (phiJB) was induced by mitomycin C and UV radiation from the Lactobacillus delbrueckii subsp. bulgaricus SDMCC050201 isolated from a Chinese yoghurt sample. It has an isometric head and a non-contractile tail with 36,969 bp linear double-stranded DNA genome, which is classified into the group a of Lb. delbrueckii phages. The genome of phiJB is highly modular with functionally related genes clustered together. Unexpectedly, there is no similarity of its DNA replication module to any phages that have been reported, while it consists of open-reading frames homologous to the proteins of Lactobacillus strains. Comparative genomic analysis indicated that its late gene clusters, integration/lysogeny modules and DNA replication module derived from different evolutionary ancestors and integrated into a chimera. Our results revealed a novel chimeric phage of commercial Lb. delbrueckii and will broaden the knowledge of phage diversity in the dairy industry.
Pausing kinetics dominates strand-displacement polymerization by reverse transcriptase
Malik, Omri; Khamis, Hadeel; Rudnizky, Sergei; Marx, Ailie
2017-01-01
Abstract Reverse transcriptase (RT) catalyzes the conversion of the viral RNA into an integration-competent double-stranded DNA, with a variety of enzymatic activities that include the ability to displace a non-template strand concomitantly with polymerization. Here, using high-resolution optical tweezers to follow the activity of the murine leukemia Virus RT, we show that strand-displacement polymerization is frequently interrupted. Abundant pauses are modulated by the strength of the DNA duplex ∼8 bp ahead, indicating the existence of uncharacterized RT/DNA interactions, and correspond to backtracking of the enzyme, whose recovery is also modulated by the duplex strength. Dissociation and reinitiation events, which induce long periods of inactivity and are likely the rate-limiting step in the synthesis of the genome in vivo, are modulated by the template structure and the viral nucleocapsid protein. Our results emphasize the potential regulatory role of conserved structural motifs, and may provide useful information for the development of potent and specific inhibitors. PMID:28973474
Fidelity of DNA Replication in Normal and Malignant Human Breast Cells
1998-07-01
synthesome has been extensively demonstrated to carry out full length DNA replication in vitro, and to accurately depict the DNA replication process as it...occurs in the intact cell. By examining the fidelity of the DNA replication process carried out by the DNA synthesome from a number of breast cell types...we have demonstrated for the first time, that the cellular DNA replication machinery of malignant human breast cells is significantly more error-prone than that of non- malignant human breast cells.
Jain, Aklank; Bacolla, Albino; del Mundo, Imee M.; Zhao, Junhua; Wang, Guliang; Vasquez, Karen M.
2013-01-01
Sequences that have the capacity to adopt alternative (i.e. non-B) DNA structures in the human genome have been implicated in stimulating genomic instability. Previously, we found that a naturally occurring intra-molecular triplex (H-DNA) caused genetic instability in mammals largely in the form of DNA double-strand breaks. Thus, it is of interest to determine the mechanism(s) involved in processing H-DNA. Recently, we demonstrated that human DHX9 helicase preferentially unwinds inter-molecular triplex DNA in vitro. Herein, we used a mutation-reporter system containing H-DNA to examine the relevance of DHX9 activity on naturally occurring H-DNA structures in human cells. We found that H-DNA significantly increased mutagenesis in small-interfering siRNA-treated, DHX9-depleted cells, affecting mostly deletions. Moreover, DHX9 associated with H-DNA in the context of supercoiled plasmids. To further investigate the role of DHX9 in the recognition/processing of H-DNA, we performed binding assays in vitro and chromatin immunoprecipitation assays in U2OS cells. DHX9 recognized H-DNA, as evidenced by its binding to the H-DNA structure and enrichment at the H-DNA region compared with a control region in human cells. These composite data implicate DHX9 in processing H-DNA structures in vivo and support its role in the overall maintenance of genomic stability at sites of alternatively structured DNA. PMID:24049074
Jain, Aklank; Bacolla, Albino; Del Mundo, Imee M; Zhao, Junhua; Wang, Guliang; Vasquez, Karen M
2013-12-01
Sequences that have the capacity to adopt alternative (i.e. non-B) DNA structures in the human genome have been implicated in stimulating genomic instability. Previously, we found that a naturally occurring intra-molecular triplex (H-DNA) caused genetic instability in mammals largely in the form of DNA double-strand breaks. Thus, it is of interest to determine the mechanism(s) involved in processing H-DNA. Recently, we demonstrated that human DHX9 helicase preferentially unwinds inter-molecular triplex DNA in vitro. Herein, we used a mutation-reporter system containing H-DNA to examine the relevance of DHX9 activity on naturally occurring H-DNA structures in human cells. We found that H-DNA significantly increased mutagenesis in small-interfering siRNA-treated, DHX9-depleted cells, affecting mostly deletions. Moreover, DHX9 associated with H-DNA in the context of supercoiled plasmids. To further investigate the role of DHX9 in the recognition/processing of H-DNA, we performed binding assays in vitro and chromatin immunoprecipitation assays in U2OS cells. DHX9 recognized H-DNA, as evidenced by its binding to the H-DNA structure and enrichment at the H-DNA region compared with a control region in human cells. These composite data implicate DHX9 in processing H-DNA structures in vivo and support its role in the overall maintenance of genomic stability at sites of alternatively structured DNA.
