Science.gov

Sample records for modulates differentiation-dependent viral

  1. The full-length E1-circumflexE4 protein of human papillomavirus type 18 modulates differentiation-dependent viral DNA amplification and late gene expression

    SciTech Connect

    Wilson, Regina; Ryan, Gordon B.; Knight, Gillian L.; Laimins, Laimonis A.; Roberts, Sally . E-mail: s.roberts@bham.ac.uk

    2007-06-05

    Activation of the productive phase of the human papillomavirus (HPV) life cycle in differentiated keratinocytes is coincident with high-level expression of E1-circumflexE4 protein. To determine the role of E1-circumflexE4 in the HPV replication cycle, we constructed HPV18 mutant genomes in which expression of the full-length E1-circumflexE4 protein was abrogated. Undifferentiated keratinocytes containing mutant genomes showed enhanced proliferation when compared to cells containing wildtype genomes, but there were no differences in maintenance of viral episomes. Following differentiation, cells with mutant genomes exhibited reduced levels of viral DNA amplification and late gene expression, compared to wildtype genome-containing cells. This indicates that HPV18 E1-circumflexE4 plays an important role in regulating HPV late functions, and it may also function in the early phase of the replication cycle. Our finding that full-length HPV18 E1-circumflexE4 protein plays a significant role in promoting viral genome amplification concurs with a similar report with HPV31, but is in contrast to an HPV11 study where viral DNA amplification was not dependent on full-length E1-circumflexE4 expression, and to HPV16 where only C-terminal truncations in E1-circumflexE4 abrogated vegetative genome replication. This suggests that type-specific differences exist between various E1-circumflexE4 proteins.

  2. Cyclophilins as Modulators of Viral Replication

    PubMed Central

    Frausto, Stephen D.; Lee, Emily; Tang, Hengli

    2013-01-01

    Cyclophilins are peptidyl‐prolyl cis/trans isomerases important in the proper folding of certain proteins. Mounting evidence supports varied roles of cyclophilins, either positive or negative, in the life cycles of diverse viruses, but the nature and mechanisms of these roles are yet to be defined. The potential for cyclophilins to serve as a drug target for antiviral therapy is evidenced by the success of non-immunosuppressive cyclophilin inhibitors (CPIs), including Alisporivir, in clinical trials targeting hepatitis C virus infection. In addition, as cyclophilins are implicated in the predisposition to, or severity of, various diseases, the ability to specifically and effectively modulate their function will prove increasingly useful for disease intervention. In this review, we will summarize the evidence of cyclophilins as key mediators of viral infection and prospective drug targets. PMID:23852270

  3. Post-Transcriptional Regulation of KLF4 by High-Risk Human Papillomaviruses Is Necessary for the Differentiation-Dependent Viral Life Cycle.

    PubMed

    Gunasekharan, Vignesh Kumar; Li, Yan; Andrade, Jorge; Laimins, Laimonis A

    2016-07-01

    Human papillomaviruses (HPVs) are epithelial tropic viruses that link their productive life cycles to the differentiation of infected host keratinocytes. A subset of the over 200 HPV types, referred to as high-risk, are the causative agents of most anogenital malignancies. HPVs infect cells in the basal layer, but restrict viral genome amplification, late gene expression, and capsid assembly to highly differentiated cells that are active in the cell cycle. In this study, we demonstrate that HPV proteins regulate the expression and activities of a critical cellular transcription factor, KLF4, through post-transcriptional and post-translational mechanisms. Our studies show that KLF4 regulates differentiation as well as cell cycle progression, and binds to sequences in the upstream regulatory region (URR) to regulate viral transcription in cooperation with Blimp1. KLF4 levels are increased in HPV-positive cells through a post-transcriptional mechanism involving E7-mediated suppression of cellular miR-145, as well as at the post-translational level by E6-directed inhibition of its sumoylation and phosphorylation. The alterations in KLF4 levels and functions results in activation and suppression of a subset of KLF4 target genes, including TCHHL1, VIM, ACTN1, and POT1, that is distinct from that seen in normal keratinocytes. Knockdown of KLF4 with shRNAs in cells that maintain HPV episomes blocked genome amplification and abolished late gene expression upon differentiation. While KLF4 is indispensable for the proliferation and differentiation of normal keratinocytes, it is necessary only for differentiation-associated functions of HPV-positive keratinocytes. Increases in KLF4 levels alone do not appear to be sufficient to explain the effects on proliferation and differentiation of HPV-positive cells indicating that additional modifications are important. KLF4 has also been shown to be a critical regulator of lytic Epstein Barr virus (EBV) replication underscoring the

  4. Prostaglandin E2 As a Modulator of Viral Infections

    PubMed Central

    Sander, Willem J.; O'Neill, Hester G.; Pohl, Carolina H.

    2017-01-01

    Viral infections are a major cause of infectious diseases worldwide. Inflammation and the immune system are the major host defenses against these viral infection. Prostaglandin E2 (PGE2), an eicosanoid generated by cyclooxygenases, has been shown to modulate inflammation and the immune system by regulating the expression/concentration of cytokines. The effect of PGE2 on viral infection and replication is cell type- and virus-family-dependent. The host immune system can be modulated by PGE2, with regards to immunosuppression, inhibition of nitrogen oxide (NO) production, inhibition of interferon (IFN) and apoptotic pathways, and inhibition of viral receptor expression. Furthermore, PGE2 can play a role in viral infection directly by increasing the production and release of virions, inhibiting viral binding and replication, and/or stimulating viral gene expression. PGE2 may also have a regulatory role in the induction of autoimmunity and in signaling via Toll-like receptors. In this review the known effects of PGE2 on the pathogenesis of various infections caused by herpes simplex virus, rotavirus, influenza A virus and human immunodeficiency virus as well the therapeutic potential of PGE2 are discussed. PMID:28261111

  5. Tat is a multifunctional viral protein that modulates cellular gene expression and functions.

    PubMed

    Clark, Evan; Nava, Brenda; Caputi, Massimo

    2017-02-07

    The human immunodeficiency virus type I (HIV-1) has developed several strategies to condition the host environment to promote viral replication and spread. Viral proteins have evolved to perform multiple functions, aiding in the replication of the viral genome and modulating the cellular response to the infection. Tat is a small, versatile, viral protein that controls transcription of the HIV genome, regulates cellular gene expression and generates a permissive environment for viral replication by altering the immune response and facilitating viral spread to multiple tissues. Studies carried out utilizing biochemical, cellular, and genomic approaches show that the expression and activity of hundreds of genes and multiple molecular networks are modulated by Tat via multiple mechanisms.

  6. Bovine viral diarrhea virus modulation of monocyte derived macrophages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bovine viral diarrhea virus (BVDV) is a single stranded, positive sense RNA virus and is the causative agent of bovine viral diarrhea (BVD). Disease can range from persistently infected (PI) animals displaying no clinical symptoms of disease to an acute, severe disease. Presently, limited studies ha...

  7. Rubella virus capsid protein modulation of viral genomic and subgenomic RNA synthesis

    SciTech Connect

    Tzeng, W.-P.; Frey, Teryl K. . E-mail: tfrey@gsu.edu

    2005-07-05

    The ratio of the subgenomic (SG) to genome RNA synthesized by rubella virus (RUB) replicons expressing the green fluorescent protein reporter gene (RUBrep/GFP) is substantially higher than the ratio of these species synthesized by RUB (4.3 for RUBrep/GFP vs. 1.3-1.4 for RUB). It was hypothesized that this modulation of the viral RNA synthesis was by one of the virus structural protein genes and it was found that introduction of the capsid (C) protein gene into the replicons as an in-frame fusion with GFP resulted in an increase of genomic RNA production (reducing the SG/genome RNA ratio), confirming the hypothesis and showing that the C gene was the moiety responsible for the modulation effect. The N-terminal one-third of the C gene was required for the effect of be exhibited. A similar phenomenon was not observed with the replicons of Sindbis virus, a related Alphavirus. Interestingly, modulation was not observed when RUBrep/GFP was co-transfected with either other RUBrep or plasmid constructs expressing the C gene, demonstrating that modulation could occur only when the C gene was provided in cis. Mutations that prevented translation of the C protein failed to modulate RNA synthesis, indicating that the C protein was the moiety responsible for modulation; consistent with this conclusion, modulation of RNA synthesis was maintained when synonymous codon mutations were introduced at the 5' end of the C gene that changed the C gene sequence without altering the amino acid sequence of the C protein. These results indicate that C protein translated in proximity of viral replication complexes, possibly from newly synthesized SG RNA, participate in regulating the replication of viral RNA.

  8. Apigenin inhibits enterovirus 71 replication through suppressing viral IRES activity and modulating cellular JNK pathway.

    PubMed

    Lv, Xiaowen; Qiu, Min; Chen, Deyan; Zheng, Nan; Jin, Yu; Wu, Zhiwei

    2014-09-01

    Enterovirus 71 (EV71) is a member of genus Enterovirus in Picornaviridae family, which is one of the major causative agents for hand, foot and mouth disease (HFMD), and sometimes associated with severe central nervous system diseases in children. Currently there are no effective therapeutic medicines or vaccines for the disease. In this report, we found that apigenin and luteolin, two flavones that differ only in the number of hydroxyl groups could inhibit EV71-mediated cytopathogenic effect (CPE) and EV71 replication with low cytotoxicity. Both molecules also showed inhibitory effect on the viral polyprotein expression. They prevented EV71-induced cell apoptosis, intracellular reactive oxygen species (ROS) generation and cytokines up-regulation. Time-of-drug addition study demonstrated that apigenin and luteolin acted after viral entry. We examined the effect of apigenin and luteolin on 2A(pro) and 3C(pro) activity, two viral proteases responsible for viral polyprotein processing, and found that they showed less inhibitory activity on 2A(pro) or 3C(pro). Further studies demonstrated that apigenin, but not luteolin could interfere with viral IRES activity. Also, apigenin inhibited EV71-induced c-Jun N-terminal kinase (JNK) activation which is critical for viral replication, in contrast to luteolin that did not. This study demonstrated that apigenin may inhibit EV71 replication through suppressing viral IRES activity and modulating cellular JNK pathway. It also provided evidence that one hydroxyl group difference in the B ring between apigenin and luteolin resulted in the distinct antiviral mechanisms. This study will provide the basis for better drug development and further identification of potential drug targets.

  9. Lipids as modulators of membrane fusion mediated by viral fusion proteins.

    PubMed

    Teissier, Elodie; Pécheur, Eve-Isabelle

    2007-11-01

    Enveloped viruses infect host cells by fusion of viral and target membranes. This fusion event is triggered by specific glycoproteins in the viral envelope. Fusion glycoproteins belong to either class I, class II or the newly described third class, depending upon their arrangement at the surface of the virion, their tri-dimensional structure and the location within the protein of a short stretch of hydrophobic amino acids called the fusion peptide, which is able to induce the initial lipid destabilization at the onset of fusion. Viral fusion occurs either with the plasma membrane for pH-independent viruses, or with the endosomal membranes for pH-dependent viruses. Although, viral fusion proteins are parted in three classes and the subcellular localization of fusion might vary, these proteins have to act, in common, on lipid assemblies. Lipids contribute to fusion through their physical, mechanical and/or chemical properties. Lipids can thus play a role as chemically defined entities, or through their preferential partitioning into membrane microdomains called "rafts", or by modulating the curvature of the membranes involved in the fusion process. The purpose of this review is to make a state of the art on recent findings on the contribution of cholesterol, sphingolipids and glycolipids in cell entry and membrane fusion of a number of viral families, whose members bear either class I or class II fusion proteins, or fusion proteins of the recently discovered third class.

  10. Ginseng Protects Against Respiratory Syncytial Virus by Modulating Multiple Immune Cells and Inhibiting Viral Replication

    PubMed Central

    Lee, Jong Seok; Lee, Yu-Na; Lee, Young-Tae; Hwang, Hye Suk; Kim, Ki-Hye; Ko, Eun-Ju; Kim, Min-Chul; Kang, Sang-Moo

    2015-01-01

    Ginseng has been used in humans for thousands of years but its effects on viral infection have not been well understood. We investigated the effects of red ginseng extract (RGE) on respiratory syncytial virus (RSV) infection using in vitro cell culture and in vivo mouse models. RGE partially protected human epithelial (HEp2) cells from RSV-induced cell death and viral replication. In addition, RGE significantly inhibited the production of RSV-induced pro-inflammatory cytokine (TNF-α) in murine dendritic and macrophage-like cells. More importantly, RGE intranasal pre-treatment prevented loss of mouse body weight after RSV infection. RGE treatment improved lung viral clearance and enhanced the production of interferon (IFN-γ) in bronchoalveolar lavage cells upon RSV infection of mice. Analysis of cellular phenotypes in bronchoalveolar lavage fluids showed that RGE treatment increased the populations of CD8+ T cells and CD11c+ dendritic cells upon RSV infection of mice. Taken together, these results provide evidence that ginseng has protective effects against RSV infection through multiple mechanisms, which include improving cell survival, partial inhibition of viral replication and modulation of cytokine production and types of immune cells migrating into the lung. PMID:25658239

  11. Hepatitis B virus modulates store-operated calcium entry to enhance viral replication in primary hepatocytes

    PubMed Central

    Casciano, Jessica C.; Duchemin, Nicholas J.; Lamontagne, R. Jason; Steel, Laura F.; Bouchard, Michael J.

