Sample records for modulates differentiation-dependent viral

  1. The full-length E1-circumflexE4 protein of human papillomavirus type 18 modulates differentiation-dependent viral DNA amplification and late gene expression

    SciTech Connect

    Wilson, Regina; Ryan, Gordon B.; Knight, Gillian L.; Laimins, Laimonis A.; Roberts, Sally . E-mail:


    Activation of the productive phase of the human papillomavirus (HPV) life cycle in differentiated keratinocytes is coincident with high-level expression of E1-circumflexE4 protein. To determine the role of E1-circumflexE4 in the HPV replication cycle, we constructed HPV18 mutant genomes in which expression of the full-length E1-circumflexE4 protein was abrogated. Undifferentiated keratinocytes containing mutant genomes showed enhanced proliferation when compared to cells containing wildtype genomes, but there were no differences in maintenance of viral episomes. Following differentiation, cells with mutant genomes exhibited reduced levels of viral DNA amplification and late gene expression, compared to wildtype genome-containing cells. This indicates that HPV18 E1-circumflexE4 plays an important role in regulating HPV late functions, and it may also function in the early phase of the replication cycle. Our finding that full-length HPV18 E1-circumflexE4 protein plays a significant role in promoting viral genome amplification concurs with a similar report with HPV31, but is in contrast to an HPV11 study where viral DNA amplification was not dependent on full-length E1-circumflexE4 expression, and to HPV16 where only C-terminal truncations in E1-circumflexE4 abrogated vegetative genome replication. This suggests that type-specific differences exist between various E1-circumflexE4 proteins.

  2. Translation of Pur-α is targeted by cellular miRNAs to modulate the differentiation-dependent susceptibility of monocytes to HIV-1 infection.


    Shen, Chan-Juan; Jia, Yan-Hui; Tian, Ren-Rong; Ding, Ming; Zhang, Chiyu; Wang, Jian-Hua


    The postentry restriction of HIV-1 replication in monocytes can be relieved when they differentiate to dendritic cells (DCs) or macrophages. Multiple mechanisms have been proposed to interpret the differentiation-dependent susceptibility of monocytes to HIV-1 infection, and the absence of host-cell-encoded essential factors for HIV-1 completing the life cycle may provide an explanation. We have analyzed the gene expression profile in monocytes by mRNA microarray and compared it with that of differentiated DCs. We demonstrated that purine-rich element binding protein α (Pur-α), a host-cell-encoded ubiquitous, sequence-specific DNA- and RNA-binding protein, showed inadequate expression in monocytes, and the translation of Pur-α mRNA was repressed by cell-expressed microRNA (miRNA). These Pur-α-targeted miRNAs modulated the differentiation-dependent susceptibility of monocytes/DCs to HIV-1 infection, because rescue of Pur-α expression by transfection of miRNA inhibitors relieved the restriction of HIV-1 infection in monocytes, and ectopic input of miRNA mimics significantly reduced HIV-1 infection of monocyte-derived DCs (MDDCs). Collectively, our data emphasized that inadequate host factors contribute to HIV-1 restriction in monocytes, and cellular miRNAs modulate differentiation-dependent susceptibility of host cells to HIV-1 infection. Elaboration of HIV-1 restriction in host cells facilitates our understanding of viral pathogenesis and the search for a new antiviral strategy.

  3. Cyclophilins as Modulators of Viral Replication

    PubMed Central

    Frausto, Stephen D.; Lee, Emily; Tang, Hengli


    Cyclophilins are peptidyl‐prolyl cis/trans isomerases important in the proper folding of certain proteins. Mounting evidence supports varied roles of cyclophilins, either positive or negative, in the life cycles of diverse viruses, but the nature and mechanisms of these roles are yet to be defined. The potential for cyclophilins to serve as a drug target for antiviral therapy is evidenced by the success of non-immunosuppressive cyclophilin inhibitors (CPIs), including Alisporivir, in clinical trials targeting hepatitis C virus infection. In addition, as cyclophilins are implicated in the predisposition to, or severity of, various diseases, the ability to specifically and effectively modulate their function will prove increasingly useful for disease intervention. In this review, we will summarize the evidence of cyclophilins as key mediators of viral infection and prospective drug targets. PMID:23852270

  4. Cyclophilins as modulators of viral replication.


    Frausto, Stephen D; Lee, Emily; Tang, Hengli


    Cyclophilins are peptidyl-prolyl cis/trans isomerases important in the proper folding of certain proteins. Mounting evidence supports varied roles of cyclophilins, either positive or negative, in the life cycles of diverse viruses, but the nature and mechanisms of these roles are yet to be defined. The potential for cyclophilins to serve as a drug target for antiviral therapy is evidenced by the success of non-immunosuppressive cyclophilin inhibitors (CPIs), including Alisporivir, in clinical trials targeting hepatitis C virus infection. In addition, as cyclophilins are implicated in the predisposition to, or severity of, various diseases, the ability to specifically and effectively modulate their function will prove increasingly useful for disease intervention. In this review, we will summarize the evidence of cyclophilins as key mediators of viral infection and prospective drug targets.

  5. Inducible heat shock protein 70 enhances HPV31 viral genome replication and virion production during the differentiation-dependent life cycle in human keratinocytes.


    Song, Hebin; Moseley, Pope L; Lowe, Stephanie L; Ozbun, Michelle A


    Increasing data indicate heat shock proteins (HSPs) including inducible HSP70 (HSP70i) are involved in the replicative cycles of various viruses including adenoviruses (Ads), polyomaviruses (PyVs), and some RNA viruses. Cell-free system studies implicate HSP70i in human papillomavirus type 11 (HPV11) genome replication with E1 and E2 proteins, and there is evidence that HSP70 is involved in capsid assembly and disassembly for PyVs and HPVs. HSP70 expression is increased in HPV16 E6/E7 gene transduced human primary keratinocytes, and frequently detected in early stage uterine cervical cancer at levels in conjunction with lesion severity. In this study we carry out analyses in the natural host epithelial tissues to assess the role of inducible HSP70 (HSP70i) in the HPV infectious life cycle. For these studies we used the organotypic (raft) culture system to recapitulate the full viral life cycle of the high-risk HPV31. Upon heat shock of HPV31-infected organotypic tissues, we find high and sustained expression of HSP70i coincident with enhanced HPV genome replication and virion production. Whereas there is no clear effect on L1 expression levels, we find HSP70i and L1 interact and HSP70i colocalizes with and enhances the nuclear localization of L1 in differentiated cells. Ad-mediated gene transfer was used to study the effects of HSP70i in naturally HPV-infected differentiating tissues and showed results similar to those in heat shocked rafts. These results indicate that increased HSP70i augments late activities in the viral life cycle. We conclude that HSP70i contributes directly to HPV replicative viral activities and the production of infectious virions.

  6. Post-Transcriptional Regulation of KLF4 by High-Risk Human Papillomaviruses Is Necessary for the Differentiation-Dependent Viral Life Cycle.


    Gunasekharan, Vignesh Kumar; Li, Yan; Andrade, Jorge; Laimins, Laimonis A


    Human papillomaviruses (HPVs) are epithelial tropic viruses that link their productive life cycles to the differentiation of infected host keratinocytes. A subset of the over 200 HPV types, referred to as high-risk, are the causative agents of most anogenital malignancies. HPVs infect cells in the basal layer, but restrict viral genome amplification, late gene expression, and capsid assembly to highly differentiated cells that are active in the cell cycle. In this study, we demonstrate that HPV proteins regulate the expression and activities of a critical cellular transcription factor, KLF4, through post-transcriptional and post-translational mechanisms. Our studies show that KLF4 regulates differentiation as well as cell cycle progression, and binds to sequences in the upstream regulatory region (URR) to regulate viral transcription in cooperation with Blimp1. KLF4 levels are increased in HPV-positive cells through a post-transcriptional mechanism involving E7-mediated suppression of cellular miR-145, as well as at the post-translational level by E6-directed inhibition of its sumoylation and phosphorylation. The alterations in KLF4 levels and functions results in activation and suppression of a subset of KLF4 target genes, including TCHHL1, VIM, ACTN1, and POT1, that is distinct from that seen in normal keratinocytes. Knockdown of KLF4 with shRNAs in cells that maintain HPV episomes blocked genome amplification and abolished late gene expression upon differentiation. While KLF4 is indispensable for the proliferation and differentiation of normal keratinocytes, it is necessary only for differentiation-associated functions of HPV-positive keratinocytes. Increases in KLF4 levels alone do not appear to be sufficient to explain the effects on proliferation and differentiation of HPV-positive cells indicating that additional modifications are important. KLF4 has also been shown to be a critical regulator of lytic Epstein Barr virus (EBV) replication underscoring the

  7. Post-Transcriptional Regulation of KLF4 by High-Risk Human Papillomaviruses Is Necessary for the Differentiation-Dependent Viral Life Cycle

    PubMed Central

    Gunasekharan, Vignesh Kumar; Li, Yan; Laimins, Laimonis A.


    Human papillomaviruses (HPVs) are epithelial tropic viruses that link their productive life cycles to the differentiation of infected host keratinocytes. A subset of the over 200 HPV types, referred to as high-risk, are the causative agents of most anogenital malignancies. HPVs infect cells in the basal layer, but restrict viral genome amplification, late gene expression, and capsid assembly to highly differentiated cells that are active in the cell cycle. In this study, we demonstrate that HPV proteins regulate the expression and activities of a critical cellular transcription factor, KLF4, through post-transcriptional and post-translational mechanisms. Our studies show that KLF4 regulates differentiation as well as cell cycle progression, and binds to sequences in the upstream regulatory region (URR) to regulate viral transcription in cooperation with Blimp1. KLF4 levels are increased in HPV-positive cells through a post-transcriptional mechanism involving E7-mediated suppression of cellular miR-145, as well as at the post-translational level by E6–directed inhibition of its sumoylation and phosphorylation. The alterations in KLF4 levels and functions results in activation and suppression of a subset of KLF4 target genes, including TCHHL1, VIM, ACTN1, and POT1, that is distinct from that seen in normal keratinocytes. Knockdown of KLF4 with shRNAs in cells that maintain HPV episomes blocked genome amplification and abolished late gene expression upon differentiation. While KLF4 is indispensable for the proliferation and differentiation of normal keratinocytes, it is necessary only for differentiation-associated functions of HPV-positive keratinocytes. Increases in KLF4 levels alone do not appear to be sufficient to explain the effects on proliferation and differentiation of HPV-positive cells indicating that additional modifications are important. KLF4 has also been shown to be a critical regulator of lytic Epstein Barr virus (EBV) replication underscoring the

  8. Prostaglandin E2 As a Modulator of Viral Infections

    PubMed Central

    Sander, Willem J.; O'Neill, Hester G.; Pohl, Carolina H.


    Viral infections are a major cause of infectious diseases worldwide. Inflammation and the immune system are the major host defenses against these viral infection. Prostaglandin E2 (PGE2), an eicosanoid generated by cyclooxygenases, has been shown to modulate inflammation and the immune system by regulating the expression/concentration of cytokines. The effect of PGE2 on viral infection and replication is cell type- and virus-family-dependent. The host immune system can be modulated by PGE2, with regards to immunosuppression, inhibition of nitrogen oxide (NO) production, inhibition of interferon (IFN) and apoptotic pathways, and inhibition of viral receptor expression. Furthermore, PGE2 can play a role in viral infection directly by increasing the production and release of virions, inhibiting viral binding and replication, and/or stimulating viral gene expression. PGE2 may also have a regulatory role in the induction of autoimmunity and in signaling via Toll-like receptors. In this review the known effects of PGE2 on the pathogenesis of various infections caused by herpes simplex virus, rotavirus, influenza A virus and human immunodeficiency virus as well the therapeutic potential of PGE2 are discussed. PMID:28261111

  9. Tat is a multifunctional viral protein that modulates cellular gene expression and functions.


    Clark, Evan; Nava, Brenda; Caputi, Massimo


    The human immunodeficiency virus type I (HIV-1) has developed several strategies to condition the host environment to promote viral replication and spread. Viral proteins have evolved to perform multiple functions, aiding in the replication of the viral genome and modulating the cellular response to the infection. Tat is a small, versatile, viral protein that controls transcription of the HIV genome, regulates cellular gene expression and generates a permissive environment for viral replication by altering the immune response and facilitating viral spread to multiple tissues. Studies carried out utilizing biochemical, cellular, and genomic approaches show that the expression and activity of hundreds of genes and multiple molecular networks are modulated by Tat via multiple mechanisms.

  10. Bovine viral diarrhea virus modulation of monocyte derived macrophages

    USDA-ARS?s Scientific Manuscript database

    Bovine viral diarrhea virus (BVDV) is a single stranded, positive sense RNA virus and is the causative agent of bovine viral diarrhea (BVD). Disease can range from persistently infected (PI) animals displaying no clinical symptoms of disease to an acute, severe disease. Presently, limited studies ha...

  11. Dengue virus life cycle: viral and host factors modulating infectivity.


    Rodenhuis-Zybert, Izabela A; Wilschut, Jan; Smit, Jolanda M


    Dengue virus (DENV 1-4) represents a major emerging arthropod-borne pathogen. All four DENV serotypes are prevalent in the (sub) tropical regions of the world and infect 50-100 million individuals annually. Whereas the majority of DENV infections proceed asymptomatically or result in self-limited dengue fever, an increasing number of patients present more severe manifestations, such as dengue hemorrhagic fever and dengue shock syndrome. In this review we will give an overview of the infectious life cycle of DENV and will discuss the viral and host factors that are important in controlling DENV infection.

  12. Staphylococcus aureus α-toxin modulates skin host response to viral infection.


    Bin, Lianghua; Kim, Byung Eui; Brauweiler, Anne; Goleva, Elena; Streib, Joanne; Ji, Yinduo; Schlievert, Patrick M; Leung, Donald Y M


    Patients with atopic dermatitis (AD) with a history of eczema herpeticum have increased staphylococcal colonization and infections. However, whether Staphylococcus aureus alters the outcome of skin viral infection has not been determined. We investigated whether S aureus toxins modulated host response to herpes simplex virus (HSV) 1 and vaccinia virus (VV) infections in normal human keratinocytes (NHKs) and in murine infection models. NHKs were treated with S aureus toxins before incubation of viruses. BALB/c mice were inoculated with S aureus 2 days before VV scarification. Viral loads of HSV-1 and VV were evaluated by using real-time PCR, a viral plaque-forming assay, and immunofluorescence staining. Small interfering RNA duplexes were used to knockdown the gene expression of the cellular receptor of α-toxin, a disintegrin and metalloprotease 10 (ADAM10). ADAM10 protein and α-toxin heptamers were detected by using Western blot assays. We demonstrate that sublytic staphylococcal α-toxin increases viral loads of HSV-1 and VV in NHKs. Furthermore, we demonstrate in vivo that the VV load is significantly greater (P < .05) in murine skin inoculated with an α-toxin-producing S aureus strain compared with murine skin inoculated with the isogenic α-toxin-deleted strain. The viral enhancing effect of α-toxin is mediated by ADAM10 and is associated with its pore-forming property. Moreover, we demonstrate that α-toxin promotes viral entry in NHKs. The current study introduces the novel concept that staphylococcal α-toxin promotes viral skin infection and provides a mechanism by which S aureus infection might predispose the host toward disseminated viral infections. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  13. Rubella virus capsid protein modulation of viral genomic and subgenomic RNA synthesis

    SciTech Connect

    Tzeng, W.-P.; Frey, Teryl K. . E-mail:


    The ratio of the subgenomic (SG) to genome RNA synthesized by rubella virus (RUB) replicons expressing the green fluorescent protein reporter gene (RUBrep/GFP) is substantially higher than the ratio of these species synthesized by RUB (4.3 for RUBrep/GFP vs. 1.3-1.4 for RUB). It was hypothesized that this modulation of the viral RNA synthesis was by one of the virus structural protein genes and it was found that introduction of the capsid (C) protein gene into the replicons as an in-frame fusion with GFP resulted in an increase of genomic RNA production (reducing the SG/genome RNA ratio), confirming the hypothesis and showing that the C gene was the moiety responsible for the modulation effect. The N-terminal one-third of the C gene was required for the effect of be exhibited. A similar phenomenon was not observed with the replicons of Sindbis virus, a related Alphavirus. Interestingly, modulation was not observed when RUBrep/GFP was co-transfected with either other RUBrep or plasmid constructs expressing the C gene, demonstrating that modulation could occur only when the C gene was provided in cis. Mutations that prevented translation of the C protein failed to modulate RNA synthesis, indicating that the C protein was the moiety responsible for modulation; consistent with this conclusion, modulation of RNA synthesis was maintained when synonymous codon mutations were introduced at the 5' end of the C gene that changed the C gene sequence without altering the amino acid sequence of the C protein. These results indicate that C protein translated in proximity of viral replication complexes, possibly from newly synthesized SG RNA, participate in regulating the replication of viral RNA.

  14. Apigenin inhibits enterovirus 71 replication through suppressing viral IRES activity and modulating cellular JNK pathway.


    Lv, Xiaowen; Qiu, Min; Chen, Deyan; Zheng, Nan; Jin, Yu; Wu, Zhiwei


    Enterovirus 71 (EV71) is a member of genus Enterovirus in Picornaviridae family, which is one of the major causative agents for hand, foot and mouth disease (HFMD), and sometimes associated with severe central nervous system diseases in children. Currently there are no effective therapeutic medicines or vaccines for the disease. In this report, we found that apigenin and luteolin, two flavones that differ only in the number of hydroxyl groups could inhibit EV71-mediated cytopathogenic effect (CPE) and EV71 replication with low cytotoxicity. Both molecules also showed inhibitory effect on the viral polyprotein expression. They prevented EV71-induced cell apoptosis, intracellular reactive oxygen species (ROS) generation and cytokines up-regulation. Time-of-drug addition study demonstrated that apigenin and luteolin acted after viral entry. We examined the effect of apigenin and luteolin on 2A(pro) and 3C(pro) activity, two viral proteases responsible for viral polyprotein processing, and found that they showed less inhibitory activity on 2A(pro) or 3C(pro). Further studies demonstrated that apigenin, but not luteolin could interfere with viral IRES activity. Also, apigenin inhibited EV71-induced c-Jun N-terminal kinase (JNK) activation which is critical for viral replication, in contrast to luteolin that did not. This study demonstrated that apigenin may inhibit EV71 replication through suppressing viral IRES activity and modulating cellular JNK pathway. It also provided evidence that one hydroxyl group difference in the B ring between apigenin and luteolin resulted in the distinct antiviral mechanisms. This study will provide the basis for better drug development and further identification of potential drug targets.

  15. Lipids as modulators of membrane fusion mediated by viral fusion proteins.


    Teissier, Elodie; Pécheur, Eve-Isabelle


    Enveloped viruses infect host cells by fusion of viral and target membranes. This fusion event is triggered by specific glycoproteins in the viral envelope. Fusion glycoproteins belong to either class I, class II or the newly described third class, depending upon their arrangement at the surface of the virion, their tri-dimensional structure and the location within the protein of a short stretch of hydrophobic amino acids called the fusion peptide, which is able to induce the initial lipid destabilization at the onset of fusion. Viral fusion occurs either with the plasma membrane for pH-independent viruses, or with the endosomal membranes for pH-dependent viruses. Although, viral fusion proteins are parted in three classes and the subcellular localization of fusion might vary, these proteins have to act, in common, on lipid assemblies. Lipids contribute to fusion through their physical, mechanical and/or chemical properties. Lipids can thus play a role as chemically defined entities, or through their preferential partitioning into membrane microdomains called "rafts", or by modulating the curvature of the membranes involved in the fusion process. The purpose of this review is to make a state of the art on recent findings on the contribution of cholesterol, sphingolipids and glycolipids in cell entry and membrane fusion of a number of viral families, whose members bear either class I or class II fusion proteins, or fusion proteins of the recently discovered third class.

  16. Borna disease virus phosphoprotein modulates epigenetic signaling in neurons to control viral replication.


    Bonnaud, Emilie M; Szelechowski, Marion; Bétourné, Alexandre; Foret, Charlotte; Thouard, Anne; Gonzalez-Dunia, Daniel; Malnou, Cécile E


    Understanding the modalities of interaction of neurotropic viruses with their target cells represents a major challenge that may improve our knowledge of many human neurological disorders for which viral origin is suspected. Borna disease virus (BDV) represents an ideal model to analyze the molecular mechanisms of viral persistence in neurons and its consequences for neuronal homeostasis. It is now established that BDV ensures its long-term maintenance in infected cells through a stable interaction of viral components with the host cell chromatin, in particular, with core histones. This has led to our hypothesis that such an interaction may trigger epigenetic changes in the host cell. Here, we focused on histone acetylation, which plays key roles in epigenetic regulation of gene expression, notably for neurons. We performed a comparative analysis of histone acetylation patterns of neurons infected or not infected by BDV, which revealed that infection decreases histone acetylation on selected lysine residues. We showed that the BDV phosphoprotein (P) is responsible for these perturbations, even when it is expressed alone independently of the viral context, and that this action depends on its phosphorylation by protein kinase C. We also demonstrated that BDV P inhibits cellular histone acetyltransferase activities. Finally, by pharmacologically manipulating cellular acetylation levels, we observed that inhibiting cellular acetyl transferases reduces viral replication in cell culture. Our findings reveal that manipulation of cellular epigenetics by BDV could be a means to modulate viral replication and thus illustrate a fascinating example of virus-host cell interaction. Persistent DNA viruses often subvert the mechanisms that regulate cellular chromatin dynamics, thereby benefitting from the resulting epigenetic changes to create a favorable milieu for their latent and persistent states. Here, we reasoned that Borna disease virus (BDV), the only RNA virus known to

  17. Ginseng Protects Against Respiratory Syncytial Virus by Modulating Multiple Immune Cells and Inhibiting Viral Replication

    PubMed Central

    Lee, Jong Seok; Lee, Yu-Na; Lee, Young-Tae; Hwang, Hye Suk; Kim, Ki-Hye; Ko, Eun-Ju; Kim, Min-Chul; Kang, Sang-Moo


    Ginseng has been used in humans for thousands of years but its effects on viral infection have not been well understood. We investigated the effects of red ginseng extract (RGE) on respiratory syncytial virus (RSV) infection using in vitro cell culture and in vivo mouse models. RGE partially protected human epithelial (HEp2) cells from RSV-induced cell death and viral replication. In addition, RGE significantly inhibited the production of RSV-induced pro-inflammatory cytokine (TNF-α) in murine dendritic and macrophage-like cells. More importantly, RGE intranasal pre-treatment prevented loss of mouse body weight after RSV infection. RGE treatment improved lung viral clearance and enhanced the production of interferon (IFN-γ) in bronchoalveolar lavage cells upon RSV infection of mice. Analysis of cellular phenotypes in bronchoalveolar lavage fluids showed that RGE treatment increased the populations of CD8+ T cells and CD11c+ dendritic cells upon RSV infection of mice. Taken together, these results provide evidence that ginseng has protective effects against RSV infection through multiple mechanisms, which include improving cell survival, partial inhibition of viral replication and modulation of cytokine production and types of immune cells migrating into the lung. PMID:25658239

  18. Hepatitis B virus modulates store-operated calcium entry to enhance viral replication in primary hepatocytes.


    Casciano, Jessica C; Duchemin, Nicholas J; Lamontagne, R Jason; Steel, Laura F; Bouchard, Michael J


    Many viruses modulate calcium (Ca2+) signaling to create a cellular environment that is more permissive to viral replication, but for most viruses that regulate Ca2+ signaling, the mechanism underlying this regulation is not well understood. The hepatitis B virus (HBV) HBx protein modulates cytosolic Ca2+ levels to stimulate HBV replication in some liver cell lines. A chronic HBV infection is associated with life-threatening liver diseases, including hepatocellular carcinoma (HCC), and HBx modulation of cytosolic Ca2+ levels could have an important role in HBV pathogenesis. Whether HBx affects cytosolic Ca2+ in a normal hepatocyte, the natural site of an HBV infection, has not been addressed. Here, we report that HBx alters cytosolic Ca2+ signaling in cultured primary hepatocytes. We used single cell Ca2+ imaging of cultured primary rat hepatocytes to demonstrate that HBx elevates the cytosolic Ca2+ level in hepatocytes following an IP3-linked Ca2+ response; HBx effects were similar when expressed alone or in the context of replicating HBV. HBx elevation of the cytosolic Ca2+ level required extracellular Ca2+ influx and store-operated Ca2+ (SOC) entry and stimulated HBV replication in hepatocytes. We used both targeted RT-qPCR and transcriptome-wide RNAseq analyses to compare levels of SOC channel components and other Ca2+ signaling regulators in HBV-expressing and control hepatocytes and show that the transcript levels of these various proteins are not affected by HBV. We also show that HBx regulation of SOC-regulated Ca2+ accumulation is likely the consequence of HBV modulation of a SOC channel regulatory mechanism. In support of this, we link HBx enhancement of SOC-regulated Ca2+ accumulation to Ca2+ uptake by mitochondria and demonstrate that HBx stimulates mitochondrial Ca2+ uptake in primary hepatocytes. The results of our study may provide insights into viral mechanisms that affect Ca2+ signaling to regulate viral replication and virus-associated diseases.

  19. Hepatitis B virus modulates store-operated calcium entry to enhance viral replication in primary hepatocytes

    PubMed Central

    Casciano, Jessica C.; Duchemin, Nicholas J.; Lamontagne, R. Jason; Steel, Laura F.; Bouchard, Michael J.


    Many viruses modulate calcium (Ca2+) signaling to create a cellular environment that is more permissive to viral replication, but for most viruses that regulate Ca2+ signaling, the mechanism underlying this regulation is not well understood. The hepatitis B virus (HBV) HBx protein modulates cytosolic Ca2+ levels to stimulate HBV replication in some liver cell lines. A chronic HBV infection is associated with life-threatening liver diseases, including hepatocellular carcinoma (HCC), and HBx modulation of cytosolic Ca2+ levels could have an important role in HBV pathogenesis. Whether HBx affects cytosolic Ca2+ in a normal hepatocyte, the natural site of an HBV infection, has not been addressed. Here, we report that HBx alters cytosolic Ca2+ signaling in cultured primary hepatocytes. We used single cell Ca2+ imaging of cultured primary rat hepatocytes to demonstrate that HBx elevates the cytosolic Ca2+ level in hepatocytes following an IP3-linked Ca2+ response; HBx effects were similar when expressed alone or in the context of replicating HBV. HBx elevation of the cytosolic Ca2+ level required extracellular Ca2+ influx and store-operated Ca2+ (SOC) entry and stimulated HBV replication in hepatocytes. We used both targeted RT-qPCR and transcriptome-wide RNAseq analyses to compare levels of SOC channel components and other Ca2+ signaling regulators in HBV-expressing and control hepatocytes and show that the transcript levels of these various proteins are not affected by HBV. We also show that HBx regulation of SOC-regulated Ca2+ accumulation is likely the consequence of HBV modulation of a SOC channel regulatory mechanism. In support of this, we link HBx enhancement of SOC-regulated Ca2+ accumulation to Ca2+ uptake by mitochondria and demonstrate that HBx stimulates mitochondrial Ca2+ uptake in primary hepatocytes. The results of our study may provide insights into viral mechanisms that affect Ca2+ signaling to regulate viral replication and virus-associated diseases

  20. A predictor for toxin-like proteins exposes cell modulator candidates within viral genomes

    PubMed Central

    Naamati, Guy; Askenazi, Manor; Linial, Michal


    Motivation: Animal toxins operate by binding to receptors and ion channels. These proteins are short and vary in sequence, structure and function. Sporadic discoveries have also revealed endogenous toxin-like proteins in non-venomous organisms. Viral proteins are the largest group of quickly evolving proteomes. We tested the hypothesis that toxin-like proteins exist in viruses and that they act to modulate functions of their hosts. Results: We updated and improved a classifier for compact proteins resembling short animal toxins that is based on a machine-learning method. We applied it in a large-scale setting to identify toxin-like proteins among short viral proteins. Among the ∼26 000 representatives of such short proteins, 510 sequences were positively identified. We focused on the 19 highest scoring proteins. Among them, we identified conotoxin-like proteins, growth factors receptor-like proteins and anti-bacterial peptides. Our predictor was shown to enhance annotation inference for many ‘uncharacterized’ proteins. We conclude that our protocol can expose toxin-like proteins in unexplored niches including metagenomics data and enhance the systematic discovery of novel cell modulators for drug development. Availability: ClanTox is available at Contact: PMID:20823311

  1. Tat acetylation modulates assembly of a viral-host RNA–protein transcription complex

    PubMed Central

    D'Orso, Iván; Frankel, Alan D.


    HIV-1 Tat enhances viral transcription elongation by forming a ribonucleoprotein complex with transactivating responsive (TAR) RNA and P-TEFb, an elongation factor composed of cyclin T1 (CycT1) and Cdk9 that phosphorylates the C-terminal domain of RNA polymerase II. Previous studies have shown that Lys-28 in the activation domain (AD) of Tat is essential for HIV-1 transcription and replication and is acetylated by p300/CBP-associated factor (PCAF), but the mechanistic basis of the Lys-28 requirement is unknown. Here, we show that Lys-28 acetylation modulates the affinity and stability of HIV-1 Tat–CycT1–TAR complexes by enhancing an interaction with the CycT1 Tat–TAR recognition motif. High-affinity assembly correlates strongly with stimulation of transcription elongation in vitro and Tat activation in vivo. In marked contrast, bovine lentiviral Tat proteins have evolved a high-affinity TAR interaction that does not require PCAF-mediated acetylation of the Tat AD or CycT1 for RNA binding, whereas HIV-2 Tat has evolved an intermediate mechanism that uses a duplicated TAR element and CycT1 to enhance RNA affinity and consequently transcription activation. The coevolution of Tat acetylation, CycT1 dependence, and TAR binding affinity is seen in viral replication assays using Tat proteins that rely on CycT1 for TAR binding but are acetylation deficient, where compensatory mutations rapidly accrue in TAR to generate high-affinity, CycT1-independent complexes reminiscent of the bovine viruses. Thus, lysine acetylation can be used to modulate and evolve the strength of a viral-host RNA–protein complex, thereby tuning the levels of transcription elongation. PMID:19223581

  2. PA28 modulates antigen processing and viral replication during coxsackievirus B3 infection

    PubMed Central

    Respondek, Dorota; Voss, Martin; Kühlewindt, Ina; Klingel, Karin; Krüger, Elke


    The function of the proteasome is modulated at the level of subunit expression and by association with its regulatory complexes. During coxsackievirus B3 (CVB3) myocarditis, IFN-induced formation of immunoproteasomes (ip) is known to be critical for regulating immune modulating molecules. The function of the IFN-γ-inducible proteasome regulator subunits PA28 α and β, however, in this context was unknown. During viral myocarditis, we found an increased abundance of PA28β subunits in heart tissue. PA28α/β exists in PA28-20S-PA28 and PA700-20S-PA28 hybrid proteasome complexes in cells both with either predominant ip and standard proteasome (sp) expression. Being in line with reduced proteasome activity in PA28α/β-deficient cells, we observed increased levels of oxidized and poly-ubiquitinated proteins upon TLR3-activation in these cells. Moreover, PA28α/β is capable to interfere directly with viral replication of CVB3 and facilitates the generation of CVB3-derived MHC class I epitopes by the proteasome. In contrast to a distinct function of PA28α/β in vitro, gene ablation of PA28α/β in mice being on a genetic background with resistance towards the development of severe infection had no significant impact on disease progression. Other than reported for the ip, in this host PA28α/β is dispensable to meet the demand of increased peptide hydrolysis capacity by the proteasome during viral myocarditis. PMID:28278207

  3. PA28 modulates antigen processing and viral replication during coxsackievirus B3 infection.


    Respondek, Dorota; Voss, Martin; Kühlewindt, Ina; Klingel, Karin; Krüger, Elke; Beling, Antje


    The function of the proteasome is modulated at the level of subunit expression and by association with its regulatory complexes. During coxsackievirus B3 (CVB3) myocarditis, IFN-induced formation of immunoproteasomes (ip) is known to be critical for regulating immune modulating molecules. The function of the IFN-γ-inducible proteasome regulator subunits PA28 α and β, however, in this context was unknown. During viral myocarditis, we found an increased abundance of PA28β subunits in heart tissue. PA28α/β exists in PA28-20S-PA28 and PA700-20S-PA28 hybrid proteasome complexes in cells both with either predominant ip and standard proteasome (sp) expression. Being in line with reduced proteasome activity in PA28α/β-deficient cells, we observed increased levels of oxidized and poly-ubiquitinated proteins upon TLR3-activation in these cells. Moreover, PA28α/β is capable to interfere directly with viral replication of CVB3 and facilitates the generation of CVB3-derived MHC class I epitopes by the proteasome. In contrast to a distinct function of PA28α/β in vitro, gene ablation of PA28α/β in mice being on a genetic background with resistance towards the development of severe infection had no significant impact on disease progression. Other than reported for the ip, in this host PA28α/β is dispensable to meet the demand of increased peptide hydrolysis capacity by the proteasome during viral myocarditis.

  4. Regulatory Interaction between the Cellular Restriction Factor IFI16 and Viral pp65 (pUL83) Modulates Viral Gene Expression and IFI16 Protein Stability

    PubMed Central

    Pautasso, Sara; von Einem, Jens; Marschall, Manfred; Plachter, Bodo


    ABSTRACT A key player in the intrinsic resistance against human cytomegalovirus (HCMV) is the interferon-γ-inducible protein 16 (IFI16), which behaves as a viral DNA sensor in the first hours postinfection and as a repressor of viral gene transcription in the later stages. Previous studies on HCMV replication demonstrated that IFI16 binds to the viral protein kinase pUL97, undergoes phosphorylation, and relocalizes to the cytoplasm of infected cells. In this study, we demonstrate that the tegument protein pp65 (pUL83) recruits IFI16 to the promoter of the UL54 gene and downregulates viral replication, as shown by use of the HCMV mutant v65Stop, which lacks pp65 expression. Interestingly, at late time points of HCMV infection, IFI16 is stabilized by its interaction with pp65, which stood in contrast to IFI16 degradation, observed in herpes simplex virus 1 (HSV-1)-infected cells. Moreover, we found that its translocation to the cytoplasm, in addition to pUL97, strictly depends on pp65, as demonstrated with the HCMV mutant RV-VM1, which expresses a form of pp65 unable to translocate into the cytoplasm. Thus, these data reveal a dual role for pp65: during early infection, it modulates IFI16 activity at the promoter of immediate-early and early genes; subsequently, it delocalizes IFI16 from the nucleus into the cytoplasm, thereby stabilizing and protecting it from degradation. Overall, these data identify a novel activity of the pp65/IFI16 interactome involved in the regulation of UL54 gene expression and IFI16 stability during early and late phases of HCMV replication. IMPORTANCE The DNA sensor IFI16, a member of the PYHIN proteins, restricts HCMV replication by impairing viral DNA synthesis. Using a mutant virus lacking the tegument protein pp65 (v65Stop), we demonstrate that pp65 recruits IFI16 to the early UL54 gene promoter. As a putative counteraction to its restriction activity, pp65 supports the nucleocytoplasmic export of IFI16, which was demonstrated with the

  5. Modulation of apoptosis and viral latency - an axis to be well understood for successful cure of human immunodeficiency virus.


    Timilsina, Uddhav; Gaur, Ritu


    Human immunodeficiency virus (HIV) is the causative agent of the deadly disease AIDS, which is characterized by the progressive decline of CD4(+)T-cells. HIV-1-encoded proteins such as envelope gp120 (glycoprotein gp120), Tat (trans-activator of transcription), Nef (negative regulatory factor), Vpr (viral protein R), Vpu (viral protein unique) and protease are known to be effective in modulating host cell signalling pathways that lead to an alteration in apoptosis of both HIV-infected and uninfected bystander cells. Depending on the stage of the virus life cycle and host cell type, these viral proteins act as mediators of pro- or anti-apoptotic signals. HIV latency in viral reservoirs is a persistent phenomenon that has remained beyond the control of the human immune system. To cure HIV infections completely, it is crucial to reactivate latent HIV from cellular pools and to drive these apoptosis-resistant cells towards death. Several previous studies have reported the role of HIV-encoded proteins in apoptosis modulation, but the molecular basis for apoptosis evasion of some chronically HIV-infected cells and reactivated latently HIV-infected cells still needs to be elucidated. The current review summarizes our present understanding of apoptosis modulation in HIV-infected cells, uninfected bystander cells and latently infected cells, with a focus on highlighting strategies to activate the apoptotic pathway to kill latently infected cells.

  6. Conserved residues in Lassa fever virus Z protein modulate viral infectivity at the level of the ribonucleoprotein.


    Capul, Althea A; de la Torre, Juan Carlos; Buchmeier, Michael J


    Arenaviruses are negative-strand RNA viruses that cause human diseases such as lymphocytic choriomeningitis, Bolivian hemorrhagic fever, and Lassa hemorrhagic fever. No licensed vaccines exist, and current treatment is limited to ribavirin. The prototypic arenavirus, lymphocytic choriomeningitis virus (LCMV), is a model for dissecting virus-host interactions in persistent and acute disease. The RING finger protein Z has been identified as the driving force of arenaviral budding and acts as the viral matrix protein. While residues in Z required for viral budding have been described, residues that govern the Z matrix function(s) have yet to be fully elucidated. Because this matrix function is integral to viral assembly, we reasoned that this would be reflected in sequence conservation. Using sequence alignment, we identified several conserved residues in Z outside the RING and late domains. Nine residues were each mutated to alanine in Lassa fever virus Z. All of the mutations affected the expression of an LCMV minigenome and the infectivity of virus-like particles, but to greatly varying degrees. Interestingly, no mutations appeared to affect Z-mediated budding or association with viral GP. Our findings provide direct experimental evidence supporting a role for Z in the modulation of the activity of the viral ribonucleoprotein (RNP) complex and its packaging into mature infectious viral particles.

  7. Modulation of sex hormone secretion in cows by acute infection with bovine viral diarrhoea virus.


    Fray, M D; Mann, G E; Bleach, E C L; Knight, P G; Clarke, M C; Charleston, B


    Bovine viral diarrhoea virus (BVDV) is a major pathogen of cattle and is responsible for considerable reproductive loss. In this study, the in vivo responses in six multiparous cows were investigated after a non-cytopathogenic BVDV challenge (strain Pe 515; 5 x 10(6) tissue culture infective dose 50) given 9 days before a synchronized ovulation. Six similar cows challenged with non-infectious culture medium served as controls. The experimental noncytopathogenic BVDV infection was followed by a viraemia and leucopenia at days 5-9 after challenge, but no other clinical signs of infection were detected. However, the BVDV infection altered endocrine function. Mean LH pulse frequency immediately before CIDR withdrawal was lower (P < or = 0.05) in the BVDV-infected (2.17 +/- 0.34 pulses per 8 h) compared with the sham-infected (4.83 +/- 1.04 pulses per 8 h) animals. At day 3 after CIDR withdrawal, plasma oestradiol concentrations remained high (P < 0.05) in the infected cows (2.19 +/- 0.51 pg ml(-1)) compared with the sham-infected controls (0.72 +/- 0.29 pg ml(-1)). However, there was no difference in the peak oestradiol concentration (BVDV: 2.31 +/- 0.29 versus sham: 2.34 +/- 0.41 pg ml(-1)). In addition, non-cytopathogenic BVDV significantly (P < 0.05) increased the duration of the interval between ovulation and onset of the postovulatory progesterone increase (values 1.0 ng ml(-1)) (BVDV: 3.0 +/- 0.26 versus sham: 4.0 +/- 0.26 days). The viral infection also significantly (P < 0.01) decreased mean plasma progesterone concentrations between day 3 and day 11 after ovulation (BVDV: 2.59 +/- 0.32 versus sham: 4.13 +/- 0.27 ng ml(-1)). These data show that non-cytopathogenic BVDV viraemias during the follicular phase can modulate the secretion of gonadotrophins and sex steroids, in particular progesterone, during a synchronized oestrous cycle. Therefore, viraemias during the follicular phase may reduce the fertility of cattle by disrupting the capacity of the ovulatory

  8. Viral infection

    PubMed Central

    Puigdomènech, Isabel; de Armas-Rillo, Laura; Machado, José-David


    Viruses have developed different survival strategies in host cells by crossing cell-membrane compartments, during different steps of their viral life cycle. In fact, the non-regenerative viral membrane of enveloped viruses needs to encounter the dynamic cell-host membrane, during early steps of the infection process, in which both membranes fuse, either at cell-surface or in an endocytic compartment, to promote viral entry and infection. Once inside the cell, many viruses accomplish their replication process through exploiting or modulating membrane traffic, and generating specialized compartments to assure viral replication, viral budding and spreading, which also serve to evade the immune responses against the pathogen. In this review, we have attempted to present some data that highlight the importance of membrane dynamics during viral entry and replicative processes, in order to understand how viruses use and move through different complex and dynamic cell-membrane structures and how they use them to persist. PMID:21966556

  9. Primate Lentiviruses Modulate NF-κB Activity by Multiple Mechanisms to Fine-Tune Viral and Cellular Gene Expression

    PubMed Central

    Heusinger, Elena; Kirchhoff, Frank


    The transcription factor nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) plays a complex role during the replication of primate lentiviruses. On the one hand, NF-κB is essential for induction of efficient proviral gene expression. On the other hand, this transcription factor contributes to the innate immune response and induces expression of numerous cellular antiviral genes. Recent data suggest that primate lentiviruses cope with this challenge by boosting NF-κB activity early during the replication cycle to initiate Tat-driven viral transcription and suppressing it at later stages to minimize antiviral gene expression. Human and simian immunodeficiency viruses (HIV and SIV, respectively) initially exploit their accessory Nef protein to increase the responsiveness of infected CD4+ T cells to stimulation. Increased NF-κB activity initiates Tat expression and productive replication. These events happen quickly after infection since Nef is rapidly expressed at high levels. Later during infection, Nef proteins of HIV-2 and most SIVs exert a very different effect: by down-modulating the CD3 receptor, an essential factor for T cell receptor (TCR) signaling, they prevent stimulation of CD4+ T cells via antigen-presenting cells and hence suppress further induction of NF-κB and an effective antiviral immune response. Efficient LTR-driven viral transcription is maintained because it is largely independent of NF-κB in the presence of Tat. In contrast, human immunodeficiency virus type 1 (HIV-1) and its simian precursors have lost the CD3 down-modulation function of Nef and use the late viral protein U (Vpu) to inhibit NF-κB activity by suppressing its nuclear translocation. In this review, we discuss how HIV-1 and other primate lentiviruses might balance viral and antiviral gene expression through a tight temporal regulation of NF-κB activity throughout their replication cycle. PMID:28261165

  10. Primate Lentiviruses Modulate NF-κB Activity by Multiple Mechanisms to Fine-Tune Viral and Cellular Gene Expression.


    Heusinger, Elena; Kirchhoff, Frank


    The transcription factor nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) plays a complex role during the replication of primate lentiviruses. On the one hand, NF-κB is essential for induction of efficient proviral gene expression. On the other hand, this transcription factor contributes to the innate immune response and induces expression of numerous cellular antiviral genes. Recent data suggest that primate lentiviruses cope with this challenge by boosting NF-κB activity early during the replication cycle to initiate Tat-driven viral transcription and suppressing it at later stages to minimize antiviral gene expression. Human and simian immunodeficiency viruses (HIV and SIV, respectively) initially exploit their accessory Nef protein to increase the responsiveness of infected CD4(+) T cells to stimulation. Increased NF-κB activity initiates Tat expression and productive replication. These events happen quickly after infection since Nef is rapidly expressed at high levels. Later during infection, Nef proteins of HIV-2 and most SIVs exert a very different effect: by down-modulating the CD3 receptor, an essential factor for T cell receptor (TCR) signaling, they prevent stimulation of CD4(+) T cells via antigen-presenting cells and hence suppress further induction of NF-κB and an effective antiviral immune response. Efficient LTR-driven viral transcription is maintained because it is largely independent of NF-κB in the presence of Tat. In contrast, human immunodeficiency virus type 1 (HIV-1) and its simian precursors have lost the CD3 down-modulation function of Nef and use the late viral protein U (Vpu) to inhibit NF-κB activity by suppressing its nuclear translocation. In this review, we discuss how HIV-1 and other primate lentiviruses might balance viral and antiviral gene expression through a tight temporal regulation of NF-κB activity throughout their replication cycle.

  11. Host and Viral Modulation of RIG-I-Mediated Antiviral Immunity

    PubMed Central

    Liu, Yiliu; Olagnier, David; Lin, Rongtuan


    Innate immunity is the first line of defense against invading pathogens. Rapid and efficient detection of pathogen-associated molecular patterns via pattern-recognition receptors is essential for the host to mount defensive and protective responses. Retinoic acid-inducible gene-I (RIG-I) is critical in triggering antiviral and inflammatory responses for the control of viral replication in response to cytoplasmic virus-specific RNA structures. Upon viral RNA recognition, RIG-I recruits the mitochondrial adaptor protein mitochondrial antiviral signaling protein, which leads to a signaling cascade that coordinates the induction of type I interferons (IFNs), as well as a large variety of antiviral interferon-stimulated genes. The RIG-I activation is tightly regulated via various posttranslational modifications for the prevention of aberrant innate immune signaling. By contrast, viruses have evolved mechanisms of evasion, such as sequestrating viral structures from RIG-I detections and targeting receptor or signaling molecules for degradation. These virus–host interactions have broadened our understanding of viral pathogenesis and provided insights into the function of the RIG-I pathway. In this review, we summarize the recent advances regarding RIG-I pathogen recognition and signaling transduction, cell-intrinsic control of RIG-I activation, and the viral antagonism of RIG-I signaling. PMID:28096803

  12. Modulation of Cellular Tropism and Innate Antiviral Response by Viral Glycans

    PubMed Central

    Rogers, Kristin M.; Heise, Mark


    Arthropod-borne viruses (arboviruses) are a significant cause of human and animal disease worldwide. Multiple interactions between virus and the host innate immune system ultimately determine the pathogenesis and clinical outcome of the infection. Evidence is rapidly emerging that suggests viral glycans play a key role in viral pathogenesis by regulating host cell tropism and interactions with the host innate immune response. Glycan-mediated interactions are especially important for arboviruses which must adapt to variable glycosylation systems and cellular receptors within both vertebrate and invertebrate hosts. This review focuses on emerging evidence which supports a crucial role for viral glycans in mediating host cell tropism and regulating the innate antiviral response. PMID:20375598

  13. Amitraz and its metabolite modulate honey bee cardiac function and tolerance to viral infection.


    O'Neal, Scott T; Brewster, Carlyle C; Bloomquist, Jeffrey R; Anderson, Troy D


    The health and survival of managed honey bee (Apis mellifera) colonies are affected by multiple factors, one of the most important being the interaction between viral pathogens and infestations of the ectoparasitic mite Varroa destructor. Currently, the only effective strategy available for mitigating the impact of viral infections is the chemical control of mite populations. Unfortunately, the use of in-hive acaricides comes at a price, as they can produce sublethal effects that are difficult to quantify, but may ultimately be as damaging as the mites they are used to treat. The goal of this study was to investigate the physiological and immunological effects of the formamidine acaricide amitraz and its primary metabolite in honey bees. Using flock house virus as a model for viral infection, this study found that exposure to a formamidine acaricide may have a negative impact on the ability of honey bees to tolerate viral infection. Furthermore, this work has demonstrated that amitraz and its metabolite significantly alter honey bee cardiac function, most likely through interaction with octopamine receptors. The results suggest a potential drawback to the in-hive use of amitraz and raise intriguing questions about the relationship between insect cardiac function and disease tolerance. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. The cytoplasmic domain of Marburg virus GP modulates early steps of viral infection.


    Mittler, Eva; Kolesnikova, Larissa; Hartlieb, Bettina; Davey, Robert; Becker, Stephan


    Marburg virus infection is mediated by the only viral surface protein, GP, a trimeric type I transmembrane protein. While its ectodomain mediates receptor binding and fusion of viral and cellular membranes and its transmembrane domain is essential for the recruitment of GP into budding particles by the matrix protein VP40, the role of the short cytoplasmic domain has remained enigmatic. Here we show that a missing cytoplasmic domain did not impair trimerization, intracellular transport, or incorporation of GP into infectious Marburg virus-like particles (iVLPs) but altered the glycosylation pattern as well as the recognition of GP by neutralizing antibodies. These results suggest that subtle conformational changes took place in the ectodomain. To investigate the function of the cytoplasmic domain during viral entry, a novel entry assay was established to monitor the uptake of filamentous VLPs by measuring the occurrence of luciferase-labeled viral nucleocapsids in the cytosol of target cells. This quantitative assay showed that the entry process of VLPs incorporating GP missing its cytoplasmic domain (GPΔCD) was impaired. Supporting these results, iVLPs incorporating a mutant GP missing its cytoplasmic domain were significantly less infectious than iVLPs containing wild-type GP. Taken together, the data indicate that the absence of the short cytoplasmic domain of Marburg virus GP may induce conformational changes in the ectodomain which impact the filoviral entry process.

  15. Brain heterogeneity leads to differential innate immune responses and modulates pathogenesis of viral infections.


    Zegenhagen, Loreen; Kurhade, Chaitanya; Koniszewski, Nikolaus; Överby, Anna K; Kröger, Andrea


    The central nervous system (CNS) is a highly complex organ with highly specialized cell subtypes. Viral infections often target specific structures of the brain and replicate in certain regions. Studies in mice deficient in type I Interferon (IFN) receptor or IFN-β have highlighted the importance of the type I IFN system against viral infections and non-viral autoimmune disorders in the CNS. Direct antiviral effects of type I IFNs appear to be crucial in limiting early spread of a number of viruses in CNS tissues. Increased efforts have been made to characterize IFN expression and responses in the brain. In this context, it is important to identify cells that produce IFN, decipher pathways leading to type I IFN expression and to characterize responding cells. In this review we give an overview about region specific aspects that influence local innate immune responses. The route of entry is critical, but also the susceptibility of different cell types, heterogeneity in subpopulations and micro-environmental cues play an important role in antiviral responses. Recent work has outlined the tremendous importance of type I IFNs, particularly in the limitation of viral spread within the CNS. This review will address recent advances in understanding the mechanisms of local type I IFN production and response, in the particular context of the CNS. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Interplay between regulatory T cells and PD-1 in modulating T cell exhaustion and viral control during chronic LCMV infection

    PubMed Central

    Penaloza-MacMaster, Pablo; Kamphorst, Alice O.; Wieland, Andreas; Araki, Koichi; Iyer, Smita S.; West, Erin E.; O’Mara, Leigh; Yang, Shu; Konieczny, Bogumila T.; Sharpe, Arlene H.; Freeman, Gordon J.


    Regulatory T (T reg) cells are critical for preventing autoimmunity mediated by self-reactive T cells, but their role in modulating immune responses during chronic viral infection is not well defined. To address this question and to investigate a role for T reg cells in exhaustion of virus-specific CD8 T cells, we depleted T reg cells in mice chronically infected with lymphocytic choriomeningitis virus (LCMV). T reg cell ablation resulted in 10–100-fold expansion of functional LCMV-specific CD8 T cells. Rescue of exhausted CD8 T cells was dependent on cognate antigen, B7 costimulation, and conventional CD4 T cells. Despite the striking recovery of LCMV-specific CD8 T cell responses, T reg cell depletion failed to diminish viral load. Interestingly, T reg cell ablation triggered up-regulation of the molecule programmed cell death ligand-1 (PD-L1), which upon binding PD-1 on T cells delivers inhibitory signals. Increased PD-L1 expression was observed especially on LCMV-infected cells, and combining T reg cell depletion with PD-L1 blockade resulted in a significant reduction in viral titers, which was more pronounced than that upon PD-L1 blockade alone. These results suggest that T reg cells effectively maintain CD8 T cell exhaustion, but blockade of the PD-1 inhibitory pathway is critical for elimination of infected cells. PMID:25113973

  17. Cytoplasmic translocation, aggregation, and cleavage of TDP-43 by enteroviral proteases modulate viral pathogenesis

    PubMed Central

    Fung, G; Shi, J; Deng, H; Hou, J; Wang, C; Hong, A; Zhang, J; Jia, W; Luo, H


    We have previously demonstrated that infection by coxsackievirus B3 (CVB3), a positive-stranded RNA enterovirus, results in the accumulation of insoluble ubiquitin–protein aggregates, which resembles the common feature of neurodegenerative diseases. The importance of protein aggregation in viral pathogenesis has been recognized; however, the underlying regulatory mechanisms remain ill-defined. Transactive response DNA-binding protein-43 (TDP-43) is an RNA-binding protein that has an essential role in regulating RNA metabolism at multiple levels. Cleavage and cytoplasmic aggregation of TDP-43 serves as a major molecular marker for amyotrophic lateral sclerosis and frontotemporal lobar degeneration and contributes significantly to disease progression. In this study, we reported that TDP-43 is translocated from the nucleus to the cytoplasm during CVB3 infection through the activity of viral protease 2A, followed by the cleavage mediated by viral protease 3C. Cytoplasmic translocation of TDP-43 is accompanied by reduced solubility and increased formation of protein aggregates. The cleavage takes place at amino-acid 327 between glutamine and alanine, resulting in the generation of an N- and C-terminal cleavage fragment of ~35 and ~8 kDa, respectively. The C-terminal product of TDP-43 is unstable and quickly degraded through the proteasome degradation pathway, whereas the N-terminal truncation of TDP-43 acts as a dominant-negative mutant that inhibits the function of native TDP-43 in alternative RNA splicing. Lastly, we demonstrated that knockdown of TDP-43 results in an increase in viral titers, suggesting a protective role for TDP-43 in CVB3 infection. Taken together, our findings suggest a novel model by which cytoplasmic redistribution and cleavage of TDP-43 as a consequence of CVB3 infection disrupts the solubility and transcriptional activity of TDP-43. Our results also reveal a mechanism evolved by enteroviruses to support efficient viral infection. PMID

  18. Direct interaction of cellular hnRNP-F and NS1 of influenza A virus accelerates viral replication by modulation of viral transcriptional activity and host gene expression

    SciTech Connect

    Lee, Jun Han; Kim, Sung-Hak; Pascua, Philippe Noriel Q.; Song, Min-Suk; Baek, Yun Hee; Jin, Xun; Choi, Joong-Kook; Kim, Chul-Joong; Kim, Hyunggee; Choi, Young Ki


    To investigate novel NS1-interacting proteins, we conducted a yeast two-hybrid analysis, followed by co-immunoprecipitation assays. We identified heterogeneous nuclear ribonucleoprotein F (hnRNP-F) as a cellular protein interacting with NS1 during influenza A virus infection. Co-precipitation assays suggest that interaction between hnRNP-F and NS1 is a common and direct event among human or avian influenza viruses. NS1 and hnRNP-F co-localize in the nucleus of host cells, and the RNA-binding domain of NS1 directly interacts with the GY-rich region of hnRNP-F determined by GST pull-down assays with truncated proteins. Importantly, hnRNP-F expression levels in host cells indicate regulatory role on virus replication. hnRNP-F depletion by small interfering RNA (siRNA) shows 10- to 100-fold increases in virus titers corresponding to enhanced viral RNA polymerase activity. Our results delineate novel mechanism of action by which NS1 accelerates influenza virus replication by modulating normal cellular mRNA processes through direct interaction with cellular hnRNP-F protein.

  19. Modulation of glycosylation and transport of viral membrane glycoproteins by a sodium ionophore

    PubMed Central


    Analysis of viral glycoprotein expression on surfaces of monensin- treated cells using a fluorescence-activated cell sorter (FACS) demonstrated that the sodium ionophore completely inhibited the appearance of the vesicular stomatitis virus (VSV) G protein on (Madin- Darby canine kidney) MDCK cell surfaces. In contrast, the expression of the influenza virus hemagglutinin (HA) glycoprotein on the surfaces of MDCK cells was observed to occur at high levels, and the time course of its appearance was not altered by the ionophore. Viral protein synthesis was not inhibited by monensin in either VSV- or influenza virus-infected cells. However, the electrophoretic mobilities of viral glycoproteins were altered, and analysis of pronase-derived glycopeptides by gel filtration indicated that the addition of sialic acid residues to the VSV G protein was impaired in monensin-treated cells. Reduced incorporation of fucose and galactose into influenza virus HA was observed in the presence of the ionophore, but the incompletely processed HA protein was cleaved, transported to the cell surface, and incorporated into budding virus particles. In contrast to the differential effects of monensin on VSV and influenza virus replication previously observed in monolayer cultures of MDCK cells, yields of both viruses were found to be significantly reduced by high concentrations of monensin in suspension cultures, indicating that cellular architecture may play a role in determining the sensitivity of virus replication to the drug. Nigericin, an ionophore that facilitates transport of potassium ions across membranes, blocked the replication of both influenza virus and VSV in MDCK cell monolayers, indicating that the ion specificity of ionophores influences their effect on the replication of enveloped viruses. PMID:6309867

  20. Viral modulators of cullin RING ubiquitin ligases: culling the host defense.


    Barry, Michele; Früh, Klaus


    Cullin RING ubiquitin ligases (CRULs) are found in all eukaryotes and play an essential role in targeting proteins for ubiquitin-mediated destruction, thus regulating a plethora of cellular processes. Viruses manipulate CRULs by redirecting this destruction machinery to eliminate unwanted host cell proteins, thus allowing viruses to slip past host immune barriers. Depending on the host organism, virus-modified CRULs can perform an amazing range of tasks, including the elimination of crucial signal transduction molecules in the human interferon pathway and suppression of virus-induced gene silencing in plants. This Perspective summarizes recent advances in our understanding of how viral proteins manipulate the function of CRULs.

  1. Vitamin D modulation of innate immune responses to respiratory viral infections.


    Zdrenghea, Mihnea T; Makrinioti, Heidi; Bagacean, Cristina; Bush, Andy; Johnston, Sebastian L; Stanciu, Luminita A


    Vitamin D, in addition to its classical functions in bone homeostasis, has a modulatory and regulatory role in multiple processes, including host defense, inflammation, immunity, and epithelial repair. Patients with respiratory disease are frequently deficient in vitamin D, implying that supplementation might provide significant benefit to these patients. Respiratory viral infections are common and are the main trigger of acute exacerbations and hospitalization in children and adults with asthma and other airways diseases. Respiratory monocytes/macrophages and epithelial cells constitutively express the vitamin D receptor. Vitamin D, acting through this receptor, may be important in protection against respiratory infections. Whether the in vitro findings can be translated into a substantial in vivo benefit still remains uncertain. Here we review the in vitro data on the role of vitamin D in antiviral innate immunity, the data concerning the deficient levels of vitamin D in lung diseases, and the in vivo role of supplementation as protection against respiratory viral infections in healthy individuals and in patients with chronic respiratory diseases. Finally, we suggest ways of improving the effectiveness of vitamin D as an adjuvant in the prevention and treatment of acute respiratory infections.

  2. Human parainfluenza virus infection of the airway epithelium: viral hemagglutinin-neuraminidase regulates fusion protein activation and modulates infectivity.


    Palermo, Laura M; Porotto, Matteo; Yokoyama, Christine C; Palmer, Samantha G; Mungall, Bruce A; Greengard, Olga; Niewiesk, Stefan; Moscona, Anne


    Three discrete activities of the paramyxovirus hemagglutinin-neuraminidase (HN) protein, receptor binding, receptor cleaving (neuraminidase), and triggering of the fusion protein, each affect the promotion of viral fusion and entry. For human parainfluenza virus type 3 (HPIV3), the effects of specific mutations that alter these functions of the receptor-binding protein have been well characterized using cultured monolayer cells, which have identified steps that are potentially relevant to pathogenesis. In the present study, proposed mechanisms that are relevant to pathogenesis were tested in natural host cell cultures, a model of the human airway epithelium (HAE) in which primary HAE cells are cultured at an air-liquid interface and retain functional properties. Infection of HAE cells with wild-type HPIV3 and variant viruses closely reflects that seen in an animal model, the cotton rat, suggesting that HAE cells provide an ideal system for assessing the interplay of host cell and viral factors in pathogenesis and for screening for inhibitory molecules that would be effective in vivo. Both HN's receptor avidity and the function and timing of F activation by HN require a critical balance for the establishment of ongoing infection in the HAE, and these HN functions independently modulate the production of active virions. Alterations in HN's F-triggering function lead to the release of noninfectious viral particles and a failure of the virus to spread. The finding that the dysregulation of F triggering prohibits successful infection in HAE cells suggests that antiviral strategies targeted to HN's F-triggering activity may have promise in vivo.

  3. C-Myc regulation by costimulatory signals modulates the generation of CD8+ memory T cells during viral infection.


    Haque, Mohammad; Song, Jianyong; Fino, Kristin; Wang, Youfei; Sandhu, Praneet; Song, Xinmeng; Norbury, Christopher; Ni, Bing; Fang, Deyu; Salek-Ardakani, Shahram; Song, Jianxun


    The signalling mechanisms of costimulation in the development of memory T cells remain to be clarified. Here, we show that the transcription factor c-Myc in CD8(+) T cells is controlled by costimulatory molecules, which modulates the development of memory CD8(+) T cells. C-Myc expression was dramatically reduced in Cd28(-/-) or Ox40(-/-) memory CD8(+) T cells, and c-Myc over-expression substantially reversed the defects in the development of T-cell memory following viral infection. C-Myc regulated the expression of survivin, an inhibitor of apoptosis, which promoted the generation of virus-specific memory CD8(+) T cells. Moreover, over-expression of survivin with bcl-xL, a downstream molecule of NF-κB and intracellular target of costimulation that controls survival, in Cd28(-/-) or Ox40(-/-) CD8(+) T cells, reversed the defects in the generation of memory T cells in response to viral infection. These results identify c-Myc as a key controller of memory CD8(+) T cells from costimulatory signals. © 2016 The Authors.

  4. Vinexin β Interacts with Hepatitis C Virus NS5A, Modulating Its Hyperphosphorylation To Regulate Viral Propagation

    PubMed Central

    Xiong, Wei; Yang, Jie; Wang, Mingzhen; Wang, Hailong; Rao, Zhipeng; Zhong, Cheng; Xin, Xiu; Mo, Lin; Yu, Shujuan


    ABSTRACT Hepatitis C virus (HCV) nonstructural protein 5A (NS5A) is essential for HCV genome replication and virion production and is involved in the regulation of multiple host signaling pathways. As a proline-rich protein, NS5A is capable of interacting with various host proteins containing Src homology 3 (SH3) domains. Previous studies have suggested that vinexin, a member of the sorbin homology (SoHo) adaptor family, might be a potential binding partner of NS5A by yeast two-hybrid screening. However, firm evidence for this interaction is lacking, and the significance of vinexin in the HCV life cycle remains unclear. In this study, we demonstrated that endogenously and exogenously expressed vinexin β coimmunoprecipitated with NS5A derived from different HCV genotypes. Two residues, tryptophan (W307) and tyrosine (Y325), in the third SH3 domain of vinexin β and conserved Pro-X-X-Pro-X-Arg motifs at the C terminus of NS5A were indispensable for the vinexin-NS5A interaction. Furthermore, downregulation of endogenous vinexin β significantly suppressed NS5A hyperphosphorylation and decreased HCV replication, which could be rescued by expressing a vinexin β short hairpin RNA-resistant mutant. We also found that vinexin β modulated the hyperphosphorylation of NS5A in a casein kinase 1α-dependent on manner. Taken together, our findings suggest that vinexin β modulates NS5A phosphorylation via its interaction with NS5A, thereby regulating HCV replication, implicating vinexin β in the viral life cycle. IMPORTANCE Hepatitis C virus (HCV) nonstructural protein NS5A is a phosphoprotein, and its phosphorylation states are usually modulated by host kinases and other viral nonstructural elements. Additionally, cellular factors containing Src homology 3 (SH3) domains have been reported to interact with proline-rich regions of NS5A. However, it is unclear whether there are any relationships between NS5A phosphorylation and the NS5A-SH3 interaction, and little is known

  5. Immunological, Viral, Environmental, and Individual Factors Modulating Lung Immune Response to Respiratory Syncytial Virus

    PubMed Central

    Bottau, Paolo; Faldella, Giacomo


    Respiratory syncytial virus is a worldwide pathogen agent responsible for frequent respiratory tract infections that may become severe and potentially lethal in high risk infants and adults. Several studies have been performed to investigate the immune response that determines the clinical course of the infection. In the present paper, we review the literature on viral, environmental, and host factors influencing virus response; the mechanisms of the immune response; and the action of nonimmunological factors. These mechanisms have often been studied in animal models and in the present review we also summarize the main findings obtained from animal models as well as the limits of each of these models. Understanding the lung response involved in the pathogenesis of these respiratory infections could be useful in improving the preventive strategies against respiratory syncytial virus. PMID:26064963

  6. Immunological, Viral, Environmental, and Individual Factors Modulating Lung Immune Response to Respiratory Syncytial Virus.


    Vandini, Silvia; Bottau, Paolo; Faldella, Giacomo; Lanari, Marcello


    Respiratory syncytial virus is a worldwide pathogen agent responsible for frequent respiratory tract infections that may become severe and potentially lethal in high risk infants and adults. Several studies have been performed to investigate the immune response that determines the clinical course of the infection. In the present paper, we review the literature on viral, environmental, and host factors influencing virus response; the mechanisms of the immune response; and the action of nonimmunological factors. These mechanisms have often been studied in animal models and in the present review we also summarize the main findings obtained from animal models as well as the limits of each of these models. Understanding the lung response involved in the pathogenesis of these respiratory infections could be useful in improving the preventive strategies against respiratory syncytial virus.

  7. The Human Metapneumovirus Small Hydrophobic Protein Has Properties Consistent with Those of a Viroporin and Can Modulate Viral Fusogenic Activity

    PubMed Central

    Masante, Cyril; El Najjar, Farah; Chang, Andres; Jones, Angela; Moncman, Carole L.


    ABSTRACT Human metapneumovirus (HMPV) encodes three glycoproteins: the glycoprotein, which plays a role in glycosaminoglycan binding, the fusion (F) protein, which is necessary and sufficient for both viral binding to the target cell and fusion between the cellular plasma membrane and the viral membrane, and the small hydrophobic (SH) protein, whose function is unclear. The SH protein of the closely related respiratory syncytial virus has been suggested to function as a viroporin, as it forms oligomeric structures consistent with a pore and alters membrane permeability. Our analysis indicates that both the full-length HMPV SH protein and the isolated SH protein transmembrane domain can associate into higher-order oligomers. In addition, HMPV SH expression resulted in increases in permeability to hygromycin B and alteration of subcellular localization of a fluorescent dye, indicating that SH affects membrane permeability. These results suggest that the HMPV SH protein has several characteristics consistent with a putative viroporin. Interestingly, we also report that expression of the HMPV SH protein can significantly decrease HMPV F protein-promoted membrane fusion activity, with the SH extracellular domain and transmembrane domain playing a key role in this inhibition. These results suggest that the HMPV SH protein could regulate both membrane permeability and fusion protein function during viral infection. IMPORTANCE Human metapneumovirus (HMPV), first identified in 2001, is a causative agent of severe respiratory tract disease worldwide. The small hydrophobic (SH) protein is one of three glycoproteins encoded by all strains of HMPV, but the function of the HMPV SH protein is unknown. We have determined that the HMPV SH protein can alter the permeability of cellular membranes, suggesting that HMPV SH is a member of a class of proteins termed viroporins, which modulate membrane permeability to facilitate critical steps in a viral life cycle. We also demonstrated

  8. Innate immune interactions within the central nervous system modulate pathogenesis of viral infections

    PubMed Central

    Nair, Sharmila; Diamond, Michael S.


    The innate immune system mediates protection against neurotropic viruses that replicate in the central nervous system (CNS). Virus infection within specific cells of the CNS triggers activation of several families of pattern recognition receptors including Toll-like receptors, retinoic acid-inducible gene 1 like receptors, nucleotide-binding oligomerization domain-like receptors, and cytosolic DNA sensors. In this review, we highlight recent advances in our understanding of how cell-intrinsic host defenses within the CNS modulate infection of different DNA and RNA viruses. PMID:26163762

  9. Modulation of Microglial Cell Fcγ Receptor Expression Following Viral Brain Infection

    PubMed Central

    Chauhan, Priyanka; Hu, Shuxian; Sheng, Wen S.; Prasad, Sujata; Lokensgard, James R.


    Fcγ receptors (FcγRs) for IgG couple innate and adaptive immunity through activation of effector cells by antigen-antibody complexes. We investigated relative levels of activating and inhibitory FcγRs on brain-resident microglia following murine cytomegalovirus (MCMV) infection. Flow cytometric analysis of microglial cells obtained from infected brain tissue demonstrated that activating FcγRs were expressed maximally at 5 d post-infection (dpi), while the inhibitory receptor (FcγRIIB) remained highly elevated during both acute and chronic phases of infection. The highly induced expression of activating FcγRIV during the acute phase of infection was also noteworthy. Furthermore, in vitro analysis using cultured primary microglia demonstrated the role of interferon (IFN)γ and interleukin (IL)-4 in polarizing these cells towards a M1 or M2 phenotype, respectively. Microglial cell-polarization correlated with maximal expression of either FcγRIV or FcγRIIB following stimulation with IFNγ or IL-4, respectively. Finally, we observed a significant delay in polarization of microglia towards an M2 phenotype in the absence of FcγRs in MCMV-infected Fcer1g and FcgR2b knockout mice. These studies demonstrate that neuro-inflammation following viral infection increases expression of activating FcγRs on M1-polarized microglia. In contrast, expression of the inhibitory FcγRIIB receptor promotes M2-polarization in order to shut-down deleterious immune responses and limit bystander brain damage. PMID:28165503

  10. Modulation of the Host Environment by Human Cytomegalovirus with Viral Interleukin 10 in Peripheral Blood.


    Young, Vivian P; Mariano, Margarette C; Tu, Carolyn C; Allaire, Kathryn M; Avdic, Selmir; Slobedman, Barry; Spencer, Juliet V


    Human cytomegalovirus (HCMV) is a herpesvirus with both lytic and latent life cycles. Human cytomegalovirus encodes 2 viral cytokines that are orthologs of human cellular interleukin 10 (cIL-10). Both cytomegalovirus interleukin 10 (cmvIL-10) and Latency-associated cytomegalovirus interleukin 10 (LAcmvIL-10) (collectively vIL-10) are expressed during lytic infection and cause immunosuppressive effects that impede virus clearance. LAcmvIL-10 is also expressed during latent infection of myeloid progenitor cells and monocytes and facilitates persistence. Here, we investigated whether vIL-10 could be detected during natural infection. Plasma from healthy blood donors was tested by enzyme-linked immunosorbent assay for anti-HCMV immunoglobulin G and immunoglobulin M and for cIL-10 and vIL-10 levels using a novel vIL-10 assay that detects cmvIL-10 and LAcmvIL-10, with no cross-reactivity to cIL-10. vIL-10 was evident in HCMV+ donors (n = 19 of 26), at levels ranging 31-547 pg/mL. By comparison, cIL-10 was detected at lower levels ranging 3-69 pg/mL. There was a strong correlation between vIL-10 and cIL-10 levels (P = .01). Antibodies against vIL-10 were also detected and neutralized vIL-10 activity. vIL-10 was detected in peripheral blood of healthy blood donors. These findings suggest that vIL-10 may play a key role in sensing or modifying the host environment during latency and, therefore, may be a potential target for intervention strategies.

  11. N-Glycans on the Nipah Virus Attachment Glycoprotein Modulate Fusion and Viral Entry as They Protect against Antibody Neutralization

    PubMed Central

    Biering, Scott B.; Huang, Andrew; Vu, Andy T.; Robinson, Lindsey R.; Bradel-Tretheway, Birgit; Choi, Eric


    Nipah virus (NiV) is the deadliest known paramyxovirus. Membrane fusion is essential for NiV entry into host cells and for the virus' pathological induction of cell-cell fusion (syncytia). The mechanism by which the attachment glycoprotein (G), upon binding to the cell receptors ephrinB2 or ephrinB3, triggers the fusion glycoprotein (F) to execute membrane fusion is largely unknown. N-glycans on paramyxovirus glycoproteins are generally required for proper protein conformational integrity, transport, and sometimes biological functions. We made conservative mutations (Asn to Gln) at the seven potential N-glycosylation sites in the NiV G ectodomain (G1 to G7) individually or in combination. Six of the seven N-glycosylation sites were found to be glycosylated. Moreover, pseudotyped virions carrying these N-glycan mutants had increased antibody neutralization sensitivities. Interestingly, our results revealed hyperfusogenic and hypofusogenic phenotypes for mutants that bound ephrinB2 at wild-type levels, and the mutant's cell-cell fusion phenotypes generally correlated to viral entry levels. In addition, when removing multiple N-glycans simultaneously, we observed synergistic or dominant-negative membrane fusion phenotypes. Interestingly, our data indicated that 4- to 6-fold increases in fusogenicity resulted from multiple mechanisms, including but not restricted to the increase of F triggering. Altogether, our results suggest that NiV-G N-glycans play a role in shielding virions against antibody neutralization, while modulating cell-cell fusion and viral entry via multiple mechanisms. PMID:22915812

  12. Residue 82 of the Chikungunya Virus E2 Attachment Protein Modulates Viral Dissemination and Arthritis in Mice

    PubMed Central

    Ashbrook, Alison W.; Burrack, Kristina S.; Silva, Laurie A.; Montgomery, Stephanie A.; Heise, Mark T.; Morrison, Thomas E.