DNA damage response in monozygotic twins discordant for smoking habits.
Marcon, Francesca; Carotti, Daniela; Andreoli, Cristina; Siniscalchi, Ester; Leopardi, Paola; Caiola, Stefania; Biffoni, Mauro; Zijno, Andrea; Medda, Emanuela; Nisticò, Lorenza; Rossi, Sabrina; Crebelli, Riccardo
2013-03-01
Previous studies in twins indicate that non-shared environment, beyond genetic factors, contributes substantially to individual variation in mutagen sensitivity; however, the role of specific causative factors (e.g. tobacco smoke, diet) was not elucidated. In this investigation, a population of 22 couples of monozygotic twins with discordant smoking habits was selected with the aim of evaluating the influence of tobacco smoke on individual response to DNA damage. The study design virtually eliminated the contribution of genetic heterogeneity to the intra-pair variation in DNA damage response, and thus any difference in the end-points investigated could directly be attributed to the non-shared environment experienced by co-twins, which included as main factor cigarette smoke exposure. Peripheral lymphocytes of study subjects were challenged ex vivo with γ-rays, and the induction, processing, fixation of DNA damage evaluated through multiple approaches. Folate status of study subjects was considered significant covariate since it is affected by smoking habits and can influence radiosensitivity. Similar responses were elicited by γ-rays in co-twins for all the end-points analysed, despite their discordant smoking habits. Folate status did not modify DNA damage response, even though a combined effect of smoking habits, low-plasma folic acid level, and ionising radiation was observed on apoptosis. A possible modulation of DNA damage response by duration and intensity of tobacco smoke exposure was suggested by Comet assay and micronucleus data, but the effect was quantitatively limited. Overall, the results obtained indicate that differences in smoking habits do not contribute to a large extent to inter-individual variability in the response to radiation-induced DNA damage observed in healthy human populations.
Koprowski, P; Fikus, M U; Dzierzbicki, P; Mieczkowski, P; Lazowska, J; Ciesla, Z
2003-08-01
We reported previously that the product of DIN7, a DNA damage-inducible gene of Saccharomyces cerevisiae, belongs to the XPG family of proteins, which are involved in DNA repair and replication. This family includes the S. cerevisiae protein Rad2p and its human homolog XPGC, Rad27p and its mammalian homolog FEN-1, and Exonuclease I (Exo I). Interestingly, Din7p is the only member of the XPG family which specifically functions in mitochondria. We reported previously that overexpression of DIN7 results in a mitochondrial mutator phenotype. In the present study we wished to test the hypothesis that this phenotype is dependent on the nuclease activity of Din7p. For this purpose, we constructed two alleles, din7-D78A and din7-D173A, which encode proteins in which highly conserved aspartates important for the nuclease activity of the XPG proteins have been replaced by alanines. Here, we report that overexpression of the mutant alleles, in contrast to DIN7, fails to increase the frequency of mitochondrial petite mutants or erythromycin-resistant (Er) mutants. Also, overproduction of din7-D78Ap does not result in destabilization of poly GT tracts in mitochondrial DNA (mtDNA), the phenotype observed in cells that overexpress Din7p. We also show that petite mutants induced by enhanced synthesis of wild-type Din7p exhibit gross rearrangements of mtDNA, and that this correlates with enhanced recombination within the mitochondrial cyt b gene. These results suggest that the stability of the mitochondrial genome of S. cerevisiae is modulated by the level of the nuclease Din7p.