    2017-01-01

    Many viruses modulate calcium (Ca2+) signaling to create a cellular environment that is more permissive to viral replication, but for most viruses that regulate Ca2+ signaling, the mechanism underlying this regulation is not well understood. The hepatitis B virus (HBV) HBx protein modulates cytosolic Ca2+ levels to stimulate HBV replication in some liver cell lines. A chronic HBV infection is associated with life-threatening liver diseases, including hepatocellular carcinoma (HCC), and HBx modulation of cytosolic Ca2+ levels could have an important role in HBV pathogenesis. Whether HBx affects cytosolic Ca2+ in a normal hepatocyte, the natural site of an HBV infection, has not been addressed. Here, we report that HBx alters cytosolic Ca2+ signaling in cultured primary hepatocytes. We used single cell Ca2+ imaging of cultured primary rat hepatocytes to demonstrate that HBx elevates the cytosolic Ca2+ level in hepatocytes following an IP3-linked Ca2+ response; HBx effects were similar when expressed alone or in the context of replicating HBV. HBx elevation of the cytosolic Ca2+ level required extracellular Ca2+ influx and store-operated Ca2+ (SOC) entry and stimulated HBV replication in hepatocytes. We used both targeted RT-qPCR and transcriptome-wide RNAseq analyses to compare levels of SOC channel components and other Ca2+ signaling regulators in HBV-expressing and control hepatocytes and show that the transcript levels of these various proteins are not affected by HBV. We also show that HBx regulation of SOC-regulated Ca2+ accumulation is likely the consequence of HBV modulation of a SOC channel regulatory mechanism. In support of this, we link HBx enhancement of SOC-regulated Ca2+ accumulation to Ca2+ uptake by mitochondria and demonstrate that HBx stimulates mitochondrial Ca2+ uptake in primary hepatocytes. The results of our study may provide insights into viral mechanisms that affect Ca2+ signaling to regulate viral replication and virus-associated diseases

  12. Hepatitis B virus modulates store-operated calcium entry to enhance viral replication in primary hepatocytes.

    PubMed

    Casciano, Jessica C; Duchemin, Nicholas J; Lamontagne, R Jason; Steel, Laura F; Bouchard, Michael J

    2017-01-01

    Many viruses modulate calcium (Ca2+) signaling to create a cellular environment that is more permissive to viral replication, but for most viruses that regulate Ca2+ signaling, the mechanism underlying this regulation is not well understood. The hepatitis B virus (HBV) HBx protein modulates cytosolic Ca2+ levels to stimulate HBV replication in some liver cell lines. A chronic HBV infection is associated with life-threatening liver diseases, including hepatocellular carcinoma (HCC), and HBx modulation of cytosolic Ca2+ levels could have an important role in HBV pathogenesis. Whether HBx affects cytosolic Ca2+ in a normal hepatocyte, the natural site of an HBV infection, has not been addressed. Here, we report that HBx alters cytosolic Ca2+ signaling in cultured primary hepatocytes. We used single cell Ca2+ imaging of cultured primary rat hepatocytes to demonstrate that HBx elevates the cytosolic Ca2+ level in hepatocytes following an IP3-linked Ca2+ response; HBx effects were similar when expressed alone or in the context of replicating HBV. HBx elevation of the cytosolic Ca2+ level required extracellular Ca2+ influx and store-operated Ca2+ (SOC) entry and stimulated HBV replication in hepatocytes. We used both targeted RT-qPCR and transcriptome-wide RNAseq analyses to compare levels of SOC channel components and other Ca2+ signaling regulators in HBV-expressing and control hepatocytes and show that the transcript levels of these various proteins are not affected by HBV. We also show that HBx regulation of SOC-regulated Ca2+ accumulation is likely the consequence of HBV modulation of a SOC channel regulatory mechanism. In support of this, we link HBx enhancement of SOC-regulated Ca2+ accumulation to Ca2+ uptake by mitochondria and demonstrate that HBx stimulates mitochondrial Ca2+ uptake in primary hepatocytes. The results of our study may provide insights into viral mechanisms that affect Ca2+ signaling to regulate viral replication and virus-associated diseases.

  13. Alzheimer's Associated β-Amyloid Protein Inhibits Influenza A Virus and Modulates Viral Interactions with Phagocytes

    PubMed Central

    White, Mitchell R.; Kandel, Ruth; Tripathi, Shweta; Condon, David; Qi, Li; Taubenberger, Jeffrey; Hartshorn, Kevan L.

    2014-01-01

    Accumulation of β-Amyloid (βA) is a key pathogenetic factor in Alzheimer's disease; however, the normal function of βA is unknown. Recent studies have shown that βA can inhibit growth of bacteria and fungi. In this paper we show that βA also inhibits replication of seasonal and pandemic strains of H3N2 and H1N1 influenza A virus (IAV) in vitro. The 42 amino acid fragment of βA (βA42) had greater activity than the 40 amino acid fragment. Direct incubation of the virus with βA42 was needed to achieve optimal inhibition. Using quantitative PCR assays βA42 was shown to reduce viral uptake by epithelial cells after 45 minutes and to reduce supernatant virus at 24 hours post infection. βA42 caused aggregation of IAV particles as detected by light transmission assays and electron and confocal microscopy. βA42 did not stimulate neutrophil H2O2 production or extracellular trap formation on its own, but it increased both responses stimulated by IAV. In addition, βA42 increased uptake of IAV by neutrophils. βA42 reduced viral protein synthesis in monocytes and reduced IAV-induced interleukin-6 production by these cells. Hence, we demonstrate for the first time that βA has antiviral activity and modulates viral interactions with phagocytes. PMID:24988208

  14. PA28 modulates antigen processing and viral replication during coxsackievirus B3 infection

    PubMed Central

    Respondek, Dorota; Voss, Martin; Kühlewindt, Ina; Klingel, Karin; Krüger, Elke

    2017-01-01

    The function of the proteasome is modulated at the level of subunit expression and by association with its regulatory complexes. During coxsackievirus B3 (CVB3) myocarditis, IFN-induced formation of immunoproteasomes (ip) is known to be critical for regulating immune modulating molecules. The function of the IFN-γ-inducible proteasome regulator subunits PA28 α and β, however, in this context was unknown. During viral myocarditis, we found an increased abundance of PA28β subunits in heart tissue. PA28α/β exists in PA28-20S-PA28 and PA700-20S-PA28 hybrid proteasome complexes in cells both with either predominant ip and standard proteasome (sp) expression. Being in line with reduced proteasome activity in PA28α/β-deficient cells, we observed increased levels of oxidized and poly-ubiquitinated proteins upon TLR3-activation in these cells. Moreover, PA28α/β is capable to interfere directly with viral replication of CVB3 and facilitates the generation of CVB3-derived MHC class I epitopes by the proteasome. In contrast to a distinct function of PA28α/β in vitro, gene ablation of PA28α/β in mice being on a genetic background with resistance towards the development of severe infection had no significant impact on disease progression. Other than reported for the ip, in this host PA28α/β is dispensable to meet the demand of increased peptide hydrolysis capacity by the proteasome during viral myocarditis. PMID:28278207

  15. PA28 modulates antigen processing and viral replication during coxsackievirus B3 infection.

    PubMed

    Respondek, Dorota; Voss, Martin; Kühlewindt, Ina; Klingel, Karin; Krüger, Elke; Beling, Antje

    2017-01-01

    The function of the proteasome is modulated at the level of subunit expression and by association with its regulatory complexes. During coxsackievirus B3 (CVB3) myocarditis, IFN-induced formation of immunoproteasomes (ip) is known to be critical for regulating immune modulating molecules. The function of the IFN-γ-inducible proteasome regulator subunits PA28 α and β, however, in this context was unknown. During viral myocarditis, we found an increased abundance of PA28β subunits in heart tissue. PA28α/β exists in PA28-20S-PA28 and PA700-20S-PA28 hybrid proteasome complexes in cells both with either predominant ip and standard proteasome (sp) expression. Being in line with reduced proteasome activity in PA28α/β-deficient cells, we observed increased levels of oxidized and poly-ubiquitinated proteins upon TLR3-activation in these cells. Moreover, PA28α/β is capable to interfere directly with viral replication of CVB3 and facilitates the generation of CVB3-derived MHC class I epitopes by the proteasome. In contrast to a distinct function of PA28α/β in vitro, gene ablation of PA28α/β in mice being on a genetic background with resistance towards the development of severe infection had no significant impact on disease progression. Other than reported for the ip, in this host PA28α/β is dispensable to meet the demand of increased peptide hydrolysis capacity by the proteasome during viral myocarditis.

  16. Tat acetylation modulates assembly of a viral-host RNA–protein transcription complex

    PubMed Central

    D'Orso, Iván; Frankel, Alan D.

    2009-01-01

    HIV-1 Tat enhances viral transcription elongation by forming a ribonucleoprotein complex with transactivating responsive (TAR) RNA and P-TEFb, an elongation factor composed of cyclin T1 (CycT1) and Cdk9 that phosphorylates the C-terminal domain of RNA polymerase II. Previous studies have shown that Lys-28 in the activation domain (AD) of Tat is essential for HIV-1 transcription and replication and is acetylated by p300/CBP-associated factor (PCAF), but the mechanistic basis of the Lys-28 requirement is unknown. Here, we show that Lys-28 acetylation modulates the affinity and stability of HIV-1 Tat–CycT1–TAR complexes by enhancing an interaction with the CycT1 Tat–TAR recognition motif. High-affinity assembly correlates strongly with stimulation of transcription elongation in vitro and Tat activation in vivo. In marked contrast, bovine lentiviral Tat proteins have evolved a high-affinity TAR interaction that does not require PCAF-mediated acetylation of the Tat AD or CycT1 for RNA binding, whereas HIV-2 Tat has evolved an intermediate mechanism that uses a duplicated TAR element and CycT1 to enhance RNA affinity and consequently transcription activation. The coevolution of Tat acetylation, CycT1 dependence, and TAR binding affinity is seen in viral replication assays using Tat proteins that rely on CycT1 for TAR binding but are acetylation deficient, where compensatory mutations rapidly accrue in TAR to generate high-affinity, CycT1-independent complexes reminiscent of the bovine viruses. Thus, lysine acetylation can be used to modulate and evolve the strength of a viral-host RNA–protein complex, thereby tuning the levels of transcription elongation. PMID:19223581

  17. Regulatory Interaction between the Cellular Restriction Factor IFI16 and Viral pp65 (pUL83) Modulates Viral Gene Expression and IFI16 Protein Stability

    PubMed Central

    Pautasso, Sara; von Einem, Jens; Marschall, Manfred; Plachter, Bodo

    2016-01-01

    ABSTRACT A key player in the intrinsic resistance against human cytomegalovirus (HCMV) is the interferon-γ-inducible protein 16 (IFI16), which behaves as a viral DNA sensor in the first hours postinfection and as a repressor of viral gene transcription in the later stages. Previous studies on HCMV replication demonstrated that IFI16 binds to the viral protein kinase pUL97, undergoes phosphorylation, and relocalizes to the cytoplasm of infected cells. In this study, we demonstrate that the tegument protein pp65 (pUL83) recruits IFI16 to the promoter of the UL54 gene and downregulates viral replication, as shown by use of the HCMV mutant v65Stop, which lacks pp65 expression. Interestingly, at late time points of HCMV infection, IFI16 is stabilized by its interaction with pp65, which stood in contrast to IFI16 degradation, observed in herpes simplex virus 1 (HSV-1)-infected cells. Moreover, we found that its translocation to the cytoplasm, in addition to pUL97, strictly depends on pp65, as demonstrated with the HCMV mutant RV-VM1, which expresses a form of pp65 unable to translocate into the cytoplasm. Thus, these data reveal a dual role for pp65: during early infection, it modulates IFI16 activity at the promoter of immediate-early and early genes; subsequently, it delocalizes IFI16 from the nucleus into the cytoplasm, thereby stabilizing and protecting it from degradation. Overall, these data identify a novel activity of the pp65/IFI16 interactome involved in the regulation of UL54 gene expression and IFI16 stability during early and late phases of HCMV replication. IMPORTANCE The DNA sensor IFI16, a member of the PYHIN proteins, restricts HCMV replication by impairing viral DNA synthesis. Using a mutant virus lacking the tegument protein pp65 (v65Stop), we demonstrate that pp65 recruits IFI16 to the early UL54 gene promoter. As a putative counteraction to its restriction activity, pp65 supports the nucleocytoplasmic export of IFI16, which was demonstrated with the

  18. Modulation of apoptosis and viral latency - an axis to be well understood for successful cure of human immunodeficiency virus.

    PubMed

    Timilsina, Uddhav; Gaur, Ritu

    2016-04-01

    Human immunodeficiency virus (HIV) is the causative agent of the deadly disease AIDS, which is characterized by the progressive decline of CD4(+)T-cells. HIV-1-encoded proteins such as envelope gp120 (glycoprotein gp120), Tat (trans-activator of transcription), Nef (negative regulatory factor), Vpr (viral protein R), Vpu (viral protein unique) and protease are known to be effective in modulating host cell signalling pathways that lead to an alteration in apoptosis of both HIV-infected and uninfected bystander cells. Depending on the stage of the virus life cycle and host cell type, these viral proteins act as mediators of pro- or anti-apoptotic signals. HIV latency in viral reservoirs is a persistent phenomenon that has remained beyond the control of the human immune system. To cure HIV infections completely, it is crucial to reactivate latent HIV from cellular pools and to drive these apoptosis-resistant cells towards death. Several previous studies have reported the role of HIV-encoded proteins in apoptosis modulation, but the molecular basis for apoptosis evasion of some chronically HIV-infected cells and reactivated latently HIV-infected cells still needs to be elucidated. The current review summarizes our present understanding of apoptosis modulation in HIV-infected cells, uninfected bystander cells and latently infected cells, with a focus on highlighting strategies to activate the apoptotic pathway to kill latently infected cells.