    CHIKV pathogenesis, we probed the function of an amino acid polymorphism in the E2 viral attachment protein using a mouse model of CHIKV musculoskeletal disease. In addition to influencing glycosaminoglycan utilization, we identified roles for this polymorphism in differential infection of mammalian and mosquito cells and targeting of CHIKV to specific tissues within infected mice. These studies demonstrate a correlation between CHIKV tissue tropism and virus-induced pathology modulated by a single polymorphism in E2, which in turn illuminates potential targets for vaccine and antiviral drug development. PMID:25142598

  13. Effects of herbal medicinal formulas on suppressing viral replication and modulating immune responses.


    Liao, Hui-Fen; Lu, Min-Chi; Chang, Hon-Chou; Wei, Cheng-Chung; Kao, Chih-Hsiung; Chen, Zong-Huei; Huang, Chin-Chin; Li, Ching


    The Chinese medicinal herbs Radix Isatidis and Viola yedoensis Makino have been suggested to possess antiviral activity. This study tests whether these and other Chinese and Western herbal medicinal formulas can modulate the immune functions involving virus-suppression in BALB/c mouse. We first confirmed the extract from Viola yedoensis Makino, but not from Radix Isatidis, the traditional Chinese medicine (TCM) formula Chui-Uren-Chien (CUC), or a Western homeopathic medicinal drink Método Canova, could inhibit the replications of herpes simplex virus-1 and enterovirus 71 in the human neuroblastoma SK-N-SH cell line. Subsequently, the same herbal extracts and drink underwent toxicity and immunomodulatory tests on mice of 5-7 weeks old. After 8 weeks of feeding different herbal medicinal formulas, no hepatic or renal toxicity was noted in any tested animal; whereas among the immune function evaluations, only the mice treated with CUC extract were found to be associated with significant increases (p < 0.05) in both the level of plasma IgG and the percentage of monocyte in blood mononuclear cells as well as the activation of macrophage Raw264.7 cells for nitric oxide production, suggesting its role in modulating the non-specific immune response. Analyses using protein arrays showed CUC was the most potent herbal medicinal formula eliciting fluctuations in plasma cytokine and chemokine concentrations. Taking all experimental data together, we conclude Chui-Uren-Chien possesses immunomodulatory capability in mouse, but none of the herbal medicinal formulas tested here are involved in strengthening antiviral immunity.

  14. A CD83-like molecule in sea bass (Dicentrarchus labrax): molecular characterization and modulation by viral and bacterial infection.


    Buonocore, Francesco; Randelli, Elisa; Tranfa, Paola; Scapigliati, Giuseppe


    The CD83 cell surface marker is an important and intriguing component of immune system. It is considered the best marker for mature human dendritic cells, but it is also important for thymic development of T cells, and it also plays a role as a regulator of peripheral B-cell function and homeostasis. A CD83-like molecule was identified in sea bass (Dicentrarchus labrax) by EST sequencing of a thymus cDNA library; the CD83 cDNA is composed of 816 bp and the mature CD83 peptide consists of 195 amino acids, with a putative signal peptide of 18 amino acids and two possible N-glycosylation sites. The comparison of sea bass CD83 sequence with its homologues in other fish species and mammals shows some differences, with two cysteine residues conserved from fish to mammals and a high variability both in the total number of cysteines and in mature CD83 sequence polypeptide length. Basal transcripts levels of CD83 mRNA are highest in liver, followed by thymus. The in vitro treatment of head kidney leukocytes with LPS resulted in a down-regulation on CD83 mRNA leves both after 4 and 24 h, whereas with poly I:C an up-regulation after 4h followed by a down-regulation at 24 h was observed. An in vivo infection of sea bass juveniles with nodavirus induced an increase of CD83 expression on head kidney leukocytes both after 6 and 24 h and a decrease after 72 h. On the other hand, an in vivo infection with Photobacterium damselae bacteria induced a decrease of CD83 transcript levels after 6 and 24 h and an increase after 72 h. These findings suggest in sea bass CD83 expression could be modulated by viral and bacterial immune response.

  15. Modulation of HIV-1 Gag NC/p1 cleavage efficiency affects protease inhibitor resistance and viral replicative capacity.


    van Maarseveen, Noortje M; Andersson, Dan; Lepšík, Martin; Fun, Axel; Schipper, Pauline J; de Jong, Dorien; Boucher, Charles A B; Nijhuis, Monique


    Mutations in the substrate of HIV-1 protease, especially changes in the NC/p1 cleavage site, can directly contribute to protease inhibitor (PI) resistance and also compensate for defects in viral replicative capacity (RC) due to a drug resistant protease. These NC/p1 changes are known to enhance processing of the Gag protein. To investigate the capacity of HIV-1 to modulate Gag cleavage and its consequences for PI resistance and RC, we performed a detailed enzymatic and virological analysis using a set of PI resistant NC/p1 variants (HXB2431V, HXB2436E+437T, HXB2437T and HXB2437V). Here, we demonstrate that single NC/p1 mutants, which displayed only a slight increase in PI resistance did not show an obvious change in RC. In contrast, the double NC/p1 mutant, which displayed a clear increase in processing efficiency and PI resistance, demonstrated a clear reduction in RC. Cleavage analysis showed that a tridecameric NC/p1 peptide representing the double NC/p1 mutant was cleaved in two specific ways instead of one.The observed decrease in RC for the double NC/p1 mutant (HXB2436E+437T) could (partially) be restored by either reversion of the 436E change or by acquisition of additional changes in the NC/p1 cleavage site at codon 435 or 438 as was revealed during in vitro evolution experiments. These changes not only restored RC but also reduced PI resistance levels. Furthermore these changes normalized Gag processing efficiency and obstructed the novel secondary cleavage site observed for the double NC/p1 mutant. The results of this study clearly demonstrate that HIV-1 can modulate Gag processing and thereby PI resistance. Distinct increases in Gag cleavage and PI resistance result in a reduced RC that can only be restored by amino acid changes in NC/p1 which reduce Gag processing to an optimal rate.

  16. The acetyltransferase Tip60 is a critical regulator of the differentiation-dependent amplification of human papillomaviruses.


    Hong, Shiyuan; Dutta, Anindya; Laimins, Laimonis A


    The life cycle of human papillomaviruses (HPVs) is dependent upon differentiation of the infected host epithelial cell as well as activation of the ataxia telangiectasia mutated (ATM) DNA repair pathway that in normal cells acts to repair double-strand DNA breaks. In normal cells, following DNA damage the acetyltransferase Tip60 must acetylate ATM proteins prior to their full activation by autophosphorylation. E6 proteins have been shown to induce the degradation of Tip60, suggesting that Tip60 action may not be required for activation of the ATM pathway in HPV-positive cells. We investigated what role, if any, Tip60 plays in regulating the differentiation-dependent HPV life cycle. Our study indicates that Tip60 levels and activity are increased in cells that stably maintain complete HPV genomes as episomes, while low levels are seen in cells that express only HPV E6 and E7 proteins. Knockdown of Tip60 with short hairpin RNAs in cells that maintain HPV episomes blocked ATM induction and differentiation-dependent genome amplification, demonstrating the critical role of Tip60 in the viral life cycle. The JAK/STAT transcription factor STAT-5 has previously been shown to regulate the phosphorylation of ATM. Our studies demonstrate that STAT-5 regulates Tip60 activation and this occurs in part by targeting glycogen synthase kinase 3β (GSK3β). Inhibition of either STAT-5, Tip60, or GSK3β blocked differentiation-dependent genome amplification. Taken together, our findings identify Tip60 to be an important regulator of HPV genome amplification whose activity during the viral life cycle is controlled by STAT-5 and the kinase GSK3β. Human papillomaviruses (HPVs) are the etiological agents of cervical and other anogenital cancers. HPVs regulate their differentiation-dependent life cycle by activation of DNA damage pathways. This study demonstrates that HPVs regulate the ATM DNA damage pathway through the action of the acetyltransferase Tip60. Furthermore, the innate

  17. Inhibition of the host proteasome facilitates papaya ringspot virus accumulation and proteosomal catalytic activity is modulated by viral factor HcPro.


    Sahana, Nandita; Kaur, Harpreet; Basavaraj; Tena, Fatima; Jain, Rakesh Kumar; Palukaitis, Peter; Canto, Tomas; Praveen, Shelly


    The ubiquitin/26S proteasome system plays an essential role not only in maintaining protein turnover, but also in regulating many other plant responses, including plant-pathogen interactions. Previous studies highlighted different roles of the 20S proteasome in plant defense during virus infection, either indirectly through viral suppressor-mediated degradation of Argonaute proteins, affecting the RNA interference pathway, or directly through modulation of the proteolytic and RNase activity of the 20S proteasome, a component of the 20S proteasome, by viral proteins, affecting the levels of viral proteins and RNAs. Here we show that MG132, a cell permeable proteasomal inhibitor, caused an increase in papaya ringspot virus (PRSV) accumulation in its natural host papaya (Carica papaya). We also show that the PRSV HcPro interacts with the papaya homologue of the Arabidopsis PAA (α1 subunit of the 20S proteasome), but not with the papaya homologue of Arabidopsis PAE (α5 subunit of the 20S proteasome), associated with the RNase activity, although the two 20S proteasome subunits interacted with each other. Mutated forms of PRSV HcPro showed that the conserved KITC54 motif in the N-terminal domain of HcPro was necessary for its binding to PAA. Co-agroinfiltration assays demonstrated that HcPro expression mimicked the action of MG132, and facilitated the accumulation of bothtotal ubiquitinated proteins and viral/non-viral exogenous RNA in Nicotiana benthamiana leaves. These effects were not observed by using an HcPro mutant (KITS54), which impaired the HcPro - PAA interaction. Thus, the PRSV HcPro interacts with a proteasomal subunit, inhibiting the action of the 20S proteasome, suggesting that HcPro might be crucial for modulating its catalytic activities in support of virus accumulation.

  18. A novel coding-region RNA element modulates infectious dengue virus particle production in both mammalian and mosquito cells and regulates viral replication in Aedes aegypti mosquitoes

    PubMed Central

    Groat-Carmona, Anna Maria; Orozco, Susana; Friebe, Peter; Payne, Anne; Kramer, Laura; Harris, Eva


    Dengue virus (DENV) is an enveloped flavivirus with a positive-sense RNA genome transmitted by Aedes mosquitoes, causing the most important arthropod-borne viral disease affecting humans. Relatively few cis-acting RNA regulatory elements have been described in the DENV coding-region. Here, by introducing silent mutations into a DENV-2 infectious clone, we identify the conserved capsid-coding region 1 (CCR1), an RNA sequence element that regulates viral replication in mammalian cells and to a greater extent in Ae. albopictus mosquito cells. These defects were confirmed in vivo, resulting in decreased replication in Ae. aegypti mosquito bodies and dissemination to the salivary glands. Furthermore, CCR1 does not regulate translation, RNA synthesis or virion retention but likely modulates assembly, as mutations resulted in the release of non-infectious viral particles from both cell types. Understanding the role of CCR1 could help characterize the poorly-defined stage of assembly in the DENV life cycle and uncover novel anti-viral targets. PMID:22840606

  19. An intrinsically disordered peptide from Ebola virus VP35 controls viral RNA synthesis by modulating nucleoprotein-RNA interactions

    SciTech Connect

    Leung, Daisy  W.; Borek, Dominika; Luthra, Priya; Binning, Jennifer  M.; Anantpadma, Manu; Liu, Gai; Harvey, Ian B.; Su, Zhaoming; Endlich-Frazier, Ariel; Pan, Juanli; Shabman, Reed  S.; Chiu, Wah; Davey, Robert  A.; Otwinowski, Zbyszek; Basler, Christopher  F.; Amarasinghe, Gaya  K.


    During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNPNTD complex, solved to 3.7 Å resolution, reveals how NPBP peptide occludes a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.

  20. LIM Kinase 1 Modulates Cortical Actin and CXCR4 Cycling and Is Activated by HIV-1 to Initiate Viral Infection*

    PubMed Central

    Vorster, Paul J.; Guo, Jia; Yoder, Alyson; Wang, Weifeng; Zheng, Yanfang; Xu, Xuehua; Yu, Dongyang; Spear, Mark; Wu, Yuntao


    Almost all viral pathogens utilize a cytoskeleton for their entry and intracellular transport. In HIV-1 infection, binding of the virus to blood resting CD4 T cells initiates a temporal course of cortical actin polymerization and depolymerization, a process mimicking the chemotactic response initiated from chemokine receptors. The actin depolymerization has been suggested to promote viral intracellular migration through cofilin-mediated actin treadmilling. However, the role of the virus-mediated actin polymerization in HIV infection is unknown, and the signaling molecules involved remain unidentified. Here we describe a pathogenic mechanism for triggering early actin polymerization through HIV-1 envelope-mediated transient activation of the LIM domain kinase (LIMK), a protein that phosphorylates cofilin. We demonstrate that HIV-mediated LIMK activation is through gp120-triggered transient activation of the Rack-PAK-LIMK pathway, and that knockdown of LIMK through siRNA decreases filamentous actin, increases CXCR4 trafficking, and diminishes viral DNA synthesis. These results suggest that HIV-mediated early actin polymerization may directly regulate the CXCR4 receptor during viral entry and is involved in viral DNA synthesis. Furthermore, we also demonstrate that in resting CD4 T cells, actin polymerization can be triggered through transient treatment with a pharmacological agent, okadaic acid, that activates LIMK and promotes HIV latent infection of resting CD4 T cells. Taken together, our results suggest that HIV hijacks LIMK to control the cortical actin dynamics for the initiation of viral infection of CD4 T cells. PMID:21321123

  1. Small Interfering RNA Pathway Modulates Initial Viral Infection in Midgut Epithelium of Insect after Ingestion of Virus

    PubMed Central

    Lan, Hanhong; Chen, Hongyan; Liu, Yuyan; Jiang, Chaoyang; Mao, Qianzhuo; Jia, Dongsheng; Chen, Qian


    ABSTRACT Numerous viruses are transmitted in a persistent manner by insect vectors. Persistent viruses establish their initial infection in the midgut epithelium, from where they disseminate to the midgut visceral muscles. Although propagation of viruses in insect vectors can be controlled by the small interfering RNA (siRNA) antiviral pathway, whether the siRNA pathway can control viral dissemination from the midgut epithelium is unknown. Infection by a rice virus (Southern rice black streaked dwarf virus [SRBSDV]) of its incompetent vector (the small brown planthopper [SBPH]) is restricted to the midgut epithelium. Here, we show that the siRNA pathway is triggered by SRBSDV infection in continuously cultured cells derived from the SBPH and in the midgut of the intact insect. Knockdown of the expression of the core component Dicer-2 of the siRNA pathway by RNA interference strongly increased the ability of SRBSDV to propagate in continuously cultured SBPH cells and in the midgut epithelium, allowing viral titers in the midgut epithelium to reach the threshold (1.99 × 109 copies of the SRBSDV P10 gene/μg of midgut RNA) needed for viral dissemination into the SBPH midgut muscles. Our results thus represent the first elucidation of the threshold for viral dissemination from the insect midgut epithelium. Silencing of Dicer-2 further facilitated the transmission of SRBSDV into rice plants by SBPHs. Taken together, our results reveal the new finding that the siRNA pathway can control the initial infection of the insect midgut epithelium by a virus, which finally affects the competence of the virus's vector. IMPORTANCE Many viral pathogens that cause significant global health and agricultural problems are transmitted via insect vectors. The first bottleneck in viral infection, the midgut epithelium, is a principal determinant of the ability of an insect species to transmit a virus. Southern rice black streaked dwarf virus (SRBSDV) is restricted exclusively to the

  2. Viral Miniproteins

    PubMed Central

    DiMaio, Daniel


    Many viruses encode short transmembrane proteins that play vital roles in virus replication or virulence. Because these proteins are often less than 50 amino acids long and not homologous to cellular proteins, their open reading frames were often overlooked during the initial annotation of viral genomes. Some of these proteins oligomerize in membranes and form ion channels. Other miniproteins bind to cellular transmembrane proteins and modulate their activity, whereas still others have an unknown mechanism of action. Based on the underlying principles of transmembrane miniprotein structure, it is possible to build artificial small transmembrane proteins that modulate a variety of biological processes. These findings suggest that short transmembrane proteins provide a versatile mechanism to regulate a wide range of cellular activities, and we speculate that cells also express many similar proteins that have not yet been discovered. PMID:24742054

  3. Immunological Characterization of the Teleost Adipose Tissue and Its Modulation in Response to Viral Infection and Fat-Content in the Diet

    PubMed Central

    Pignatelli, Jaime; Castro, Rosario; González Granja, Aitor; Abós, Beatriz; González, Lucia; Jensen, Linda B.; Tafalla, Carolina


    The immune response of the adipose tissue (AT) has been neglected in most animal models until recently, when the observations made in human and mice linking obesity to chronic inflammation and diabetes highlighted an important immune component of this tissue. In the current study, we have immunologically characterized the AT for the first time in teleosts. We have analyzed the capacity of rainbow trout (Oncorhynchus mykiss) AT to produce different immune mediators and we have identified the presence of local populations of B lymphocytes expressing IgM, IgD or IgT, CD8α+ cells and cells expressing major histocompatibility complex II (MHC-II). Because trout AT retained antigens from the peritoneal cavity, we analyzed the effects of intraperitoneal infection with viral hemorrhagic septicemia virus (VHSV) on AT functionality. A wide range of secreted immune factors were modulated within the AT in response to VHSV. Furthermore, the viral infection provoked a significant decrease in the number of IgM+ cells which, along with an increased secretion of IgM in the tissue, suggested a differentiation of B cells into plasmablasts. The virus also increased the number of CD8α+ cells in the AT. Finally, when a fat-enriched diet was fed to the fish, a significant modulation of immune gene expression in the AT was also observed. Thus, we have demonstrated for the first time in teleost that the AT functions as a relevant immune tissue; responsive to peritoneal viral infections and that this immune response can be modulated by the fat-content in the diet. PMID:25333488

  4. An intrinsically disordered peptide from Ebola virus VP35 controls viral RNA synthesis by modulating nucleoprotein-RNA interactions


    Leung, Daisy  W.; Borek, Dominika; Luthra, Priya; ...


    During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNPNTD complex, solved to 3.7 Å resolution, reveals how NPBP peptide occludesmore » a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.« less

  5. Viral Infections


    ... to fight it off. For most viral infections, treatments can only help with symptoms while you wait ... for viral infections. There are antiviral medicines to treat some viral infections. Vaccines can help prevent you ...

  6. Human Choline Kinase-α Promotes Hepatitis C Virus RNA Replication through Modulation of Membranous Viral Replication Complex Formation

    PubMed Central

    Wong, Mun-Teng


    ABSTRACT Hepatitis C virus (HCV) infection reorganizes cellular membranes to create an active viral replication site named the membranous web (MW). The role that human choline kinase-α (hCKα) plays in HCV replication remains elusive. Here, we first showed that hCKα activity, not the CDP-choline pathway, promoted viral RNA replication. Confocal microscopy and subcellular fractionation of HCV-infected cells revealed that a small fraction of hCKα colocalized with the viral replication complex (RC) on the endoplasmic reticulum (ER) and that HCV infection increased hCKα localization to the ER. In the pTM-NS3-NS5B model, NS3-NS5B expression increased the localization of the wild-type, not the inactive D288A mutant, hCKα on the ER, and hCKα activity was required for effective trafficking of hCKα and NS5A to the ER. Coimmunoprecipitation showed that hCKα was recruited onto the viral RC presumably through its binding to NS5A domain 1 (D1). hCKα silencing or treatment with CK37, an hCKα activity inhibitor, abolished HCV-induced MW formation. In addition, hCKα depletion hindered NS5A localization on the ER, interfered with NS5A and NS5B colocalization, and mitigated NS5A-NS5B interactions but had no apparent effect on NS5A-NS4B and NS4B-NS5B interactions. Nevertheless, hCKα activity was not essential for the binding of NS5A to hCKα or NS5B. These findings demonstrate that hCKα forms a complex with NS5A and that hCKα activity enhances the targeting of the complex to the ER, where hCKα protein, not activity, mediates NS5A binding to NS5B, thereby promoting functional membranous viral RC assembly and viral RNA replication. IMPORTANCE HCV infection reorganizes the cellular membrane to create an active viral replication site named the membranous web (MW). Here, we report that human choline kinase-α (hCKα) acts as an essential host factor for HCV RNA replication. A fraction of hCKα colocalizes with the viral replication complex (RC) on the endoplasmic reticulum

  7. Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.


    Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei


    DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

  8. Three types of human CpG motifs differentially modulate and augment immunogenicity of nonviral and viral replicon DNA vaccines as built-in adjuvants.


    Yu, Yun-Zhou; Li, Na; Ma, Yao; Wang, Shuang; Yu, Wei-Yuan; Sun, Zhi-Wei


    NakedDNA vaccines given by intramuscular injection are efficient in mouse models, but they require improvement for human use. As the immunogenicity of DNA vaccines depends, to a large extent, on the presence of CpG motifs as built-in adjuvants, we addressed this issue by inserting three types of human CpG motifs (A-type, B-type, and C-type) into the backbone of nonviral DNA and viral DNA replicon vectors with distinct immunostimulatory activities on human PBMCs. The adjuvant effects of CpG modifications in DNA vaccines expressing three types of antigens (β-Gal, AHc, or PA4) were then characterized in mice and found to significantly enhance antigen-specific humoral and cell-mediated immune responses. The three types of CpG motifs also differentially affected and modulated immune responses and protective potency against botulinum neurotoxin serotype A and Bacillus anthracis A16R challenge. Taken together, these results demonstrate that insertion of human CpG motifs can differentially modulate the immunogenicity of nonviral DNA vaccines as well as viral DNA replicon vaccines. Our study provides not only a better understanding of the in vivo activities of CpG motif adjuvants but implications for the rational design of such motifs as built-in adjuvants for DNA vectors targeting specific antigens.

  9. Temporal and spatial expression of the E5a protein during the differentiation-dependent life cycle of human papillomavirus type 31b.


    Mayer, T J; Meyers, C


    Human papillomaviruses (HPVs) are epitheliotropic viruses, and their life cycle is intimately linked to the stratification and differentiation state of the host epithelial tissues. Defining a role for the E5 gene product in the differentiation-dependent viral life cycle has been difficult due to the lack of a suitable culture system. We used the organotypic (raft) culture system to investigate the spatial and temporal expression pattern of the E5 protein during the differentiation-dependent life cycle of HPV-31b. We report the generation of antisera specific to the HPV-31b E5a protein. The HPV-31b E5a protein was detected throughout the viral life cycle in raft cultures as determined by immunostaining analyses, and the protein was localized predominantly to the basal and granular layers. Expression of epidermal growth factor receptor or platelet-derived growth factor receptors, two proteins with which E5 has been shown to interact in cell culture, did not specifically colocalize with E5a expression. However, HPV-31b E5a expression did colocalize with the epithelial differentiation-specific marker filaggrin. The kinetics of E5a protein expression during the complete viral life cycle was analyzed by immunoblotting, and the highest level was found to be coincidental with the onset of virion morphogenesis. Copyright 1998 Academic Press.

  10. Modulation of Type I Interferon-Associated Viral Sensing during Acute Simian Immunodeficiency Virus Infection in African Green Monkeys

    PubMed Central

    Jochems, Simon P.; Petitjean, Gaël; Kunkel, Désirée; Liovat, Anne-Sophie; Ploquin, Mickaël J.; Barré-Sinoussi, Françoise; Lebon, Pierre; Jacquelin, Béatrice


    ABSTRACT Natural hosts of simian immunodeficiency virus (SIV), such as African green monkeys (AGMs), do not progress to AIDS when infected with SIV. This is associated with an absence of a chronic type I interferon (IFN-I) signature. It is unclear how the IFN-I response is downmodulated in AGMs. We longitudinally assessed the capacity of AGM blood cells to produce IFN-I in response to SIV and herpes simplex virus (HSV) infection. Phenotypes and functions of plasmacytoid dendritic cells (pDCs) and other mononuclear blood cells were assessed by flow cytometry, and expression of viral sensors was measured by reverse transcription-PCR. pDCs displayed low BDCA-2, CD40, and HLA-DR expression levels during AGM acute SIV (SIVagm) infection. BDCA-2 was required for sensing of SIV, but not of HSV, by pDCs. In acute infection, AGM peripheral blood mononuclear cells (PBMCs) produced less IFN-I upon SIV stimulation. In the chronic phase, the production was normal, confirming that the lack of chronic inflammation is not due to a sensing defect of pDCs. In contrast to stimulation by SIV, more IFN-I was produced upon HSV stimulation of PBMCs isolated during acute infection, while the frequency of AGM pDCs producing IFN-I upon in vitro stimulation with HSV was diminished. Indeed, other cells started producing IFN-I. This increased viral sensing by non-pDCs was associated with an upregulation of Toll-like receptor 3 and IFN-γ-inducible protein 16 caused by IFN-I in acute SIVagm infection. Our results suggest that, as in pathogenic SIVmac infection, SIVagm infection mobilizes bone marrow precursor pDCs. Moreover, we show that SIV infection modifies the capacity of viral sensing in cells other than pDCs, which could drive IFN-I production in specific settings. IMPORTANCE The effects of HIV/SIV infections on the capacity of plasmacytoid dendritic cells (pDCs) to produce IFN-I in vivo are still incompletely defined. As IFN-I can restrict viral replication, contribute to inflammation

  11. TMV-Cg Coat Protein stabilizes DELLA proteins and in turn negatively modulates salicylic acid-mediated defense pathway during Arabidopsis thaliana viral infection

    PubMed Central


    Background Plant viral infections disturb defense regulatory networks during tissue invasion. Emerging evidence demonstrates that a significant proportion of these alterations are mediated by hormone imbalances. Although the DELLA proteins have been reported to be central players in hormone cross-talk, their role in the modulation of hormone signaling during virus infections remains unknown. Results This work revealed that TMV-Cg coat protein (CgCP) suppresses the salicylic acid (SA) signaling pathway without altering defense hormone SA or jasmonic acid (JA) levels in Arabidopsis thaliana. Furthermore, it was observed that the expression of CgCP reduces plant growth and delays the timing of floral transition. Quantitative RT-qPCR analysis of DELLA target genes showed that CgCP alters relative expression of several target genes, indicating that the DELLA proteins mediate transcriptional changes produced by CgCP expression. Analyses by fluorescence confocal microscopy showed that CgCP stabilizes DELLA proteins accumulation in the presence of gibberellic acid (GA) and that the DELLA proteins are also stabilized during TMV-Cg virus infections. Moreover, DELLA proteins negatively modulated defense transcript profiles during TMV-Cg infection. As a result, TMV-Cg accumulation was significantly reduced in the quadruple-DELLA mutant Arabidopsis plants compared to wild type plants. Conclusions Taken together, these results demonstrate that CgCP negatively regulates the salicylic acid-mediated defense pathway by stabilizing the DELLA proteins during Arabidopsis thaliana viral infection, suggesting that CgCP alters the stability of DELLAs as a mechanism of negative modulation of antiviral defense responses. PMID:25084837

  12. TMV-Cg Coat Protein stabilizes DELLA proteins and in turn negatively modulates salicylic acid-mediated defense pathway during Arabidopsis thaliana viral infection.


    Rodriguez, Maria Cecilia; Conti, Gabriela; Zavallo, Diego; Manacorda, Carlos Augusto; Asurmendi, Sebastian


    Plant viral infections disturb defense regulatory networks during tissue invasion. Emerging evidence demonstrates that a significant proportion of these alterations are mediated by hormone imbalances. Although the DELLA proteins have been reported to be central players in hormone cross-talk, their role in the modulation of hormone signaling during virus infections remains unknown. This work revealed that TMV-Cg coat protein (CgCP) suppresses the salicylic acid (SA) signaling pathway without altering defense hormone SA or jasmonic acid (JA) levels in Arabidopsis thaliana. Furthermore, it was observed that the expression of CgCP reduces plant growth and delays the timing of floral transition. Quantitative RT-qPCR analysis of DELLA target genes showed that CgCP alters relative expression of several target genes, indicating that the DELLA proteins mediate transcriptional changes produced by CgCP expression. Analyses by fluorescence confocal microscopy showed that CgCP stabilizes DELLA proteins accumulation in the presence of gibberellic acid (GA) and that the DELLA proteins are also stabilized during TMV-Cg virus infections. Moreover, DELLA proteins negatively modulated defense transcript profiles during TMV-Cg infection. As a result, TMV-Cg accumulation was significantly reduced in the quadruple-DELLA mutant Arabidopsis plants compared to wild type plants. Taken together, these results demonstrate that CgCP negatively regulates the salicylic acid-mediated defense pathway by stabilizing the DELLA proteins during Arabidopsis thaliana viral infection, suggesting that CgCP alters the stability of DELLAs as a mechanism of negative modulation of antiviral defense responses.

  13. Host Cellular Protein TRAPPC6AΔ Interacts with Influenza A Virus M2 Protein and Regulates Viral Propagation by Modulating M2 Trafficking.


    Zhu, Pengyang; Liang, Libin; Shao, Xinyuan; Luo, Weiyu; Jiang, Shuitao; Zhao, Qingqing; Sun, Nan; Zhao, Yuhui; Li, Junping; Wang, Jinguang; Zhou, Yuan; Zhang, Jie; Wang, Guangwen; Jiang, Li; Chen, Hualan; Li, Chengjun


    Influenza A virus (IAV) matrix protein 2 (M2) plays multiple roles in the early and late phases of viral infection. Once synthesized, M2 is translocated to the endoplasmic reticulum (ER), travels to the Golgi apparatus, and is sorted at the trans-Golgi network (TGN) for transport to the apical plasma membrane, where it functions in virus budding. We hypothesized that M2 trafficking along with its secretory pathway must be finely regulated, and host factors could be involved in this process. However, no studies examining the role of host factors in M2 posttranslational transport have been reported. Here, we used a yeast two-hybrid (Y2H) system to screen for host proteins that interact with the M2 protein and identified transport protein particle complex 6A (TRAPPC6A) as a potential binding partner. We found that both TRAPPC6A and its N-terminal internal-deletion isoform, TRAPPC6A delta (TRAPPC6AΔ), interact with M2. Truncation and mutation analyses showed that the highly conserved leucine residue at position 96 of M2 is critical for mediating this interaction. The role of TRAPPC6AΔ in the viral life cycle was investigated by the knockdown of endogenous TRAPPC6AΔ with small interfering RNA (siRNA) and by generating a recombinant virus that was unable to interact with TRAPPC6A/TRAPPC6AΔ. The results indicated that TRAPPC6AΔ, through its interaction with M2, slows M2 trafficking to the apical plasma membrane, favors viral replication in vitro, and positively modulates virus virulence in mice. The influenza A virus M2 protein regulates the trafficking of not only other proteins but also itself along the secretory pathway. However, the host factors involved in the regulation of the posttranslational transport of M2 are largely unknown. In this study, we identified TRAPPC6A and its N-terminal internal-deletion isoform, TRAPPC6AΔ, as interacting partners of M2. We found that the leucine (L) residue at position 96 of M2 is critical for mediating this interaction

  14. Host Cellular Protein TRAPPC6AΔ Interacts with Influenza A Virus M2 Protein and Regulates Viral Propagation by Modulating M2 Trafficking

    PubMed Central

    Zhu, Pengyang; Liang, Libin; Shao, Xinyuan; Luo, Weiyu; Jiang, Shuitao; Zhao, Qingqing; Sun, Nan; Zhao, Yuhui; Li, Junping; Wang, Jinguang; Zhou, Yuan; Zhang, Jie; Wang, Guangwen; Jiang, Li


    ABSTRACT Influenza A virus (IAV) matrix protein 2 (M2) plays multiple roles in the early and late phases of viral infection. Once synthesized, M2 is translocated to the endoplasmic reticulum (ER), travels to the Golgi apparatus, and is sorted at the trans-Golgi network (TGN) for transport to the apical plasma membrane, where it functions in virus budding. We hypothesized that M2 trafficking along with its secretory pathway must be finely regulated, and host factors could be involved in this process. However, no studies examining the role of host factors in M2 posttranslational transport have been reported. Here, we used a yeast two-hybrid (Y2H) system to screen for host proteins that interact with the M2 protein and identified transport protein particle complex 6A (TRAPPC6A) as a potential binding partner. We found that both TRAPPC6A and its N-terminal internal-deletion isoform, TRAPPC6A delta (TRAPPC6AΔ), interact with M2. Truncation and mutation analyses showed that the highly conserved leucine residue at position 96 of M2 is critical for mediating this interaction. The role of TRAPPC6AΔ in the viral life cycle was investigated by the knockdown of endogenous TRAPPC6AΔ with small interfering RNA (siRNA) and by generating a recombinant virus that was unable to interact with TRAPPC6A/TRAPPC6AΔ. The results indicated that TRAPPC6AΔ, through its interaction with M2, slows M2 trafficking to the apical plasma membrane, favors viral replication in vitro, and positively modulates virus virulence in mice. IMPORTANCE The influenza A virus M2 protein regulates the trafficking of not only other proteins but also itself along the secretory pathway. However, the host factors involved in the regulation of the posttranslational transport of M2 are largely unknown. In this study, we identified TRAPPC6A and its N-terminal internal-deletion isoform, TRAPPC6AΔ, as interacting partners of M2. We found that the leucine (L) residue at position 96 of M2 is critical for mediating

  15. Genomic analysis of host - Peste des petits ruminants vaccine viral transcriptome uncovers transcription factors modulating immune regulatory pathways.


    Manjunath, Siddappa; Kumar, Gandham Ravi; Mishra, Bishnu Prasad; Mishra, Bina; Sahoo, Aditya Prasad; Joshi, Chaitanya G; Tiwari, Ashok K; Rajak, Kaushal Kishore; Janga, Sarath Chandra


    Peste des petits ruminants (PPR), is an acute transboundary viral disease of economic importance, affecting goats and sheep. Mass vaccination programs around the world resulted in the decline of PPR outbreaks. Sungri 96 is a live attenuated vaccine, widely used in Northern India against PPR. This vaccine virus, isolated from goat works efficiently both in sheep and goat. Global gene expression changes under PPR vaccine virus infection are not yet well defined. Therefore, in this study we investigated the host-vaccine virus interactions by infecting the peripheral blood mononuclear cells isolated from goat with PPRV (Sungri 96 vaccine virus), to quantify the global changes in the transcriptomic signature by RNA-sequencing. Viral genome of Sungri 96 vaccine virus was assembled from the PPRV infected transcriptome confirming the infection and demonstrating the feasibility of building a complete non-host genome from the blood transcriptome. Comparison of infected transcriptome with control transcriptome revealed 985 differentially expressed genes. Functional analysis showed enrichment of immune regulatory pathways under PPRV infection. Key genes involved in immune system regulation, spliceosomal and apoptotic pathways were identified to be dysregulated. Network analysis revealed that the protein - protein interaction network among differentially expressed genes is significantly disrupted in infected state. Several genes encoding TFs that govern immune regulatory pathways were identified to co-regulate the differentially expressed genes. These data provide insights into the host - PPRV vaccine virus interactome for the first time. Our findings suggested dysregulation of immune regulatory pathways and genes encoding Transcription Factors (TFs) that govern these pathways in response to viral infection.

  16. Regulation of human papillomavirus transcription by the differentiation-dependent epithelial factor Epoc-1/skn-1a.


    Yukawa, K; Butz, K; Yasui, T; Kikutani, H; Hoppe-Seyler, F


    Human papillomavirus (HPV) early gene expression is closely linked to the differentiation status of infected epithelial cells. Typically, HPV type 16 (HPV16) or HPV18 E6 and E7 transcripts are only barely detectable within the undifferentiated basal cell layer, but their levels increase concomitantly with higher degrees of epithelial cell differentiation in suprabasal cells. A similar differentiation-dependent distribution of expression has been reported for the recently cloned epithelial cell specific transcription factor Epoc-1/skn-1a. We therefore examined whether Epoc-1/skn-1a may be directly involved in the activation of HPV E6/E7 transcription. Transient transfection studies showed that Epoc-1/skn-1a specifically stimulated the HPV16 and HPV18 E6/E7 promoters. Moreover, ectopically expressed Epoc-1/skn-1a was sufficient to stimulate HPV transcription also in nonepithelial cells. By deletion analyses, the Epoc-1/skn-1a-responsive element was mapped to the promoter-proximal portion of the HPV18 transcriptional control region. Footprint analyses and gel retardation assays demonstrated direct binding of Epoc-1/skn-1a to a hitherto uncharacterized site within this region. Mutation of the Epoc-1/skn-1a recognition site within the context of the complete HPV18 upstream regulatory region inhibited Epoc-1/skn-1a-mediated transactivation. These results show that Epoc-1/skn-1a can directly activate the E6/E7 promoter by binding to the viral transcriptional control region. Thus, Epoc-1/skn-1a may be involved in the differentiation-dependent regulation of HPV transcription.

  17. Regulation of human papillomavirus transcription by the differentiation-dependent epithelial factor Epoc-1/skn-1a.

    PubMed Central

    Yukawa, K; Butz, K; Yasui, T; Kikutani, H; Hoppe-Seyler, F


    Human papillomavirus (HPV) early gene expression is closely linked to the differentiation status of infected epithelial cells. Typically, HPV type 16 (HPV16) or HPV18 E6 and E7 transcripts are only barely detectable within the undifferentiated basal cell layer, but their levels increase concomitantly with higher degrees of epithelial cell differentiation in suprabasal cells. A similar differentiation-dependent distribution of expression has been reported for the recently cloned epithelial cell specific transcription factor Epoc-1/skn-1a. We therefore examined whether Epoc-1/skn-1a may be directly involved in the activation of HPV E6/E7 transcription. Transient transfection studies showed that Epoc-1/skn-1a specifically stimulated the HPV16 and HPV18 E6/E7 promoters. Moreover, ectopically expressed Epoc-1/skn-1a was sufficient to stimulate HPV transcription also in nonepithelial cells. By deletion analyses, the Epoc-1/skn-1a-responsive element was mapped to the promoter-proximal portion of the HPV18 transcriptional control region. Footprint analyses and gel retardation assays demonstrated direct binding of Epoc-1/skn-1a to a hitherto uncharacterized site within this region. Mutation of the Epoc-1/skn-1a recognition site within the context of the complete HPV18 upstream regulatory region inhibited Epoc-1/skn-1a-mediated transactivation. These results show that Epoc-1/skn-1a can directly activate the E6/E7 promoter by binding to the viral transcriptional control region. Thus, Epoc-1/skn-1a may be involved in the differentiation-dependent regulation of HPV transcription. PMID:8523512

  18. Hepatitis C virus envelope glycoprotein signatures are associated with treatment failure and modulation of viral entry and neutralization.


    Schvoerer, Evelyne; Moenne-Loccoz, Rémy; Murray, John M; Velay, Aurélie; Turek, Marine; Fofana, Isabel; Fafi-Kremer, Samira; Erba, Anne-Claire; Habersetzer, François; Doffoël, Michel; Gut, Jean-Pierre; Donlin, Maureen J; Tavis, John E; Zeisel, Mirjam B; Stoll-Keller, Françoise; Baumert, Thomas F


    A major challenge for antiviral treatment of hepatitis C virus (HCV) infection is viral resistance, potentially resulting from the high variability of HCV envelope glycoproteins and subsequent selection of strains with enhanced infectivity and/or immune escape. We used a bioinformatics and functional approach to investigate whether E1/E2 envelope glycoprotein structure and function were associated with treatment failure in 92 patients infected with HCV genotype 1. Bioinformatics analysis identified 1 sustain virological response (R)-related residue in E1 (219T) and 2 non-SVR (NR)-related molecular signatures in E2 (431A and 642V) in HCV genotype 1a. Two of these positions also appeared in minimal networks separating NR patients from R patients. HCV pseudoparticles (HCVpp) expressing 431A and 642V resulted in a decrease in antibody-mediated neutralization by pretreatment sera. 431A/HCVpp entry into Huh7.5 cells increased with overexpression of CD81 and SR-BI. Moreover, an association of envelope glycoprotein signatures with treatment failure was confirmed in an independent cohort (Virahep-C). Combined in silico and functional analyses demonstrate that envelope glycoprotein signatures associated with treatment failure result in an alteration of host cell entry factor use and escape from neutralizing antibodies, suggesting that virus-host interactions during viral entry contribute to treatment failure.

  19. Bovine viral diarrhea virus type 2 in vivo infection modulates TLR4 responsiveness in differentiated myeloid cells which is associated with decreased MyD88 expression.


    Schaut, Robert G; McGill, Jodi L; Neill, John D; Ridpath, Julia F; Sacco, Randy E


    Symptoms of bovine viral diarrhea virus (BVDV) infection range from subclinical to severe, depending on strain virulence. Several in vitro studies showed BVDV infection impaired leukocyte function. Fewer studies have examined the effects of in vivo BVDV infection on monocyte/macrophage function, especially with strains of differing virulence. We characterized cytokine production by bovine myeloid cells isolated early or late in high (HV) or low virulence (LV) BVDV2 infection. Given BVDV infection may enhance susceptibility to secondary bacterial infection, LPS responses were examined as well. Monocytes from HV and LV infected calves produced higher levels of cytokines compared to cells from controls. In contrast, monocyte-derived macrophage cytokine levels were generally reduced. Modulated cytokine expression in HV BVDV2 macrophages was associated with decreased MyD88 expression, likely due to its interaction with viral NS5A. These data and those of others, suggest that certain Flaviviridae may have evolved strategies for subverting receptor signaling pathways involving MyD88.

  20. Alternative splicing of human immunodeficiency virus type 1 mRNA modulates viral protein expression, replication, and infectivity.

    PubMed Central

    Purcell, D F; Martin, M A


    Multiple RNA splicing sites exist within human immunodeficiency virus type 1 (HIV-1) genomic RNA, and these sites enable the synthesis of many mRNAs for each of several viral proteins. We evaluated the biological significance of the alternatively spliced mRNA species during productive HIV-1 infections of peripheral blood lymphocytes and human T-cell lines to determine the potential role of alternative RNA splicing in the regulation of HIV-1 replication and infection. First, we used a semiquantitative polymerase chain reaction of cDNAs that were radiolabeled for gel analysis to determine the relative abundance of the diverse array of alternatively spliced HIV-1 mRNAs. The predominant rev, tat, vpr, and env RNAs contained a minimum of noncoding sequence, but the predominant nef mRNAs were incompletely spliced and invariably included noncoding exons. Second, the effect of altered RNA processing was measured following mutagenesis of the major 5' splice donor and several cryptic, constitutive, and competing 3' splice acceptor motifs of HIV-1NL4-3. Mutations that ablated constitutive splice sites led to the activation of new cryptic sites; some of these preserved biological function. Mutations that ablated competing splice acceptor sites caused marked alterations in the pool of virus-derived mRNAs and, in some instances, in virus infectivity and/or the profile of virus proteins. The redundant RNA splicing signals in the HIV-1 genome and alternatively spliced mRNAs provides a mechanism for regulating the relative proportions of HIV-1 proteins and, in some cases, viral infectivity. Images PMID:8411338

  1. The structure of mouse cytomegalovirus m04 protein obtained from sparse NMR data reveals a conserved fold of the m02-m06 viral immune modulator family.


    Sgourakis, Nikolaos G; Natarajan, Kannan; Ying, Jinfa; Vogeli, Beat; Boyd, Lisa F; Margulies, David H; Bax, Ad


    Immunoevasins are key proteins used by viruses to subvert host immune responses. Determining their high-resolution structures is key to understanding virus-host interactions toward the design of vaccines and other antiviral therapies. Mouse cytomegalovirus encodes a unique set of immunoevasins, the m02-m06 family, that modulates major histocompatibility complex class I (MHC-I) antigen presentation to CD8+ T cells and natural killer cells. Notwithstanding the large number of genetic and functional studies, the structural biology of immunoevasins remains incompletely understood, largely because of crystallization bottlenecks. Here we implement a technology using sparse nuclear magnetic resonance data and integrative Rosetta modeling to determine the structure of the m04/gp34 immunoevasin extracellular domain. The structure reveals a β fold that is representative of the m02-m06 family of viral proteins, several of which are known to bind MHC-I molecules and interfere with antigen presentation, suggesting its role as a diversified immune regulation module.

  2. Viral pneumonia


    ... Names Pneumonia - viral; Walking pneumonia - viral Images Lungs Respiratory system References Lee FE, Treanor JJ. Viral infections. In: Broaddus VC, Mason RJ, Ernst JD, et al, eds. Murray and Nadel's Textbook of Respiratory Medicine . 6th ed. Philadelphia, PA: Elsevier Saunders; 2016: ...

  3. Human CD64-targeted non-viral siRNA delivery system for blood monocyte gene modulation

    PubMed Central

    Yong, Seok-Beom; Kim, Hyung Jin; Kim, Jang Kyoung; Chung, Jee Young; Kim, Yong-Hee


    A subset of phagocytes including inflammatory monocytes in blood migrate and give rise to macrophages in inflammatory tissues which generated the idea that blood monocytes are the therapeutic targets for drug delivery. Fc gamma receptor I (CD64) is a membrane receptor for the Fc region of immunoglobulin G, primarily expressed on monocyte-lineage, and H22 a monoclonal antibody for human CD64 had shown rapid blood monocyte binding and occupation in clinical studies. Small interfering RNA-mediated gene silencing as a therapeutic has been proposed and is a promising strategy in terms of its “knock-down” ability on the target gene prior to translation. However, its instability and off-targeting effect must be overcome for success in clinical studies. In this study, we developed a non-viral delivery system composed of oligo-nona-arginine (9R) and anti-human CD64 single chain antibodies (H22) for human monocyte-specific siRNA delivery. A targeted and efficient siRNA delivery mediated by anti-CD64 scFv-9R was observed in CD64 positive human leukemia cells, THP-1. With primary human blood cells, anti-CD64 scFv-9R mediated gene silencing was quantitatively confirmed representing blood monocyte selective gene delivery. These results demonstrate the potential of anti-CD64 scFv-9R mediated siRNA delivery for the treatment of human inflammatory diseases via blood monocytes gene delivery. PMID:28169353

  4. Interleukin-37 Ameliorates Coxsackievirus B3-induced Viral Myocarditis by Modulating the Th17/Regulatory T cell Immune Response.


    An, Bang; Liu, Xuefei; Li, Ge; Yuan, Haitao


    Myocarditis is a heterogeneous group of disorders defined by inflammation of the heart muscle with an excessively activated immune response. Numerous interventions have been investigated for the treatment of myocarditis while success is limited. Interleukin-37 (IL-37), a novel member of the IL-1 cytokine family, is a natural inhibitor of innate immunity associated with autoimmune diseases. However, the modulatory effect of IL-37 in myocarditis is unknown. In this study, we investigated the immunological regulation of IL-37 in the coxsackievirus B3-induced model of murine viral myocarditis. The results show that IL-37 significantly ameliorates the signs of myocarditis with increased survival rate and bodyweight, improved histological changes, reduced activities of MB isoenzyme of creatine kinase and cardiac troponin I, and a suppressed response of Th17 cells and enhanced response of regulatory T cells (Tregs) in the spleen. Moreover, IL-37 down-regulates the expression of Th17-related cytokines IL-6 and IL-17A, while promoting Treg-related cytokine IL-10 levels in the heart. Therefore, IL-37 may exhibit anti-inflammatory activity in the murine model of myocarditis by regulating the balance between Th17 and Treg cells, thereby providing a possible novel therapeutic target in myocarditis.

  5. Modulation of NKG2D-mediated cytotoxic functions of natural killer cells by viral protein R from HIV-1 primary isolates.


    Pham, Tram N Q; Richard, Jonathan; Gerard, Francine C A; Power, Christopher; Cohen, Éric A


    HIV-1 viral protein R (Vpr) from laboratory-adapted virus strains activates the DNA damage/stress sensor ATR kinase and induces cell cycle arrest at the G(2)/M phase through a process that requires Vpr to engage the DDB1-CUL4A (VprBP/DCAF-1) E3 ligase complex. Activation of this DNA damage/stress checkpoint in G(2) by Vpr was shown to modulate NKG2D-dependent NK cell effector functions via enhancing expression of NKG2D ligands, notably ULBP2. However, it is unknown whether Vpr from HIV-1 primary isolates (groups M, N, O, and P) could modulate NKG2D-mediated cytotoxic functions of NK cells. Here, we report that Vpr from most HIV-1 primary isolates can upregulate ULBP2 expression and induce NKG2D-dependent NK cell killing. Importantly, these activities were always accompanied by an active G(2) cell cycle arrest function. Interestingly, Vpr variants from group P and a clade D isolate of group M were defective at enhancing NKG2D-mediated NK cell lysis owing to their inability to augment ULBP2 expression. However, distinct mechanisms were responsible for their failure to do so. While Vpr from group P was deficient in its ability to engage the DDB1-CUL4A (VprBP/DCAF-1) E3 ligase complex, the Vpr variant from group D was unable to properly localize to the nucleus, underlining the importance of these biological properties in Vpr function. In conclusion, the ability of Vpr from HIV-1 primary isolates to regulate NK cell effector function underscores the importance of this HIV-1 accessory protein in the modulation of the host's innate immune responses.

  6. Arabidopsis m(6)A demethylase activity modulates viral infection of a plant virus and the m(6)A abundance in its genomic RNAs.


    Martínez-Pérez, Mireya; Aparicio, Frederic; López-Gresa, Maria Pilar; Bellés, Jose María; Sánchez-Navarro, Jesus A; Pallás, Vicente


    N(6)-methyladenosine (m(6)A) is an internal, reversible nucleotide modification that constitutes an important regulatory mechanism in RNA biology. Unlike mammals and yeast, no component of the m(6)A cellular machinery has been described in plants at present. m(6)A has been identified in the genomic RNAs of diverse mammalian viruses and, additionally, viral infection was found to be modulated by the abundance of m(6)A in viral RNAs. Here we show that the Arabidopsis thaliana protein atALKBH9B (At2g17970) is a demethylase that removes m(6)A from single-stranded RNA molecules in vitro. atALKBH9B accumulates in cytoplasmic granules, which colocalize with siRNA bodies and associate with P bodies, suggesting that atALKBH9B m(6)A demethylase activity could be linked to mRNA silencing and/or mRNA decay processes. Moreover, we identified the presence of m(6)A in the genomes of two members of the Bromoviridae family, alfalfa mosaic virus (AMV) and cucumber mosaic virus (CMV). The demethylation activity of atALKBH9B affected the infectivity of AMV but not of CMV, correlating with the ability of atALKBH9B to interact (or not) with their coat proteins. Suppression of atALKBH9B increased the relative abundance of m(6)A in the AMV genome, impairing the systemic invasion of the plant, while not having any effect on CMV infection. Our findings suggest that, as recently found in animal viruses, m(6)A modification may represent a plant regulatory strategy to control cytoplasmic-replicating RNA viruses.

  7. Mechanisms of viral mutation.


    Sanjuán, Rafael; Domingo-Calap, Pilar


    The remarkable capacity of some viruses to adapt to new hosts and environments is highly dependent on their ability to generate de novo diversity in a short period of time. Rates of spontaneous mutation vary amply among viruses. RNA viruses mutate faster than DNA viruses, single-stranded viruses mutate faster than double-strand virus, and genome size appears to correlate negatively with mutation rate. Viral mutation rates are modulated at different levels, including polymerase fidelity, sequence context, template secondary structure, cellular microenvironment, replication mechanisms, proofreading, and access to post-replicative repair. Additionally, massive numbers of mutations can be introduced by some virus-encoded diversity-generating elements, as well as by host-encoded cytidine/adenine deaminases. Our current knowledge of viral mutation rates indicates that viral genetic diversity is determined by multiple virus- and host-dependent processes, and that viral mutation rates can evolve in response to specific selective pressures.

  8. Human papillomaviruses activate and recruit SMC1 cohesin proteins for the differentiation-dependent life cycle through association with CTCF insulators.


    Mehta, Kavi; Gunasekharan, Vignesh; Satsuka, Ayano; Laimins, Laimonis A


    Human papillomaviruses infect stratified epithelia and link their productive life cycle to the differentiation state of the host cell. Productive viral replication or amplification is restricted to highly differentiated suprabasal cells and is dependent on the activation of the ATM DNA damage pathway. The ATM pathway has three arms that can act independently of one another. One arm is centered on p53, another on CHK2 and a third on SMC1/NBS1 proteins. A role for CHK2 in HPV genome amplification has been demonstrated but it was unclear what other factors provided important activities. The cohesin protein, SMC1, is necessary for sister chromatid association prior to mitosis. In addition the phosphorylated form of SMC1 plays a critical role together with NBS1 in the ATM DNA damage response. In normal cells, SMC1 becomes phosphorylated in response to radiation, however, in HPV positive cells our studies demonstrate that it is constitutively activated. Furthermore, pSMC1 is found localized in distinct nuclear foci in complexes with γ-H2AX, and CHK2 and bound to HPV DNA. Importantly, knockdown of SMC1 blocks differentiation-dependent genome amplification. pSMC1 forms complexes with the insulator transcription factor CTCF and our studies show that these factors bind to conserved sequence motifs in the L2 late region of HPV 31. Similar motifs are found in most HPV types. Knockdown of CTCF with shRNAs blocks genome amplification and mutation of the CTCF binding motifs in the L2 open reading frame inhibits stable maintenance of viral episomes in undifferentiated cells as well as amplification of genomes upon differentiation. These findings suggest a model in which SMC1 factors are constitutively activated in HPV positive cells and recruited to viral genomes through complex formation with CTCF to facilitate genome amplification. Our findings identify both SMC1 and CTCF as critical regulators of the differentiation-dependent life cycle of high-risk human papillomaviruses.

  9. Surface-Engineered Contact Lens as an Advanced Theranostic Platform for Modulation and Detection of Viral Infection.


    Mak, Wing Cheung; Cheung, Kwan Yee; Orban, Jenny; Lee, Chyan-Jang; Turner, Anthony P F; Griffith, May


    We have demonstrated an entirely new concept of a wearable theranostic device in the form of a contact lens (theranostic lens) with a dual-functional hybrid surface to modulate and detect a pathogenic attack, using a the corneal HSV serotype-1 (HSV-1) model. The theranostic lenses were constructed using a facile layer-by-layer surface engineering technique, keeping the theranostic lenses with good surface wettability, optically transparency, and nontoxic toward human corneal epithelial cells. The theranostic lenses were used to capture and concentrate inflammatory cytokines such as interleukin-1α (IL-1α), which is upregulated during HSV-1 reactivation, for sensitive, noninvasive diagnostics. The theranostic lens also incorporated an antiviral coating to serve as a first line of defense to protect patients against disease. Our strategy tackles major problems in tear diagnostics that are mainly associated with the sampling of a relatively small volume of fluid and the low concentration of biomarkers. The theranostic lenses show effective anti-HSV-1 activity and good analytical performance for the detection of IL-1α, with a limit of detection of 1.43 pg mL(-1) and a wide linear range covering the clinically relevant region. This work offers a new paradigm for "wearable" noninvasive healthcare devices combining "diagnosis" and "protection" against disease, while supporting patient compliance. We believe that this approach holds immense promise as a next-generation point-of-care and decentralized diagnostic/theranostic platform for a range of biomarkers.

  10. Identification of adeno-associated viral vectors suitable for intestinal gene delivery and modulation of experimental colitis.


    Polyak, Steven; Mach, Annette; Porvasnik, Stacy; Dixon, Lisa; Conlon, Thomas; Erger, Kirsten E; Acosta, Andres; Wright, Amy J; Campbell-Thompson, Martha; Zolotukhin, Irene; Wasserfall, Clive; Mah, Cathryn


    Effective gene transfer with sustained gene expression is an important adjunct to the study of intestinal inflammation and future therapy in inflammatory bowel disease. Recombinant adeno-associated virus (AAV) vectors are ideal for gene transfer and long-term transgene expression. The purpose of our study was to identify optimal AAV pseudotypes for transduction of the epithelium in the small intestine and colon, which could be used for studies in experimental colitis. The tropism and transduction efficiencies of AAV pseudotypes 1-10 were examined in murine small intestine and colon 8 wk after administration by real-time PCR and immunohistochemistry. The clinical and histopathological effects of IL-10-mediated intestinal transduction delivered by AAVrh10 were examined in the murine IL-10⁻/⁻ enterocolitis model. Serum IL-10 levels and IL-10 expression were followed by ELISA and real-time PCR, respectively. AAV pseudotypes 4, 7, 8, 9, and 10 demonstrated optimal intestinal transduction. Transgene expression was sustained 8 wk after administration and was frequently observed in enteroendocrine cells. Long-term IL-10 gene expression and serum IL-10 levels were observed following AAV transduction in an IL-10-/- model of enterocolitis. Animals treated with AAVrh10-IL-10 had lower disease activity index scores, higher colon weight-to-length ratios, and lower microscopic inflammation scores. This study identifies novel AAV pseudotypes with small intestine and colon tropism and sustained transgene expression capable of modulating mucosal inflammation in a murine model of enterocolitis.

  11. Viral arthritides.


    Outhred, Alexander C; Kok, Jen; Dwyer, Dominic E


    Viral infections may manifest as acute or chronic arthritis. Joint involvement arises from either direct infection of the joint, through an immunological response directed towards the virus or autoimmunity. Epidemiological clues to the diagnosis include geographic location and exposure to vector-borne, blood-borne or sexually transmitted viruses. Although not always possible, it is important to diagnose the pathogenic virus, usually by serology, nucleic acid tests or rarely, viral culture. In general, viral arthritides are self-limiting and treatment is targeted at symptomatic relief. This article focuses on the causes, clinical features, diagnosis and treatment of viral arthritides.

  12. Shrimp STAT was hijacked by white spot syndrome virus immediate-early protein IE1 involved in modulation of viral genes.


    Yao, Defu; Ruan, Lingwei; Lu, Huasong; Shi, Hong; Xu, Xun


    STATs are a family of transcription factors that regulate a cascade of cellular processes including cell growth, differentiation, apoptosis and immune responses. However, they are usually targeted by viruses to assist infection. In this study, we identified that white spot syndrome virus (WSSV) immediate-early protein IE1 interacted with Litopenaeus vannamei STAT (LvSTAT) and thereby led to its phosphorylation activation. In addition, we demonstrated that LvSTAT could bind to the promoters of the viral immediate-early genes wsv051 and ie1 through STAT-binding motifs in vitro and vivo, allowing the enhancement of their promoters' activities. Moreover, IE1 could promote the transcriptional activation activity of LvSTAT to augment the transcription of wsv051 and ie1. In conclusion, our findings revealed a novel linkage between WSSV IE1 and shrimp STAT, which was a clue to well understand how WSSV adopted the active strategies to modulate the shrimp signaling pathway.

  13. PERK Signal-Modulated Protein Translation Promotes the Survivability of Dengue 2 Virus-Infected Mosquito Cells and Extends Viral Replication.


    Hou, Jiun-Nan; Chen, Tien-Huang; Chiang, Yi-Hsuan; Peng, Jing-Yun; Yang, Tsong-Han; Cheng, Chih-Chieh; Sofiyatun, Eny; Chiu, Cheng-Hsun; Chiang-Ni, Chuan; Chen, Wei-June


    Survival of mosquitoes from dengue virus (DENV) infection is a prerequisite of viral transmission to the host. This study aimed to see how mosquito cells can survive the infection during prosperous replication of the virus. In C6/36 cells, global protein translation was shut down after infection by DENV type 2 (DENV2). However, it returned to a normal level when infected cells were treated with an inhibitor of the protein kinase RNA (PKR)-like ER kinase (PERK) signaling pathway. Based on a 7-Methylguanosine 5'-triphosphate (m7GTP) pull-down assay, the eukaryotic translation initiation factor 4F (eIF4F) complex was also identified in DENV2-infected cells. This suggests that most mosquito proteins are synthesized via canonical cap-dependent translation. When the PERK signal pathway was inhibited, both accumulation of reactive oxygen species and changes in the mitochondrial membrane potential increased. This suggested that ER stress response was alleviated through the PERK-mediated shutdown of global proteins in DENV2-infected C6/36 cells. In the meantime, the activities of caspases-9 and -3 and the apoptosis-related cell death rate increased in C6/36 cells with PERK inhibition. This reflected that the PERK-signaling pathway is involved in determining cell survival, presumably by reducing DENV2-induced ER stress. Looking at the PERK downstream target, α-subunit of eukaryotic initiation factor 2 (eIF2α), an increased phosphorylation status was only shown in infected C6/36 cells. This indicated that recruitment of ribosome binding to the mRNA 5'-cap structure could have been impaired in cap-dependent translation. It turned out that shutdown of cellular protein translation resulted in a pro-survival effect on mosquito cells in response to DENV2 infection. As synthesis of viral proteins was not affected by the PERK signal pathway, an alternate mode other than cap-dependent translation may be utilized. This finding provides insights into elucidating how the PERK signal

  14. Viral arthritis


    Infectious arthritis - viral ... Arthritis may be a symptom of many virus-related illnesses. It usually disappears on its own without ... the rubella vaccine, only a few people develop arthritis. No risk factors are known.

  15. Viral Meningitis


    ... Resources for Healthcare Professionals Related Links Vaccine Schedules Preteen & Teen Vaccines Meningococcal Disease Sepsis Viral Meningitis Language: ... Arboviruses Lymphocytic Choriomeningitis Virus Related Links Vaccine Schedules Preteen & Teen ... Disease Sepsis Language: English Spanish ...

  16. Viral arthritis

    PubMed Central

    Marks, Michael; Marks, Jonathan L


    Acute-onset arthritis is a common clinical problem facing both the general clinician and the rheumatologist. A viral aetiology is though to be responsible for approximately 1% of all cases of acute arthritis with a wide range of causal agents recognised. The epidemiology of acute viral arthritis continues to evolve, with some aetiologies, such as rubella, becoming less common due to vaccination, while some vector-borne viruses have become more widespread. A travel history therefore forms an important part of the assessment of patients presenting with an acute arthritis. Worldwide, parvovirus B19, hepatitis B and C, HIV and the alphaviruses are among the most important causes of virally mediated arthritis. Targeted serological testing may be of value in establishing a diagnosis, and clinicians must also be aware that low-titre autoantibodies, such as rheumatoid factor and antinuclear antibody, can occur in the context of acute viral arthritis. A careful consideration of epidemiological, clinical and serological features is therefore required to guide clinicians in making diagnostic and treatment decisions. While most virally mediated arthritides are self-limiting some warrant the initiation of specific antiviral therapy. PMID:27037381

  17. Viral quasispecies.


    Andino, Raul; Domingo, Esteban


    New generation sequencing is greatly expanding the capacity to examine the composition of mutant spectra of viral quasispecies in infected cells and host organisms. Here we review recent progress in the understanding of quasispecies dynamics, notably the occurrence of intra-mutant spectrum interactions, and implications of fitness landscapes for virus adaptation and de-adaptation. Complementation or interference can be established among components of the same mutant spectrum, dependent on the mutational status of the ensemble. Replicative fitness relates to an optimal mutant spectrum that provides the molecular basis for phenotypic flexibility, with implications for antiviral therapy. The biological impact of viral fitness renders particularly relevant the capacity of new generation sequencing to establish viral fitness landscapes. Progress with experimental model systems is becoming an important asset to understand virus behavior in the more complex environments faced during natural infections.

  18. Viral quasispecies

    PubMed Central

    Andino, Raul; Domingo, Esteban


    New generation sequencing is greatly expanding the capacity to examine the composition of mutant spectra of viral quasispecies in infected cells and host organisms. Here we review recent progress in the understanding of quasispecies dynamics, notably the occurrence of intra-mutant spectrum interactions, and implications of fitness landscapes for virus adaptation and de-adaptation. Complementation or interference can be established among components of the same mutant spectrum, dependent on the mutational status of the ensemble. Replicative fitness relates to an optimal mutant spectrum that provides the molecular basis for phenotypic flexibility, with implications for antiviral therapy. The biological impact of viral fitness renders particularly relevant the capacity of new generation sequencing to establish viral fitness landscapes. Progress with experimental model systems is becoming an important asset to understand virus behavior in the more complex environments faced during natural infections. PMID:25824477

  19. Human Papillomaviruses Activate and Recruit SMC1 Cohesin Proteins for the Differentiation-Dependent Life Cycle through Association with CTCF Insulators

    PubMed Central

    Satsuka, Ayano; Laimins, Laimonis A.


    Human papillomaviruses infect stratified epithelia and link their productive life cycle to the differentiation state of the host cell. Productive viral replication or amplification is restricted to highly differentiated suprabasal cells and is dependent on the activation of the ATM DNA damage pathway. The ATM pathway has three arms that can act independently of one another. One arm is centered on p53, another on CHK2 and a third on SMC1/NBS1 proteins. A role for CHK2 in HPV genome amplification has been demonstrated but it was unclear what other factors provided important activities. The cohesin protein, SMC1, is necessary for sister chromatid association prior to mitosis. In addition the phosphorylated form of SMC1 plays a critical role together with NBS1 in the ATM DNA damage response. In normal cells, SMC1 becomes phosphorylated in response to radiation, however, in HPV positive cells our studies demonstrate that it is constitutively activated. Furthermore, pSMC1 is found localized in distinct nuclear foci in complexes with γ-H2AX, and CHK2 and bound to HPV DNA. Importantly, knockdown of SMC1 blocks differentiation-dependent genome amplification. pSMC1 forms complexes with the insulator transcription factor CTCF and our studies show that these factors bind to conserved sequence motifs in the L2 late region of HPV 31. Similar motifs are found in most HPV types. Knockdown of CTCF with shRNAs blocks genome amplification and mutation of the CTCF binding motifs in the L2 open reading frame inhibits stable maintenance of viral episomes in undifferentiated cells as well as amplification of genomes upon differentiation. These findings suggest a model in which SMC1 factors are constitutively activated in HPV positive cells and recruited to viral genomes through complex formation with CTCF to facilitate genome amplification. Our findings identify both SMC1 and CTCF as critical regulators of the differentiation-dependent life cycle of high-risk human papillomaviruses

  20. Viral Hepatitis


    ... with hepatitis? How does a pregnant woman pass hepatitis B virus to her baby? If I have hepatitis B, what does my baby need so that she ... Can I breastfeed my baby if I have hepatitis B? More information on viral hepatitis What is hepatitis? ...

  1. Snapshots: Chromatin Control of Viral Infection

    PubMed Central

    Knipe, David M.; Lieberman, Paul M.; Jung, Jae U.; McBride, Alison A.; Morris, Kevin V.; Ott, Melanie; Margolis, David; Nieto, Amelia; Nevels, Michael; Parks, Robin J.; Kristie, Thomas M.


    Like their cellular host counterparts, many invading viral pathogens must contend with, modulate, and utilize the host cell’s chromatin machinery to promote efficient lytic infection or control persistent-latent states. While not intended to be comprehensive, this review represents a compilation of conceptual snapshots of the dynamic interplay of viruses with the chromatin environment. Contributions focus on chromatin dynamics during infection, viral circumvention of cellular chromatin repression, chromatin organization of large DNA viruses, tethering and persistence, viral interactions with cellular chromatin modulation machinery, and control of viral latency-reactivation cycles. PMID:23217624

  2. Viral Dose and Immunosuppression Modulate the Progression of Acute BVDV-1 Infection in Calves: Evidence of Long Term Persistence after Intra-Nasal Infection

    PubMed Central

    Strong, Rebecca; La Rocca, Severina Anna; Paton, David; Bensaude, Emmanuelle; Sandvik, Torstein; Davis, Leanne; Turner, Jane; Drew, Trevor; Raue, Rudiger; Vangeel, Ilse; Steinbach, Falko


    Bovine viral diarrhoea virus (BVDV) infection of cattle causes a diverse range of clinical outcomes from being asymptomatic, or a transient mild disease, to producing severe cases of acute disease leading to death. Four groups of calves were challenged with a type 1 BVDV strain, originating from a severe outbreak of BVDV in England, to study the effect of viral dose and immunosuppression on the viral replication and transmission of BVDV. Three groups received increasing amounts of virus: Group A received 102.55TCID50/ml, group B 105.25TCID50/ml and group C 106.7TCID 50/ml. A fourth group (D) was inoculated with a medium dose (105.25TCID50/ml) and concomitantly treated with dexamethasone (DMS) to assess the effects of chemically induced immunosuppression. Naïve calves were added as sentinel animals to assess virus transmission. The outcome of infection was dose dependent with animals given a higher dose developing severe disease and more pronounced viral replication. Despite virus being shed by the low-dose infection group, BVD was not transmitted to sentinel calves. Administration of dexamethasone (DMS) resulted in more severe clinical signs, prolonged viraemia and virus shedding. Using PCR techniques, viral RNA was detected in blood, several weeks after the limit of infectious virus recovery. Finally, a recently developed strand-specific RT-PCR detected negative strand viral RNA, indicative of actively replicating virus, in blood samples from convalescent animals, as late as 85 days post inoculation. This detection of long term replicating virus may indicate the way in which the virus persists and/or is reintroduced within herds. PMID:25955849

  3. Induction of memory cytotoxic T cells to influenza A virus and subsequent viral clearance is not modulated by PB1-F2-dependent inflammasome activation

    PubMed Central

    Lee, Patricia (Hoi Yee); Bird, Nicola; MacKenzie-Kludas, Charley; Mansell, Ashley; Kedzierska, Katherine; Brown, Lorena; McAuley, Julie


    Expression of the viral virulence protein PB1-F2 during infection has been linked to NLRP3 inflammasome complex activation in macrophages and induction of early inflammatory events enhancing immunopathology during influenza disease. We sought to determine whether PB1-F2-specific NLRP3 inflammasome activation influenced the magnitude and/or robustness of the CD8+ T-cell responses specific for conserved viral antigens and subsequent virus elimination. Using murine heterosubtypic viral infection models, we showed that mice infected with virus unable to produce PB1-F2 protein showed no deficit in the overall magnitude and functional memory responses of CD8+ T cells established during the effector phase compared with those infected with wild-type PB1-F2-expressing virus and were equally capable of mounting robust recall responses. These data indicate that while expression of PB1-F2 protein can induce inflammatory events, the capacity to generate memory CD8+ T cells specific for immunodominant viral epitopes remains uncompromised. PMID:26667784

  4. Bovine viral diarrhea virus type 2 in vivo infection modulates TLR4 responsiveness in differentiated Myeloid cells which is associated with decreased MyD88 expression

    USDA-ARS?s Scientific Manuscript database

    Bovine viral diarrhea virus (BVDV) causes clinical signs in cattle ranging from mild to severe acute infection which can lead to increased susceptibility to secondary bacteria. In this study we examined the effects of BVDV genotype 2 (BVDV2) infection on the ability of myeloid lineage cells derived...

  5. The Influenza Virus H5N1 Infection Can Induce ROS Production for Viral Replication and Host Cell Death in A549 Cells Modulated by Human Cu/Zn Superoxide Dismutase (SOD1) Overexpression.


    Lin, Xian; Wang, Ruifang; Zou, Wei; Sun, Xin; Liu, Xiaokun; Zhao, Lianzhong; Wang, Shengyu; Jin, Meilin


    Highly pathogenic H5N1 infections are often accompanied by excessive pro-inflammatory response, high viral titer, and apoptosis; as such, the efficient control of these infections poses a great challenge. The pathogenesis of influenza virus infection is also related to oxidative stress. However, the role of endogenic genes with antioxidant effect in the control of influenza viruses, especially H5N1 viruses, should be further investigated. In this study, the H5N1 infection in lung epithelial cells decreased Cu/Zn superoxide dismutase (SOD1) expression at mRNA and protein levels. Forced SOD1 expression significantly inhibited the H5N1-induced increase in reactive oxygen species, decreased pro-inflammatory response, prevented p65 and p38 phosphorylation, and impeded viral ribonucleoprotein nuclear export and viral replication. The SOD1 overexpression also rescued H5N1-induced cellular apoptosis and alleviated H5N1-caused mitochondrial dysfunction. Therefore, this study described the role of SOD1 in the replication of H5N1 influenza virus and emphasized the relevance of this enzyme in the control of H5N1 replication in epithelial cells. Pharmacological modulation or targeting SOD1 may open a new way to fight H5N1 influenza virus.

  6. CTCF and Rad21 act as host cell restriction factors for Kaposi's sarcoma-associated herpesvirus (KSHV) lytic replication by modulating viral gene transcription.