Chitose, Shun-ichi; Sakazaki, T; Ono, T; Kurita, T; Mihashi, H; Nakashima, T
2010-06-01
This study aimed to clarify the local immune status in the larynx in the presence of infection or carcinogenesis associated with human papilloma virus. Cytological samples (for human papilloma virus detection) and laryngeal secretions (for immunoglobulin assessment) were obtained from 31 patients with laryngeal disease, during microscopic laryngeal surgery. On histological examination, 12 patients had squamous cell carcinoma, four had laryngeal papilloma and 15 had other benign laryngeal disease. Cytological samples were tested for human papilloma virus DNA using the Hybrid Capture 2 assay. High risk human papilloma virus DNA was detected in 25 per cent of patients (three of 12) with laryngeal cancer. Low risk human papilloma virus DNA was detected only in three laryngeal papilloma patients. The mean laryngeal secretion concentrations of immunoglobulins M, G and A and secretory immunoglobulin A in human papilloma virus DNA positive patients were more than twice those in human papilloma virus DNA negative patients. A statistically significant difference was observed between the secretory immunoglobulin A concentrations in the two groups. Patients with laryngeal cancer had higher laryngeal secretion concentrations of each immunoglobulin type, compared with patients with benign laryngeal disease. The study assessed the mean laryngeal secretion concentrations of each immunoglobulin type in the 12 laryngeal cancer patients, comparing human papilloma virus DNA positive patients (n = 3) and human papilloma virus DNA negative patients (n = 9); the mean concentrations of immunoglobulins M, G and A and secretory immunoglobulin A tended to be greater in human papilloma virus DNA positive cancer patients, compared with human papilloma virus DNA negative cancer patients. These results suggest that the local laryngeal immune response is activated by infection or carcinogenesis due to human papilloma virus. The findings strongly suggest that secretory IgA has inhibitory activity against infection or carcinogenesis associated with human papilloma virus in the larynx.
Sembongi, Hiroshi; Di Re, Miriam; Bokori-Brown, Monika; Holt, Ian J
2007-10-01
Rearrangements of mitochondrial DNA (mtDNA) are a well-recognized cause of human disease; deletions are more frequent, but duplications are more readily transmitted to offspring. In theory, partial duplications of mtDNA can be resolved to partially deleted and wild-type (WT) molecules, via homologous recombination. Therefore, the yeast CCE1 gene, encoding a Holliday junction resolvase, was introduced into cells carrying partially duplicated or partially triplicated mtDNA. Some cell lines carrying the CCE1 gene had substantial amounts of WT mtDNA suggesting that the enzyme can mediate intramolecular recombination in human mitochondria. However, high levels of expression of CCE1 frequently led to mtDNA loss, and so it is necessary to strictly regulate the expression of CCE1 in human cells to ensure the selection and maintenance of WT mtDNA.
hPDI: a database of experimental human protein-DNA interactions.
Xie, Zhi; Hu, Shaohui; Blackshaw, Seth; Zhu, Heng; Qian, Jiang
2010-01-15
The human protein DNA Interactome (hPDI) database holds experimental protein-DNA interaction data for humans identified by protein microarray assays. The unique characteristics of hPDI are that it contains consensus DNA-binding sequences not only for nearly 500 human transcription factors but also for >500 unconventional DNA-binding proteins, which are completely uncharacterized previously. Users can browse, search and download a subset or the entire data via a web interface. This database is freely accessible for any academic purposes. http://bioinfo.wilmer.jhu.edu/PDI/.
Role of Choline in the Modulation of Degenerative Processes: In Vivo and In Vitro Studies.
Merinas-Amo, Tania; Tasset-Cuevas, Inmaculada; Díaz-Carretero, Antonio M; Alonso-Moraga, Ángeles; Calahorro, Fernando
2017-03-01
The purpose of the present study was to examine the nutraceutical potential of choline as an added value to its well-known brain nutrient role. Several toxicity, antitoxicity, genotoxicity, antigenotoxicity, and longevity endpoints were checked in the somatic mutation and recombination test in in vivo Drosophila animal model. Cytotoxicity in human leukemia-60 cell line (HL-60) promyelocytic and NIH3T3 mouse fibroblast cells, proapoptotic DNA fragmentation, comet assay, methylation status, and macroautophagy (MA) activity were tested in in vitro assays. Choline is not only safe but it is also able to protect against the DNA damage caused by an oxidative genotoxin. Moreover, it improves the life extension in the animal model. The in vitro results show that it is able to exhibit genetic damage against leukemia HL-60 cells. Single-strand breaks in DNA are observed at the molecular level in treatments with choline, although only a significant hypermethylation on the long interspersed elements-1 and a hypomethylation on the satellite-alpha DNA repetitive DNA sequences of HL-60 cells at the lowest concentration (0.447 mM) were observed. Besides, choline decreased MA at the lower assayed concentration and the MA response to topoisomerase inhibitor (etoposide) is maintained in the presence of treatment with 0.22 mM choline. Taking into account the hopeful results obtained in the in vivo and in vitro assays, choline could be proposed as a substance with an important nutraceutical value for different purposes.
Mechanism of Mitochondrial Transcription Factor A Attenuation of CpG-Induced Antibody Production
Saifee, Jessica F.; Torres, Raul M.; Janoff, Edward N.