  19. Conserved residues in Lassa fever virus Z protein modulate viral infectivity at the level of the ribonucleoprotein.

    PubMed

    Capul, Althea A; de la Torre, Juan Carlos; Buchmeier, Michael J

    2011-04-01

    Arenaviruses are negative-strand RNA viruses that cause human diseases such as lymphocytic choriomeningitis, Bolivian hemorrhagic fever, and Lassa hemorrhagic fever. No licensed vaccines exist, and current treatment is limited to ribavirin. The prototypic arenavirus, lymphocytic choriomeningitis virus (LCMV), is a model for dissecting virus-host interactions in persistent and acute disease. The RING finger protein Z has been identified as the driving force of arenaviral budding and acts as the viral matrix protein. While residues in Z required for viral budding have been described, residues that govern the Z matrix function(s) have yet to be fully elucidated. Because this matrix function is integral to viral assembly, we reasoned that this would be reflected in sequence conservation. Using sequence alignment, we identified several conserved residues in Z outside the RING and late domains. Nine residues were each mutated to alanine in Lassa fever virus Z. All of the mutations affected the expression of an LCMV minigenome and the infectivity of virus-like particles, but to greatly varying degrees. Interestingly, no mutations appeared to affect Z-mediated budding or association with viral GP. Our findings provide direct experimental evidence supporting a role for Z in the modulation of the activity of the viral ribonucleoprotein (RNP) complex and its packaging into mature infectious viral particles.

  20. Chemical Modulation of Endocytic Sorting Augments Adeno-associated Viral Transduction*

    PubMed Central

    Berry, Garrett E.; Asokan, Aravind

    2016-01-01

    Intracellular trafficking of viruses can be influenced by a variety of inter-connected cellular sorting and degradation pathways involving endo-lysosomal vesicles, the ubiquitin-proteasome system, and autophagy-based or endoplasmic reticulum-associated machinery. In the case of recombinant adeno-associated viruses (AAV), proteasome inhibitors are known to prevent degradation of ubiquitinated AAV capsids, thereby leading to increased nuclear accumulation and transduction. However, the impact of other cellular degradation pathways on AAV trafficking is not well understood. In the current study, we screened a panel of small molecules focused on modulating different cellular degradation pathways and identified eeyarestatin I (EerI) as a novel reagent that enhances AAV transduction. EerI improved AAV transduction by an order of magnitude regardless of vector dose, genome architecture, cell type, or serotype. This effect was preceded by sequestration of AAV within enlarged vesicles that were dispersed throughout the cytoplasm. Specifically, EerI treatment redirected AAV particles toward large vesicles positive for late endosomal (Rab7) and lysosomal (LAMP1) markers. Notably, MG132 and EerI (proteasomal and endoplasmic reticulum-associated degradation inhibitors, respectively) appear to enhance AAV transduction by increasing the intracellular accumulation of viral particles in a mutually exclusive fashion. Taken together, our results expand on potential strategies to redirect recombinant AAV vectors toward more productive trafficking pathways by deregulating cellular degradation mechanisms. PMID:26527686

  1. Modulation of sex hormone secretion in cows by acute infection with bovine viral diarrhoea virus.

    PubMed

    Fray, M D; Mann, G E; Bleach, E C L; Knight, P G; Clarke, M C; Charleston, B

    2002-02-01

    Bovine viral diarrhoea virus (BVDV) is a major pathogen of cattle and is responsible for considerable reproductive loss. In this study, the in vivo responses in six multiparous cows were investigated after a non-cytopathogenic BVDV challenge (strain Pe 515; 5 x 10(6) tissue culture infective dose 50) given 9 days before a synchronized ovulation. Six similar cows challenged with non-infectious culture medium served as controls. The experimental noncytopathogenic BVDV infection was followed by a viraemia and leucopenia at days 5-9 after challenge, but no other clinical signs of infection were detected. However, the BVDV infection altered endocrine function. Mean LH pulse frequency immediately before CIDR withdrawal was lower (P < or = 0.05) in the BVDV-infected (2.17 +/- 0.34 pulses per 8 h) compared with the sham-infected (4.83 +/- 1.04 pulses per 8 h) animals. At day 3 after CIDR withdrawal, plasma oestradiol concentrations remained high (P < 0.05) in the infected cows (2.19 +/- 0.51 pg ml(-1)) compared with the sham-infected controls (0.72 +/- 0.29 pg ml(-1)). However, there was no difference in the peak oestradiol concentration (BVDV: 2.31 +/- 0.29 versus sham: 2.34 +/- 0.41 pg ml(-1)). In addition, non-cytopathogenic BVDV significantly (P < 0.05) increased the duration of the interval between ovulation and onset of the postovulatory progesterone increase (values 1.0 ng ml(-1)) (BVDV: 3.0 +/- 0.26 versus sham: 4.0 +/- 0.26 days). The viral infection also significantly (P < 0.01) decreased mean plasma progesterone concentrations between day 3 and day 11 after ovulation (BVDV: 2.59 +/- 0.32 versus sham: 4.13 +/- 0.27 ng ml(-1)). These data show that non-cytopathogenic BVDV viraemias during the follicular phase can modulate the secretion of gonadotrophins and sex steroids, in particular progesterone, during a synchronized oestrous cycle. Therefore, viraemias during the follicular phase may reduce the fertility of cattle by disrupting the capacity of the ovulatory

  2. Primate Lentiviruses Modulate NF-κB Activity by Multiple Mechanisms to Fine-Tune Viral and Cellular Gene Expression

    PubMed Central

    Heusinger, Elena; Kirchhoff, Frank

    2017-01-01

    The transcription factor nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) plays a complex role during the replication of primate lentiviruses. On the one hand, NF-κB is essential for induction of efficient proviral gene expression. On the other hand, this transcription factor contributes to the innate immune response and induces expression of numerous cellular antiviral genes. Recent data suggest that primate lentiviruses cope with this challenge by boosting NF-κB activity early during the replication cycle to initiate Tat-driven viral transcription and suppressing it at later stages to minimize antiviral gene expression. Human and simian immunodeficiency viruses (HIV and SIV, respectively) initially exploit their accessory Nef protein to increase the responsiveness of infected CD4+ T cells to stimulation. Increased NF-κB activity initiates Tat expression and productive replication. These events happen quickly after infection since Nef is rapidly expressed at high levels. Later during infection, Nef proteins of HIV-2 and most SIVs exert a very different effect: by down-modulating the CD3 receptor, an essential factor for T cell receptor (TCR) signaling, they prevent stimulation of CD4+ T cells via antigen-presenting cells and hence suppress further induction of NF-κB and an effective antiviral immune response. Efficient LTR-driven viral transcription is maintained because it is largely independent of NF-κB in the presence of Tat. In contrast, human immunodeficiency virus type 1 (HIV-1) and its simian precursors have lost the CD3 down-modulation function of Nef and use the late viral protein U (Vpu) to inhibit NF-κB activity by suppressing its nuclear translocation. In this review, we discuss how HIV-1 and other primate lentiviruses might balance viral and antiviral gene expression through a tight temporal regulation of NF-κB activity throughout their replication cycle. PMID:28261165

  3. Host and Viral Modulation of RIG-I-Mediated Antiviral Immunity

    PubMed Central

    Liu, Yiliu; Olagnier, David; Lin, Rongtuan

    2017-01-01

    Innate immunity is the first line of defense against invading pathogens. Rapid and efficient detection of pathogen-associated molecular patterns via pattern-recognition receptors is essential for the host to mount defensive and protective responses. Retinoic acid-inducible gene-I (RIG-I) is critical in triggering antiviral and inflammatory responses for the control of viral replication in response to cytoplasmic virus-specific RNA structures. Upon viral RNA recognition, RIG-I recruits the mitochondrial adaptor protein mitochondrial antiviral signaling protein, which leads to a signaling cascade that coordinates the induction of type I interferons (IFNs), as well as a large variety of antiviral interferon-stimulated genes. The RIG-I activation is tightly regulated via various posttranslational modifications for the prevention of aberrant innate immune signaling. By contrast, viruses have evolved mechanisms of evasion, such as sequestrating viral structures from RIG-I detections and targeting receptor or signaling molecules for degradation. These virus–host interactions have broadened our understanding of viral pathogenesis and provided insights into the function of the RIG-I pathway. In this review, we summarize the recent advances regarding RIG-I pathogen recognition and signaling transduction, cell-intrinsic control of RIG-I activation, and the viral antagonism of RIG-I signaling. PMID:28096803

  4. Interplay between regulatory T cells and PD-1 in modulating T cell exhaustion and viral control during chronic LCMV infection

    PubMed Central

    Penaloza-MacMaster, Pablo; Kamphorst, Alice O.; Wieland, Andreas; Araki, Koichi; Iyer, Smita S.; West, Erin E.; O’Mara, Leigh; Yang, Shu; Konieczny, Bogumila T.; Sharpe, Arlene H.; Freeman, Gordon J.

    2014-01-01

    Regulatory T (T reg) cells are critical for preventing autoimmunity mediated by self-reactive T cells, but their role in modulating immune responses during chronic viral infection is not well defined. To address this question and to investigate a role for T reg cells in exhaustion of virus-specific CD8 T cells, we depleted T reg cells in mice chronically infected with lymphocytic choriomeningitis virus (LCMV). T reg cell ablation resulted in 10–100-fold expansion of functional LCMV-specific CD8 T cells. Rescue of exhausted CD8 T cells was dependent on cognate antigen, B7 costimulation, and conventional CD4 T cells. Despite the striking recovery of LCMV-specific CD8 T cell responses, T reg cell depletion failed to diminish viral load. Interestingly, T reg cell ablation triggered up-regulation of the molecule programmed cell death ligand-1 (PD-L1), which upon binding PD-1 on T cells delivers inhibitory signals. Increased PD-L1 expression was observed especially on LCMV-infected cells, and combining T reg cell depletion with PD-L1 blockade resulted in a significant reduction in viral titers, which was more pronounced than that upon PD-L1 blockade alone. These results suggest that T reg cells effectively maintain CD8 T cell exhaustion, but blockade of the PD-1 inhibitory pathway is critical for elimination of infected cells. PMID:25113973

  5. The cytoplasmic domain of Marburg virus GP modulates early steps of viral infection.

    PubMed

    Mittler, Eva; Kolesnikova, Larissa; Hartlieb, Bettina; Davey, Robert; Becker, Stephan

    2011-08-01

    Marburg virus infection is mediated by the only viral surface protein, GP, a trimeric type I transmembrane protein. While its ectodomain mediates receptor binding and fusion of viral and cellular membranes and its transmembrane domain is essential for the recruitment of GP into budding particles by the matrix protein VP40, the role of the short cytoplasmic domain has remained enigmatic. Here we show that a missing cytoplasmic domain did not impair trimerization, intracellular transport, or incorporation of GP into infectious Marburg virus-like particles (iVLPs) but altered the glycosylation pattern as well as the recognition of GP by neutralizing antibodies. These results suggest that subtle conformational changes took place in the ectodomain. To investigate the function of the cytoplasmic domain during viral entry, a novel entry assay was established to monitor the uptake of filamentous VLPs by measuring the occurrence of luciferase-labeled viral nucleocapsids in the cytosol of target cells. This quantitative assay showed that the entry process of VLPs incorporating GP missing its cytoplasmic domain (GPΔCD) was impaired. Supporting these results, iVLPs incorporating a mutant GP missing its cytoplasmic domain were significantly less infectious than iVLPs containing wild-type GP. Taken together, the data indicate that the absence of the short cytoplasmic domain of Marburg virus GP may induce conformational changes in the ectodomain which impact the filoviral entry process.

  6. Direct interaction of cellular hnRNP-F and NS1 of influenza A virus accelerates viral replication by modulation of viral transcriptional activity and host gene expression

    SciTech Connect

    Lee, Jun Han; Kim, Sung-Hak; Pascua, Philippe Noriel Q.; Song, Min-Suk; Baek, Yun Hee; Jin, Xun; Choi, Joong-Kook; Kim, Chul-Joong; Kim, Hyunggee; Choi, Young Ki

    2010-02-05

    To investigate novel NS1-interacting proteins, we conducted a yeast two-hybrid analysis, followed by co-immunoprecipitation assays. We identified heterogeneous nuclear ribonucleoprotein F (hnRNP-F) as a cellular protein interacting with NS1 during influenza A virus infection. Co-precipitation assays suggest that interaction between hnRNP-F and NS1 is a common and direct event among human or avian influenza viruses. NS1 and hnRNP-F co-localize in the nucleus of host cells, and the RNA-binding domain of NS1 directly interacts with the GY-rich region of hnRNP-F determined by GST pull-down assays with truncated proteins. Importantly, hnRNP-F expression levels in host cells indicate regulatory role on virus replication. hnRNP-F depletion by small interfering RNA (siRNA) shows 10- to 100-fold increases in virus titers corresponding to enhanced viral RNA polymerase activity. Our results delineate novel mechanism of action by which NS1 accelerates influenza virus replication by modulating normal cellular mRNA processes through direct interaction with cellular hnRNP-F protein.