    Li, Da-Jiang; Verma, Dinesh; Mosbruger, Tim; Swaminathan, Sankar


    Kaposi's sarcoma-associated herpesvirus (KSHV) is a human herpesvirus that causes Kaposi's sarcoma and is associated with the development of lymphoproliferative diseases. KSHV reactivation from latency and virion production is dependent on efficient transcription of over eighty lytic cycle genes and viral DNA replication. CTCF and cohesin, cellular proteins that cooperatively regulate gene expression and mediate long-range DNA interactions, have been shown to bind at specific sites in herpesvirus genomes. CTCF and cohesin regulate KSHV gene expression during latency and may also control lytic reactivation, although their role in lytic gene expression remains incompletely characterized. Here, we analyze the dynamic changes in CTCF and cohesin binding that occur during the process of KSHV viral reactivation and virion production by high resolution chromatin immunoprecipitation and deep sequencing (ChIP-Seq) and show that both proteins dissociate from viral genomes in kinetically and spatially distinct patterns. By utilizing siRNAs to specifically deplete CTCF and Rad21, a cohesin component, we demonstrate that both proteins are potent restriction factors for KSHV replication, with cohesin knockdown leading to hundred-fold increases in viral yield. High-throughput RNA sequencing was used to characterize the transcriptional effects of CTCF and cohesin depletion, and demonstrated that both proteins have complex and global effects on KSHV lytic transcription. Specifically, both proteins act as positive factors for viral transcription initially but subsequently inhibit KSHV lytic transcription, such that their net effect is to limit KSHV RNA accumulation. Cohesin is a more potent inhibitor of KSHV transcription than CTCF but both proteins are also required for efficient transcription of a subset of KSHV genes. These data reveal novel effects of CTCF and cohesin on transcription from a relatively small genome that resemble their effects on the cellular genome by acting as

  7. Viral epigenetics.


    Milavetz, Barry I; Balakrishnan, Lata


    DNA tumor viruses including members of the polyomavirus, adenovirus, papillomavirus, and herpes virus families are presently the subject of intense interest with respect to the role that epigenetics plays in control of the virus life cycle and the transformation of a normal cell to a cancer cell. To date, these studies have primarily focused on the role of histone modification, nucleosome location, and DNA methylation in regulating the biological consequences of infection. Using a wide variety of strategies and techniques ranging from simple ChIP to ChIP-chip and ChIP-seq to identify histone modifications, nuclease digestion to genome wide next generation sequencing to identify nucleosome location, and bisulfite treatment to MeDIP to identify DNA methylation sites, the epigenetic regulation of these viruses is slowly becoming better understood. While the viruses may differ in significant ways from each other and cellular chromatin, the role of epigenetics appears to be relatively similar. Within the viral genome nucleosomes are organized for the expression of appropriate genes with relevant histone modifications particularly histone acetylation. DNA methylation occurs as part of the typical gene silencing during latent infection by herpesviruses. In the simple tumor viruses like the polyomaviruses, adenoviruses, and papillomaviruses, transformation of the cell occurs via integration of the virus genome such that the virus's normal regulation is disrupted. This results in the unregulated expression of critical viral genes capable of redirecting cellular gene expression. The redirected cellular expression is a consequence of either indirect epigenetic regulation where cellular signaling or transcriptional dysregulation occurs or direct epigenetic regulation where epigenetic cofactors such as histone deacetylases are targeted. In the more complex herpersviruses transformation is a consequence of the expression of the viral latency proteins and RNAs which again can

  8. Differentiation-dependent interactions between RUNX-1 and FLI-1 during megakaryocyte development.


    Huang, Hui; Yu, Ming; Akie, Thomas E; Moran, Tyler B; Woo, Andrew J; Tu, Nathan; Waldon, Zachary; Lin, Yin Yin; Steen, Hanno; Cantor, Alan B


    The transcription factor RUNX-1 plays a key role in megakaryocyte differentiation and is mutated in cases of myelodysplastic syndrome and leukemia. In this study, we purified RUNX-1-containing multiprotein complexes from phorbol ester-induced L8057 murine megakaryoblastic cells and identified the ets transcription factor FLI-1 as a novel in vivo-associated factor. The interaction occurs via direct protein-protein interactions and results in synergistic transcriptional activation of the c-mpl promoter. Interestingly, the interaction fails to occur in uninduced cells. Gel filtration chromatography confirms the differentiation-dependent binding and shows that it correlates with the assembly of a complex also containing the key megakaryocyte transcription factors GATA-1 and Friend of GATA-1 (FOG-1). Phosphorylation analysis of FLI-1 with uninduced versus induced L8057 cells suggests the loss of phosphorylation at serine 10 in the induced state. Substitution of Ser10 with the phosphorylation mimic aspartic acid selectively impairs RUNX-1 binding, abrogates transcriptional synergy with RUNX-1, and dominantly inhibits primary fetal liver megakaryocyte differentiation in vitro. Conversely, substitution with alanine, which blocks phosphorylation, augments differentiation of primary megakaryocytes. We propose that dephosphorylation of FLI-1 is a key event in the transcriptional regulation of megakaryocyte maturation. These findings have implications for other cell types where interactions between runx and ets family proteins occur.

  9. RNA-binding protein PSPC1 promotes the differentiation-dependent nuclear export of adipocyte RNAs.


    Wang, Jiexin; Rajbhandari, Prashant; Damianov, Andrey; Han, Areum; Sallam, Tamer; Waki, Hironori; Villanueva, Claudio J; Lee, Stephen D; Nielsen, Ronni; Mandrup, Susanne; Reue, Karen; Young, Stephen G; Whitelegge, Julian; Saez, Enrique; Black, Douglas L; Tontonoz, Peter


    A highly orchestrated gene expression program establishes the properties that define mature adipocytes, but the contribution of posttranscriptional factors to the adipocyte phenotype is poorly understood. Here we have shown that the RNA-binding protein PSPC1, a component of the paraspeckle complex, promotes adipogenesis in vitro and is important for mature adipocyte function in vivo. Cross-linking and immunoprecipitation followed by RNA sequencing revealed that PSPC1 binds to intronic and 3'-untranslated regions of a number of adipocyte RNAs, including the RNA encoding the transcriptional regulator EBF1. Purification of the paraspeckle complex from adipocytes further showed that PSPC1 associates with the RNA export factor DDX3X in a differentiation-dependent manner. Remarkably, PSPC1 relocates from the nucleus to the cytoplasm during differentiation, coinciding with enhanced export of adipogenic RNAs. Mice lacking PSPC1 in fat displayed reduced lipid storage and adipose tissue mass and were resistant to diet-induced obesity and insulin resistance due to a compensatory increase in energy expenditure. These findings highlight a role for PSPC1-dependent RNA maturation in the posttranscriptional control of adipose development and function.

  10. Human immunodeficiency virus type 1 Tat increases the expression of cleavage and polyadenylation specificity factor 73-kilodalton subunit modulating cellular and viral expression.


    Calzado, Marco A; Sancho, Rocío; Muñoz, Eduardo


    The human immunodeficiency virus type 1 (HIV-1) Tat protein, which is essential for HIV gene expression and viral replication, is known to mediate pleiotropic effects on various cell functions. For instance, Tat protein is able to regulate the rate of transcription of host cellular genes and to interact with the signaling machinery, leading to cellular dysfunction. To study the effect that HIV-1 Tat exerts on the host cell, we identified several genes that were up- or down-regulated in tat-expressing cell lines by using the differential display method. HIV-1 Tat specifically increases the expression of the cleavage and polyadenylation specificity factor (CPSF) 73-kDa subunit (CPSF3) without affecting the expression of the 160- and 100-kDa subunits of the CPSF complex. This complex comprises four subunits and has a key function in the 3'-end processing of pre-mRNAs by a coordinated interaction with other factors. CPSF3 overexpression experiments and knockdown of the endogenous CPSF3 by mRNA interference have shown that this subunit of the complex is an important regulatory protein for both viral and cellular gene expression. In addition to the known CPSF3 function in RNA polyadenylation, we also present evidence that this protein exerts transcriptional activities by repressing the mdm2 gene promoter. Thus, HIV-1-Tat up-regulation of CPSF3 could represent a novel mechanism by which this virus increases mRNA processing, causing an increase in both cell and viral gene expression.

  11. Viral Carcinogenesis.


    Smith, A J; Smith, L A


    Cancer has been recognized for thousands of years. Egyptians believed that cancer occurred at the will of the gods. Hippocrates believed human disease resulted from an imbalance of the four humors: blood, phlegm, yellow bile, and black bile with cancer being caused by excess black bile. The lymph theory of cancer replaced the humoral theory and the blastema theory replaced the lymph theory. Rudolph Virchow was the first to recognize that cancer cells like all cells came from other cells and believed chronic irritation caused cancer. At the same time there was a belief that trauma caused cancer, though it never evolved after many experiments inducing trauma. The birth of virology occurred in 1892 when Dimitri Ivanofsky demonstrated that diseased tobacco plants remained infective after filtering their sap through a filter that trapped bacteria. Martinus Beijerinck would call the tiny infective agent a virus and both Dimitri Ivanofsky and Marinus Beijerinck would become the fathers of virology. Not to long thereafter, Payton Rous founded the field of tumor virology in 1911 with his discovery of a transmittable sarcoma of chickens by what would come to be called Rous sarcoma virus or RSV for short. The first identified human tumor virus was the Epstein-Barr virus (EBV), named after Tony Epstein and Yvonne Barr who visualized the virus particles in Burkitt's lymphoma cells by electron microscopy in 1965. Since that time, many viruses have been associated with carcinogenesis including the most studied, human papilloma virus associated with cervical carcinoma, many other anogenital carcinomas, and oropharyngeal carcinoma. The World Health Organization currently estimates that approximately 22% of worldwide cancers are attributable to infectious etiologies, of which viral etiologies is estimated at 15-20%. The field of tumor virology/viral carcinogenesis has not only identified viruses as etiologic agents of human cancers, but has also given molecular insights to all human

  12. miR-190 is upregulated in Epstein-Barr Virus type I latency and modulates cellular mRNAs involved in cell survival and viral reactivation.


    Cramer, Elizabeth M; Shao, Ying; Wang, Yan; Yuan, Yan


    Epstein-Barr Virus (EBV) is a prevalent human pathogen infecting over 90% of the population. Much of the success of the virus is attributed to its ability to maintain latency. The detailed mechanisms underlying the establishment and maintenance of EBV latency remain poorly understood. A microRNA profiling study revealed differential expression of many cellular miRNAs between types I and III latency cells, suggesting cellular miRNAs may play roles in regulating EBV latency. mir-190 is the most differentially up-regulated miRNA in type I latency cells as compared with type III latency cells and the up-regulation appears to be attributed to EBER RNAs that express in higher levels in type I latency cells than type III cells. With the aide of a lentiviral overexpression system and microarray analysis, several cellular mRNAs are identified as potential targets of mir-190. By targeting TP53INP1, miR-190 enhances cell survival by preventing apoptosis and relieving G0/G1 cell cycle arrest. Additionally, miR-190 down-regulates NR4A3, a cellular immediate-early gene for EBV reactivation, and inhibits the expression of the viral immediate-early gene bzlf1 and viral lytic DNA replication. Taken together, our data revealed a mechanism that EBV utilizes a cellular microRNA to promote host cell survival and prevent virus from entering lytic life cycle for latency maintenance.

  13. Volatile Organic Compound Gamma-Butyrolactone Released upon Herpes Simplex Virus Type -1 Acute Infection Modulated Membrane Potential and Repressed Viral Infection in Human Neuron-Like Cells

    PubMed Central

    Waguespack, Yan; Figliozzi, Robert W.; Kharel, Madan K.; Zhang, Qiaojuan; Martin-Caraballo, Miguel


    Herpes Simplex Virus Type -1 (HSV-1) infections can cause serious complications such as keratitis and encephalitis. The goal of this study was to identify any changes in the concentrations of volatile organic compounds (VOCs) produced during HSV-1 infection of epithelial cells that could potentially be used as an indicator of a response to stress. An additional objective was to study if any VOCs released from acute epithelial infection may influence subsequent neuronal infection to facilitate latency. To investigate these hypotheses, Vero cells were infected with HSV-1 and the emission of VOCs was analyzed using two-dimensional gas chromatograph/mass spectrometry (2D GC/MS). It was observed that the concentrations of gamma-butyrolactone (GBL) in particular changed significantly after a 24-hour infection. Since HSV-1 may establish latency in neurons after the acute infection, GBL was tested to determine if it exerts neuronal regulation of infection. The results indicated that GBL altered the resting membrane potential of differentiated LNCaP cells and promoted a non-permissive state of HSV-1 infection by repressing viral replication. These observations may provide useful clues towards understanding the complex signaling pathways that occur during the HSV-1 primary infection and establishment of viral latency. PMID:27537375

  14. Viral Parkinsonism

    PubMed Central

    Jang, Haeman; Boltz, David A.; Webster, Robert G.; Smeyne, Richard Jay


    Parkinson's disease is a debilitating neurological disorder characterized that affects 1-2% of the adult population over 55 years of age. For the vast majority of cases, the etiology of this disorder is unknown, although it is generally accepted that there is a genetic susceptibility to any number of environmental agents. One such agent may be viruses. It has been shown that numerous viruses can enter the nervous system, i.e. they are neurotropic, and induce a number of encephalopathies. One of the secondary consequences of these encephalopathies can be parkinsonism, that is both transient as well as permanent. One of the most highlighted and controversial cases of viral parkinsonism is that which followed the 1918 influenza outbreak and the subsequent induction of von Economo's encephalopathy. In this review, we discuss the neurological sequelae of infection by influenza virus as well as that of other viruses known to induce parkinsonism including Coxsackie, Japanese encephalitis B, St. Louis, West Nile and HIV viruses. PMID:18760350

  15. Serine/Arginine-rich Splicing Factor 2 Modulates Herpes Simplex Virus Type 1 Replication via Regulating Viral Gene Transcriptional Activity and Pre-mRNA Splicing.


    Wang, Ziqiang; Liu, Qing; Lu, Jinhua; Fan, Ping; Xie, Weidong; Qiu, Wei; Wang, Fan; Hu, Guangnan; Zhang, Yaou


    Once it enters the host cell, herpes simplex virus type 1 (HSV-1) recruits a series of host cell factors to facilitate its life cycle. Here, we demonstrate that serine/arginine-rich splicing factor 2 (SRSF2), which is an important component of the splicing speckle, mediates HSV-1 replication by regulating viral gene expression at the transcriptional and posttranscriptional levels. Our results indicate that SRSF2 functions as a transcriptional activator by directly binding to infected cell polypeptide 0 (ICP0), infected cell polypeptide 27 (ICP27), and thymidine kinase promoters. Moreover, SRSF2 participates in ICP0 pre-mRNA splicing by recognizing binding sites in ICP0 exon 3. These findings provide insight into the functions of SRSF2 in HSV-1 replication and gene expression. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. A multi-step process of viral adaptation to a mutagenic nucleoside analogue by modulation of transition types leads to extinction-escape.


    Agudo, Rubén; Ferrer-Orta, Cristina; Arias, Armando; de la Higuera, Ignacio; Perales, Celia; Pérez-Luque, Rosa; Verdaguer, Nuria; Domingo, Esteban


    Resistance of viruses to mutagenic agents is an important problem for the development of lethal mutagenesis as an antiviral strategy. Previous studies with RNA viruses have documented that resistance to the mutagenic nucleoside analogue ribavirin (1-β-D-ribofuranosyl-1-H-1,2,4-triazole-3-carboxamide) is mediated by amino acid substitutions in the viral polymerase that either increase the general template copying fidelity of the enzyme or decrease the incorporation of ribavirin into RNA. Here we describe experiments that show that replication of the important picornavirus pathogen foot-and-mouth disease virus (FMDV) in the presence of increasing concentrations of ribavirin results in the sequential incorporation of three amino acid substitutions (M296I, P44S and P169S) in the viral polymerase (3D). The main biological effect of these substitutions is to attenuate the consequences of the mutagenic activity of ribavirin -by avoiding the biased repertoire of transition mutations produced by this purine analogue-and to maintain the replicative fitness of the virus which is able to escape extinction by ribavirin. This is achieved through alteration of the pairing behavior of ribavirin-triphosphate (RTP), as evidenced by in vitro polymerization assays with purified mutant 3Ds. Comparison of the three-dimensional structure of wild type and mutant polymerases suggests that the amino acid substitutions alter the position of the template RNA in the entry channel of the enzyme, thereby affecting nucleotide recognition. The results provide evidence of a new mechanism of resistance to a mutagenic nucleoside analogue which allows the virus to maintain a balance among mutation types introduced into progeny genomes during replication under strong mutagenic pressure.

  17. A Teleost Bactericidal Permeability-Increasing Protein Kills Gram-Negative Bacteria, Modulates Innate Immune Response, and Enhances Resistance against Bacterial and Viral Infection

    PubMed Central

    Sun, Yuan-yuan; Sun, Li


    Bactericidal/permeability-increasing protein (BPI) is an important factor of innate immunity that in mammals is known to take part in the clearance of invading Gram-negative bacteria. In teleost, the function of BPI is unknown. In the present work, we studied the function of tongue sole (Cynoglossus semilaevis) BPI, CsBPI. We found that CsBPI was produced extracellularly by peripheral blood leukocytes (PBL). Recombinant CsBPI (rCsBPI) was able to bind to a number of Gram-negative bacteria but not Gram-positive bacteria. Binding to bacteria led to bacterial death through membrane permeabilization and structural destruction, and the bound bacteria were more readily taken up by PBL. In vivo, rCsBPI augmented the expression of a wide arrange of genes involved in antibacterial and antiviral immunity. Furthermore, rCsBPI enhanced the resistance of tongue sole against bacterial as well as viral infection. These results indicate for the first time that a teleost BPI possesses immunoregulatory effect and plays a significant role in antibacterial and antiviral defense. PMID:27105425

  18. The Arabidopsis AtNPR1 inversely modulates defense responses against fungal, bacterial, or viral pathogens while conferring hypersensitivity to abiotic stresses in transgenic rice.


    Quilis, Jordi; Peñas, Gisela; Messeguer, Joaquima; Brugidou, Christophe; San Segundo, Blanca


    The nonexpressor of pathogenesis-related (PR) genes (NPR1) protein plays an important role in mediating defense responses activated by pathogens in Arabidopsis. In rice, a disease-resistance pathway similar to the Arabidopsis NPR1-mediated signaling pathway one has been described. Here, we show that constitutive expression of the Arabidopsis NPR1 (AtNPR1) gene in rice confers resistance against fungal and bacterial pathogens. AtNPR1 exerts its protective effects against fungal pathogens by priming the expression of salicylic acid (SA)-responsive endogenous genes, such as the PR1b, TLP (PR5), PR10, and PBZ1. However, expression of AtNPR1 in rice has negative effects on viral infections. The AtNPR1-expressing rice plants showed a higher susceptibility to infection by the Rice yellow mottle virus (RYMV) which correlated well with a misregulation of RYMV-responsive genes, including expression of the SA-regulated RNA-dependent RNA polymerase 1 gene (OsRDR1). Moreover, AtNPR1 negatively regulates the expression of genes playing a role in the plant response to salt and drought stress (rab21, salT, and dip1), which results in a higher sensitivity of AtNPR1 rice to the two types of abiotic stress. These observations suggest that AtNPR1 has both positive and negative regulatory roles in mediating defense responses against biotic and abiotic stresses.

  19. A Teleost Bactericidal Permeability-Increasing Protein Kills Gram-Negative Bacteria, Modulates Innate Immune Response, and Enhances Resistance against Bacterial and Viral Infection.


    Sun, Yuan-Yuan; Sun, Li


    Bactericidal/permeability-increasing protein (BPI) is an important factor of innate immunity that in mammals is known to take part in the clearance of invading Gram-negative bacteria. In teleost, the function of BPI is unknown. In the present work, we studied the function of tongue sole (Cynoglossus semilaevis) BPI, CsBPI. We found that CsBPI was produced extracellularly by peripheral blood leukocytes (PBL). Recombinant CsBPI (rCsBPI) was able to bind to a number of Gram-negative bacteria but not Gram-positive bacteria. Binding to bacteria led to bacterial death through membrane permeabilization and structural destruction, and the bound bacteria were more readily taken up by PBL. In vivo, rCsBPI augmented the expression of a wide arrange of genes involved in antibacterial and antiviral immunity. Furthermore, rCsBPI enhanced the resistance of tongue sole against bacterial as well as viral infection. These results indicate for the first time that a teleost BPI possesses immunoregulatory effect and plays a significant role in antibacterial and antiviral defense.

  20. Human viral cardiomyopathy.


    Maisch, Bernhard; Ristic, Arsen D; Portig, Irene; Pankuweit, Sabine


    Viral infection of the heart is relatively common, usually asymptomatic and has a spontaneous and complete resolution. It can, however, in rare cases, lead to substantial cardiac damage, development of viral cardiomyopathy and congestive heart failure. Viral cardiomyopathy is defined as viral persistence in a dilated heart. It may be accompanied by myocardial inflammation and then termed inflammatory viral cardiomyopathy (or viral myocarditis with cardiomegaly). If no inflammation is observed in the biopsy of a dilated heart (<14 lymphocytes and macrophages/mm ) the term viral cardiomyopathy or viral persistence in dilated cardiomyopathy should be applied. The diagnosis of myocarditis and viral cardiomyopathy can be made only by endomyocardial biopsy, implementing the WHO/WHF criteria, and PCR techniques for identification of viral genome. The most frequent cardiotropic viruses detected by endomyocardial biopsy are Parvo B19, enteroviruses, adenoviruses, cytomegalovirus, and less frequently Epstein-Barr virus, and influenza virus.

  1. The prostacyclin agonist iloprost aggravates fibrosis and enhances viral replication in enteroviral myocarditis by modulation of ERK signaling and increase of iNOS expression.


    Gruhle, Stefan; Sauter, Martina; Szalay, Gudrun; Ettischer, Nicole; Kandolf, Reinhard; Klingel, Karin


    Enteroviruses, such as coxsackieviruses of group B (CVB), are able to induce a chronic inflammation of the myocardium, which may finally lead to the loss of functional tissue, remodeling processes and the development of fibrosis, thus affecting the proper contractile function of the heart. In other fibrotic diseases like scleroderma, the prostacyclin agonist iloprost was found to inhibit the extracellular signal-regulated kinase (ERK, p44/42 MAPK), a mitogen-activated protein kinase, and consecutively, the expression of the profibrotic cytokine connective tissue growth factor (CTGF), thereby preventing the development of fibrosis. As CTGF was found to mediate fibrosis in chronic CVB3 myocarditis as well, we evaluated whether the in vivo application of iloprost is capable to reduce the development of ERK/CTGF-mediated fibrosis in enteroviral myocarditis. Unexpectedly, the application of iloprost resulted in a prolonged myocardial inflammation and an aggravated fibrosis and failed to reduce activation of ERK and expression of CTGF at later stages of the disease. In addition, viral replication was found to be increased in iloprost-treated mice. Notably, the expression of cardiac inducible nitric oxide synthase (iNOS), which is known to aggravate myocardial damage in CVB3-infected mice, was strongly enhanced by iloprost. Using cultivated bone marrow macrophages (BMM), we confirmed these results, proving that iloprost potentiates the expression of iNOS mRNA and protein in CVB3-infected and IFN-gamma stimulated BMM. In conclusion, these results suggest a critical reflection of the clinical use of iloprost, especially in patients possibly suffering from an enteroviral myocarditis.

  2. Differential Modulation of IgT and IgM upon Parasitic, Bacterial, Viral, and Dietary Challenges in a Perciform Fish.


    Piazzon, Maria C; Galindo-Villegas, Jorge; Pereiro, Patricia; Estensoro, Itziar; Calduch-Giner, Josep A; Gómez-Casado, Eduardo; Novoa, Beatriz; Mulero, Victoriano; Sitjà-Bobadilla, Ariadna; Pérez-Sánchez, Jaume


    Three different immunoglobulin (Ig) isotypes can be found in teleost fish, IgM, IgD, and the teleost-specific IgT. IgM is considered to have a systemic activity, and IgT is attributed a mucosal role, similar to mammalian IgA. In this study, the complete sequence of gilthead sea bream IgM and IgT in their membrane (m) and soluble (s) forms are described for the first time in a perciform fish. Their constitutive gene expression is analyzed in different tissues, and their regulation upon viral, bacterial, parasitic, mucosal vaccination and dietary challenges are studied. GCB IgM and IgT have the prototypical structure when compared to other fish Igs. The constitutive expression of sIgM was the highest overall in all tissues, whereas mIgT expression was highest in mucosal tissues, such as gills and intestine. IgM and IgT were differentially regulated upon infection. IgT was highly upregulated locally upon infection with the intestinal parasite Enteromyxum leei or systemically after Nodavirus infection. Long-term intestinal parasitic infections increased the serum titer of both isotypes. Mucosal vaccination against Photobacterium damselae subsp. piscicida finely regulated the Ig response inducing a systemic increase of IgM titers in serum and a local IgT response in skin mucus when animals were exposed to the pathogen by bath challenge. Interestingly, plant-based diets inhibit IgT upregulation upon intestinal parasitic challenge, which was related to a worse disease outcome. All these results corroborate the mucosal role of IgT and emphasize the importance of a finely tuned regulation of Ig isotypes upon infection, which could be of special interest in vaccination studies.

  3. Differential Modulation of IgT and IgM upon Parasitic, Bacterial, Viral, and Dietary Challenges in a Perciform Fish

    PubMed Central

    Piazzon, Maria C.; Galindo-Villegas, Jorge; Pereiro, Patricia; Estensoro, Itziar; Calduch-Giner, Josep A.; Gómez-Casado, Eduardo; Novoa, Beatriz; Mulero, Victoriano; Sitjà-Bobadilla, Ariadna; Pérez-Sánchez, Jaume


    Three different immunoglobulin (Ig) isotypes can be found in teleost fish, IgM, IgD, and the teleost-specific IgT. IgM is considered to have a systemic activity, and IgT is attributed a mucosal role, similar to mammalian IgA. In this study, the complete sequence of gilthead sea bream IgM and IgT in their membrane (m) and soluble (s) forms are described for the first time in a perciform fish. Their constitutive gene expression is analyzed in different tissues, and their regulation upon viral, bacterial, parasitic, mucosal vaccination and dietary challenges are studied. GCB IgM and IgT have the prototypical structure when compared to other fish Igs. The constitutive expression of sIgM was the highest overall in all tissues, whereas mIgT expression was highest in mucosal tissues, such as gills and intestine. IgM and IgT were differentially regulated upon infection. IgT was highly upregulated locally upon infection with the intestinal parasite Enteromyxum leei or systemically after Nodavirus infection. Long-term intestinal parasitic infections increased the serum titer of both isotypes. Mucosal vaccination against Photobacterium damselae subsp. piscicida finely regulated the Ig response inducing a systemic increase of IgM titers in serum and a local IgT response in skin mucus when animals were exposed to the pathogen by bath challenge. Interestingly, plant-based diets inhibit IgT upregulation upon intestinal parasitic challenge, which was related to a worse disease outcome. All these results corroborate the mucosal role of IgT and emphasize the importance of a finely tuned regulation of Ig isotypes upon infection, which could be of special interest in vaccination studies. PMID:28082977

  4. The 5′ UTR of HIV-1 full-length mRNA and the Tat viral protein modulate the programmed −1 ribosomal frameshift that generates HIV-1 enzymes

    PubMed Central

    Charbonneau, Johanie; Gendron, Karine; Ferbeyre, Gerardo; Brakier-Gingras, Léa


    Translation of the full-length messenger RNA (mRNA) of the human immunodeficiency virus type 1 (HIV-1) generates the precursor of the viral enzymes via a programmed −1 ribosomal frameshift. Here, using dual-luciferase reporters, we investigated whether the highly structured 5′ untranslated region (UTR) of this mRNA, which interferes with translation initiation, can modulate HIV-1 frameshift efficiency. We showed that, when the 5′ UTR of HIV-1 mRNA occupies the 5′ end of the reporter mRNA, HIV-1 frameshift efficiency is increased about fourfold in Jurkat T-cells, compared with a control dual-luciferase reporter with a short unstructured 5′ UTR. This increase was related to an interference with cap-dependent translation initiation by the TAR-Poly(A) region at the 5′ end of the messenger. HIV-1 mRNA 5′ UTR also contains an internal ribosome entry site (IRES), but we showed that, when the cap-dependent initiation mode is available, the IRES is not used or is weakly used. However, when the ribosomes have to use the IRES to translate the dual-luciferase reporter, the frameshift efficiency is comparable to that of the control dual-luciferase reporter. The decrease in cap-dependent initiation and the accompanying increase in frameshift efficiency caused by the 5′ UTR of HIV-1 mRNA is antagonized, in a dose-dependent way, by the Tat viral protein. Tat also stimulates the IRES-dependent initiation and decreases the corresponding frameshift efficiency. A model is presented that accounts for the variations in frameshift efficiency depending on the 5′ UTR and the presence of Tat, and it is proposed that a range of frameshift efficiencies is compatible with the virus replication. PMID:22286970

  5. Cytoplasmic RNA Granules and Viral Infection.


    Tsai, Wei-Chih; Lloyd, Richard E


    RNA granules are dynamic cellular structures essential for proper gene expression and homeostasis. The two principal types of cytoplasmic RNA granules are stress granules, which contain stalled translation initiation complexes, and processing bodies (P bodies), which concentrate factors involved in mRNA degradation. RNA granules are associated with gene silencing of transcripts; thus, viruses repress RNA granule functions to favor replication. This article discusses the breadth of viral interactions with cytoplasmic RNA granules, focusing on mechanisms that modulate the functions of RNA granules and that typically promote viral replication. Currently, mechanisms for virus manipulation of RNA granules can be loosely grouped into three nonexclusive categories: (a) cleavage of key RNA granule factors, (b) regulation of PKR activation, and (c) co-opting of RNA granule factors for new roles in viral replication. Viral modulation of RNA granules supports productive infection by inhibiting their gene-silencing functions and counteracting their role in linking stress sensing with innate immune activation.

  6. The PDZ-Ligand and Src-Homology Type 3 Domains of Epidemic Avian Influenza Virus NS1 Protein Modulate Human Src Kinase Activity during Viral Infection

    PubMed Central

    Bavagnoli, Laura; Dundon, William G.; Garbelli, Anna; Zecchin, Bianca; Milani, Adelaide; Parakkal, Geetha; Baldanti, Fausto; Paolucci, Stefania; Volmer, Romain; Tu, Yizeng; Wu, Chuanyue; Capua, Ilaria; Maga, Giovanni


    The Non-structural 1 (NS1) protein of avian influenza (AI) viruses is important for pathogenicity. Here, we identify a previously unrecognized tandem PDZ-ligand (TPL) domain in the extreme carboxy terminus of NS1 proteins from a subset of globally circulating AI viruses. By using protein arrays we have identified several human PDZ-cellular ligands of this novel domain, one of which is the RIL protein, a known regulator of the cellular tyrosine kinase Src. We found that the AI NS1 proteins bind and stimulate human Src tyrosine kinase, through their carboxy terminal Src homology type 3-binding (SHB) domain. The physical interaction between NS1 and Src and the ability of AI viruses to modulate the phosphorylation status of Src during the infection, were found to be influenced by the TPL arrangement. These results indicate the potential for novel host-pathogen interactions mediated by the TPL and SHB domains of AI NS1 protein. PMID:22110760

  7. Viral Skin Diseases.


    Ramdass, Priya; Mullick, Sahil; Farber, Harold F


    In the vast world of skin diseases, viral skin disorders account for a significant percentage. Most viral skin diseases present with an exanthem (skin rash) and, oftentimes, an accompanying enanthem (lesions involving the mucosal membrane). In this article, the various viral skin diseases are explored, including viral childhood exanthems (measles, rubella, erythema infectiosum, and roseola), herpes viruses (herpes simplex virus, varicella zoster virus, Kaposi sarcoma herpes virus, viral zoonotic infections [orf, monkeypox, ebola, smallpox]), and several other viral skin diseases, such as human papilloma virus, hand, foot, and mouth disease, molluscum contagiosum, and Gianotti-Crosti syndrome. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Interaction between chronically HIV-infected promonocytic cells and human umbilical vein endothelial cells: role of proinflammatory cytokines and chemokines in viral expression modulation

    PubMed Central

    Borghi, M O; Panzeri, P; Shattock, R; Sozzani, S; Dobrina, A; Meroni, P L


    HIV type 1 expression was significantly up-regulated in chronically infected promonocytic cell line (U1) co-cultured with human umbilical vein endothelial cells (HUVEC). Virus replication, evaluated as supernatant p24 release, was higher when U1 were co-cultured with IL-1β-activated HUVEC than with unstimulated HUVEC. When non-adherent U1 were removed from co-cultures, the remaining U1 cells adherent to the endothelial monolayer still showed enhanced HIV replication in comparison with an equal number of U1 cultured alone. While addition of adhesion molecule blocking antibodies (anti-intercellular adhesion molecule-1 (ICAM-1), -vascular cell adhesion molecule-1 (VCAM-1), -CD18 and -very late antigen-4 (VLA-4)) strongly inhibited adherence of U1 cells to endothelial monolayers, such treatment resulted in only a partial reduction in p24 release. Furthermore, HIV replication in U1 cells was enhanced on culture in HUVEC-conditioned media. Such data suggest that soluble mediators secreted by endothelial monolayers may modulate HIV-1 expression. Indeed, addition of cytokine and chemokine antagonists to both U1/HUVEC co-cultures and to U1 cultured in HUVEC-conditioned media clearly down-regulated p24 release. Anti-IL-6, anti-tumour necrosis factor-alpha (TNF-α) and, particularly, anti-MCP-1 MoAbs reduced p24 release, while anti-IL-8 polyclonal antiserum and IL-1 receptor antagonist (IL-1Ra) had no significant effect. Thus, the interaction between HUVEC and infected monocytic cells up-regulates HIV-1 replication predominantly through production of endothelium-derived soluble factors including MCP-1, TNF-α and IL-6. This phenomenon may influence the passage of HIV-1 from latency to productive replication and enhance virus spreading during physiological and/or pathological contact of monocytes with endothelium. PMID:10759769

  9. Viral Hemorrhagic Fevers


    ... The CDC Cancel Submit Search The CDC Viral Hemorrhagic Fevers (VHFs) Note: Javascript is disabled or is not ... please visit this page: About . Viral Hemorrhagic Fevers (VHFs) Virus Families Arenaviruses Old World/New World ...

  10. Oxygen tension level and human viral infections.


    Morinet, Frédéric; Casetti, Luana; François, Jean-Hugues; Capron, Claude; Pillet, Sylvie


    The role of oxygen tension level is a well-known phenomenon that has been studied in oncology and radiotherapy since about 60 years. Oxygen tension may inhibit or stimulate propagation of viruses in vitro as well as in vivo. In turn modulating oxygen metabolism may constitute a novel approach to treat viral infections as an adjuvant therapy. The major transcription factor which regulates oxygen tension level is hypoxia-inducible factor-1 alpha (HIF-1α). Down-regulating the expression of HIF-1α is a possible method in the treatment of chronic viral infection such as human immunodeficiency virus infection, chronic hepatitis B and C viral infections and Kaposi sarcoma in addition to classic chemotherapy. The aim of this review is to supply an updating concerning the influence of oxygen tension level in human viral infections and to evoke possible new therapeutic strategies regarding this environmental condition.

  11. Ocean plankton. Patterns and ecological drivers of ocean viral communities.


    Brum, Jennifer R; Ignacio-Espinoza, J Cesar; Roux, Simon; Doulcier, Guilhem; Acinas, Silvia G; Alberti, Adriana; Chaffron, Samuel; Cruaud, Corinne; de Vargas, Colomban; Gasol, Josep M; Gorsky, Gabriel; Gregory, Ann C; Guidi, Lionel; Hingamp, Pascal; Iudicone, Daniele; Not, Fabrice; Ogata, Hiroyuki; Pesant, Stéphane; Poulos, Bonnie T; Schwenck, Sarah M; Speich, Sabrina; Dimier, Celine; Kandels-Lewis, Stefanie; Picheral, Marc; Searson, Sarah; Bork, Peer; Bowler, Chris; Sunagawa, Shinichi; Wincker, Patrick; Karsenti, Eric; Sullivan, Matthew B


    Viruses influence ecosystems by modulating microbial population size, diversity, metabolic outputs, and gene flow. Here, we use quantitative double-stranded DNA (dsDNA) viral-fraction metagenomes (viromes) and whole viral community morphological data sets from 43 Tara Oceans expedition samples to assess viral community patterns and structure in the upper ocean. Protein cluster cataloging defined pelagic upper-ocean viral community pan and core gene sets and suggested that this sequence space is well-sampled. Analyses of viral protein clusters, populations, and morphology revealed biogeographic patterns whereby viral communities were passively transported on oceanic currents and locally structured by environmental conditions that affect host community structure. Together, these investigations establish a global ocean dsDNA viromic data set with analyses supporting the seed-bank hypothesis to explain how oceanic viral communities maintain high local diversity.

  12. Subversion of the actin cytoskeleton during viral infection

    PubMed Central

    Taylor, Matthew P.; Koyuncu, Orkide O.; Enquist, Lynn W.


    Viral infection converts the normal functions of a cell to optimize viral replication and virion production. One striking observation of this conversion is the reconfiguration and reorganization of cellular actin, affecting every stage of the viral life cycle, from entry through assembly to egress. The extent and degree of cytoskeletal reorganization varies among different viral infections, suggesting the evolution of myriad viral strategies. In this Review, we describe how the interaction of viral proteins with the cell modulates the structure and function of the actin cytoskeleton to initiate, sustain and spread infections. The molecular biology of such interactions continues to engage virologists in their quest to understand viral replication and informs cell biologists about the role of the cytoskeleton in the uninfected cell. PMID:21522191

  13. Regulation of viral oncogenesis by microRNAs

    PubMed Central

    Xu, Xiaojie; Ye, Qinong


    Viral infection may play a causative role in human cancers, for example hepatitis B virus (HBV) or hepatitis C virus (HCV) in liver cancer, human papilloma virus (HPV) in cervical cancer, and Epstein–Barr virus (EBV) in nasopharyngeal carcinoma. Virally infected cells express viral-encoded genes that are critical for oncogenesis. Some viruses also encode microRNA (miRNA) species. miRNAs are small noncoding RNA molecules that play an important role in cancer development and progression. Recent studies indicate an important interplay among viral oncoproteins, virus-encoded miRNAs, cellular miRNAs, and cellular genes. This review focuses on modulation of HBV-, HCV-, HPV-, and EBV-associated cancers by cellular and/or viral miRNA. An understanding of the mechanisms underlying the regulation of viral carcinogenesis by miRNAs may provide new targets for the development of specific viral therapies. PMID:27308317

  14. Latency-Associated Viral Interleukin-10 (IL-10) Encoded by Human Cytomegalovirus Modulates Cellular IL-10 and CCL8 Secretion during Latent Infection through Changes in the Cellular MicroRNA hsa-miR-92a

    PubMed Central

    Poole, Emma; Avdic, Selmir; Hodkinson, Jemima; Jackson, Sarah; Wills, Mark; Slobedman, Barry


    ABSTRACT The UL111A gene of human cytomegalovirus encodes a viral homologue of the cellular immunomodulatory cytokine interleukin 10 (cIL-10), which, due to alternative splicing, results in expression of two isoforms designated LAcmvIL-10 (expressed during both lytic and latent infection) and cmvIL-10 (identified only during lytic infection). We have analyzed the functions of LAcmvIL-10 during latent infection of primary myeloid progenitor cells and found that LAcmvIL-10 is responsible, at least in part, for the known increase in secretion of cellular IL-10 and CCL8 in the secretomes of latently infected cells. This latency-associated increase in CCL8 expression results from a concomitant LAcmvIL-10-mediated suppression of the expression of the cellular microRNA (miRNA) hsa-miR-92a, which targets CCL8 directly. Taking the data together, we show that the previously observed downregulation of hsa-miR-92a and upregulation of CCL8 during HCMV latent infection of myeloid cells are intimately linked via the latency-associated expression of LAcmvIL-10. IMPORTANCE HCMV latency causes significant morbidity and mortality in immunocompromised individuals, yet HCMV is carried silently (latently) in 50 to 90% of the population. Understanding how HCMV maintains infection for the lifetime of an infected individual is critical for the treatment of immunocompromised individuals suffering with disease as a result of HCMV. In this study, we analyze one of the proteins that are expressed during the “latent” phase of HCMV, LAcmvIL-10, and find that the expression of the gene modulates the microenvironment of the infected cell, leading to evasion of the immune system. PMID:25253336

  15. KLF13 regulates the differentiation-dependent human papillomavirus life cycle in keratinocytes through STAT5 and IL-8.


    Zhang, W; Hong, S; Maniar, K P; Cheng, S; Jie, C; Rademaker, A W; Krensky, A M; Clayberger, C


    High-risk strains of human papillomavirus (HPV) are the causative agents of cervical and anogenital cancers and are associated with 5% of all human cancers. Although prophylactic vaccines targeting a subset of HPV types are available, they are ineffective in HPV-infected individuals. Elucidation of the mechanisms controlling HPV replication may allow development of novel anti-HPV therapeutics. Infectious HPV virions are produced during terminal differentiation of host cells. The process of viral maturation requires synergistic interactions between viral and cellular proteins that leads to amplification of the viral genome and expression of late viral genes. Here we show that the transcription factor Kruppel-like factor 13 (KLF13) has a critical role in the HPV life cycle. KLF13 is overexpressed in HPV-positive keratinocytes and cervical cancer cell lines. Expression of KLF13 in normal cervical epithelium is low but increases significantly in cervical intraepithelial neoplasia and invasive squamous cervical cancer. After HPV infection, the E7 protein suppresses ubiquitin ligase FBW7 expression leading to an increase in KLF13 expression. Reduction of KLF13 with short hairpin RNA in differentiating HPV-positive cells resulted in diminished levels of viral gene expression and genome amplification. Knockdown of KLF13 also reduced the level of the transcription factor signal transducer and activator of transcription 5, which led to the downregulation of the ataxia-telangiectasia mutated DNA damage pathway and the chemokine interleukin-8 (IL-8). In addition, neutralization of IL-8 diminished viral genome amplification in differentiating HPV-positive cells. Thus, KLF13 is critical for the activation of the HPV productive life cycle and is likely involved in initiation and progression of cervical cancer.

  16. RNA Structural Elements of Hepatitis C Virus Controlling Viral RNA Translation and the Implications for Viral Pathogenesis

    PubMed Central

    Piñeiro, David; Martinez-Salas, Encarnación


    Hepatitis C virus (HCV) genome multiplication requires the concerted action of the viral RNA, host factors and viral proteins. Recent studies have provided information about the requirement of specific viral RNA motifs that play an active role in the viral life cycle. RNA regulatory motifs controlling translation and replication of the viral RNA are mostly found at the 5' and 3' untranslated regions (UTRs). In particular, viral protein synthesis is under the control of the internal ribosome entry site (IRES) element, a complex RNA structure located at the 5'UTR that recruits the ribosomal subunits to the initiator codon. Accordingly, interfering with this RNA structural motif causes the abrogation of the viral cycle. In addition, RNA translation initiation is modulated by cellular factors, including miRNAs and RNA-binding proteins. Interestingly, a RNA structural motif located at the 3'end controls viral replication and establishes long-range RNA-RNA interactions with the 5'UTR, generating functional bridges between both ends on the viral genome. In this article, we review recent advances on virus-host interaction and translation control modulating viral gene expression in infected cells. PMID:23202462

  17. Fulminant viral hepatitis.


    Jayakumar, Saumya; Chowdhury, Raiyan; Ye, Carrie; Karvellas, Constantine J


    Acute liver failure (ALF) is a condition wherein the previously healthy liver rapidly deteriorates, resulting in jaundice, encephalopathy, and coagulopathy. There are approximately 2000 cases per year of ALF in the United States. Viral causes (fulminant viral hepatitis [FVH]) are the predominant cause of ALF in developing countries. Given the ease of spread of viral hepatitis and the high morbidity and mortality associated with ALF, a systematic approach to the diagnosis and treatment of FVH is required. In this review, the authors describe the viral causes of ALF and review the intensive care unit management of patients with FVH. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Oxygen tension level and human viral infections

    SciTech Connect

    Morinet, Frédéric; Casetti, Luana; François, Jean-Hugues; Capron, Claude; Pillet, Sylvie


    The role of oxygen tension level is a well-known phenomenon that has been studied in oncology and radiotherapy since about 60 years. Oxygen tension may inhibit or stimulate propagation of viruses in vitro as well as in vivo. In turn modulating oxygen metabolism may constitute a novel approach to treat viral infections as an adjuvant therapy. The major transcription factor which regulates oxygen tension level is hypoxia-inducible factor-1 alpha (HIF-1α). Down-regulating the expression of HIF-1α is a possible method in the treatment of chronic viral infection such as human immunodeficiency virus infection, chronic hepatitis B and C viral infections and Kaposi sarcoma in addition to classic chemotherapy. The aim of this review is to supply an updating concerning the influence of oxygen tension level in human viral infections and to evoke possible new therapeutic strategies regarding this environmental condition. - Highlights: • Oxygen tension level regulates viral replication in vitro and possibly in vivo. • Hypoxia-inducible factor 1 (HIF-1α) is the principal factor involved in Oxygen tension level. • HIF-1α upregulates gene expression for example of HIV, JC and Kaposi sarcoma viruses. • In addition to classical chemotherapy inhibition of HIF-1α may constitute a new track to treat human viral infections.

  19. Bats as Viral Reservoirs.


    Hayman, David T S


    Bats are hosts of a range of viruses, including ebolaviruses, and many important human viral infections, such as measles and mumps, may have their ancestry traced back to bats. Here, I review viruses of all viral families detected in global bat populations. The viral diversity in bats is substantial, and viruses with all known types of genomic structures and replication strategies have been discovered in bats. However, the discovery of viruses is not geographically even, with some apparently undersampled regions, such as South America. Furthermore, some bat families, including those with global or wide distributions such as Emballonuridae and Miniopteridae, are underrepresented on viral databases. Future studies, including those that address these sampling gaps along with those that develop our understanding of viral-host relationships, are highlighted.

  20. Viral Disease Networks?

    NASA Astrophysics Data System (ADS)

    Gulbahce, Natali; Yan, Han; Vidal, Marc; Barabasi, Albert-Laszlo


    Viral infections induce multiple perturbations that spread along the links of the biological networks of the host cells. Understanding the impact of these cascading perturbations requires an exhaustive knowledge of the cellular machinery as well as a systems biology approach that reveals how individual components of the cellular system function together. Here we describe an integrative method that provides a new approach to studying virus-human interactions and its correlations with diseases. Our method involves the combined utilization of protein - protein interactions, protein -- DNA interactions, metabolomics and gene - disease associations to build a ``viraldiseasome''. By solely using high-throughput data, we map well-known viral associated diseases and predict new candidate viral diseases. We use microarray data of virus-infected tissues and patient medical history data to further test the implications of the viral diseasome. We apply this method to Epstein-Barr virus and Human Papillomavirus and shed light into molecular development of viral diseases and disease pathways.

  1. [Viral hepatitis during pregnancy].


    Gutkowski, Krzysztof; Gutkowska, Dorota; Lepiech, Jacek


    Viral hepatitis is one of the most common liver diseases appearing during pregnancy. Prevention against hepatotropic viruses is restricted due to lack of vaccines being effective in induction of efficient immunization in the majority of these microorganisms. In general, there is no possibility of active immunization against hepatotropic viruses except type A and B viral hepatitis. An issue of viral hepatitis in pregnancy as an aspect of potential risk factor connected with infection of pregnant women and a fetus has been described in this paper. Furthermore, the most important topics in the field of the epidemiology, prophylaxis and possible treatment options of viral hepatitis A, B, C, D, E and G have been discussed. The newest reports of pregnant women lamivudine therapy as a preventive treatment against vertical transmission during delivery have been reviewed. Rarly diagnosed viral hepatitis caused by herpes simplex virus, cytomegalovirus, Epstein-Barr virus and adenoviruses have been characterized as well.

  2. Amino-terminal domains of kainate receptors determine the differential dependence on Neto auxiliary subunits for trafficking

    PubMed Central

    Sheng, Nengyin; Shi, Yun Stone; Nicoll, Roger A.


    The kainate receptor (KAR), a subtype of glutamate receptor, mediates excitatory synaptic responses at a subset of glutamatergic synapses. However, the molecular mechanisms underlying the trafficking of its different subunits are poorly understood. Here we use the CA1 hippocampal pyramidal cell, which lacks KAR-mediated synaptic currents, as a null background to determine the minimal requirements for the extrasynaptic and synaptic expression of the GluK2 subunit. We find that the GluK2 receptor itself, in contrast to GluK1, traffics to the neuronal surface and synapse efficiently and the auxiliary subunits Neto1 and Neto2 caused no further enhancement of these two trafficking processes. However, the regulation of GluK2 biophysical properties by Neto proteins is the same as that of GluK1. We further determine that it is the amino-terminal domains (ATDs) of GluK1 and GluK2 that control the strikingly different trafficking properties between these two receptors. Moreover, the ATDs are critical for synaptic expression of heteromeric receptors at mossy fiber–CA3 synapses and also mediate the differential dependence on Neto proteins for surface and synaptic trafficking of GluK1 and GluK2. These results highlight the fundamental differences between the two major KAR subunits and their interplay with Neto auxiliary proteins. PMID:28100490

  3. Amino-terminal domains of kainate receptors determine the differential dependence on Neto auxiliary subunits for trafficking.


    Sheng, Nengyin; Shi, Yun Stone; Nicoll, Roger A


    The kainate receptor (KAR), a subtype of glutamate receptor, mediates excitatory synaptic responses at a subset of glutamatergic synapses. However, the molecular mechanisms underlying the trafficking of its different subunits are poorly understood. Here we use the CA1 hippocampal pyramidal cell, which lacks KAR-mediated synaptic currents, as a null background to determine the minimal requirements for the extrasynaptic and synaptic expression of the GluK2 subunit. We find that the GluK2 receptor itself, in contrast to GluK1, traffics to the neuronal surface and synapse efficiently and the auxiliary subunits Neto1 and Neto2 caused no further enhancement of these two trafficking processes. However, the regulation of GluK2 biophysical properties by Neto proteins is the same as that of GluK1. We further determine that it is the amino-terminal domains (ATDs) of GluK1 and GluK2 that control the strikingly different trafficking properties between these two receptors. Moreover, the ATDs are critical for synaptic expression of heteromeric receptors at mossy fiber-CA3 synapses and also mediate the differential dependence on Neto proteins for surface and synaptic trafficking of GluK1 and GluK2. These results highlight the fundamental differences between the two major KAR subunits and their interplay with Neto auxiliary proteins.

  4. Semicarbazide-sensitive amine oxidase in vascular smooth muscle cells: differentiation-dependent expression and role in glucose uptake.


    El Hadri, Khadija; Moldes, Marthe; Mercier, Nathalie; Andreani, Marise; Pairault, Jacques; Feve, Bruno


    Cultured vascular smooth muscle cells (VSMCs) derived from rat aortic media were used to examine semicarbazide-sensitive amine oxidase (SSAO) expression during their differentiation process. In a defined serum-free medium permissive for in vitro VSMC differentiation, there was a large increase in SSAO mRNA and protein levels and in the related enzyme activity during the course of cell culture. This pattern of expression was concomitant with that of some smooth muscle-specific mRNA markers of differentiation. mRNAs in differentiated cultured VSMCs were comparable to those detected in total aorta and media. Pharmacological properties of SSAO present in VSMCs were similar to enzyme activities previously described in the aortic wall. In this model, we also demonstrated that methylamine, a physiological substrate of SSAO, activated 2-deoxyglucose transport in a time- and dose-dependent manner. This methylamine effect was reproduced by other SSAO substrates and was prevented by the SSAO inhibitor semicarbazide. It was antagonized in the presence of catalase, suggesting that SSAO-activated glucose transport was mediated through H(2)O(2) production. In addition, methylamine promoted glucose transporter 1 accumulation at the cell surface. Thus, we demonstrate for the first time the differentiation-dependent expression of SSAO in VSMCs and its role in the regulation of VSMC glucose uptake.

  5. APOBEC3 Interference during Replication of Viral Genomes

    PubMed Central

    Willems, Luc; Gillet, Nicolas Albert


    Co-evolution of viruses and their hosts has reached a fragile and dynamic equilibrium that allows viral persistence, replication and transmission. In response, infected hosts have developed strategies of defense that counteract the deleterious effects of viral infections. In particular, single-strand DNA editing by Apolipoprotein B Editing Catalytic subunits proteins 3 (APOBEC3s) is a well-conserved mechanism of mammalian innate immunity that mutates and inactivates viral genomes. In this review, we describe the mechanisms of APOBEC3 editing during viral replication, the viral strategies that prevent APOBEC3 activity and the consequences of APOBEC3 modulation on viral fitness and host genome integrity. Understanding the mechanisms involved reveals new prospects for therapeutic intervention. PMID:26110583

  6. APOBEC3 Interference during Replication of Viral Genomes.


    Willems, Luc; Gillet, Nicolas Albert


    Co-evolution of viruses and their hosts has reached a fragile and dynamic equilibrium that allows viral persistence, replication and transmission. In response, infected hosts have developed strategies of defense that counteract the deleterious effects of viral infections. In particular, single-strand DNA editing by Apolipoprotein B Editing Catalytic subunits proteins 3 (APOBEC3s) is a well-conserved mechanism of mammalian innate immunity that mutates and inactivates viral genomes. In this review, we describe the mechanisms of APOBEC3 editing during viral replication, the viral strategies that prevent APOBEC3 activity and the consequences of APOBEC3 modulation on viral fitness and host genome integrity. Understanding the mechanisms involved reveals new prospects for therapeutic intervention.

  7. Viruses and viral proteins.


    Verdaguer, Nuria; Ferrero, Diego; Murthy, Mathur R N


    For more than 30 years X-ray crystallography has been by far the most powerful approach for determining the structures of viruses and viral proteins at atomic resolution. The information provided by these structures, which covers many important aspects of the viral life cycle such as cell-receptor recognition, viral entry, nucleic acid transfer and genome replication, has extensively enriched our vision of the virus world. Many of the structures available correspond to potential targets for antiviral drugs against important human pathogens. This article provides an overview of the current knowledge of different structural aspects of the above-mentioned processes.

  8. Viruses and viral proteins

    PubMed Central

    Verdaguer, Nuria; Ferrero, Diego; Murthy, Mathur R. N.


    For more than 30 years X-ray crystallography has been by far the most powerful approach for determining the structures of viruses and viral proteins at atomic resolution. The information provided by these structures, which covers many important aspects of the viral life cycle such as cell-receptor recognition, viral entry, nucleic acid transfer and genome replication, has extensively enriched our vision of the virus world. Many of the structures available correspond to potential targets for antiviral drugs against important human pathogens. This article provides an overview of the current knowledge of different structural aspects of the above-mentioned processes. PMID:25485129

  9. Inflammatory cytokines IL-32 and IL-17 have common signaling intermediates despite differential dependence on TNF-receptor 1.


    Turner-Brannen, Emily; Choi, Ka-Yee Grace; Arsenault, Ryan; El-Gabalawy, Hani; Napper, Scott; Mookherjee, Neeloffer


    Cytokines IL-32 and IL-17 are emerging as critical players in the pathophysiology of immune-mediated chronic inflammatory diseases. It has been speculated that the molecular mechanisms governing IL-32- and IL-17-mediated cellular responses are differentially dependent on the TNF pathway. In this study, kinome analysis demonstrated that following stimulation with cytokine IL-32, but not IL-17, there was increased phosphorylation of a peptide target corresponding to TNF-R1. Consistent with this observation, blocking TNF-R1 resulted in a suppression of IL-32-induced downstream responses, indicating that IL-32-mediated activity may be dependent on TNF-R1. In contrast, blocking TNF-R1 did not affect IL-17-induced downstream responses. Kinome analysis also implicated p300 (transcriptional coactivator) and death-associated protein kinase-1 (DAPK-1) as signaling intermediates for both IL-32 and IL-17. Phosphorylation of p300 and DAPK-1 upon stimulation with either IL-32 or IL-17 was confirmed by immunoblots. The presence of common targets was supported by results demonstrating similar downstream responses induced in the presence of IL-32 and IL-17, such as transcriptional responses and the direct activation of NF-κB. Furthermore, knockdown of p300 and DAPK-1 altered downstream responses induced by IL-32 and IL-17, and impacted certain cellular responses induced by TNF-α and IL-1β. We hypothesize that p300 and DAPK-1 represent nodes where the inflammatory networks of IL-32 and IL-17 overlap, and that these proteins would affect both TNF-R1-dependent and -independent pathways. Therefore, p300 and DAPK-1 are viable potential therapeutic targets for chronic inflammatory diseases.

  10. Methods of using viral replicase polynucleotides and polypeptides


    Gordon-Kamm, William J.; Lowe, Keith S.; Bailey, Matthew A.; Gregory, Carolyn A.; Hoerster, George J.; Larkins, Brian A.; Dilkes, Brian R.; Burnett, Ronald; Woo, Young Min


    The invention provides novel methods of using viral replicase polypeptides and polynucleotides. Included are methods for increasing transformation frequencies, increasing crop yield, providing a positive growth advantage, modulating cell division, transiently modulating cell division, and for providing a means of positive selection.

  11. Viral hemorrhagic septicemia

    USGS Publications Warehouse

    Batts, William N.; Winton, James R.


    Viral hemorrhagic septicemia (VHS) is one of the most important viral diseases of finfish worldwide. In the past, VHS was thought to affect mainly rainbow trout Oncorhynchus mykiss reared at freshwater facilities in Western Europe where it was known by various names including Egtved disease and infectious kidney swelling and liver degeneration (Wolf 1988). Today, VHS is known as an important source of mortality for cultured and wild fish in freshwater and marine environments in several regions of the northern hemisphere (Dixon 1999; Gagné et al. 2007; Kim and Faisal 2011; Lumsden et al. 2007; Marty et al. 1998, 2003; Meyers and Winton 1995; Skall et al. 2005b; Smail 1999; Takano et al. 2001). Viral hemorrhagic septicemia is caused by the fish rhabdovirus, viral hemorrhagic septicemia virus (VHSV), a member of the genus Novirhabdovirus of the family Rhabdoviridae

  12. Viral quasispecies complexity measures.


    Gregori, Josep; Perales, Celia; Rodriguez-Frias, Francisco; Esteban, Juan I; Quer, Josep; Domingo, Esteban


    Mutant spectrum dynamics (changes in the related mutants that compose viral populations) has a decisive impact on virus behavior. The several platforms of next generation sequencing (NGS) to study viral quasispecies offer a magnifying glass to study viral quasispecies complexity. Several parameters are available to quantify the complexity of mutant spectra, but they have limitations. Here we critically evaluate the information provided by several population diversity indices, and we propose the introduction of some new ones used in ecology. In particular we make a distinction between incidence, abundance and function measures of viral quasispecies composition. We suggest a multidimensional approach (complementary information contributed by adequately chosen indices), propose some guidelines, and illustrate the use of indices with a simple example. We apply the indices to three clinical samples of hepatitis C virus that display different population heterogeneity. Areas of virus biology in which population complexity plays a role are discussed.

  13. Modeling Viral Spread

    PubMed Central

    Graw, Frederik; Perelson, Alan S.


    The way in which a viral infection spreads within a host is a complex process that is not well understood. Different viruses, such as human immunodeficiency virus type 1 and hepatitis C virus, have evolved different strategies, including direct cell-to-cell transmission and cell-free transmission, to spread within a host. To what extent these two modes of transmission are exploited in vivo is still unknown. Mathematical modeling has been an essential tool to get a better systematic and quantitative understanding of viral processes that are difficult to discern through strictly experimental approaches. In this review, we discuss recent attempts that combine experimental data and mathematical modeling in order to determine and quantify viral transmission modes. We also discuss the current challenges for a systems-level understanding of viral spread, and we highlight the promises and challenges that novel experimental techniques and data will bring to the field. PMID:27618637

  14. Microvesicles and viral infection.


    Meckes, David G; Raab-Traub, Nancy


    Cells secrete various membrane-enclosed microvesicles from their cell surface (shedding microvesicles) and from internal, endosome-derived membranes (exosomes). Intriguingly, these vesicles have many characteristics in common with enveloped viruses, including biophysical properties, biogenesis, and uptake by cells. Recent discoveries describing the microvesicle-mediated intercellular transfer of functional cellular proteins, RNAs, and mRNAs have revealed additional similarities between viruses and cellular microvesicles. Apparent differences include the complexity of viral entry, temporally regulated viral expression, and self-replication proceeding to infection of new cells. Interestingly, many virally infected cells secrete microvesicles that differ in content from their virion counterparts but may contain various viral proteins and RNAs. For the most part, these particles have not been analyzed for their content or functions during viral infection. However, early studies of microvesicles (L-particles) secreted from herpes simplex virus-infected cells provided the first evidence of microvesicle-mediated intercellular communication. In the case of Epstein-Barr virus, recent evidence suggests that this tumorigenic herpesvirus also utilizes exosomes as a mechanism of cell-to-cell communication through the transfer of signaling competent proteins and functional microRNAs to uninfected cells. This review focuses on aspects of the biology of microvesicles with an emphasis on their potential contributions to viral infection and pathogenesis.

  15. Microvesicles and Viral Infection▿

    PubMed Central

    Meckes, David G.; Raab-Traub, Nancy


    Cells secrete various membrane-enclosed microvesicles from their cell surface (shedding microvesicles) and from internal, endosome-derived membranes (exosomes). Intriguingly, these vesicles have many characteristics in common with enveloped viruses, including biophysical properties, biogenesis, and uptake by cells. Recent discoveries describing the microvesicle-mediated intercellular transfer of functional cellular proteins, RNAs, and mRNAs have revealed additional similarities between viruses and cellular microvesicles. Apparent differences include the complexity of viral entry, temporally regulated viral expression, and self-replication proceeding to infection of new cells. Interestingly, many virally infected cells secrete microvesicles that differ in content from their virion counterparts but may contain various viral proteins and RNAs. For the most part, these particles have not been analyzed for their content or functions during viral infection. However, early studies of microvesicles (L-particles) secreted from herpes simplex virus-infected cells provided the first evidence of microvesicle-mediated intercellular communication. In the case of Epstein-Barr virus, recent evidence suggests that this tumorigenic herpesvirus also utilizes exosomes as a mechanism of cell-to-cell communication through the transfer of signaling competent proteins and functional microRNAs to uninfected cells. This review focuses on aspects of the biology of microvesicles with an emphasis on their potential contributions to viral infection and pathogenesis. PMID:21976651

  16. Immigration and viral hepatitis.


    Sharma, Suraj; Carballo, Manuel; Feld, Jordan J; Janssen, Harry L A


    WHO estimates reveal that the global prevalence of viral hepatitis may be as high as 500 million, with an annual mortality rate of up to 1.3 million individuals. The majority of this global burden of disease is borne by nations of the developing world with high rates of vertical and iatrogenic transmission of HBV and HCV, as well as poor access to healthcare. In 2013, 3.2% of the global population (231 million individuals) migrated into a new host nation. Migrants predominantly originate from the developing countries of the south, into the developed economies of North America and Western Europe. This mass migration of individuals from areas of high-prevalence of viral hepatitis poses a unique challenge to the healthcare systems of the host nations. Due to a lack of universal standards for screening, vaccination and treatment of viral hepatitis, the burden of chronic liver disease and hepatocellular carcinoma continues to increase among migrant populations globally. Efforts to increase case identification and treatment among migrants have largely been limited to small outreach programs in urban centers, such that the majority of migrants with viral hepatitis continue to remain unaware of their infection. This review summarizes the data on prevalence of viral hepatitis and burden of chronic liver disease among migrants, current standards for screening and treatment of immigrants and refugees, and efforts to improve the identification and treatment of viral hepatitis among migrants.

  17. NCBI viral genomes resource.


    Brister, J Rodney; Ako-Adjei, Danso; Bao, Yiming; Blinkova, Olga


    Recent technological innovations have ignited an explosion in virus genome sequencing that promises to fundamentally alter our understanding of viral biology and profoundly impact public health policy. Yet, any potential benefits from the billowing cloud of next generation sequence data hinge upon well implemented reference resources that facilitate the identification of sequences, aid in the assembly of sequence reads and provide reference annotation sources. The NCBI Viral Genomes Resource is a reference resource designed to bring order to this sequence shockwave and improve usability of viral sequence data. The resource can be accessed at and catalogs all publicly available virus genome sequences and curates reference genome sequences. As the number of genome sequences has grown, so too have the difficulties in annotating and maintaining reference sequences. The rapid expansion of the viral sequence universe has forced a recalibration of the data model to better provide extant sequence representation and enhanced reference sequence products to serve the needs of the various viral communities. This, in turn, has placed increased emphasis on leveraging the knowledge of individual scientific communities to identify important viral sequences and develop well annotated reference virus genome sets. Published by Oxford University Press on behalf of Nucleic Acids Research 2014. This work is written by US Government employees and is in the public domain in the US.

  18. NCBI Viral Genomes Resource

    PubMed Central

    Brister, J. Rodney; Ako-adjei, Danso; Bao, Yiming; Blinkova, Olga


    Recent technological innovations have ignited an explosion in virus genome sequencing that promises to fundamentally alter our understanding of viral biology and profoundly impact public health policy. Yet, any potential benefits from the billowing cloud of next generation sequence data hinge upon well implemented reference resources that facilitate the identification of sequences, aid in the assembly of sequence reads and provide reference annotation sources. The NCBI Viral Genomes Resource is a reference resource designed to bring order to this sequence shockwave and improve usability of viral sequence data. The resource can be accessed at and catalogs all publicly available virus genome sequences and curates reference genome sequences. As the number of genome sequences has grown, so too have the difficulties in annotating and maintaining reference sequences. The rapid expansion of the viral sequence universe has forced a recalibration of the data model to better provide extant sequence representation and enhanced reference sequence products to serve the needs of the various viral communities. This, in turn, has placed increased emphasis on leveraging the knowledge of individual scientific communities to identify important viral sequences and develop well annotated reference virus genome sets. PMID:25428358

  19. Cell cycle regulation during viral infection.


    Bagga, Sumedha; Bouchard, Michael J


    To replicate their genomes in cells and generate new progeny, viruses typically require factors provided by the cells that they have infected. Subversion of the cellular machinery that controls replication of the infected host cell is a common activity of many viruses. Viruses employ different strategies to deregulate cell cycle checkpoint controls and modulate cell proliferation pathways. A number of DNA and RNA viruses encode proteins that target critical cell cycle regulators to achieve cellular conditions that are beneficial for viral replication. Many DNA viruses induce quiescent cells to enter the cell cycle; this is thought to increase pools of deoxynucleotides and thus, facilitate viral replication. In contrast, some viruses can arrest cells in a particular phase of the cell cycle that is favorable for replication of the specific virus. Cell cycle arrest may inhibit early cell death of infected cells, allow the cells to evade immune defenses, or help promote virus assembly. Although beneficial for the viral life cycle, virus-mediated alterations in normal cell cycle control mechanisms could have detrimental effects on cellular physiology and may ultimately contribute to pathologies associated with the viral infection, including cell transformation and cancer progression and maintenance. In this chapter, we summarize various strategies employed by DNA and RNA viruses to modulate the replication cycle of the virus-infected cell. When known, we describe how these virus-associated effects influence replication of the virus and contribute to diseases associated with infection by that specific virus.

  20. HCV-specific interleukin-21+CD4+ T cells responses associated with viral control through the modulation of HCV-specific CD8+ T cells function in chronic hepatitis C patients.


    Feng, Guohua; Zhang, Ji-Yuan; Zeng, Qing-Lei; Jin, Lei; Fu, Junliang; Yang, Bin; Sun, Ying; Jiang, Tianjun; Xu, Xiangsheng; Zhang, Zheng; Yuan, Jinhong; Wu, Liyuan; Wang, Fu-Sheng


    Interleukin-21 (IL-21)+CD4+ T cells are involved in the immune response against hepatitis B virus (HBV) by secreting IL-21. However, the role of IL-21+CD4+ T cells in the immune response against chronic hepatitis C (CHC) virus infection is poorly understood. This study aimed to investigate the role of IL-21+CD4+ T cells in CHC patients and the potential mechanisms. The study subjects included nineteen CHC patients who were grouped by viral load (low, < 10(6) RNA copies/ml, n = 8; high, > 10(6) RNA copies/ml, n = 11). The peripheral frequency of HCV-specific IL-21+CD4+ T cells was higher in the low viral load group and was negatively correlated with the serum HCV RNA viral load in all CHC patients. Meanwhile, IL-21+ cells accumulated in the liver in the low viral load group. In vitro, IL-21 treatment increased the expression of proliferation markers and cytolytic molecules on HCV-specific CD8+ T cells. In summary, these findings suggest that HCV-specific IL-21+CD4+ T cells might contribute to HCV control by rescuing HCV-specific CD8+ T cells in CHC patients.

  1. Concepts in viral pathogenesis II

    SciTech Connect

    Notkins, A.L.; Oldstone, M.B.A.


    This paper contains papers divided among 10 sections. The section titles are: Viral Structure and Function; Viral Constructs; Oncogenes, Transfection, and Differentiation; Viral Tropism and Entry into Cells; Immune Recognition of Viruses; Evolving Concepts in Viral Pathogenesis Illustrated by Selected Plant and Animal Models; Evolving Concepts in Viral Pathogenesis Illustrated by Selected Diseases in Humans; New Trends in Diagnosis and Epidemiology; and Vaccines and Antiviral Therapy.

  2. [Viral drug resistance].


    Dudman, Susanne Gjeruldsen; Stene-Johansen, Kathrine; Vik, Inger Sofie Samdal


    More and more viral infections are treated with antiviral drugs, and resistance against these drugs is steadily increasing. Our aim is to give a general understanding of viral resistance and its clinical significance. This article is based on review of published literature on the subject, international recommendations and our own experience as a national reference laboratory for hepatitis viruses. Development of viral resistance is an increasing problem with long-term treatment of both latent and chronic viral infections and may be one of the reasons for clinical treatment failure. Susceptibility testing is therefore an important diagnostic tool in cases of suspected failure during antiviral treatment, and is also necessary for customising of treatment to each individual patient. In Norway, susceptibility testing is offered for HIV, HBV, CMV and influenza, whereas systematic surveillance for the time being is only performed on HIV and influenza resistance. Surveillance on viral resistance is necessary in order to choose the adequate empirical therapy and to monitor the spread of resistant virus in the population. Prevalence of resistance can be limited with infection control measures and appropriate antiviral treatment, especially used in combinations of effective drugs directed at different enzymes and proteins within the virus.

  3. Modeling Viral Capsid Assembly

    PubMed Central


    I present a review of the theoretical and computational methodologies that have been used to model the assembly of viral capsids. I discuss the capabilities and limitations of approaches ranging from equilibrium continuum theories to molecular dynamics simulations, and I give an overview of some of the important conclusions about virus assembly that have resulted from these modeling efforts. Topics include the assembly of empty viral shells, assembly around single-stranded nucleic acids to form viral particles, and assembly around synthetic polymers or charged nanoparticles for nanotechnology or biomedical applications. I present some examples in which modeling efforts have promoted experimental breakthroughs, as well as directions in which the connection between modeling and experiment can be strengthened. PMID:25663722

  4. Acute viral myocarditis

    PubMed Central

    Dennert, Robert; Crijns, Harry J.; Heymans, Stephane


    Acute myocarditis is one of the most challenging diagnosis in cardiology. At present, no diagnostic gold standard is generally accepted, due to the insensitivity of traditional diagnostic tests. This leads to the need for new diagnostic approaches, which resulted in the emergence of new molecular tests and a more detailed immunohistochemical analysis of endomyocardial biopsies. Recent findings using these new diagnostic tests resulted in increased interest in inflammatory cardiomyopathies and a better understanding of its pathophysiology, the recognition in overlap of virus-mediated damage, inflammation, and autoimmune dysregulation. Novel results also pointed towards a broader spectrum of viral genomes responsible for acute myocarditis, indicating a shift of enterovirus and adenovirus to parvovirus B19 and human herpes virus 6. The present review proposes a general diagnostic approach, focuses on the viral aetiology and associated autoimmune processes, and reviews treatment options for patients with acute viral myocarditis. PMID:18617482

  5. [Vasculitis and viral infection].


    Martínez Aguilar, N E; Guido Bayardo, R; Vargas Camaño, M E; Compañ González, D; Miranda Feria, A J


    Viruses have been implicated in vasculitis. To determine activity of viral infection associated with vasculitis. 17 patients with vasculitis had been in immunological and antiviral antibodies evaluation. Twenty five healthy controls sex and age matched with hematic biometry (BH) and AA. All subjects were negative to HIV and HBV. Viral activity was demonstrated in eight patients; vascular purpura (5), Takayasu disease (1), polyarteritis nodosa (1), erythema nodosum (1). None subject of control group had IgM activity. Antibodies response of IgG in patients were of lesser intensity than in control group. 14 abnormalities in BH were found in patients and 4 in control group. Immune response in patients, measured by lymphocyte subpopulations and circulating immune complexes was abnormal. In conclusion 47% showed viral activity, but the dominant feature was abnormal immune response in 82%.