2016-01-01
Mitochondrial transcription factor A (TFAM) had previously been shown to act as a damage associated molecular pattern with the ability to enhance CpG-A phosphorothioate oligodeoxynucleotide (ODN)-mediated stimulation of IFNα production from human plasmacytoid dendritic cells. Examination of the mechanism by which TFAM might influence CpG ODN mediated innate immune responses revealed that TFAM binds directly, tightly and selectively to the structurally related CpG-A, -B, and -C ODN. TFAM also modulated the ability of the CpG-B or -C to stimulate the production of antibodies from human B cells. TFAM showed a dose-dependent modulation of CpG-B, and -C -induced antibody production from human B cells in vitro, with enhancement of high dose and inhibition of low doses of CpG stimulation. This effect was linked to the ability of TFAM to directly inhibit the binding of CpG ODNs to B cells, in a manner consistent with the relative binding affinities of TFAM for the ODNs. These data suggest that TFAM alters the free concentration of the CpG available to stimulate B cells by sequestering this ODN in a TFAM-CpG complex. Thus, TFAM has the potential to decrease the pathogenic consequences of exposure to natural CpG-like hypomethylated DNA in vivo, as well as such as that found in traumatic injury, infection, autoimmune disease and during pregnancy. PMID:27280778
Rohban, Rokhsareh; Reinisch, Andreas; Etchart, Nathalie; Schallmoser, Katharina; Hofmann, Nicole A.; Szoke, Krisztina; Brinchmann, Jan E.; Rad, Ehsan Bonyadi; Rohde, Eva; Strunk, Dirk
2013-01-01
Therapeutic neo-vasculogenesis in vivo can be achieved by the co-transplantation of human endothelial colony-forming progenitor cells (ECFCs) with mesenchymal stem/progenitor cells (MSPCs). The underlying mechanism is not completely understood thus hampering the development of novel stem cell therapies. We hypothesized that proteomic profiling could be used to retrieve the in vivo signaling signature during the initial phase of human neo-vasculogenesis. ECFCs and MSPCs were therefore either transplanted alone or co-transplanted subcutaneously into immune deficient mice. Early cell signaling, occurring within the first 24 hours in vivo, was analyzed using antibody microarray proteomic profiling. Vessel formation and persistence were verified in parallel transplants for up to 24 weeks. Proteomic analysis revealed significant alteration of regulatory components including caspases, calcium/calmodulin-dependent protein kinase, DNA protein kinase, human ErbB2 receptor-tyrosine kinase as well as mitogen-activated protein kinases. Caspase-4 was selected from array results as one therapeutic candidate for targeting vascular network formation in vitro as well as modulating therapeutic vasculogenesis in vivo. As a proof-of-principle, caspase-4 and general caspase-blocking led to diminished endothelial network formation in vitro and significantly decreased vasculogenesis in vivo. Proteomic profiling ex vivo thus unraveled a signaling signature which can be used for target selection to modulate neo-vasculogenesis in vivo. PMID:23826172
Duval, Romain; Xu, Ximing; Bui, Linh-Chi; Mathieu, Cécile; Petit, Emile; Cariou, Kevin; Dodd, Robert H; Dupret, Jean-Marie; Rodrigues-Lima, Fernando
2016-02-23
Aromatic amines (AAs) are chemicals of industrial, pharmacological and environmental relevance. Certain AAs, such as 4-aminobiphenyl (4-ABP), are human carcinogens that require enzymatic metabolic activation to reactive chemicals to form genotoxic DNA adducts. Arylamine N-acetyltransferases (NAT) are xenobiotic metabolizing enzymes (XME) that play a major role in this carcinogenic bioactivation process. Isothiocyanates (ITCs), including benzyl-ITC (BITC) and phenethyl-ITC (PEITC), are phytochemicals known to have chemopreventive activity against several aromatic carcinogens. In particular, ITCs have been shown to modify the bioactivation and subsequent mutagenicity of carcinogenic AA chemicals such as 4-ABP. However, the molecular and biochemical mechanisms by which these phytochemicals may modulate AA carcinogens bioactivation and AA-DNA damage remains poorly understood. This manuscript provides evidence indicating that ITCs can decrease the metabolic activation of carcinogenic AAs via the irreversible inhibition of NAT enzymes and subsequent alteration of the acetylation of AAs. We demonstrate that BITC and PEITC react with NAT1 and inhibit readily its acetyltransferase activity (k(i) = 200 M(-1).s(-1) and 66 M(-1).s(-1) for BITC and PEITC, respectively). Chemical labeling, docking approaches and substrate protection assays indicated that inhibition of the acetylation of AAs by NAT1 was due to the chemical modification of the enzyme active site cysteine. Moreover, analyses of AAs acetylation and DNA adducts in cells showed that BITC was able to modulate the endogenous acetylation and bioactivation of 4-ABP. In conclusion, we show that direct inhibition of NAT enzymes may be an important mechanism by which ITCs exert their chemopreventive activity towards AA chemicals.