  7. Modulation of cellular and viral promoters by mutant human p53 proteins found in tumor cells.

    PubMed Central

    Deb, S; Jackson, C T; Subler, M A; Martin, D W

    1992-01-01

    Wild-type p53 has recently been shown to repress transcription from several cellular and viral promoters. Since p53 mutations are the most frequently reported genetic defects in human cancers, it becomes important to study the effects of mutations of p53 on promoter functions. We, therefore, have studied the effects of wild-type and mutant human p53 on the human proliferating-cell nuclear antigen (PCNA) promoter and on several viral promoters, including the herpes simplex virus type 1 UL9 promoter, the human cytomegalovirus major immediate-early promoter-enhancer, and the long terminal repeat promoters of Rous sarcoma virus and human T-cell lymphotropic virus type I. HeLa cells were cotransfected with a wild-type or mutant p53 expression vector and a plasmid containing a chloramphenicol acetyltransferase reporter gene under viral (or cellular) promoter control. As expected, expression of the wild-type p53 inhibited promoter function. Expression of a p53 with a mutation at any one of the four amino acid positions 175, 248, 273, or 281, however, correlated with a significant increase of the PCNA promoter activity (2- to 11-fold). The viral promoters were also activated, although to a somewhat lesser extent. We also showed that activation by a mutant p53 requires a minimal promoter containing a lone TATA box. A more significant increase (25-fold) in activation occurs when the promoter contains a binding site for the activating transcription factor or cyclic AMP response element-binding protein. Using Saos-2 cells that do not express p53, we showed that activation by a mutant p53 was a direct enhancement. The mutant forms of p53 used in this study are found in various cancer cells. The activation of PCNA by mutant p53s may indicate a way to increase cell proliferation by the mutant p53s. Thus, our data indicate a possible functional role for the mutants of p53 found in cancer cells in activating several important loci, including PCNA. Images PMID:1356162

  8. Viral modulators of cullin RING ubiquitin ligases: culling the host defense.

    PubMed

    Barry, Michele; Früh, Klaus

    2006-05-16

    Cullin RING ubiquitin ligases (CRULs) are found in all eukaryotes and play an essential role in targeting proteins for ubiquitin-mediated destruction, thus regulating a plethora of cellular processes. Viruses manipulate CRULs by redirecting this destruction machinery to eliminate unwanted host cell proteins, thus allowing viruses to slip past host immune barriers. Depending on the host organism, virus-modified CRULs can perform an amazing range of tasks, including the elimination of crucial signal transduction molecules in the human interferon pathway and suppression of virus-induced gene silencing in plants. This Perspective summarizes recent advances in our understanding of how viral proteins manipulate the function of CRULs.

  9. Human parainfluenza virus infection of the airway epithelium: viral hemagglutinin-neuraminidase regulates fusion protein activation and modulates infectivity.

    PubMed

    Palermo, Laura M; Porotto, Matteo; Yokoyama, Christine C; Palmer, Samantha G; Mungall, Bruce A; Greengard, Olga; Niewiesk, Stefan; Moscona, Anne

    2009-07-01

    Three discrete activities of the paramyxovirus hemagglutinin-neuraminidase (HN) protein, receptor binding, receptor cleaving (neuraminidase), and triggering of the fusion protein, each affect the promotion of viral fusion and entry. For human parainfluenza virus type 3 (HPIV3), the effects of specific mutations that alter these functions of the receptor-binding protein have been well characterized using cultured monolayer cells, which have identified steps that are potentially relevant to pathogenesis. In the present study, proposed mechanisms that are relevant to pathogenesis were tested in natural host cell cultures, a model of the human airway epithelium (HAE) in which primary HAE cells are cultured at an air-liquid interface and retain functional properties. Infection of HAE cells with wild-type HPIV3 and variant viruses closely reflects that seen in an animal model, the cotton rat, suggesting that HAE cells provide an ideal system for assessing the interplay of host cell and viral factors in pathogenesis and for screening for inhibitory molecules that would be effective in vivo. Both HN's receptor avidity and the function and timing of F activation by HN require a critical balance for the establishment of ongoing infection in the HAE, and these HN functions independently modulate the production of active virions. Alterations in HN's F-triggering function lead to the release of noninfectious viral particles and a failure of the virus to spread. The finding that the dysregulation of F triggering prohibits successful infection in HAE cells suggests that antiviral strategies targeted to HN's F-triggering activity may have promise in vivo.

  10. Vitamin D modulation of innate immune responses to respiratory viral infections.

    PubMed

    Zdrenghea, Mihnea T; Makrinioti, Heidi; Bagacean, Cristina; Bush, Andy; Johnston, Sebastian L; Stanciu, Luminita A

    2017-01-01

    Vitamin D, in addition to its classical functions in bone homeostasis, has a modulatory and regulatory role in multiple processes, including host defense, inflammation, immunity, and epithelial repair. Patients with respiratory disease are frequently deficient in vitamin D, implying that supplementation might provide significant benefit to these patients. Respiratory viral infections are common and are the main trigger of acute exacerbations and hospitalization in children and adults with asthma and other airways diseases. Respiratory monocytes/macrophages and epithelial cells constitutively express the vitamin D receptor. Vitamin D, acting through this receptor, may be important in protection against respiratory infections. Whether the in vitro findings can be translated into a substantial in vivo benefit still remains uncertain. Here we review the in vitro data on the role of vitamin D in antiviral innate immunity, the data concerning the deficient levels of vitamin D in lung diseases, and the in vivo role of supplementation as protection against respiratory viral infections in healthy individuals and in patients with chronic respiratory diseases. Finally, we suggest ways of improving the effectiveness of vitamin D as an adjuvant in the prevention and treatment of acute respiratory infections.

  11. C-Myc regulation by costimulatory signals modulates the generation of CD8+ memory T cells during viral infection.

    PubMed

    Haque, Mohammad; Song, Jianyong; Fino, Kristin; Wang, Youfei; Sandhu, Praneet; Song, Xinmeng; Norbury, Christopher; Ni, Bing; Fang, Deyu; Salek-Ardakani, Shahram; Song, Jianxun

    2016-01-01

    The signalling mechanisms of costimulation in the development of memory T cells remain to be clarified. Here, we show that the transcription factor c-Myc in CD8(+) T cells is controlled by costimulatory molecules, which modulates the development of memory CD8(+) T cells. C-Myc expression was dramatically reduced in Cd28(-/-) or Ox40(-/-) memory CD8(+) T cells, and c-Myc over-expression substantially reversed the defects in the development of T-cell memory following viral infection. C-Myc regulated the expression of survivin, an inhibitor of apoptosis, which promoted the generation of virus-specific memory CD8(+) T cells. Moreover, over-expression of survivin with bcl-xL, a downstream molecule of NF-κB and intracellular target of costimulation that controls survival, in Cd28(-/-) or Ox40(-/-) CD8(+) T cells, reversed the defects in the generation of memory T cells in response to viral infection. These results identify c-Myc as a key controller of memory CD8(+) T cells from costimulatory signals.

  12. Immunological, Viral, Environmental, and Individual Factors Modulating Lung Immune Response to Respiratory Syncytial Virus

    PubMed Central

    Bottau, Paolo; Faldella, Giacomo

    2015-01-01

    Respiratory syncytial virus is a worldwide pathogen agent responsible for frequent respiratory tract infections that may become severe and potentially lethal in high risk infants and adults. Several studies have been performed to investigate the immune response that determines the clinical course of the infection. In the present paper, we review the literature on viral, environmental, and host factors influencing virus response; the mechanisms of the immune response; and the action of nonimmunological factors. These mechanisms have often been studied in animal models and in the present review we also summarize the main findings obtained from animal models as well as the limits of each of these models. Understanding the lung response involved in the pathogenesis of these respiratory infections could be useful in improving the preventive strategies against respiratory syncytial virus. PMID:26064963

  13. Immunological, Viral, Environmental, and Individual Factors Modulating Lung Immune Response to Respiratory Syncytial Virus.

    PubMed

    Vandini, Silvia; Bottau, Paolo; Faldella, Giacomo; Lanari, Marcello

    2015-01-01

    Respiratory syncytial virus is a worldwide pathogen agent responsible for frequent respiratory tract infections that may become severe and potentially lethal in high risk infants and adults. Several studies have been performed to investigate the immune response that determines the clinical course of the infection. In the present paper, we review the literature on viral, environmental, and host factors influencing virus response; the mechanisms of the immune response; and the action of nonimmunological factors. These mechanisms have often been studied in animal models and in the present review we also summarize the main findings obtained from animal models as well as the limits of each of these models. Understanding the lung response involved in the pathogenesis of these respiratory infections could be useful in improving the preventive strategies against respiratory syncytial virus.

  14. Innate immune interactions within the central nervous system modulate pathogenesis of viral infections

    PubMed Central

    Nair, Sharmila; Diamond, Michael S.

    2015-01-01

    The innate immune system mediates protection against neurotropic viruses that replicate in the central nervous system (CNS). Virus infection within specific cells of the CNS triggers activation of several families of pattern recognition receptors including Toll-like receptors, retinoic acid-inducible gene 1 like receptors, nucleotide-binding oligomerization domain-like receptors, and cytosolic DNA sensors. In this review, we highlight recent advances in our understanding of how cell-intrinsic host defenses within the CNS modulate infection of different DNA and RNA viruses. PMID:26163762

  15. Modulation of Microglial Cell Fcγ Receptor Expression Following Viral Brain Infection

    PubMed Central

    Chauhan, Priyanka; Hu, Shuxian; Sheng, Wen S.; Prasad, Sujata; Lokensgard, James R.

    2017-01-01

    Fcγ receptors (FcγRs) for IgG couple innate and adaptive immunity through activation of effector cells by antigen-antibody complexes. We investigated relative levels of activating and inhibitory FcγRs on brain-resident microglia following murine cytomegalovirus (MCMV) infection. Flow cytometric analysis of microglial cells obtained from infected brain tissue demonstrated that activating FcγRs were expressed maximally at 5 d post-infection (dpi), while the inhibitory receptor (FcγRIIB) remained highly elevated during both acute and chronic phases of infection. The highly induced expression of activating FcγRIV during the acute phase of infection was also noteworthy. Furthermore, in vitro analysis using cultured primary microglia demonstrated the role of interferon (IFN)γ and interleukin (IL)-4 in polarizing these cells towards a M1 or M2 phenotype, respectively. Microglial cell-polarization correlated with maximal expression of either FcγRIV or FcγRIIB following stimulation with IFNγ or IL-4, respectively. Finally, we observed a significant delay in polarization of microglia towards an M2 phenotype in the absence of FcγRs in MCMV-infected Fcer1g and FcgR2b knockout mice. These studies demonstrate that neuro-inflammation following viral infection increases expression of activating FcγRs on M1-polarized microglia. In contrast, expression of the inhibitory FcγRIIB receptor promotes M2-polarization in order to shut-down deleterious immune responses and limit bystander brain damage. PMID:28165503

  16. Residue 82 of the Chikungunya Virus E2 Attachment Protein Modulates Viral Dissemination and Arthritis in Mice

    PubMed Central

    Ashbrook, Alison W.; Burrack, Kristina S.; Silva, Laurie A.; Montgomery, Stephanie A.; Heise, Mark T.; Morrison, Thomas E.

    2014-01-01

    CHIKV pathogenesis, we probed the function of an amino acid polymorphism in the E2 viral attachment protein using a mouse model of CHIKV musculoskeletal disease. In addition to influencing glycosaminoglycan utilization, we identified roles for this polymorphism in differential infection of mammalian and mosquito cells and targeting of CHIKV to specific tissues within infected mice. These studies demonstrate a correlation between CHIKV tissue tropism and virus-induced pathology modulated by a single polymorphism in E2, which in turn illuminates potential targets for vaccine and antiviral drug development. PMID:25142598

  17. Nonstructural 5A Protein of Hepatitis C Virus Interacts with Pyruvate Carboxylase and Modulates Viral Propagation

    PubMed Central

    Kim, Jong-Wook; Hwang, Soon B.