  6. Viral infections and allergies.


    Xepapadaki, Paraskevi; Papadopoulos, Nikolaos G


    Respiratory viral infections have been implicated in the origin of, protection from and exacerbation of allergy-related symptoms in a variety of ways. Viral infections are closely linked to infantile wheezing. Severe bronchiolitis in early infancy may predispose to chronic childhood asthma as well as allergic sensitization; alternatively it could represent a marker of susceptible individuals. In contrast, repeated mild infections in early life may have a protective role in the development of asthma or atopy by driving the immune system towards Th1 responses. However, evidence on this hypothesis is not consistent as far as respiratory viruses are concerned. Several factors, including the presence of an atopic environment, timing of exposure and severity of the infection, interactively contribute to the allergy-infection relationship. In the present report, recent data on the role of viral infections in the development and progression of allergy and asthma are reviewed.

  7. Viral mimicry of cytokines, chemokines and their receptors.


    Alcami, Antonio


    Viruses have evolved elegant mechanisms to evade detection and destruction by the host immune system. One of the evasion strategies that have been adopted by large DNA viruses is to encode homologues of cytokines, chemokines and their receptors--molecules that have a crucial role in control of the immune response. Viruses have captured host genes or evolved genes to target specific immune pathways, and so viral genomes can be regarded as repositories of important information about immune processes, offering us a viral view of the host immune system. The study of viral immunomodulatory proteins might help us to uncover new human genes that control immunity, and their characterization will increase our understanding of not only viral pathogenesis, but also normal immune mechanisms. Moreover, viral proteins indicate strategies of immune modulation that might have therapeutic potential.

  8. Advances in viral oncology

    SciTech Connect

    Klein, G.


    Volume 6 of Advances in Viral Oncology presents experimental approaches to multifactorial interactions in tumor development. Included are in-depth analyses of malignant phenotypes by oncogene complementation, as well as studies of complementary interactions among DNA viral oncogenes; multiple cell-derived sequences in single retroviral genomes; and sequences that influence the transforming activity and expression of the mos oncogene. The genetic regulation of tumorigenic expression in somatic cell hybrids, the inhibition of oncogenes by cellular genes, and the interaction of genes that favor and genes that suppress tumorigenesis are examined in detail. The book concludes with a study of the relationship of oncogenes to the evolution of the metastatic phenotype.

  9. Viral apoptotic mimicry.


    Amara, Ali; Mercer, Jason


    As opportunistic pathogens, viruses have evolved many elegant strategies to manipulate host cells for infectious entry and replication. Viral apoptotic mimicry, defined by the exposure of phosphatidylserine - a marker for apoptosis - on the pathogen surface, is emerging as a common theme used by enveloped viruses to promote infection. Focusing on the four best described examples (vaccinia virus, dengue virus, Ebola virus and pseudotyped lentivirus), we summarize our current understanding of apoptotic mimicry as a mechanism for virus entry, binding and immune evasion. We also describe recent examples of non-enveloped viruses that use this mimicry strategy, and discuss future directions and how viral apoptotic mimicry could be targeted therapeutically.

  10. Viral diseases of the rabbit.


    Krogstad, Aric P; Simpson, Janet E; Korte, Scott W


    Viral disease in the rabbit is encountered infrequently by the clinical practitioner; however, several viral diseases were reported to occur in this species. Viral diseases that are described in the rabbit primarily may affect the integument, gastrointestinal tract or, central nervous system or maybe multi-systemic in nature. Rabbit viral diseases range from oral papillomatosis, with benign clinical signs, to rabbit hemorrhagic disease and myxomatosis, which may result in significant clinical disease and mortality. The wild rabbit may serve as a reservoir for disease transmission for many of these viral agents. In general, treatment of viral disease in the rabbit is supportive in nature.

  11. Marine Viral Pathogens.

    DTIC Science & Technology


    toxin producing microalgae (Raphidophyceae). Although we have not definitively shown that the pathogen is viral, it has many characteristics that...Society America, Miami, FL, June 1994. 40.Hennes, K.P. and C.A. Suttle. 1994. The use of cyanine dyes for quantifying free viruses in natural water

  12. Leafhopper viral pathogens

    USDA-ARS?s Scientific Manuscript database

    Four newly discovered viral pathogens in leafhopper vectors of Pierce’s disease of grapes, have been shown to replicate in sharpshooter leafhoppers; the glassy-winged sharpshooter, GWSS, Homalodisca vitripennis, and Oncometopia nigricans (Hemiptera: Cicadellidae). The viruses were classified as memb...


    EPA Science Inventory

    Viral and protozoan pathogens associated with raw sludge can cause encephalitis, gastroenteritis, hepatitis, myocarditis, and a number of other diseases. Raw sludge that has been treated to reduce these pathogens can be used for land application according to the regulations spec...


    EPA Science Inventory

    Viral and protozoan pathogens associated with raw sludge can cause encephalitis, gastroenteritis, hepatitis, myocarditis, and a number of other diseases. Raw sludge that has been treated to reduce these pathogens can be used for land application according to the regulations spec...

  15. Viral dependence on cellular ion channels - an emerging anti-viral target?


    Hover, Samantha; Foster, Becky; Barr, John; Mankouri, Jamel


    The broad range of cellular functions governed by ion channels represents an attractive target for viral manipulation. Indeed, modulation of host cell ion channel activity by viral proteins is being increasingly identified as an important virus-host interaction. Recent examples have demonstrated that virion entry, virus-egress and the maintenance of a cellular environment conducive to virus persistence are in part, dependent on virus manipulation of ion channel activity. Most excitingly, evidence has emerged that targeting ion channels pharmacologically can impede virus lifecycles. Here we discuss current examples of virus-ion channel interactions and the potential of targeting ion channel function as a new, pharmacologically safe and broad ranging anti-viral therapeutic strategy.

  16. Cytoplasmic RNA Granules and Viral Infection

    PubMed Central

    Tsai, Wei-Chih; Lloyd, Richard E.


    RNA granules are dynamic cellular structures essential for proper gene expression and homeostasis. The two principle types of cytoplasmic RNA granules are stress granules (SGs), which contain stalled translation initiation complexes, and processing bodies (P-bodies, PBs), which concentrate factors involved in mRNA degradation. RNA granules are associated with gene silencing of transcripts, thus, viruses repress RNA granule functions to favor replication. This review discusses the breadth of viral interactions with cytoplasmic RNA granules, focusing on mechanisms that modulate the functions of RNA granules and that typically promote viral replication. Currently mechanisms for virus manipulation of RNA granules can be loosely grouped into three non-exclusive categories; i) cleavage of key RNA granule factors, ii) regulation of PKR activation and iii) co-opting RNA granule factors for new roles in viral replication. Viral repression of RNA granules supports productive infection by inhibiting their gene silencing functions and counteracting their role in linking stress sensing with innate immune activation. PMID:26958719

  17. Vpr-host interactions during HIV-1 viral life cycle.


    Zhao, Richard Y; Li, Ge; Bukrinsky, Michael I


    Human immunodeficiency virus type 1 (HIV-1) viral protein R (Vpr) is a multifunctional viral protein that plays important role at multiple stages of the HIV-1 viral life cycle. Although the molecular mechanisms underlying these activities are subject of ongoing investigations, overall, these activities have been linked to promotion of viral replication and impairment of anti-HIV immunity. Importantly, functional defects of Vpr have been correlated with slow disease progression of HIV-infected patients. Vpr is required for efficient viral replication in non-dividing cells such as macrophages, and it promotes, to some extent, viral replication in proliferating CD4+ T cells. The specific activities of Vpr include modulation of fidelity of viral reverse transcription, nuclear import of the HIV-1 pre-integration complex, transactivation of the HIV-1 LTR promoter, induction of cell cycle G2 arrest and cell death via apoptosis. In this review, we focus on description of the cellular proteins that specifically interact with Vpr and discuss their significance with regard to the known Vpr activities at each step of the viral life cycle in proliferating and non-proliferating cells.

  18. Herpes viral culture of lesion


    ... virus; Herpes simplex virus culture Images Viral lesion culture References Costello M, Sabatini LM, Yungbluth M. Viral infections. In: McPherson RA, Pincus MR, eds. Henry's Clinical Diagnosis and Management by Laboratory Methods . 22nd ed. Philadelphia, PA: Elsevier ...

  19. Genetic methods for studying the role of viral oncogenes in the HPV life cycle.


    Bodily, Jason M


    Human papillomaviruses are the causative agents of several cancers, but only a minority of HPV infections progress to malignancy. In order to better understand HPV biology during the normal, differentiation-dependent life cycle, a cell culture model that maintains the complete episomal genome and permits host cell differentiation is critical. Furthermore, the use of cloned DNA as a starting material is important to facilitate genetic analyses. In this chapter, procedures for isolating human keratinocytes, establishing cell lines maintaining HPV16 genomes, and inducing cellular differentiation, which permits analysis of both early and late stages in the viral life cycle, are described.

  20. Viral Vector Production: Adenovirus.


    Kim, Julius W; Morshed, Ramin A; Kane, J Robert; Auffinger, Brenda; Qiao, Jian; Lesniak, Maciej S


    Adenoviral vectors have proven to be valuable resources in the development of novel therapies aimed at targeting pathological conditions of the central nervous system, including Alzheimer's disease and neoplastic brain lesions. Not only can some genetically engineered adenoviral vectors achieve remarkably efficient and specific gene delivery to target cells, but they also may act as anticancer agents by selectively replicating within cancer cells.Due to the great interest in using adenoviral vectors for various purposes, the need for a comprehensive protocol for viral vector production is especially apparent. Here, we describe the process of generating an adenoviral vector in its entirety, including the more complex process of adenoviral fiber modification to restrict viral tropism in order to achieve more efficient and specific gene delivery.

  1. Viral Membrane Scission

    PubMed Central

    Rossman, Jeremy S.; Lamb, Robert A.


    Virus budding is a complex, multistep process in which viral proteins make specific alterations in membrane curvature. Many different viral proteins can deform the membrane and form a budding virion, but very few can mediate membrane scission to complete the budding process. As a result, enveloped viruses have developed numerous ways of facilitating membrane scission, including hijacking host cellular scission machinery and expressing their own scission proteins. These proteins mediate scission in very different ways, though the biophysical mechanics underlying their actions may be similar. In this review, we explore the mechanisms of membrane scission and the ways in which enveloped viruses use these systems to mediate the release of budding virions. PMID:24099087

  2. Immunogenetics of viral infections.


    Martin, Maureen P; Carrington, Mary


    The HLA class I and II genes encode molecules that lie at the heart of the acquired immune response against infectious diseases. Associations between these polymorphic loci and genetically complex infectious diseases have been historically elusive, in contrast to the more obvious HLA associations with autoimmune diseases. High resolution molecular typing of large, clinically well-defined cohorts has begun to uncover evidence for the influence of HLA diversity on diseases of viral etiology, such as those caused by HIV-1, hepatitis B virus, hepatitis C virus and human papilloma virus. Combinations of HLA and KIR also appear to affect outcome to viral infection, supporting a role for HLA class I diversity in the innate immune response in addition to the acquired immune response.

  3. Viral membrane fusion

    PubMed Central

    Harrison, Stephen C


    Infection by viruses having lipid-bilayer envelopes proceeds through fusion of the viral membrane with a membrane of the target cell. Viral ‘fusion proteins’ facilitate this process. They vary greatly in structure, but all seem to have a common mechanism of action, in which a ligand-triggered, large-scale conformational change in the fusion protein is coupled to apposition and merger of the two bilayers. We describe three examples—the influenza virus hemagglutinin, the flavivirus E protein and the vesicular stomatitis virus G protein—in some detail, to illustrate the ways in which different structures have evolved to implement this common mechanism. Fusion inhibitors can be effective antiviral agents. PMID:18596815

  4. Viral membrane fusion

    PubMed Central

    Harrison, Stephen C.


    Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formed draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. PMID:25866377

  5. Viral membrane fusion

    SciTech Connect

    Harrison, Stephen C.


    Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formed draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. - Highlights: • Viral fusion proteins overcome the high energy barrier to lipid bilayer merger. • Different molecular structures but the same catalytic mechanism. • Review describes properties of three known fusion-protein structural classes. • Single-virion fusion experiments elucidate mechanism.

  6. Beyond Viral Neutralization.


    Lewis, George K; Pazgier, Marzena; Evans, David; Ferrari, Guido; Bournazos, Stylianos; Parsons, Matthew S; Bernard, Nicole F; Finzi, Andrés


    It has been known for more than 30 years that Human Immunodeficiency Virus 1 (HIV-1) infection drives a very potent B cell response resulting in the production of anti-HIV-1 antibodies targeting several viral proteins, particularly its envelope glycoproteins (Env). Env epitopes are exposed on the surfaces of viral particles and infected cells where they are targets of potentially protective antibodies. These antibodies can interdict infection by neutralization and there is strong evidence suggesting that Fc-mediated effector function can also contribute to protection. Current evidence suggests that Fc-mediated effector function plays a role in protection against infection by broadly neutralizing antibodies (bnAbs) and it might be important for protection by non-neutralizing antibodies. Fc-mediated effector function includes diverse mechanisms that include antibody-dependent cellular cytotoxicity (ADCC), antibody-mediated complement activation (ADC), antibody-dependent cellular phagocytosis (ADCP), antibody-dependent cell-mediated virus inhibition (ADCVI), antibody-mediated trancytosis inhibition, and antibody-mediated virus opsonization. All these functions could be beneficial in fighting viral infections including HIV-1. In this perspective, we discuss the latest developments for ADCC responses discussed at the HIVR4P satellite session on non-neutralizing antibodies, with emphasis on the mechanisms of ADCC resistance employed by HIV-1, the structural basis of epitopes recognized by antibodies that mediate ADCC, NK-cell education and ADCC, and murine models to study ADCC against HIV-1.

  7. KSHV Rta Promoter Specification and Viral Reactivation

    PubMed Central

    Guito, Jonathan; Lukac, David M.


    Viruses are obligate intracellular pathogens whose biological success depends upon replication and packaging of viral genomes, and transmission of progeny viruses to new hosts. The biological success of herpesviruses is enhanced by their ability to reproduce their genomes without producing progeny viruses or killing the host cells, a process called latency. Latency permits a herpesvirus to remain undetected in its animal host for decades while maintaining the potential to reactivate, or switch, to a productive life cycle when host conditions are conducive to generating viral progeny. Direct interactions between many host and viral molecules are implicated in controlling herpesviral reactivation, suggesting complex biological networks that control the decision. One viral protein that is necessary and sufficient to switch latent Kaposi’s sarcoma-associated herpesvirus (KSHV) into the lytic infection cycle is called K-Rta. K-Rta is a transcriptional activator that specifies promoters by binding DNA directly and interacting with cellular proteins. Among these cellular proteins, binding of K-Rta to RBP-Jk is essential for viral reactivation. In contrast to the canonical model for Notch signaling, RBP-Jk is not uniformly and constitutively bound to the latent KSHV genome, but rather is recruited to DNA by interactions with K-Rta. Stimulation of RBP-Jk DNA binding requires high affinity binding of Rta to repetitive and palindromic “CANT DNA repeats” in promoters, and formation of ternary complexes with RBP-Jk. However, while K-Rta expression is necessary for initiating KSHV reactivation, K-Rta’s role as the switch is inefficient. Many factors modulate K-Rta’s function, suggesting that KSHV reactivation can be significantly regulated post-Rta expression and challenging the notion that herpesviral reactivation is bistable. This review analyzes rapidly evolving research on KSHV K-Rta to consider the role of K-Rta promoter specification in regulating the progression

  8. Optimizing Viral Discovery in Bats

    PubMed Central

    Young, Cristin C. W.; Olival, Kevin J.


    Viral discovery studies in bats have increased dramatically over the past decade, yet a rigorous synthesis of the published data is lacking. We extract and analyze data from 93 studies published between 2007–2013 to examine factors that increase success of viral discovery in bats, and specific trends and patterns of infection across host taxa and viral families. Over the study period, 248 novel viruses from 24 viral families have been described. Using generalized linear models, at a study level we show the number of host species and viral families tested best explained number of viruses detected. We demonstrate that prevalence varies significantly across viral family, specimen type, and host taxonomy, and calculate mean PCR prevalence by viral family and specimen type across all studies. Using a logistic model, we additionally identify factors most likely to increase viral detection at an individual level for the entire dataset and by viral families with sufficient sample sizes. Our analysis highlights major taxonomic gaps in recent bat viral discovery efforts and identifies ways to improve future viral pathogen detection through the design of more efficient and targeted sample collection and screening approaches. PMID:26867024

  9. Digoxin Suppresses HIV-1 Replication by Altering Viral RNA Processing

    PubMed Central

    Wong, Raymond W.; Balachandran, Ahalya; Ostrowski, Mario A.; Cochrane, Alan


    To develop new approaches to control HIV-1 replication, we examined the capacity of recently described small molecular modulators of RNA splicing for their effects on viral RNA metabolism. Of the drugs tested, digoxin was found to induce a dramatic inhibition of HIV-1 structural protein synthesis, a response due, in part, to reduced accumulation of the corresponding viral mRNAs. In addition, digoxin altered viral RNA splice site use, resulting in loss of the essential viral factor Rev. Digoxin induced changes in activity of the CLK family of SR protein kinases and modification of several SR proteins, including SRp20 and Tra2β, which could account for the effects observed. Consistent with this hypothesis, overexpression of SRp20 elicited changes in HIV-1 RNA processing similar to those observed with digoxin. Importantly, digoxin was also highly active against clinical strains of HIV-1 in vitro, validating this novel approach to treatment of this infection. PMID:23555254

  10. Viral surveillance and discovery.


    Lipkin, Walter Ian; Firth, Cadhla


    The field of virus discovery has burgeoned with the advent of high throughput sequencing platforms and bioinformatics programs that enable rapid identification and molecular characterization of known and novel agents, investments in global microbial surveillance that include wildlife and domestic animals as well as humans, and recognition that viruses may be implicated in chronic as well as acute diseases. Here we review methods for viral surveillance and discovery, strategies and pitfalls in linking discoveries to disease, and identify opportunities for improvements in sequencing instrumentation and analysis, the use of social media and medical informatics that will further advance clinical medicine and public health. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Diagnosis of viral hepatitis.


    Easterbrook, Philippa J; Roberts, Teri; Sands, Anita; Peeling, Rosanna


    Chronic hepatitis B virus (HBV) and hepatitis C virus (HCV) infections and HIV-HBV and HCV coinfection are major causes of chronic liver disease worldwide. Testing and diagnosis is the gateway for access to both treatment and prevention services, but there remains a large burden of undiagnosed infection globally. We review the global epidemiology, key challenges in the current hepatitis testing response, new tools to support the hepatitis global response (2016-2020 Global Hepatitis Health Sector strategy, and 2017 WHO guidelines on hepatitis testing) and future directions and innovations in hepatitis diagnostics. Key challenges in the current hepatitis testing response include lack of quality-assured serological and low-cost virological in-vitro diagnostics, limited facilities for testing, inadequate data to guide country-specific hepatitis testing approaches, stigmatization of those with or at risk of viral hepatitis and lack of guidelines on hepatitis testing for resource-limited settings. The new Global Hepatitis Health Sector strategy sets out goals for elimination of viral hepatitis as a public health threat by 2030 and gives outcome targets for reductions in new infections and mortality, as well as service delivery targets that include testing, diagnosis and treatment. The 2017 WHO hepatitis testing guidelines for adults, adolescents and children in low-income and middle-income countries outline the public health approach to strengthen and expand current testing practices for viral hepatitis and addresses who to test (testing approaches), which serological and virological assays to use (testing strategies) as well as interventions to promote linkage to prevention and care. Future directions and innovations in hepatitis testing include strategies to improve access such as through use of existing facility and community-based testing opportunities for hepatitis testing, near-patient or point-of-care assays for virological markers (nucleic acid testing and HCV

  12. Understanding Image Virality

    DTIC Science & Technology


    of images that is most similar to ours is the concurrently introduced viral meme generator of Wang et al., that combines NLP and Computer Vision (low...from what we might expect at a first glance. An analogous scenario researched in NLP is understanding the semantics of “That’s what she said!” jokes...and will require NLP and Computer Vision for understanding. 4.1. Intrinsic context We first examine whether humans and machines can pre- dict just by

  13. Diagnosis of viral hepatitis

    PubMed Central

    Easterbrook, Philippa J.; Roberts, Teri; Sands, Anita; Peeling, Rosanna


    Purpose of review Chronic hepatitis B virus (HBV) and hepatitis C virus (HCV) infections and HIV–HBV and HCV coinfection are major causes of chronic liver disease worldwide. Testing and diagnosis is the gateway for access to both treatment and prevention services, but there remains a large burden of undiagnosed infection globally. We review the global epidemiology, key challenges in the current hepatitis testing response, new tools to support the hepatitis global response (2016–2020 Global Hepatitis Health Sector strategy, and 2017 WHO guidelines on hepatitis testing) and future directions and innovations in hepatitis diagnostics. Recent findings Key challenges in the current hepatitis testing response include lack of quality-assured serological and low-cost virological in-vitro diagnostics, limited facilities for testing, inadequate data to guide country-specific hepatitis testing approaches, stigmatization of those with or at risk of viral hepatitis and lack of guidelines on hepatitis testing for resource-limited settings. The new Global Hepatitis Health Sector strategy sets out goals for elimination of viral hepatitis as a public health threat by 2030 and gives outcome targets for reductions in new infections and mortality, as well as service delivery targets that include testing, diagnosis and treatment. The 2017 WHO hepatitis testing guidelines for adults, adolescents and children in low-income and middle-income countries outline the public health approach to strengthen and expand current testing practices for viral hepatitis and addresses who to test (testing approaches), which serological and virological assays to use (testing strategies) as well as interventions to promote linkage to prevention and care. Summary Future directions and innovations in hepatitis testing include strategies to improve access such as through use of existing facility and community-based testing opportunities for hepatitis testing, near-patient or point-of-care assays for

  14. Human viral gastroenteritis.

    PubMed Central

    Christensen, M L


    During the last 15 years, several different groups of fastidious viruses that are responsible for a large proportion of acute viral gastroenteritis cases have been discovered by the electron microscopic examination of stool specimens. This disease is one of the most prevalent and serious clinical syndromes seen around the world, especially in children. Rotaviruses, in the family Reoviridae, and fastidious fecal adenoviruses account for much of the viral gastroenteritis in infants and young children, whereas the small caliciviruses and unclassified astroviruses, and possibly enteric coronaviruses, are responsible for significantly fewer cases overall. In addition to electron microscopy, enzyme immunoassays and other rapid antigen detection systems have been developed to detect rotaviruses and fastidious fecal adenoviruses in the stool specimens of both nonhospitalized patients and those hospitalized for dehydration and electrolyte imbalance. Experimental rotavirus vaccines have also been developed, due to the prevalence and seriousness of rotavirus infection. The small, unclassified Norwalk virus and morphologically similar viruses are responsible for large and small outbreaks of acute gastroenteritis in older children, adolescents, and adults. Hospitalization of older patients infected with these viruses is usually not required, and their laboratory diagnoses have been limited primarily to research laboratories. Images PMID:2644024

  15. Viral membrane fusion.


    Harrison, Stephen C


    Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a "fusion loop" or "fusion peptide") engages the target-cell membrane and collapse of the bridging intermediate thus formed draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  16. Viral infections of rabbits.


    Kerr, Peter J; Donnelly, Thomas M


    Viral diseases of rabbits have been used historically to study oncogenesis (e.g. rabbit fibroma virus, cottontail rabbit papillomavirus) and biologically to control feral rabbit populations (e.g. myxoma virus). However, clinicians seeing pet rabbits in North America infrequently encounter viral diseases although myxomatosis may be seen occasionally. The situation is different in Europe and Australia, where myxomatosis and rabbit hemorrhagic disease are endemic. Advances in epidemiology and virology have led to detection of other lapine viruses that are now recognized as agents of emerging infectious diseases. Rabbit caliciviruses, related to rabbit hemorrhagic disease, are generally avirulent, but lethal variants are being identified in Europe and North America. Enteric viruses including lapine rotavirus, rabbit enteric coronavirus and rabbit astrovirus are being acknowledged as contributors to the multifactorial enteritis complex of juvenile rabbits. Three avirulent leporid herpesviruses are found in domestic rabbits. A fourth highly pathogenic virus designated leporid herpesvirus 4 has been described in Canada and Alaska. This review considers viruses affecting rabbits by their clinical significance. Viruses of major and minor clinical significance are described, and viruses of laboratory significance are mentioned. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. [Viral safety of biologicals].


    Barin, F


    The viral safety of biologicals, either human blood derivatives or animal products or recombinant proteins issued from biotechnology, relies on the quality of the starting material, the manufacturing process and, if necessary, the control of the final product. The quality of the starting material is highly guaranteed for blood derivatives due to the individual screening for specific markers (antigens, genome, antibodies) for major blood borne viruses such as hepatitis B and C viruses (HBV, HCV) and human immunodeficiency virus (HIV). It can be reinforced by the detection through amplification procedures (polymerase chain reaction) in the plasma pool of genomes from viruses that have been implicated in contaminations of blood derivatives in the past (parvovirus B19, hepatitis A virus). The association in the manufacturing process of different steps dedicated to purification of plasma proteins (partitioning), virus inactivation (solvent/detergent treatment, heat inactivation) or specific procedures allowing virus removal (nanofiltration) allows to reduce the viral risk very efficiently. The validation studies using scaled down systems and model viruses allow to evaluate the virus safety of any product quantitatively. The aim of these procedures is to guarantee the lack of infectivity due to any virus, either known or unknown.

  18. Saliva and viral infections.


    Corstjens, Paul L A M; Abrams, William R; Malamud, Daniel


    Over the last 10 years there have been only a handful of publications dealing with the oral virome, which is in contrast to the oral microbiome, an area that has seen considerable interest. Here, we survey viral infections in general and then focus on those viruses that are found in and/or are transmitted via the oral cavity; norovirus, rabies, human papillomavirus, Epstein-Barr virus, herpes simplex viruses, hepatitis C virus, and HIV. Increasingly, viral infections have been diagnosed using an oral sample (e.g. saliva mucosal transudate or an oral swab) instead of blood or urine. The results of two studies using a rapid and semi-quantitative lateral flow assay format demonstrating the correlation of HIV anti-IgG/sIgA detection with saliva and serum samples are presented. When immediate detection of infection is important, point-of-care devices that obtain a non-invasive sample from the oral cavity can be used to provide a first line diagnosis to assist in determining appropriate counselling and therapeutic path for an increasing number of diseases.

  19. [Prevention of viral hepatitis].


    Bruguera, Miguel


    Prevention of viral hepatitis infection involves health measures designed to avert transmission of viral agents and promote the use of gammaglobulin and vaccines. The availability of safe drinking water and improvements in quality of life result in better individual hygiene; these factors have had the greatest impact on hepatitis A prevention. Serum gammaglobulin administration has been replaced by vaccinations for pre-exposure, and to a great extent for post-exposure prophylaxis because of the progressively lower anti-HAV content of gammaglobulin and the short duration of the protective effect. Universal vaccination in childhood is the recommended measure for controlling hepatitis A. Adults belonging to high-risk groups should also undergo vaccination. The incidence of hepatitis B has decreased worldwide because of universal vaccination programs, initiated in preadolescence and childhood. Prevention of hepatitis C requires control of situations in which there is a likelihood of parenteral infection with the virus. Post-transfusion hepatitis has been virtually eradicated, but considerable effort is still needed to prevent nosocomial hepatitis.

  20. Viral noncoding RNAs: more surprises

    PubMed Central

    Tycowski, Kazimierz T.; Guo, Yang Eric; Lee, Nara; Moss, Walter N.; Vallery, Tenaya K.; Xie, Mingyi


    Eukaryotic cells produce several classes of long and small noncoding RNA (ncRNA). Many DNA and RNA viruses synthesize their own ncRNAs. Like their host counterparts, viral ncRNAs associate with proteins that are essential for their stability, function, or both. Diverse biological roles—including the regulation of viral replication, viral persistence, host immune evasion, and cellular transformation—have been ascribed to viral ncRNAs. In this review, we focus on the multitude of functions played by ncRNAs produced by animal viruses. We also discuss their biogenesis and mechanisms of action. PMID:25792595

  1. VPDB: Viral Protein Structural Database

    PubMed Central

    Sharma, Om Prakash; Jadhav, Ankush; Hussain, Afzal; Kumar, Muthuvel Suresh


    Viral Protein Database is an interactive database for three dimensional viral proteins. Our aim is to provide a comprehensive resource to the community of structural virology, with an emphasis on the description of derived data from structural biology. Currently, VPDB includes ˜1,670 viral protein structures from >277 viruses with more than 465 virus strains. The whole database can be easily accessed through the user convenience text search. Interactivity has been enhanced by using Jmol, WebMol and Strap to visualize the viral protein molecular structure. Availability The database is available for free at PMID:21769196

  2. Kaposi Sarcoma Herpesvirus (KSHV) Latency-Associated Nuclear Antigen (LANA) recruits components of the MRN (Mre11-Rad50-NBS1) repair complex to modulate an innate immune signaling pathway and viral latency.


    Mariggiò, Giuseppe; Koch, Sandra; Zhang, Guigen; Weidner-Glunde, Magdalena; Rückert, Jessica; Kati, Semra; Santag, Susann; Schulz, Thomas F


    Kaposi Sarcoma Herpesvirus (KSHV), a γ2-herpesvirus and class 1 carcinogen, is responsible for at least three human malignancies: Kaposi Sarcoma (KS), Primary Effusion Lymphoma (PEL) and Multicentric Castleman's Disease (MCD). Its major nuclear latency protein, LANA, is indispensable for the maintenance and replication of latent viral DNA in infected cells. Although LANA is mainly a nuclear protein, cytoplasmic isoforms of LANA exist and can act as antagonists of the cytoplasmic DNA sensor, cGAS. Here, we show that cytosolic LANA also recruits members of the MRN (Mre11-Rad50-NBS1) repair complex in the cytosol and thereby inhibits their recently reported role in the sensing of cytoplasmic DNA and activation of the NF-κB pathway. Inhibition of NF-κB activation by cytoplasmic LANA is accompanied by increased lytic replication in KSHV-infected cells, suggesting that MRN-dependent NF-κB activation contributes to KSHV latency. Cytoplasmic LANA may therefore support the activation of KSHV lytic replication in part by counteracting the activation of NF-κB in response to cytoplasmic DNA. This would complement the recently described role of cytoplasmic LANA in blocking an interferon response triggered by cGAS and thereby promoting lytic reactivation. Our findings highlight a second point at which cytoplasmic LANA interferes with the innate immune response, as well as the importance of the recently discovered role of cytoplasmic MRN complex members as innate sensors of cytoplasmic DNA for the control of KSHV replication.

  3. The Role of Immunophilins in Viral Infection

    PubMed Central

    Hopkins, Sam; Gallay, Philippe A.


    Background Tremendous progress has been made in the past 20 years in understanding the roles played by immunophilins, and in particular the cyclophilins, in supporting the replication cycles of human viruses. A growing body of genetic and biochemical evidence and data from clinical trials confirms that cyclophilins are essential cofactors that contribute to establishing a permissive environment within the host cell that supports the replication of HIV-1 and HCV. Cyclophilin A regulates HIV-1 replication kinetics and infectivity, modulates sensitivity to host restriction factors, and cooperates in the transit of the pre-integration complex into the nucleus of infected cells. Cyclophilin A is an essential cofactor whose expression supports HCV-specific RNA replication in human hepatocytes. General Significance Peptidyl-prolyl isomerase inhibitors have been used in clinical trials to validate cyclophilins as antiviral targets for the treatment of HIV-1 and Chronic Hepatitis C virus infection and as molecular probes to identify the roles played by immunophilins in supporting the replication cycles of human viruses. Scope of Review This review summarizes emerging research that defines the functions of immunophilins in supporting the replication cycles of HIV-1, HCV, HBV, coronaviruses, and other viral pathogens and describes new information that suggests a role for immunophilins in regulating innate immune responses against chronic viral infection. Major Conclusions The dependence on cyclophilins by evolutionarily distinct viruses for accomplishing various steps in replication such as viral entry, initiation of genomic nucleic acid replication, viral genome uncoating, nuclear import and nuclear entry, emphasizes the potential of cyclophilin inhibitors as therapeutic agents. PMID:25445708

  4. Viral quasispecies evolution.


    Domingo, Esteban; Sheldon, Julie; Perales, Celia


    Evolution of RNA viruses occurs through disequilibria of collections of closely related mutant spectra or mutant clouds termed viral quasispecies. Here we review the origin of the quasispecies concept and some biological implications of quasispecies dynamics. Two main aspects are addressed: (i) mutant clouds as reservoirs of phenotypic variants for virus adaptability and (ii) the internal interactions that are established within mutant spectra that render a virus ensemble the unit of selection. The understanding of viruses as quasispecies has led to new antiviral designs, such as lethal mutagenesis, whose aim is to drive viruses toward low fitness values with limited chances of fitness recovery. The impact of quasispecies for three salient human pathogens, human immunodeficiency virus and the hepatitis B and C viruses, is reviewed, with emphasis on antiviral treatment strategies. Finally, extensions of quasispecies to nonviral systems are briefly mentioned to emphasize the broad applicability of quasispecies theory.

  5. Viral Quasispecies Evolution

    PubMed Central

    Sheldon, Julie; Perales, Celia


    Summary: Evolution of RNA viruses occurs through disequilibria of collections of closely related mutant spectra or mutant clouds termed viral quasispecies. Here we review the origin of the quasispecies concept and some biological implications of quasispecies dynamics. Two main aspects are addressed: (i) mutant clouds as reservoirs of phenotypic variants for virus adaptability and (ii) the internal interactions that are established within mutant spectra that render a virus ensemble the unit of selection. The understanding of viruses as quasispecies has led to new antiviral designs, such as lethal mutagenesis, whose aim is to drive viruses toward low fitness values with limited chances of fitness recovery. The impact of quasispecies for three salient human pathogens, human immunodeficiency virus and the hepatitis B and C viruses, is reviewed, with emphasis on antiviral treatment strategies. Finally, extensions of quasispecies to nonviral systems are briefly mentioned to emphasize the broad applicability of quasispecies theory. PMID:22688811

  6. Dengue viral infections

    PubMed Central

    Malavige, G; Fernando, S; Fernando, D; Seneviratne, S


    Dengue viral infections are one of the most important mosquito borne diseases in the world. They may be asymptomatic or may give rise to undifferentiated fever, dengue fever, dengue haemorrhagic fever (DHF), or dengue shock syndrome. Annually, 100 million cases of dengue fever and half a million cases of DHF occur worldwide. Ninety percent of DHF subjects are children less than 15 years of age. At present, dengue is endemic in 112 countries in the world. No vaccine is available for preventing this disease. Early recognition and prompt initiation of appropriate treatment are vital if disease related morbidity and mortality are to be limited. This review outlines aspects of the epidemiology of dengue infections, the dengue virus and its mosquito vector, clinical features and pathogenesis of dengue infections, and the management and control of these infections. PMID:15466994

  7. [Viral hemorrhagic fever].


    Kager, P A


    Viral haemorrhagic fevers, such as Lassa fever and yellow fever, cause tens of thousands of deaths annually outside the Netherlands. The viruses are mostly transmitted by mosquitoes, ticks or via excreta of rodents. Important to travellers are yellow fever, dengue and Lassa and Ebola fever. For yellow fever there is an efficacious vaccine. Dengue is frequently observed in travellers; prevention consists in avoiding mosquito bites, the treatment is symptomatic. Lassa and Ebola fever are extremely rare among travellers; a management protocol can be obtained from the Netherlands Ministry of Health, Welfare and Sports. Diagnostics of a patient from the tropics with fever and haemorrhagic diathesis should be aimed at treatable disorders such as malaria, typhoid fever, rickettsiosis or bacterial sepsis, because the probability of such a disease is much higher than that of Lassa or Ebola fever.

  8. Viral Hemorrhagic Fever Diagnostics

    PubMed Central

    Racsa, Lori D.; Kraft, Colleen S.; Olinger, Gene G.; Hensley, Lisa E.


    There are 4 families of viruses that cause viral hemorrhagic fever (VHF), including Filoviridae. Ebola virus is one virus within the family Filoviridae and the cause of the current outbreak of VHF in West Africa. VHF-endemic areas are found throughout the world, yet traditional diagnosis of VHF has been performed in large reference laboratories centered in Europe and the United States. The large amount of capital needed, as well as highly trained and skilled personnel, has limited the availability of diagnostics in endemic areas except in conjunction with governmental and nongovernmental entities. However, rapid diagnosis of VHF is essential to efforts that will limit outbreaks. In addition, increased global travel suggests VHF diagnoses may be made outside of the endemic areas. Thus, understanding how to diagnose VHF is imperative for laboratories worldwide. This article reviews traditional and current diagnostic modalities for VHF. PMID:26354968

  9. Viral causes of diarrhea.


    Goodgame, R W


    Viruses are important causes of diarrhea. In healthy adults, the main clinical manifestation is acute, self-limited gastroenteritis. Advances in molecular diagnostics have shown that epidemics of acute gastroenteritis most frequently are due to caliciviruses spread through contaminated food or through person-to-person contact. Application of similar technology is needed to make a definitive statement about the role of such candidate viruses as rotavirus, astrovirus, and adenovirus as the cause of nonepidemic acute gastroenteritis in adults. Rarely a previously healthy adult gets acute CMV colitis. CMV and EBV mainly cause diarrhea in immunocompromised patients, however. Advances in prophylaxis and treatment have reduced the frequency and severity of these diseases. Acute infantile gastroenteritis is caused by rotavirus, calcivirus, astrovirus, and adenovirus. These viral diseases of the gut are seen by the physician as routine and rare clinical problems.

  10. Impact of tumor microenvironment on oncolytic viral therapy

    PubMed Central

    Wojton, Jeffrey; Kaur, Balveen


    Interactions between tumor cells and their microenvironment have been shown to play a very significant role in the initiation, progression, and invasiveness of cancer. These tumor-stromal interactions are capable of altering the delivery and effectiveness of therapeutics into the tumor and are also known to influence future resistance and re-growth after treatment. Here we review recent advances in the understanding of the tumor microenvironment and its response to oncolytic viral therapy. The multifaceted environmental response to viral therapy can influence viral infection, replication, and propagation within the tumor. Recent studies have unveiled the complicated temporal changes in the tumor vasculature post OV treatment, and their impact on tumor biology. Similarly, the secreted extracellular matrix in solid tumors can affect both infection and spread of the therapeutic virus. Together, these complex changes in the tumor microenvironment also modulate the activation of the innate antiviral host immune response, leading to quick and efficient viral clearance. In order to combat these detrimental responses, viruses have been combined with pharmacological adjuvants and “armed” with therapeutic genes in order to suppress the pernicious environmental conditions following therapy. In this review we will discuss the impact of the tumor environment on viral therapy and examine some of the recent literature investigating methods of modulating this environment to enhance oncolysis. PMID:20399700

  11. The repressing and enhancing functions of the herpes simplex virus regulatory protein ICP27 map to C-terminal regions and are required to modulate viral gene expression very early in infection.

    PubMed Central

    McMahan, L; Schaffer, P A


    The phenotypic properties of ICP27 temperature-sensitive and deletion mutants and the results of transient expression assays have demonstrated that ICP27 has a modulatory effect on viral gene expression induced by ICPs 0 and 4. In order to identify the regions of the ICP27 molecule that are responsible for its enhancing and repressing activities, 10 nonsense and 3 in-frame deletion mutations were introduced into the coding sequence of the cloned ICP27 gene. These mutant genes were tested in transient expression assays for their ability to complement an ICP27 null mutant and to enhance and repress expression from a spectrum of herpes simplex virus type 1 promoters in reporter CAT genes when expression was induced by ICP0 or ICP4. The results of assays with cloned mutant genes demonstrate that the ICP27 polypeptide contains two regions, located between amino acid residues 327 and 407 and residues 465 and 511, that contribute to its repressing activity. The amino acid region located between the two repressing regions (residues 407 to 465) is able to interfere with ICP27 repressing activity. None of the mutant genes exhibited efficient enhancing activity for any of the herpes simplex type 1 promoters tested, demonstrating that amino acids comprising the carboxy-terminal half of the ICP27 molecule, including the terminal phenylalanine residue, are required for wild-type enhancement as well as for efficient complementation of an ICP27 null mutant. Phenotypic characterization of an in-frame deletion mutant, vd3, and a previously isolated null mutant, 5dl 1.2 (A. M. McCarthy, L. and P. A. Schaffer, J. Virol. 63:18-27, 1989), demonstrated that ICP27 is required to induce the expression of all classes of viral genes very early in infection and confirmed the requirement for ICP27 later in infection (i) to repress early gene expression, (ii) to induce wild-type levels of delayed-early or gamma 1 gene expression, and (iii) to induce true late or gamma 2 gene expression. The vd3

  12. Mechanical Properties of Viral Capsids

    NASA Astrophysics Data System (ADS)

    Zandi, Roya; Reguera, David


    Viral genomes, whether they involve RNA or DNA molecules, are invariably protected by a rigid, single-protein-thick, shell referred to as ``capsid.'' Viral capsids are known to tolerate wide ranges of pH and salt conditions and to withstand internal pressures as high as 100 atms. We study the mechanical properties of viral capsids, calling explicit attention to the inhomogeneity of the shells that is inherent in their being discrete/polyhedral rather than continuous/spherical. We analyze the distribution of stress in these capsids due to isotropic internal pressure (arising, for instance, from genome confinement and/or osmotic activity), and compare the results with appropriate generalizations of classical elasticity theory. We also examine the competing mechanisms for viral shell failure, e.g., in-plane crack formation vs radial bursting. The biological consequences of the special stabilities and stress distributions of viral capsids are also discussed.

  13. Confined aquifers as viral reservoirs.


    Smith, Renee J; Jeffries, Thomas C; Roudnew, Ben; Seymour, Justin R; Fitch, Alison J; Simons, Keryn L; Speck, Peter G; Newton, Kelly; Brown, Melissa H; Mitchell, James G


    Knowledge about viral diversity and abundance in deep groundwater reserves is limited. We found that the viral community inhabiting a deep confined aquifer in South Australia was more similar to reclaimed water communities than to the viral communities in the overlying unconfined aquifer community. This similarity was driven by high relative occurrence of the single-stranded DNA viral groups Circoviridae, Geminiviridae and Microviridae, which include many known plant and animal pathogens. These groups were present in a 1500-year-old water situated 80 m below the surface, which suggests the potential for long-term survival and spread of potentially pathogenic viruses in deep, confined groundwater. Obtaining a broader understanding of potentially pathogenic viral communities within aquifers is particularly important given the ability of viruses to spread within groundwater ecosystems.

  14. [Epidemiology of viral hepatitis].


    Kaić, Bernard; Vilibić-Cavlek, Tatjana; Filipović, Sanja Kurecić; Nemeth-Blazić, Tatjana; Pem-Novosel, Iva; Vucina, Vesna Visekruna; Simunović, Aleksandar; Zajec, Martina; Radić, Ivan; Pavlić, Jasmina; Glamocanin, Marica; Gjenero-Margan, Ira


    Understanding the country-specific epidemiology of disease, which may vary greatly among countries, is crucial for identifying the most appropriate preventive and control measures. An overview of the local epidemiology of viral hepatitis in Croatia is given in this paper. The overall prevalence of hepatitis B in Croatia is low (less than 2% HBsAg carriers in the general population). Hepatitis B incidence and prevalence began to decline significantly following the introduction of universal hepatitis B vaccination in 1999. Information on HBsAg seroprevalence is derived from routine testing of certain subpopulations (pregnant women, blood donors) and seroprevalence studies mostly targeted at high-risk populations. Universal childhood vaccination against hepatitis B remains the main preventive measure. We recommend testing for immunity one to two months after the third dose of hepatitis B vaccine for health-care workers. The incidence and prevalence of hepatitis C have also been declining in the general population. The main preventive measures are ensuring safety of blood products, prevention of drug abuse, and harm reduction programs for intravenous drug users. Hepatitis A incidence has declined dramatically since fifty years ago, when thousands of cases were reported annually. In the last five years, an average of twenty cases have been reported per year. The reduction of hepatitis A is a consequence of improved personal and community hygiene and sanitation. Hepatitis D has not been reported in Croatia. The risk of hepatitis D will get to be even smaller as the proportion of population vaccinated against hepatitis B builds up. Hepatitis E is reported only sporadically in Croatia, mostly in persons occupationally in contact with pigs and in travelers to endemic countries. In conclusion, Croatia is a low prevalence country for hepatitides A, B and C. Hepatitis D has not been reported to occur in Croatia and there are only sporadic cases of hepatitis E. Since hepatitis

  15. Influenza virus RNA polymerase: insights into the mechanisms of viral RNA synthesis

    PubMed Central

    te Velthuis, Aartjan J.W.; Fodor, Ervin


    The genome of influenza viruses consists of multiple segments of single stranded negative-sense RNA. Each of these segments is bound by the heterotrimeric viral RNA-dependent RNA polymerase and multiple copies of nucleoprotein, forming viral ribonucleoprotein (vRNP) complexes. It is in the context of these vRNPs that the viral RNA polymerase carries out transcription of viral genes and replication of the viral RNA genome. In this Review, we discuss our current knowledge of the structure of the influenza virus RNA polymerase, how it carries out transcription and replication, and how its activities are modulated by viral and host factors. Furthermore, we discuss how advances in our understanding of polymerase function could help identifying new antiviral targets. PMID:27396566

  16. Viral Hepatitis: A through E and Beyond


    Viral Hepatitis: A through E and Beyond NATIONAL INSTITUTES OF HEALTH U.S. Department of Health and Human Services National Digestive Diseases Information Clearinghouse What is viral hepatitis? Viral hepatitis is inflammation of the liver caused ...

  17. Insulated Foamy Viral Vectors

    PubMed Central

    Browning, Diana L.; Collins, Casey P.; Hocum, Jonah D.; Leap, David J.; Rae, Dustin T.; Trobridge, Grant D.


    Retroviral vector-mediated gene therapy is promising, but genotoxicity has limited its use in the clinic. Genotoxicity is highly dependent on the retroviral vector used, and foamy viral (FV) vectors appear relatively safe. However, internal promoters may still potentially activate nearby genes. We developed insulated FV vectors, using four previously described insulators: a version of the well-studied chicken hypersensitivity site 4 insulator (650cHS4), two synthetic CCCTC-binding factor (CTCF)-based insulators, and an insulator based on the CCAAT box-binding transcription factor/nuclear factor I (7xCTF/NF1). We directly compared these insulators for enhancer-blocking activity, effect on FV vector titer, and fidelity of transfer to both proviral long terminal repeats. The synthetic CTCF-based insulators had the strongest insulating activity, but reduced titers significantly. The 7xCTF/NF1 insulator did not reduce titers but had weak insulating activity. The 650cHS4-insulated FV vector was identified as the overall most promising vector. Uninsulated and 650cHS4-insulated FV vectors were both significantly less genotoxic than gammaretroviral vectors. Integration sites were evaluated in cord blood CD34+ cells and the 650cHS4-insulated FV vector had fewer hotspots compared with an uninsulated FV vector. These data suggest that insulated FV vectors are promising for hematopoietic stem cell gene therapy. PMID:26715244

  18. Tight Junctions Go Viral!


    Torres-Flores, Jesús M; Arias, Carlos F


    Tight junctions (TJs) are highly specialized membrane domains involved in many important cellular processes such as the regulation of the passage of ions and macromolecules across the paracellular space and the establishment of cell polarity in epithelial cells. Over the past few years there has been increasing evidence that different components of the TJs can be hijacked by viruses in order to complete their infectious cycle. Viruses from at least nine different families of DNA and RNA viruses have been reported to use TJ proteins in their benefit. For example, TJ proteins such as JAM-A or some members of the claudin family of proteins are used by members of the Reoviridae family and hepatitis C virus as receptors or co-receptors during their entry into their host cells. Reovirus, in addition, takes advantage of the TJ protein Junction Adhesion Molecule-A (JAM-A) to achieve its hematogenous dissemination. Some other viruses are capable of regulating the expression or the localization of TJ proteins to induce cell transformation or to improve the efficiency of their exit process. This review encompasses the importance of TJs for viral entry, replication, dissemination, and egress, and makes a clear statement of the importance of studying these proteins to gain a better understanding of the replication strategies used by viruses that infect epithelial and/or endothelial cells.

  19. Insulated Foamy Viral Vectors.


    Browning, Diana L; Collins, Casey P; Hocum, Jonah D; Leap, David J; Rae, Dustin T; Trobridge, Grant D


    Retroviral vector-mediated gene therapy is promising, but genotoxicity has limited its use in the clinic. Genotoxicity is highly dependent on the retroviral vector used, and foamy viral (FV) vectors appear relatively safe. However, internal promoters may still potentially activate nearby genes. We developed insulated FV vectors, using four previously described insulators: a version of the well-studied chicken hypersensitivity site 4 insulator (650cHS4), two synthetic CCCTC-binding factor (CTCF)-based insulators, and an insulator based on the CCAAT box-binding transcription factor/nuclear factor I (7xCTF/NF1). We directly compared these insulators for enhancer-blocking activity, effect on FV vector titer, and fidelity of transfer to both proviral long terminal repeats. The synthetic CTCF-based insulators had the strongest insulating activity, but reduced titers significantly. The 7xCTF/NF1 insulator did not reduce titers but had weak insulating activity. The 650cHS4-insulated FV vector was identified as the overall most promising vector. Uninsulated and 650cHS4-insulated FV vectors were both significantly less genotoxic than gammaretroviral vectors. Integration sites were evaluated in cord blood CD34(+) cells and the 650cHS4-insulated FV vector had fewer hotspots compared with an uninsulated FV vector. These data suggest that insulated FV vectors are promising for hematopoietic stem cell gene therapy.

  20. Viral infection, inflammation and schizophrenia

    PubMed Central

    Kneeland, Rachel E.; Fatemi, S. Hossein


    Schizophrenia is a severe neurodevelopmental disorder with genetic and environmental etiologies. Prenatal viral/bacterial infections and inflammation play major roles in the genesis of schizophrenia. In this review, we describe a viral model of schizophrenia tested in mice whereby the offspring of mice prenatally infected with influenza at E7, E9, E16, and E18 show significant gene, protein, and brain structural abnormalities postnatally. Similarly, we describe data on rodents exposed to bacterial infection or injected with a synthetic viral mimic (PolyI:C) also demonstrating brain structural and behavioral abnormalities. Moreover, human serologic data has been indispensible in supporting the viral theory of schizophrenia. Individuals born seropositive for bacterial and viral agents are at a significantly elevated risk of developing schizophrenia. While the specific mechanisms of prenatal viral/bacterial infections and brain disorder are unclear, recent findings suggest that the maternal inflammatory response may be associated with fetal brain injury. Preventive and therapeutic treatment options are also proposed. This review presents data related to epidemiology, human serology, and experimental animal models which support the viral model of schizophrenia. PMID:22349576

  1. Viral infection, inflammation and schizophrenia.


    Kneeland, Rachel E; Fatemi, S Hossein


    Schizophrenia is a severe neurodevelopmental disorder with genetic and environmental etiologies. Prenatal viral/bacterial infections and inflammation play major roles in the genesis of schizophrenia. In this review, we describe a viral model of schizophrenia tested in mice whereby the offspring of mice prenatally infected with influenza at E7, E9, E16, and E18 show significant gene, protein, and brain structural abnormalities postnatally. Similarly, we describe data on rodents exposed to bacterial infection or injected with a synthetic viral mimic (PolyI:C) also demonstrating brain structural and behavioral abnormalities. Moreover, human serologic data has been indispensible in supporting the viral theory of schizophrenia. Individuals born seropositive for bacterial and viral agents are at a significantly elevated risk of developing schizophrenia. While the specific mechanisms of prenatal viral/bacterial infections and brain disorder are unclear, recent findings suggest that the maternal inflammatory response may be associated with fetal brain injury. Preventive and therapeutic treatment options are also proposed. This review presents data related to epidemiology, human serology, and experimental animal models which support the viral model of schizophrenia. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Hepatitis C viral life cycle.


    Suzuki, Tetsuro; Ishii, Koji; Aizaki, Hideki; Wakita, Takaji


    Hepatitis C virus (HCV) has been recognized as a major cause of chronic liver diseases worldwide. Molecular studies of the virus became possible with the successful cloning of its genome in 1989. Although much work remains to be done regarding early and late stages of the HCV life cycle, significant progress has been made with respect to the molecular biology of HCV, especially the viral protein processing and the genome replication. This review summarizes our current understanding of genomic organization of HCV, features of the viral protein characteristics, and the viral life cycle.

  3. Viral BLIP dynamics during HAART.

    SciTech Connect

    Markowitz, M.; Louie, M.; Hurley, A.; Ho, David D.; Perelson, Alan S.,; Di Mascio, M.


    Intermittent episodes of low-level viremia (blips) are often observed in well-suppressed, HAART-treated patients. It has been reported that viral blips do not correlate with the emergence of new HAART-related mutations; however, increased frequency of blips correlates with slower decay of latently infected cells. Since blips are transient and unpredictable, detailed knowledge about them is difficult to obtain. We present an analysis of the dynamics of viral blips from viral load (VL) measurements on 123 patients for a period of 809k480d (21-1817d) and sampled every 31{+-}12d for a total of 26{+-}15 samples per patient.

  4. VZV ORF47 serine protein kinase and its viral substrates.


    Kenyon, Teri K; Grose, Charles


    ORF47, a serine protein kinase of varicella-zoster virus (VZV) and homolog of herpes simplex virus UL13, is an interesting modulator of VZV pathogenesis. This chapter summarizes research showing that ORF47 protein kinase activity, by virtue of phosphorylation of or binding to various viral substrates, regulates VZV proteins during all phases of viral infection and has a pronounced effect on the trafficking of gE, the predominant VZV glycoprotein, which in turn is critical for cell-to-cell spread of the virus. Casein kinase II, an ubiquitous cellular protein kinase, recognizes a similar but less stringent phosphorylation consensus sequence and can partially compensate for lack of ORF47 activity in VZV-infected cells. Differences between the phosphorylation consensus sites of the viral and cellular kinases are outlined in detail.

  5. Neuroanatomy goes viral!


    Nassi, Jonathan J; Cepko, Constance L; Born, Richard T; Beier, Kevin T


    The nervous system is complex not simply because of the enormous number of neurons it contains but by virtue of the specificity with which they are connected. Unraveling this specificity is the task of neuroanatomy. In this endeavor, neuroanatomists have traditionally exploited an impressive array of tools ranging from the Golgi method to electron microscopy. An ideal method for studying anatomy would label neurons that are interconnected, and, in addition, allow expression of foreign genes in these neurons. Fortuitously, nature has already partially developed such a method in the form of neurotropic viruses, which have evolved to deliver their genetic material between synaptically connected neurons while largely eluding glia and the immune system. While these characteristics make some of these viruses a threat to human health, simple modifications allow them to be used in controlled experimental settings, thus enabling neuroanatomists to trace multi-synaptic connections within and across brain regions. Wild-type neurotropic viruses, such as rabies and alpha-herpes virus, have already contributed greatly to our understanding of brain connectivity, and modern molecular techniques have enabled the construction of recombinant forms of these and other viruses. These newly engineered reagents are particularly useful, as they can target genetically defined populations of neurons, spread only one synapse to either inputs or outputs, and carry instructions by which the targeted neurons can be made to express exogenous proteins, such as calcium sensors or light-sensitive ion channels, that can be used to study neuronal function. In this review, we address these uniquely powerful features of the viruses already in the neuroanatomist's toolbox, as well as the aspects of their biology that currently limit their utility. Based on the latter, we consider strategies for improving viral tracing methods by reducing toxicity, improving control of transsynaptic spread, and extending

  6. Neuroanatomy goes viral!

    PubMed Central

    Nassi, Jonathan J.; Cepko, Constance L.; Born, Richard T.; Beier, Kevin T.


    The nervous system is complex not simply because of the enormous number of neurons it contains but by virtue of the specificity with which they are connected. Unraveling this specificity is the task of neuroanatomy. In this endeavor, neuroanatomists have traditionally exploited an impressive array of tools ranging from the Golgi method to electron microscopy. An ideal method for studying anatomy would label neurons that are interconnected, and, in addition, allow expression of foreign genes in these neurons. Fortuitously, nature has already partially developed such a method in the form of neurotropic viruses, which have evolved to deliver their genetic material between synaptically connected neurons while largely eluding glia and the immune system. While these characteristics make some of these viruses a threat to human health, simple modifications allow them to be used in controlled experimental settings, thus enabling neuroanatomists to trace multi-synaptic connections within and across brain regions. Wild-type neurotropic viruses, such as rabies and alpha-herpes virus, have already contributed greatly to our understanding of brain connectivity, and modern molecular techniques have enabled the construction of recombinant forms of these and other viruses. These newly engineered reagents are particularly useful, as they can target genetically defined populations of neurons, spread only one synapse to either inputs or outputs, and carry instructions by which the targeted neurons can be made to express exogenous proteins, such as calcium sensors or light-sensitive ion channels, that can be used to study neuronal function. In this review, we address these uniquely powerful features of the viruses already in the neuroanatomist’s toolbox, as well as the aspects of their biology that currently limit their utility. Based on the latter, we consider strategies for improving viral tracing methods by reducing toxicity, improving control of transsynaptic spread, and

  7. Cytokine determinants of viral tropism

    PubMed Central

    McFadden, Grant; Mohamed, Mohamed R.; Rahman, Masmudur M.; Bartee, Eric


    The specificity of a given virus for a ceil type, tissue or species — collectively known as viral tropism — is an important factor in determining the outcome of viral infection in any particular host. Owing to the increased prevalence of zoonotic infections and the threat of emerging and re-emerging pathogens, gaining a better understanding of the factors that determine viral tropism has become particularly important. In this Review, we summarize our current understanding of the central role of antiviral and pro-inflammatory cytokines, particularly the interferons and tumour necrosis factor, in dictating viral tropism and how these cytokine pathways can be exploited therapeutically for cancer treatment and to better counter future threats from emerging zoonotic pathogens. PMID:19696766

  8. Cytokine determinants of viral tropism.


    McFadden, Grant; Mohamed, Mohamed R; Rahman, Masmudur M; Bartee, Eric


    The specificity of a given virus for a cell type, tissue or species - collectively known as viral tropism - is an important factor in determining the outcome of viral infection in any particular host. Owing to the increased prevalence of zoonotic infections and the threat of emerging and re-emerging pathogens, gaining a better understanding of the factors that determine viral tropism has become particularly important. In this Review, we summarize our current understanding of the central role of antiviral and pro-inflammatory cytokines, particularly the interferons and tumour necrosis factor, in dictating viral tropism and how these cytokine pathways can be exploited therapeutically for cancer treatment and to better counter future threats from emerging zoonotic pathogens.

  9. Viral infections of the face.


    Avci, Oktay; Ertam, Ilgen


    Viral infections affecting the face may cause significant morbidity, cosmetic disfigurement, and psychological distress. The success of therapy needs whole and correct evaluation of the clinical signs and symptoms. Some viruses such as Papillomaviridae, Herpesviridae, and Polyomaviridae primarily infect the facial skin, whereas others affect the face infrequently, as in parapox virus infections. Sometimes, involvement of the face can be a part of more generalized eruption and systemic symptoms in viral infections caused by Todaviridae, Flaviviridae, Arenaviridiae, and Flaviviridae. Clinical diagnosis can be challenging in various viral diseases when they occur in nonendemic geographic areas. The objective of this review was to concentrate on epidemiologic and clinical characteristics of the viral illnesses with facial skin involvement.

  10. Statistical Mechanics of Viral Entry

    NASA Astrophysics Data System (ADS)

    Zhang, Yaojun; Dudko, Olga K.


    Viruses that have lipid-membrane envelopes infect cells by fusing with the cell membrane to release viral genes. Membrane fusion is known to be hindered by high kinetic barriers associated with drastic structural rearrangements—yet viral infection, which occurs by fusion, proceeds on remarkably short time scales. Here, we present a quantitative framework that captures the principles behind the invasion strategy shared by all enveloped viruses. The key to this strategy—ligand-triggered conformational changes in the viral proteins that pull the membranes together—is treated as a set of concurrent, bias field-induced activated rate processes. The framework results in analytical solutions for experimentally measurable characteristics of virus-cell fusion and enables us to express the efficiency of the viral strategy in quantitative terms. The predictive value of the theory is validated through simulations and illustrated through recent experimental data on influenza virus infection.

  11. Viral Evolution Core | FNLCR Staging

    Brandon F. Keele, Ph.D. PI/Senior Principal Investigator, Retroviral Evolution Section Head, Viral Evolution Core Leidos Biomedical Research, Inc. Frederick National Laboratory for Cancer Research Frederick, MD 21702-1201 Tel: 301-846-173

  12. Viral hepatitis and the surgeon

    PubMed Central

    Cohen, A. J.; Assy, N.; Moser, M.


    Background. Viral hepatitis is an infection of the liver caused by one or more of six known (HAV-HGV) hepatotropic viruses. It is a common problem among health care workers and their patients. Surgeons are at particular risk of both acquiring and transmitting some of these viruses from and to their patients. Unfortunately, specific immunoprophylaxis for viral hepatitis is presently limited to protecting against the spread of hepatitis A and B viral infections, leaving a high degree of vigilance and careful surgical technique as the only means available to prevent the transmission of other viruses relative to the surgeon. The purpose of this paper is to review the various forms of viral hepatitis including the nature of the virus, serologic testing, clinical features, epidemiology (with specific reference to those issues that arise in surgical practice), treatment and prevention. PMID:18333162

  13. Inferring Host Gene Subnetworks Involved in Viral Replication

    PubMed Central

    Chasman, Deborah; Gancarz, Brandi; Hao, Linhui; Ferris, Michael; Ahlquist, Paul; Craven, Mark


    Systematic, genome-wide loss-of-function experiments can be used to identify host factors that directly or indirectly facilitate or inhibit the replication of a virus in a host cell. We present an approach that combines an integer linear program and a diffusion kernel method to infer the pathways through which those host factors modulate viral replication. The inputs to the method are a set of viral phenotypes observed in single-host-gene mutants and a background network consisting of a variety of host intracellular interactions. The output is an ensemble of subnetworks that provides a consistent explanation for the measured phenotypes, predicts which unassayed host factors modulate the virus, and predicts which host factors are the most direct interfaces with the virus. We infer host-virus interaction subnetworks using data from experiments screening the yeast genome for genes modulating the replication of two RNA viruses. Because a gold-standard network is unavailable, we assess the predicted subnetworks using both computational and qualitative analyses. We conduct a cross-validation experiment in which we predict whether held-aside test genes have an effect on viral replication. Our approach is able to make high-confidence predictions more accurately than several baselines, and about as well as the best baseline, which does not infer mechanistic pathways. We also examine two kinds of predictions made by our method: which host factors are nearest to a direct interaction with a viral component, and which unassayed host genes are likely to be involved in viral replication. Multiple predictions are supported by recent independent experimental data, or are components or functional partners of confirmed relevant complexes or pathways. Integer program code, background network data, and inferred host-virus subnetworks are available at PMID:24874113

  14. Viral RNAs Are Unusually Compact

    PubMed Central

    Gopal, Ajaykumar; Egecioglu, Defne E.; Yoffe, Aron M.; Ben-Shaul, Avinoam; Rao, Ayala L. N.; Knobler, Charles M.; Gelbart, William M.


    A majority of viruses are composed of long single-stranded genomic RNA molecules encapsulated by protein shells with diameters of just a few tens of nanometers. We examine the extent to which these viral RNAs have evolved to be physically compact molecules to facilitate encapsulation. Measurements of equal-length viral, non-viral, coding and non-coding RNAs show viral RNAs to have among the smallest sizes in solution, i.e., the highest gel-electrophoretic mobilities and the smallest hydrodynamic radii. Using graph-theoretical analyses we demonstrate that their sizes correlate with the compactness of branching patterns in predicted secondary structure ensembles. The density of branching is determined by the number and relative positions of 3-helix junctions, and is highly sensitive to the presence of rare higher-order junctions with 4 or more helices. Compact branching arises from a preponderance of base pairing between nucleotides close to each other in the primary sequence. The density of branching represents a degree of freedom optimized by viral RNA genomes in response to the evolutionary pressure to be packaged reliably. Several families of viruses are analyzed to delineate the effects of capsid geometry, size and charge stabilization on the selective pressure for RNA compactness. Compact branching has important implications for RNA folding and viral assembly. PMID:25188030

  15. Viral RNAs are unusually compact.


    Gopal, Ajaykumar; Egecioglu, Defne E; Yoffe, Aron M; Ben-Shaul, Avinoam; Rao, Ayala L N; Knobler, Charles M; Gelbart, William M


    A majority of viruses are composed of long single-stranded genomic RNA molecules encapsulated by protein shells with diameters of just a few tens of nanometers. We examine the extent to which these viral RNAs have evolved to be physically compact molecules to facilitate encapsulation. Measurements of equal-length viral, non-viral, coding and non-coding RNAs show viral RNAs to have among the smallest sizes in solution, i.e., the highest gel-electrophoretic mobilities and the smallest hydrodynamic radii. Using graph-theoretical analyses we demonstrate that their sizes correlate with the compactness of branching patterns in predicted secondary structure ensembles. The density of branching is determined by the number and relative positions of 3-helix junctions, and is highly sensitive to the presence of rare higher-order junctions with 4 or more helices. Compact branching arises from a preponderance of base pairing between nucleotides close to each other in the primary sequence. The density of branching represents a degree of freedom optimized by viral RNA genomes in response to the evolutionary pressure to be packaged reliably. Several families of viruses are analyzed to delineate the effects of capsid geometry, size and charge stabilization on the selective pressure for RNA compactness. Compact branching has important implications for RNA folding and viral assembly.

  16. Virus Variation Resource – improved response to emergent viral outbreaks

    PubMed Central

    Hatcher, Eneida L.; Zhdanov, Sergey A.; Bao, Yiming; Blinkova, Olga; Nawrocki, Eric P.; Ostapchuck, Yuri; Schäffer, Alejandro A.; Brister, J. Rodney


    The Virus Variation Resource is a value-added viral sequence data resource hosted by the National Center for Biotechnology Information. The resource is located at and includes modules for seven viral groups: influenza virus, Dengue virus, West Nile virus, Ebolavirus, MERS coronavirus, Rotavirus A and Zika virus. Each module is supported by pipelines that scan newly released GenBank records, annotate genes and proteins and parse sample descriptors and then map them to controlled vocabulary. These processes in turn support a purpose-built search interface where users can select sequences based on standardized gene, protein and metadata terms. Once sequences are selected, a suite of tools for downloading data, multi-sequence alignment and tree building supports a variety of user directed activities. This manuscript describes a series of features and functionalities recently added to the Virus Variation Resource. PMID:27899678

  17. Non-viral vectors for gene-based therapy.


    Yin, Hao; Kanasty, Rosemary L; Eltoukhy, Ahmed A; Vegas, Arturo J; Dorkin, J Robert; Anderson, Daniel G


    Gene-based therapy is the intentional modulation of gene expression in specific cells to treat pathological conditions. This modulation is accomplished by introducing exogenous nucleic acids such as DNA, mRNA, small interfering RNA (siRNA), microRNA (miRNA) or antisense oligonucleotides. Given the large size and the negative charge of these macromolecules, their delivery is typically mediated by carriers or vectors. In this Review, we introduce the biological barriers to gene delivery in vivo and discuss recent advances in material sciences, nanotechnology and nucleic acid chemistry that have yielded promising non-viral delivery systems, some of which are currently undergoing testing in clinical trials. The diversity of these systems highlights the recent progress of gene-based therapy using non-viral approaches.

  18. Viral Serpin Therapeutics: From Concept to Clinic

    PubMed Central

    Chen, Hao; Zheng, Donghang; Davids, Jennifer; Bartee, Mee Yong; Dai, Erbin; Liu, Liying; Petrov, Lyubomir; Macaulay, Colin; Thoburn, Robert; Sobel, Eric; Moyer, Richard; McFadden, Grant; Lucas, Alexandra


    Over the past 19 years, we have developed a novel myxoma virus-derived anti-inflammatory serine protease inhibitor, termed a serpin, as a new class of immunomodulatory therapeutic. This review will describe the initial identification of viral serpins with anti-inflammatory potential, beginning with preclinical analysis of viral pathogenesis and proceeding to cell and molecular target analyses, and successful clinical trial. The central aim of this review is to describe the development of two serpins, Serp-1 and Serp-2, as a new class of immune modulating drug, from inception to implementation. We begin with an overview of the approaches used for successful mining of the virus for potential serpin immunomodulators in viruses. We then provide a methodological overview of one inflammatory animal model used to test for serpin anti-inflammatory activity followed by methods used to identify cells in the inflammatory response system targeted by these serpins and molecular responses to serpin treatment. Finally, we provide an overview of our findings from a recent, successful clinical trial of the secreted myxomaviral serpin, Serp-1, in patients with unstable inflammatory coronary arterial disease. PMID:21683260

  19. Spontaneous Clearance of Viral Infections by Mesoscopic Fluctuations

    PubMed Central

    Chaudhury, Srabanti; Perelson, Alan S.; Sinitstyn, Nikolai A.


    Spontaneous disease extinction can occur due to a rare stochastic fluctuation. We explore this process, both numerically and theoretically, in two minimal models of stochastic viral infection dynamics. We propose a method that reduces the complexity in models of viral infections so that the remaining dynamics can be studied by previously developed techniques for analyzing epidemiological models. Using this technique, we obtain an expression for the infection clearance time as a function of kinetic parameters. We apply our theoretical results to study stochastic infection clearance for specific stages of HIV and HCV dynamics. Our results show that the typical time for stochastic clearance of a viral infection increases exponentially with the size of the population, but infection still can be cleared spontaneously within a reasonable time interval in a certain population of cells. We also show that the clearance time is exponentially sensitive to the viral decay rate and viral infectivity but only linearly dependent on the lifetime of an infected cell. This suggests that if standard drug therapy fails to clear an infection then intensifying therapy by adding a drug that reduces the rate of cell infection rather than immune modulators that hasten infected cell death may be more useful in ultimately clearing remaining pockets of infection. PMID:22693646

  20. The ABCs of viral hepatitis that define biomarker signatures of acute viral hepatitis.


    Duffy, Darragh; Mamdouh, Rasha; Laird, Melissa; Soneson, Charlotte; Le Fouler, Lenaig; El-Daly, Maï; Casrouge, Armanda; Decalf, Jérémie; Abbas, Amal; Eldin, Noha Sharaf; Fontes, Magnus; Abdel-Hamid, Mohamed; Mohamed, Mostafa K; Rafik, Mona; Fontanet, Arnaud; Albert, Matthew L


    Viral hepatitis is the leading cause of liver disease worldwide and can be caused by several agents, including hepatitis A (HAV), B (HBV), and C (HCV) virus. We employed multiplexed protein immune assays to identify biomarker signatures of viral hepatitis in order to define unique and common responses for three different acute viral infections of the liver. We performed multianalyte profiling, measuring the concentrations of 182 serum proteins obtained from acute HAV- (18), HBV- (18), and HCV-infected (28) individuals, recruited as part of a hospital-based surveillance program in Cairo, Egypt. Virus-specific biomarker signatures were identified and validation was performed using a unique patient population. A core signature of 46 plasma proteins was commonly modulated in all three infections, as compared to healthy controls. Principle component analysis (PCA) revealed a host response based upon 34 proteins, which could distinguish HCV patients from HAV- and HBV-infected individuals or healthy controls. When HAV and HBV groups were compared directly, 34 differentially expressed serum proteins allowed the separation of these two patient groups. A validation study was performed on an additional 111 patients, confirming the relevance of our initial findings, and defining the 17 analytes that reproducibly segregated the patient populations. This combined discovery and biomarker validation approach revealed a previously unrecognized virus-specific induction of host proteins. The identification of hepatitis virus specific signatures provides a foundation for functional studies and the identification of potential correlates of viral clearance. © 2014 by the American Association for the Study of Liver Diseases.

  1. Hepatitis B virus: pathogenesis, viral intermediates, and viral replication.


    Lee, Jia-Yee; Locarnini, Stephen


    Although HBV has the potential to generate an almost limitless spectrum of quasispecies during chronic infection, the viability of the majority of these quasispecies is almost certainly impaired due to constraints imposed by the remarkably compact organization of the HBV genome. On the other hand, single mutations may affect more than one gene and result in complex and unpredictable effects on viral phenotype. Better understanding of the constraints imposed by gene overlap and of genotype-phenotype relationships should help in the development of improved antiviral strategies and management approaches. Although the probability of developing viral resistance is directly proportional to the intensity of selection pressure and the diversity of quasispecies, potent inhibition of HBV replication should be able to prevent development of drug resistance because mutagenesis is replication dependent. If viral replication can be suppressed for a sufficient length of time, viral load should decline to a point where the continued production of quasispecies with the potential to resist new drug treatments no longer occurs. Clinical application of this concept will require optimization of combination therapies analogous to highly active antiretroviral therapy (HAART) for HIV infection. Total cure of hepatitis B will require elimination of the intranuclear pool of viral minichromosomes, which will probably only be achieved by normal cell turnover, reactivation of host immunity, or elucidation of the antiviral mechanisms operating during cytokine clearance in acute hepatitis B (see Fig. 1).