BAP1 regulates IP3R3-mediated Ca2+ flux to mitochondria suppressing cell transformation
Bononi, Angela; Giorgi, Carlotta; Patergnani, Simone; Larson, David; Verbruggen, Kaitlyn; Tanji, Mika; Pellegrini, Laura; Signorato, Valentina; Olivetto, Federica; Pastorino, Sandra; Nasu, Masaki; Napolitano, Andrea; Gaudino, Giovanni; Morris, Paul; Sakamoto, Greg; Ferris, Laura K.; Danese, Alberto; Raimondi, Andrea; Tacchetti, Carlo; Kuchay, Shafi; Pass, Harvey I.; Affar, El Bachir; Yang, Haining; Pinton, Paolo; Carbone, Michele
2017-01-01
BRCA1-associated protein 1 (BAP1) is a potent tumor suppressor gene that modulates environmental carcinogenesis1-3. All carriers of inherited heterozygous germline BAP1 inactivating mutations (BAP1+/-) developed one and often several BAP1-/- malignancies in their lifetime4, mostly malignant mesothelioma (MM), uveal melanoma (UVM)2,5, etc6-10. Moreover, BAP1 acquired biallelic mutations are frequent in human cancers8,11-14. BAP1 tumor suppressor activity has been attributed to its nuclear localization where BAP1 helps maintaining genome integrity15-17. The possible activity of BAP1 in the cytoplasm was unknown. Cells with reduced levels of BAP1 exhibit chromosomal abnormalities and decreased DNA repair by homologous recombination18, indicating that BAP1 dosage is critical. Cells with extensive DNA damage should die and not grow into malignancies. We discovered that BAP1 localizes at the endoplasmic reticulum (ER). Here BAP1 binds, deubiquitylates and stabilizes type-3 inositol-1,4,5-trisphosphate-receptor (IP3R3), modulating calcium (Ca2+) release from the ER into the cytosol and mitochondria, promoting apoptosis. Reduced levels of BAP1 in BAP1+/- carriers caused reduction of both IP3R3 levels and Ca2+ flux, preventing BAP1+/- cells that had accumulated DNA damage from executing apoptosis. A higher fraction of cells exposed to either ionizing or ultraviolet radiation, or to asbestos, survived genotoxic stress resulting in a higher rate of cellular transformation. We propose that the high incidence of cancers in BAP1+/- carriers results from the combined reduced nuclear and cytoplasmic BAP1 activities. Our data provide a mechanistic rationale for the powerful ability of BAP1 to regulate gene-environment interaction. PMID:28614305
Furlong, Suzanne J; Ridgway, Neale D; Hoskin, David W
2008-03-01
Bovine lactoferricin (LfcinB) is a cationic antimicrobial peptide that selectively induces apoptosis in several different types of human cancer cells. However, the potential use of LfcinB as an anticancer agent is presently limited by the need for relatively high concentrations of the peptide to trigger apoptosis. Ceramide is a membrane sphingolipid that is believed to function as a second messenger during apoptosis. In this study, we investigated the role of ceramide in LfcinB-induced apoptosis in CCRF-CEM and Jurkat T-leukemia cell lines. Exposure to LfcinB caused nuclear condensation and fragmentation, poly(ADP-ribose) polymerase (PARP) cleavage, and DNA fragmentation in CCRF-CEM and Jurkat T-cell acute lymphoblastic leukemia cell lines. Treatment with C6 ceramide, a cell-permeable, short-chain ceramide analog, also induced apoptotic nuclear morphology, PARP cleavage, and DNA fragmentation in T-leukemia cells. Although LfcinB treatment did not cause ceramide to accumulate in CCRF-CEM or Jurkat cells, the addition of C6 ceramide to LfcinB-treated T-leukemia cells resulted in increased DNA fragmentation. Furthermore, modulation of cellular ceramide metabolism either by inhibiting ceramidases with D-erythro-2-(N-myristoylamino)-1-phenyl-1-propanol or N-oleoylethanolamine, or by blocking glucosylceramide synthase activity with 1-phenyl-2-palmitoylamino-3-morpholino-1-propanol, enhanced the ability of LfcinB to trigger apoptosis in both Jurkat and CCRF-CEM cells. In addition, LfcinB-induced apoptosis of T-leukemia cells was enhanced in the presence of the antiestrogen tamoxifen, which has multiple effects on cancer cells, including inhibition of glucosylceramide synthase activity. We conclude that manipulation of cellular ceramide levels in combination with LfcinB therapy warrants further investigation as a novel strategy for the treatment of T cell-derived leukemias.