    2013-01-01

    Hepatitis C virus (HCV) is highly dependent on cellular factors for its own propagation. By employing tandem affinity purification method, we identified pyruvate carboxylase (PC) as a cellular partner for NS5A protein. NS5A interacted with PC through the N-terminal region of NS5A and the biotin carboxylase domain of PC. PC expression was decreased in cells expressing NS5A and HCV-infected cells. Promoter activity of PC was also decreased by NS5A protein. However, FAS expression was increased in cells expressing NS5A and cell culture grown HCV (HCVcc)-infected cells. Silencing of PC promoted fatty acid synthase (FAS) expression level. These data suggest HCV may modulate PC via NS5A protein for its own propagation. PMID:23861867

  18. Effects of herbal medicinal formulas on suppressing viral replication and modulating immune responses.

    PubMed

    Liao, Hui-Fen; Lu, Min-Chi; Chang, Hon-Chou; Wei, Cheng-Chung; Kao, Chih-Hsiung; Chen, Zong-Huei; Huang, Chin-Chin; Li, Ching

    2010-01-01

    The Chinese medicinal herbs Radix Isatidis and Viola yedoensis Makino have been suggested to possess antiviral activity. This study tests whether these and other Chinese and Western herbal medicinal formulas can modulate the immune functions involving virus-suppression in BALB/c mouse. We first confirmed the extract from Viola yedoensis Makino, but not from Radix Isatidis, the traditional Chinese medicine (TCM) formula Chui-Uren-Chien (CUC), or a Western homeopathic medicinal drink Método Canova, could inhibit the replications of herpes simplex virus-1 and enterovirus 71 in the human neuroblastoma SK-N-SH cell line. Subsequently, the same herbal extracts and drink underwent toxicity and immunomodulatory tests on mice of 5-7 weeks old. After 8 weeks of feeding different herbal medicinal formulas, no hepatic or renal toxicity was noted in any tested animal; whereas among the immune function evaluations, only the mice treated with CUC extract were found to be associated with significant increases (p < 0.05) in both the level of plasma IgG and the percentage of monocyte in blood mononuclear cells as well as the activation of macrophage Raw264.7 cells for nitric oxide production, suggesting its role in modulating the non-specific immune response. Analyses using protein arrays showed CUC was the most potent herbal medicinal formula eliciting fluctuations in plasma cytokine and chemokine concentrations. Taking all experimental data together, we conclude Chui-Uren-Chien possesses immunomodulatory capability in mouse, but none of the herbal medicinal formulas tested here are involved in strengthening antiviral immunity.

  19. A CD83-like molecule in sea bass (Dicentrarchus labrax): molecular characterization and modulation by viral and bacterial infection.

    PubMed

    Buonocore, Francesco; Randelli, Elisa; Tranfa, Paola; Scapigliati, Giuseppe

    2012-06-01

    The CD83 cell surface marker is an important and intriguing component of immune system. It is considered the best marker for mature human dendritic cells, but it is also important for thymic development of T cells, and it also plays a role as a regulator of peripheral B-cell function and homeostasis. A CD83-like molecule was identified in sea bass (Dicentrarchus labrax) by EST sequencing of a thymus cDNA library; the CD83 cDNA is composed of 816 bp and the mature CD83 peptide consists of 195 amino acids, with a putative signal peptide of 18 amino acids and two possible N-glycosylation sites. The comparison of sea bass CD83 sequence with its homologues in other fish species and mammals shows some differences, with two cysteine residues conserved from fish to mammals and a high variability both in the total number of cysteines and in mature CD83 sequence polypeptide length. Basal transcripts levels of CD83 mRNA are highest in liver, followed by thymus. The in vitro treatment of head kidney leukocytes with LPS resulted in a down-regulation on CD83 mRNA leves both after 4 and 24 h, whereas with poly I:C an up-regulation after 4h followed by a down-regulation at 24 h was observed. An in vivo infection of sea bass juveniles with nodavirus induced an increase of CD83 expression on head kidney leukocytes both after 6 and 24 h and a decrease after 72 h. On the other hand, an in vivo infection with Photobacterium damselae bacteria induced a decrease of CD83 transcript levels after 6 and 24 h and an increase after 72 h. These findings suggest in sea bass CD83 expression could be modulated by viral and bacterial immune response.

  20. Inhibition of the host proteasome facilitates papaya ringspot virus accumulation and proteosomal catalytic activity is modulated by viral factor HcPro.

    PubMed

    Sahana, Nandita; Kaur, Harpreet; Basavaraj; Tena, Fatima; Jain, Rakesh Kumar; Palukaitis, Peter; Canto, Tomas; Praveen, Shelly

    2012-01-01

    The ubiquitin/26S proteasome system plays an essential role not only in maintaining protein turnover, but also in regulating many other plant responses, including plant-pathogen interactions. Previous studies highlighted different roles of the 20S proteasome in plant defense during virus infection, either indirectly through viral suppressor-mediated degradation of Argonaute proteins, affecting the RNA interference pathway, or directly through modulation of the proteolytic and RNase activity of the 20S proteasome, a component of the 20S proteasome, by viral proteins, affecting the levels of viral proteins and RNAs. Here we show that MG132, a cell permeable proteasomal inhibitor, caused an increase in papaya ringspot virus (PRSV) accumulation in its natural host papaya (Carica papaya). We also show that the PRSV HcPro interacts with the papaya homologue of the Arabidopsis PAA (α1 subunit of the 20S proteasome), but not with the papaya homologue of Arabidopsis PAE (α5 subunit of the 20S proteasome), associated with the RNase activity, although the two 20S proteasome subunits interacted with each other. Mutated forms of PRSV HcPro showed that the conserved KITC54 motif in the N-terminal domain of HcPro was necessary for its binding to PAA. Co-agroinfiltration assays demonstrated that HcPro expression mimicked the action of MG132, and facilitated the accumulation of bothtotal ubiquitinated proteins and viral/non-viral exogenous RNA in Nicotiana benthamiana leaves. These effects were not observed by using an HcPro mutant (KITS54), which impaired the HcPro - PAA interaction. Thus, the PRSV HcPro interacts with a proteasomal subunit, inhibiting the action of the 20S proteasome, suggesting that HcPro might be crucial for modulating its catalytic activities in support of virus accumulation.

  1. An intrinsically disordered peptide from Ebola virus VP35 controls viral RNA synthesis by modulating nucleoprotein-RNA interactions

    SciTech Connect

    Leung, Daisy  W.; Borek, Dominika; Luthra, Priya; Binning, Jennifer  M.; Anantpadma, Manu; Liu, Gai; Harvey, Ian B.; Su, Zhaoming; Endlich-Frazier, Ariel; Pan, Juanli; Shabman, Reed  S.; Chiu, Wah; Davey, Robert  A.; Otwinowski, Zbyszek; Basler, Christopher  F.; Amarasinghe, Gaya  K.

    2015-04-01

    During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNPNTD complex, solved to 3.7 Å resolution, reveals how NPBP peptide occludes a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.

  2. LIM Kinase 1 Modulates Cortical Actin and CXCR4 Cycling and Is Activated by HIV-1 to Initiate Viral Infection*

    PubMed Central

    Vorster, Paul J.; Guo, Jia; Yoder, Alyson; Wang, Weifeng; Zheng, Yanfang; Xu, Xuehua; Yu, Dongyang; Spear, Mark; Wu, Yuntao

    2011-01-01

    Almost all viral pathogens utilize a cytoskeleton for their entry and intracellular transport. In HIV-1 infection, binding of the virus to blood resting CD4 T cells initiates a temporal course of cortical actin polymerization and depolymerization, a process mimicking the chemotactic response initiated from chemokine receptors. The actin depolymerization has been suggested to promote viral intracellular migration through cofilin-mediated actin treadmilling. However, the role of the virus-mediated actin polymerization in HIV infection is unknown, and the signaling molecules involved remain unidentified. Here we describe a pathogenic mechanism for triggering early actin polymerization through HIV-1 envelope-mediated transient activation of the LIM domain kinase (LIMK), a protein that phosphorylates cofilin. We demonstrate that HIV-mediated LIMK activation is through gp120-triggered transient activation of the Rack-PAK-LIMK pathway, and that knockdown of LIMK through siRNA decreases filamentous actin, increases CXCR4 trafficking, and diminishes viral DNA synthesis. These results suggest that HIV-mediated early actin polymerization may directly regulate the CXCR4 receptor during viral entry and is involved in viral DNA synthesis. Furthermore, we also demonstrate that in resting CD4 T cells, actin polymerization can be triggered through transient treatment with a pharmacological agent, okadaic acid, that activates LIMK and promotes HIV latent infection of resting CD4 T cells. Taken together, our results suggest that HIV hijacks LIMK to control the cortical actin dynamics for the initiation of viral infection of CD4 T cells. PMID:21321123

  3. Viral Miniproteins

    PubMed Central

    DiMaio, Daniel

    2015-01-01

    Many viruses encode short transmembrane proteins that play vital roles in virus replication or virulence. Because these proteins are often less than 50 amino acids long and not homologous to cellular proteins, their open reading frames were often overlooked during the initial annotation of viral genomes. Some of these proteins oligomerize in membranes and form ion channels. Other miniproteins bind to cellular transmembrane proteins and modulate their activity, whereas still others have an unknown mechanism of action. Based on the underlying principles of transmembrane miniprotein structure, it is possible to build artificial small transmembrane proteins that modulate a variety of biological processes. These findings suggest that short transmembrane proteins provide a versatile mechanism to regulate a wide range of cellular activities, and we speculate that cells also express many similar proteins that have not yet been discovered. PMID:24742054

  4. Small Interfering RNA Pathway Modulates Initial Viral Infection in Midgut Epithelium of Insect after Ingestion of Virus

    PubMed Central

    Lan, Hanhong; Chen, Hongyan; Liu, Yuyan; Jiang, Chaoyang; Mao, Qianzhuo; Jia, Dongsheng; Chen, Qian

    2015-01-01

    ABSTRACT Numerous viruses are transmitted in a persistent manner by insect vectors. Persistent viruses establish their initial infection in the midgut epithelium, from where they disseminate to the midgut visceral muscles. Although propagation of viruses in insect vectors can be controlled by the small interfering RNA (siRNA) antiviral pathway, whether the siRNA pathway can control viral dissemination from the midgut epithelium is unknown. Infection by a rice virus (Southern rice black streaked dwarf virus [SRBSDV]) of its incompetent vector (the small brown planthopper [SBPH]) is restricted to the midgut epithelium. Here, we show that the siRNA pathway is triggered by SRBSDV infection in continuously cultured cells derived from the SBPH and in the midgut of the intact insect. Knockdown of the expression of the core component Dicer-2 of the siRNA pathway by RNA interference strongly increased the ability of SRBSDV to propagate in continuously cultured SBPH cells and in the midgut epithelium, allowing viral titers in the midgut epithelium to reach the threshold (1.99 × 109 copies of the SRBSDV P10 gene/μg of midgut RNA) needed for viral dissemination into the SBPH midgut muscles. Our results thus represent the first elucidation of the threshold for viral dissemination from the insect midgut epithelium. Silencing of Dicer-2 further facilitated the transmission of SRBSDV into rice plants by SBPHs. Taken together, our results reveal the new finding that the siRNA pathway can control the initial infection of the insect midgut epithelium by a virus, which finally affects the competence of the virus's vector. IMPORTANCE Many viral pathogens that cause significant global health and agricultural problems are transmitted via insect vectors. The first bottleneck in viral infection, the midgut epithelium, is a principal determinant of the ability of an insect species to transmit a virus. Southern rice black streaked dwarf virus (SRBSDV) is restricted exclusively to the

  5. Immunological Characterization of the Teleost Adipose Tissue and Its Modulation in Response to Viral Infection and Fat-Content in the Diet

    PubMed Central

    Pignatelli, Jaime; Castro, Rosario; González Granja, Aitor; Abós, Beatriz; González, Lucia; Jensen, Linda B.; Tafalla, Carolina

    2014-01-01

    The immune response of the adipose tissue (AT) has been neglected in most animal models until recently, when the observations made in human and mice linking obesity to chronic inflammation and diabetes highlighted an important immune component of this tissue. In the current study, we have immunologically characterized the AT for the first time in teleosts. We have analyzed the capacity of rainbow trout (Oncorhynchus mykiss) AT to produce different immune mediators and we have identified the presence of local populations of B lymphocytes expressing IgM, IgD or IgT, CD8α+ cells and cells expressing major histocompatibility complex II (MHC-II). Because trout AT retained antigens from the peritoneal cavity, we analyzed the effects of intraperitoneal infection with viral hemorrhagic septicemia virus (VHSV) on AT functionality. A wide range of secreted immune factors were modulated within the AT in response to VHSV. Furthermore, the viral infection provoked a significant decrease in the number of IgM+ cells which, along with an increased secretion of IgM in the tissue, suggested a differentiation of B cells into plasmablasts. The virus also increased the number of CD8α+ cells in the AT. Finally, when a fat-enriched diet was fed to the fish, a significant modulation of immune gene expression in the AT was also observed. Thus, we have demonstrated for the first time in teleost that the AT functions as a relevant immune tissue; responsive to peritoneal viral infections and that this immune response can be modulated by the fat-content in the diet. PMID:25333488

  6. An intrinsically disordered peptide from Ebola virus VP35 controls viral RNA synthesis by modulating nucleoprotein-RNA interactions

    DOE PAGES

    Leung, Daisy  W.; Borek, Dominika; Luthra, Priya; ...

    2015-04-01

    During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNPNTD complex, solved to 3.7 Å resolution, reveals how NPBP peptide occludesmore » a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.« less

  7. Viral Hepatitis

    MedlinePlus

    ... Public Home » For Veterans and the Public Viral Hepatitis Menu Menu Viral Hepatitis Viral Hepatitis Home For ... the Public Veterans and Public Home How is Hepatitis C Treated? Find the facts about the newest ...

  8. Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

    PubMed

    Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

    2015-08-01

    DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

  9. Three types of human CpG motifs differentially modulate and augment immunogenicity of nonviral and viral replicon DNA vaccines as built-in adjuvants.