  2. The enzymes LSD1 and Set1A cooperate with the viral protein HBx to establish an active hepatitis B viral chromatin state

    PubMed Central

    Alarcon, Valentina; Hernández, Sergio; Rubio, Lorena; Alvarez, Francisca; Flores, Yvo; Varas-Godoy, Manuel; De Ferrari, Giancarlo V.; Kann, Michael; Villanueva, Rodrigo A.; Loyola, Alejandra


    With about 350 million people chronically infected around the world hepatitis B is a major health problem. Template for progeny HBV synthesis is the viral genome, organized as a minichromosome (cccDNA) inside the hepatocyte nucleus. How viral cccDNA gene expression is regulated by its chromatin structure; more importantly, how the modulation of this structure impacts on viral gene expression remains elusive. Here, we found that the enzyme SetDB1 contributes to setting up a repressed cccDNA chromatin state. This repressive state is activated by the histone lysine demethylase-1 (LSD1). Consistently, inhibiting or reducing LSD1 levels led to repression of viral gene expression. This correlates with the transcriptionally repressive mark H3K9 methylation and reduction on the activating marks H3 acetylation and H3K4 methylation on viral promoters. Investigating the importance of viral proteins we found that LSD1 recruitment to viral promoters was dependent on the viral transactivator protein HBx. Moreover, the histone methyltransferase Set1A and HBx are simultaneously bound to the core promoter, and Set1A expression correlates with cccDNA H3K4 methylation. Our results shed light on the mechanisms of HBV regulation mediated by the cccDNA chromatin structure, offering new therapeutic targets to develop drugs for the treatment of chronically infected HBV patients. PMID:27174370

  3. The enzymes LSD1 and Set1A cooperate with the viral protein HBx to establish an active hepatitis B viral chromatin state.


    Alarcon, Valentina; Hernández, Sergio; Rubio, Lorena; Alvarez, Francisca; Flores, Yvo; Varas-Godoy, Manuel; De Ferrari, Giancarlo V; Kann, Michael; Villanueva, Rodrigo A; Loyola, Alejandra


    With about 350 million people chronically infected around the world hepatitis B is a major health problem. Template for progeny HBV synthesis is the viral genome, organized as a minichromosome (cccDNA) inside the hepatocyte nucleus. How viral cccDNA gene expression is regulated by its chromatin structure; more importantly, how the modulation of this structure impacts on viral gene expression remains elusive. Here, we found that the enzyme SetDB1 contributes to setting up a repressed cccDNA chromatin state. This repressive state is activated by the histone lysine demethylase-1 (LSD1). Consistently, inhibiting or reducing LSD1 levels led to repression of viral gene expression. This correlates with the transcriptionally repressive mark H3K9 methylation and reduction on the activating marks H3 acetylation and H3K4 methylation on viral promoters. Investigating the importance of viral proteins we found that LSD1 recruitment to viral promoters was dependent on the viral transactivator protein HBx. Moreover, the histone methyltransferase Set1A and HBx are simultaneously bound to the core promoter, and Set1A expression correlates with cccDNA H3K4 methylation. Our results shed light on the mechanisms of HBV regulation mediated by the cccDNA chromatin structure, offering new therapeutic targets to develop drugs for the treatment of chronically infected HBV patients.

  4. [Pathology and viral metagenomics, a recent history].


    Bernardo, Pauline; Albina, Emmanuel; Eloit, Marc; Roumagnac, Philippe


    Human, animal and plant viral diseases have greatly benefited from recent metagenomics developments. Viral metagenomics is a culture-independent approach used to investigate the complete viral genetic populations of a sample. During the last decade, metagenomics concepts and techniques that were first used by ecologists progressively spread into the scientific field of viral pathology. The sample, which was first for ecologists a fraction of ecosystem, became for pathologists an organism that hosts millions of microbes and viruses. This new approach, providing without a priori high resolution qualitative and quantitative data on the viral diversity, is now revolutionizing the way pathologists decipher viral diseases. This review describes the very last improvements of the high throughput next generation sequencing methods and discusses the applications of viral metagenomics in viral pathology, including discovery of novel viruses, viral surveillance and diagnostic, large-scale molecular epidemiology, and viral evolution. © 2013 médecine/sciences – Inserm.

  5. Viral Vector-Mediated Antisense Therapy for Genetic Diseases

    PubMed Central

    Imbert, Marine; Dias-Florencio, Gabriella; Goyenvalle, Aurélie


    RNA plays complex roles in normal health and disease and is becoming an important target for therapeutic intervention; accordingly, therapeutic strategies that modulate RNA function have gained great interest over the past decade. Antisense oligonucleotides (AOs) are perhaps the most promising strategy to modulate RNA expression through a variety of post binding events such as gene silencing through degradative or non-degradative mechanisms, or splicing modulation which has recently demonstrated promising results. However, AO technology still faces issues like poor cellular-uptake, low efficacy in target tissues and relatively rapid clearance from the circulation which means repeated injections are essential to complete therapeutic efficacy. To overcome these limitations, viral vectors encoding small nuclear RNAs have been engineered to shuttle antisense sequences into cells, allowing appropriate subcellular localization with pre-mRNAs and permanent correction. In this review, we outline the different strategies for antisense therapy mediated by viral vectors and provide examples of each approach. We also address the advantages and limitations of viral vector use, with an emphasis on their clinical application. PMID:28134780

  6. Brd4 Activates Early Viral Transcription upon Human Papillomavirus 18 Infection of Primary Keratinocytes

    PubMed Central

    McKinney, Caleb C.; Kim, Min Jung; Chen, Dan


    ABSTRACT  Human papillomaviruses (HPVs) replicate in the cutaneous and mucosal epithelia, and the infectious cycle is synchronous with the differentiation program of the host keratinocytes. The virus initially infects dividing cells in the lower layers of the epithelium, where it establishes a persistent infection. The viral genome is maintained as a low-copy-number, extrachromosomal element in these proliferating cells but switches to the late stage of the life cycle in differentiated cells. The cellular chromatin adaptor protein Brd4 is involved in several stages and processes of the viral life cycle. In concert with the viral transcriptional regulator E2, Brd4 can repress transcription from the early viral promoter. Brd4 and E2 form a complex with the viral genome that associates with host chromosomes to partition the viral genome in dividing cells; Brd4 also localizes to active sites of productive HPV DNA replication. However, because of the difficulties in producing HPV viral particles, the role of Brd4 in modulating viral transcription and replication at the initial stage of infection is unclear. In this study, we have used an HPV18 quasivirus-based genome delivery system to assess the role of Brd4 in the initial infectivity of primary human keratinocytes. We show that, upon infection of primary human keratinocytes with HPV18 quasivirus, Brd4 activates viral transcription and replication. Furthermore, this activation is independent of the functional interaction between Brd4 and the HPV18 E2 protein. PMID:27879331

  7. Viral metagenomics and blood safety.


    Sauvage, V; Eloit, M


    The characterization of the human blood-associated viral community (also called blood virome) is essential for epidemiological surveillance and to anticipate new potential threats for blood transfusion safety. Currently, the risk of blood-borne agent transmission of well-known viruses (HBV, HCV, HIV and HTLV) can be considered as under control in high-resource countries. However, other viruses unknown or unsuspected may be transmitted to recipients by blood-derived products. This is particularly relevant considering that a significant proportion of transfused patients are immunocompromised and more frequently subjected to fatal outcomes. Several measures to prevent transfusion transmission of unknown viruses have been implemented including the exclusion of at-risk donors, leukocyte reduction of donor blood, and physicochemical treatment of the different blood components. However, up to now there is no universal method for pathogen inactivation, which would be applicable for all types of blood components and, equally effective for all viral families. In addition, among available inactivation procedures of viral genomes, some of them are recognized to be less effective on non-enveloped viruses, and inadequate to inactivate higher viral titers in plasma pools or derivatives. Given this, there is the need to implement new methodologies for the discovery of unknown viruses that may affect blood transfusion. Viral metagenomics combined with High Throughput Sequencing appears as a promising approach for the identification and global surveillance of new and/or unexpected viruses that could impair blood transfusion safety. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  8. Viral infections of nonhuman primates.


    Kalter, S S; Heberling, R L; Cooke, A W; Barry, J D; Tian, P Y; Northam, W J


    Approximately 53,000 serologic tests and viral isolation studies were performed on 1,700 nonhuman primate specimens for evidence of past and/or current viral infection. Information, other than the requested test, generally was not provided with the specimen. This lack of information does not permit any attempt at interpretation of results. Requested testing included a large number of diverse viral agents in approximately 40 primate species. The resulting data are in keeping with those of previous studies and offer an insight into the needs of colony management, as well as some general information on the overall frequency of infection with the indicated viruses. Inasmuch as the results represent testing of single specimens, they are not to be construed as "diagnostic," and simply indicate past infection as represented by the presence of antibody in the test animal. Viral isolation results are listed, and the number of positive results versus the number of animals tested emphasizes the limitations of the procedure. Investigations such as these continue to assist in the maintenance of healthy nonhuman primate colonies. This information also supports continued use of nonhuman primates for research in human viral infections and may be helpful in terms of animal selection for use in xenotransplants.

  9. Promoter elements and transcription factors involved in differentiation-dependent human chorionic gonadotrophin-alpha messenger ribonucleic acid expression of term villous trophoblasts.


    Knöfler, M; Saleh, L; Bauer, S; Vasicek, R; Griesinger, G; Strohmer, H; Helmer, H; Husslein, P


    Differentiation of primary villous cytotrophoblasts into syncytia is associated with increasing production of alpha and beta human CG subunits, which is predominantly governed at the level of messenger RNA expression. Here, we present a detailed study on the mechanisms involved in the differentiation-dependent regulation of the trophoblast-specific CGalpha gene promoter. Site-directed mutations in each of the five DNA-elements of the composite enhancer were performed to investigate the contribution of the individual regulatory sequences to the overall transcriptional activity of the promoter at two different stages of trophoblast in vitro differentiation. We show that deletion of one cyclic AMP response element (CRE) did not affect CGalpha promoter activity in cytotrophoblasts; however, it reduced transcription by 33% in differentiating cultures. Removal of both CREs almost abolished transcription at early and later stages of in vitro differentiation. Upon mutation the enhancer elements alphaACT, JRE, and CCAAT significantly decreased luciferase reporter transcription; however their contribution to the total promoter activity did not change during in vitro differentiation. Contrary to that, mutated TSE diminished promoter activity by 19% during 12 and 48 h of cultivation but reduced luciferase expression by 78% between 48 and 84 h of differentiation. In electrophoretic mobility shift assay, the TSE interacted with activating protein (AP)-2alpha in both primary trophoblasts and choriocarcinoma cells. While CRE-interacting proteins were detectable 12 h after isolation, the TSE-binding complex did not appear before 36 h of in vitro differentiation. During syncytium formation increasing protein expression of activating transcription factor (ATF)-1, cAMP response element-binding protein (CREB)-1, and AP-2alpha was observed on Western blots. Moreover, phosphorylated CREB-1 and ATF-1 accumulated between 24 and 78 h of trophoblast cultivation. By fluorescence

  10. Developmental toxicity of 4-ring polycyclic aromatic hydrocarbons in zebrafish is differentially dependent on AH receptor isoforms and hepatic cytochrome P4501A metabolism

    SciTech Connect

    Incardona, John P. . E-mail:; Day, Heather L.; Collier, Tracy K.; Scholz, Nathaniel L.


    Polycyclic aromatic hydrocarbons (PAHs) derived from fossil fuels are ubiquitous contaminants and occur in aquatic habitats as highly variable and complex mixtures of compounds containing 2 to 6 rings. For aquatic species, PAHs are generally accepted as acting through either of two modes of action: (1) 'dioxin-like' toxicity mediated by activation of the aryl hydrocarbon receptor (AHR), which controls a battery of genes involved in PAH metabolism, such as cytochrome P4501A (CYP1A) and (2) 'nonpolar narcosis', in which tissue uptake is dependent solely on hydrophobicity and toxicity is mediated through non-specific partitioning into lipid bilayers. As part of a systematic analysis of mechanisms of PAH developmental toxicity in zebrafish, we show here that three tetracyclic PAHs (pyrene, chrysene, and benz[a]anthracene) activate the AHR pathway tissue-specifically to induce distinct patterns of CYP1A expression. Using morpholino knockdown of ahr1a, ahr2, and cyp1a, we show that distinct embryolarval syndromes induced by exposure to two of these compounds are differentially dependent on tissue-specific activation of AHR isoforms or metabolism by CYP1A. Exposure of embryos with and without circulation (silent heart morphants) resulted in dramatically different patterns of CYP1A induction, with circulation required to deliver some compounds to internal tissues. Therefore, biological effects of PAHs cannot be predicted simply by quantitative measures of AHR activity or a compound's hydrophobicity. These results indicate that current models of PAH toxicity in fish are greatly oversimplified and that individual PAHs are pharmacologically active compounds with distinct and specific cellular targets.

  11. IL-33 markedly activates murine eosinophils by an NF-κB-dependent mechanism differentially dependent upon an IL-4-driven autoinflammatory loop.


    Bouffi, Carine; Rochman, Mark; Zust, Christopher B; Stucke, Emily M; Kartashov, Andrey; Fulkerson, Patricia C; Barski, Artem; Rothenberg, Marc E


    Eosinophils are major effector cells in type 2 inflammatory responses and become activated in response to IL-4 and IL-33, yet the molecular mechanisms and cooperative interaction between these cytokines remain unclear. Our objective was to investigate the molecular mechanism and cooperation of IL-4 and IL-33 in eosinophil activation. Eosinophils derived from bone marrow or isolated from Il5-transgenic mice were activated in the presence of IL-4 or IL-33 for 1 or 4 h, and the transcriptome was analyzed by RNA sequencing. The candidate genes were validated by quantitative PCR and ELISA. We demonstrated that murine-cultured eosinophils respond to IL-4 and IL-33 by phosphorylation of STAT-6 and NF-κB, respectively. RNA sequence analysis of murine-cultured eosinophils indicated that IL-33 induced 519 genes, whereas IL-4 induced only 28 genes, including 19 IL-33-regulated genes. Interestingly, IL-33 induced eosinophil activation via two distinct mechanisms, IL-4 independent and IL-4 secretion/autostimulation dependent. Anti-IL-4 or anti-IL-4Rα Ab-treated cultured and mature eosinophils, as well as Il4- or Stat6-deficient cultured eosinophils, had attenuated protein secretion of a subset of IL-33-induced genes, including Retnla and Ccl17. Additionally, IL-33 induced the rapid release of preformed IL-4 protein from eosinophils by a NF-κB-dependent mechanism. However, the induction of most IL-33-regulated transcripts (e.g., Il6 and Il13) was IL-4 independent and blocked by NF-κB inhibition. In conclusion, we have identified a novel activation pathway in murine eosinophils that is induced by IL-33 and differentially dependent upon an IL-4 auto-amplification loop.

  12. Viral diseases affecting the pleura.


    Nestor, Jennings; Huggins, Terrill; Kummerfeldt, Carlos; DiVietro, Matthew; Walters, Kenneth; Sahn, Steven


    Viruses affect the human body in multiple ways producing various disease states. The infections of the pulmonary parenchyma have been well described. However, there has been no current review of the literature pertaining to the pleura. To review the available literature pertaining to diseases of the pleura that are caused by viral infections. A Medline search was performed and available research and review articles relating to viral infections that resulted in pleural effusions, pleural masses, pleural thickening, and pleural nodularity were reviewed. There are numerous viruses that cause diseases of the pleura. Pleural effusions and lesions within the pleura are the most common presentation of the disease state. Polymerase chain reaction has the potential to further diagnose viral infections and expand our knowledge base in this field. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Viral Inhibition of PRR-Mediated Innate Immune Response: Learning from KSHV Evasion Strategies.


    Lee, Hye-Ra; Choi, Un Yung; Hwang, Sung-Woo; Kim, Stephanie; Jung, Jae U


    The innate immune system has evolved to detect and destroy invading pathogens before they can establish systemic infection. To successfully eradicate pathogens, including viruses, host innate immunity is activated through diverse pattern recognition receptors (PRRs) which detect conserved viral signatures and trigger the production of type I interferon (IFN) and pro-inflammatory cytokines to mediate viral clearance. Viral persistence requires that viruses co-opt cellular pathways and activities for their benefit. In particular, due to the potent antiviral activities of IFN and cytokines, viruses have developed various strategies to meticulously modulate intracellular innate immune sensing mechanisms to facilitate efficient viral replication and persistence. In this review, we highlight recent advances in the study of viral immune evasion strategies with a specific focus on how Kaposi's sarcoma-associated herpesvirus (KSHV) effectively targets host PRR signaling pathways.

  14. [Novel treatments for hepatitis C viral infection and the hepatic fibrosis].


    Lugo-Baruqui, Alejandro; Bautista López, Carlos Alfredo; Armendáriz-Borunda, Juan


    Hepatitis C virus (HCV) infection represents a global health problem due to its evolution to hepatic cirrhosis and hepatocellular carcinoma. The viral pathogenesis and infectious processes are not yet fully understood. The development of natural viral resistance towards the host immune system represents a mayor challenge for the design of alternative therapeutic interventions and development of viral vaccines. The molecular mechanisms of hepatic fibrosis are well described. New alternatives for the treatment of patients with HCV infection and hepatic cirrhosis are under intensive research. New drugs such as viral protease inhibitors and assembly inhibitors, as well as immune modulators have been studied in clinical trials. Additional alternatives include antifibrotic drugs, which reverse the hepatic cellular damage caused by HCV infection. This review makes reference to viral infective mechanisms, molecular pathways of liver fibrosis and overviews conventional and new treatments for HCV infection and liver fibrosis.

  15. Viral Inhibition of PRR-Mediated Innate Immune Response: Learning from KSHV Evasion Strategies

    PubMed Central

    Lee, Hye-Ra; Choi, Un Yung; Hwang, Sung-Woo; Kim, Stephanie; Jung, Jae U.


    The innate immune system has evolved to detect and destroy invading pathogens before they can establish systemic infection. To successfully eradicate pathogens, including viruses, host innate immunity is activated through diverse pattern recognition receptors (PRRs) which detect conserved viral signatures and trigger the production of type I interferon (IFN) and pro-inflammatory cytokines to mediate viral clearance. Viral persistence requires that viruses co-opt cellular pathways and activities for their benefit. In particular, due to the potent antiviral activities of IFN and cytokines, viruses have developed various strategies to meticulously modulate intracellular innate immune sensing mechanisms to facilitate efficient viral replication and persistence. In this review, we highlight recent advances in the study of viral immune evasion strategies with a specific focus on how Kaposi’s sarcoma-associated herpesvirus (KSHV) effectively targets host PRR signaling pathways. PMID:27871174

  16. Going Viral with Fluorescent Proteins.


    Costantini, Lindsey M; Snapp, Erik L


    Many longstanding questions about dynamics of virus-cell interactions can be answered by combining fluorescence imaging techniques with fluorescent protein (FP) tagging strategies. Successfully creating a FP fusion with a cellular or viral protein of interest first requires selecting the appropriate FP. However, while viral architecture and cellular localization often dictate the suitability of a FP, a FP's chemical and physical properties must also be considered. Here, we discuss the challenges of and offer suggestions for identifying the optimal FPs for studying the cell biology of viruses.

  17. Nosocomial Spread of Viral Disease

    PubMed Central

    Aitken, Celia; Jeffries, Donald J.


    Viruses are important causes of nosocomial infection, but the fact that hospital outbreaks often result from introduction(s) from community-based epidemics, together with the need to initiate specific laboratory testing, means that there are usually insufficient data to allow the monitoring of trends in incidences. The most important defenses against nosocomial transmission of viruses are detailed and continuing education of staff and strict adherence to infection control policies. Protocols must be available to assist in the management of patients with suspected or confirmed viral infection in the health care setting. In this review, we present details on general measures to prevent the spread of viral infection in hospitals and other health care environments. These include principles of accommodation of infected patients and approaches to good hygiene and patient management. They provide detail on individual viral diseases accompanied in each case with specific information on control of the infection and, where appropriate, details of preventive and therapeutic measures. The important areas of nosocomial infection due to blood-borne viruses have been extensively reviewed previously and are summarized here briefly, with citation of selected review articles. Human prion diseases, which present management problems very different from those of viral infection, are not included. PMID:11432812

  18. Viral Subversion of Nucleocytoplasmic Trafficking

    PubMed Central

    Yarbrough, Melanie L.; Mata, Miguel A.; Sakthivel, Ramanavelan; Fontoura, Beatriz M. A.


    Trafficking of proteins and RNA into and out of the nucleus occurs through the nuclear pore complex (NPC). Due to its critical function in many cellular processes, the NPC and transport factors are common targets of several viruses that disrupt key constituents of the machinery to facilitate viral replication. Many viruses such as poliovirus and severe acute respiratory syndrome (SARS) virus inhibit protein import into the nucleus, while viruses such as influenza A virus target and disrupt host mRNA nuclear export. Current evidence indicates that these viruses may employ such strategies to avert the host immune response. Conversely, many viruses co-opt nucleocytoplasmic trafficking to facilitate transport of viral RNAs. Since viral proteins interact with key regulators of the host nuclear transport machinery, viruses have served as invaluable tools of discovery that led to the identification of novel constituents of nuclear transport pathways. In addition, this review explores the importance of nucleocytoplasmic trafficking to viral pathogenesis as these studies revealed new antiviral therapeutic strategies and exposed previously unknown cellular mechanisms. Further understanding of nuclear transport pathways will determine whether such therapeutics will be useful treatments for important human pathogens. PMID:24289861

  19. Drug Development against Viral Diseases

    DTIC Science & Technology


    DEVELOPMENT AND TESTING 07 ANTI-VIRAL DRUGS SECONDARY TESTING, PtIMATE NODEL YALE ARBOVIRUS RESUACR UNIT FINAL REPORT DATE OF REPORT: 10/24/86 TOXICITY...50 mg/kg Age/wt of animal: Adult; 526 gos Animal identification number and weight: 43; 526 gis Other treatments given: Anesthesia Bled (1.5 mls), Days

  20. The Paradigm of Viral Communication.

    ERIC Educational Resources Information Center

    Welker, Carl B.


    Introduces the concepts of idea viruses and viral communication, a technology-based communication that spreads ideas quickly. Explains its applicability in the area of direct marketing and discusses a technology platform that provides the opportunity of sending a message to a large number of people and emotional or pecuniary incentives to…

  1. The Paradigm of Viral Communication.

    ERIC Educational Resources Information Center

    Welker, Carl B.


    Introduces the concepts of idea viruses and viral communication, a technology-based communication that spreads ideas quickly. Explains its applicability in the area of direct marketing and discusses a technology platform that provides the opportunity of sending a message to a large number of people and emotional or pecuniary incentives to…

  2. A combination HIV reporter virus system for measuring post-entry event efficiency and viral outcome in primary CD4+ T cell subsets.


    Tilton, Carisa A; Tabler, Caroline O; Lucera, Mark B; Marek, Samantha L; Haqqani, Aiman A; Tilton, John C


    Fusion between the viral membrane of human immunodeficiency virus (HIV) and the host cell marks the end of the HIV entry process and the beginning of a series of post-entry events including uncoating, reverse transcription, integration, and viral gene expression. The efficiency of post-entry events can be modulated by cellular factors including viral restriction factors and can lead to several distinct outcomes: productive, latent, or abortive infection. Understanding host and viral proteins impacting post-entry event efficiency and viral outcome is critical for strategies to reduce HIV infectivity and to optimize transduction of HIV-based gene therapy vectors. Here, we report a combination reporter virus system measuring both membrane fusion and viral promoter-driven gene expression. This system enables precise determination of unstimulated primary CD4+ T cell subsets targeted by HIV, the efficiency of post-entry viral events, and viral outcome and is compatible with high-throughput screening and cell-sorting methods.

  3. Herbal medicines for viral myocarditis

    PubMed Central

    Liu, Zhao Lan; Liu, Zhi Jun; Liu, Jian Ping; Yang, Min; Kwong, Joey


    Background Herbal medicines are being used for treating viral diseases including viral myocarditis, and many controlled trials have been done to investigate their efficacy. Objectives To assess the effects of herbal medicines on clinical and indirect outcomes in patients with viral myocarditis. Search strategy We searched the Cochrane Central Register of Controlled Trials (CENTRAL) in The Cochrane Library Issue 3, 2009, MEDLINE (January 1966 - July 2009), EMBASE (January 1998 - July 2009), Chinese Biomedical Database (1979 - 2009), China National Knowledge Infrastructure (1979 - 2009), Chinese VIP Information (1989 - 2009), Chinese Academic Conference Papers Database and Chinese Dissertation Database (1980 - 2009), AMED (1985 - 2009), LILACS accessed in July 2009 and the trials register of the Cochrane Complementary Medicine Field. We handsearched Chinese journals and conference proceedings. No language restrictions were applied. Selection criteria Randomised controlled trials of herbal medicines (with a minimum of seven days treatment duration) compared with placebo, no intervention, or conventional interventions were included. Trials of herbal medicine plus conventional drug versus drug alone were also included. Only trials that reported adequate description of allocation sequence generation were included. Data collection and analysis Two review authors independently extracted data and evaluated trial quality. Adverse effects information was collected from the trials. Main results Fourteen randomised trials involving 1463 people were included. All trials were conducted and published in China. Quality of the trials was assessed to be low. No trial had diagnosis of viral myocarditis confirmed histologically, and only a few trials attempted to establish viral aetiology. Nine different herbal medicines were tested in the included trials. The trials reported electrocardiogram results, level of myocardial enzymes, cardiac function, symptoms, and adverse effects

  4. Herbal medicines for viral myocarditis

    PubMed Central

    Liu, Zhao Lan; Liu, Zhi Jun; Liu, Jian Ping; Yang, Min; Kwong, Joey


    Background Herbal medicines are being used for treating viral diseases including viral myocarditis, and many controlled trials have been done to investigate their efficacy. Objectives To assess the effects of herbal medicines on clinical and indirect outcomes in patients with viral myocarditis. Search methods We searched the Cochrane Central Register of Controlled Trials (CENTRAL) in The Cochrane Library Issue 3, 2009, MEDLINE (January 1966 - July 2009), EMBASE (January 1998 - July 2009), Chinese Biomedical Database (1979 - 2009), China National Knowledge Infrastructure (1979 - 2009), Chinese VIP Information (1989 - 2009), Chinese Academic Conference Papers Database and Chinese Dissertation Database (1980 - 2009), AMED (1985 - 2009), LILACS accessed in July 2009 and the trials register of the Cochrane Complementary Medicine Field. We handsearched Chinese journals and conference proceedings. No language restrictions were applied. Selection criteria Randomised controlled trials of herbal medicines (with a minimum of seven days treatment duration) compared with placebo, no intervention, or conventional interventions were included. Trials of herbal medicine plus conventional drug versus drug alone were also included. Only trials that reported adequate description of allocation sequence generation were included. Data collection and analysis Two review authors independently extracted data and evaluated trial quality. Adverse effects information was collected from the trials. Results Fourteen randomised trials involving 1463 people were included. All trials were conducted and published in China. Quality of the trials was assessed to be low. No trial had diagnosis of viral myocarditis confirmed histologically, and only a few trials attempted to establish viral aetiology. Nine different herbal medicines were tested in the included trials. The trials reported electrocardiogram results, level of myocardial enzymes, cardiac function, symptoms, and adverse effects. Astragalus

  5. Herbal medicines for viral myocarditis.


    Liu, Zhao Lan; Liu, Zhi Jun; Liu, Jian Ping; Yang, Min; Kwong, Joey


    Herbal medicines are being used for treating viral diseases including viral myocarditis, and many controlled trials have been done to investigate their efficacy. To assess the effects of herbal medicines on clinical and indirect outcomes in patients with viral myocarditis. We searched the Cochrane Central Register of Controlled Trials (CENTRAL) in The Cochrane Library Issue 3, 2009, MEDLINE (January 1966 - July 2009), EMBASE (January 1998 - July 2009), Chinese Biomedical Database (1979 - 2009), China National Knowledge Infrastructure (1979 - 2009), Chinese VIP Information (1989 - 2009), Chinese Academic Conference Papers Database and Chinese Dissertation Database (1980 - 2009), AMED (1985 - 2009), LILACS accessed in July 2009 and the trials register of the Cochrane Complementary Medicine Field. We handsearched Chinese journals and conference proceedings. No language restrictions were applied. Randomised controlled trials of herbal medicines (with a minimum of seven days treatment duration) compared with placebo, no intervention, or conventional interventions were included. Trials of herbal medicine plus conventional drug versus drug alone were also included. Only trials that reported adequate description of allocation sequence generation were included. Two review authors independently extracted data and evaluated trial quality. Adverse effects information was collected from the trials. Fourteen randomised trials involving 1463 people were included. All trials were conducted and published in China. Quality of the trials was assessed to be low. No trial had diagnosis of viral myocarditis confirmed histologically, and only a few trials attempted to establish viral aetiology. Nine different herbal medicines were tested in the included trials. The trials reported electrocardiogram results, level of myocardial enzymes, cardiac function, symptoms, and adverse effects.Astragalus membranaceus (either as an injection or granules) showed significant positive effects in

  6. Viral Inhibition of the IFN-Induced JAK/STAT Signalling Pathway: Development of Live Attenuated Vaccines by Mutation of Viral-Encoded IFN-Antagonists

    PubMed Central

    Fleming, Stephen B.


    The interferon (IFN) induced anti-viral response is amongst the earliest and most potent of the innate responses to fight viral infection. The induction of the Janus kinase/signal transducer and activation of transcription (JAK/STAT) signalling pathway by IFNs leads to the upregulation of hundreds of interferon stimulated genes (ISGs) for which, many have the ability to rapidly kill viruses within infected cells. During the long course of evolution, viruses have evolved an extraordinary range of strategies to counteract the host immune responses in particular by targeting the JAK/STAT signalling pathway. Understanding how the IFN system is inhibited has provided critical insights into viral virulence and pathogenesis. Moreover, identification of factors encoded by viruses that modulate the JAK/STAT pathway has opened up opportunities to create new anti-viral drugs and rationally attenuated new generation vaccines, particularly for RNA viruses, by reverse genetics. PMID:27367734

  7. Autistic disorder and viral infections.


    Libbey, Jane E; Sweeten, Thayne L; McMahon, William M; Fujinami, Robert S


    Autistic disorder (autism) is a behaviorally defined developmental disorder with a wide range of behaviors. Although the etiology of autism is unknown, data suggest that autism results from multiple etiologies with both genetic and environmental contributions, which may explain the spectrum of behaviors seen in this disorder. One proposed etiology for autism is viral infection very early in development. The mechanism, by which viral infection may lead to autism, be it through direct infection of the central nervous system (CNS), through infection elsewhere in the body acting as a trigger for disease in the CNS, through alteration of the immune response of the mother or offspring, or through a combination of these, is not yet known. Animal models in which early viral infection results in behavioral changes later in life include the influenza virus model in pregnant mice and the Borna disease virus model in newborn Lewis rats. Many studies over the years have presented evidence both for and against the association of autism with various viral infections. The best association to date has been made between congenital rubella and autism; however, members of the herpes virus family may also have a role in autism. Recently, controversy has arisen as to the involvement of measles virus and/or the measles, mumps, rubella (MMR) vaccine in the development of autism. Biological assays lend support to the association between measles virus or MMR and autism whereas epidemiologic studies show no association between MMR and autism. Further research is needed to clarify both the mechanisms whereby viral infection early in development may lead to autism and the possible involvement of the MMR vaccine in the development of autism.

  8. Roles of the Picornaviral 3C Proteinase in the Viral Life Cycle and Host Cells.


    Sun, Di; Chen, Shun; Cheng, Anchun; Wang, Mingshu


    The Picornaviridae family comprises a large group of non-enveloped viruses that have a major impact on human and veterinary health. The viral genome contains one open reading frame encoding a single polyprotein that can be processed by viral proteinases. The crucial 3C proteinases (3C(pro)s) of picornaviruses share similar spatial structures and it is becoming apparent that 3C(pro) plays a significant role in the viral life cycle and virus host interaction. Importantly, the proteinase and RNA-binding activity of 3C(pro) are involved in viral polyprotein processing and the initiation of viral RNA synthesis. In addition, 3C(pro) can induce the cleavage of certain cellular factors required for transcription, translation and nucleocytoplasmic trafficking to modulate cell physiology for viral replication. Due to interactions between 3C(pro) and these essential factors, 3C(pro) is also involved in viral pathogenesis to support efficient infection. Furthermore, based on the structural conservation, the development of irreversible inhibitors and discovery of non-covalent inhibitors for 3C(pro) are ongoing and a better understanding of the roles played by 3C(pro) may provide insights into the development of potential antiviral treatments. In this review, the current knowledge regarding the structural features, multiple functions in the viral life cycle, pathogen host interaction, and development of antiviral compounds for 3C(pro) is summarized.

  9. Roles of the Picornaviral 3C Proteinase in the Viral Life Cycle and Host Cells

    PubMed Central

    Sun, Di; Chen, Shun; Cheng, Anchun; Wang, Mingshu


    The Picornaviridae family comprises a large group of non-enveloped viruses that have a major impact on human and veterinary health. The viral genome contains one open reading frame encoding a single polyprotein that can be processed by viral proteinases. The crucial 3C proteinases (3Cpros) of picornaviruses share similar spatial structures and it is becoming apparent that 3Cpro plays a significant role in the viral life cycle and virus host interaction. Importantly, the proteinase and RNA-binding activity of 3Cpro are involved in viral polyprotein processing and the initiation of viral RNA synthesis. In addition, 3Cpro can induce the cleavage of certain cellular factors required for transcription, translation and nucleocytoplasmic trafficking to modulate cell physiology for viral replication. Due to interactions between 3Cpro and these essential factors, 3Cpro is also involved in viral pathogenesis to support efficient infection. Furthermore, based on the structural conservation, the development of irreversible inhibitors and discovery of non-covalent inhibitors for 3Cpro are ongoing and a better understanding of the roles played by 3Cpro may provide insights into the development of potential antiviral treatments. In this review, the current knowledge regarding the structural features, multiple functions in the viral life cycle, pathogen host interaction, and development of antiviral compounds for 3Cpro is summarized. PMID:26999188

  10. Combining genomic sequencing methods to explore viral diversity and reveal potential virus-host interactions

    PubMed Central

    Chow, Cheryl-Emiliane T.; Winget, Danielle M.; White, Richard A.; Hallam, Steven J.; Suttle, Curtis A.


    Viral diversity and virus-host interactions in oxygen-starved regions of the ocean, also known as oxygen minimum zones (OMZs), remain relatively unexplored. Microbial community metabolism in OMZs alters nutrient and energy flow through marine food webs, resulting in biological nitrogen loss and greenhouse gas production. Thus, viruses infecting OMZ microbes have the potential to modulate community metabolism with resulting feedback on ecosystem function. Here, we describe viral communities inhabiting oxic surface (10 m) and oxygen-starved basin (200 m) waters of Saanich Inlet, a seasonally anoxic fjord on the coast of Vancouver Island, British Columbia using viral metagenomics and complete viral fosmid sequencing on samples collected between April 2007 and April 2010. Of 6459 open reading frames (ORFs) predicted across all 34 viral fosmids, 77.6% (n = 5010) had no homology to reference viral genomes. These fosmids recruited a higher proportion of viral metagenomic sequences from Saanich Inlet than from nearby northeastern subarctic Pacific Ocean (Line P) waters, indicating differences in the viral communities between coastal and open ocean locations. While functional annotations of fosmid ORFs were limited, recruitment to NCBI's non-redundant “nr” database and publicly available single-cell genomes identified putative viruses infecting marine thaumarchaeal and SUP05 proteobacteria to provide potential host linkages with relevance to coupled biogeochemical cycling processes in OMZ waters. Taken together, these results highlight the power of coupled analyses of multiple sequence data types, such as viral metagenomic and fosmid sequence data with prokaryotic single cell genomes, to chart viral diversity, elucidate genomic and ecological contexts for previously unclassifiable viral sequences, and identify novel host interactions in natural and engineered ecosystems. PMID:25914678

  11. Regulation of human papillomavirus type 31 gene expression during the differentiation-dependent life cycle through histone modifications and transcription factor binding.


    Wooldridge, Tonia R; Laimins, Laimonis A


    The life cycle of high-risk human papillomaviruses is linked to epithelial differentiation with virion production restricted to highly differentiated suprabasal cells. Two major viral promoters direct high-risk HPV gene expression and their activities are dependent upon differentiation. The early promoter controls initiation of transcripts at sites upstream of the E6 open reading frame and is active in both undifferentiated as well as differentiated cells. The late viral promoter directs transcription from a series of heterogeneous start sites in E7 and is activated upon differentiation. In this study, the state of histones as well as the spectrum of transcription factors bound to the two major HPV 31 viral promoters in undifferentiated and differentiated cells were examined using chromatin immunoprecipitation assays. Our studies indicate that, in undifferentiated cells, the chromatin surrounding both promoter regions is in an open, transcriptionally active state as indicated by the presence of dimethylated forms of histone H3 K4 as well as acetylated H3 and acetylated H4. Upon differentiation, there was an increase of four to six fold in the levels of dimethylated H3K4 and acetylated H3 respectively around both promoter regions as well as an increase of approximately nine fold in acetylated H4 at the early promoter. This suggests that nucleosomes of both promoter regions are further activated through histone modifications during differentiation. Chromatin immunoprecipitation assays were also used to examine the binding of transcription factors to the keratinocyte enhancer (KE)/early promoter region in the upstream regulatory region (URR) and late promoter sequences throughout differentiation. Our results suggest that a dynamic change in transcription factor binding occurs in both regions upon differentiation; most notably a significant increase in C/EBP-beta binding to the KE/early promoter region as well as C/EBP-alpha binding to the late promoter region upon

  12. Viral interaction with molecular chaperones: role in regulating viral infection.


    Xiao, Allen; Wong, Jerry; Luo, Honglin


    As essential effectors in protein quality control, molecular chaperones serve as the primary checkpoint to assist proper protein folding and prevent misfolded proteins from denaturation and aggregation. In addition, chaperones can function to direct terminally misfolded proteins to the proteolytic system for degradation. Viruses rely on host cell machineries for productive infection. Like for many other processes, various viruses have been shown to evolve mechanisms to utilize or subvert the host protein quality control machinery to support the completion of their life cycle. Furthermore, recent studies suggest that some viruses encode for their own chaperone-like proteins to enhance their infectivity. This review summarizes the current understanding of the interplay between molecular chaperones and viral proteins, highlights the chaperone activities of a number of viral proteins, and discusses potential antiviral therapeutic strategies targeting the virus-chaperone interactions.

  13. Endemic Poultry Viral Diseases 2016 Research Update

    USDA-ARS?s Scientific Manuscript database

    Viral infections of the avian gastrointestinal tract negatively impact poultry production; however, determining the complex etiologies of the viral enteric diseases in poultry has been difficult. Project scientists are continuing to investigate the species specificity, molecular phylogenetics, and p...

  14. Marked Variability in the Extent of Protein Disorder within and between Viral Families

    PubMed Central

    Pushker, Ravindra; Mooney, Catherine; Davey, Norman E.; Jacqué, Jean-Marc; Shields, Denis C.


    Intrinsically disordered regions in eukaryotic proteomes contain key signaling and regulatory modules and mediate interactions with many proteins. Many viral proteomes encode disordered proteins and modulate host factors through the use of short linear motifs (SLiMs) embedded within disordered regions. However, the degree of viral protein disorder across different viruses is not well understood, so we set out to establish the constraints acting on viruses, in terms of their use of disordered protein regions. We surveyed predicted disorder across 2,278 available viral genomes in 41 families, and correlated the extent of disorder with genome size and other factors. Protein disorder varies strikingly between viral families (from 2.9% to 23.1% of residues), and also within families. However, this substantial variation did not follow the established trend among their hosts, with increasing disorder seen across eubacterial, archaebacterial, protists, and multicellular eukaryotes. For example, among large mammalian viruses, poxviruses and herpesviruses showed markedly differing disorder (5.6% and 17.9%, respectively). Viral families with smaller genome sizes have more disorder within each of five main viral types (ssDNA, dsDNA, ssRNA+, dsRNA, retroviruses), except for negative single-stranded RNA viruses, where disorder increased with genome size. However, surveying over all viruses, which compares tiny and enormous viruses over a much bigger range of genome sizes, there is no strong association of genome size with protein disorder. We conclude that there is extensive variation in the disorder content of viral proteomes. While a proportion of this may relate to base composition, to extent of gene overlap, and to genome size within viral types, there remain important additional family and virus-specific effects. Differing disorder strategies are likely to impact on how different viruses modulate host factors, and on how rapidly viruses can evolve novel instances of SLi

  15. [Recent acquisitions on viral hepatitis].


    Resti, M; Tucci, F; Vierucci, A


    In the last years the research on viral hepatitis let to better understand the biological, molecular, immunological and epidemiologic characteristics of the viruses that are responsible for hepatitis. The first studied virus was hepatitis B virus (HBv). The scientific attention is still, today, focused on that virus since new markers of infectivity and biological importance in early diagnosis and in disease evolution have been found. The most important result in the last years in the field of viral hepatitis has been, however, the identification of agents responsible for Non-A-Non-B hepatitis. Its epidemiology and clinical importance are discussed in the present paper. Virus C is the most important parenteral agent of NANB hepatitis. Its epidemiology in at risk populations and its role in post-transfusional and cryptogenetic hepatitis are here discussed. The research of new markers of HCV infection is today considered a main goal since the role of the only marker now available is still under discussion.

  16. Canine viral enteritis. Recent developments.


    Pollock, R V; Carmichael, L


    Two apparently novel viral gastroenteritides of dogs were recognized in 1978: one caused by a parvo-like virus (CPV) and one by a corona-like virus (CCV). A rotavirus has also been tentatively associated with neonatal pup enteritis. Canine viral enteritis is characterized by a sudden onset of vomiting and diarrhea, rapid spread and high morbidity. Treatment is only supportive but must be initiated promptly. Infected animals should be isolated immediately; the extremely contagious nature of these diseases makes them difficult to contain. Feces from infected dogs appear to be the primary means of transmission. Sodium hypochlorite solutions (eg, Clorox) are recommended for disinfection. The development of effective vaccines is an immediate and pressing problem.

  17. Prospects for new viral vaccines.


    Marmion, B P


    Animal virology has made outstanding contributions to preventive medicine by the development of vaccines for the control of infectious disease in man and animals. Cost-benefit analysis indicates substantial savings in health care costs from the control of diseases such as smallpox, poliomyelitis, yellow fever and measels. Areas for further development include vaccines for influenza (living, attenuated virus), the herpes group (varicella: cytomegalovirus), respiratory syncytial virus, rotavirus and hepatitis A, B, and non A/non B. The general options for vaccine formulation are discussed with particular emphasis on approaches with the use of viral genetics to 'tailor make' vaccine viruses with defined growth potential in laboratory systems, low pathogenicity, and defined antigens. Current progress with the development of an inactivated hepatitis B vaccine is reviewed as a case study in vaccine development. The impact of recent experiments in cloning hepatitis B virus DNA in E. coli on the production of a purified viral polypeptide vaccine is assessed.

  18. Neutrophil Extracellular Traps Go Viral

    PubMed Central

    Schönrich, Günther; Raftery, Martin J.


    Neutrophils are the most numerous immune cells. Their importance as the first line of defense against bacterial and fungal pathogens is well described. In contrast, the role of neutrophils in controlling viral infections is less clear. Bacterial and fungal pathogens can stimulate neutrophils extracellular traps (NETs) in a process called NETosis. Although NETosis has previously been described as a special form of programmed cell death, there are forms of NET production that do not end with the demise of neutrophils. As an end result of NETosis, genomic DNA complexed with microbicidal proteins is expelled from neutrophils. These structures can kill pathogens or at least prevent their local spread within host tissue. On the other hand, disproportionate NET formation can cause local or systemic damage. Only recently, it was recognized that viruses can also induce NETosis. In this review, we discuss the mechanisms by which NETs are produced in the context of viral infection and how this may contribute to both antiviral immunity and immunopathology. Finally, we shed light on viral immune evasion mechanisms targeting NETs. PMID:27698656

  19. Recycling Endosomes and Viral Infection

    PubMed Central

    Vale-Costa, Sílvia; Amorim, Maria João


    Many viruses exploit specific arms of the endomembrane system. The unique composition of each arm prompts the development of remarkably specific interactions between viruses and sub-organelles. This review focuses on the viral–host interactions occurring on the endocytic recycling compartment (ERC), and mediated by its regulatory Ras-related in brain (Rab) GTPase Rab11. This protein regulates trafficking from the ERC and the trans-Golgi network to the plasma membrane. Such transport comprises intricate networks of proteins/lipids operating sequentially from the membrane of origin up to the cell surface. Rab11 is also emerging as a critical factor in an increasing number of infections by major animal viruses, including pathogens that provoke human disease. Understanding the interplay between the ERC and viruses is a milestone in human health. Rab11 has been associated with several steps of the viral lifecycles by unclear processes that use sophisticated diversified host machinery. For this reason, we first explore the state-of-the-art on processes regulating membrane composition and trafficking. Subsequently, this review outlines viral interactions with the ERC, highlighting current knowledge on viral-host binding partners. Finally, using examples from the few mechanistic studies available we emphasize how ERC functions are adjusted during infection to remodel cytoskeleton dynamics, innate immunity and membrane composition. PMID:27005655

  20. Pediatric Asthma and Viral Infection.


    Garcia-Garcia, M Luz; Calvo Rey, Cristina; Del Rosal Rabes, Teresa


    Respiratory viral infections, particularly respiratory syncytial virus (RSV) and rhinovirus, are the most importance risk factors for the onset of wheezing in infants and small children. Bronchiolitis is the most common acute respiratory infection in children under 1year of age, and the most common cause of hospitalization in this age group. RSV accounts for approximately 70% of all these cases, followed by rhinovirus, adenovirus, metapneumovirus and bocavirus. The association between bronchiolitis caused by RSV and the development of recurrent wheezing and/or asthma was first described more than 40years ago, but it is still unclear whether bronchiolitis causes chronic respiratory symptoms, or if it is a marker for children with a genetic predisposition for developing asthma in the medium or long term. In any case, sufficient evidence is available to corroborate the existence of this association, which is particularly strong when the causative agent of bronchiolitis is rhinovirus. The pathogenic role of respiratory viruses as triggers for exacerbations in asthmatic patients has not been fully characterized. However, it is clear that respiratory viruses, and in particular rhinovirus, are the most common causes of exacerbation in children, and some type of respiratory virus has been identified in over 90% of children hospitalized for an episode of wheezing. Changes in the immune response to viral infections in genetically predisposed individuals are very likely to be the main factors involved in the association between viral infection and asthma.

  1. Viral Hepatitis: Information for Gay and Bisexual Men


    VIRAL HEPATITIS Information for Gay and Bisexual Men What is viral hepatitis? Viral hepatitis is an infection of the liver caused by ... United States, the most common types of viral hepatitis are Hepatitis A, Hepatitis B, and Hepatitis C. ...

  2. Hepatitis C viral protein translation: mechanisms and implications in developing antivirals.


    Hoffman, Brett; Liu, Qiang


    Hepatitis C viral protein translation occurs in a cap-independent manner through the use of an internal ribosomal entry site (IRES) present within the viral 5'-untranslated region. The IRES is composed of highly conserved structural domains that directly recruit the 40S ribosomal subunit to the viral genomic RNA. This frees the virus from relying on a large number of translation initiation factors that are required for cap-dependent translation, conferring a selective advantage to the virus especially in times when the availability of such factors is low. Although the mechanism of translation initiation on the Hepatitis C virus (HCV) IRES is well established, modulation of the HCV IRES activity by both cellular and viral factors is not well understood. As the IRES is essential in the HCV life cycle and as such remains well conserved in an otherwise highly heterogenic virus, the process of HCV protein translation represents an attractive target in the development of novel antivirals. This review will focus on the mechanisms of HCV protein translation and how this process is postulated to be modulated by cis-acting viral factors, as well as trans-acting viral and cellular factors. Numerous therapeutic approaches investigated in targeting HCV protein translation for the development of novel antivirals will also be discussed.

  3. Viral-templated Palladium Nanocatalysts

    NASA Astrophysics Data System (ADS)

    Yang, Cuixian

    Despite recent progress on nanocatalysis, there exist several critical challenges in simple and readily controllable nanocatalyst synthesis including the unpredictable particle growth, deactivation of catalytic activity, cumbersome catalyst recovery and lack of in-situ reaction monitoring. In this dissertation, two novel approaches are presented for the fabrication of viral-templated palladium (Pd) nanocatalysts, and their catalytic activities for dichromate reduction reaction and Suzuki Coupling reaction were thoroughly studied. In the first approach, viral template based bottom-up assembly is employed for the Pd nanocatalyst synthesis in a chip-based format. Specifically, genetically displayed cysteine residues on each coat protein of Tobacco Mosaic Virus (TMV) templates provide precisely spaced thiol functionalities for readily controllable surface assembly and enhanced formation of catalytically active Pd nanoparticles. Catalysts with the chip-based format allow for simple separation and in-situ monitoring of the reaction extent. Thorough examination of synthesis-structure-activity relationship of Pd nanoparticles formed on surface-assembled viral templates shows that Pd nanoparticle size, catalyst loading density and catalytic activity of viral-templated Pd nanocatalysts can be readily controlled simply by tuning the synthesis conditions. The viral-templated Pd nanocatalysts with optimized synthesis conditions are shown to have higher catalytic activity per unit Pd mass than the commercial Pd/C catalysts. Furthermore, tunable and selective surface assembly of TMV biotemplates is exploited to control the loading density and location of Pd nanocatalysts on solid substrates via preferential electroless deposition. In addition, the catalytic activities of surface-assembled TMV-templated Pd nanocatalysts were also investigated for the ligand-free Suzuki Coupling reaction under mild reaction conditions. The chip-based format enables simple catalyst separation and

  4. Rabies Virus Infection Induces the Formation of Stress Granules Closely Connected to the Viral Factories

    PubMed Central

    Nikolic, Jovan; Civas, Ahmet; Lagaudrière-Gesbert, Cécile; Blondel, Danielle


    Stress granules (SGs) are membrane-less dynamic structures consisting of mRNA and protein aggregates that form rapidly in response to a wide range of environmental cellular stresses and viral infections. They act as storage sites for translationally silenced mRNAs under stress conditions. During viral infection, SG formation results in the modulation of innate antiviral immune responses, and several viruses have the ability to either promote or prevent SG assembly. Here, we show that rabies virus (RABV) induces SG formation in infected cells, as revealed by the detection of SG-marker proteins Ras GTPase-activating protein-binding protein 1 (G3BP1), T-cell intracellular antigen 1 (TIA-1) and poly(A)-binding protein (PABP) in the RNA granules formed during viral infection. As shown by live cell imaging, RABV-induced SGs are highly dynamic structures that increase in number, grow in size by fusion events, and undergo assembly/disassembly cycles. Some SGs localize in close proximity to cytoplasmic viral factories, known as Negri bodies (NBs). Three dimensional reconstructions reveal that both structures remain distinct even when they are in close contact. In addition, viral mRNAs synthesized in NBs accumulate in the SGs during viral infection, revealing material exchange between both compartments. Although RABV-induced SG formation is not affected in MEFs lacking TIA-1, TIA-1 depletion promotes viral translation which results in an increase of viral replication indicating that TIA-1 has an antiviral effect. Inhibition of PKR expression significantly prevents RABV-SG formation and favors viral replication by increasing viral translation. This is correlated with a drastic inhibition of IFN-B gene expression indicating that SGs likely mediate an antiviral response which is however not sufficient to fully counteract RABV infection. PMID:27749929

  5. Identification of a Novel Viral Protein Expressed from the PB2 Segment of Influenza A Virus

    PubMed Central

    Watanabe, Mariko; Goto, Hideo


    ABSTRACT Over the past 2 decades, several novel influenza virus proteins have been identified that modulate viral infections in vitro and/or in vivo. The PB2 segment, which is one of the longest influenza A virus segments, is known to encode only one viral protein, PB2. In the present study, we used reverse transcription-PCR (RT-PCR) targeting viral mRNAs transcribed from the PB2 segment to look for novel viral proteins encoded by spliced mRNAs. We identified a new viral protein, PB2-S1, encoded by a novel spliced mRNA in which the region corresponding to nucleotides 1513 to 1894 of the PB2 mRNA is deleted. PB2-S1 was detected in virus-infected cells and in cells transfected with a protein expression plasmid encoding PB2. PB2-S1 localized to mitochondria, inhibited the RIG-I-dependent interferon signaling pathway, and interfered with viral polymerase activity (dependent on its PB1-binding capability). The nucleotide sequences around the splicing donor and acceptor sites for PB2-S1 were highly conserved among pre-2009 human H1N1 viruses but not among human H1N1pdm and H3N2 viruses. PB2-S1-deficient viruses, however, showed growth kinetics in MDCK cells and virulence in mice similar to those of wild-type virus. The biological significance of PB2-S1 to the replication and pathogenicity of seasonal H1N1 influenza A viruses warrants further investigation. IMPORTANCE Transcriptome analysis of cells infected with influenza A virus has improved our understanding of the host response to viral infection, because such analysis yields considerable information about both in vitro and in vivo viral infections. However, little attention has been paid to transcriptomes derived from the viral genome. Here we focused on the splicing of mRNA expressed from the PB2 segment and identified a spliced viral mRNA encoding a novel viral protein. This result suggests that other, as yet unidentified viral proteins encoded by spliced mRNAs could be expressed in virus-infected cells. A viral

  6. Reverse transcriptase directs viral evolution in a deep ocean methane seep

    NASA Astrophysics Data System (ADS)

    Paul, B. G.; Bagby, S. C.


    Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.

  7. Viral vector-based tools advance knowledge of basal ganglia anatomy and physiology

    PubMed Central

    Sizemore, Rachel J.; Seeger-Armbruster, Sonja; Hughes, Stephanie M.


    Viral vectors were originally developed to deliver genes into host cells for therapeutic potential. However, viral vector use in neuroscience research has increased because they enhance interpretation of the anatomy and physiology of brain circuits compared with conventional tract tracing or electrical stimulation techniques. Viral vectors enable neuronal or glial subpopulations to be labeled or stimulated, which can be spatially restricted to a single target nucleus or pathway. Here we review the use of viral vectors to examine the structure and function of motor and limbic basal ganglia (BG) networks in normal and pathological states. We outline the use of viral vectors, particularly lentivirus and adeno-associated virus, in circuit tracing, optogenetic stimulation, and designer drug stimulation experiments. Key studies that have used viral vectors to trace and image pathways and connectivity at gross or ultrastructural levels are reviewed. We explain how optogenetic stimulation and designer drugs used to modulate a distinct pathway and neuronal subpopulation have enhanced our mechanistic understanding of BG function in health and pathophysiology in disease. Finally, we outline how viral vector technology may be applied to neurological and psychiatric conditions to offer new treatments with enhanced outcomes for patients. PMID:26888111

  8. Estimating viral titres in solutions with low viral loads.


    Brownie, C; Statt, J; Bauman, P; Buczynski, G; Skjolaas, K; Lee, D; Hotta, J; Roth, N J


    An important consideration in the manufacture of products derived from animal or human sources is the virus reduction capacity of the manufacturing process as estimated using validated bench-scale models of relevant manufacturing steps. In these studies, manufacturing process intermediates are spiked with virus and processed using the bench-scale model and the resulting viral titres of input and output samples are typically determined using cell-based infectivity assays. In these assays, the Spearman-Kärber (SK) method is commonly used to estimate titres when there is one or more positive observation (i.e., the presence of any viral cytopathic effect). The SK method is most accurate when the proportion of positive observations ranges from <0.1 to >0.9 across dilutions but can be biased otherwise. Maximum likelihood (ML) based on a single-hit Poisson model is an alternative widely used estimation method. We compared SK with ML and found the methods to have similar properties except for situations in which the concentration of virus is low but measurable. In this case, the SK method produces upwardly biased estimates of titres. Based on our results, we recommend the use of either ML or SK at most virus concentrations; however, at low virus concentrations ML is preferred. Copyright © 2011 The International Alliance for Biologicals. Published by Elsevier Ltd. All rights reserved.

  9. RNA silencing and plant viral diseases.


    Wang, Ming-Bo; Masuta, Chikara; Smith, Neil A; Shimura, Hanako


    RNA silencing plays a critical role in plant resistance against viruses, with multiple silencing factors participating in antiviral defense. Both RNA and DNA viruses are targeted by the small RNA-directed RNA degradation pathway, with DNA viruses being also targeted by RNA-directed DNA methylation. To evade RNA silencing, plant viruses have evolved a variety of counter-defense mechanisms such as expressing RNA-silencing suppressors or adopting silencing-resistant RNA structures. This constant defense-counter defense arms race is likely to have played a major role in defining viral host specificity and in shaping viral and possibly host genomes. Recent studies have provided evidence that RNA silencing also plays a direct role in viral disease induction in plants, with viral RNA-silencing suppressors and viral siRNAs as potentially the dominant players in viral pathogenicity. However, questions remain as to whether RNA silencing is the principal mediator of viral pathogenicity or if other RNA-silencing-independent mechanisms also account for viral disease induction. RNA silencing has been exploited as a powerful tool for engineering virus resistance in plants as well as in animals. Further understanding of the role of RNA silencing in plant-virus interactions and viral symptom induction is likely to result in novel anti-viral strategies in both plants and animals.

  10. Long noncoding RNAs in viral infections

    PubMed Central

    Fortes, Puri; Morris, Kevin


    Viral infections induce strong modifications in the cell transcriptome. Among the RNAs whose expression is altered by infection are long noncoding RNAs (lncRNAs). LncRNAs are transcripts with potential to function as RNA molecules. Infected cells may express viral lncRNAs, cellular lncRNAs and chimeric lncRNAs formed by viral and cellular sequences. Some viruses express viral lncRNAs whose function is essential for viral viability. They are transcribed by polymerase II or III and some of them can be processed by unique maturation steps performed by host cell machineries. Some viral lncRNAs control transcription, stability or translation of cellular and viral genes. Surprisingly, similar functions can be exerted by cellular lncRNAs induced by infection. Expression of cellular lncRNAs may be altered in response to viral replication or viral protein expression. However, many cellular lncRNAs respond to the antiviral pathways induced by infection. In fact, many lncRNAs function as positive or negative regulators of the innate antiviral response. Our current knowledge about the identity and function of lncRNAs in infected cells is very limited. However, research into this field has already helped in the identification of novel cellular pathways and may help in the development of therapeutic tools for the treatment of viral infections, autoimmune diseases, neurological disorders and cancer. PMID:26454188

  11. [Imported viral hepatitis in the Czech Republic].


    Dlhý, J; Benes, C


    Through the analysis of notified viral hepatitis, trends in the occurrence of imported cases in the Czech Republic have been specified, the aim of which was to draw attention to the epidemiologically important aspects of travelling abroad. In the software environment of Epi Info version 6.04d, nationwide databases of communicable diseases over the period of 1993-2005 were analysed. The period was defined with respect to the availability of necessary data in the Epidat information system for communicable disease reporting in the Czech Republic. During the years 1993-2005, 12,091 cases of communicable diseases were imported into the Czech Republic of which viral hepatitis accounted for 5.7 % (685). The rates by diagnosis were as follows: viral hepatitis A 61 %, acute viral hepatitis B 15 %, chronic viral hepatitis C 11 %, viral hepatitis E 5 %, acute viral hepatitis C 3 %, chronic viral hepatitis B 3 % and other cases of viral hepatitis 2 %. The rates by the "imported by" variable: Czech tourists 47.2 %, foreigners 32.8 %, Czech business travellers 20.0 %. The diseases were most commonly imported from the following countries: Ukraine 13 %, Slovakia 8 %, Southern Europe 6 %, Egypt 6 % and Russia 5 %. In the Czech Republic, communicable diseases are reported using the Epidat system. The Epidat database analysis focused on reported cases of imported viral hepatitis represents an important starting point for assessing health risks associated with travelling abroad.

  12. [The ABC of viral hepatitis].


    Van Bambeke, F


    Viral hepatitis has long been under-diagnosed. Hepatitis A is an acute disease, while patients infected by hepatitis B and hepatitis C viruses are likely to develop chronical infections and severe complications (cancer, cirrhosis). The current treatment of hepatitis B and C consists in alpha interferon (preferably under its pegylated form), in combination with ribavirin for hepatitis C. The frequent and severe adverse effects of interferon-based therapy constitute, however, a major limiting factor (reactions at the injection site, flu-like syndrome, neurological disorders, ...). For hepatitis B, two alternatives are available so far, namely lamivudine and adefovir (used as a prodrug with highe oral bioavailability).

  13. Viral diseases of marine invertebrates

    NASA Astrophysics Data System (ADS)

    Johnson, P. T.


    Approximately 40 viruses are known from marine sponges; turbellarian and monogenetic flatworms; cephalopod, bivalve, and gastropod mollusks; nereid polychaetes; and isopod and decapod crustaceans. Most of the viruses can be tentatively assigned to the Herpesviridae, Baculoviridae, Iridoviridae, Adenoviridae, Papovaviridae, Reoviridae, “Birnaviridae”, Bunyaviridae, Rhabdoviridae, and Picornaviridae. Viruslike particles found in oysters might be representatives of the Togaviridae and Retroviridae. Enveloped single-stranded RNA viruses from crustaceans have developmental and morphological characteristics intermediate between families, and some show evidence of relationships to the Paramyxoviridae as well as the Bunyaviridae or Rhabdoviridae. Certain small viruses of shrimp cannot be assigned, even tentatively, to a particular family. Some viruses cause disease in wild and captive hosts, others are associated with disease states but may not be primary instigators, and many occur in apparently normal animals. The frequency of viral disease in natural populations of marine invertebrates is unknown. Several viruses that cause disease in captive animals, with or without experimental intervention, have also been found in diseased wild hosts, including herpeslike viruses of crabs and oysters, iridovirus of octopus, and reolike and bunyalike viruses of crabs. Iridolike viruses have been implicated in massive mortalities of cultured oysters. Baculoviruses, and IHHN virus, which is of uncertain affinities, cause economically damaging diseases in cultured penaeid shrimp. Double or multiple viral infection is common in crabs. For example, a reolike virus and associated rhabdolike virus act synergistically to cause paralytic and fatal disease in Callinectes sapidus. Information on host range, most susceptible stage, and viral latency is available only for viruses of shrimp. One baculovirus attacks five species of New World penaeid shrimp. IHHN virus infects three species of

  14. Modulation techniques

    NASA Technical Reports Server (NTRS)

    Schilling, D. L.


    Bandwidth efficient digital modulation techniques, proposed for use on and/or applied to satellite channels, are reviewed. In a survey of recent works on digital modulation techniques, the performance of several schemes operating in various environments are compared. Topics covered include: (1) quadrature phase shift keying; (2) offset - QPSK and MSK; (3) combined modulation and coding; and (4) spectrally efficient modulation techniques.

  15. The role of protein kinase A regulation of the E6 PDZ-binding domain during the differentiation-dependent life cycle of human papillomavirus type 18.


    Delury, Craig P; Marsh, Elizabeth K; James, Claire D; Boon, Siaw Shi; Banks, Lawrence; Knight, Gillian L; Roberts, Sally


    Human papillomavirus (HPV) E6 proteins of high-risk alpha types target a select group of PSD95/DLG1/ZO1 (PDZ) domain-containing proteins by using a C-terminal PDZ-binding motif (PBM), an interaction that can be negatively regulated by phosphorylation of the E6 PBM by protein kinase A (PKA). Here, we have mutated the canonical PKA recognition motif that partially overlaps with the E6 PBM in the HPV18 genome (E6153PKA) and compared the effect of this mutation on the HPVl8 life cycle in primary keratinocytes with the wild-type genome and with a second mutant genome that lacks the E6 PBM (E6ΔPDZ). Loss of PKA recognition of E6 was associated with increased growth of the genome-containing cells relative to cells carrying the wild-type genome, and upon stratification, a more hyperplastic phenotype, with an increase in the number of S-phase competent cells in the upper suprabasal layers, while the opposite was seen with the E6ΔPDZ genome. Moreover, the growth of wild-type genome-containing cells was sensitive to changes in PKA activity, and these changes were associated with increased phosphorylation of the E6 PBM. In marked contrast to E6ΔPDZ genomes, the E6153PKA mutation exhibited no deleterious effects on viral genome amplification or expression of late proteins. Our data suggest that the E6 PBM function is differentially regulated by phosphorylation in the HPV18 life cycle. We speculate that perturbation of protein kinase signaling pathways could lead to changes in E6 PBM function, which in turn could have a bearing on tumor promotion and progression.

  16. The Role of Protein Kinase A Regulation of the E6 PDZ-Binding Domain during the Differentiation-Dependent Life Cycle of Human Papillomavirus Type 18

    PubMed Central

    Delury, Craig P.; Marsh, Elizabeth K.; James, Claire D.; Boon, Siaw Shi; Banks, Lawrence; Knight, Gillian L.


    Human papillomavirus (HPV) E6 proteins of high-risk alpha types target a select group of PSD95/DLG1/ZO1 (PDZ) domain-containing proteins by using a C-terminal PDZ-binding motif (PBM), an interaction that can be negatively regulated by phosphorylation of the E6 PBM by protein kinase A (PKA). Here, we have mutated the canonical PKA recognition motif that partially overlaps with the E6 PBM in the HPV18 genome (E6153PKA) and compared the effect of this mutation on the HPVl8 life cycle in primary keratinocytes with the wild-type genome and with a second mutant genome that lacks the E6 PBM (E6ΔPDZ). Loss of PKA recognition of E6 was associated with increased growth of the genome-containing cells relative to cells carrying the wild-type genome, and upon stratification, a more hyperplastic phenotype, with an increase in the number of S-phase competent cells in the upper suprabasal layers, while the opposite was seen with the E6ΔPDZ genome. Moreover, the growth of wild-type genome-containing cells was sensitive to changes in PKA activity, and these changes were associated with increased phosphorylation of the E6 PBM. In marked contrast to E6ΔPDZ genomes, the E6153PKA mutation exhibited no deleterious effects on viral genome amplification or expression of late proteins. Our data suggest that the E6 PBM function is differentially regulated by phosphorylation in the HPV18 life cycle. We speculate that perturbation of protein kinase signaling pathways could lead to changes in E6 PBM function, which in turn could have a bearing on tumor promotion and progression. PMID:23804647

  17. Sequencing Needs for Viral Diagnostics

    SciTech Connect

    Gardner, S N; Lam, M; Mulakken, N J; Torres, C L; Smith, J R; Slezak, T


    We built a system to guide decisions regarding the amount of genomic sequencing required to develop diagnostic DNA signatures, which are short sequences that are sufficient to uniquely identify a viral species. We used our existing DNA diagnostic signature prediction pipeline, which selects regions of a target species genome that are conserved among strains of the target (for reliability, to prevent false negatives) and unique relative to other species (for specificity, to avoid false positives). We performed simulations, based on existing sequence data, to assess the number of genome sequences of a target species and of close phylogenetic relatives (''near neighbors'') that are required to predict diagnostic signature regions that are conserved among strains of the target species and unique relative to other bacterial and viral species. For DNA viruses such as variola (smallpox), three target genomes provide sufficient guidance for selecting species-wide signatures. Three near neighbor genomes are critical for species specificity. In contrast, most RNA viruses require four target genomes and no near neighbor genomes, since lack of conservation among strains is more limiting than uniqueness. SARS and Ebola Zaire are exceptional, as additional target genomes currently do not improve predictions, but near neighbor sequences are urgently needed. Our results also indicate that double stranded DNA viruses are more conserved among strains than are RNA viruses, since in most cases there was at least one conserved signature candidate for the DNA viruses and zero conserved signature candidates for the RNA viruses.

  18. Controlling viral outbreaks: Quantitative strategies

    PubMed Central


    Preparing for and responding to outbreaks of serious livestock infectious diseases are critical measures to safeguard animal health, public health, and food supply. Almost all of the current control strategies are empirical, and mass culling or “stamping out” is frequently the principal strategy for controlling epidemics. However, there are ethical, ecological, and economic reasons to consider less drastic control strategies. Here we use modeling to quantitatively study the efficacy of different control measures for viral outbreaks, where the infectiousness, transmissibility and death rate of animals commonly depends on their viral load. We develop a broad theoretical framework for exploring and understanding this heterogeneity. The model includes both direct transmission from infectious animals and indirect transmission from an environmental reservoir. We then incorporate a large variety of control measures, including vaccination, antivirals, isolation, environmental disinfection, and several forms of culling, which may result in fewer culled animals. We provide explicit formulae for the basic reproduction number, R0, for each intervention and for combinations. We evaluate the control methods for a realistic simulated outbreak of low pathogenic avian influenza on a mid-sized turkey farm. In this simulated outbreak, culling results in more total dead birds and dramatically more when culling all of the infected birds. PMID:28187137

  19. Population Dynamics of Viral Inactivation

    NASA Astrophysics Data System (ADS)

    Freeman, Krista; Li, Dong; Behrens, Manja; Streletzky, Kiril; Olsson, Ulf; Evilevitch, Alex

    We have investigated the population dynamics of viral inactivation in vitrousing time-resolved cryo electron microscopy combined with light and X-ray scattering techniques. Using bacteriophage λ as a model system for pressurized double-stranded DNA viruses, we found that virions incubated with their cell receptor eject their genome in a stochastic triggering process. The triggering of DNA ejection occurs in a non synchronized manner after the receptor addition, resulting in an exponential decay of the number of genome-filled viruses with time. We have explored the characteristic time constant of this triggering process at different temperatures, salt conditions, and packaged genome lengths. Furthermore, using the temperature dependence we determined an activation energy for DNA ejections. The dependences of the time constant and activation energy on internal DNA pressure, affected by salt conditions and encapsidated genome length, suggest that the triggering process is directly dependent on the conformational state of the encapsidated DNA. The results of this work provide insight into how the in vivo kinetics of the spread of viral infection are influenced by intra- and extra cellular environmental conditions. This material is based upon work supported by the National Science Foundation Graduate Research Fellowship under Grant No. DGE-1252522.

  20. Commercialization of veterinary viral vaccines.


    Flore, P H


    If vaccines are to reliably prevent disease, they must be developed, produced and quality-controlled according to very strict regulations and procedures. Veterinary viral vaccine registrations are governed by different rules in different countries, but these rules all emphasize that the quality of the raw materials--the cells, eggs, animals or plants that are used in production--need to be carefully controlled. The veterinary vaccine business is also very cost-conscious. Emphasis over the last 5-10 years has therefore been to develop culture systems that minimize labor and sterility problems and thus provide for reliable and cost-effective production. Implementing these often more complex systems in a production environment takes considerable effort, first in scale-up trials and further down the line in convincing production personnel to change their familiar system for something new and possibly untried. To complete scale-up trials successfully, it is absolutely necessary to understand the biochemistry of the cells and the influence of the virus on the cells under scale-up and later production conditions. Once a viral product can be produced on a large scale, it is imperative that the quality of the end-product is controlled in an intelligent way. One needs to know whether the end-product performs in the animal as was intended during its conception in the research and development department. The development of the appropriate tests to demonstrate this plays an important role in the successful development of a vaccine.

  1. Viral hepatitis and liver cancer

    PubMed Central

    Ringehan, Marc


    Hepatitis B and C viruses are a global health problem causing acute and chronic infections that can lead to liver cirrhosis and hepatocellular carcinoma (HCC). These infections are the leading cause for HCC worldwide and are associated with significant mortality, accounting for more than 1.3 million deaths per year. Owing to its high incidence and resistance to treatment, liver cancer is the second leading cause of cancer-related death worldwide, with HCC representing approximately 90% of all primary liver cancer cases. The majority of viral-associated HCC cases develop in subjects with liver cirrhosis; however, hepatitis B virus infection can promote HCC development without prior end-stage liver disease. Thus, understanding the role of hepatitis B and C viral infections in HCC development is essential for the future design of treatments and therapies for this cancer. In this review, we summarize the current knowledge on hepatitis B and C virus hepatocarcinogenesis and highlight direct and indirect risk factors. This article is part of the themed issue ‘Human oncogenic viruses’. PMID:28893941

  2. Viral Organization of Human Proteins

    PubMed Central

    Wuchty, Stefan; Siwo, Geoffrey; Ferdig, Michael T.