USDA-ARS?s Scientific Manuscript database
As a sequel of our investigations on the impact of epigenome in inducing fetal alcohol spectrum disorder (FASD) phenotypes in Japanese rice fish, we investigated on several DNA methylation machinery genes including DNA methyl transferase 3ba (dnmt3ba) and methyl binding proteins (MBPs), namely, mbdl...
USDA-ARS?s Scientific Manuscript database
We aimed to investigate the impact of the epigenome in inducting fetal alcohol spectrum disorder (FASD) phenotypes in Japanese rice fish embryogenesis. One of the significant events in epigenome is DNA methylation which is catalyzed by DNA methyl transferase (DNMT) enzymes. We analyzed DNMT enzyme m...
Zhang, Jing; Kan, Shu; Huang, Brian; Hao, Zhenyue; Mak, Tak W; Zhong, Qing
2011-12-15
Histone deacetylases (HDACs) are major epigenetic modulators involved in a broad spectrum of human diseases including cancers. Administration of HDAC inhibitors (HDACis) leads to growth inhibition, differentiation, and apoptosis of cancer cells. Understanding the regulatory mechanism of HDACs is imperative to harness the therapeutic potentials of HDACis. Here we show that HDACi- and DNA damage-induced apoptosis are severely compromised in mouse embryonic fibroblasts lacking a HECT domain ubiquitin ligase, Mule (Mcl-1 ubiquitin ligase E3). Mule specifically targets HDAC2 for ubiquitination and degradation. Accumulation of HDAC2 in Mule-deficient cells leads to compromised p53 acetylation as well as crippled p53 transcriptional activation, accumulation, and apoptotic response upon DNA damage and Nutlin-3 treatments. These defects in Mule-null cells can be partially reversed by HDACis and fully rescued by lowering the elevated HDAC2 in Mule-null cells to the normal levels as in wild-type cells. Taken together, our results reveal a critical regulatory mechanism of HDAC2 by Mule and suggest this pathway determines the cellular response to HDACis and DNA damage. © 2011 by Cold Spring Harbor Laboratory Press
Epigenomics in cancer management
Costa, Fabricio F
2010-01-01
The identification of all epigenetic modifications implicated in gene expression is the next step for a better understanding of human biology in both normal and pathological states. This field is referred to as epigenomics, and it is defined as epigenetic changes (ie, DNA methylation, histone modifications and regulation by noncoding RNAs such as microRNAs) on a genomic scale rather than a single gene. Epigenetics modulate the structure of the chromatin, thereby affecting the transcription of genes in the genome. Different studies have already identified changes in epigenetic modifications in a few genes in specific pathways in cancers. Based on these epigenetic changes, drugs against different types of tumors were developed, which mainly target epimutations in the genome. Examples include DNA methylation inhibitors, histone modification inhibitors, and small molecules that target chromatin-remodeling proteins. However, these drugs are not specific, and side effects are a major problem; therefore, new DNA sequencing technologies combined with epigenomic tools have the potential to identify novel biomarkers and better molecular targets to treat cancers. The purpose of this review is to discuss current and emerging epigenomic tools and to address how these new technologies may impact the future of cancer management. PMID:21188117
Bacteria-Human Somatic Cell Lateral Gene Transfer Is Enriched in Cancer Samples
Robinson, Kelly M.; White, James Robert; Ganesan, Ashwinkumar; Nourbakhsh, Syrus; Dunning Hotopp, Julie C.
2013-01-01
There are 10× more bacterial cells in our bodies from the microbiome than human cells. Viral DNA is known to integrate in the human genome, but the integration of bacterial DNA has not been described. Using publicly available sequence data from the human genome project, the 1000 Genomes Project, and The Cancer Genome Atlas (TCGA), we examined bacterial DNA integration into the human somatic genome. Here we present evidence that bacterial DNA integrates into the human somatic genome through an RNA intermediate, and that such integrations are detected more frequently in (a) tumors than normal samples, (b) RNA than DNA samples, and (c) the mitochondrial genome than the nuclear genome. Hundreds of thousands of paired reads support random integration of Acinetobacter-like DNA in the human mitochondrial genome in acute myeloid leukemia samples. Numerous read pairs across multiple stomach adenocarcinoma samples support specific integration of Pseudomonas-like DNA in the 5′-UTR and 3′-UTR of four proto-oncogenes that are up-regulated in their transcription, consistent with conversion to an oncogene. These data support our hypothesis that bacterial integrations occur in the human somatic genome and may play a role in carcinogenesis. We anticipate that the application of our approach to additional cancer genome projects will lead to the more frequent detection of bacterial DNA integrations in tumors that are in close proximity to the human microbiome. PMID:23840181
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singh, Satyender; Kumar, Vivek; Vashisht, Kapil
2011-11-15