    PubMed

    Yu, Yun-Zhou; Li, Na; Ma, Yao; Wang, Shuang; Yu, Wei-Yuan; Sun, Zhi-Wei

    2013-01-01

    NakedDNA vaccines given by intramuscular injection are efficient in mouse models, but they require improvement for human use. As the immunogenicity of DNA vaccines depends, to a large extent, on the presence of CpG motifs as built-in adjuvants, we addressed this issue by inserting three types of human CpG motifs (A-type, B-type, and C-type) into the backbone of nonviral DNA and viral DNA replicon vectors with distinct immunostimulatory activities on human PBMCs. The adjuvant effects of CpG modifications in DNA vaccines expressing three types of antigens (β-Gal, AHc, or PA4) were then characterized in mice and found to significantly enhance antigen-specific humoral and cell-mediated immune responses. The three types of CpG motifs also differentially affected and modulated immune responses and protective potency against botulinum neurotoxin serotype A and Bacillus anthracis A16R challenge. Taken together, these results demonstrate that insertion of human CpG motifs can differentially modulate the immunogenicity of nonviral DNA vaccines as well as viral DNA replicon vaccines. Our study provides not only a better understanding of the in vivo activities of CpG motif adjuvants but implications for the rational design of such motifs as built-in adjuvants for DNA vectors targeting specific antigens.

  10. Human Choline Kinase-α Promotes Hepatitis C Virus RNA Replication through Modulation of Membranous Viral Replication Complex Formation

    PubMed Central

    Wong, Mun-Teng

    2016-01-01

    ABSTRACT Hepatitis C virus (HCV) infection reorganizes cellular membranes to create an active viral replication site named the membranous web (MW). The role that human choline kinase-α (hCKα) plays in HCV replication remains elusive. Here, we first showed that hCKα activity, not the CDP-choline pathway, promoted viral RNA replication. Confocal microscopy and subcellular fractionation of HCV-infected cells revealed that a small fraction of hCKα colocalized with the viral replication complex (RC) on the endoplasmic reticulum (ER) and that HCV infection increased hCKα localization to the ER. In the pTM-NS3-NS5B model, NS3-NS5B expression increased the localization of the wild-type, not the inactive D288A mutant, hCKα on the ER, and hCKα activity was required for effective trafficking of hCKα and NS5A to the ER. Coimmunoprecipitation showed that hCKα was recruited onto the viral RC presumably through its binding to NS5A domain 1 (D1). hCKα silencing or treatment with CK37, an hCKα activity inhibitor, abolished HCV-induced MW formation. In addition, hCKα depletion hindered NS5A localization on the ER, interfered with NS5A and NS5B colocalization, and mitigated NS5A-NS5B interactions but had no apparent effect on NS5A-NS4B and NS4B-NS5B interactions. Nevertheless, hCKα activity was not essential for the binding of NS5A to hCKα or NS5B. These findings demonstrate that hCKα forms a complex with NS5A and that hCKα activity enhances the targeting of the complex to the ER, where hCKα protein, not activity, mediates NS5A binding to NS5B, thereby promoting functional membranous viral RC assembly and viral RNA replication. IMPORTANCE HCV infection reorganizes the cellular membrane to create an active viral replication site named the membranous web (MW). Here, we report that human choline kinase-α (hCKα) acts as an essential host factor for HCV RNA replication. A fraction of hCKα colocalizes with the viral replication complex (RC) on the endoplasmic reticulum

  11. Host Cellular Protein TRAPPC6AΔ Interacts with Influenza A Virus M2 Protein and Regulates Viral Propagation by Modulating M2 Trafficking

    PubMed Central

    Zhu, Pengyang; Liang, Libin; Shao, Xinyuan; Luo, Weiyu; Jiang, Shuitao; Zhao, Qingqing; Sun, Nan; Zhao, Yuhui; Li, Junping; Wang, Jinguang; Zhou, Yuan; Zhang, Jie; Wang, Guangwen; Jiang, Li

    2016-01-01

    ABSTRACT Influenza A virus (IAV) matrix protein 2 (M2) plays multiple roles in the early and late phases of viral infection. Once synthesized, M2 is translocated to the endoplasmic reticulum (ER), travels to the Golgi apparatus, and is sorted at the trans-Golgi network (TGN) for transport to the apical plasma membrane, where it functions in virus budding. We hypothesized that M2 trafficking along with its secretory pathway must be finely regulated, and host factors could be involved in this process. However, no studies examining the role of host factors in M2 posttranslational transport have been reported. Here, we used a yeast two-hybrid (Y2H) system to screen for host proteins that interact with the M2 protein and identified transport protein particle complex 6A (TRAPPC6A) as a potential binding partner. We found that both TRAPPC6A and its N-terminal internal-deletion isoform, TRAPPC6A delta (TRAPPC6AΔ), interact with M2. Truncation and mutation analyses showed that the highly conserved leucine residue at position 96 of M2 is critical for mediating this interaction. The role of TRAPPC6AΔ in the viral life cycle was investigated by the knockdown of endogenous TRAPPC6AΔ with small interfering RNA (siRNA) and by generating a recombinant virus that was unable to interact with TRAPPC6A/TRAPPC6AΔ. The results indicated that TRAPPC6AΔ, through its interaction with M2, slows M2 trafficking to the apical plasma membrane, favors viral replication in vitro, and positively modulates virus virulence in mice. IMPORTANCE The influenza A virus M2 protein regulates the trafficking of not only other proteins but also itself along the secretory pathway. However, the host factors involved in the regulation of the posttranslational transport of M2 are largely unknown. In this study, we identified TRAPPC6A and its N-terminal internal-deletion isoform, TRAPPC6AΔ, as interacting partners of M2. We found that the leucine (L) residue at position 96 of M2 is critical for mediating

  12. Regulation of human papillomavirus transcription by the differentiation-dependent epithelial factor Epoc-1/skn-1a.

    PubMed

    Yukawa, K; Butz, K; Yasui, T; Kikutani, H; Hoppe-Seyler, F

    1996-01-01

    Human papillomavirus (HPV) early gene expression is closely linked to the differentiation status of infected epithelial cells. Typically, HPV type 16 (HPV16) or HPV18 E6 and E7 transcripts are only barely detectable within the undifferentiated basal cell layer, but their levels increase concomitantly with higher degrees of epithelial cell differentiation in suprabasal cells. A similar differentiation-dependent distribution of expression has been reported for the recently cloned epithelial cell specific transcription factor Epoc-1/skn-1a. We therefore examined whether Epoc-1/skn-1a may be directly involved in the activation of HPV E6/E7 transcription. Transient transfection studies showed that Epoc-1/skn-1a specifically stimulated the HPV16 and HPV18 E6/E7 promoters. Moreover, ectopically expressed Epoc-1/skn-1a was sufficient to stimulate HPV transcription also in nonepithelial cells. By deletion analyses, the Epoc-1/skn-1a-responsive element was mapped to the promoter-proximal portion of the HPV18 transcriptional control region. Footprint analyses and gel retardation assays demonstrated direct binding of Epoc-1/skn-1a to a hitherto uncharacterized site within this region. Mutation of the Epoc-1/skn-1a recognition site within the context of the complete HPV18 upstream regulatory region inhibited Epoc-1/skn-1a-mediated transactivation. These results show that Epoc-1/skn-1a can directly activate the E6/E7 promoter by binding to the viral transcriptional control region. Thus, Epoc-1/skn-1a may be involved in the differentiation-dependent regulation of HPV transcription.

  13. Bovine viral diarrhea virus type 2 in vivo infection modulates TLR4 responsiveness in differentiated myeloid cells which is associated with decreased MyD88 expression.

    PubMed

    Schaut, Robert G; McGill, Jodi L; Neill, John D; Ridpath, Julia F; Sacco, Randy E

    2015-10-02

    Symptoms of bovine viral diarrhea virus (BVDV) infection range from subclinical to severe, depending on strain virulence. Several in vitro studies showed BVDV infection impaired leukocyte function. Fewer studies have examined the effects of in vivo BVDV infection on monocyte/macrophage function, especially with strains of differing virulence. We characterized cytokine production by bovine myeloid cells isolated early or late in high (HV) or low virulence (LV) BVDV2 infection. Given BVDV infection may enhance susceptibility to secondary bacterial infection, LPS responses were examined as well. Monocytes from HV and LV infected calves produced higher levels of cytokines compared to cells from controls. In contrast, monocyte-derived macrophage cytokine levels were generally reduced. Modulated cytokine expression in HV BVDV2 macrophages was associated with decreased MyD88 expression, likely due to its interaction with viral NS5A. These data and those of others, suggest that certain Flaviviridae may have evolved strategies for subverting receptor signaling pathways involving MyD88.

  14. Alternative splicing of human immunodeficiency virus type 1 mRNA modulates viral protein expression, replication, and infectivity.

    PubMed Central

    Purcell, D F; Martin, M A

    1993-01-01

    Multiple RNA splicing sites exist within human immunodeficiency virus type 1 (HIV-1) genomic RNA, and these sites enable the synthesis of many mRNAs for each of several viral proteins. We evaluated the biological significance of the alternatively spliced mRNA species during productive HIV-1 infections of peripheral blood lymphocytes and human T-cell lines to determine the potential role of alternative RNA splicing in the regulation of HIV-1 replication and infection. First, we used a semiquantitative polymerase chain reaction of cDNAs that were radiolabeled for gel analysis to determine the relative abundance of the diverse array of alternatively spliced HIV-1 mRNAs. The predominant rev, tat, vpr, and env RNAs contained a minimum of noncoding sequence, but the predominant nef mRNAs were incompletely spliced and invariably included noncoding exons. Second, the effect of altered RNA processing was measured following mutagenesis of the major 5' splice donor and several cryptic, constitutive, and competing 3' splice acceptor motifs of HIV-1NL4-3. Mutations that ablated constitutive splice sites led to the activation of new cryptic sites; some of these preserved biological function. Mutations that ablated competing splice acceptor sites caused marked alterations in the pool of virus-derived mRNAs and, in some instances, in virus infectivity and/or the profile of virus proteins. The redundant RNA splicing signals in the HIV-1 genome and alternatively spliced mRNAs provides a mechanism for regulating the relative proportions of HIV-1 proteins and, in some cases, viral infectivity. Images PMID:8411338

  15. Viral Meningitis

    MedlinePlus

    ... have severe illness from viral meningitis. Causes Non-polio enteroviruses are the most common cause of viral ... following viruses spread by visiting CDC’s websites: Non-polio enteroviruses Mumps virus Herpesviruses, including Epstein-Barr virus , ...

  16. Viral Infections

    MedlinePlus

    ... from medicines, which usually move through your bloodstream. Antibiotics do not work for viral infections. There are a few antiviral medicines available. Vaccines can help prevent you from getting many viral diseases. NIH: National Institute of Allergy and Infectious Diseases

  17. The structure of mouse cytomegalovirus m04 protein obtained from sparse NMR data reveals a conserved fold of the m02-m06 viral immune modulator family.

    PubMed

    Sgourakis, Nikolaos G; Natarajan, Kannan; Ying, Jinfa; Vogeli, Beat; Boyd, Lisa F; Margulies, David H; Bax, Ad

    2014-09-02

    Immunoevasins are key proteins used by viruses to subvert host immune responses. Determining their high-resolution structures is key to understanding virus-host interactions toward the design of vaccines and other antiviral therapies. Mouse cytomegalovirus encodes a unique set of immunoevasins, the m02-m06 family, that modulates major histocompatibility complex class I (MHC-I) antigen presentation to CD8+ T cells and natural killer cells. Notwithstanding the large number of genetic and functional studies, the structural biology of immunoevasins remains incompletely understood, largely because of crystallization bottlenecks. Here we implement a technology using sparse nuclear magnetic resonance data and integrative Rosetta modeling to determine the structure of the m04/gp34 immunoevasin extracellular domain. The structure reveals a β fold that is representative of the m02-m06 family of viral proteins, several of which are known to bind MHC-I molecules and interfere with antigen presentation, suggesting its role as a diversified immune regulation module.

  18. Viral pneumonia

    MedlinePlus

    ... Names Pneumonia - viral; Walking pneumonia - viral Images Lungs Respiratory system References Lee FE, Treanor JJ. Viral infections. In: Broaddus VC, Mason RJ, Ernst JD, et al, eds. Murray and Nadel's Textbook of Respiratory Medicine . 6th ed. Philadelphia, PA: Elsevier Saunders; 2016: ...

  19. Human CD64-targeted non-viral siRNA delivery system for blood monocyte gene modulation

    PubMed Central

    Yong, Seok-Beom; Kim, Hyung Jin; Kim, Jang Kyoung; Chung, Jee Young; Kim, Yong-Hee

    2017-01-01

    A subset of phagocytes including inflammatory monocytes in blood migrate and give rise to macrophages in inflammatory tissues which generated the idea that blood monocytes are the therapeutic targets for drug delivery. Fc gamma receptor I (CD64) is a membrane receptor for the Fc region of immunoglobulin G, primarily expressed on monocyte-lineage, and H22 a monoclonal antibody for human CD64 had shown rapid blood monocyte binding and occupation in clinical studies. Small interfering RNA-mediated gene silencing as a therapeutic has been proposed and is a promising strategy in terms of its “knock-down” ability on the target gene prior to translation. However, its instability and off-targeting effect must be overcome for success in clinical studies. In this study, we developed a non-viral delivery system composed of oligo-nona-arginine (9R) and anti-human CD64 single chain antibodies (H22) for human monocyte-specific siRNA delivery. A targeted and efficient siRNA delivery mediated by anti-CD64 scFv-9R was observed in CD64 positive human leukemia cells, THP-1. With primary human blood cells, anti-CD64 scFv-9R mediated gene silencing was quantitatively confirmed representing blood monocyte selective gene delivery. These results demonstrate the potential of anti-CD64 scFv-9R mediated siRNA delivery for the treatment of human inflammatory diseases via blood monocytes gene delivery. PMID:28169353

  20. Modulation of NKG2D-mediated cytotoxic functions of natural killer cells by viral protein R from HIV-1 primary isolates.