    Although maps of intracellular interactions are increasingly well characterized, little is known about large-scale maps of host-pathogen protein interactions. The investigation of host-pathogen interactions can reveal features of pathogenesis and provide a foundation for the development of drugs and disease prevention strategies. A compilation of experimentally verified interactions between HIV-1 and human proteins and a set of HIV-dependency factors (HDF) allowed insights into the topology and intricate interplay between viral and host proteins on a large scale. We found that targeted and HDF proteins appear predominantly in rich-clubs, groups of human proteins that are strongly intertwined among each other. These assemblies of proteins may serve as an infection gateway, allowing the virus to take control of the human host by reaching protein pathways and diversified cellular functions in a pronounced and focused way. Particular transcription factors and protein kinases facilitate indirect interactions between HDFs and viral proteins. Discerning the entanglement of directly targeted and indirectly interacting proteins may uncover molecular and functional sites that can provide novel perspectives on the progression of HIV infection and highlight new avenues to fight this virus. PMID:20827298

  3. Viral Infection in Renal Transplant Recipients

    PubMed Central

    Cukuranovic, Jovana; Ugrenovic, Sladjana; Jovanovic, Ivan; Visnjic, Milan; Stefanovic, Vladisav


    Viruses are among the most common causes of opportunistic infection after transplantation. The risk for viral infection is a function of the specific virus encountered, the intensity of immune suppression used to prevent graft rejection, and other host factors governing susceptibility. Although cytomegalovirus is the most common opportunistic pathogen seen in transplant recipients, numerous other viruses have also affected outcomes. In some cases, preventive measures such as pretransplant screening, prophylactic antiviral therapy, or posttransplant viral monitoring may limit the impact of these infections. Recent advances in laboratory monitoring and antiviral therapy have improved outcomes. Studies of viral latency, reactivation, and the cellular effects of viral infection will provide clues for future strategies in prevention and treatment of viral infections. This paper will summarize the major viral infections seen following transplant and discuss strategies for prevention and management of these potential pathogens. PMID:22654630

  4. Membrane dynamics associated with viral infection.


    de Armas-Rillo, Laura; Valera, María-Soledad; Marrero-Hernández, Sara; Valenzuela-Fernández, Agustín


    Viral replication and spreading are fundamental events in the viral life cycle, accounting for the assembly and egression of nascent virions, events that are directly associated with viral pathogenesis in target hosts. These processes occur in cellular compartments that are modified by specialized viral proteins, causing a rearrangement of different cell membranes in infected cells and affecting the ER, mitochondria, Golgi apparatus, vesicles and endosomes, as well as processes such as autophagic membrane flux. In fact, the activation or inhibition of membrane trafficking and other related activities are fundamental to ensure the adequate replication and spreading of certain viruses. In this review, data will be presented that support the key role of membrane dynamics in the viral cycle, especially in terms of the assembly, egression and infection processes. By defining how viruses orchestrate these events it will be possible to understand how they successfully complete their route of infection, establishing viral pathogenesis and provoking disease.

  5. Assessing ubiquitination of viral proteins: Lessons from flavivirus NS5.


    Taylor, R Travis; Best, Sonja M


    Ubiquitin (Ub) conjugation to a substrate protein is a widely used cellular mechanism for control of protein stability and function, modulation of signal transduction pathways and antiviral responses. Identification and characterization of ubiquitinated viral proteins is an important step in understanding novel mechanisms of viral protein regulation as well as elucidating cellular antiviral strategies. Here we describe a protocol to easily detect and characterize the ubiquitination status of a viral substrate protein expressed either during infection or ectopically expressed as a fusion with a biotinylatable epitope tag. This tag provides advantages over current immunoprecipitation techniques by making use of the extremely tight biotin-streptavidin interaction. We provide an example of this protocol using the nonstructural protein 5 (NS5) from Langat virus (LGTV), a member of the tick-borne encephalitis virus (TBEV) serocomplex within the Flavivirus genus. Using the protocols outlined here, we describe some of the pitfalls inherent in determination of Ub linkage and demonstrate that NS5 is modified by at least two distinct ubiquitination types, multiubiquitination and K48-linked polyubiquitin chains.

  6. Assessing ubiquitination of viral proteins: lessons from flavivirus NS5

    PubMed Central

    Taylor, R. Travis; Best, Sonja M.


    Ubiquitin (Ub) conjugation to a substrate protein is a widely used cellular mechanism for control of protein stability and function, modulation of signal transduction pathways and antiviral responses. Identification and characterization of ubiquitinated viral proteins is an important step in understanding novel mechanisms of viral protein regulation as well as elucidating cellular antiviral strategies. Here we describe a protocol to easily detect and characterize the ubiquitination status of a viral substrate protein expressed either during infection or ectopically expressed as a fusion with a biotinylatable epitope tag. This tag provides advantages over current immunoprecipitation techniques by making use of the extremely tight biotin-streptavidin interaction. We provide an example of this protocol using the nonstructural protein 5 (NS5) from Langat virus (LGTV), a member of the tick-borne encephalitis virus (TBEV) serocomplex within the Flavivirus genus. Using the protocols outlined here, we describe some of the pitfalls inherent in determination of Ub linkage and demonstrate that NS5 is modified by at least two distinct ubiquitination types, multiubiquitination and K48-linked polyubiquitin chains. PMID:21855635

  7. Role of CCL5 (RANTES) in viral lung disease.


    Culley, Fiona J; Pennycook, Alasdair M J; Tregoning, John S; Dodd, Jonathan S; Walzl, Gerhard; Wells, Timothy N; Hussell, Tracy; Openshaw, Peter J M


    CCL5/RANTES is a key proinflammatory chemokine produced by virus-infected epithelial cells and present in respiratory secretions of asthmatics. To examine the role of CCL5 in viral lung disease, we measured its production during primary respiratory syncytial virus (RSV) infection and during secondary infection after sensitizing vaccination that induces Th2-mediated eosinophilia. A first peak of CCL5 mRNA and protein production was seen at 18 to 24 h of RSV infection, before significant lymphocyte recruitment occurred. Treatment in vivo with Met-RANTES (a competitive chemokine receptor blocker) throughout primary infection decreased CD4+ and CD8+ cell recruitment and increased viral replication. In RSV-infected, sensitized mice with eosinophilic disease, CCL5 production was further augmented; Met-RANTES treatment again reduced inflammatory cell recruitment and local cytokine production. A second wave of CCL5 production occurred on day 7, attributable to newly recruited T cells. Paradoxically, mice treated with Met-RANTES during primary infection demonstrated increased cellular infiltration during reinfection. We therefore show that RSV induces CCL5 production in the lung and this causes the recruitment of RSV-specific cells, including those making additional CCL5. If this action is blocked with Met-RANTES, inflammation decreases and viral clearance is delayed. However, the exact effects of chemokine modulation depend critically on time of administration, a factor that may potentially complicate the use of chemokine blockers in inflammatory diseases.

  8. Role of the innate immune system in acute viral myocarditis.


    Huang, Chien-Hua; Vallejo, Jesus G; Kollias, George; Mann, Douglas L


    Although the adaptive immune system is thought to play an important role in the pathogenesis of viral myocarditis, the role of the innate immune system has not been well defined. To address this deficiency, we employed a unique line of mice that harbor a genomic "knock in" of a mutated TNF gene lacking the AU rich element (TNF(ARE/ARE)) that is critical for TNF mRNA stability and translation, in order to examine the contribution of the innate immune system in encephalomyocarditis-induced myocarditis (EMCV). Heterozygous mice (TNF(ARE/+)) were infected with 500 plaque-forming units of EMCV. TNF(ARE/+)mice had a significantly higher 14-day mortality and myocardial inflammation when compared to littermate control mice. Virologic studies showed that the viral load at 14 days was significantly lower in the hearts of TNF(ARE/+) mice. TNF(ARE/+) mice had an exaggerated proinflammatory cytokine and chemokine response in the heart following EMCV infection. Modulation of the innate immune response in TNF(ARE/+) mice by the late administration of prednisolone resulted in a significant improvement in survival and decreased cardiac inflammation, whereas early administration of prednisolone resulted in a blunted innate response and increased mortality in littermate control mice. Viewed together, these data suggest that the duration and degree of activation of the innate immune system plays a critical role in determining host outcomes in experimental viral myocarditis.

  9. The Etiology and Pathogenesis of Viral Gastroenteritis.

    DTIC Science & Technology


    OF VIRAL GASTROENTERITIS Annual Progress Report by Neil R. Blacklov, M.D. 31 July, 1984 (For the Period 1983 - 1984) Supported By U.S. ARMY MEDICAL...TITLE (and Subtltle) 5. TYPE OF REPORT & PRIOD COVERED ANNUAl, THE ETIOLOGY AND PATHOGENESIS OF VIRAL ug.,1983-July 31, 1984 GASTROENTERITIS S...KEY WORDS (Continue on reverse side It necesary and Identify by block number) Viral gastroenteritis Diarrhea Epidenic gastroenteritis 20. ABSTRACT

  10. [Workshop on Molecular Epidemiology of Viral Diseases].


    Gómez, B; Cabrera, L; Arias, C F


    A workshop on viral epidemiology was held on September 29, 1995 at the Medical School of the Universidad Nacional Autónoma de Mexico. The aim of this workshop was to promote interaction among scientists working in viral epidemiology. Eighteen scientists from ten institutions presented their experiences and work. General aspects of the epidemiology of meaningful viral diseases in the country were discussed, and lectures presented on the rota, polio, respiratory syncytial, dengue, papiloma, rabies, VIH and hepatitis viruses.

  11. Virion-targeted viral inactivation: new therapy against viral infection.


    Okui, N; Kitamura, Y; Kobayashi, N; Sakuma, R; Ishikawa, T; Kitamura, T


    Acquired immune deficiency syndrome (AIDS) is resistant to all current therapy. Gene therapy is an attractive alternative or additive to current, unsatisfactory AIDS therapy. To develop an antiviral molecule targeting viral integrase (HIV IN), we generated a single-chain antibody, termed scAb, which interacted with human immunodeficiency virus type 1 (HIV-1) IN and inhibited virus replication at the integration step when expressed intracellularly. To reduce infectivity from within the virus particles, we made expression plasmids (pC-scAbE-Vpr, pC-scAbE-CA, and pC-scAbE-WXXF), which expressed the anti-HIV IN scAb fused to the N-terminus of HIV-1-associated accessory protein R (Vpr), capsid protein (CA), and specific binding motif to Vpr (WXXF), respectively. All fusion proteins were tagged with a nine-amino acid peptide derived from influenza virus hemagglutinin (HA) at the C terminus. The fusion molecules, termed scAbE-Vpr, scAbE-CA, and scAbE-WXXF, interacted specifically with HIV IN immobilized on a nitrocellulose membrane. Immunoblot analysis showed that scAbE-Vpr, scAbE-CA, and scAbE-WXXF were incorporated into the virions produced by cotransfection of 293T cells with HIV-1 infectious clone DNA (pLAI) and pC-scAbE-Vpr, pC-scAbE-WXXF. A multinuclear activation galactosidase indicator (MAGI) assay revealed that the virions released from 293T cells cotransfected with pLAI and pC-scAbE-Vpr, pC-scAbE-WXXF had as little 1000-fold of the infectivity of the control wild-type virions, which were produced from the 293T cells transfected with pLAI alone. Furthermore, the virions produced from the 293T cells cotransfected with pLAI and an scAb expression vector (pC-scAb) showed only 1% of the infectivity of the control HIV-1 in a MAGI assay, although scAb was not incorporated into the virions. In either instance, the total quantity of the progeny virions released from the transfected 293T cells and the patterns of the virion proteins were hardly affected by the presence of

  12. Towards optimized methods to study viral impacts on soil microbial carbon cycling

    NASA Astrophysics Data System (ADS)

    Trubl, G. G.; Roux, S.; Jang, H. B.; Solonenko, N.; Sullivan, M. B.; Rich, V. I.


    Permafrost contains 50% of global soil carbon and is rapidly thawing. While the fate of this carbon is currently unknown, it will undoubtedly be shaped by microbes and their associated viruses, which modulate host activities via mortality and metabolic control. However, little is known about soil viruses generally and their impact on terrestrial biogeochemistry; this is partially due to the presence of inhibitory substances (e.g. humic acids) in soils that interfere with sample processing and sequence-based metagenomics surveys. To address this problem, we examined viral populations in three different peat soils along a permafrost thaw gradient. These samples yielded low viral DNA recoveries, and shallow metagenomic sequencing, but still resulted in the recovery of 40 viral genome fragments. Genome- and network-based classification suggested that these new references represented 11 viral clusters, and ecological patterns (based upon non-redundant fragment recruitment) showed that viral populations were distinct in each habitat. Although only 31% of the genes could be functionally classified, pairwise genome comparisons classified 63% of the viruses taxonomically. Additionally, comparison of the 40 viral genome fragments to 53 previously recovered fragments from the same site showed no overlap, suggesting only a small portion of the resident viral community has been sampled. A follow-up experiment was performed to remove more humics during extraction and thereby obtain better viral metagenomes. Three DNA extraction protocols were tested (CTAB, PowerSoil, and Wizard columns) and the DNA was further purified with an AMPure clean-up. The PowerSoil kit maximized DNA yield (3x CTAB and 6x Wizard), and yielded the purest DNA (based on NanoDrop 260:230 ratio). Given the important roles of viruses in biogeochemical cycles in better-studied systems, further research and humic-removal optimization on these thawing permafrost-associated viral communities is needed to clarify

  13. Mosquito defense strategies against viral infection

    PubMed Central

    Cheng, Gong; Liu, Yang; Wang, Penghua; Xiao, Xiaoping


    Mosquito-borne viral diseases are a major concern of global health and result in significant economic losses in many countries. As natural vectors, mosquitoes are very permissive to and allow systemic and persistent arbovirus infection. Intriguingly, persistent viral propagation in mosquito tissues neither results in dramatic pathological sequelae nor impairs the vectorial behavior or lifespan, indicating that mosquitoes have evolved mechanisms to tolerate persistent infection and developed efficient antiviral strategies to restrict viral replication to non-pathogenic levels. Here, we provide an overview of recent progress in understanding mosquito antiviral immunity and advances in the strategies by which mosquitoes control viral infection in specific tissues. PMID:26626596

  14. Iron withholding: a defense against viral infections.


    Weinberg, E D


    A variety of laboratory and clinical investigations during the past 15 years have observed that one of the dangers of excessive iron is its ability to favor animal viral infections. The metal is essential for host cell synthesis of virions and can also impair defense cell function and increase oxidative stress. In both animal models and humans, viral infections cause upregulation of the iron withholding defense system. Factors that suppress the system enhance viral progression; factors that strengthen the system augment host defense. Procedures designed to reinforce the system are being developed and tested; some of these may become useful adjuncts in prevention and management of viral diseases.

  15. FANCD2 Binds Human Papillomavirus Genomes and Associates with a Distinct Set of DNA Repair Proteins to Regulate Viral Replication

    PubMed Central

    Spriggs, Chelsey C.


    ABSTRACT The life cycle of human papillomavirus (HPV) is dependent on the differentiation state of its host cell. HPV genomes are maintained as low-copy episomes in basal epithelial cells and amplified to thousands of copies per cell in differentiated layers. Replication of high-risk HPVs requires the activation of the ataxia telangiectasia-mutated (ATM) and ATM and Rad3-related (ATR) DNA repair pathways. The Fanconi anemia (FA) pathway is a part of the DNA damage response and mediates cross talk between the ATM and ATR pathways. Our studies show that HPV activates the FA pathway, leading to the accumulation of a key regulatory protein, FANCD2, in large nuclear foci. These HPV-dependent foci colocalize with a distinct population of DNA repair proteins, including ATM components γH2AX and BRCA1, but infrequently with p-SMC1, which is required for viral genome amplification in differentiated cells. Furthermore, FANCD2 is found at viral replication foci, where it is preferentially recruited to viral genomes compared to cellular chromosomes and is required for maintenance of HPV episomes in undifferentiated cells. These findings identify FANCD2 as an important regulator of HPV replication and provide insight into the role of the DNA damage response in the differentiation-dependent life cycle of HPV. PMID:28196964

  16. Viral Activation of Cellular Metabolism

    PubMed Central

    Sanchez, Erica L.; Lagunoff, Michael


    To ensure optimal environments for their replication and spread, viruses have evolved to alter many host cell pathways. In the last decade, metabolomic studies have shown that eukaryotic viruses induce large-scale alterations in host cellular metabolism. Most viruses examined to date induce aerobic glycolysis also known as the Warburg effect. Many viruses tested also induce fatty acid synthesis as well as glutaminolysis. These modifications of carbon source utilization by infected cells can increase available energy for virus replication and virion production, provide specific cellular substrates for virus particles and create viral replication niches while increasing infected cell survival. Each virus species also likely requires unique metabolic changes for successful spread and recent research has identified additional virus-specific metabolic changes induced by many virus species. A better understanding of the metabolic alterations required for each virus may lead to novel therapeutic approaches through targeted inhibition of specific cellular metabolic pathways. PMID:25812764

  17. Structure unifies the viral universe.


    Abrescia, Nicola G A; Bamford, Dennis H; Grimes, Jonathan M; Stuart, David I


    Is it possible to meaningfully comprehend the diversity of the viral world? We propose that it is. This is based on the observation that, although there is immense genomic variation, every infective virion is restricted by strict constraints in structure space (i.e., there are a limited number of ways to fold a protein chain, and only a small subset of these have the potential to construct a virion, the hallmark of a virus). We have previously suggested the use of structure for the higher-order classification of viruses, where genomic similarities are no longer observable. Here, we summarize the arguments behind this proposal, describe the current status of structural work, highlighting its power to infer common ancestry, and discuss the limitations and obstacles ahead of us. We also reflect on the future opportunities for a more concerted effort to provide high-throughput methods to facilitate the large-scale sampling of the virosphere.

  18. Viral Ancestors of Antiviral Systems

    PubMed Central

    Villarreal, Luis P.


    All life must survive their corresponding viruses. Thus antiviral systems are essential in all living organisms. Remnants of virus derived information are also found in all life forms but have historically been considered mostly as junk DNA. However, such virus derived information can strongly affect host susceptibility to viruses. In this review, I evaluate the role viruses have had in the origin and evolution of host antiviral systems. From Archaea through bacteria and from simple to complex eukaryotes I trace the viral components that became essential elements of antiviral immunity. I conclude with a reexamination of the ‘Big Bang’ theory for the emergence of the adaptive immune system in vertebrates by horizontal transfer and note how viruses could have and did provide crucial and coordinated features. PMID:22069523

  19. Viral ancestors of antiviral systems.


    Villarreal, Luis P


    All life must survive their corresponding viruses. Thus antiviral systems are essential in all living organisms. Remnants of virus derived information are also found in all life forms but have historically been considered mostly as junk DNA. However, such virus derived information can strongly affect host susceptibility to viruses. In this review, I evaluate the role viruses have had in the origin and evolution of host antiviral systems. From Archaea through bacteria and from simple to complex eukaryotes I trace the viral components that became essential elements of antiviral immunity. I conclude with a reexamination of the 'Big Bang' theory for the emergence of the adaptive immune system in vertebrates by horizontal transfer and note how viruses could have and did provide crucial and coordinated features.

  20. Packing nanomechanics of viral genomes

    NASA Astrophysics Data System (ADS)

    Iber, A. Å.; Dragar, M.; Parsegian, V. A.; Podgornik, R.


    We investigate the osmotic equilibrium between a bulk polyethylene glycol (PEG) solution and DNA tightly packed in a spherical capsid. We base our analysis on the equations of thermodynamic equilibrium in terms of osmotic pressure. The equality between external osmotic pressure of PEG and osmotic pressure of tightly packed DNA gives us the DNA encapsidation curves. In this way we directly connect the wealth of existing osmotic pressure data for DNA in the bulk with the DNA encapsidation curves within small viral capsids. Specific calculations are made for a monovalent salt, Na+ -DNA and a divalent salt, Mn2+ -DNA that have quite different DNA encapsidation behaviors. The main conclusion of our work is that bending energy of DNA is of minor importance regarding the encapsidated DNA length, but has a non-negligible influence on the density distribution of DNA within the capsid.

  1. [Microbiological diagnosis of viral hepatitis].


    Alonso, Roberto; Aguilera, Antonio; Córdoba, Juan; Fuertes, Antonio


    Liver inflammation or hepatitis has many different causes, both infectious and non-infectious. Among the former, viral infection is responsible for at least half of all hepatitis worldwide. Different viruses have been described with primary tropism for liver tissue. These microorganisms have been successively named with letters of the alphabet: A, B, C, D, E and G. The aim of this paper is to review this heterogeneous group of viruses in its most basic aspects, including clinical implications, treatment, main control, and prophylactic measures and, of special interest, diagnostic approaches, both serological and molecular, which are used for their detection, quantification and characterization. Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  2. Viral haemorrhagic fever in children.


    MacDermott, Nathalie E; De, Surjo; Herberg, Jethro A


    Viral haemorrhagic fevers (VHFs) are currently at the forefront of the world's attention due to the recent Zaire ebola virus epidemic in West Africa. This epidemic has highlighted the frailty of the world's public health response mechanisms and demonstrated the potential risks to nations around the world of imported cases of epidemic diseases. While imported cases in children are less likely, the potential for such a scenario remains. It is therefore essential that paediatricians are aware of and prepared for potential imported cases of tropical diseases, VHFs being of particular importance due to their propensity to cause nosocomial spread. Examining the four families of viruses--Filoviridae, Arenaviridae, Bunyaviridae and Flaviviridae--we describe the different types of VHFs, with emphasis on differentiation from other diseases through detailed history-taking, their presentation and management from a paediatric perspective.

  3. Addressing viral resistance through vaccines

    PubMed Central

    Laughlin, Catherine; Schleif, Amanda; Heilman, Carole A


    Antimicrobial resistance is a serious healthcare concern affecting millions of people around the world. Antiviral resistance has been viewed as a lesser threat than antibiotic resistance, but it is important to consider approaches to address this growing issue. While vaccination is a logical strategy, and has been shown to be successful many times over, next generation viral vaccines with a specific goal of curbing antiviral resistance will need to clear several hurdles including vaccine design, evaluation and implementation. This article suggests that a new model of vaccination may need to be considered: rather than focusing on public health, this model would primarily target sectors of the population who are at high risk for complications from certain infections. PMID:26604979

  4. Actin-binding Protein Drebrin Regulates HIV-1-triggered Actin Polymerization and Viral Infection*

    PubMed Central

    Gordón-Alonso, Mónica; Rocha-Perugini, Vera; Álvarez, Susana; Ursa, Ángeles; Izquierdo-Useros, Nuria; Martinez-Picado, Javier; Muñoz-Fernández, María A.; Sánchez-Madrid, Francisco


    HIV-1 contact with target cells triggers F-actin rearrangements that are essential for several steps of the viral cycle. Successful HIV entry into CD4+ T cells requires actin reorganization induced by the interaction of the cellular receptor/co-receptor complex CD4/CXCR4 with the viral envelope complex gp120/gp41 (Env). In this report, we analyze the role of the actin modulator drebrin in HIV-1 viral infection and cell to cell fusion. We show that drebrin associates with CXCR4 before and during HIV infection. Drebrin is actively recruited toward cell-virus and Env-driven cell to cell contacts. After viral internalization, drebrin clustering is retained in a fraction of the internalized particles. Through a combination of RNAi-based inhibition of endogenous drebrin and GFP-tagged expression of wild-type and mutant forms, we establish drebrin as a negative regulator of HIV entry and HIV-mediated cell fusion. Down-regulation of drebrin expression promotes HIV-1 entry, decreases F-actin polymerization, and enhances profilin local accumulation in response to HIV-1. These data underscore the negative role of drebrin in HIV infection by modulating viral entry, mainly through the control of actin cytoskeleton polymerization in response to HIV-1. PMID:23926103

  5. DNA methyltransferase DNMT3A associates with viral proteins and impacts HSV-1 infection.


    Rowles, Daniell L; Tsai, Yuan-Chin; Greco, Todd M; Lin, Aaron E; Li, Minghao; Yeh, Justin; Cristea, Ileana M


    Viral infections can alter the cellular epigenetic landscape, through modulation of either DNA methylation profiles or chromatin remodeling enzymes and histone modifications. These changes can act to promote viral replication or host defense. Herpes simplex virus type 1 (HSV-1) is a prominent human pathogen, which relies on interactions with host factors for efficient replication and spread. Nevertheless, the knowledge regarding its modulation of epigenetic factors remains limited. Here, we used fluorescently-labeled viruses in conjunction with immunoaffinity purification and MS to study virus-virus and virus-host protein interactions during HSV-1 infection in primary human fibroblasts. We identified interactions among viral capsid and tegument proteins, detecting phosphorylation of the capsid protein VP26 at sites within its UL37-binding domain, and an acetylation within the major capsid protein VP5. Interestingly, we found a nuclear association between viral capsid proteins and the de novo DNA methyltransferase DNA (cytosine-5)-methyltransferase 3A (DNMT3A), which we confirmed by reciprocal isolations and microscopy. We show that drug-induced inhibition of DNA methyltransferase activity, as well as siRNA- and shRNA-mediated DNMT3A knockdowns trigger reductions in virus titers. Altogether, our results highlight a functional association of viral proteins with the mammalian DNA methyltransferase machinery, pointing to DNMT3A as a host factor required for effective HSV-1 infection.

  6. Poor retention in care one-year after viral suppression: a significant predictor of viral rebound.


    Crawford, Timothy N


    Optimal retention in care should be continuously monitored even after suppression to prevent the risk of viral rebound. The purpose of this study is to assess the association between retention in care and viral rebound 12 months after viral suppression. A retrospective medical chart review study was conducted at an academic clinic in Lexington, KY, to determine an association between retention in care and viral rebound. A total of 658 patients, who were virally suppressed at any time between 2003 and 2009, were followed for 12 months after viral suppression. Retention in care was defined as having at least one clinic visit every three months (visit constancy) and viral rebound was defined as a viral load >400 copies/ml. Of the 658 patients included in the study, 43% were less than optimally retained in care and 26% had a viral rebound 12 months after suppression. In the multivariable logistic regression model, the odds of a viral rebound were much greater for suboptimal (odds ratio [OR]: 2.28; 95% confidence interval [CI]: 1.44-3.63) and poor (OR: 15.1; 95% CI: 6.82-33.41) retainers compared to optimal retainers. The results of the study suggest that retention in HIV care plays a central role in maintaining optimal outcomes such as viral suppression. Interventions that target improvement in retention in care among those who are poorly retained must be set in place in order to reduce the risk of a viral rebound.

  7. Viral DNA-Dependent Induction of Innate Immune Response to Hepatitis B Virus in Immortalized Mouse Hepatocytes

    PubMed Central

    Cui, Xiuji; Clark, Daniel N.; Liu, Kuancheng; Xu, Xiao-Dong; Guo, Ju-Tao


    ABSTRACT Hepatitis B virus (HBV) infects hundreds of millions of people worldwide and causes acute and chronic hepatitis, cirrhosis, and hepatocellular carcinoma. HBV is an enveloped virus with a relaxed circular (RC) DNA genome. In the nuclei of infected human hepatocytes, conversion of RC DNA from the incoming virion or cytoplasmic mature nucleocapsid (NC) to the covalently closed circular (CCC) DNA, which serves as the template for producing all viral transcripts, is essential to establish and sustain viral replication. A prerequisite for CCC DNA formation is the uncoating (disassembly) of NCs to expose their RC DNA content for conversion to CCC DNA. We report here that in an immortalized mouse hepatocyte cell line, AML12HBV10, in which RC DNA exposure is enhanced, the exposed viral DNA could trigger an innate immune response that was able to modulate viral gene expression and replication. When viral gene expression and replication were low, the innate response initially stimulated these processes but subsequently acted to shut off viral gene expression and replication after they reached peak levels. Inhibition of viral DNA synthesis or cellular DNA sensing and innate immune signaling diminished the innate response. These results indicate that HBV DNA, when exposed in the host cell cytoplasm, can function to trigger an innate immune response that, in turn, modulates viral gene expression and replication. IMPORTANCE Chronic infection by hepatitis B virus (HBV) afflicts hundreds of millions worldwide and is sustained by the episomal covalently closed circular (CCC) DNA in the nuclei of infected hepatocytes. Release of viral genomic DNA from cytoplasmic nucleocapsids (NCs) (NC disassembly or uncoating) is a prerequisite for its conversion to CCC DNA, which can also potentially expose the viral DNA to host DNA sensors and trigger an innate immune response. We have found that in an immortalized mouse hepatocyte cell line in which efficient CCC DNA formation was

  8. The V3 Loop of HIV-1 Env Determines Viral Susceptibility to IFITM3 Impairment of Viral Infectivity.


    Wang, Yimeng; Pan, Qinghua; Ding, Shilei; Wang, Zhen; Yu, Jingyou; Finzi, Andrés; Liu, Shan-Lu; Liang, Chen


    Interferon-inducible transmembrane proteins (IFITMs) inhibit a broad spectrum of viruses, including HIV-1. IFITM proteins deter HIV-1 entry when expressed in target cells and also impair HIV-1 infectivity when expressed in virus producer cells. However, little is known about how viruses resist IFITM inhibition. In this study, we have investigated the susceptibilities of different primary isolates of HIV-1 to the inhibition of viral infectivity by IFITMs. Our results demonstrate that the infectivity of different HIV-1 primary isolates, including transmitted founder viruses, is diminished by IFITM3 to various levels, with strain AD8-1 exhibiting strong resistance. Further mutagenesis studies revealed that HIV-1 Env, and the V3 loop sequence in particular, determines the extent of inhibition of viral infectivity by IFITM3. IFITM3-sensitive Env proteins are also more susceptible to neutralization by soluble CD4 or the 17b antibody than are IFITM3-resistant Env proteins. Together, data from our study suggest that the propensity of HIV-1 Env to sample CD4-bound-like conformations modulates viral sensitivity to IFITM3 inhibition.IMPORTANCE Results of our study have revealed the key features of the HIV-1 envelope protein that are associated with viral resistance to the IFITM3 protein. IFITM proteins are important effectors in interferon-mediated antiviral defense. A variety of viruses are inhibited by IFITMs at the virus entry step. Although it is known that envelope proteins of several different viruses resist IFITM inhibition, the detailed mechanisms are not fully understood. Taking advantage of the fact that envelope proteins of different HIV-1 strains exhibit different degrees of resistance to IFITM3 and that these HIV-1 envelope proteins share the same domain structure and similar sequences, we performed mutagenesis studies and determined the key role of the V3 loop in this viral resistance phenotype. We were also able to associate viral resistance to IFITM3

  9. Molecular biology of bovine viral diarrhea virus

    USDA-ARS?s Scientific Manuscript database

    Bovine viral diarrhea viruses (BVDV) are arguably the most important viral pathogen of ruminants worldwide and can cause severe economic loss. Clinical symptoms of the disease caused by BVDV range from subclinical to severe acute hemorrhagic syndrome, with the severity of disease being strain depend...

  10. Computational clustering for viral reference proteomes.


    Chen, Chuming; Huang, Hongzhan; Mazumder, Raja; Natale, Darren A; McGarvey, Peter B; Zhang, Jian; Polson, Shawn W; Wang, Yuqi; Wu, Cathy H


    The enormous number of redundant sequenced genomes has hindered efforts to analyze and functionally annotate proteins. As the taxonomy of viruses is not uniformly defined, viral proteomes pose special challenges in this regard. Grouping viruses based on the similarity of their proteins at proteome scale can normalize against potential taxonomic nomenclature anomalies. We present Viral Reference Proteomes (Viral RPs), which are computed from complete virus proteomes within UniProtKB. Viral RPs based on 95, 75, 55, 35 and 15% co-membership in proteome similarity based clusters are provided. Comparison of our computational Viral RPs with UniProt's curator-selected Reference Proteomes indicates that the two sets are consistent and complementary. Furthermore, each Viral RP represents a cluster of virus proteomes that was consistent with virus or host taxonomy. We provide BLASTP search and FTP download of Viral RP protein sequences, and a browser to facilitate the visualization of Viral RPs. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  11. Viral kinetic modeling: state of the art

    SciTech Connect

    Canini, Laetitia; Perelson, Alan S.


    Viral kinetic modeling has led to increased understanding of the within host dynamics of viral infections and the effects of therapy. Here we review recent developments in the modeling of viral infection kinetics with emphasis on two infectious diseases: hepatitis C and influenza. We review how viral kinetic modeling has evolved from simple models of viral infections treated with a drug or drug cocktail with an assumed constant effectiveness to models that incorporate drug pharmacokinetics and pharmacodynamics, as well as phenomenological models that simply assume drugs have time varying-effectiveness. We also discuss multiscale models that include intracellular events in viral replication, models of drug-resistance, models that include innate and adaptive immune responses and models that incorporate cell-to-cell spread of infection. Overall, viral kinetic modeling has provided new insights into the understanding of the disease progression and the modes of action of several drugs. In conclusion, we expect that viral kinetic modeling will be increasingly used in the coming years to optimize drug regimens in order to improve therapeutic outcomes and treatment tolerability for infectious diseases.

  12. Macrophages and the Viral Dissemination Super Highway

    PubMed Central

    Klepper, Arielle; Branch, Andrea D


    Monocytes and macrophages are key components of the innate immune system yet they are often the victims of attack by infectious agents. This review examines the significance of viral infection of macrophages. The central hypothesis is that macrophage tropism enhances viral dissemination and persistence, but these changes may come at the cost of reduced replication in cells other than macrophages. PMID:26949751

  13. Uncovering viral protein-protein interactions and their role in arenavirus life cycle.


    Loureiro, Maria Eugenia; D'Antuono, Alejandra; Levingston Macleod, Jesica M; López, Nora


    The Arenaviridae family includes widely distributed pathogens that cause severe hemorrhagic fever in humans. Replication and packaging of their single-stranded RNA genome involve RNA recognition by viral proteins and a number of key protein-protein interactions. Viral RNA synthesis is directed by the virus-encoded RNA dependent-RNA polymerase (L protein) and requires viral RNA encapsidation by the Nucleoprotein. In addition to the role that the interaction between L and the Nucleoprotein may have in the replication process, polymerase activity appears to be modulated by the association between L and the small multifunctional Z protein. Z is also a structural component of the virions that plays an essential role in viral morphogenesis. Indeed, interaction of the Z protein with the Nucleoprotein is critical for genome packaging. Furthermore, current evidence suggests that binding between Z and the viral envelope glycoprotein complex is required for virion infectivity, and that Z homo-oligomerization is an essential step for particle assembly and budding. Efforts to understand the molecular basis of arenavirus life cycle have revealed important details on these viral protein-protein interactions that will be reviewed in this article.

  14. Uncovering Viral Protein-Protein Interactions and their Role in Arenavirus Life Cycle

    PubMed Central

    Loureiro, Maria Eugenia; D’Antuono, Alejandra; Levingston Macleod, Jesica M.; López, Nora


    The Arenaviridae family includes widely distributed pathogens that cause severe hemorrhagic fever in humans. Replication and packaging of their single-stranded RNA genome involve RNA recognition by viral proteins and a number of key protein-protein interactions. Viral RNA synthesis is directed by the virus-encoded RNA dependent-RNA polymerase (L protein) and requires viral RNA encapsidation by the Nucleoprotein. In addition to the role that the interaction between L and the Nucleoprotein may have in the replication process, polymerase activity appears to be modulated by the association between L and the small multifunctional Z protein. Z is also a structural component of the virions that plays an essential role in viral morphogenesis. Indeed, interaction of the Z protein with the Nucleoprotein is critical for genome packaging. Furthermore, current evidence suggests that binding between Z and the viral envelope glycoprotein complex is required for virion infectivity, and that Z homo-oligomerization is an essential step for particle assembly and budding. Efforts to understand the molecular basis of arenavirus life cycle have revealed important details on these viral protein-protein interactions that will be reviewed in this article. PMID:23170177

  15. Viral Vector Biosafety in Laboratory Animal Research.


    Collins, Dalis E; Reuter, Jon D; Rush, Howard G; Villano, Jason S


    Viral vector research presents unique occupational health and safety challenges to institutions due to the rapid development of both in vivo and in vitro gene-editing technologies. Risks to human and animal health make it incumbent on institutions to appropriately evaluate viral vector usage in research on the basis of available information and governmental regulations and guidelines. Here we review the factors related to risk assessment regarding viral vector usage in animals and the relevant regulatory documents associated with this research, and we highlight the most commonly used viral vectors in research today. This review is particularly focused on the background, use in research and associated health and environmental risks related to adenoviral, adeno-associated viral, lentiviral, and herpesviral vectors.

  16. Betanodavirus: Dissection of the viral life cycle.


    Low, C-F; Syarul Nataqain, B; Chee, H-Y; Rozaini, M Z H; Najiah, M


    Progressive research has been recently made in dissecting the molecular biology of Betanodavirus life cycle, the causative pathogen of viral encephalopathy and retinopathy in economic important marine fish species. Establishment of betanodavirus infectious clone allows the manipulation of virus genome for functional genomic study, which elucidates the biological event of the viral life cycle at molecular level. The betanodavirus strategizes its replication by expressing anti-apoptosis/antinecrotic proteins to maintain the cell viability during early infection. Subsequently utilizes and controls the biological machinery of the infected cells for viral genome replication. Towards the late phase of infection, mass production of capsid protein for virion assembly induces the activation of host apoptosis pathway. It eventually leads to the cell lysis and death, which the lysis of cell contributes to the accomplishment of viral shedding that completes a viral life cycle. The recent efforts to dissect the entire betanodavirus life cycle are currently reviewed. © 2017 John Wiley & Sons Ltd.

  17. Origins and challenges of viral dark matter.


    Krishnamurthy, Siddharth R; Wang, David


    The accurate classification of viral dark matter - metagenomic sequences that originate from viruses but do not align to any reference virus sequences - is one of the major obstacles in comprehensively defining the virome. Depending on the sample, viral dark matter can make up from anywhere between 40 and 90% of sequences. This review focuses on the specific nature of dark matter as it relates to viral sequences. We identify three factors that contribute to the existence of viral dark matter: the divergence and length of virus sequences, the limitations of alignment based classification, and limited representation of viruses in reference sequence databases. We then discuss current methods that have been developed to at least partially circumvent these limitations and thereby reduce the extent of viral dark matter. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Non-random patterns in viral diversity

    PubMed Central

    Anthony, Simon J.; Islam, Ariful; Johnson, Christine; Navarrete-Macias, Isamara; Liang, Eliza; Jain, Komal; Hitchens, Peta L.; Che, Xiaoyu; Soloyvov, Alexander; Hicks, Allison L.; Ojeda-Flores, Rafael; Zambrana-Torrelio, Carlos; Ulrich, Werner; Rostal, Melinda K.; Petrosov, Alexandra; Garcia, Joel; Haider, Najmul; Wolfe, Nathan; Goldstein, Tracey; Morse, Stephen S.; Rahman, Mahmudur; Epstein, Jonathan H.; Mazet, Jonna K.; Daszak, Peter; Lipkin, W. Ian


    It is currently unclear whether changes in viral communities will ever be predictable. Here we investigate whether viral communities in wildlife are inherently structured (inferring predictability) by looking at whether communities are assembled through deterministic (often predictable) or stochastic (not predictable) processes. We sample macaque faeces across nine sites in Bangladesh and use consensus PCR and sequencing to discover 184 viruses from 14 viral families. We then use network modelling and statistical null-hypothesis testing to show the presence of non-random deterministic patterns at different scales, between sites and within individuals. We show that the effects of determinism are not absolute however, as stochastic patterns are also observed. In showing that determinism is an important process in viral community assembly we conclude that it should be possible to forecast changes to some portion of a viral community, however there will always be some portion for which prediction will be unlikely. PMID:26391192

  19. Ethical Considerations in Research Participation Virality.


    Ellis-Barton, Carol


    This article seeks to commence and encourage discussion around the upcoming ethical challenges of virality in network structures. When the call for participation in a research project on lupus in Ireland went from an advertisement in a newsletter to a meme (unit of transmissible information) on a closed Facebook page, the ethical considerations of virality were raised. The article analyzes the Association of Internet Researchers guidelines, Facebook policies, and the context of privacy in relation to virality. Virality creates the leverage for methodological pluralism. The nature of the inquiry can determine the method rather than the other way around. Viral ethical considerations are evolving due to the cyber world becoming the primary meme of communication, with flexibility in the researcher's protocol providing opportunities for efficient, cost-effective, and diverse recruitment.

  20. Non-random patterns in viral diversity.


    Anthony, Simon J; Islam, Ariful; Johnson, Christine; Navarrete-Macias, Isamara; Liang, Eliza; Jain, Komal; Hitchens, Peta L; Che, Xiaoyu; Soloyvov, Alexander; Hicks, Allison L; Ojeda-Flores, Rafael; Zambrana-Torrelio, Carlos; Ulrich, Werner; Rostal, Melinda K; Petrosov, Alexandra; Garcia, Joel; Haider, Najmul; Wolfe, Nathan; Goldstein, Tracey; Morse, Stephen S; Rahman, Mahmudur; Epstein, Jonathan H; Mazet, Jonna K; Daszak, Peter; Lipkin, W Ian


    It is currently unclear whether changes in viral communities will ever be predictable. Here we investigate whether viral communities in wildlife are inherently structured (inferring predictability) by looking at whether communities are assembled through deterministic (often predictable) or stochastic (not predictable) processes. We sample macaque faeces across nine sites in Bangladesh and use consensus PCR and sequencing to discover 184 viruses from 14 viral families. We then use network modelling and statistical null-hypothesis testing to show the presence of non-random deterministic patterns at different scales, between sites and within individuals. We show that the effects of determinism are not absolute however, as stochastic patterns are also observed. In showing that determinism is an important process in viral community assembly we conclude that it should be possible to forecast changes to some portion of a viral community, however there will always be some portion for which prediction will be unlikely.

  1. HTLV-1 Rex is required for viral spread and persistence in vivo but is dispensable for cellular immortalization in vitro.


    Ye, Jianxin; Silverman, Lee; Lairmore, Michael D; Green, Patrick L


    Human T-cell leukemia virus type 1 (HTLV-1) is associated with leukemia/lymphoma and neurologic disorders. Although the viral transcriptional activator Tax is the critical viral oncoprotein, Rex, which regulates the expression of the viral structural and enzymatic genes, is essential for efficient viral replication. Herein, we investigate the contribution of Rex in HTLV-1 immortalization of primary T cells in vitro and viral survival in an infectious rabbit animal model. A Rex-deficient HTLV-1 (HTLVRex-) was constructed and characterized for viral gene expression, protein production, and immortalization capacity. Cells transiently transfected with the HTLVRex- proviral clone produced low detectable levels of p19 Gag. 729HTLVRex- stable transfectants produced functional Tax, but undetectable levels of Rex or p19 Gag. Coculture of irradiated 729HTLVRex- cells with peripheral blood mononuclear cells (PBMCs) resulted in sustained interleukin-2 (IL-2)-dependent growth of primary T lymphocytes. These cells carried the HTLVRex- genome and expressed tax/rex mRNA but produced no detectable Rex or p19 Gag. Rabbits inoculated with irradiated 729HTLVRex- cells or 729HTLVRex- cells transiently transfected with a Rex cDNA expression plasmid failed to become persistently infected or mount a detectable antibody response to the viral gene products. Together, our results provide the first direct evidence that Rex and its function to modulate viral gene expression and virion production is not required for in vitro immortalization by HTLV-1. However, Rex is critical for efficient infection of cells and persistence in vivo.

  2. [Viral hepatitis of enteric origin].


    Debord, T; Buisson, Y


    Hepatitis viruses of oral-fecal origin are responsible for a high morbidity and mortality throughout the world, even if they never result in chronic hepatitis. Two viruses, the virus of hepatitis A (VHA) and of hepatitis E (VHE) are at present the cause of severe viral hepatitis of enteric origin. Water is the principle vector in the spread of these viruses. However, the epidemiological aspects vary according to the pathogenic agent. VHA is excreted in a highly concentrated form in the feces for a relatively short period of time. Since it resists in an exterior environment, the virus remains infectious for a long time. VHE is excreted for a short period of time and in low concentrations. The viral particles are fragile in vitro and their variability in the environment is little known. The possible reservoir role of certain animals has been envisaged. Epidemics arise especially in countries suffering from poor hygiene and massive water pollution. Hepatitis A should no longer be considered a benign disease of childhood. The progress made in hygiene and economic development in industrialized countries have made contacts with this virus scarce, rendering the populations more receptive to it and epidemics more widespread. When the sickness occurs later in life, infection is more often symptomatic and can be serious, resulting sometimes long-term indisposition. Hepatitis E has a vast distribution throughout the world and manifests itself either in epidemic or endemic-sporadic form in many poor countries. In developed countries, it comes about mostly as a result of imported pathology, even if there exists a "substratum" of infection in these areas. The main clinical aspects, such as we were able to study them in 39 cases of military men from Tchad, Guyana and Somalia, are comparable to those of hepatitis A. The reasons for the particular gravity of symptoms in pregnant women are unknown. These affections have no specific treatment. In the field of prevention, vaccination

  3. Module Configuration


    Oweis, Salah; D'Ussel, Louis; Chagnon, Guy; Zuhowski, Michael; Sack, Tim; Laucournet, Gaullume; Jackson, Edward J.


    A stand alone battery module including: (a) a mechanical configuration; (b) a thermal management configuration; (c) an electrical connection configuration; and (d) an electronics configuration. Such a module is fully interchangeable in a battery pack assembly, mechanically, from the thermal management point of view, and electrically. With the same hardware, the module can accommodate different cell sizes and, therefore, can easily have different capacities. The module structure is designed to accommodate the electronics monitoring, protection, and printed wiring assembly boards (PWAs), as well as to allow airflow through the module. A plurality of modules may easily be connected together to form a battery pack. The parts of the module are designed to facilitate their manufacture and assembly.


    PubMed Central

    Old, Lloyd J.; Stockert, Elisabeth; Boyse, Edward A.; Kim, Jae Ho


    Antigenic modulation (the loss of TL antigens from TL+ cells exposed to TL antibody in the absence of lytic complement) has been demonstrated in vitro. An ascites leukemia, phenotype TL.1,2,3, which modulates rapidly and completely when incubated with TL antiserum in vitro, was selected for further study of the phenomenon. Over a wide range of TL antibody concentrations modulation at 37°C was detectable within 10 min and was complete within approximately 1 hr. The cells were initially sensitized to C' by their contact with antibody, thereafter losing this sensitivity to C' lysis together with their sensitivity to TL antibody and C' in the cytotoxic test. The capacity of the cells to undergo modulation was abolished by actinomycin D and by iodoacetamide, and by reducing the temperature of incubation to 0°C. Thus modulation apparently is an active cellular process. Antigens TL. 1,2, and 3 are all modulated by anti-TL.1,3 serum and by anti-TL.3 serum. This modulation affects all three TL components together, even when antibody to one or two of them is lacking. aAnti-TL.2 serum does not induce modulation and in fact impairs modulation by the other TL antibodies. The influence of the TL phenotype of cells upon the demonstrable content of H-2 (D region) isoantigen, first shown in cells modulated in vivo, has been observed with cells modulated in vitro. Cells undergoing modulation show a progressive increase in H-2 (D region) antigen over a period of 4 hr, with no change in H-2 antigens of the K region. Restoration of the TL+ phenotype of modulated cells after removal of antibody is less rapid than TL+ → TL- modulation and may require several cell divisions. PMID:5636556

  5. Ebola viral disease and pregnancy

    PubMed Central

    Caluwaerts, Séverine; Achar, Jay


    Ebola viral disease’s interaction with pregnancy is poorly understood and remains a particular challenge for medical and para-medical personnel responding to an outbreak. This review article is written with the benefit of hindsight and experience from the largest recorded Ebola outbreak in history. We have provided a broad overview of the issues that arise for pregnant women and for the professionals treating them during an Ebola outbreak. The discussion focuses on the specifics of Ebola infection in pregnancy and possible management strategies, including the delivery of an infected woman. We have also discussed the wider challenges posed to pregnant women and their carers during an epidemic, including the identification of suspected Ebola-infected pregnant women and the impact of the disease on pre-existing health services. This paper outlines current practices in the field, as well as highlighting the gaps in our knowledge and the paramount need to protect the health-care workers directly involved in the management of pregnant women. PMID:26457118

  6. [Treatment of viral hepatitis C].


    Chassany, O


    Viral hepatitis C is a serious public health problem in France by the number of infected patients, the evolutive profile and by the lack of fully efficient therapeutics. However, the risk of developing cirrhosis and hepatocellular carcinoma may not be so high as it has been stated until now. Interferon alpha is at the present time, the only approved drug for the treatment of chronic hepatitis C. Its efficiency on criteria such as normalization of aminotransferases values or negativation of viremia is obtained in less than 25% of patients. The present recommendation is to use 3 MU of interferon alpha, 3 times per week during 12 months. While interferon leads to improvement of histologic lesions, it is not yet proved that a treatment by interferon can reduce, years after, the incidence of cirrhosis and hepatocellular carcinoma. No therapeutic strategy has been defined yet for the frequent situations of "no response", relapses or presence of factors that reduce the efficacy of treatment (high initial viremia level, genotype 1b, cirrhosis). It is possible that the course of patients having low or no elevation of aminotransferases and/or minimal histologic lesions, is good without any treatment. The efficacy of interferon alone appears insufficient. Thus trials in progress concern associations of antiviral drugs such as vidarabine. In lack of vaccine, preventive treatment is essential and depends upon knowledge of conditions of transmission of the virus. Transmission through blood and intravenous drug addiction represent 60 to 70% of cases of hepatitis C.

  7. Immunological techniques in viral hepatitis.


    Rehermann, Barbara; Naoumov, Nikolai V


    The need to quantitate and monitor immune responses of large patient cohorts with standardized techniques is increasing due to the growing range of treatment options for hepatitis B and hepatitis C, the development of combination therapies, and candidate experimental vaccines for HCV. In addition, advances in immunological techniques have provided new tools for detailed phenotypic and functional analysis of cellular immune responses. At present, there is substantial variation in laboratory protocols, reagents, controls and analysis and presentation of results. Standardization of immunological assays would therefore allow better comparison of results amongst individual laboratories and patient cohorts. The EASL-sponsored and AASLD-endorsed Monothematic Conference on Clinical Immunology in Viral Hepatitis was held at the University College London, United Kingdom, Oct 7-8, 2006 to bring together investigators with research experience in clinical immunology of hepatitis B virus (HBV) and hepatitis C virus (HCV) infections for in-depth discussion, critical evaluation and standardization of immunological assays. This report summarizes the information presented and discussed at the conference, but is not intended to represent a consensus statement. Our aim is to highlight topics and issues that were supported by general agreement and those that were controversial, as well as to provide suggestions for future work.

  8. Viral activation of cellular metabolism.


    Sanchez, Erica L; Lagunoff, Michael


    To ensure optimal environments for their replication and spread, viruses have evolved to alter many host cell pathways. In the last decade, metabolomic studies have shown that eukaryotic viruses induce large-scale alterations in host cellular metabolism. Most viruses examined to date induce aerobic glycolysis also known as the Warburg effect. Many viruses tested also induce fatty acid synthesis as well as glutaminolysis. These modifications of carbon source utilization by infected cells can increase available energy for virus replication and virion production, provide specific cellular substrates for virus particles and create viral replication niches while increasing infected cell survival. Each virus species also likely requires unique metabolic changes for successful spread and recent research has identified additional virus-specific metabolic changes induced by many virus species. A better understanding of the metabolic alterations required for the replication of each virus may lead to novel therapeutic approaches through targeted inhibition of specific cellular metabolic pathways. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Viral kinetic modeling: state of the art


    Canini, Laetitia; Perelson, Alan S.


    Viral kinetic modeling has led to increased understanding of the within host dynamics of viral infections and the effects of therapy. Here we review recent developments in the modeling of viral infection kinetics with emphasis on two infectious diseases: hepatitis C and influenza. We review how viral kinetic modeling has evolved from simple models of viral infections treated with a drug or drug cocktail with an assumed constant effectiveness to models that incorporate drug pharmacokinetics and pharmacodynamics, as well as phenomenological models that simply assume drugs have time varying-effectiveness. We also discuss multiscale models that include intracellular events in viralmore » replication, models of drug-resistance, models that include innate and adaptive immune responses and models that incorporate cell-to-cell spread of infection. Overall, viral kinetic modeling has provided new insights into the understanding of the disease progression and the modes of action of several drugs. In conclusion, we expect that viral kinetic modeling will be increasingly used in the coming years to optimize drug regimens in order to improve therapeutic outcomes and treatment tolerability for infectious diseases.« less

  10. Viral vectors for vascular gene therapy

    PubMed Central

    Fischer, Lukas; Preis, Meir; Weisz, Anat; Koren, Belly; Lewis, Basil S; Flugelman, Moshe Y


    Vascular gene therapy is the focus of multiple experimental and clinical research efforts. While several genes with therapeutic potential have been identified, the best method of gene delivery is unknown. Viral vectors have the capacity to transfer genes at high efficiency rates. Several viral-based vectors have been used in experimental vascular gene therapy for in vivo and ex vivo gene transfer. Adenoviral-based vectors are being used for the induction of angiogenesis in phase 1 and 2 clinical trials. In the present review, the characteristics of the ‘ideal’ viral vector are discussed and the major types of viral vectors used in vascular gene transfer are reviewed. Basic knowledge of the use of viral vectors for direct in vivo gene transfer (adenoviral-based vectors, etc) and for ex vivo gene transfer (retroviral-based vectors) is provided. New developments in the field of viral vectorology, such as pseudotyping of retroviral vectors and targeting of other viral vectors to a specific cell type, will enhance the more rapid transition of vascular gene therapy from the experimental arena to the clinical setting. PMID:19649233

  11. A skeptical look at viral immune evasion.


    Davis, I A; Rouse, B T


    In the past several years, many viral gene products have been found to encode proteins which interfere with immune defense mechanisms. Whether these interactions between virus and immune system components are actually evasion mechanisms used during viral infections in their natural hosts remains to be proven. In vitro studies do, however, reveal several tactics which may aid viral replication and dissemination by interfering with components of both the innate and adaptive immune systems. In this manuscript, we discuss the more intensively studied of these putative in vitro evasion tactics and ponder their relevance in in vivo situations.

  12. Vaccines in the Prevention of Viral Pneumonia.


    Fraser, Clementine S; Jha, Akhilesh; Openshaw, Peter J M


    Pneumonia is of great global public health importance. Viral infections play both direct and indirect parts in its cause across the globe. Influenza is a leading cause of viral pneumonia in both children and adults, and respiratory syncytial virus is increasingly recognized as causing disease at both extremes of age. Vaccination offers the best prospect for prevention but current influenza vaccines do not provide universal and durable protection, and require yearly reformulation. In the future, it is hoped that influenza vaccines will give better and universal protection, and that new vaccines can be found for other causes of viral pneumonia. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Some vexations that challenge viral immunology

    PubMed Central

    Rouse, Barry T.; Mueller, Scott N.


    The field of viral immunology seeks to understand mechanisms of virus-host interaction with a view of applying this knowledge to the design of effective vaccines and immunomodulators that control viral infections. This brief review discusses several areas of the field that hold substantial promise for translation, but where further work is critically required to find solutions. We emphasize that our fundamental understanding of virus-host relationships is moving in leaps and bounds, but we lag behind in applying this knowledge to the successful control of many viral infections. PMID:27303640

  14. Viral Evasion of Natural Killer Cell Activation.


    Ma, Yi; Li, Xiaojuan; Kuang, Ersheng


    Natural killer (NK) cells play a key role in antiviral innate defenses because of their abilities to kill infected cells and secrete regulatory cytokines. Additionally, NK cells exhibit adaptive memory-like antigen-specific responses, which represent a novel antiviral NK cell defense mechanism. Viruses have evolved various strategies to evade the recognition and destruction by NK cells through the downregulation of the NK cell activating receptors. Here, we review the recent findings on viral evasion of NK cells via the impairment of NK cell-activating receptors and ligands, which provide new insights on the relationship between NK cells and viral actions during persistent viral infections.

  15. Comparing viral metagenomics methods using a highly multiplexed human viral pathogens reagent

    PubMed Central

    Li, Linlin; Deng, Xutao; Mee, Edward T.; Collot-Teixeira, Sophie; Anderson, Rob; Schepelmann, Silke; Minor, Philip D.; Delwart, Eric


    Unbiased metagenomic sequencing holds significant potential as a diagnostic tool for the simultaneous detection of any previously genetically described viral nucleic acids in clinical samples. Viral genome sequences can also inform on likely phenotypes including drug susceptibility or neutralization serotypes. In this study, different variables of the laboratory methods often used to generate viral metagenomics libraries on the efficiency of viral detection and virus genome coverage were compared. A biological reagent consisting of 25 different human RNA and DNA viral pathogens was used to estimate the effect of filtration and nuclease digestion, DNA/RNA extraction methods, pre-amplification and the use of different library preparation kits on the detection of viral nucleic acids. Filtration and nuclease treatment led to slight decreases in the percentage of viral sequence reads and number of viruses detected. For nucleic acid extractions silica spin columns improved viral sequence recovery relative to magnetic beads and Trizol extraction. Pre-amplification using random RT-PCR while generating more viral sequence reads resulted in detection of fewer viruses, more overlapping sequences, and lower genome coverage. The ScriptSeq library preparation method retrieved more viruses and a greater fraction of their genomes than the TruSeq and Nextera methods. Viral metagenomics sequencing was able to simultaneously detect up to 22 different viruses in the biological reagent analyzed including all those detected by qPCR. Further optimization will be required for the detection of viruses in biologically more complex samples such as tissues, blood, or feces. PMID:25497414

  16. Alpha-Synuclein Expression Restricts RNA Viral Infections in the Brain

    PubMed Central

    Beatman, Erica L.; Massey, Aaron; Shives, Katherine D.; Burrack, Kristina S.; Chamanian, Mastooreh; Morrison, Thomas E.


    ABSTRACT We have discovered that native, neuronal expression of alpha-synuclein (Asyn) inhibits viral infection, injury, and disease in the central nervous system (CNS). Enveloped RNA viruses, such as West Nile virus (WNV), invade the CNS and cause encephalitis, yet little is known about the innate neuron-specific inhibitors of viral infections in the CNS. Following WNV infection of primary neurons, we found that Asyn protein expression is increased. The infectious titer of WNV and Venezuelan equine encephalitis virus (VEEV) TC83 in the brains of Asyn-knockout mice exhibited a mean increase of 104.5 infectious viral particles compared to the titers in wild-type and heterozygote littermates. Asyn-knockout mice also exhibited significantly increased virus-induced mortality compared to Asyn heterozygote or homozygote control mice. Virus-induced Asyn localized to perinuclear, neuronal regions expressing viral envelope protein and the endoplasmic reticulum (ER)-associated trafficking protein Rab1. In Asyn-knockout primary neuronal cultures, the levels of expression of ER signaling pathways, known to support WNV replication, were significantly elevated before and during viral infection compared to those in Asyn-expressing primary neuronal cultures. We propose a model in which virus-induced Asyn localizes to ER-derived membranes, modulates virus-induced ER stress signaling, and inhibits viral replication, growth, and injury in the CNS. These data provide a novel and important functional role for the expression of native alpha-synuclein, a protein that is closely associated with the development of Parkinson's disease. IMPORTANCE Neuroinvasive viruses such as West Nile virus are able to infect neurons and cause severe disease, such as encephalitis, or infection of brain tissue. Following viral infection in the central nervous system, only select neurons are infected, implying that neurons exhibit innate resistance to viral infections. We discovered that native neuronal

  17. Limiting influenza virus, HIV and dengue virus infection by targeting viral proteostasis

    PubMed Central

    Heaton, Nicholas S.; Moshkina, Natasha; Fenouil, Romain; Gardner, Thomas J.; Aguirre, Sebastian; Shah, Priya S.; Zhao, Nan; Manganaro, Lara; Hultquist, Judd; Noel, Justine; Sachs, David; Hamilton, Jennifer; Leon, Paul E.; Chawdury, Amit; Tripathy, Shashank; Melegari, Camilla; Campisi, Laura; Hai, Rong; Metreveli, Giorgi; Gamarnik, Andrea V.; García-Sastre, Adolfo; Greenbaum, Benjamin; Simon, Viviana; Fernandez-Sesma, Ana; Krogan, Nevan; Mulder, Lubbertus C.F.; van Bakel, Harm; Tortorella, Domenico; Taunton, Jack; Palese, Peter; Marazzi, Ivan


    Viruses are obligate parasites as they require the machinery of the host cell to replicate. Inhibition of host factors co-opted during active infection is a strategy to suppress viral replication and a potential pan antiviral therapy. To define the cellular proteins and processes required for a virus during infection is thus crucial to understanding the mechanisms of virally induced disease. In this report, we generated fully infectious tagged influenza viruses and used infection-based proteomics to identify pivotal arms of cellular signaling required for influenza virus growth and infectivity. Using mathematical modeling, genetic, and pharmacologic approaches, we revealed that modulation of Sec61-mediated cotranslational translocation selectively impaired glycoprotein proteostasis of influenza as well as HIV and dengue viruses, and led to inhibition of viral growth and infectivity. Thus, by studying virus-human protein-protein interactions in the context of active replication we have identified targetable host factors for broad-spectrum antiviral therapies. PMID:26789921

  18. Aplastica Anemia And Viral Hepatitis

    PubMed Central

    Cudillo, Laura


    Acquired aplastic anemia (aAA) is a severe and rare disease, characterized by hematopoietic bone marrow failure and peripheral cytopenia. The pathophysiology is immune mediated in most cases, activated T1 lymphocytes have been identified as effector cells. The disease can be successfully treated with combined immunosuppressive therapy or allogeneic hematopoietic stem cell transplantation. Hepatitis-associated aplastic anemia (HAA) is a syndrome of bone marrow failure following the development of acute seronegative hepatitis. HAA syndrome most often affects young males who presented severe pancytopenia two to three months after an episode of acute hepatitis. The clinical course of hepatitis is more frequently benign but a fulminant severe course is also described. The bone marrow failure can be explosive and severe and it is usually fatal if untreated, no correlations have been observed between severity of hepatitis and AA. In none of the studies a specific virus could be identified and most cases are seronegative for known hepatitis viruses. The clinical characteristics and response to immunotherapy indicate a central role for immune-mediated mechanism in the pathogenesis of HAA. The initial target organ of the immune response is the liver as suggested by the time interval between hepatitis and the onset of bone marrow failure. Liver histology is characterized by T cell infiltrating the parenchyma as reported in acute hepatitis. Recently in HAA it has been demonstrated intrahepatic and blood lymphocytes with T cell repertoire similar to that of confirmed viral acute hepatitis. The expanded T cell clones return to a normal distribution after response to immunosuppressive treatment, suggesting the antigen or T cell clearance. Therapeutic options are the same as acquired aplastic anemia. PMID:21415960

  19. Aplastica anemia and viral hepatitis.


    Cudillo, Laura


    Acquired aplastic anemia (aAA) is a severe and rare disease, characterized by hematopoietic bone marrow failure and peripheral cytopenia. The pathophysiology is immune mediated in most cases, activated T1 lymphocytes have been identified as effector cells. The disease can be successfully treated with combined immunosuppressive therapy or allogeneic hematopoietic stem cell transplantation. Hepatitis-associated aplastic anemia (HAA) is a syndrome of bone marrow failure following the development of acute seronegative hepatitis. HAA syndrome most often affects young males who presented severe pancytopenia two to three months after an episode of acute hepatitis. The clinical course of hepatitis is more frequently benign but a fulminant severe course is also described. The bone marrow failure can be explosive and severe and it is usually fatal if untreated, no correlations have been observed between severity of hepatitis and AA. In none of the studies a specific virus could be identified and most cases are seronegative for known hepatitis viruses. The clinical characteristics and response to immunotherapy indicate a central role for immune-mediated mechanism in the pathogenesis of HAA. The initial target organ of the immune response is the liver as suggested by the time interval between hepatitis and the onset of bone marrow failure. Liver histology is characterized by T cell infiltrating the parenchyma as reported in acute hepatitis. Recently in HAA it has been demonstrated intrahepatic and blood lymphocytes with T cell repertoire similar to that of confirmed viral acute hepatitis. The expanded T cell clones return to a normal distribution after response to immunosuppressive treatment, suggesting the antigen or T cell clearance. Therapeutic options are the same as acquired aplastic anemia.

  20. Module Evaluation

    DTIC Science & Technology


    various testing methodologies for the evaluation and characterization of Transmit /Receive (T/R) modules for phased array radars. Discussed are techniques...for characterizing T/R modules in transmit and receive modes under ideal and emulated operation environments. Further, techniques for life testing...characteristics of T/R modules developed during the early and mid 1980’s. Data provided shows the performance in terms of gain and phase for both transmit

  1. Viral fitness: definitions, measurement, and current insights.


    Wargo, Andrew R; Kurath, Gael


    Viral fitness is an active area of research, with recent work involving an expanded number of human, non-human vertebrate, invertebrate, plant, and bacterial viruses. Many publications deal with RNA viruses associated with major disease emergence events, such as HIV-1, influenza virus, and Dengue virus. Study topics include drug resistance, immune escape, viral emergence, host jumps, mutation effects, quasispecies diversity, and mathematical models of viral fitness. Important recent trends include increasing use of in vivo systems to assess vertebrate virus fitness, and a broadening of research beyond replicative fitness to also investigate transmission fitness and epidemiologic fitness. This is essential for a more integrated understanding of overall viral fitness, with implications for disease management in the future.

  2. Translation initiation of viral mRNAs.


    López-Lastra, Marcelo; Ramdohr, Pablo; Letelier, Alejandro; Vallejos, Maricarmen; Vera-Otarola, Jorge; Valiente-Echeverría, Fernando


    Viruses depend on cells for their replication but have evolved mechanisms to achieve this in an efficient and, in some instances, a cell-type-specific manner. The expression of viral proteins is frequently subject to translational control. The dominant target of such control is the initiation step of protein synthesis. Indeed, during the early stages of infection, viral mRNAs must compete with their host counterparts for the protein synthetic machinery, especially for the limited pool of eukaryotic translation initiation factors (eIFs) that mediate the recruitment of ribosomes to both viral and cellular mRNAs. To circumvent this competition viruses use diverse strategies so that ribosomes can be recruited selectively to viral mRNAs. In this review we focus on the initiation of protein synthesis and outline some of the strategies used by viruses to ensure efficient translation initiation of their mRNAs.

  3. Illuminating viral infections in the nervous system

    PubMed Central

    McGavern, Dorian B.; Kang, Silvia S.


    Viral infections are a major cause of human disease. Although most viruses replicate in peripheral tissues, some have developed unique strategies to move into the nervous system, where they establish acute or persistent infections. Viral infections in the central nervous system (CNS) can alter homeostasis, induce neurological dysfunction and result in serious, potentially life-threatening inflammatory diseases. This Review focuses on the strategies used by neurotropic viruses to cross the barrier systems of the CNS and on how the immune system detects and responds to viral infections in the CNS. A special emphasis is placed on immune surveillance of persistent and latent viral infections and on recent insights gained from imaging both protective and pathogenic antiviral immune responses. PMID:21508982

  4. Severe Viral Infections and Primary Immunodeficiencies

    PubMed Central

    Cohen, Jeffrey I.


    Patients with severe viral infections are often not thoroughly evaluated for immunodeficiencies. In this review, we summarize primary immunodeficiencies that predispose individuals to severe viral infections. Some immunodeficiencies enhance susceptibility to disease with a specific virus or family of viruses, whereas others predispose to diseases with multiple viruses in addition to disease with other microbes. Although the role of cytotoxic T cells in controlling viral infections is well known, a number of immunodeficiencies that predispose to severe viral diseases have recently been ascribed to defects in the Toll-like receptor–interferon signaling pathway. These immunodeficiencies are rare, but it is important to identify them both for prognostic information and for genetic counseling. Undoubtedly, additional mutations in proteins in the innate and adaptive arms of the immune system will be identified in the future, which will reveal the importance of these proteins in controlling infections caused by viruses and other pathogens. PMID:21960712

  5. Theory of conformational transitions of viral shells

    NASA Astrophysics Data System (ADS)

    Guérin, Thomas; Bruinsma, Robijn


    We propose a continuum theory for the conformational transitions of viral shells. Conformational transitions of viral shells, as encountered during viral maturation, are associated with a soft mode instability of the capsid proteins [F. Tama and C. L. Brooks, J. Mol. Biol. 345(2), 299 (2005)]. The continuum theory presented here is an adaptation of the Ginzburg-Landau theory of soft-mode structural phase transitions of solids to viral shells. The theory predicts that the conformational transitions are characterized by a pronounced softening of the shell elasticity in the critical region. We demonstrate that the thermodynamics of the conformational transition can be probed quantitatively by a micromechanical atomic force microscope study. The external force can drive a capsid into a state of phase coexistence characterized by a highly nonlinear force deformation curve.

  6. Viral fitness: definitions, measurement, and current insights

    USGS Publications Warehouse

    Wargo, Andrew R.; Kurath, Gael


    Viral fitness is an active area of research, with recent work involving an expanded number of human, non-human vertebrate, invertebrate, plant, and bacterial viruses. Many publications deal with RNA viruses associated with major disease emergence events, such as HIV-1, influenza virus, and Dengue virus. Study topics include drug resistance, immune escape, viral emergence, host jumps, mutation effects, quasispecies diversity, and mathematical models of viral fitness. Important recent trends include increasing use of in vivo systems to assess vertebrate virus fitness, and a broadening of research beyond replicative fitness to also investigate transmission fitness and epidemiologic fitness. This is essential for a more integrated understanding of overall viral fitness, with implications for disease management in the future.

  7. Drug Use and Viral Infections (HIV, Hepatitis)


    ... virus can pass it to their baby during pregnancy, whether or not they use drugs. The viral infections of greatest concern related to drug use are HIV and hepatitis. People can reduce their risk of getting or ...

  8. Notified viral hepatitis in New Zealand.


    McGlashan, N


    Statistical analysis of notified cases of viral hepatits in New Zealand for an 18-month period is used first to demonstrate and then to consider a geographical gradient across the country with implications warranting further epidemiologic enquiry.

  9. Viral load distribution in SARS outbreak.


    Chu, Chung-Ming; Cheng, Vincent C C; Hung, Ivan F N; Chan, Kin-Sang; Tang, Bone S F; Tsang, Thomas H F; Chan, Kwok-Hung; Yuen, Kwok-Yung


    An unprecedented community outbreak of severe acute respiratory syndrome (SARS) occurred in the Amoy Gardens, a high-rise residential complex in Hong Kong. Droplet, air, contaminated fomites, and rodent pests have been proposed to be mechanisms for transmitting SARS in a short period. We studied nasopharyngeal viral load of SARS patients on admission and their geographic distribution. Higher nasopharyngeal viral load was found in patients living in adjacent units of the same block inhabited by the index patient, while a lower but detectable nasopharyngeal viral load was found in patients living further away from the index patient. This pattern of nasopharyngeal viral load suggested that airborne transmission played an important part in this outbreak in Hong Kong. Contaminated fomites and rodent pests may have also played a role.

  10. Viral Immunotherapy to Eradicate Subclinical Brain Metastases

    DTIC Science & Technology


    re-activated to enter and destroy early BM by viral infection of Her2-positive breast BM by a recombinant vesicular stomatitis virus (VSV), which...memory T-cells can be re-activated to enter and destroy early BM by viral infection of Her2-positive breast BM by a recombinant vesicular stomatitis ...delivered to CSF macrophages (Months 0-9) a. Generate donor survivor animals by treatment with replicating recombinant Vesicular Stomatitis Virus (rrVSV

  11. Rapid and highly fieldable viral diagnostic


    McKnight, Timothy E.


    The present invention relates to a rapid, highly fieldable, nearly reagentless diagnostic to identify active RNA viral replication in a live, infected cells, and more particularly in leukocytes and tissue samples (including biopsies and nasal swabs) using an array of a plurality of vertically-aligned nanostructures that impale the cells and introduce a DNA reporter construct that is expressed and amplified in the presence of active viral replication.

  12. Cellular pathways for viral transport through plasmodesmata.


    Niehl, Annette; Heinlein, Manfred


    Plant viruses use plasmodesmata (PD) to spread infection between cells and systemically. Dependent on viral species, movement through PD can occur in virion or non-virion form, and requires different mechanisms for targeting and modification of the pore. These mechanisms are supported by viral movement proteins and by other virus-encoded factors that interact among themselves and with plant cellular components to facilitate virus movement in a coordinated and regulated fashion.

  13. Neutrophil in Viral Infections, Friend or Foe?

    PubMed Central

    Drescher, Brandon; Bai, Fengwei


    Polymorphonuclear leukocytes or neutrophils are the first immune cells to the site of injury and microbial infection. Neutrophils are crucial players in controlling bacterial and fungal infections, and in particular secondary infections, by phagocytosis, degranulation and neutrophil extracellular traps (NETs). While neutrophils have been shown to play important roles in viral pathogenesis, there is a lack of detailed investigation. In this article, we will review recent progresses toward understanding the role of neutrophils in viral pathogenesis. PMID:23178588

  14. The contribution of viral genotype to plasma viral set-point in HIV infection.


    Hodcroft, Emma; Hadfield, Jarrod D; Fearnhill, Esther; Phillips, Andrew; Dunn, David; O'Shea, Siobhan; Pillay, Deenan; Leigh Brown, Andrew J


    Disease progression in HIV-infected individuals varies greatly, and while the environmental and host factors influencing this variation have been widely investigated, the viral contribution to variation in set-point viral load, a predictor of disease progression, is less clear. Previous studies, using transmission-pairs and analysis of phylogenetic signal in small numbers of individuals, have produced a wide range of viral genetic effect estimates. Here we present a novel application of a population-scale method based in quantitative genetics to estimate the viral genetic effect on set-point viral load in the UK subtype B HIV-1 epidemic, based on a very large data set. Analyzing the initial viral load and associated pol sequence, both taken before anti-retroviral therapy, of 8,483 patients, we estimate the proportion of variance in viral load explained by viral genetic effects to be 5.7% (CI 2.8-8.6%). We also estimated the change in viral load over time due to selection on the virus and environmental effects to be a decline of 0.05 log10 copies/mL/year, in contrast to recent studies which suggested a reported small increase in viral load over the last 20 years might be due to evolutionary changes in the virus. Our results suggest that in the UK epidemic, subtype B has a small but significant viral genetic effect on viral load. By allowing the analysis of large sample sizes, we expect our approach to be applicable to the estimation of the genetic contribution to traits in many organisms.