Organophosphate pesticides (OPs) are primarily metabolized by several xenobiotic metabolizing enzymes (XMEs). Very few studies have explored genetic polymorphisms of XMEs and their association with DNA damage in pesticide-exposed workers. The present study was designed to determine the role of genetic polymorphisms of CYP1A1, CYP3A5, CYP2C9, CYP2D6, and PON1 in the modulation of DNA damage in workers occupationally exposed to OPs. We examined 284 subjects including 150 workers occupationally exposed to OPs and 134 normal healthy controls. The DNA damage was evaluated using the alkaline comet assay and genotyping was done using PCR-RFLP. The results revealed that the PONase activitymore » toward paraoxonase and AChE activity was found significantly lowered in workers as compared to control subjects (p < 0.001). Workers showed significantly higher DNA damage compared to control subjects (14.37 {+-} 2.15 vs. 6.24 {+-} 1.37 tail% DNA, p < 0.001). Further, the workers with CYP2D6*3 PM and PON1 (QQ and MM) genotypes were found to have significantly higher DNA damage when compared to other genotypes (p < 0.05). In addition, significant increase in DNA damage was also observed in workers with concomitant presence of certain CYP2D6 and PON1 (Q192R and L55M) genotypes which need further extensive studies. In conclusion, the results indicate that the PON1 and CYP2D6 genotypes can modulate DNA damage elicited by some OPs possibly through gene-environment interactions. -- Highlights: Black-Right-Pointing-Pointer Role of CYP1A1, CYP3A5, CYP2C, CYP2D6 and PON1 genotypes on DNA damage. Black-Right-Pointing-Pointer Workers exposed to some OPs demonstrated increased DNA damage. Black-Right-Pointing-Pointer CYP2D6 *3 PM and PON1 (Q192R and L55M) genotypes are associated with DNA damage. Black-Right-Pointing-Pointer Concomitant presence of certain CYP2D6 and PON1 genotypes can increase DNA damage.« less
Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko
2015-01-01
To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources.
Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko
2015-01-01
To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources. PMID:26308446
Dehydrated human amnion/chorion membrane regulates stem cell activity in vitro
Massee, Michelle; Chinn, Kathryn; Lei, Jennifer; Lim, Jeremy J.; Young, Conan S.
2015-01-01
Abstract Human‐derived placental tissues have been shown in randomized clinical trials to be effective for healing chronic wounds, and have also demonstrated the ability to recruit stem cells to the wound site in vitro and in vivo. In this study, PURION® Processed dehydrated human amnion/chorion membrane allografts (dHACM, EpiFix®, MiMedx Group, Marietta, GA) were evaluated for their ability to alter stem cell activity in vitro. Human bone marrow mesenchymal stem cells (BM‐MSCs), adipose derived stem cells (ADSCs), and hematopoietic stem cells (HSCs) were treated with soluble extracts of dHACM tissue, and were evaluated for cellular proliferation, migration, and cytokine secretion. Stem cells were analyzed for cell number by DNA assay after 24 h, closure of an acellular zone using microscopy over 3 days, and soluble cytokine production in the medium of treated stem cells was analyzed after 3 days using a multiplex ELISA array. Treatment with soluble extracts of dHACM tissue stimulated BM‐MSCs, ADSCs, and HSCs to proliferate with a significant increase in cell number after 24 h. dHACM treatment accelerated closure of an acellular zone by ADSCs and BM‐MSCs after 3 days, compared to basal medium. BM‐MSCs, ADSCs, and HSCs also modulated endogenous production of a number of various soluble signals, including regulators of inflammation, mitogenesis, and wound healing. dHACM treatment promoted increased proliferation and migration of ADSCs, BM‐MSCs, and HSCs, along with modulation of secreted proteins from those cells. Therefore, dHACM may impact wound healing by amplifying host stem cell populations and modulating their responses in treated wound tissues. © 2015 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 104B: 1495–1503, 2016. PMID:26175122
Distribution of DNA in human Sertoli cell nucleoli.
Mosgöller, W; Schöfer, C; Derenzini, M; Steiner, M; Maier, U; Wachtler, F
1993-10-01
For better understanding of nucleolar architecture, different techniques have been used to localize DNA within the dense fibrillar component (DF) or within the fibrillar centers (FC) by electron microscopy (EM). Since it still remains controversial which components contain DNA, we investigated the distribution of DNA in human Sertoli cells using various approaches. In situ hybridization (ISH) with human total genomic DNA as probe and the use of anti-DNA antibody were followed by immunogold detection. This allowed statistical evaluation of the signal density over individual components. The Feulgen-like osmium-ammine (OA) technique for the selective visualization of DNA was also applied. The anti-DNA antibodies detected DNA in mitochondria, in chromatin, and in the DF of the nucleolus. ISH using human total genomic DNA showed similar labeling patterns. The OA technique revealed DNA filaments in the FC and focal agglomerates of decondensed DNA within the DF. We conclude that (a) EM staining techniques that utilize colloidal gold appear to be less sensitive for DNA detection than the OA method, (b) the DF consists of different domains with different molecular composition, and (c) decondensed DNA is not necessarily confined to one particular nucleolar component.