    PubMed

    Pham, Tram N Q; Richard, Jonathan; Gerard, Francine C A; Power, Christopher; Cohen, Éric A

    2011-12-01

    HIV-1 viral protein R (Vpr) from laboratory-adapted virus strains activates the DNA damage/stress sensor ATR kinase and induces cell cycle arrest at the G(2)/M phase through a process that requires Vpr to engage the DDB1-CUL4A (VprBP/DCAF-1) E3 ligase complex. Activation of this DNA damage/stress checkpoint in G(2) by Vpr was shown to modulate NKG2D-dependent NK cell effector functions via enhancing expression of NKG2D ligands, notably ULBP2. However, it is unknown whether Vpr from HIV-1 primary isolates (groups M, N, O, and P) could modulate NKG2D-mediated cytotoxic functions of NK cells. Here, we report that Vpr from most HIV-1 primary isolates can upregulate ULBP2 expression and induce NKG2D-dependent NK cell killing. Importantly, these activities were always accompanied by an active G(2) cell cycle arrest function. Interestingly, Vpr variants from group P and a clade D isolate of group M were defective at enhancing NKG2D-mediated NK cell lysis owing to their inability to augment ULBP2 expression. However, distinct mechanisms were responsible for their failure to do so. While Vpr from group P was deficient in its ability to engage the DDB1-CUL4A (VprBP/DCAF-1) E3 ligase complex, the Vpr variant from group D was unable to properly localize to the nucleus, underlining the importance of these biological properties in Vpr function. In conclusion, the ability of Vpr from HIV-1 primary isolates to regulate NK cell effector function underscores the importance of this HIV-1 accessory protein in the modulation of the host's innate immune responses.

  1. Human papillomaviruses activate and recruit SMC1 cohesin proteins for the differentiation-dependent life cycle through association with CTCF insulators.

    PubMed

    Mehta, Kavi; Gunasekharan, Vignesh; Satsuka, Ayano; Laimins, Laimonis A

    2015-04-01

    Human papillomaviruses infect stratified epithelia and link their productive life cycle to the differentiation state of the host cell. Productive viral replication or amplification is restricted to highly differentiated suprabasal cells and is dependent on the activation of the ATM DNA damage pathway. The ATM pathway has three arms that can act independently of one another. One arm is centered on p53, another on CHK2 and a third on SMC1/NBS1 proteins. A role for CHK2 in HPV genome amplification has been demonstrated but it was unclear what other factors provided important activities. The cohesin protein, SMC1, is necessary for sister chromatid association prior to mitosis. In addition the phosphorylated form of SMC1 plays a critical role together with NBS1 in the ATM DNA damage response. In normal cells, SMC1 becomes phosphorylated in response to radiation, however, in HPV positive cells our studies demonstrate that it is constitutively activated. Furthermore, pSMC1 is found localized in distinct nuclear foci in complexes with γ-H2AX, and CHK2 and bound to HPV DNA. Importantly, knockdown of SMC1 blocks differentiation-dependent genome amplification. pSMC1 forms complexes with the insulator transcription factor CTCF and our studies show that these factors bind to conserved sequence motifs in the L2 late region of HPV 31. Similar motifs are found in most HPV types. Knockdown of CTCF with shRNAs blocks genome amplification and mutation of the CTCF binding motifs in the L2 open reading frame inhibits stable maintenance of viral episomes in undifferentiated cells as well as amplification of genomes upon differentiation. These findings suggest a model in which SMC1 factors are constitutively activated in HPV positive cells and recruited to viral genomes through complex formation with CTCF to facilitate genome amplification. Our findings identify both SMC1 and CTCF as critical regulators of the differentiation-dependent life cycle of high-risk human papillomaviruses.

  2. Surface-Engineered Contact Lens as an Advanced Theranostic Platform for Modulation and Detection of Viral Infection.

    PubMed

    Mak, Wing Cheung; Cheung, Kwan Yee; Orban, Jenny; Lee, Chyan-Jang; Turner, Anthony P F; Griffith, May

    2015-11-18

    We have demonstrated an entirely new concept of a wearable theranostic device in the form of a contact lens (theranostic lens) with a dual-functional hybrid surface to modulate and detect a pathogenic attack, using a the corneal HSV serotype-1 (HSV-1) model. The theranostic lenses were constructed using a facile layer-by-layer surface engineering technique, keeping the theranostic lenses with good surface wettability, optically transparency, and nontoxic toward human corneal epithelial cells. The theranostic lenses were used to capture and concentrate inflammatory cytokines such as interleukin-1α (IL-1α), which is upregulated during HSV-1 reactivation, for sensitive, noninvasive diagnostics. The theranostic lens also incorporated an antiviral coating to serve as a first line of defense to protect patients against disease. Our strategy tackles major problems in tear diagnostics that are mainly associated with the sampling of a relatively small volume of fluid and the low concentration of biomarkers. The theranostic lenses show effective anti-HSV-1 activity and good analytical performance for the detection of IL-1α, with a limit of detection of 1.43 pg mL(-1) and a wide linear range covering the clinically relevant region. This work offers a new paradigm for "wearable" noninvasive healthcare devices combining "diagnosis" and "protection" against disease, while supporting patient compliance. We believe that this approach holds immense promise as a next-generation point-of-care and decentralized diagnostic/theranostic platform for a range of biomarkers.

  3. Viral arthritides.

    PubMed

    Outhred, Alexander C; Kok, Jen; Dwyer, Dominic E

    2011-05-01

    Viral infections may manifest as acute or chronic arthritis. Joint involvement arises from either direct infection of the joint, through an immunological response directed towards the virus or autoimmunity. Epidemiological clues to the diagnosis include geographic location and exposure to vector-borne, blood-borne or sexually transmitted viruses. Although not always possible, it is important to diagnose the pathogenic virus, usually by serology, nucleic acid tests or rarely, viral culture. In general, viral arthritides are self-limiting and treatment is targeted at symptomatic relief. This article focuses on the causes, clinical features, diagnosis and treatment of viral arthritides.

  4. Shrimp STAT was hijacked by white spot syndrome virus immediate-early protein IE1 involved in modulation of viral genes.

    PubMed

    Yao, Defu; Ruan, Lingwei; Lu, Huasong; Shi, Hong; Xu, Xun

    2016-12-01

    STATs are a family of transcription factors that regulate a cascade of cellular processes including cell growth, differentiation, apoptosis and immune responses. However, they are usually targeted by viruses to assist infection. In this study, we identified that white spot syndrome virus (WSSV) immediate-early protein IE1 interacted with Litopenaeus vannamei STAT (LvSTAT) and thereby led to its phosphorylation activation. In addition, we demonstrated that LvSTAT could bind to the promoters of the viral immediate-early genes wsv051 and ie1 through STAT-binding motifs in vitro and vivo, allowing the enhancement of their promoters' activities. Moreover, IE1 could promote the transcriptional activation activity of LvSTAT to augment the transcription of wsv051 and ie1. In conclusion, our findings revealed a novel linkage between WSSV IE1 and shrimp STAT, which was a clue to well understand how WSSV adopted the active strategies to modulate the shrimp signaling pathway.

  5. Viral arthritis

    PubMed Central

    Marks, Michael; Marks, Jonathan L

    2016-01-01

    Acute-onset arthritis is a common clinical problem facing both the general clinician and the rheumatologist. A viral aetiology is though to be responsible for approximately 1% of all cases of acute arthritis with a wide range of causal agents recognised. The epidemiology of acute viral arthritis continues to evolve, with some aetiologies, such as rubella, becoming less common due to vaccination, while some vector-borne viruses have become more widespread. A travel history therefore forms an important part of the assessment of patients presenting with an acute arthritis. Worldwide, parvovirus B19, hepatitis B and C, HIV and the alphaviruses are among the most important causes of virally mediated arthritis. Targeted serological testing may be of value in establishing a diagnosis, and clinicians must also be aware that low-titre autoantibodies, such as rheumatoid factor and antinuclear antibody, can occur in the context of acute viral arthritis. A careful consideration of epidemiological, clinical and serological features is therefore required to guide clinicians in making diagnostic and treatment decisions. While most virally mediated arthritides are self-limiting some warrant the initiation of specific antiviral therapy. PMID:27037381

  6. Viral quasispecies.

    PubMed

    Andino, Raul; Domingo, Esteban

    2015-05-01

    New generation sequencing is greatly expanding the capacity to examine the composition of mutant spectra of viral quasispecies in infected cells and host organisms. Here we review recent progress in the understanding of quasispecies dynamics, notably the occurrence of intra-mutant spectrum interactions, and implications of fitness landscapes for virus adaptation and de-adaptation. Complementation or interference can be established among components of the same mutant spectrum, dependent on the mutational status of the ensemble. Replicative fitness relates to an optimal mutant spectrum that provides the molecular basis for phenotypic flexibility, with implications for antiviral therapy. The biological impact of viral fitness renders particularly relevant the capacity of new generation sequencing to establish viral fitness landscapes. Progress with experimental model systems is becoming an important asset to understand virus behavior in the more complex environments faced during natural infections.

  7. Viral Hepatitis

    MedlinePlus

    ... with hepatitis? How does a pregnant woman pass hepatitis B virus to her baby? If I have hepatitis B, what does my baby need so that she ... Can I breastfeed my baby if I have hepatitis B? More information on viral hepatitis What is hepatitis? ...

  8. Viral Dose and Immunosuppression Modulate the Progression of Acute BVDV-1 Infection in Calves: Evidence of Long Term Persistence after Intra-Nasal Infection

    PubMed Central

    Strong, Rebecca; La Rocca, Severina Anna; Paton, David; Bensaude, Emmanuelle; Sandvik, Torstein; Davis, Leanne; Turner, Jane; Drew, Trevor; Raue, Rudiger; Vangeel, Ilse; Steinbach, Falko

    2015-01-01

    Bovine viral diarrhoea virus (BVDV) infection of cattle causes a diverse range of clinical outcomes from being asymptomatic, or a transient mild disease, to producing severe cases of acute disease leading to death. Four groups of calves were challenged with a type 1 BVDV strain, originating from a severe outbreak of BVDV in England, to study the effect of viral dose and immunosuppression on the viral replication and transmission of BVDV. Three groups received increasing amounts of virus: Group A received 102.55TCID50/ml, group B 105.25TCID50/ml and group C 106.7TCID 50/ml. A fourth group (D) was inoculated with a medium dose (105.25TCID50/ml) and concomitantly treated with dexamethasone (DMS) to assess the effects of chemically induced immunosuppression. Naïve calves were added as sentinel animals to assess virus transmission. The outcome of infection was dose dependent with animals given a higher dose developing severe disease and more pronounced viral replication. Despite virus being shed by the low-dose infection group, BVD was not transmitted to sentinel calves. Administration of dexamethasone (DMS) resulted in more severe clinical signs, prolonged viraemia and virus shedding. Using PCR techniques, viral RNA was detected in blood, several weeks after the limit of infectious virus recovery. Finally, a recently developed strand-specific RT-PCR detected negative strand viral RNA, indicative of actively replicating virus, in blood samples from convalescent animals, as late as 85 days post inoculation. This detection of long term replicating virus may indicate the way in which the virus persists and/or is reintroduced within herds. PMID:25955849

  9. The Influenza Virus H5N1 Infection Can Induce ROS Production for Viral Replication and Host Cell Death in A549 Cells Modulated by Human Cu/Zn Superoxide Dismutase (SOD1) Overexpression.

    PubMed

    Lin, Xian; Wang, Ruifang; Zou, Wei; Sun, Xin; Liu, Xiaokun; Zhao, Lianzhong; Wang, Shengyu; Jin, Meilin

    2016-01-08

    Highly pathogenic H5N1 infections are often accompanied by excessive pro-inflammatory response, high viral titer, and apoptosis; as such, the efficient control of these infections poses a great challenge. The pathogenesis of influenza virus infection is also related to oxidative stress. However, the role of endogenic genes with antioxidant effect in the control of influenza viruses, especially H5N1 viruses, should be further investigated. In this study, the H5N1 infection in lung epithelial cells decreased Cu/Zn superoxide dismutase (SOD1) expression at mRNA and protein levels. Forced SOD1 expression significantly inhibited the H5N1-induced increase in reactive oxygen species, decreased pro-inflammatory response, prevented p65 and p38 phosphorylation, and impeded viral ribonucleoprotein nuclear export and viral replication. The SOD1 overexpression also rescued H5N1-induced cellular apoptosis and alleviated H5N1-caused mitochondrial dysfunction. Therefore, this study described the role of SOD1 in the replication of H5N1 influenza virus and emphasized the relevance of this enzyme in the control of H5N1 replication in epithelial cells. Pharmacological modulation or targeting SOD1 may open a new way to fight H5N1 influenza virus.