  15. Host - hepatitis C viral interactions: The role of genetics.


    Heim, Markus H; Bochud, Pierre-Yves; George, Jacob


    Hepatitis C virus (HCV) is a major cause of chronic viral hepatitis that can lead to cirrhosis and hepatocellular carcinoma. Only a minority of patients can clear the virus spontaneously. Elimination of HCV during acute infection correlates with a rapid induction of innate, especially interferon (IFN)-induced genes, and a delayed induction of adaptive immune responses. There is a strong association between genetic variants in the IFNλ (IL28B) locus with the rate of spontaneous clearance. Individuals with the ancestral IFNλ4 allele capable of producing a fully active IFNλ4 are paradoxically not able to clear HCV in the acute phase and develop chronic hepatitis C (CHC) with more than 90% probability. In the chronic phase of HCV infection, the wild-type IFNλ4 genotype is strongly associated with an induction of hundreds of classical type I/type III IFN stimulated genes in hepatocytes. However, the activation of the endogenous IFN system in the liver is ineffective in clearing HCV, and is even associated with impaired therapeutic responses to pegylated (Peg)IFNα containing treatments. While the role of genetic variation in the IFNλ locus to the outcome of CHC treatment has declined, it is clear that variation not only at this locus, but also at other loci, modulate clinically important liver phenotypes, including inflammation, fibrosis progression and the development of hepatocellular cancer. In this review, we summarize current knowledge about the role of genetics in the host response to viral hepatitis and the potential future evolution of knowledge in understanding host-viral interactions.

  16. Transactivation of programmed ribosomal frameshifting by a viral protein

    PubMed Central

    Li, Yanhua; Treffers, Emmely E.; Napthine, Sawsan; Tas, Ali; Zhu, Longchao; Sun, Zhi; Bell, Susanne; Mark, Brian L.; van Veelen, Peter A.; van Hemert, Martijn J.; Firth, Andrew E.; Brierley, Ian; Snijder, Eric J.; Fang, Ying


    Programmed −1 ribosomal frameshifting (−1 PRF) is a widely used translational mechanism facilitating the expression of two polypeptides from a single mRNA. Commonly, the ribosome interacts with an mRNA secondary structure that promotes −1 frameshifting on a homopolymeric slippery sequence. Recently, we described an unusual −2 frameshifting (−2 PRF) signal directing efficient expression of a transframe protein [nonstructural protein 2TF (nsp2TF)] of porcine reproductive and respiratory syndrome virus (PRRSV) from an alternative reading frame overlapping the viral replicase gene. Unusually, this arterivirus PRF signal lacks an obvious stimulatory RNA secondary structure, but as confirmed here, can also direct the occurrence of −1 PRF, yielding a third, truncated nsp2 variant named “nsp2N.” Remarkably, we now show that both −2 and −1 PRF are transactivated by a protein factor, specifically a PRRSV replicase subunit (nsp1β). Embedded in nsp1β’s papain-like autoproteinase domain, we identified a highly conserved, putative RNA-binding motif that is critical for PRF transactivation. The minimal RNA sequence required for PRF was mapped within a 34-nt region that includes the slippery sequence and a downstream conserved CCCANCUCC motif. Interaction of nsp1β with the PRF signal was demonstrated in pull-down assays. These studies demonstrate for the first time, to our knowledge, that a protein can function as a transactivator of ribosomal frameshifting. The newly identified frameshifting determinants provide potential antiviral targets for arterivirus disease control and prevention. Moreover, protein-induced transactivation of frameshifting may be a widely used mechanism, potentially including previously undiscovered viral strategies to regulate viral gene expression and/or modulate host cell translation upon infection. PMID:24825891

  17. Generating viral metagenomes from the coral holobiont

    PubMed Central

    Wood-Charlson, Elisha M.; Suttle, Curtis A.; van Oppen, Madeleine J. H.


    Reef-building corals comprise multipartite symbioses where the cnidarian animal is host to an array of eukaryotic and prokaryotic organisms, and the viruses that infect them. These viruses are critical elements of the coral holobiont, serving not only as agents of mortality, but also as potential vectors for lateral gene flow, and as elements encoding a variety of auxiliary metabolic functions. Consequently, understanding the functioning and health of the coral holobiont requires detailed knowledge of the associated viral assemblage and its function. Currently, the most tractable way of uncovering viral diversity and function is through metagenomic approaches, which is inherently difficult in corals because of the complex holobiont community, an extracellular mucus layer that all corals secrete, and the variety of sizes and structures of nucleic acids found in viruses. Here we present the first protocol for isolating, purifying and amplifying viral nucleic acids from corals based on mechanical disruption of cells. This method produces at least 50% higher yields of viral nucleic acids, has very low levels of cellular sequence contamination and captures wider viral diversity than previously used chemical-based extraction methods. We demonstrate that our mechanical-based method profiles a greater diversity of DNA and RNA genomes, including virus groups such as Retro-transcribing and ssRNA viruses, which are absent from metagenomes generated via chemical-based methods. In addition, we briefly present (and make publically available) the first paired DNA and RNA viral metagenomes from the coral Acropora tenuis. PMID:24847321

  18. Viral Metagenomics: MetaView Software

    SciTech Connect

    Zhou, C; Smith, J


    The purpose of this report is to design and develop a tool for analysis of raw sequence read data from viral metagenomics experiments. The tool should compare read sequences of known viral nucleic acid sequence data and enable a user to attempt to determine, with some degree of confidence, what virus groups may be present in the sample. This project was conducted in two phases. In phase 1 we surveyed the literature and examined existing metagenomics tools to educate ourselves and to more precisely define the problem of analyzing raw read data from viral metagenomic experiments. In phase 2 we devised an approach and built a prototype code and database. This code takes viral metagenomic read data in fasta format as input and accesses all complete viral genomes from Kpath for sequence comparison. The system executes at the UNIX command line, producing output that is stored in an Oracle relational database. We provide here a description of the approach we came up with for handling un-assembled, short read data sets from viral metagenomics experiments. We include a discussion of the current MetaView code capabilities and additional functionality that we believe should be added, should additional funding be acquired to continue the work.

  19. Bioinformatics tools for analysing viral genomic data.


    Orton, R J; Gu, Q; Hughes, J; Maabar, M; Modha, S; Vattipally, S B; Wilkie, G S; Davison, A J


    The field of viral genomics and bioinformatics is experiencing a strong resurgence due to high-throughput sequencing (HTS) technology, which enables the rapid and cost-effective sequencing and subsequent assembly of large numbers of viral genomes. In addition, the unprecedented power of HTS technologies has enabled the analysis of intra-host viral diversity and quasispecies dynamics in relation to important biological questions on viral transmission, vaccine resistance and host jumping. HTS also enables the rapid identification of both known and potentially new viruses from field and clinical samples, thus adding new tools to the fields of viral discovery and metagenomics. Bioinformatics has been central to the rise of HTS applications because new algorithms and software tools are continually needed to process and analyse the large, complex datasets generated in this rapidly evolving area. In this paper, the authors give a brief overview of the main bioinformatics tools available for viral genomic research, with a particular emphasis on HTS technologies and their main applications. They summarise the major steps in various HTS analyses, starting with quality control of raw reads and encompassing activities ranging from consensus and de novo genome assembly to variant calling and metagenomics, as well as RNA sequencing.

  20. Viral encephalitis: current treatments and future perspectives.


    Domingues, Renan Barros


    Several viruses may cause central nervous system infections that lead to a broad range of clinical manifestations. The course of the viral encephalitis can be acute, sub acute, or chronic. Some viruses have the ability to enter into the brain and cause direct injury, while others activate inflammatory cells that attack the central nervous system (CNS) secondarily. Some types of viral encephalitis occur in previously healthy individuals, while others affect immunocompromised patients. The epidemiology of viral encephalitis has undergone changes in recent years. Factors such as evolving lifestyles and ecological changes have had a considerable impact on the epidemiology of some types of viral encephalitis. The result is a change in the etiology spectrum of viral encephalitis, with new types of encephalitis arising or returning from time to time. Many scientific achievements in neuroimaging, molecular diagnosis, antiviral therapy, immunomodulatory treatments, and neurointensive care have allowed more precise and earlier diagnoses and more efficient treatments, resulting in improved outcomes. Despite these advances, there is still considerable morbidity and mortality related to these disorders. This aim of this article is to review the current knowledge of the current drugs used in the management of the most important viral encephalitis, focusing on the mechanisms of action, efficacy, and side effects of the drugs. In addition, future perspectives in this area will be addressed. Despite the technological advances, much effort has yet to be undertaken to reduce the impact of these potentially devastating diseases.

  1. TDP-43 regulates endogenous retrovirus-K viral protein accumulation.


    Manghera, Mamneet; Ferguson-Parry, Jennifer; Douville, Renée N


    The concomitant expression of neuronal TAR DNA binding protein 43 (TDP-43) and human endogenous retrovirus-K (ERVK) is a hallmark of ALS. Since the involvement of TDP-43 in retrovirus replication remains controversial, we sought to evaluate whether TDP-43 exerts an effect on ERVK expression. In this study, TDP-43 bound the ERVK promoter in the context of inflammation or proteasome inhibition, with no effect on ERVK transcription. However, over-expression of ALS-associated aggregating forms of TDP-43, but not wild-type TDP-43, significantly enhanced ERVK viral protein accumulation. Human astrocytes and neurons further demonstrated cell-type specific differences in their ability to express and clear ERVK proteins during inflammation and proteasome inhibition. Astrocytes, but not neurons, were able to clear excess ERVK proteins through stress granule formation and autophagy. In vitro findings were validated in autopsy motor cortex tissue from patients with ALS and neuro-normal controls. We further confirmed marked enhancement of ERVK in cortical neurons of patients with ALS. Despite evidence of enhanced stress granule and autophagic response in ALS cortical neurons, these cells failed to clear excess ERVK protein accumulation. This highlights how multiple cellular pathways, in conjunction with disease-associated mutations, can converge to modulate the expression and clearance of viral gene products from genomic elements such as ERVK. In ALS, ERVK protein aggregation is a novel aspect of TDP-43 misregulation contributing towards the pathology of this neurodegenerative disease. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Regulatory T Cells in Autoimmune and Viral Chronic Hepatitis.


    Lapierre, Pascal; Lamarre, Alain


    In both autoimmune liver disease and chronic viral hepatitis, the injury results from an immune-mediated cytotoxic T cell response to liver cells. As such, it is not surprising that CD4(+) regulatory T cells, a key regulatory population of T cells able to curb immune responses, could be involved in both autoimmune hepatitis and chronic viral hepatitis. The liver can induce the conversion of naïve CD4(+) T cells to CD4(+) regulatory T cells and induce tolerance to locally expressed antigens. This tolerance mechanism is carefully regulated in physiological conditions but any imbalance could be pathological. An overly tolerant immune response can lead to chronic infections while an overreactive and unbridled immune response can lead to autoimmune hepatitis. With the recent advent of monoclonal antibodies able to target regulatory T cells (daclizumab) and improve immune responses and several ongoing clinical trials analysing the impact of regulatory T cell infusion on autoimmune liver disease or liver transplant tolerance, modulation of immunological tolerance through CD4(+) regulatory T cells could be a key element of future immunotherapies for several liver diseases allowing restoring the balance between proper immune responses and tolerance.  .

  3. Update on chronic viral hepatitis

    PubMed Central

    Walsh, K; Alexander, G


    Many recent and significant advances in the field of chronic viral hepatitis, including therapy, suggest that an update on chronic hepatitis is timely.
Chronic hepatitis B virus infection remains a significant worldwide cause of liver cirrhosis and hepatocellular carcinoma, despite the wide availability of a long established and effective vaccine. Transmission occurs via perinatal, sexual, and parenteral routes (particularly intravenous drug abuse and although blood products still carry a risk, this is now extremely low in Western countries). Only a minority of infected adult cases develop chronic hepatitis but in children under 1 year, 90% develop chronic hepatitis. The clinical spectrum of chronic liver injury ranges from mild inflammation to end stage liver cirrhosis. Interferon alfa has been the mainstay of treatment for patients with active disease but nucleoside analogues (lamivudine and adefovir) are now available with similar efficacy. Patients with end stage liver disease and hepatocellular carcinoma can be offered transplantation but infection in the graft is commonplace. The combination of hepatitis B immunoglobulin and newer antiviral drugs reduce the incidence and severity of graft infection significantly.
The hepatitis C virus epidemic of the latter half of the 20th century now affects more than 1% of populations worldwide. This RNA virus is spread parenterally and is becoming the leading indication for liver transplantation. The majority of patients develop chronic hepatitis, which may be progressive, evolving to significant liver disease (cirrhosis or hepatocellular carcinoma) in about 20% cases after decades. Treatment with the combination of interferon alfa and ribavirin is successful in up to 40% cases. Liver transplantation is a therapeutic option for some but graft infection is universal and often complicated by progressive liver fibrosis. A vaccine remains a remote prospect so that prevention is crucial.
Hepatitis D virus infection

  4. Modulation of signaling pathways by RNA virus capsid proteins.


    Urbanowski, Matthew D; Ilkow, Carolina S; Hobman, Tom C


    Capsid proteins are structural components of virus particles. They are nucleic acid-binding proteins whose main recognized function is to package viral genomes into protective structures called nucleocapsids. Research over the last 10 years indicates that in addition to their role as genome guardians, viral capsid proteins modulate host cell signaling networks. Disruption or alteration of intracellular signaling pathways by viral capsids may benefit replication of the virus by affecting innate immunity and in some cases, may underlie disease progression. In this review, we describe how the capsid proteins from medically relevant RNA viruses interact with host cell signaling pathways.

  5. Optimized protocol for detection of HIV-1 drug mutations in patients with low viral load.


    Stelzl, Evelyn; Troppan, Katharina T; Winkler, Michaela; Korn, Klaus; Kessler, Harald H


    The TRUGENE HIV-1 Genotyping Kit for HIV-1 drug resistance testing is limited by the need for samples with HIV-1 RNA loads of at least 1000 copies/mL. In order to enable sequencing of clinical samples with viral loads under 1000 copies/mL, an optimized automated sample preparation protocol on the VERSANT kPCR Sample Preparation (SP) Module was evaluated. In order to prove the concept of successful sequencing of low-titer clinical samples with the optimized protocol, a dilution series of a routine clinical sample was analyzed. Furthermore, 57 routine clinical samples with viral loads below 1000 HIV-1 RNA copies/mL were tested. Finally, samples obtained from two patients with low viral loads were tested retrospectively for HIV-1 drug resistances and results were compared with those of the preceding and the subsequent sample. The dilution containing 92 HIV-1 RNA copies/mL was the lowest yielding an analyzable sequence with the optimized protocol. When routine clinical samples with viral loads between 100 and 1000 HIV-1 RNA copies/mL were tested, a sequence was obtained in 90.5%. Samples with low viral load of two patients that could not be analyzed with the routine protocol showed identical drug mutations in both, the low viral-load and the subsequent samples. Together with the optimized automated sample preparation protocol, the TRUGENE HIV-1 Genotyping Kit allows successful sequencing of the majority of samples with HIV-1 RNA loads between 100 and 1000 copies/mL. Detection of resistance mutations in low viral-load samples may lead to an earlier optimized antiretroviral therapy. Copyright 2010 Elsevier B.V. All rights reserved.

  6. Specific Regulation of the Chemokine Response to Viral Hemorrhagic Septicemia Virus at the Entry Site▿

    PubMed Central

    Montero, Jana; Garcia, Jessica; Ordas, M. Camino; Casanova, Isabel; Gonzalez, Antonia; Villena, Alberto; Coll, Julio; Tafalla, Carolina


    The fin bases constitute the main portal of rhabdovirus entry into rainbow trout (Oncorhynchus mykiss), and replication in this first site strongly conditions the outcome of the infection. In this context, we studied the chemokine response elicited in this area in response to viral hemorrhagic septicemia virus (VHSV), a rhabdovirus. Among all the rainbow trout chemokine genes studied, only the transcription levels of CK10 and CK12 were significantly upregulated in response to VHSV. As the virus had previously been shown to elicit a much stronger chemokine response in internal organs, we compared the effect of VHSV on the gills, another mucosal site which does not constitute the main site of viral entry or rhabdoviral replication. In this case, a significantly stronger chemokine response was triggered, with CK1, CK3, CK9, and CK11 being upregulated in response to VHSV and CK10 and CK12 being down-modulated by the virus. We then conducted further experiments to understand how these different chemokine responses of mucosal tissues could correlate with their capacity to support VHSV replication. No viral replication was detected in the gills, while at the fin bases, only the skin and the muscle were actively supporting viral replication. Within the skin, viral replication took place in the dermis, while viral replication was blocked within epidermal cells at some point before protein translation. The different susceptibilities of the different skin layers to VHSV correlated with the effect that VHSV has on their capacity to secrete chemotactic factors. Altogether, these results suggest a VHSV interference mechanism on the early chemokine response at its active replication sites within mucosal tissues, a possible key process that may facilitate viral entry. PMID:21325404

  7. Paternally transmitted mitochondria express a new gene of potential viral origin.


    Milani, Liliana; Ghiselli, Fabrizio; Maurizii, Maria Gabriella; Nuzhdin, Sergey V; Passamonti, Marco


    Mitochondrial ORFans (open reading frames having no detectable homology and with unknown function) were discovered in bivalve molluscs with doubly uniparental inheritance (DUI) of mitochondria. In these animals, two mitochondrial lineages are present, one transmitted through eggs (F-type), the other through sperm (M-type), each showing a specific ORFan. In this study, we used in situ hybridization and immunocytochemistry to provide evidence for the expression of Ruditapes philippinarum male-specific ORFan (orf21): both the transcript and the protein (RPHM21) were localized in spermatogenic cells and mature spermatozoa; the protein was localized in sperm mitochondria and nuclei, and in early embryos. Also, in silico analyses of orf21 flanking region and RPHM21 structure supported its derivation from viral sequence endogenization. We propose that RPHM21 prevents the recognition of M-type mitochondria by the degradation machinery, allowing their survival in the zygote. The process might involve a mechanism similar to that of Modulators of Immune Recognition, viral proteins involved in the immune recognition pathway, to which RPHM21 showed structural similarities. A viral origin of RPHM21 may also support a developmental role, because some integrated viral elements are involved in development and sperm differentiation of their host. Mitochondrial ORFans could be responsible for or participate in the DUI mechanism and their viral origin could explain the acquired capability of M-type mitochondria to avoid degradation and invade the germ line, that is what viruses do best: to elude host immune system and proliferate.

  8. The anti-obesity drug orlistat reveals anti-viral activity.


    Ammer, Elisabeth; Nietzsche, Sandor; Rien, Christian; Kühnl, Alexander; Mader, Theresa; Heller, Regine; Sauerbrei, Andreas; Henke, Andreas


    The administration of drugs to inhibit metabolic pathways not only reduces the risk of obesity-induced diseases in humans but may also hamper the replication of different viral pathogens. In order to investigate the value of the US Food and Drug Administration-approved anti-obesity drug orlistat in view of its anti-viral activity against different human-pathogenic viruses, several anti-viral studies, electron microscopy analyses as well as fatty acid uptake experiments were performed. The results indicate that administrations of non-cytotoxic concentrations of orlistat reduced the replication of coxsackievirus B3 (CVB3) in different cell types significantly. Moreover, orlistat revealed cell protective effects and modified the formation of multi-layered structures in CVB3-infected cells, which are necessary for viral replication. Lowering fatty acid uptake from the extracellular environment by phloretin administrations had only marginal impact on CVB3 replication. Finally, orlistat reduced also the replication of varicella-zoster virus moderately but had no significant influence on the replication of influenza A viruses. The data support further experiments into the value of orlistat as an inhibitor of the fatty acid synthase to develop new anti-viral compounds, which are based on the modulation of cellular metabolic pathways.

  9. Nordihydroguaiaretic acid (NDGA) inhibits replication and viral morphogenesis of dengue virus.


    Soto-Acosta, Rubén; Bautista-Carbajal, Patricia; Syed, Gulam H; Siddiqui, Aleem; Del Angel, Rosa M


    Dengue is the most common mosquito borne viral disease in humans. The infection with any of the 4 dengue virus serotypes (DENV) can either be asymptomatic or manifest in two clinical forms, the mild dengue fever or the more severe dengue hemorrhagic fever that may progress into dengue shock syndrome. A DENV replicative cycle relies on host lipid metabolism; specifically, DENV infection modulates cholesterol and fatty acid synthesis, generating a lipid-enriched cellular environment necessary for viral replication. Thus, the aim of this work was to evaluate the anti-DENV effect of the Nordihydroguaiaretic acid (NDGA), a hypolipidemic agent with antioxidant and anti-inflammatory properties. A dose-dependent inhibition in viral yield and NS1 secretion was observed in supernatants of infected cells treated for 24 and 48 h with different concentrations of NDGA. To evaluate the effect of NDGA in DENV replication, a DENV4 replicon transfected Vero cells were treated with different concentrations of NDGA. NDGA treatment significantly reduced DENV replication, reiterating the importance of lipids in viral replication. NDGA treatment also led to reduction in number of lipid droplets (LDs), the neutral lipid storage organelles involved in DENV morphogenesis that are known to increase in number during DENV infection. Furthermore, NDGA treatment resulted in dissociation of the C protein from LDs. Overall our results suggest that NDGA inhibits DENV infection by targeting genome replication and viral assembly. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. The roles of direct recognition by animal lectins in antiviral immunity and viral pathogenesis.


    Liu, Yang; Liu, Jianying; Pang, Xiaojing; Liu, Tao; Ning, Zhijie; Cheng, Gong


    Lectins are a group of proteins with carbohydrate recognition activity. Lectins are categorized into many families based on their different cellular locations as well as their specificities for a variety of carbohydrate structures due to the features of their carbohydrate recognition domain (CRD) modules. Many studies have indicated that the direct recognition of particular oligosaccharides on viral components by lectins is important for interactions between hosts and viruses. Herein, we aim to globally review the roles of this recognition by animal lectins in antiviral immune responses and viral pathogenesis. The different classes of mammalian lectins can either recognize carbohydrates to activate host immunity for viral elimination or can exploit those carbohydrates as susceptibility factors to facilitate viral entry, replication or assembly. Additionally, some arthropod C-type lectins were recently identified as key susceptibility factors that directly interact with multiple viruses and then facilitate infection. Summarization of the pleiotropic roles of direct viral recognition by animal lectins will benefit our understanding of host-virus interactions and could provide insight into the role of lectins in antiviral drug and vaccine development.

  11. Viral infections in type 1 diabetes mellitus--why the β cells?


    Op de Beeck, Anne; Eizirik, Decio L


    Type 1 diabetes mellitus (T1DM) is caused by progressive autoimmune-mediated loss of pancreatic β-cell mass via apoptosis. The onset of T1DM depends on environmental factors that interact with predisposing genes to induce an autoimmune assault against β cells. Epidemiological, clinical and pathology studies in humans support viral infection--particularly by enteroviruses (for example, coxsackievirus)--as an environmental trigger for the development of T1DM. Many candidate genes for T1DM, such as MDA5, PTPN2 and TYK2, regulate antiviral responses in both β cells and the immune system. Cellular permissiveness to viral infection is modulated by innate antiviral responses that vary among different tissues or cell types. Some data indicate that pancreatic islet α cells trigger a more efficient antiviral response to infection with diabetogenic viruses than do β cells, and so are able to eradicate viral infections without undergoing apoptosis. This difference could account for the varying ability of islet-cell subtypes to clear viral infections and explain why chronically infected pancreatic β cells, but not α cells, are targeted by an autoimmune response and killed during the development of T1DM. These issues and attempts to target viral infection as a preventive therapy for T1DM are discussed in the present Review.

  12. Viral infections in type 1 diabetes mellitus — why the β cells?

    PubMed Central


    Type 1 diabetes mellitus (T1DM) is caused by progressive autoimmune-mediated loss of pancreatic β-cell mass via apoptosis. The onset of T1DM depends on environmental factors that interact with predisposing genes to induce an autoimmune assault against β cells. Epidemiological, clinical and pathology studies in humans support viral infection — particularly by enteroviruses (for example, coxsackievirus) — as an environmental trigger for the development of T1DM. Many candidate genes for T1DM, such as MDA5, PTPN2 and TYK2, regulate antiviral responses in both β cells and the immune system. Cellular permissiveness to viral infection is modulated by innate antiviral responses that vary among different tissues or cell types. Some data indicate that pancreatic islet α cells trigger a more efficient antiviral response to infection with diabetogenic viruses than do β cells, and so are able to eradicate viral infections without undergoing apoptosis. This difference could account for the varying ability of islet-cell subtypes to clear viral infections and explain why chronically infected pancreatic β cells, but not α cells, are targeted by an autoimmune response and killed during the development of T1DM. These issues and attempts to target viral infection as a preventive therapy for T1DM are discussed in the present Review. PMID:27020257

  13. Paternally Transmitted Mitochondria Express a New Gene of Potential Viral Origin

    PubMed Central

    Milani, Liliana; Ghiselli, Fabrizio; Maurizii, Maria Gabriella; Nuzhdin, Sergey V.; Passamonti, Marco


    Mitochondrial ORFans (open reading frames having no detectable homology and with unknown function) were discovered in bivalve molluscs with doubly uniparental inheritance (DUI) of mitochondria. In these animals, two mitochondrial lineages are present, one transmitted through eggs (F-type), the other through sperm (M-type), each showing a specific ORFan. In this study, we used in situ hybridization and immunocytochemistry to provide evidence for the expression of Ruditapes philippinarum male-specific ORFan (orf21): both the transcript and the protein (RPHM21) were localized in spermatogenic cells and mature spermatozoa; the protein was localized in sperm mitochondria and nuclei, and in early embryos. Also, in silico analyses of orf21 flanking region and RPHM21 structure supported its derivation from viral sequence endogenization. We propose that RPHM21 prevents the recognition of M-type mitochondria by the degradation machinery, allowing their survival in the zygote. The process might involve a mechanism similar to that of Modulators of Immune Recognition, viral proteins involved in the immune recognition pathway, to which RPHM21 showed structural similarities. A viral origin of RPHM21 may also support a developmental role, because some integrated viral elements are involved in development and sperm differentiation of their host. Mitochondrial ORFans could be responsible for or participate in the DUI mechanism and their viral origin could explain the acquired capability of M-type mitochondria to avoid degradation and invade the germ line, that is what viruses do best: to elude host immune system and proliferate. PMID:24500970

  14. Comparative analysis of viral RNA signatures on different RIG-I-like receptors

    PubMed Central

    Sanchez David, Raul Y; Combredet, Chantal; Sismeiro, Odile; Dillies, Marie-Agnès; Jagla, Bernd; Coppée, Jean-Yves; Mura, Marie; Guerbois Galla, Mathilde; Despres, Philippe; Tangy, Frédéric; Komarova, Anastassia V


    The RIG-I-like receptors (RLRs) play a major role in sensing RNA virus infection to initiate and modulate antiviral immunity. They interact with particular viral RNAs, most of them being still unknown. To decipher the viral RNA signature on RLRs during viral infection, we tagged RLRs (RIG-I, MDA5, LGP2) and applied tagged protein affinity purification followed by next-generation sequencing (NGS) of associated RNA molecules. Two viruses with negative- and positive-sense RNA genome were used: measles (MV) and chikungunya (CHIKV). NGS analysis revealed that distinct regions of MV genome were specifically recognized by distinct RLRs: RIG-I recognized defective interfering genomes, whereas MDA5 and LGP2 specifically bound MV nucleoprotein-coding region. During CHIKV infection, RIG-I associated specifically to the 3’ untranslated region of viral genome. This study provides the first comparative view of the viral RNA ligands for RIG-I, MDA5 and LGP2 in the presence of infection. DOI: PMID:27011352

  15. Viral subversion of autophagy impairs oncogene-induced senescence.


    Leidal, Andrew M; Lee, Patrick W K; McCormick, Craig


    Many viruses have evolved elegant strategies to co-opt cellular autophagic responses to facilitate viral propagation and evasion of immune surveillance. Kaposi's sarcoma-associated herpesvirus (KSHV) establishes a life-long persistent infection in its human host, and is etiologically linked to several cancers. KSHV gene products have been shown to modulate autophagy but their contribution to pathogenesis remains unclear. Our recent study demonstrated that KSHV subversion of autophagy promotes bypass of oncogene-induced senescence (OIS), an important host barrier to tumor initiation. These findings suggest that KSHV has evolved to subvert autophagy, at least in part, to establish an optimal niche for infection, concurrently dampening host antiviral defenses and allowing the ongoing proliferation of infected cells.

  16. The stress granule component TIA-1 binds tick-borne encephalitis virus RNA and is recruited to perinuclear sites of viral replication to inhibit viral translation.


    Albornoz, Amelina; Carletti, Tea; Corazza, Gianmarco; Marcello, Alessandro


    Flaviviruses are a major cause of disease in humans and animals worldwide. Tick-borne encephalitis virus (TBEV) is the most important arthropod-borne flavivirus endemic in Europe and is the etiological agent of tick-borne encephalitis, a potentially fatal infection of the central nervous system. However, the contributions of host proteins during TBEV infection are poorly understood. In this work, we investigate the cellular protein TIA-1 and its cognate factor TIAR, which are stress-induced RNA-binding proteins involved in the repression of initiation of translation of cellular mRNAs and in the formation of stress granules. We show that TIA-1 and TIAR interact with viral RNA in TBEV-infected cells. During TBEV infection, cytoplasmic TIA-1 and TIAR are recruited at sites of viral replication with concomitant depletion from stress granules. This effect is specific, since G3BP1, another component of these cytoplasmic structures, remains localized to stress granules. Moreover, heat shock induction of stress granules containing TIA-1, but not G3BP1, is inhibited in TBEV-infected cells. Infection of cells depleted of TIA-1 or TIAR by small interfering RNA (siRNA) or TIA-1(-/-) mouse fibroblasts, leads to a significant increase in TBEV extracellular infectivity. Interestingly, TIAR(-/-) fibroblasts show the opposite effect on TBEV infection, and this phenotype appears to be related to an excess of TIA-1 in these cells. Taking advantage of a TBE-luciferase replicon system, we also observed increased luciferase activity in TIA-1(-/-) mouse fibroblasts at early time points, consistent with TIA-1-mediated inhibition at the level of the first round of viral translation. These results indicate that, in response to TBEV infection, TIA-1 is recruited to sites of virus replication to bind TBEV RNA and modulate viral translation independently of stress granule (SG) formation. This study (i) extends previous work that showed TIA-1/TIAR recruitment at sites of flavivirus replication

  17. The Stress Granule Component TIA-1 Binds Tick-Borne Encephalitis Virus RNA and Is Recruited to Perinuclear Sites of Viral Replication To Inhibit Viral Translation

    PubMed Central

    Albornoz, Amelina; Carletti, Tea; Corazza, Gianmarco


    ABSTRACT Flaviviruses are a major cause of disease in humans and animals worldwide. Tick-borne encephalitis virus (TBEV) is the most important arthropod-borne flavivirus endemic in Europe and is the etiological agent of tick-borne encephalitis, a potentially fatal infection of the central nervous system. However, the contributions of host proteins during TBEV infection are poorly understood. In this work, we investigate the cellular protein TIA-1 and its cognate factor TIAR, which are stress-induced RNA-binding proteins involved in the repression of initiation of translation of cellular mRNAs and in the formation of stress granules. We show that TIA-1 and TIAR interact with viral RNA in TBEV-infected cells. During TBEV infection, cytoplasmic TIA-1 and TIAR are recruited at sites of viral replication with concomitant depletion from stress granules. This effect is specific, since G3BP1, another component of these cytoplasmic structures, remains localized to stress granules. Moreover, heat shock induction of stress granules containing TIA-1, but not G3BP1, is inhibited in TBEV-infected cells. Infection of cells depleted of TIA-1 or TIAR by small interfering RNA (siRNA) or TIA-1−/− mouse fibroblasts, leads to a significant increase in TBEV extracellular infectivity. Interestingly, TIAR−/− fibroblasts show the opposite effect on TBEV infection, and this phenotype appears to be related to an excess of TIA-1 in these cells. Taking advantage of a TBE-luciferase replicon system, we also observed increased luciferase activity in TIA-1−/− mouse fibroblasts at early time points, consistent with TIA-1-mediated inhibition at the level of the first round of viral translation. These results indicate that, in response to TBEV infection, TIA-1 is recruited to sites of virus replication to bind TBEV RNA and modulate viral translation independently of stress granule (SG) formation. IMPORTANCE This study (i) extends previous work that showed TIA-1/TIAR recruitment at sites

  18. Duck hepatitis A virus serotype 1 minigenome: a model for studying the viral 3'UTR effect on viral translation.


    Liang, Ruiying; Li, Chuanfeng; Jin, Hongyan; Meng, Chunchun; Chen, Zongyan; Zhu, Jie; Miao, Qiuhong; Ding, Chan; Liu, Guangqing


    To date, the genetic replication and translation mechanisms as well as the pathogenesis of duck hepatitis A virus type 1 (DHAV-1) have not been adequately characterized due to the lack of a reliable and efficient cell culture system. Although the full-length infections clone system is the best platform to manipulate the virus, it is relatively difficult to assemble this system due to the lack of a suitable cell line. It has been proven that the minigenome system an efficient reverse genetics system for the study of RNA viruses. In some cases, it can be used to displace the infectious clone of RNA viruses. Here, we generated a minigenome for DHAV-1 with two luciferase reporter genes, firefly luciferase (Fluc) and Renilla luciferase (Rluc). The Rluc gene was used as a reference gene for the normalization of the Fluc gene expression in transfected cells, which provided a platform for studying the regulatory mechanisms of DHAV-1. Furthermore, to investigate the role of DHAV-3'UTR in the regulation of viral protein translation, deletions in the 3'UTR were introduced into the DHAV-1 minigenome. Luciferase activity, an indicator of virus translation, was then determined. These results showed that a minigenome system for DHAV-1 was successfully constructed for the first time and that the complete or partial deletion of the DHAV-3'UTR did not affect the expression level of the reporter gene, indicating that DHAV-1 translation may not be modulated by the viral genomic 3'UTR sequence.

  19. Lactoferrin for prevention of common viral infections.


    Wakabayashi, Hiroyuki; Oda, Hirotsugu; Yamauchi, Koji; Abe, Fumiaki


    Although lactoferrin has many biological functions, the host-protective effects against pathogenic microorganisms including bacteria, fungi, and viruses are regarded as one of the most important. Here, we review research on the protective role of lactoferrin administration against common viral infections. Many studies have shown the in vitro antiviral activity of lactoferrin against viral pathogens that cause common infections such as the common cold, influenza, gastroenteritis, summer cold, and herpes, where lactoferrin inhibits mainly viral attachment to the target cells. Recently, studies indicating the in vivo protective effects of lactoferrin by oral administration against common viral infections have been increasing. For instance, norovirus is an extremely important emerging human pathogen that causes a majority of gastroenteritis outbreaks worldwide that may be a target candidate for lactoferrin. Lactoferrin consumption reduced the incidence of noroviral gastroenteritis in children and a similar effect was observed in a wide range of ages in a preliminary survey. A recent in vitro study reported that lactoferrin inhibits both cellular attachment of the murine norovirus, a virus closely-related to the human norovirus, and viral replication in the cells by inducing antiviral cytokines interferon (IFN)-α/β. Lactoferrin administration also enhances NK cell activity and Th1 cytokine responses, which lead to protection against viral infections. In conclusion, lactoferrin consumption may protect the host from viral infections through inhibiting the attachment of a virus to the cells, replication of the virus in the cells, and enhancement of systemic immune functions. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  20. Raw Sewage Harbors Diverse Viral Populations

    PubMed Central

    Cantalupo, Paul G.; Calgua, Byron; Zhao, Guoyan; Hundesa, Ayalkibet; Wier, Adam D.; Katz, Josh P.; Grabe, Michael; Hendrix, Roger W.; Girones, Rosina; Wang, David; Pipas, James M.


    ABSTRACT At this time, about 3,000 different viruses are recognized, but metagenomic studies suggest that these viruses are a small fraction of the viruses that exist in nature. We have explored viral diversity by deep sequencing nucleic acids obtained from virion populations enriched from raw sewage. We identified 234 known viruses, including 17 that infect humans. Plant, insect, and algal viruses as well as bacteriophages were also present. These viruses represented 26 taxonomic families and included viruses with single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), positive-sense ssRNA [ssRNA(+)], and dsRNA genomes. Novel viruses that could be placed in specific taxa represented 51 different families, making untreated wastewater the most diverse viral metagenome (genetic material recovered directly from environmental samples) examined thus far. However, the vast majority of sequence reads bore little or no sequence relation to known viruses and thus could not be placed into specific taxa. These results show that the vast majority of the viruses on Earth have not yet been characterized. Untreated wastewater provides a rich matrix for identifying novel viruses and for studying virus diversity. Importance At this time, virology is focused on the study of a relatively small number of viral species. Specific viruses are studied either because they are easily propagated in the laboratory or because they are associated with disease. The lack of knowledge of the size and characteristics of the viral universe and the diversity of viral genomes is a roadblock to understanding important issues, such as the origin of emerging pathogens and the extent of gene exchange among viruses. Untreated wastewater is an ideal system for assessing viral diversity because virion populations from large numbers of individuals are deposited and because raw sewage itself provides a rich environment for the growth of diverse host species and thus their viruses. These studies suggest that

  1. Prospects for cannabinoid therapies in viral encephalitis.


    Solbrig, Marylou V; Fan, Yijun; Hazelton, Paul


    Cannabinoids are promising therapies to support neurogenesis and decelerate disease progression in neuroinflammatory and degenerative disorders. Whether neuroprotective effects of cannabinoids are sustainable during persistent viral infection of the CNS is not known. Using a rodent model of chronic viral encephalitis based on Borna Disease (BD) virus, in which 1 week treatment with the general cannabinoid WIN 55,212-2 has been shown to be neuroprotective (Solbrig et al., 2010), we examine longer term (2 week treatment) effects of a general (CB1 and CB2) cannabinoid receptor agonist WIN55,212-2 (1mg/kg ip twice per day) or a specific (CB2) cannabinoid receptor agonist HU-308 (5mg/kg ip once daily) on histopathology, measures of frontostriatal neurogenesis and gliogenesis, and viral load. We find that WIN and HU-308 differ in their ability to protect new BrdU(+) cells. The selective CB2 agonist HU increases BrdU(+) cells in prefrontal cortex (PFC), significantly increases BrdU(+) cells in striatum, differentially regulates polydendrocytes vs. microglia/macrophages, and reduces immune activation at a time WIN-treated rats appear tolerant to the anti-inflammatory effect of their cannabinoid treatment. WIN and HU had little direct viral effect in PFC and striatum, yet reduced viral signal in hippocampus. Thus, HU-308 action on CB2 receptors, receptors known to be renewed during microglia proliferation and action, is a nontolerizing mechanism of controlling CNS inflammation during viral encephalitis by reducing microglia activation, as well as partially limiting viral infection, and uses a nonpsychotropic cannabinoid agonist. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Molecular piracy: the viral link to carcinogenesis.


    Flaitz, C M; Hicks, M J


    The vast majority of the human experience with viral infections is associated with acute symptoms, such as malaise, fever, chills, rhinitis and diarrhea. With this acute or lytic phase, the immune system mounts a response and eliminates the viral agent while acquiring antibodies to that specific viral subtype. With latent or chronic infections, the viral agent becomes incorporated into the human genome. Viral agents capable of integration into the host's genetic material are particularly dangerous and may commandeer the host's ability to regulate normal cell growth and proliferation. The oncogenic viruses may immortalize the host cell, and facilitate malignant transformation. Cell growth and proliferation may be enhanced by viral interference with tumor suppressor gene function (p53 and pRb). Viruses may act as vectors for mutated proto-oncogenes (oncogenes). Overexpression of these oncogenes in viral-infected cells interferes with normal cell function and allows unregulated cell growth and proliferation, which may lead to malignant transformation and tumour formation. Development of oral neoplasms, both benign and malignant, has been linked to several viruses. Epstein-Barr virus is associated with oral hairy leukoplakia, lymphoproliferative disease, lymphoepithelial carcinoma, B-cell lymphomas, and nasopharyngeal carcinoma. Human herpesvirus-8 has been implicated in all forms of Kaposi's sarcoma, primary effusion lymphomas, multiple myeloma, angioimmunoblastic lymphadenopathy, and Castleman's disease. Human herpesvirus-6 has been detected in lymphoproliferative disease, lymphomas, Hodgkin's disease, and oral squamous cell carcinoma. The role of human papillomavirus in benign (squamous papilloma, focal epithelial hyperplasia, condyloma acuminatum, verruca vulgaris), premalignant (oral epithelial dysplasia), and malignant (squamous cell carcinoma) neoplasms within the oral cavity is well recognized. Herpes simplex virus may participate as a cofactor in oral squamous

  3. Viral Macro Domains Reverse Protein ADP-Ribosylation.


    Li, Changqing; Debing, Yannick; Jankevicius, Gytis; Neyts, Johan; Ahel, Ivan; Coutard, Bruno; Canard, Bruno


    ADP-ribosylation is a posttranslational protein modification in which ADP-ribose is transferred from NAD(+) to specific acceptors to regulate a wide variety of cellular processes. The macro domain is an ancient and highly evolutionarily conserved protein domain widely distributed throughout all kingdoms of life, including viruses. The human TARG1/C6orf130, MacroD1, and MacroD2 proteins can reverse ADP-ribosylation by acting on ADP-ribosylated substrates through the hydrolytic activity of their macro domains. Here, we report that the macro domain from hepatitis E virus (HEV) serves as an ADP-ribose-protein hydrolase for mono-ADP-ribose (MAR) and poly(ADP-ribose) (PAR) chain removal (de-MARylation and de-PARylation, respectively) from mono- and poly(ADP)-ribosylated proteins, respectively. The presence of the HEV helicase in cis dramatically increases the binding of the macro domain to poly(ADP-ribose) and stimulates the de-PARylation activity. Abrogation of the latter dramatically decreases replication of an HEV subgenomic replicon. The de-MARylation activity is present in all three pathogenic positive-sense, single-stranded RNA [(+)ssRNA] virus families which carry a macro domain: Coronaviridae (severe acute respiratory syndrome coronavirus and human coronavirus 229E), Togaviridae (Venezuelan equine encephalitis virus), and Hepeviridae (HEV), indicating that it might be a significant tropism and/or pathogenic determinant. Protein ADP-ribosylation is a covalent posttranslational modification regulating cellular protein activities in a dynamic fashion to modulate and coordinate a variety of cellular processes. Three viral families, Coronaviridae, Togaviridae, and Hepeviridae, possess macro domains embedded in their polyproteins. Here, we show that viral macro domains reverse cellular ADP-ribosylation, potentially cutting the signal of a viral infection in the cell. Various poly(ADP-ribose) polymerases which are notorious guardians of cellular integrity are demodified

  4. Viral Macro Domains Reverse Protein ADP-Ribosylation

    PubMed Central

    Li, Changqing; Debing, Yannick; Jankevicius, Gytis; Neyts, Johan; Ahel, Ivan


    ABSTRACT ADP-ribosylation is a posttranslational protein modification in which ADP-ribose is transferred from NAD+ to specific acceptors to regulate a wide variety of cellular processes. The macro domain is an ancient and highly evolutionarily conserved protein domain widely distributed throughout all kingdoms of life, including viruses. The human TARG1/C6orf130, MacroD1, and MacroD2 proteins can reverse ADP-ribosylation by acting on ADP-ribosylated substrates through the hydrolytic activity of their macro domains. Here, we report that the macro domain from hepatitis E virus (HEV) serves as an ADP-ribose-protein hydrolase for mono-ADP-ribose (MAR) and poly(ADP-ribose) (PAR) chain removal (de-MARylation and de-PARylation, respectively) from mono- and poly(ADP)-ribosylated proteins, respectively. The presence of the HEV helicase in cis dramatically increases the binding of the macro domain to poly(ADP-ribose) and stimulates the de-PARylation activity. Abrogation of the latter dramatically decreases replication of an HEV subgenomic replicon. The de-MARylation activity is present in all three pathogenic positive-sense, single-stranded RNA [(+)ssRNA] virus families which carry a macro domain: Coronaviridae (severe acute respiratory syndrome coronavirus and human coronavirus 229E), Togaviridae (Venezuelan equine encephalitis virus), and Hepeviridae (HEV), indicating that it might be a significant tropism and/or pathogenic determinant. IMPORTANCE Protein ADP-ribosylation is a covalent posttranslational modification regulating cellular protein activities in a dynamic fashion to modulate and coordinate a variety of cellular processes. Three viral families, Coronaviridae, Togaviridae, and Hepeviridae, possess macro domains embedded in their polyproteins. Here, we show that viral macro domains reverse cellular ADP-ribosylation, potentially cutting the signal of a viral infection in the cell. Various poly(ADP-ribose) polymerases which are notorious guardians of cellular

  5. Genetic Variation of HIV: Viral Load and Genotypic Diversity in Relation to Viral Pathogenesis and Treatment

    DTIC Science & Technology


    Replication; Viral Pathogenesis; Viral Quantitation; Vaccines; Genetic Variation; 16. PRICE CODE Zoonosis ; PCR; RAD I 17. SECURITY CLASSIFICATION 18...sooty mangabey and that HIV-2 infection of man represents a zoonosis (88). First, SIVm is a pathogenic in sooty mangabeys (89,90) but is pathogenic in

  6. Human Cytomegalovirus UL97 Phosphorylates the Viral Nuclear Egress Complex

    PubMed Central

    Sharma, Mayuri; Bender, Brian J.; Kamil, Jeremy P.; Lye, Ming F.; Pesola, Jean M.; Reim, Natalia I.; Hogle, James M.


    ABSTRACT Herpesvirus nucleocapsids exit the host cell nucleus in an unusual process known as nuclear egress. The human cytomegalovirus (HCMV) UL97 protein kinase is required for efficient nuclear egress, which can be explained by its phosphorylation of the nuclear lamina component lamin A/C, which disrupts the nuclear lamina. We found that a dominant negative lamin A/C mutant complemented the replication defect of a virus lacking UL97 in dividing cells, validating this explanation. However, as complementation was incomplete, we investigated whether the HCMV nuclear egress complex (NEC) subunits UL50 and UL53, which are required for nuclear egress and recruit UL97 to the nuclear rim, are UL97 substrates. Using mass spectrometry, we detected UL97-dependent phosphorylation of UL50 residue S216 (UL50-S216) and UL53-S19 in infected cells. Moreover, UL53-S19 was specifically phosphorylated by UL97 in vitro. Notably, treatment of infected cells with the UL97 inhibitor maribavir or infection with a UL97 mutant led to a punctate rather than a continuous distribution of the NEC at the nuclear rim. Alanine substitutions in both UL50-S216 and UL53-S19 resulted in a punctate distribution of the NEC in infected cells and also decreased virus production and nuclear egress in the absence of maribavir. These results indicate that UL97 phosphorylates the NEC and suggest that this phosphorylation modulates nuclear egress. Thus, the UL97-NEC interaction appears to recruit UL97 to the nuclear rim both for disruption of the nuclear lamina and phosphorylation of the NEC. IMPORTANCE Human cytomegalovirus (HCMV) causes birth defects and it can cause life-threatening diseases in immunocompromised patients. HCMV assembles in the nucleus and then translocates to the cytoplasm in an unusual process termed nuclear egress, an attractive target for antiviral therapy. A viral enzyme, UL97, is important for nuclear egress. It has been proposed that this is due to its role in disruption of the

  7. The dependence of viral parameter estimates on the assumed viral life cycle: limitations of studies of viral load data.

    PubMed Central

    Lloyd, A. L.


    Estimation of viral parameters, such as the basic reproductive number (R0) and infected cell life span, is central to the quantitative study of the within-host dynamics of viral diseases such as human immunodeficiency virus, hepatitis B or hepatitis C. As these parameters can rarely be determined directly, they are usually estimated indirectly by fitting mathematical models to viral load data. This paper investigates how parameter estimates obtained by such procedures depend on the assumptions made concerning the viral life cycle. It finds that estimates of the basic reproductive number obtained using viral load data collected during the initial stages of infection can depend quite sensitively on these assumptions. The use of models which neglect the intracellular delay before virion production can lead to severe underestimates of R0 and, hence, to overly optimistic predictions of how efficacious treatment must be in order to prevent or eradicate the disease. These results are also of importance for attempts at estimating R0 from similar epidemiological data as there is a correspondence between within-host and between-host models. Estimates of the life span of infected cells obtained from viral load data collected during drug treatment studies also depend on the assumptions made in modelling the virus life cycle. The use of more realistic descriptions of the life cycle is seen to increase estimates of infected cell life span, in addition to providing a new explanation for the shoulder phase seen during drug treatment. This study highlights the limitations of what can be learnt by fitting mathematical models to infectious disease data without detailed independent knowledge of the life cycle of the infectious agent. PMID:11345331

  8. LL37 and Cationic Peptides Enhance TLR3 Signaling by Viral Double-stranded RNAs

    PubMed Central

    Lai, Yvonne; Adhikarakunnathu, Sreedevi; Bhardwaj, Kanchan; Ranjith-Kumar, C. T.; Wen, Yahong; Jordan, Jarrat L.; Wu, Linda H.; Dragnea, Bogdan; Mateo, Lani San; Kao, C. Cheng


    Background Toll-like Receptor 3 (TLR3) detects viral dsRNA during viral infection. However, most natural viral dsRNAs are poor activators of TLR3 in cell-based systems, leading us to hypothesize that TLR3 needs additional factors to be activated by viral dsRNAs. The anti-microbial peptide LL37 is the only known human member of the cathelicidin family of anti-microbial peptides. LL37 complexes with bacterial lipopolysaccharide (LPS) to prevent activation of TLR4, binds to ssDNA to modulate TLR9 and ssRNA to modulate TLR7 and 8. It synergizes with TLR2/1, TLR3 and TLR5 agonists to increase IL8 and IL6 production. This work seeks to determine whether LL37 enhances viral dsRNA recognition by TLR3. Methodology/Principal Findings Using a human bronchial epithelial cell line (BEAS2B) and human embryonic kidney cells (HEK 293T) transiently transfected with TLR3, we found that LL37 enhanced poly(I:C)-induced TLR3 signaling and enabled the recognition of viral dsRNAs by TLR3. The presence of LL37 also increased the cytokine response to rhinovirus infection in BEAS2B cells and in activated human peripheral blood mononuclear cells. Confocal microscopy determined that LL37 could co-localize with TLR3. Electron microscopy showed that LL37 and poly(I:C) individually formed globular structures, but a complex of the two formed filamentous structures. To separate the effects of LL37 on TLR3 and TLR4, other peptides that bind RNA and transport the complex into cells were tested and found to activate TLR3 signaling in response to dsRNAs, but had no effect on TLR4 signaling. This is the first demonstration that LL37 and other RNA-binding peptides with cell penetrating motifs can activate TLR3 signaling and facilitate the recognition of viral ligands. Conclusions/Significance LL37 and several cell-penetrating peptides can enhance signaling by TLR3 and enable TLR3 to respond to viral dsRNA. PMID:22039520

  9. Molecular imaging of oncolytic viral therapy

    PubMed Central

    Haddad, Dana; Fong, Yuman


    Oncolytic viruses have made their mark on the cancer world as a potential therapeutic option, with the possible advantages of reduced side effects and strengthened treatment efficacy due to higher tumor selectivity. Results have been so promising, that oncolytic viral treatments have now been approved for clinical trials in several countries. However, clinical studies may benefit from the ability to noninvasively and serially identify sites of viral targeting via molecular imaging in order to provide safety, efficacy, and toxicity information. Furthermore, molecular imaging of oncolytic viral therapy may provide a more sensitive and specific diagnostic technique to detect tumor origin and, more importantly, presence of metastases. Several strategies have been investigated for molecular imaging of viral replication broadly categorized into optical and deep tissue imaging, utilizing several reporter genes encoding for fluorescence proteins, conditional enzymes, and membrane protein and transporters. Various imaging methods facilitate molecular imaging, including computer tomography, magnetic resonance imaging, positron emission tomography, single photon emission CT, gamma-scintigraphy, and photoacoustic imaging. In addition, several molecular probes are used for medical imaging, which act as targeting moieties or signaling agents. This review will explore the preclinical and clinical use of in vivo molecular imaging of replication-competent oncolytic viral therapy. PMID:27119098

  10. [Viral safety: European and French directives].


    Rossi, F; Legras, J F


    The viral safety of IVIg is defined by transposition of European Directives. Directive 89/381/CEE defines plasma-derived medicinal products (pd-MP) which should be registred through a Marketing Authorization (75/318/CEE) and requires specific criteria for donation acceptability and fractionation processing. Recommendations and Notes for Guidance are prepared by the "Biotechnology Working Party" (BWP), Committee for Proprietary Medicinal Products (CPMP) ad hoc group. "Note for Guidance on Virus Validation Studies: CPMP/BWP/268/95" defines, for conventional viruses, the validation study as regards viral elimination /inactivation steps (relevant virus, scale reduction system and statistical interpretation of the results). "Note for Guidance on 'blood products'- CPMP/BWP/269/95" defines the key issues of viral safety: starting material, viral elimination /inactivation steps within the fractionation processing and in process controls. Pd-MP used as excipients are also covered. BWP/CPMP recommends that exclusion criteria only be considered for sporadic, familial or iatrogenic Creutzfeldt-Jakob disease (CJD), while withdrawal should be undertaken, according to the precaution principle, when a donor is suffering from nv-CJD (February 1998). Also, screening tests currently under development for transmissible spongiform encephalopathies are encouraged to be introduced for fractionation products (January 1999). Some donor exclusion criteria for conventional viruses and prions are specific to France. In conclusion, measures taken to ensure pd-MP viral safety are constantly changing. Its evaluation can only be done when considering numerous parameters within a global context.

  11. Viral-associated glomerulopathies in children

    PubMed Central

    Wenderfer, Scott E.


    Viral infections associate temporally with the onset of many glomerular diseases, particularly in children. In other cases of glomerulonephritis, when infection is clinically silent, viral syndromes can still be implicated as a trigger. However, strong evidence for viral causality in most glomerular disease is still lacking. While numerous case reports in children document the occurrence of specific forms of glomerular disease after seroconversion to a wide range of viruses, relatively few reports provide pathologic evidence of viral infection associated with glomerular lesions on kidney biopsy. Strong associations between hepatitis viruses and glomerular injury have been acknowledged in adults, but hepatitis C virus appears not to be an etiology in children. In the context of treating glomerular diseases, when diagnosed, the treatment of hepatitis B virus, cytomegalovirus and human immunodeficiency virus in children with membranoproliferative, membranous and collapsing glomerulopathy plays an important role. Otherwise, there is no evidence suggesting that the identification of a viral infection in a child with glomerulopathy should change the management of the infection or the glomerulonephritis. Therefore, additional research into this topic is very much needed. PMID:25752759

  12. Bacterial and viral infections associated with influenza.


    Joseph, Carol; Togawa, Yu; Shindo, Nahoko


    Influenza-associated bacterial and viral infections are responsible for high levels of morbidity and death during pandemic and seasonal influenza episodes. A review was undertaken to assess and evaluate the incidence, epidemiology, aetiology, clinical importance and impact of bacterial and viral co-infection and secondary infection associated with influenza. A review was carried out of published articles covering bacterial and viral infections associated with pandemic and seasonal influenza between 1918 and 2009 (and published through December 2011) to include both pulmonary and extra-pulmonary infections. While pneumococcal infection remains the predominant cause of bacterial pneumonia, the review highlights the importance of other co- and secondary bacterial and viral infections associated with influenza, and the emergence of newly identified dual infections associated with the 2009 H1N1 pandemic strain. Severe influenza-associated pneumonia is often bacterial and will necessitate antibiotic treatment. In addition to the well-known bacterial causes, less common bacteria such as Legionella pneumophila may also be associated with influenza when new influenza strains emerge. This review should provide clinicians with an overview of the range of bacterial and viral co- or secondary infections that could present with influenza illness.

  13. Viral Vectors: The Road to Reducing Genotoxicity.


    David, Rhiannon M; Doherty, Ann T


    Viral vector use in gene therapy has highlighted several safety concerns, including genotoxic events. Generally, vector-mediated genotoxicity results from upregulation of cellular proto-oncogenes via promoter insertion, promoter activation, or gene transcript truncation, with enhancer-mediated activation of nearby genes the primary mechanism reported in gene therapy trials. Vector-mediated genotoxicity can be influenced by virus type, integration target site, and target cell type; different vectors have distinct integration profiles which are cell-specific. Non-viral factors, including patient age, disease, and dose can also influence genotoxic potential, thus the choice of test models and clinical trial populations is important to ensure they are indicative of efficacy and safety. Efforts have been made to develop viral vectors with less risk of insertional mutagenesis, including self-inactivating (SIN) vectors, enhancer-blocking insulators, and microRNA targeting of vectors, although insertional mutagenesis is not completely abrogated. Here we provide an overview of the current understanding of viral vector-mediated genotoxicity risk from factors contributing to viral vector-mediated genotoxicity to efforts made to reduce genotoxicity, and testing strategies required to adequately assess the risk of insertional mutagenesis. It is clear that there is not a 'one size fits all' approach to vector modification for reducing genotoxicity, and addressing these challenges will be a key step in the development of therapies such as CRISPR-Cas9 and delivery of future gene-editing technologies.

  14. Bovine viral diarrhea virus: biotypes and disease.

    PubMed Central

    Deregt, D; Loewen, K G


    Bovine viral diarrhea virus continues to produce significant economic losses for the cattle industry and challenges investigators with the complexity of diseases it produces and the mechanisms by which it causes disease. This paper updates and attempts to clarify information regarding the roles of noncytopathic and cytopathic bovine viral diarrhea viruses in persistent infections and mucosal disease. It also covers, in brief, what is known of the new diseases: thrombocytopenia and hemorrhagic disease, and a disease resembling mucosal disease that is apparently caused solely by noncytopathic virus. Although a good understanding of the roles of the 2 biotypes in the production of persistent infections and the precipitation of mucosal disease has been obtained, there are still unanswered questions regarding the origin of cytopathic viruses and the mechanism by which they cause pathological changes in cells. It is apparent, however, that cytopathic bovine viral diarrhea viruses arise by mutation of noncytopathic viruses, and it is known that p80 is the marker protein for cytopathic viruses. The previous distinction between mild bovine viral diarrhea and fatal mucosal disease has been eroded with the emergence of new virulent bovine viral diarrhea viruses. The new diseases pose a threat to the cattle industry and present a new challenge for investigators. Index Veterinarius (1984-1994) and Medline (1985-1994) databases and personal files updated since 1987 from BIOSIS Previews and Biosciences Information Services were used to search the literature. Images Figure 1. PMID:7648541

  15. Chronic viral hepatitis: the histology report.


    Guido, Maria; Mangia, Alessandra; Faa, Gavino


    In chronic viral hepatitis, the role of liver biopsy as a diagnostic test has seen a decline, paralleled by its increasing importance for prognostic purposes. Nowadays, the main indication for liver biopsy in chronic viral hepatitis is to assess the severity of the disease, in terms of both necro-inflammation (grade) and fibrosis (stage), which is important for prognosis and therapeutic management. Several scoring systems have been proposed for grading and staging chronic viral hepatitis and there is no a general consensus on the best system to be used in the daily practice. All scoring systems have their drawbacks and all may be affected by sampling and observer variability. Whatever the system used, a histological score is a reductive approach since damage in chronic viral hepatitis is a complex biological process. Thus, scoring systems are not intended to replace the detailed, descriptive, pathology report. In fact, lesions other than those scored for grading and staging may have clinical relevance and should be assessed and reported. This paper aims to provide a systematic approach to the interpretation of liver biopsies obtained in cases of chronic viral hepatitis, with the hope of helping general pathologists in their diagnostic practice.

  16. Lethal Mutagenesis Failure May Augment Viral Adaptation

    PubMed Central

    Paff, Matthew L.; Stolte, Steven P.; Bull, James J.


    Lethal mutagenesis, the attempt to extinguish a population by elevating its mutation rate, has been endorsed in the virology literature as a promising approach for treating viral infections. In support of the concept, in vitro studies have forced viral extinction with high doses of mutagenic drugs. However, the one known mutagenic drug used on patients commonly fails to cure infections, and in vitro studies typically find a wide range of mutagenic conditions permissive for viral growth. A key question becomes how subsequent evolution is affected if the viral population is mutated but avoids extinction—Is viral adaptation augmented rather than suppressed? Here we consider the evolution of highly mutated populations surviving mutagenesis, using the DNA phage T7. In assays using inhibitory hosts, whenever resistance mutants were observed, the mutagenized populations exhibited higher frequencies, but some inhibitors blocked plaque formation by even the mutagenized stock. Second, outgrowth of previously mutagenized populations led to rapid and potentially complete fitness recovery but polymorphism was slow to decay, and mutations exhibited inconsistent patterns of change. Third, the combination of population bottlenecks with mutagenesis did cause fitness declines, revealing a vulnerability that was not apparent from mutagenesis of large populations. The results show that a population surviving high mutagenesis may exhibit enhanced adaptation in some environments and experience little negative fitness consequences in many others. PMID:24092771

  17. Viral kinetic modeling: state of the art.


    Canini, Laetitia; Perelson, Alan S


    Viral kinetic (VK) modeling has led to increased understanding of the within host dynamics of viral infections and the effects of therapy. Here we review recent developments in the modeling of viral infection kinetics with emphasis on two infectious diseases: hepatitis C and influenza. We review how VK modeling has evolved from simple models of viral infections treated with a drug or drug cocktail with an assumed constant effectiveness to models that incorporate drug pharmacokinetics and pharmacodynamics, as well as phenomenological models that simply assume drugs have time varying-effectiveness. We also discuss multiscale models that include intracellular events in viral replication, models of drug-resistance, models that include innate and adaptive immune responses and models that incorporate cell-to-cell spread of infection. Overall, VK modeling has provided new insights into the understanding of the disease progression and the modes of action of several drugs. We expect that VK modeling will be increasingly used in the coming years to optimize drug regimens in order to improve therapeutic outcomes and treatment tolerability for infectious diseases.

  18. Fish viral infections in northwest of Spain.


    Ledo, A; Lupiani, B; Dopazo, C P; Toranzo, A E; Barja, J L


    During a three years survey, a total of 149 samples from 20 farms of rainbow trout, salmon and turbot were examined for the presence of virus with the purpose to study the viral infections affecting cultured fish and their incidence in the fishfarms of Northwestern Spain. Infectious pancreatic necrosis virus (IPNV) was the only viral agent isolated from salmonid fish. Fry and fingerlings of trout showed the highest infection rate (24%). This virus was not detected in broodstock or embryonated eggs, although it was isolated from ovaric and seminal fluids and from juvenile carriers. From 24 samples of salmon analyzed, IPNV was only detected in one sample of juveniles. Examination of turbot led the isolation of a new virus belonging to the reoviridae family, which affected to the ongrowing population. All of the IPNV tested belonged to serotype Sp regardless of the origin of the trout stocks. During the monitorization of imported embryonated eggs, no virus was detected from any of the samples. However, in some case, IPNV was isolated when testing the fry obtained in our laboratory from those samples of imported eggs. Our findings indicate that: i) the analysis of fingerlings increase the probability to detect viral infections allowing us an optimal control of importations, and ii) most of the viral infections of fish take place in the own fish farms. The detection of mixed viral and bacterial infections emphasize the importance of carrying out an integral microbiological analysis to determine the causal agent(s) of fish mortalities.

  19. Recombination-dependent concatemeric viral DNA replication.


    Lo Piano, Ambra; Martínez-Jiménez, María I; Zecchi, Lisa; Ayora, Silvia


    The initiation of viral double stranded (ds) DNA replication involves proteins that recruit and load the replisome at the replication origin (ori). Any block in replication fork progression or a programmed barrier may act as a factor for ori-independent remodelling and assembly of a new replisome at the stalled fork. Then replication initiation becomes dependent on recombination proteins, a process called recombination-dependent replication (RDR). RDR, which is recognized as being important for replication restart and stability in all living organisms, plays an essential role in the replication cycle of many dsDNA viruses. The SPP1 virus, which infects Bacillus subtilis cells, serves as a paradigm to understand the links between replication and recombination in circular dsDNA viruses. SPP1-encoded initiator and replisome assembly proteins control the onset of viral replication and direct the recruitment of host-encoded replisomal components at viral oriL. SPP1 uses replication fork reactivation to switch from ori-dependent θ-type (circle-to-circle) replication to σ-type RDR. Replication fork arrest leads to a double strand break that is processed by viral-encoded factors to generate a D-loop into which a new replisome is assembled, leading to σ-type viral replication. SPP1 RDR proteins are compared with similar proteins encoded by other viruses and their possible in vivo roles are discussed.

  20. Association of Bovine Viral Diarrhea Virus with Multiple Viral Infections in Bovine Respiratory Disease Outbreaks

    PubMed Central

    Richer, Lisette; Marois, Paul; Lamontagne, Lucie


    We investigated eleven outbreaks of naturally occurring bovine respiratory diseases in calves and adult animals in the St-Hyacinthe area of Quebec. Specific antibodies to bovine herpesvirus-1, bovine viral diarrhea virus, respiratory syncytial virus, parainfluenza type 3 virus, reovirus type 3, and serotypes 1 to 7 of bovine adenovirus were found in paired sera from diseased animals. Several bovine viruses with respiratory tropism were involved concomitantly in herds during an outbreak of bovine respiratory disease. In addition, concomitant fourfold rises of antibody titers were frequently observed to two or more viral agents in seroconverted calves (61%) or adult animals (38%). Bovine viral diarrhea virus was found to be the most frequent viral agent associated with multiple viral infection in calves only (92%). PMID:17423116

  1. Viral deubiquitinases: role in evasion of anti-viral innate immunity.


    Kumari, Puja; Kumar, Himanshu


    Host anti-viral innate-immune signalling pathways are regulated by a variety of post-translation modifications including ubiquitination, which is critical to regulate various signalling pathways for synthesis of anti-viral molecules. A homeostasis of host immune responses, induced due to viral infection and further ubiquitination, is maintained by the action of deubiquitinases (DUB). Infecting viruses utilize the process of deubiquitination for tricking host immune system wherein viral DUBs compete with host DUBs for inhibition of innate-immune anti-viral signalling pathways, which instead of maintaining an immune homeostasis bring about virus-mediated pathogenesis. This suggests that viruses co-evolve with their hosts to acquire similar machinery for tricking immune surveillance and establishing infection.

  2. Modulated Entry

    NASA Technical Reports Server (NTRS)

    Grant, Frederick C.


    The technique of modulation, or variable coefficients, is discussed and the analytical formulation is reviewed. Representative numerical results of the use of modulation are shown for the lifting and nonlifting cases. These results include the effects of modulation on peak acceleration, entry corridor, and heat absorption. Results are given for entry at satellite speed and escape speed. The indications are that coefficient modulation on a vehicle with good lifting capability offers the possibility of sizable loading reductions or, alternatively, wider corridors; thus, steep entries become practical from the loading standpoint. The amount of steepness depends on the acceptable heating penalty. The price of sizable fractions of the possible gains does not appear to be excessive.

  3. Diagnosis and Control of Viral Diseases of Reproductive Importance: Infectious Bovine Rhinotracheitis and Bovine Viral Diarrhea.


    Newcomer, Benjamin W; Givens, Daniel


    Both bovine viral diarrhea virus and bovine herpesvirus 1 can have significant negative reproductive impacts on cattle health. Vaccination is the primary control method for the viral pathogens in US cattle herds. Polyvalent, modified-live vaccines are recommended to provide optimal protection against various viral field strains. Of particular importance to bovine viral diarrhea control is the limitation of contact of pregnant cattle with potential viral reservoirs during the critical first 125 days of gestation.

  4. Hepatitis viral load correlates to glutathione levels.



    Several recent scientific articles have found a direct correlation between Glutathione levels and viral activity for hepatitis B and C. When viral load increases, Glutathione decreases. Researchers from Germany report that adding NAC (N-acetyl cysteine) to HBV producing cells lines can reduce hepatitis viral load 50 fold. Glutathione is used by the liver to help break down toxins. Patients who have chronic infection for more than 90 days should ask their physicians to check their Glutathione levels. A test kit is available from ImmunoSciences Labs; contact information is included. An amino acid, L-Glutamine, can be used with Alpha Lipoic Acid and NAC to increase Glutathione levels. Chlorophyll also offers benefits to people with hepatitis and other infections. Instructions on how to use a special retention enema containing chlorophyll, water, and apple cider vinegar are provided.

  5. V-GAP: Viral genome assembly pipeline.


    Nakamura, Yoji; Yasuike, Motoshige; Nishiki, Issei; Iwasaki, Yuki; Fujiwara, Atushi; Kawato, Yasuhiko; Nakai, Toshihiro; Nagai, Satoshi; Kobayashi, Takanori; Gojobori, Takashi; Ototake, Mitsuru


    Next-generation sequencing technologies have allowed the rapid determination of the complete genomes of many organisms. Although shotgun sequences from large genome organisms are still difficult to reconstruct perfect contigs each of which represents a full chromosome, those from small genomes have been assembled successfully into a very small number of contigs. In this study, we show that shotgun reads from phage genomes can be reconstructed into a single contig by controlling the number of read sequences used in de novo assembly. We have developed a pipeline to assemble small viral genomes with good reliability using a resampling method from shotgun data. This pipeline, named V-GAP (Viral Genome Assembly Pipeline), will contribute to the rapid genome typing of viruses, which are highly divergent, and thus will meet the increasing need for viral genome comparisons in metagenomic studies. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Shedding new light on viral photosynthesis.


    Puxty, Richard J; Millard, Andrew D; Evans, David J; Scanlan, David J


    Viruses infecting the environmentally important marine cyanobacteria Prochlorococcus and Synechococcus encode 'auxiliary metabolic genes' (AMGs) involved in the light and dark reactions of photosynthesis. Here, we discuss progress on the inventory of such AMGs in the ever-increasing number of viral genome sequences as well as in metagenomic datasets. We contextualise these gene acquisitions with reference to a hypothesised fitness gain to the phage. We also report new evidence with regard to the sequence and predicted structural properties of viral petE genes encoding the soluble electron carrier plastocyanin. Viral copies of PetE exhibit extensive modifications to the N-terminal signal peptide and possess several novel residues in a region responsible for interaction with redox partners. We also highlight potential knowledge gaps in this field and discuss future opportunities to discover novel phage-host interactions involved in the photosynthetic process.

  7. Developments in Viral Vector-Based Vaccines

    PubMed Central

    Ura, Takehiro; Okuda, Kenji; Shimada, Masaru


    Viral vectors are promising tools for gene therapy and vaccines. Viral vector-based vaccines can enhance immunogenicity without an adjuvant and induce a robust cytotoxic T lymphocyte (CTL) response to eliminate virus-infected cells. During the last several decades, many types of viruses have been developed as vaccine vectors. Each has unique features and parental virus-related risks. In addition, genetically altered vectors have been developed to improve efficacy and safety, reduce administration dose, and enable large-scale manufacturing. To date, both successful and unsuccessful results have been reported in clinical trials. These trials provide important information on factors such as toxicity, administration dose tolerated, and optimized vaccination strategy. This review highlights major viral vectors that are the best candidates for clinical use. PMID:26344749

  8. Human viral oncogenesis: a cancer hallmarks analysis.


    Mesri, Enrique A; Feitelson, Mark A; Munger, Karl


    Approximately 12% of all human cancers are caused by oncoviruses. Human viral oncogenesis is complex, and only a small percentage of the infected individuals develop cancer, often many years to decades after the initial infection. This reflects the multistep nature of viral oncogenesis, host genetic variability, and the fact that viruses contribute to only a portion of the oncogenic events. In this review, the Hallmarks of Cancer framework of Hanahan and Weinberg (2000 and 2011) is used to dissect the viral, host, and environmental cofactors that contribute to the biology of multistep oncogenesis mediated by established human oncoviruses. The viruses discussed include Epstein-Barr virus (EBV), high-risk human papillomaviruses (HPVs), hepatitis B and C viruses (HBV and HCV, respectively), human T cell lymphotropic virus-1 (HTLV-1), and Kaposi's sarcoma herpesvirus (KSHV).