Benleulmi, Mohamed S; Matysiak, Julien; Robert, Xavier; Miskey, Csaba; Mauro, Eric; Lapaillerie, Delphine; Lesbats, Paul; Chaignepain, Stéphane; Henriquez, Daniel R; Calmels, Christina; Oladosu, Oyindamola; Thierry, Eloïse; Leon, Oscar; Lavigne, Marc; Andreola, Marie-Line; Delelis, Olivier; Ivics, Zoltán; Ruff, Marc; Gouet, Patrice; Parissi, Vincent
2017-11-28
Stable insertion of the retroviral DNA genome into host chromatin requires the functional association between the intasome (integrase·viral DNA complex) and the nucleosome. The data from the literature suggest that direct protein-protein contacts between integrase and histones may be involved in anchoring the intasome to the nucleosome. Since histone tails are candidates for interactions with the incoming intasomes we have investigated whether they could participate in modulating the nucleosomal integration process. We show here that histone tails are required for an optimal association between HIV-1 integrase (IN) and the nucleosome for efficient integration. We also demonstrate direct interactions between IN and the amino-terminal tail of human histone H4 in vitro. Structure/function studies enabled us to identify amino acids in the carboxy-terminal domain of IN that are important for this interaction. Analysis of the nucleosome-binding properties of catalytically active mutated INs confirmed that their ability to engage the nucleosome for integration in vitro was affected. Pseudovirus particles bearing mutations that affect the IN/H4 association also showed impaired replication capacity due to altered integration and re-targeting of their insertion sites toward dynamic regions of the chromatin with lower nucleosome occupancy. Collectively, our data support a functional association between HIV-1 IN and histone tails that promotes anchoring of the intasome to nucleosomes and optimal integration into chromatin.
The future of human DNA vaccines.
Li, Lei; Saade, Fadi; Petrovsky, Nikolai
2012-12-31
DNA vaccines have evolved greatly over the last 20 years since their invention, but have yet to become a competitive alternative to conventional protein or carbohydrate based human vaccines. Whilst safety concerns were an initial barrier, the Achilles heel of DNA vaccines remains their poor immunogenicity when compared to protein vaccines. A wide variety of strategies have been developed to optimize DNA vaccine immunogenicity, including codon optimization, genetic adjuvants, electroporation and sophisticated prime-boost regimens, with each of these methods having its advantages and limitations. Whilst each of these methods has contributed to incremental improvements in DNA vaccine efficacy, more is still needed if human DNA vaccines are to succeed commercially. This review foresees a final breakthrough in human DNA vaccines will come from application of the latest cutting-edge technologies, including "epigenetics" and "omics" approaches, alongside traditional techniques to improve immunogenicity such as adjuvants and electroporation, thereby overcoming the current limitations of DNA vaccines in humans. Copyright © 2012 Elsevier B.V. All rights reserved.
Helix–hairpin–helix motifs confer salt resistance and processivity on chimeric DNA polymerases
Pavlov, Andrey R.; Belova, Galina I.; Kozyavkin, Sergei A.; Slesarev, Alexei I.
2002-01-01
Helix–hairpin–helix (HhH) is a widespread motif involved in sequence-nonspecific DNA binding. The majority of HhH motifs function as DNA-binding modules with typical occurrence of one HhH motif or one or two (HhH)2 domains in proteins. We recently identified 24 HhH motifs in DNA topoisomerase V (Topo V). Although these motifs are dispensable for the topoisomerase activity of Topo V, their removal narrows the salt concentration range for topoisomerase activity tenfold. Here, we demonstrate the utility of Topo V's HhH motifs for modulating DNA-binding properties of the Stoffel fragment of TaqDNA polymerase and Pfu DNA polymerase. Different HhH cassettes fused with either NH2 terminus or COOH terminus of DNA polymerases broaden the salt concentration range of the polymerase activity significantly (up to 0.5 M NaCl or 1.8 M potassium glutamate). We found that anions play a major role in the inhibition of DNA polymerase activity. The resistance of initial extension rates and the processivity of chimeric polymerases to salts depend on the structure of added HhH motifs. Regardless of the type of the construct, the thermal stability of chimeric Taq polymerases increases under the optimal ionic conditions, as compared with that of TaqDNA polymerase or its Stoffel fragment. Our approach to raise the salt tolerance, processivity, and thermostability of Taq and Pfu DNA polymerases may be applied to all pol1- and polB-type polymerases, as well as to other DNA processing enzymes. PMID:12368475