  9. Controlling viral capsid assembly with templating

    NASA Astrophysics Data System (ADS)

    Hagan, Michael F.


    We develop coarse-grained models that describe the dynamic encapsidation of functionalized nanoparticles by viral capsid proteins. We find that some forms of cooperative interactions between protein subunits and nanoparticles can dramatically enhance rates and robustness of assembly, as compared to the spontaneous assembly of subunits into empty capsids. For large core-subunit interactions, subunits adsorb onto core surfaces en masse in a disordered manner, and then undergo a cooperative rearrangement into an ordered capsid structure. These assembly pathways are unlike any identified for empty capsid formation. Our models can be directly applied to recent experiments in which viral capsid proteins assemble around functionalized inorganic nanoparticles [Sun , Proc. Natl. Acad. Sci. U.S.A. 104, 1354 (2007)]. In addition, we discuss broader implications for understanding the dynamic encapsidation of single-stranded genomic molecules during viral replication and for developing multicomponent nanostructured materials.

  10. [Obesity development associated with viral infections].


    Jaworowska, Agnieszka; Bazylak, Grzegorz


    This overview of the significance of viral infections in the development of human obesity is presented within context of the commonly recognized obesity risk factors, including the personal and public health consequences of obesity in various countries. In addition, the results of past and recently published studies on the recognition of six taxonomically different viruses which can undoubtedly be associated with obesity progression in some species of animals are summarized. More attention is focused on the results of preliminary epidemiological studies indicating that human infection by the avian adenovirus SMAM-1 or the human adenovirus Ad-36 can be objectively related to symptoms, prevalence, and complications of obesity in some adult men. Proposed pathogenic pathways involved in the observed cases of viral infection-dependent obesity in animals and humans are also briefly described. Urgent implementation of high-throughput diagnostics procedures is advised to extend viral infection-oriented modes of prevention, recognition, and therapy of obesity currently available in modern societies.

  11. Controlling Viral Capsid Assembly with Templating

    PubMed Central

    Hagan, Michael F.


    We develop coarse-grained models that describe the dynamic encapsidation of functionalized nanoparticles by viral capsid proteins. We find that some forms of cooperative interactions between protein subunits and nanoparticles can dramatically enhance rates and robustness of assembly, as compared to the spontaneous assembly of subunits into empty capsids. For large core-subunit interactions, subunits adsorb onto core surfaces en masse in a disordered manner, and then undergo a cooperative rearrangement into an ordered capsid structure. These assembly pathways are unlike any identified for empty capsid formation. Our models can be directly applied to recent experiments in which viral capsid proteins assemble around the functionalized inorganic nanoparticles [Sun et al., Proc. Natl. Acad. Sci (2007) 104, 1354]. In addition, we discuss broader implications for understanding the dynamic encapsidation of single-stranded genomic molecules during viral replication and for developing multicomponent nanostructured materials. PMID:18643099

  12. [Viral retinitis following intravitreal triamcinolone injection].


    Zghal, I; Malek, I; Amel, C; Soumaya, O; Bouguila, H; Nacef, L


    Necrotizing viral retinitis is associated with infection by the Herpes family of viruses, especially herpes simplex virus (HSV), varicella zoster virus (VZV) and occasionally cytomegalovirus (CMV). When the diagnosis is suspected clinically, antiviral therapy must be instituted immediately. We report the case of a patient presenting with necrotizing viral retinitis 3 months following intravitreal injection of triamcinolone acetonide for diabetic macular edema. Fluorescein angiography demonstrated a superior temporal occlusive vasculitis. A diagnostic anterior chamber paracentesis was performed to obtain deoxyribo-nucleic acid (DNA) for a polymerase chain reaction (PCR) test for viral retinitis. PCR was positive for CMV. The patient was placed on intravenous ganciclovir. CMV retinitis is exceedingly rare in immunocompetent patients; however, it remains the most common cause of posterior uveitis in immunocompromised patients. The incidence of this entity remains unknown. Local immunosuppression, the dose and the frequency of injections may explain the occurrence of this severe retinitis.

  13. Molecular basis of viral and microbial pathogenesis

    SciTech Connect

    Rott, R.; Goebel, W.


    The contents of this book are: Correlation Between Viroid Structure and Pathogenicty; Antigenicity of the Influenza Haemagglutinia Membrane Glycoprotein; Viral Glycoproteins as Determinants of Pathogenicity; Virus Genes Involved in Host Range and Pathogenicity; Molecular Heterogenetiy of Pathogenic Herpus Viruses; Recombination of Foreign (Viral) DNA with Host Genome: Studies in Vivo and in a Cell-Free system; Disorders of Cellular Neuro-Functions by Persistent Viral Infection; Pathogenic Aspects of Measles Virus-Persistent Infections in Man; Analysis of the Dual Lineage Specificity of E26 Avian Leukemia Virus; Mx Gene Control of Influenza Virus Susceptibility; Shiga and Shika-Like Toxins: A Family of Related Cytokinons; and Molecular Mechanisms of Pathogenicity in Shigella Flexneri.

  14. Viral vector-based influenza vaccines

    PubMed Central

    de Vries, Rory D.; Rimmelzwaan, Guus F.


    ABSTRACT Antigenic drift of seasonal influenza viruses and the occasional introduction of influenza viruses of novel subtypes into the human population complicate the timely production of effective vaccines that antigenically match the virus strains that cause epidemic or pandemic outbreaks. The development of game-changing vaccines that induce broadly protective immunity against a wide variety of influenza viruses is an unmet need, in which recombinant viral vectors may provide. Use of viral vectors allows the delivery of any influenza virus antigen, or derivative thereof, to the immune system, resulting in the optimal induction of virus-specific B- and T-cell responses against this antigen of choice. This systematic review discusses results obtained with vectored influenza virus vaccines and advantages and disadvantages of the currently available viral vectors. PMID:27455345

  15. [Epidemiology of viral hepatitis in Mexico].


    Panduro, Arturo; Escobedo Meléndez, Griselda; Fierro, Nora A; Ruiz Madrigal, Bertha; Zepeda-Carrillo, Eloy Alfonso; Román, Sonia


    The main etiology of liver disease in Mexico is alcohol and viral hepatitis. The aim of the present study was to analyze the current epidemiology of viral hepatitis in Mexico. From 2000 to 2007 the Ministry of Health reported 192 588 cases of hepatitis, 79% HAV, 3.3% HBV, 6% HCV, and 12% without a specific etiologic factor. Due to high endemic areas for HBV infection in native Mexican population, limitations in the diagnostic sensitivity and specificity of the serological immunoassays used to date and presence of occult hepatitis B in the country, the real prevalence of HBV infection could be even higher than HCV in Mexico. Hepatitis E virus in cirrhotic patients and in porcine farms could at least partially explain the cases of hepatitis that are diagnosed without a specific etiologic agent. Specific strategies to establish control regulations against viral hepatitis infections in Mexico are proposed.

  16. Latent Herpes Viral Reactivation in Astronauts

    NASA Technical Reports Server (NTRS)

    Pierson, D. L.; Mehta, S. K.; Stowe, R.


    Latent viruses are ubiquitous and reactivate during stressful periods with and without symptoms. Latent herpes virus reactivation is used as a tool to predict changes in the immune status in astronauts and to evaluate associated health risks. Methods: Viral DNA was detected by real time polymerase chain reaction in saliva and urine from astronauts before, during and after short and long-duration space flights. Results and Discussion: EpsteinBarr virus (EBV), cytomegalovirus (CMV), and varicella zoster virus (VZV) reactivated, and viral DNA was shed in saliva (EBV and VZV) or urine (CMV). EBV levels in saliva during flight were 10fold higher than baseline levels. Elevations in EBV specific CD8+ T-cells, viral antibody titers, and specific cytokines were consistent with viral reactivation. Intracellular levels of cytokines were reduced in EBVspecific Tcells. CMV, rarely present in urine of healthy individuals, was shed in urine of 27% of astronauts during all phases of spaceflight. VZV, not found in saliva of asymptomatic individuals, was found in saliva of 50% of astronauts during spaceflight and 35 days after flight. VZV recovered from astronaut saliva was found to be live, infectious virus. DNA sequencing demonstrated that the VZV recovered from astronauts was from the common European strain of VZV. Elevation of stress hormones accompanied viral reactivation indicating involvement of the hypothalmic-pituitary-adrenal and sympathetic adrenal-medullary axes in the mechanism of viral reactivation in astronauts. A study of 53 shingles patients found that all shingles patients shed VZV DNA in their saliva and the VZV levels correlated with the severity of the disease. Lower VZV levels in shingles patients were similar to those observed in astronauts. We proposed a rapid, simple, and cost-effective assay to detect VZV in saliva of patients with suspected shingles. Early detection of VZV infection allows early medical intervention.

  17. Metatranscriptomic analysis of extremely halophilic viral communities

    PubMed Central

    Santos, Fernando; Moreno-Paz, Mercedes; Meseguer, Inmaculada; López, Cristina; Rosselló-Mora, Ramon; Parro, Víctor; Antón, Josefa


    Hypersaline environments harbour the highest number of viruses reported for aquatic environments. In crystallizer ponds from solar salterns, haloviruses coexist with extremely halophilic Archaea and Bacteria and present a high diversity although little is known about their activity. In this work, we analyzed the viral expression in one crystallizer using a metatranscriptomic approach in which clones from a metaviromic library were immobilized in a microarray and used as probes against total mRNA extracted from the hypersaline community. This approach has two advantages: (i) it overcomes the fact that there is no straightforward, unambiguous way to extract viral mRNA from bulk mRNAs and (ii) it makes the sequencing of all mRNAs unnecessary. Transcriptomic data indicated that the halovirus assemblage was highly active at the time of sampling and the viral groups with the highest expression levels were those related to high GC content haloarchaea and Salinibacter representatives, which are minor components in the environment. Moreover, the changes in the viral expression pattern and in the numbers of free viral particles were analyzed after submitting the samples to two stress conditions: ultraviolet-radiation and dilution. Results showed that Archaea were more sensitive than Bacteria to these stress conditions. The overexpression in the predicted archaeal virus fraction raised and the total numbers of free viruses increased. Furthermore, we identified some very closely related viral clones, displaying single-nucleotide polymorphisms, which were expressed only under certain conditions. These clones could be part of very closely related virus genomes for which we propose the term ‘ecoviriotypes'. PMID:21490689

  18. Latent Herpes Viral Reactivation in Astronauts

    NASA Technical Reports Server (NTRS)

    Pierson, D. L.; Mehta, S. K.; Stowe, R.


    Latent viruses are ubiquitous and reactivate during stressful periods with and without symptoms. Latent herpes virus reactivation is used as a tool to predict changes in the immune status in astronauts and to evaluate associated health risks. Methods: Viral DNA was detected by real time polymerase chain reaction in saliva and urine from astronauts before, during and after short and long-duration space flights. Results and Discussion: EpsteinBarr virus (EBV), cytomegalovirus (CMV), and varicella zoster virus (VZV) reactivated, and viral DNA was shed in saliva (EBV and VZV) or urine (CMV). EBV levels in saliva during flight were 10fold higher than baseline levels. Elevations in EBV specific CD8+ T-cells, viral antibody titers, and specific cytokines were consistent with viral reactivation. Intracellular levels of cytokines were reduced in EBVspecific Tcells. CMV, rarely present in urine of healthy individuals, was shed in urine of 27% of astronauts during all phases of spaceflight. VZV, not found in saliva of asymptomatic individuals, was found in saliva of 50% of astronauts during spaceflight and 35 days after flight. VZV recovered from astronaut saliva was found to be live, infectious virus. DNA sequencing demonstrated that the VZV recovered from astronauts was from the common European strain of VZV. Elevation of stress hormones accompanied viral reactivation indicating involvement of the hypothalmic-pituitary-adrenal and sympathetic adrenal-medullary axes in the mechanism of viral reactivation in astronauts. A study of 53 shingles patients found that all shingles patients shed VZV DNA in their saliva and the VZV levels correlated with the severity of the disease. Lower VZV levels in shingles patients were similar to those observed in astronauts. We proposed a rapid, simple, and cost-effective assay to detect VZV in saliva of patients with suspected shingles. Early detection of VZV infection allows early medical intervention.

  19. IFITM Proteins Restrict Viral Membrane Hemifusion

    PubMed Central

    Golfetto, Ottavia; Bungart, Brittani; Li, Minghua; Ding, Shilei; He, Yuxian; Liang, Chen; Lee, James C.; Gratton, Enrico; Cohen, Fredric S.; Liu, Shan-Lu


    The interferon-inducible transmembrane (IFITM) protein family represents a new class of cellular restriction factors that block early stages of viral replication; the underlying mechanism is currently not known. Here we provide evidence that IFITM proteins restrict membrane fusion induced by representatives of all three classes of viral membrane fusion proteins. IFITM1 profoundly suppressed syncytia formation and cell-cell fusion induced by almost all viral fusion proteins examined; IFITM2 and IFITM3 also strongly inhibited their fusion, with efficiency somewhat dependent on cell types. Furthermore, treatment of cells with IFN also markedly inhibited viral membrane fusion and entry. By using the Jaagsiekte sheep retrovirus envelope and influenza A virus hemagglutinin as models for study, we showed that IFITM-mediated restriction on membrane fusion is not at the steps of receptor- and/or low pH-mediated triggering; instead, the creation of hemifusion was essentially blocked by IFITMs. Chlorpromazine (CPZ), a chemical known to promote the transition from hemifusion to full fusion, was unable to rescue the IFITM-mediated restriction on fusion. In contrast, oleic acid (OA), a lipid analog that generates negative spontaneous curvature and thereby promotes hemifusion, virtually overcame the restriction. To explore the possible effect of IFITM proteins on membrane molecular order and fluidity, we performed fluorescence labeling with Laurdan, in conjunction with two-photon laser scanning and fluorescence-lifetime imaging microscopy (FLIM). We observed that the generalized polarizations (GPs) and fluorescence lifetimes of cell membranes expressing IFITM proteins were greatly enhanced, indicating higher molecularly ordered and less fluidized membranes. Collectively, our data demonstrated that IFITM proteins suppress viral membrane fusion before the creation of hemifusion, and suggested that they may do so by reducing membrane fluidity and conferring a positive spontaneous

  20. Characterization of a defective interfering RNA that contains a mosaic of a plant viral genome

    SciTech Connect

    Morris, T.J.; Jackson, A.O.


    Our lab was the first to describe and characterize a defective interfering RNA (DI RNAs or DIs) in association with a small RNA plant virus. The features of the DIs that we discovered in infections of tomato bushy stunt virus were compatible with the properties of DIs identified in many animal virus infections. Animal virologists have generally recognized the importance of studying DIs because they are invaluable tools for identifying cis-acting sequences important in virus multiplication and because they offer the opportunity to elucidate mechanisms involved in viral persistence and disease attenuation. Hence our discovery offered a comparably valuable tool for use in plant virus studies for the first time. Since then, we have also discovered the second example of plant viral DI RNAs associated with turnip crinkle virus (TCV), a virus structurally related to TBSV. We proposed a thorough characterization of this unique class of symptom modulating RNAs with the overall objective of identifying viral RNA nucleotide, sequences involved in such fundamental processes as virus replication and encapsidation as well as the degree of symptom expression resulting from the viral-DI-host interaction. The proposed research focused on the molecular characterization of the DI RNAs and the helper virus. We had demonstrated that the DIs were collinear deletion mutants of the genome of a cherry strain of tomato bushy stunt virus (TBSV). We had also shown that these low molecular weight RNAs interfered with the helper plant virus and modulated disease expression by preventing the development of a lethal necrotic disease in susceptible host plants. We also suggested that by exploring the mechanisms associated with the symptom attenuation effect, we might be able to devise novel strategies useful for engineering viral disease resistance.

  1. Engineering targeted viral vectors for gene therapy.


    Waehler, Reinhard; Russell, Stephen J; Curiel, David T


    To achieve therapeutic success, transfer vehicles for gene therapy must be capable of transducing target cells while avoiding impact on non-target cells. Despite the high transduction efficiency of viral vectors, their tropism frequently does not match the therapeutic need. In the past, this lack of appropriate targeting allowed only partial exploitation of the great potential of gene therapy. Substantial progress in modifying viral vectors using diverse techniques now allows targeting to many cell types in vitro. Although important challenges remain for in vivo applications, the first clinical trials with targeted vectors have already begun to take place.

  2. Arrhythmias in viral myocarditis and pericarditis.


    Baksi, A John; Kanaganayagam, G Sunthar; Prasad, Sanjay K


    Acute viral myocarditis and acute pericarditis are self-limiting conditions that run a benign course and that may not involve symptoms that lead to medical assessment. However, ventricular arrhythmia is frequent in viral myocarditis. Myocarditis is thought to account for a large proportion of sudden cardiac deaths in young people without prior structural heart disease. Identification of acute myocarditis either with or without pericarditis is therefore important. However, therapeutic interventions are limited and nonspecific. Identifying those at greatest risk of a life-threatening arrhythmia is critical to reducing the mortality. This review summarizes current understanding of this challenging area in which many questions remain.

  3. Viral and host proteins involved in picornavirus life cycle.


    Lin, Jing-Yi; Chen, Tzu-Chun; Weng, Kuo-Feng; Chang, Shih-Cheng; Chen, Li-Lien; Shih, Shin-Ru


    Picornaviruses cause several diseases, not only in humans but also in various animal hosts. For instance, human enteroviruses can cause hand-foot-and-mouth disease, herpangina, myocarditis, acute flaccid paralysis, acute hemorrhagic conjunctivitis, severe neurological complications, including brainstem encephalitis, meningitis and poliomyelitis, and even death. The interaction between the virus and the host is important for viral replication, virulence and pathogenicity. This article reviews studies of the functions of viral and host factors that are involved in the life cycle of picornavirus. The interactions of viral capsid proteins with host cell receptors is discussed first, and the mechanisms by which the viral and host cell factors are involved in viral replication, viral translation and the switch from translation to RNA replication are then addressed. Understanding how cellular proteins interact with viral RNA or viral proteins, as well as the roles of each in viral infection, will provide insights for the design of novel antiviral agents based on these interactions.

  4. Naf1 Regulates HIV-1 Latency by Suppressing Viral Promoter-Driven Gene Expression in Primary CD4+ T Cells.


    Li, Chuan; Wang, Hai-Bo; Kuang, Wen-Dong; Ren, Xiao-Xin; Song, Shu-Ting; Zhu, Huan-Zhang; Li, Qiang; Xu, Li-Ran; Guo, Hui-Jun; Wu, Li; Wang, Jian-Hua


    HIV-1 latency is characterized by reversible silencing of viral transcription driven by the long terminal repeat (LTR) promoter of HIV-1. Cellular and viral factors regulating LTR activity contribute to HIV-1 latency, and certain repressive cellular factors modulate viral transcription silencing. Nef-associated factor 1 (Naf1) is a host nucleocytoplasmic shuttling protein that regulates multiple cellular signaling pathways and HIV-1 production. We recently reported that nuclear Naf1 promoted nuclear export of unspliced HIV-1 gag mRNA, leading to increased Gag production. Here we demonstrate new functions of Naf1 in regulating HIV-1 persistence. We found that Naf1 contributes to the maintenance of HIV-1 latency by inhibiting LTR-driven HIV-1 gene transcription in a nuclear factor kappa B-dependent manner. Interestingly, Naf1 knockdown significantly enhanced viral reactivation in both latently HIV-1-infected Jurkat T cells and primary central memory CD4(+) T cells. Furthermore, Naf1 knockdown in resting CD4(+) T cells from HIV-1-infected individuals treated with antiretroviral therapy significantly increased viral reactivation upon T-cell activation, suggesting an important role of Naf1 in modulating HIV-1 latency in vivo Our findings provide new insights for a better understanding of HIV-1 latency and suggest that inhibition of Naf1 activity to activate latently HIV-1-infected cells may be a potential therapeutic strategy.

  5. Membranes, peptides, and disease: unraveling the mechanisms of viral proteins with solid state nuclear magnetic resonance spectroscopy.


    Eddy, Matthew T; Yu, Tsyr-Yan


    The interplay between peptides and lipid bilayers drives crucial biological processes. For example, a critical step in the replication cycle of enveloped viruses is the fusion of the viral membrane and host cell endosomal membrane, and these fusion events are controlled by viral fusion peptides. Thus such membrane-interacting peptides are of considerable interest as potential pharmacological targets. Deeper insight is needed into the mechanisms by which fusion peptides and other viral peptides modulate their surrounding membrane environment, and also how the particular membrane environment modulates the structure and activity of these peptides. An important step toward understanding these processes is to characterize the structure of viral peptides in environments that are as biologically relevant as possible. Solid state nuclear magnetic resonance (ssNMR) is uniquely well suited to provide atomic level information on the structure and dynamics of both membrane-associated peptides as well as the lipid bilayer itself; further ssNMR can delineate the contribution of specific membrane components, such as cholesterol, or changing cellular conditions, such as a decrease in pH on membrane-associating peptides. This paper highlights recent advances in the study of three types of membrane associated viral peptides by ssNMR to illustrate the more general power of ssNMR in addressing important biological questions involving membrane proteins. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. ViralORFeome: an integrated database to generate a versatile collection of viral ORFs

    PubMed Central

    Pellet, J.; Tafforeau, L.; Lucas-Hourani, M.; Navratil, V.; Meyniel, L.; Achaz, G.; Guironnet-Paquet, A.; Aublin-Gex, A.; Caignard, G.; Cassonnet, P.; Chaboud, A.; Chantier, T.; Deloire, A.; Demeret, C.; Le Breton, M.; Neveu, G.; Jacotot, L.; Vaglio, P.; Delmotte, S.; Gautier, C.; Combet, C.; Deleage, G.; Favre, M.; Tangy, F.; Jacob, Y.; Andre, P.; Lotteau, V.; Rabourdin-Combe, C.; Vidalain, P. O.


    Large collections of protein-encoding open reading frames (ORFs) established in a versatile recombination-based cloning system have been instrumental to study protein functions in high-throughput assays. Such ‘ORFeome’ resources have been developed for several organisms but in virology, plasmid collections covering a significant fraction of the virosphere are still needed. In this perspective, we present ViralORFeome 1.0 (, an open-access database and management system that provides an integrated set of bioinformatic tools to clone viral ORFs in the Gateway® system. ViralORFeome provides a convenient interface to navigate through virus genome sequences, to design ORF-specific cloning primers, to validate the sequence of generated constructs and to browse established collections of virus ORFs. Most importantly, ViralORFeome has been designed to manage all possible variants or mutants of a given ORF so that the cloning procedure can be applied to any emerging virus strain. A subset of plasmid constructs generated with ViralORFeome platform has been tested with success for heterologous protein expression in different expression systems at proteome scale. ViralORFeome should provide our community with a framework to establish a large collection of virus ORF clones, an instrumental resource to determine functions, activities and binding partners of viral proteins. PMID:20007148

  7. ViralORFeome: an integrated database to generate a versatile collection of viral ORFs.


    Pellet, J; Tafforeau, L; Lucas-Hourani, M; Navratil, V; Meyniel, L; Achaz, G; Guironnet-Paquet, A; Aublin-Gex, A; Caignard, G; Cassonnet, P; Chaboud, A; Chantier, T; Deloire, A; Demeret, C; Le Breton, M; Neveu, G; Jacotot, L; Vaglio, P; Delmotte, S; Gautier, C; Combet, C; Deleage, G; Favre, M; Tangy, F; Jacob, Y; Andre, P; Lotteau, V; Rabourdin-Combe, C; Vidalain, P O


    Large collections of protein-encoding open reading frames (ORFs) established in a versatile recombination-based cloning system have been instrumental to study protein functions in high-throughput assays. Such 'ORFeome' resources have been developed for several organisms but in virology, plasmid collections covering a significant fraction of the virosphere are still needed. In this perspective, we present ViralORFeome 1.0 (, an open-access database and management system that provides an integrated set of bioinformatic tools to clone viral ORFs in the Gateway(R) system. ViralORFeome provides a convenient interface to navigate through virus genome sequences, to design ORF-specific cloning primers, to validate the sequence of generated constructs and to browse established collections of virus ORFs. Most importantly, ViralORFeome has been designed to manage all possible variants or mutants of a given ORF so that the cloning procedure can be applied to any emerging virus strain. A subset of plasmid constructs generated with ViralORFeome platform has been tested with success for heterologous protein expression in different expression systems at proteome scale. ViralORFeome should provide our community with a framework to establish a large collection of virus ORF clones, an instrumental resource to determine functions, activities and binding partners of viral proteins.

  8. UGGT1 enhances enterovirus 71 pathogenicity by promoting viral RNA synthesis and viral replication

    PubMed Central

    Huang, Peng-Nien; Cameron, Craig E.


    Positive-strand RNA virus infections can induce the stress-related unfolded protein response (UPR) in host cells. This study found that enterovirus A71 (EVA71) utilizes host UDP-glucose glycoprotein glucosyltransferase 1 (UGGT1), a key endoplasmic reticulum protein (ER) involved in UPR, to enhance viral replication and virulence. EVA71 forms replication complexes (RCs) on cellular membranes that contain a mix of host and viral proteins to facilitate viral replication, but the components and processes involved in the assembly and function of RCs are not fully understood. Using EVA71 as a model, this study found that host UGGT1 and viral 3D polymerase co-precipitate along with other factors on membranous replication complexes to enhance viral replication. Increased UGGT1 levels elevated viral growth rates, while viral pathogenicity was observed to be lower in heterozygous knockout mice (Uggt1 +/- mice). These findings provide important insight on the role of UPR and host UGGT1 in regulating RNA virus replication and pathogenicity. PMID:28545059

  9. Viral hepatitis in the Arctic. A review from a Circumpolar Workshop on Viral hepatitis, ICCH13.


    Tulisov, Andrei; McMahon, Brian J; Koch, Anders; Minuk, Gerald; Chulanov, Vladimir; Bruce, Michael G; Uhanova, Julia; Børresen, Malene; Williams, James; Osiowy, Carla; Gelvan, Allan; Alexeeva, Marfa; Larke, Bryce; Watt, Kymberly


    This article is a review of the viral hepatitis workshop, held during the 13th International Congress of the Circumpolar Health consists of a review of data on viral hepatitis in the Arctic territories of four countries: Canada, Greenland, Russia and United States (Alaska). The main purpose of the workshop was to exchange knowledge on viral hepatitis in the Arctic and identify further needs for collaborative hepatitis research, which is planned to be implemented through the established Viral Hepatitis Working Group in the Arctic. The review is based on the available published research results, surveillance data and professional opinions of the authors. The information is presented by Arctic country. Viral hepatitis constitutes an important problem among Aboriginal peoples of the Arctic; the incidence of most types of viral hepatitis is higher among indigenous populations than in the general public. However, due to differences in the available information from each of the four Arctic countries, it is difficult to compare differences in types of disease in them. The main areas for future research are: HBV genotypes distribution, relations between different types of HBV, HCV and disease outcomes, HBV mutation rate and specific substitutions in the HBV genome over time in the Arctic, and occurrence of active liver disease in HBsAg carriers living in the Arctic, as well as further research in viral hepatitis A, C, D and E.

  10. Comparing viral metagenomics methods using a highly multiplexed human viral pathogens reagent.


    Li, Linlin; Deng, Xutao; Mee, Edward T; Collot-Teixeira, Sophie; Anderson, Rob; Schepelmann, Silke; Minor, Philip D; Delwart, Eric


    Unbiased metagenomic sequencing holds significant potential as a diagnostic tool for the simultaneous detection of any previously genetically described viral nucleic acids in clinical samples. Viral genome sequences can also inform on likely phenotypes including drug susceptibility or neutralization serotypes. In this study, different variables of the laboratory methods often used to generate viral metagenomics libraries were compared for their abilities to detect multiple viruses and generate full genome coverage. A biological reagent consisting of 25 different human RNA and DNA viral pathogens was used to estimate the effect of filtration and nuclease digestion, DNA/RNA extraction methods, pre-amplification and the use of different library preparation kits on the detection of viral nucleic acids. Filtration and nuclease treatment led to slight decreases in the percentage of viral sequence reads and number of viruses detected. For nucleic acid extractions silica spin columns improved viral sequence recovery relative to magnetic beads and Trizol extraction. Pre-amplification using random RT-PCR while generating more viral sequence reads resulted in detection of fewer viruses, more overlapping sequences, and lower genome coverage. The ScriptSeq library preparation method retrieved more viruses and a greater fraction of their genomes than the TruSeq and Nextera methods. Viral metagenomics sequencing was able to simultaneously detect up to 22 different viruses in the biological reagent analyzed including all those detected by qPCR. Further optimization will be required for the detection of viruses in biologically more complex samples such as tissues, blood, or feces. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. High viral abundance as a consequence of low viral decay in the Baltic Sea redoxcline

    PubMed Central

    Scharnreitner, Lisa; Jürgens, Klaus; Labrenz, Matthias; Herndl, Gerhard J.; Winter, Christian


    Throughout the Baltic Sea redoxcline, virus production and the frequency of lytically-infected prokaryotic cells were estimated from parallel incubations of undiluted seawater and seawater that contained prokaryotes with substantially reduced numbers of viruses (virus dilution approach), effectively preventing viral reinfection during the incubation period. Undiluted seawater incubations resulted in much higher estimates of virus production (6–35×104 mL-1 h-1) and the frequency of infected cells (5–84%) than the virus dilution approach (virus production: 1–3×104 mL-1 h-1; frequency of infected cells: 1–11%). Viral production and the frequency of infected cells from both approaches, however, cannot be directly compared, as data obtained from undiluted incubations were biased by viral reinfection and other uncontrollable processes during the incubation period. High in situ viral abundance (1–2×107 mL-1) together with low virus production rates based on the virus dilution approach resulted in some of the longest viral turnover times (24–84 d) ever reported for the epipelagial. Throughout a wide range of environmental conditions, viral turnover time and burst size were negatively correlated. Given that viral decay estimated in ultra-filtered water was below the detection limit and the burst size was low (1–17), we conclude that prokaryotic viruses in the Baltic Sea redoxcline are investing most of their resources into stress defense (strong capsids) rather than proliferation (high burst size). In summary, the Baltic Sea redoxcline constitutes an environment where low virus production is found in combination with low viral decay, resulting in high viral abundance. PMID:28594863

  12. Right Cervical Vagotomy Aggravates Viral Myocarditis in Mice Via the Cholinergic Anti-inflammatory Pathway

    PubMed Central

    Li-Sha, Ge; Xing-Xing, Chen; Lian-Pin, Wu; De-Pu, Zhou; Xiao-Wei, Li; Jia-Feng, Lin; Yue-Chun, Li


    The autonomic nervous system dysfunction with increased sympathetic activity and withdrawal of vagal activity may play an important role in the pathogenesis of viral myocarditis. The vagus nerve can modulate the immune response and control inflammation through a ‘cholinergic anti-inflammatory pathway’ dependent on the α7-nicotinic acetylcholine receptor (α7nAChR). Although the role of β-adrenergic stimulation on viral myocarditis has been investigated in our pervious studies, the direct effect of vagal tone in this setting has not been yet studied. Therefore, in the present study, we investigated the effects of cervical vagotomy in a murine model of viral myocarditis. In a coxsackievirus B3 murine myocarditis model (Balb/c), effects of right cervical vagotomy and nAChR agonist nicotine on echocardiography, myocardial histopathology, viral RNA, and proinflammatory cytokine levels were studied. We found that right cervical vagotomy inhibited the cholinergic anti-inflammatory pathway, aggravated myocardial lesions, up-regulated the expression of TNF-α, IL-1β, and IL-6, and worsened the impaired left ventricular function in murine viral myocarditis, and these changes were reversed by co-treatment with nicotine by activating the cholinergic anti-inflammatory pathway. These results indicate that vagal nerve plays an important role in mediating the anti-inflammatory effect in viral myocarditis, and that cholinergic stimulation with nicotine also plays its peripheral anti-inflammatory role relying on α7nAChR, without requirement for the integrity of vagal nerve in the model. The findings suggest that vagus nerve stimulation mediated inhibition of the inflammatory processes likely provide important benefits in myocarditis treatment. PMID:28197102

  13. MicroRNA regulation of viral immunity, latency, and carcinogenesis of selected tumor viruses and HIV.


    Wang, Ling; Li, Guangyu; Yao, Zhi Q; Moorman, Jonathan P; Ning, Shunbin


    MicroRNAs (miRNAs) function as key regulators in immune responses and cancer development. In the contexts of infection with oncogenic viruses, miRNAs are engaged in viral persistence, latency establishment and maintenance, and oncogenesis. In this review, we summarize the potential roles and mechanisms of viral and cellular miRNAs in the host-pathogen interactions during infection with selected tumor viruses and HIV, which include (i) repressing viral replication and facilitating latency establishment by targeting viral transcripts, (ii) evading innate and adaptive immune responses via toll-like receptors, RIG-I-like receptors, T-cell receptor, and B-cell receptor pathways by targeting signaling molecules such as TRAF6, IRAK1, IKKε, and MyD88, as well as downstream targets including regulatory cytokines such as tumor necrosis factor α, interferon γ, interleukin 10, and transforming growth factor β, (iii) antagonizing intrinsic and extrinsic apoptosis pathways by targeting pro-apoptotic or anti-apoptotic gene transcripts such as the Bcl-2 family and caspase-3, (iv) modulating cell proliferation and survival through regulation of the Wnt, PI3K/Akt, Erk/MAPK, and Jak/STAT signaling pathways, as well as the signaling pathways triggered by viral oncoproteins such as Epstein-Barr Virus LMP1, by targeting Wnt-inhibiting factor 1, SHIP, pTEN, and SOCSs, and (v) regulating cell cycle progression by targeting cell cycle inhibitors such as p21/WAF1 and p27/KIP1. Further elucidation of the interaction between miRNAs and these key biological events will facilitate our understanding of the pathogenesis of viral latency and oncogenesis and may lead to the identification of miRNAs as novel targets for developing new therapeutic or preventive interventions.

  14. Viral deep sequencing needs an adaptive approach: IRMA, the iterative refinement meta-assembler.


    Shepard, Samuel S; Meno, Sarah; Bahl, Justin; Wilson, Malania M; Barnes, John; Neuhaus, Elizabeth


    Deep sequencing makes it possible to observe low-frequency viral variants and sub-populations with greater accuracy and sensitivity than ever before. Existing platforms can be used to multiplex a large number of samples; however, analysis of the resulting data is complex and involves separating barcoded samples and various read manipulation processes ending in final assembly. Many assembly tools were designed with larger genomes and higher fidelity polymerases in mind and do not perform well with reads derived from highly variable viral genomes. Reference-based assemblers may leave gaps in viral assemblies while de novo assemblers may struggle to assemble unique genomes. The IRMA (iterative refinement meta-assembler) pipeline solves the problem of viral variation by the iterative optimization of read gathering and assembly. As with all reference-based assembly, reads are included in assembly when they match consensus template sets; however, IRMA provides for on-the-fly reference editing, correction, and optional elongation without the need for additional reference selection. This increases both read depth and breadth. IRMA also focuses on quality control, error correction, indel reporting, variant calling and variant phasing. In fact, IRMA's ability to detect and phase minor variants is one of its most distinguishing features. We have built modules for influenza and ebolavirus. We demonstrate usage and provide calibration data from mixture experiments. Methods for variant calling, phasing, and error estimation/correction have been redesigned to meet the needs of viral genomic sequencing. IRMA provides a robust next-generation sequencing assembly solution that is adapted to the needs and characteristics of viral genomes. The software solves issues related to the genetic diversity of viruses while providing customized variant calling, phasing, and quality control. IRMA is freely available for non-commercial use on Linux and Mac OS X and has been parallelized for high

  15. Firefighting Module

    NASA Technical Reports Server (NTRS)


    NASA and the U.S. Coast Guard are working jointly to develop a helicopter transportable firefighting module that can shave precious minutes in combating shipboard or harbor fires. The program was undertaken in 1975, after a series of disastrous fires on oil tankers indicated a need for a lightweight, self-contained system that could be moved quickly to the scene of a fire. A prototype module was delivered to the Coast Guard last year and service testing is under way. The compact module weighs little more than a ton but it contains everything needed to fight a fire. The key component is a high output pump, which delivers up to 2,000 gallons of sea water a minute; the pump can be brought up to maximum output in only one minute after turning on the power source, a small Allison gas turbine engine. The module also contains hose, a foam nozzle and a spray nozzle, three sets of protective clothing for firefighters, and fuel for three hours operation. Designed to be assembled without special tools, the module can be set up for operation in less than 20 minutes.

  16. Distinct macrophage subpopulations regulate viral encephalitis but not viral clearance in the CNS

    PubMed Central

    Steel, Christina D.; Kim, Woong-Ki; Sanford, Larry; Wellman, Laurie; Burnett, Sandra; Van Rooijen, Nico; Ciavarra, Richard P.


    Intranasal application of vesicular stomatitis virus (VSV) induces acute encephalitis characterized by a pronounced myeloid and T cell infiltrate. The role of distinct phagocytic populations on VSV encephalitis was therefore examined in this study. Ablation of peripheral macrophages did not impair VSV encephalitis or viral clearance from the brain, whereas, depletion of splenic marginal dendritic cells impaired this response and enhanced morbidity/mortality. Selective depletion of brain perivascular macrophages also suppressed this response without altering viral clearance. Thus, two anatomically distinct phagocytic populations regulate VSV encephalitis in a non-redundant fashion although neither population is essential for viral clearance in the CNS. PMID:20599280

  17. Genetic and biochemical analysis of cis regulatory elements within the keratinocyte enhancer region of the human papillomavirus type 31 upstream regulatory region during different stages of the viral life cycle.


    Sen, Ellora; Alam, Samina; Meyers, Craig


    Using linker scanning mutational analysis, we recently identified potential cis regulatory elements contained within the 5' upstream regulatory region (URR) domain and auxiliary enhancer (AE) region of the human papillomavirus type 31 (HPV31) URR involved in the regulation of E6/E7 promoter activity at different stages of the viral life cycle. For the present study, we extended the linker scanning mutational analysis to identify potential cis elements located in the keratinocyte enhancer (KE) region (nucleotides 7511 to 7762) of the HPV31 URR and to characterize cellular factors that bind to these elements under conditions representing different stages of the viral life cycle. The linker scanning mutational analysis identified viral cis elements located in the KE region that regulate transcription in the presence and absence of any viral gene products or viral DNA replication and determine the role of host tissue differentiation on viral transcriptional regulation. Using electrophoretic mobility shift assays, we illustrated defined reorganization in the composition of cellular transcription factors binding to the same cis regulatory elements at different stages of the HPV differentiation-dependent life cycle. Our studies provide an extensive map of functional elements in the KE region of the HPV31 URR, identify cis regulatory elements that exhibit significant transcription regulatory potential, and illustrate changes in specific protein-DNA interactions at different stages of the viral life cycle. The variable recruitment of transcription factors to the same cis element under different cellular conditions may represent a mechanism underlying the tight link between keratinocyte differentiation and E6/E7 expression.

  18. Neutron diffraction studies of viral fusion peptides

    NASA Astrophysics Data System (ADS)

    Bradshaw, Jeremy P.; J. M. Darkes, Malcolm; Katsaras, John; Epand, Richard M.


    Membrane fusion plays a vital role in a large and diverse number of essential biological processes. Despite this fact, the precise molecular events that occur during fusion are still not known. We are currently engaged on a study of membrane fusion as mediated by viral fusion peptides. These peptides are the N-terminal regions of certain viral envelope proteins that mediate the process of fusion between the viral envelope and the membranes of the host cell during the infection process. As part of this study, we have carried out neutron diffraction measurements at the ILL, BeNSC and Chalk River, on a range of viral fusion peptides. The peptides, from simian immunodeficiency virus (SIV), influenza A and feline leukaemia virus (FeLV), were incorporated into stacked phospholipid bilayers. Some of the peptides had been specifically deuterated at key amino acids. Lamellar diffraction data were collected and analysed to yield information on the peptide conformation, location and orientation relative to the bilayer.

  19. Viral genome sequencing bt random priming methods

    USDA-ARS?s Scientific Manuscript database

    Most emerging health threats are of zoonotic origin. For the overwhelming majority, their causative agents are viruses which include but are not limited to HIV, Influenza, SARS, Ebola, Dengue, and Hantavirus. Of increasing importance therefore is an understanding of the viral diversity to enable b...

  20. Diagnosis and treatment of viral encephalitis

    PubMed Central

    Chaudhuri, A; Kennedy, P


    Acute encephalitis constitutes a medical emergency. In most cases, the presence of focal neurological signs and focal seizures will distinguish encephalitis from encephalopathy. Acute disseminated encephalomyelitis is a non-infective inflammatory encephalitis that may require to be treated with steroids. Acute infective encephalitis is usually viral. Herpes simplex encephalitis (HSE) is the commonest sporadic acute viral encephalitis in the Western world. Magnetic resonance imaging of brain is the investigation of choice in HSE and the diagnosis may be confirmed by the polymerase chain reaction test for the virus in the cerebrospinal fluid. In this article, we review the diagnosis, investigations, and management of acute encephalitis. With few exceptions (for example, aciclovir for HSE), no specific therapy is available for most forms of viral encephalitis. Mortality and morbidity may be high and long term sequelae are known among survivors. The emergence of unusual forms of zoonotic encephalitis has posed an important public health problem. Vaccination and vector control measures are useful preventive strategies in certain arboviral and zoonotic encephalitis. However, we need better antiviral therapy to meet the challenge of acute viral encephalitis more effectively. PMID:12415078

  1. Mechanisms of influenza viral membrane fusion.


    Blijleven, Jelle S; Boonstra, Sander; Onck, Patrick R; van der Giessen, Erik; van Oijen, Antoine M


    Influenza viral particles are enveloped by a lipid bilayer. A major step in infection is fusion of the viral and host cellular membranes, a process with large kinetic barriers. Influenza membrane fusion is catalyzed by hemagglutinin (HA), a class I viral fusion protein activated by low pH. The exact nature of the HA conformational changes that deliver the energy required for fusion remains poorly understood. This review summarizes our current knowledge of HA structure and dynamics, describes recent single-particle experiments and modeling studies, and discusses their role in understanding how multiple HAs mediate fusion. These approaches provide a mechanistic picture in which HAs independently and stochastically insert into the target membrane, forming a cluster of HAs that is collectively able to overcome the barrier to membrane fusion. The new experimental and modeling approaches described in this review hold promise for a more complete understanding of other viral fusion systems and the protein systems responsible for cellular fusion. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Viral capsids as MRI contrast agents.


    Liepold, Lars; Anderson, Stasia; Willits, Deborah; Oltrogge, Luke; Frank, Joseph A; Douglas, Trevor; Young, Mark


    Viral capsids have the potential for combined cell/tissue targeting, drug delivery, and imaging. Described here is the development of a viral capsid as an efficient and potentially relevant MRI contrast agent. Two approaches are outlined to fuse high affinity Gd(3+) chelating moieties to the surface of the cowpea chlorotic mottle virus (CCMV) capsid. In the first approach, a metal binding peptide has been genetically engineered into the subunit of CCMV. In a second approach gadolinium-tetraazacyclododecane tetraacetic acid (GdDOTA) was attached to CCMV by reactions with endogenous lysine residues on the surface of the viral capsid. T(1) and T(2) ionic relaxivity rates for the genetic fusion particle were R1 = 210 and R2 = 402 mM(-1)s(-1) (R2 at 56 MHz) and for CCMV functionalized with GdDOTA were R1 = 46 and R2 = 142 mM(-1)s(-1) at 61 MHz. The relaxivities per intact capsid for the genetic fusion were R1 = 36,120 and R2 = 69,144 mM(-1)s(-1) (R2 at 56 MHz) and for the GdDOTA CCMV construct were R1 = 2,806 and R2 = 8,662 mM(-1)s(-1) at 61 MHz. The combination of high relaxivity, stable Gd(3+) binding, and large Gd(3+) payloads indicates the potential of viral capsids as high-performance contrast agents. Copyright 2007 Wiley-Liss, Inc.

  3. Viral skin diseases of the rabbit.


    Meredith, Anna L


    This article describes the viral skin diseases affecting the domestic rabbit, the most important being myxomatosis. Transmission and pathogenesis, clinical signs, diagnosis, treatment, and control are described and the article will be of interest to veterinary practitioners who treat rabbits. Shope fibroma virus, Shope papilloma virus, and rabbitpox are also discussed. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Interferon Induced Transfer of Viral Resistance

    DTIC Science & Technology


    interferon: We decided that rather than first studying induction of tyrosinase in melanoma cells or plasminogen activator in ovarian granulosa cells as...177-184 (HP Publishing, New York). 14. Lockhart, R.Z. (1973). Criteria for acceptance of a viral inhibitor as an interferon and a general

  5. Chromatin organization regulates viral egress dynamics


    Aho, Vesa; Myllys, Markko; Ruokolainen, Visa; ...


    Various types of DNA viruses are known to elicit the formation of a large nuclear viral replication compartment and marginalization of the cell chromatin. We used three-dimensional soft x-ray tomography, confocal and electron microscopy, combined with numerical modelling of capsid diffusion to analyse the molecular organization of chromatin in herpes simplex virus 1 infection and its effect on the transport of progeny viral capsids to the nuclear envelope. Our data showed that the formation of the viral replication compartment at late infection resulted in the enrichment of heterochromatin in the nuclear periphery accompanied by the compaction of chromatin. Random walkmore » modelling of herpes simplex virus 1–sized particles in a three-dimensional soft x-ray tomography reconstruction of an infected cell nucleus demonstrated that the peripheral, compacted chromatin restricts viral capsid diffusion, but due to interchromatin channels capsids are able to reach the nuclear envelope, the site of their nuclear egress.« less

  6. Non-viral gene delivery using nanoparticles.


    Ditto, Andrew J; Shah, Parth N; Yun, Yang H


    Although the potential benefits of gene therapy for the treatment of acquired and inherited genetic diseases have been demonstrated through preclinical studies, the results of human gene therapy trials have been disappointing. Recombinant viruses are the primary vectors of choice because of their ability to protect genetic materials, cross cellular membranes, escape from endosomes and transport their genetic materials into the nucleus. Unfortunately, viral vectors have been unable to gain widespread clinical application because of their toxicity and immunogenicity. Consequently, the need for safer alternatives has led to the development of liposomes, cationic polyplexes, microparticles and nanoparticles. Although these alternative vectors have shown promise, degradable nanoparticles are the only non-viral vectors that can provide a targeted intracellular delivery with controlled release properties. Furthermore, the potential advantage of degradable nanoparticles over their non-degradable counterparts is the reduced toxicity and the avoidance of accumulation within the target tissue after repeated administration. In this article, current non-viral gene delivery devices are reviewed with a special emphasis on nanoparticle gene delivery systems. Also, the authors highlight their philosophy and efforts on the development of l-tyrosine-based polyphosphate nanoparticle-based non-viral gene delivery systems and assess the potential benefits and shortcomings of their approach.

  7. History and Global Burden of Viral Hepatitis.


    Blum, Hubert E

    Between 1963 and 1989, 5 hepatotropic viruses have been discovered that are the major causes of viral hepatitides worldwide: hepatitis A virus, hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis delta virus and hepatitis E virus. Their epidemiology and pathogenesis have been studied in great detail. Furthermore, the structure and genetic organization of their DNA or RNA genome including the viral life cycle have been elucidated and have been successfully translated into important clinical applications, such as the specific diagnosis, therapy and prevention of the associated liver diseases, including liver cirrhosis and hepatocellular carcinoma (HCC). The prevalence of acute and chronic viral hepatitis A-E shows distinct geographic differences. The global burden of disease (prevalence, incidence, death, disability-adjusted life years) has been analyzed in seminal studies that show that the worldwide prevalence of hepatitis A-E has significantly decreased between 1990 and 2013. During the same time, the incidence of HBV-related liver cirrhosis and HCC, respectively, also decreased or increased slightly, the incidence of the HCV-related liver cirrhosis remained stable and the incidence of HCV-related HCC showed a major increase. During the coming years, we expect to improve our ability to prevent and effectively treat viral hepatitis A-E, resulting in the control of these global infections and the elimination of their associated morbidities and mortalities. © 2016 S. Karger AG, Basel.

  8. Mathematical Modeling of Viral Zoonoses in Wildlife

    PubMed Central

    Allen, L. J. S.; Brown, V. L.; Jonsson, C. B.; Klein, S. L.; Laverty, S. M.; Magwedere, K.; Owen, J. C.; van den Driessche, P.


    Zoonoses are a worldwide public health concern, accounting for approximately 75% of human infectious diseases. In addition, zoonoses adversely affect agricultural production and wildlife. We review some mathematical models developed for the study of viral zoonoses in wildlife and identify areas where further modeling efforts are needed. PMID:22639490

  9. Visualizing viral transport and host infection

    NASA Astrophysics Data System (ADS)

    Son, Kwangmin; Guasto, Jeffrey; Cubillos-Ruiz, Andres; Sullivan, Matthew; Stocker, Roman; MIT Team


    A virus is a non-motile infectious agent that can only replicate inside a living host. They consist of a <100 nm diameter capsid which houses their DNA, and a <20 nm diameter tail used to inject DNA to the host, which are classified into three different morphologies by the tail type: short tail (~ 10 nm, podovirus), rigid contractile tail (~ 100 nm, myovirus), or flexible noncontractile tail (~ 300 nm, siphovirus). Combining microfluidics with epifluorescent microscopy, we studied the simultaneous diffusive transport governing the initial encounter and ultimately the infection of a non-motile cyanobacteria host (~ 1 μm prochlorococcus) and their viral (phage) counterparts in real time. This methodology allows us to quantify the virus-host encounter/adsorption dynamics and subsequently the effectiveness of various tail morphologies for viral infection. Viral transport and the role of viral morphology in host-virus interactions are critical to our understanding of both ecosystem dynamics and human health, as well as to the evolution of virus morphology.

  10. Inhibition of LSD1 reduces herpesvirus infection, shedding, and recurrence by promoting epigenetic suppression of viral genomes

    PubMed Central

    Hill, James M.; Quenelle, Debra C.; Cardin, Rhonda D.; Vogel, Jodi L.; Clement, Christian; Bravo, Fernando J.; Foster, Timothy P.; Bosch-Marce, Marta; Raja, Priya; Lee, Jennifer S.; Bernstein, David I.; Krause, Philip R.; Knipe, David M.; Kristie, Thomas M.


    The high prevalence of Herpesviruses in the population and the maintenance of lifelong latent reservoirs are challenges to the control of herpetic diseases, despite the availability of antiviral pharmaceuticals that target viral DNA replication. In addition to oral and genital lesions, herpes simplex virus infections and recurrent reactivations from the latent pool can result in severe pathology including neonatal infection and mortality, blindness due to ocular keratitis, and viral-induced complications in immunosuppressed individuals. Herpesviruses, like their cellular hosts, are subject to the regulatory impacts of chromatin and chromatin modulation machinery that promotes or suppresses gene expression. The initiation of herpes simplex virus infection and reactivation from latency is dependent on a transcriptional coactivator complex that contains two required histone demethylases, LSD1 and JMJD2s. Inhibition of either of these enzymes results in heterochromatic suppression of the viral genome and a block to infection and reactivation in vitro. Here, the concept of epigenetic suppression of viral infection is demonstrated in three animal models of herpes simplex virus infection and disease. Inhibition of LSD1 via treatment of animals with the monoamine oxidase inhibitor tranylcypromine results in suppression of viral lytic infection, subclinical shedding, and reactivation from latency in vivo. Phenotypic suppression is correlated with enhanced epigenetic suppression of the viral genome and suggests that, even during latency, the chromatin state of the virus is dynamic. Given the expanding development of epipharmaceuticals, this approach has substantial potential for anti-herpetic treatments with distinct advantages over the present pharmaceutical options. PMID:25473037

  11. Firefighting Module

    NASA Technical Reports Server (NTRS)


    Aviation Power Supply's mobile firefighting module called Firefly II is mounted on a trailer pulled by a pickup truck. Trailer unit has two three- inch water cannons, and the pickup carries a six inch cannon. Completely self contained, module pumps 3,000 gallons of water a minute from hydrants or open bodies of water. Stream can go as far as 400 feet or can be employed in a high-loft mode to reach the tops of tall refinery towers. Compact Firefly II weighs only 2,500 pounds when fully fueled. Key component is a specially designed two stage pump. Power for the pump is generated by a gas turbine engine. Module also includes an electronic/pump controller, multiple hose connections, up to 1,500 feet of hose and fuel for four hours operation. Firefly trailer can be backed onto specially-built large fireboat.

  12. Firefighting Module

    NASA Technical Reports Server (NTRS)


    Aviation Power Supply's mobile firefighting module called Firefly II is mounted on a trailer pulled by a pickup truck. Trailer unit has two three- inch water cannons, and the pickup carries a six inch cannon. Completely self contained, module pumps 3,000 gallons of water a minute from hydrants or open bodies of water. Stream can go as far as 400 feet or can be employed in a high-loft mode to reach the tops of tall refinery towers. Compact Firefly II weighs only 2,500 pounds when fully fueled. Key component is a specially designed two stage pump. Power for the pump is generated by a gas turbine engine. Module also includes an electronic/pump controller, multiple hose connections, up to 1,500 feet of hose and fuel for four hours operation. Firefly trailer can be backed onto specially-built large fireboat.

  13. Firefighting Module

    NASA Astrophysics Data System (ADS)


    Aviation Power Supply's mobile firefighting module called Firefly II is mounted on a trailer pulled by a pickup truck. Trailer unit has two three- inch water cannons, and the pickup carries a six inch cannon. Completely self contained, module pumps 3,000 gallons of water a minute from hydrants or open bodies of water. Stream can go as far as 400 feet or can be employed in a high-loft mode to reach the tops of tall refinery towers. Compact Firefly II weighs only 2,500 pounds when fully fueled. Key component is a specially designed two stage pump. Power for the pump is generated by a gas turbine engine. Module also includes an electronic/pump controller, multiple hose connections, up to 1,500 feet of hose and fuel for four hours operation. Firefly trailer can be backed onto specially-built large fireboat.

  14. Firefighting Module

    NASA Astrophysics Data System (ADS)


    Aviation Power Supply's mobile firefighting module called Firefly II is mounted on a trailer pulled by a pickup truck. Trailer unit has two three- inch water cannons, and the pickup carries a six inch cannon. Completely self contained, module pumps 3,000 gallons of water a minute from hydrants or open bodies of water. Stream can go as far as 400 feet or can be employed in a high-loft mode to reach the tops of tall refinery towers. Compact Firefly II weighs only 2,500 pounds when fully fueled. Key component is a specially designed two stage pump. Power for the pump is generated by a gas turbine engine. Module also includes an electronic/pump controller, multiple hose connections, up to 1,500 feet of hose and fuel for four hours operation. Firefly trailer can be backed onto specially-built large fireboat.

  15. Thermionic modules


    King, Donald B.; Sadwick, Laurence P.; Wernsman, Bernard R.


    Modules of assembled microminiature thermionic converters (MTCs) having high energy-conversion efficiencies and variable operating temperatures manufactured using MEMS manufacturing techniques including chemical vapor deposition. The MTCs incorporate cathode to anode spacing of about 1 micron or less and use cathode and anode materials having work functions ranging from about 1 eV to about 3 eV. The MTCs also exhibit maximum efficiencies of just under 30%, and thousands of the devices and modules can be fabricated at modest costs.

  16. Acute Viral Hepatitis in Pediatric Age Groups.


    Kc, Sudhamshu; Sharma, Dilip; Poudyal, Nandu; Basnet, Bhupendra Kumar


    Our clinical experience showed that there has been no decrease in pediatric cases of acute viral hepatitis in Kathmandu. The objective of the study was to analyze the etiology, clinical features, laboratory parameters, sonological findings and other to determine the probable prognostic factors of Acute Viral Hepatitis in pediatric population. Consecutive patients of suspected Acute Viral Hepatitis, below the age of 15 years, attending the liver clinic between January 2006 and December 2010 were studied. After clinical examination they were subjected to blood tests and ultrasound examination of abdomen. The patients were divided in 3 age groups; 0-5, 5-10 and 5-15 years. Clinical features, laboratory parameters, ultrasound findings were compared in three age groups. Etiology of Acute Viral Hepatitis was Hepatitis A virus 266 (85%), Hepatitis E virus in 24 (8%), Hepatitis B virus in 15 (5%). In 7(2%) patients etiology was unknown. Three patients went to acute liver failure but improved with conservative treatment. There was no statistical difference in most of the parameters studied in different age groups. Ascites was more common in 5-10 years age group. Patients with secondary bacterial infection, ultrasound evidence of prominent biliary tree and ascites were associated with increased duration of illness. Patients with history of herbal medications had prolonged cholestasis. Hepatitis A is most common cause of Acute Viral Hepatitis in pediatric population. Improper use of herbal medications, secondary bacterial infection and faulty dietary intake was associated with prolonged illness. Patients with prominent biliary radicals should be treated with antibiotics even with normal blood counts for earlier recovery.

  17. Viral detection using DNA functionalized gold filaments†

    PubMed Central

    Perez, Jonas W.; Haselton, Frederick R.


    Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5′ [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3′ covalently attached to a 5 cm length of a 100 μm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 μm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 μL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was ~200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting. PMID:20448919

  18. Plant viral vectors for delivery by Agrobacterium.


    Gleba, Yuri Y; Tusé, Daniel; Giritch, Anatoli


    Plant viral vectors delivered by Agrobacterium are the basis of several manufacturing processes that are currently in use for producing a wide range of proteins for multiple applications, including vaccine antigens, antibodies, protein nanoparticles such as virus-like particles (VLPs), and other protein and protein-RNA scaffolds. Viral vectors delivered by agrobacterial T-DNA transfer (magnifection) have also become important tools in research. In recent years, essential advances have been made both in the development of second-generation vectors designed using the 'deconstructed virus' approach, as well as in the development of upstream manufacturing processes that are robust and fully scalable. The strategy relies on Agrobacterium as a vector to deliver DNA copies of one or more viral RNA/DNA replicons; the bacteria are delivered into leaves by vacuum infiltration, and the viral machinery takes over from the point of T-DNA transfer to the plant cell nucleus, driving massive RNA and protein production and, if required, cell-to-cell spread of the replicons. Among the most often used viral backbones are those of the RNA viruses Tobacco mosaic virus (TMV), Potato virus X (PVX) and Cowpea mosaic virus (CPMV), and the DNA geminivirus Bean yellow dwarf virus. Prototypes of industrial processes that provide for high yield, rapid scale up and fast manufacturing cycles have been designed, and several GMP-compliant and GMP-certified manufacturing facilities are in place. These efforts have been successful as evidenced by the fact that several antibodies and vaccine antigens produced by magnifection are currently in clinical development.

  19. FANCD2 Binds Human Papillomavirus Genomes and Associates with a Distinct Set of DNA Repair Proteins to Regulate Viral Replication.


    Spriggs, Chelsey C; Laimins, Laimonis A


    The life cycle of human papillomavirus (HPV) is dependent on the differentiation state of its host cell. HPV genomes are maintained as low-copy episomes in basal epithelial cells and amplified to thousands of copies per cell in differentiated layers. Replication of high-risk HPVs requires the activation of the ataxia telangiectasia-mutated (ATM) and ATM and Rad3-related (ATR) DNA repair pathways. The Fanconi anemia (FA) pathway is a part of the DNA damage response and mediates cross talk between the ATM and ATR pathways. Our studies show that HPV activates the FA pathway, leading to the accumulation of a key regulatory protein, FANCD2, in large nuclear foci. These HPV-dependent foci colocalize with a distinct population of DNA repair proteins, including ATM components γH2AX and BRCA1, but infrequently with p-SMC1, which is required for viral genome amplification in differentiated cells. Furthermore, FANCD2 is found at viral replication foci, where it is preferentially recruited to viral genomes compared to cellular chromosomes and is required for maintenance of HPV episomes in undifferentiated cells. These findings identify FANCD2 as an important regulator of HPV replication and provide insight into the role of the DNA damage response in the differentiation-dependent life cycle of HPV.IMPORTANCE High-risk human papillomaviruses (HPVs) are the etiological agents of cervical cancer and are linked to the development of many other anogenital and oropharyngeal cancers. Identification of host cellular pathways involved in regulating the viral life cycle may be helpful in identifying treatments for HPV lesions. Mutations in genes of the Fanconi anemia (FA) DNA repair pathway lead to genomic instability in patients and a predisposition to HPV-associated malignancies. Our studies demonstrate that FA pathway component FANCD2 is recruited to HPV DNA, associates with members of the ATM DNA repair pathway, and is essential for the maintenance of viral episomes in basal

  20. The universal epitope of influenza A viral neuraminidase fundamentally contributes to enzyme activity and viral replication.


    Doyle, Tracey M; Jaentschke, Bozena; Van Domselaar, Gary; Hashem, Anwar M; Farnsworth, Aaron; Forbes, Nicole E; Li, Changgui; Wang, Junzhi; He, Runtao; Brown, Earl G; Li, Xuguang


    The only universally conserved sequence among all influenza A viral neuraminidases is located between amino acids 222 and 230. However, the potential roles of these amino acids remain largely unknown. Through an array of experimental approaches including mutagenesis, reverse genetics, and growth kinetics, we found that this sequence could markedly affect viral replication. Additional experiments revealed that enzymes with mutations in this region demonstrated substantially decreased catalytic activity, substrate binding, and thermostability. Consistent with viral replication analyses and enzymatic studies, protein modeling suggests that these amino acids could either directly bind to the substrate or contribute to the formation of the active site in the enzyme. Collectively, these findings reveal the essential role of this unique region in enzyme function and viral growth, which provides the basis for evaluating the validity of this sequence as a potential target for antiviral intervention and vaccine development.

  1. Positive-strand RNA viruses stimulate host phosphatidylcholine synthesis at viral replication sites

    PubMed Central

    Zhang, Jiantao; Zhang, Zhenlu; Chukkapalli, Vineela; Nchoutmboube, Jules A.; Li, Jianhui; Randall, Glenn; Belov, George A.; Wang, Xiaofeng


    All positive-strand RNA viruses reorganize host intracellular membranes to assemble their viral replication complexes (VRCs); however, how these viruses modulate host lipid metabolism to accommodate such membrane proliferation and rearrangements is not well defined. We show that a significantly increased phosphatidylcholine (PC) content is associated with brome mosaic virus (BMV) replication in both natural host barley and alternate host yeast based on a lipidomic analysis. Enhanced PC levels are primarily associated with the perinuclear ER membrane, where BMV replication takes place. More specifically, BMV replication protein 1a interacts with and recruits Cho2p (choline requiring 2), a host enzyme involved in PC synthesis, to the site of viral replication. These results suggest that PC synthesized at the site of VRC assembly, not the transport of existing PC, is responsible for the enhanced accumulation. Blocking PC synthesis by deleting the CHO2 gene resulted in VRCs with wider diameters than those in wild-type cells; however, BMV replication was significantly inhibited, highlighting the critical role of PC in VRC formation and viral replication. We further show that enhanced PC levels also accumulate at the replication sites of hepatitis C virus and poliovirus, revealing a conserved feature among a group of positive-strand RNA viruses. Our work also highlights a potential broad-spectrum antiviral strategy that would disrupt PC synthesis at the sites of viral replication but would not alter cellular processes. PMID:26858414

  2. Host and viral proteins in the virion of Kaposi's sarcoma-associated herpesvirus.


    Bechtel, Jill T; Winant, Richard C; Ganem, Don


    Infection of cultured cells with Kaposi's sarcoma associated herpesvirus (KSHV) typically establishes a latent infection, in which only a few viral genes are expressed. Recently, it has been reported that a subset of lytic genes are transiently expressed very early after viral entry but that this burst of abortive lytic gene expression is terminated with the supervention of latency (H. H. Krishnan, P. P. Naranatt, M. S. Smith, L. Zeng, C. Bloomer, and B. Chandran, J. Virol. 78:3601-3620, 2004). To identify molecules imported into cells by KSHV that might influence this gene expression program, we have examined the protein composition of the KSHV particle. Immunoblotting of virus particles demonstrated that RTA, the lytic switch protein, and RAP, a viral protein that is a transcriptional and cell cycle modulator, were both incorporated into virus particles. In a second approach, polypeptides isolated from purified virions were identified by mass-spectrometric analysis of their constituent tryptic peptides. With this approach we were able to identify 18 major virion proteins, including structural, regulatory, and signaling proteins of both viral and cellular origin.

  3. Inhibition of viral RNA synthesis in canine distemper virus infection by proanthocyanidin A2.


    Gallina, Laura; Dal Pozzo, Fabiana; Galligioni, Viola; Bombardelli, Ezio; Scagliarini, Alessandra


    Canine distemper virus (CDV) is a contagious and multisystemic viral disease that affects domestic and wild canines as well as other terrestrial and aquatic carnivores. The disease in dogs is often fatal and no specific antiviral therapy is currently available. In this study, we evaluated the in vitro antiviral activity against CDV of proanthocyanidin A2 (PA2), a phenolic dimer belonging to the class of condensed tannins present in plants. Our results showed that PA2 exerted in vitro antiviral activity against CDV with a higher selectivity index compared to ribavirin, included in our study for the previously tested anti-CDV activity. The time of addition assay led us to observe that PA2 was able to decrease the viral RNA synthesis and to reduce progeny virus liberation, at different times post infection suggesting multiple mechanisms of action including inhibition of viral replicative complex and modulation of the redox milieu. These data suggest that PA2, isolated from the bark of Aesculus hippocastanum, has potential usefulness as an anti-CDV compound inhibiting viral replication.

  4. US28, a Virally-Encoded GPCR as an Antiviral Target for Human Cytomegalovirus Infection

    PubMed Central

    Lee, Sungjin; Chung, Yoon Hee; Lee, Choongho


    Viruses continue to evolve a new strategy to take advantage of every aspect of host cells in order to maximize their survival. Due to their central roles in transducing a variety of transmembrane signals, GPCRs seem to be a prime target for viruses to pirate for their own use. Incorporation of GPCR functionality into the genome of herpesviruses has been demonstrated to be essential for pathogenesis of many herpesviruses-induced diseases. Here, we introduce US28 of human cytomegalovirus (HCMV) as the best-studied example of virally-encoded GPCRs to manipulate host GPCR signaling. In this review, we wish to summarize a number of US28-related topics including its regulation of host signaling pathways, its constitutive internalization, its structural and functional analysis, its roles in HCMV biology and pathogenesis, its proliferative activities and role in oncogenesis, and pharmacological modulation of its biological activities. This review will aid in our understanding of how pathogenic viruses usurp the host GPCR signaling for successful viral infection. This kind of knowledge will enable us to build a better strategy to control viral infection by normalizing the virally-dysregulated host GPCR signaling. PMID:28035083

  5. Viral immunoblotting: a sensitive method for detecting viral-specific oliogoclonal bands in unconcentrated cerebrospinal fluid.


    Moyle, S; Keir, G; Thompson, E J


    A new method for detecting viral antibodies in cerebrospinal fluid is described. The technique has many advantages over previously published methods in that it is highly sensitive eliminating the need to concentrate the CSF, takes 5 h to complete, avoids the use of radionucleides, and most importantly circumvents problems associated with prozone effects which occur in immunoprecipitation reaction since the viral antigen is immobilized on nitrocellulose membranes.

  6. Type I IFN Signaling Is Dispensable during Secondary Viral Infection.


    Hosking, Martin P; Flynn, Claudia T; Whitton, J Lindsay


    Innate immune responses in general, and type I interferons (T1IFNs) in particular, play an important and often essential role during primary viral infections, by directly combatting the virus and by maximizing the primary adaptive immune response. Several studies have suggested that T1IFNs also contribute very substantially to the secondary (recall) response; they are thought (i) to be required to drive the early attrition of memory T cells, (ii) to support the subsequent expansion of surviving virus-specific memory cells, and (iii) to assist in the suppression and clearance of the infectious agent. However, many of these observations were predicated upon models in which T1IFN signaling was interrupted prior to a primary immune response, raising the possibility that the resulting memory cells might be intrinsically abnormal. We have directly addressed this by using an inducible-Cre model system in which the host remains genetically-intact during the primary response to infection, and in which T1IFN signaling can be effectively ablated prior to secondary viral challenge. We report that, in stark contrast to primary infection, T1IFN signaling is not required during the recall response. IFNαβR-deficient memory CD8+ and CD4+ memory T cells undergo attrition and expansion with kinetics that are indistinguishable from those of receptor-sufficient cells. Moreover, even in the absence of functional T1IFN signaling, the host's immune capacity to rapidly suppress, and then to eradicate, a secondary infection remains intact. Thus, this study shows that T1IFN signaling is dispensable during the recall response to a virus infection. Moreover, two broader implications may be drawn. First, a T cell's requirement for a cytokine is highly dependent on the cell's maturation / differentiation status. Consequently, second, these data underscore the importance of evaluating a gene's impact by modulating its expression or function in a temporally-controllable manner.

  7. Type I IFN Signaling Is Dispensable during Secondary Viral Infection

    PubMed Central

    Hosking, Martin P.; Flynn, Claudia T.; Whitton, J. Lindsay


    Innate immune responses in general, and type I interferons (T1IFNs) in particular, play an important and often essential role during primary viral infections, by directly combatting the virus and by maximizing the primary adaptive immune response. Several studies have suggested that T1IFNs also contribute very substantially to the secondary (recall) response; they are thought (i) to be required to drive the early attrition of memory T cells, (ii) to support the subsequent expansion of surviving virus-specific memory cells, and (iii) to assist in the suppression and clearance of the infectious agent. However, many of these observations were predicated upon models in which T1IFN signaling was interrupted prior to a primary immune response, raising the possibility that the resulting memory cells might be intrinsically abnormal. We have directly addressed this by using an inducible-Cre model system in which the host remains genetically-intact during the primary response to infection, and in which T1IFN signaling can be effectively ablated prior to secondary viral challenge. We report that, in stark contrast to primary infection, T1IFN signaling is not required during the recall response. IFNαβR-deficient memory CD8+ and CD4+ memory T cells undergo attrition and expansion with kinetics that are indistinguishable from those of receptor-sufficient cells. Moreover, even in the absence of functional T1IFN signaling, the host’s immune capacity to rapidly suppress, and then to eradicate, a secondary infection remains intact. Thus, this study shows that T1IFN signaling is dispensable during the recall response to a virus infection. Moreover, two broader implications may be drawn. First, a T cell’s requirement for a cytokine is highly dependent on the cell’s maturation / differentiation status. Consequently, second, these data underscore the importance of evaluating a gene’s impact by modulating its expression or function in a temporally-controllable manner. PMID

  8. Cellular versus viral microRNAs in host–virus interaction

    PubMed Central

    Ghosh, Zhumur; Mallick, Bibekanand; Chakrabarti, Jayprokas


    MicroRNAs (miRNAs) mark a new paradigm of RNA-directed gene expression regulation in a wide spectrum of biological systems. These small non-coding RNAs can contribute to the repertoire of host-pathogen interactions during viral infection. This interplay has important consequences, both for the virus and the host. There have been reported evidences of host-cellular miRNAs modulating the expression of various viral genes, thereby playing a pivotal role in the host–pathogen interaction network. In the hide-and-seek game between the pathogens and the infected host, viruses have evolved highly sophisticated gene-silencing mechanisms to evade host-immune response. Recent reports indicate that virus too encode miRNAs that protect them against cellular antiviral response. Furthermore, they may exploit the cellular miRNA pathway to their own advantage. Nevertheless, our increasing knowledge of the host–virus interaction at the molecular level should lead us toward possible explanations to viral tropism, latency and oncogenesis along with the development of an effective, durable and nontoxic antiviral therapy. Here, we summarize the recent updates on miRNA-induced gene-silencing mechanism, modulating host–virus interactions with a glimpse of the miRNA-based antiviral therapy for near future. PMID:19095692

  9. Innate immune restriction and antagonism of viral RNA lacking 2'-O methylation

    SciTech Connect

    Hyde, Jennifer L.; Diamond, Michael S.


    N-7 and 2′-O methylation of host cell mRNA occurs in the nucleus and results in the generation of cap structures (cap 0, m{sup 7}GpppN; cap 1, m{sup 7}GpppNm) that control gene expression by modulating nuclear export, splicing, turnover, and protein synthesis. Remarkably, RNA cap modification also contributes to mammalian cell host defense as viral RNA lacking 2′-O methylation is sensed and inhibited by IFIT1, an interferon (IFN) stimulated gene (ISG). Accordingly, pathogenic viruses that replicate in the cytoplasm have evolved mechanisms to circumvent IFIT1 restriction and facilitate infection of mammalian cells. These include: (a) generating cap 1 structures on their RNA through cap-snatching or virally-encoded 2′-O methyltransferases, (b) using cap-independent means of translation, or (c) using RNA secondary structural motifs to antagonize IFIT1 binding. This review will discuss new insights as to how specific modifications at the 5′-end of viral RNA modulate host pathogen recognition responses to promote infection and disease.

  10. Innate immune restriction and antagonism of viral RNA lacking 2׳-O methylation.