  10. Induction of memory cytotoxic T cells to influenza A virus and subsequent viral clearance is not modulated by PB1-F2-dependent inflammasome activation

    PubMed Central

    Lee, Patricia (Hoi Yee); Bird, Nicola; MacKenzie-Kludas, Charley; Mansell, Ashley; Kedzierska, Katherine; Brown, Lorena; McAuley, Julie

    2016-01-01

    Expression of the viral virulence protein PB1-F2 during infection has been linked to NLRP3 inflammasome complex activation in macrophages and induction of early inflammatory events enhancing immunopathology during influenza disease. We sought to determine whether PB1-F2-specific NLRP3 inflammasome activation influenced the magnitude and/or robustness of the CD8+ T-cell responses specific for conserved viral antigens and subsequent virus elimination. Using murine heterosubtypic viral infection models, we showed that mice infected with virus unable to produce PB1-F2 protein showed no deficit in the overall magnitude and functional memory responses of CD8+ T cells established during the effector phase compared with those infected with wild-type PB1-F2-expressing virus and were equally capable of mounting robust recall responses. These data indicate that while expression of PB1-F2 protein can induce inflammatory events, the capacity to generate memory CD8+ T cells specific for immunodominant viral epitopes remains uncompromised. PMID:26667784

  11. Bovine viral diarrhea virus type 2 in vivo infection modulates TLR4 responsiveness in differentiated Myeloid cells which is associated with decreased MyD88 expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bovine viral diarrhea virus (BVDV) causes clinical signs in cattle ranging from mild to severe acute infection which can lead to increased susceptibility to secondary bacteria. In this study we examined the effects of BVDV genotype 2 (BVDV2) infection on the ability of myeloid lineage cells derived...

  12. CTCF and Rad21 act as host cell restriction factors for Kaposi's sarcoma-associated herpesvirus (KSHV) lytic replication by modulating viral gene transcription.

    PubMed

    Li, Da-Jiang; Verma, Dinesh; Mosbruger, Tim; Swaminathan, Sankar

    2014-01-01

    Kaposi's sarcoma-associated herpesvirus (KSHV) is a human herpesvirus that causes Kaposi's sarcoma and is associated with the development of lymphoproliferative diseases. KSHV reactivation from latency and virion production is dependent on efficient transcription of over eighty lytic cycle genes and viral DNA replication. CTCF and cohesin, cellular proteins that cooperatively regulate gene expression and mediate long-range DNA interactions, have been shown to bind at specific sites in herpesvirus genomes. CTCF and cohesin regulate KSHV gene expression during latency and may also control lytic reactivation, although their role in lytic gene expression remains incompletely characterized. Here, we analyze the dynamic changes in CTCF and cohesin binding that occur during the process of KSHV viral reactivation and virion production by high resolution chromatin immunoprecipitation and deep sequencing (ChIP-Seq) and show that both proteins dissociate from viral genomes in kinetically and spatially distinct patterns. By utilizing siRNAs to specifically deplete CTCF and Rad21, a cohesin component, we demonstrate that both proteins are potent restriction factors for KSHV replication, with cohesin knockdown leading to hundred-fold increases in viral yield. High-throughput RNA sequencing was used to characterize the transcriptional effects of CTCF and cohesin depletion, and demonstrated that both proteins have complex and global effects on KSHV lytic transcription. Specifically, both proteins act as positive factors for viral transcription initially but subsequently inhibit KSHV lytic transcription, such that their net effect is to limit KSHV RNA accumulation. Cohesin is a more potent inhibitor of KSHV transcription than CTCF but both proteins are also required for efficient transcription of a subset of KSHV genes. These data reveal novel effects of CTCF and cohesin on transcription from a relatively small genome that resemble their effects on the cellular genome by acting as

  13. RNA-binding protein PSPC1 promotes the differentiation-dependent nuclear export of adipocyte RNAs.

    PubMed

    Wang, Jiexin; Rajbhandari, Prashant; Damianov, Andrey; Han, Areum; Sallam, Tamer; Waki, Hironori; Villanueva, Claudio J; Lee, Stephen D; Nielsen, Ronni; Mandrup, Susanne; Reue, Karen; Young, Stephen G; Whitelegge, Julian; Saez, Enrique; Black, Douglas L; Tontonoz, Peter

    2017-03-01

    A highly orchestrated gene expression program establishes the properties that define mature adipocytes, but the contribution of posttranscriptional factors to the adipocyte phenotype is poorly understood. Here we have shown that the RNA-binding protein PSPC1, a component of the paraspeckle complex, promotes adipogenesis in vitro and is important for mature adipocyte function in vivo. Cross-linking and immunoprecipitation followed by RNA sequencing revealed that PSPC1 binds to intronic and 3'-untranslated regions of a number of adipocyte RNAs, including the RNA encoding the transcriptional regulator EBF1. Purification of the paraspeckle complex from adipocytes further showed that PSPC1 associates with the RNA export factor DDX3X in a differentiation-dependent manner. Remarkably, PSPC1 relocates from the nucleus to the cytoplasm during differentiation, coinciding with enhanced export of adipogenic RNAs. Mice lacking PSPC1 in fat displayed reduced lipid storage and adipose tissue mass and were resistant to diet-induced obesity and insulin resistance due to a compensatory increase in energy expenditure. These findings highlight a role for PSPC1-dependent RNA maturation in the posttranscriptional control of adipose development and function.

  14. Differentiation-dependent interactions between RUNX-1 and FLI-1 during megakaryocyte development.

    PubMed

    Huang, Hui; Yu, Ming; Akie, Thomas E; Moran, Tyler B; Woo, Andrew J; Tu, Nathan; Waldon, Zachary; Lin, Yin Yin; Steen, Hanno; Cantor, Alan B

    2009-08-01

    The transcription factor RUNX-1 plays a key role in megakaryocyte differentiation and is mutated in cases of myelodysplastic syndrome and leukemia. In this study, we purified RUNX-1-containing multiprotein complexes from phorbol ester-induced L8057 murine megakaryoblastic cells and identified the ets transcription factor FLI-1 as a novel in vivo-associated factor. The interaction occurs via direct protein-protein interactions and results in synergistic transcriptional activation of the c-mpl promoter. Interestingly, the interaction fails to occur in uninduced cells. Gel filtration chromatography confirms the differentiation-dependent binding and shows that it correlates with the assembly of a complex also containing the key megakaryocyte transcription factors GATA-1 and Friend of GATA-1 (FOG-1). Phosphorylation analysis of FLI-1 with uninduced versus induced L8057 cells suggests the loss of phosphorylation at serine 10 in the induced state. Substitution of Ser10 with the phosphorylation mimic aspartic acid selectively impairs RUNX-1 binding, abrogates transcriptional synergy with RUNX-1, and dominantly inhibits primary fetal liver megakaryocyte differentiation in vitro. Conversely, substitution with alanine, which blocks phosphorylation, augments differentiation of primary megakaryocytes. We propose that dephosphorylation of FLI-1 is a key event in the transcriptional regulation of megakaryocyte maturation. These findings have implications for other cell types where interactions between runx and ets family proteins occur.

  15. Viral epigenetics.

    PubMed

    Milavetz, Barry I; Balakrishnan, Lata

    2015-01-01

    DNA tumor viruses including members of the polyomavirus, adenovirus, papillomavirus, and herpes virus families are presently the subject of intense interest with respect to the role that epigenetics plays in control of the virus life cycle and the transformation of a normal cell to a cancer cell. To date, these studies have primarily focused on the role of histone modification, nucleosome location, and DNA methylation in regulating the biological consequences of infection. Using a wide variety of strategies and techniques ranging from simple ChIP to ChIP-chip and ChIP-seq to identify histone modifications, nuclease digestion to genome wide next generation sequencing to identify nucleosome location, and bisulfite treatment to MeDIP to identify DNA methylation sites, the epigenetic regulation of these viruses is slowly becoming better understood. While the viruses may differ in significant ways from each other and cellular chromatin, the role of epigenetics appears to be relatively similar. Within the viral genome nucleosomes are organized for the expression of appropriate genes with relevant histone modifications particularly histone acetylation. DNA methylation occurs as part of the typical gene silencing during latent infection by herpesviruses. In the simple tumor viruses like the polyomaviruses, adenoviruses, and papillomaviruses, transformation of the cell occurs via integration of the virus genome such that the virus's normal regulation is disrupted. This results in the unregulated expression of critical viral genes capable of redirecting cellular gene expression. The redirected cellular expression is a consequence of either indirect epigenetic regulation where cellular signaling or transcriptional dysregulation occurs or direct epigenetic regulation where epigenetic cofactors such as histone deacetylases are targeted. In the more complex herpersviruses transformation is a consequence of the expression of the viral latency proteins and RNAs which again can

  16. Human immunodeficiency virus type 1 Tat increases the expression of cleavage and polyadenylation specificity factor 73-kilodalton subunit modulating cellular and viral expression.

    PubMed

    Calzado, Marco A; Sancho, Rocío; Muñoz, Eduardo

    2004-07-01

    The human immunodeficiency virus type 1 (HIV-1) Tat protein, which is essential for HIV gene expression and viral replication, is known to mediate pleiotropic effects on various cell functions. For instance, Tat protein is able to regulate the rate of transcription of host cellular genes and to interact with the signaling machinery, leading to cellular dysfunction. To study the effect that HIV-1 Tat exerts on the host cell, we identified several genes that were up- or down-regulated in tat-expressing cell lines by using the differential display method. HIV-1 Tat specifically increases the expression of the cleavage and polyadenylation specificity factor (CPSF) 73-kDa subunit (CPSF3) without affecting the expression of the 160- and 100-kDa subunits of the CPSF complex. This complex comprises four subunits and has a key function in the 3'-end processing of pre-mRNAs by a coordinated interaction with other factors. CPSF3 overexpression experiments and knockdown of the endogenous CPSF3 by mRNA interference have shown that this subunit of the complex is an important regulatory protein for both viral and cellular gene expression. In addition to the known CPSF3 function in RNA polyadenylation, we also present evidence that this protein exerts transcriptional activities by repressing the mdm2 gene promoter. Thus, HIV-1-Tat up-regulation of CPSF3 could represent a novel mechanism by which this virus increases mRNA processing, causing an increase in both cell and viral gene expression.

  17. Viral Carcinogenesis.

    PubMed

    Smith, A J; Smith, L A

    2016-01-01

    Cancer has been recognized for thousands of years. Egyptians believed that cancer occurred at the will of the gods. Hippocrates believed human disease resulted from an imbalance of the four humors: blood, phlegm, yellow bile, and black bile with cancer being caused by excess black bile. The lymph theory of cancer replaced the humoral theory and the blastema theory replaced the lymph theory. Rudolph Virchow was the first to recognize that cancer cells like all cells came from other cells and believed chronic irritation caused cancer. At the same time there was a belief that trauma caused cancer, though it never evolved after many experiments inducing trauma. The birth of virology occurred in 1892 when Dimitri Ivanofsky demonstrated that diseased tobacco plants remained infective after filtering their sap through a filter that trapped bacteria. Martinus Beijerinck would call the tiny infective agent a virus and both Dimitri Ivanofsky and Marinus Beijerinck would become the fathers of virology. Not to long thereafter, Payton Rous founded the field of tumor virology in 1911 with his discovery of a transmittable sarcoma of chickens by what would come to be called Rous sarcoma virus or RSV for short. The first identified human tumor virus was the Epstein-Barr virus (EBV), named after Tony Epstein and Yvonne Barr who visualized the virus particles in Burkitt's lymphoma cells by electron microscopy in 1965. Since that time, many viruses have been associated with carcinogenesis including the most studied, human papilloma virus associated with cervical carcinoma, many other anogenital carcinomas, and oropharyngeal carcinoma. The World Health Organization currently estimates that approximately 22% of worldwide cancers are attributable to infectious etiologies, of which viral etiologies is estimated at 15-20%. The field of tumor virology/viral carcinogenesis has not only identified viruses as etiologic agents of human cancers, but has also given molecular insights to all human

  18. Volatile Organic Compound Gamma-Butyrolactone Released upon Herpes Simplex Virus Type -1 Acute Infection Modulated Membrane Potential and Repressed Viral Infection in Human Neuron-Like Cells

    PubMed Central

    Waguespack, Yan; Figliozzi, Robert W.; Kharel, Madan K.; Zhang, Qiaojuan; Martin-Caraballo, Miguel

    2016-01-01

    Herpes Simplex Virus Type -1 (HSV-1) infections can cause serious complications such as keratitis and encephalitis. The goal of this study was to identify any changes in the concentrations of volatile organic compounds (VOCs) produced during HSV-1 infection of epithelial cells that could potentially be used as an indicator of a response to stress. An additional objective was to study if any VOCs released from acute epithelial infection may influence subsequent neuronal infection to facilitate latency. To investigate these hypotheses, Vero cells were infected with HSV-1 and the emission of VOCs was analyzed using two-dimensional gas chromatograph/mass spectrometry (2D GC/MS). It was observed that the concentrations of gamma-butyrolactone (GBL) in particular changed significantly after a 24-hour infection. Since HSV-1 may establish latency in neurons after the acute infection, GBL was tested to determine if it exerts neuronal regulation of infection. The results indicated that GBL altered the resting membrane potential of differentiated LNCaP cells and promoted a non-permissive state of HSV-1 infection by repressing viral replication. These observations may provide useful clues towards understanding the complex signaling pathways that occur during the HSV-1 primary infection and establishment of viral latency. PMID:27537375

  19. miR-190 is upregulated in Epstein-Barr Virus type I latency and modulates cellular mRNAs involved in cell survival and viral reactivation.

    PubMed

    Cramer, Elizabeth M; Shao, Ying; Wang, Yan; Yuan, Yan

    2014-09-01

    Epstein-Barr Virus (EBV) is a prevalent human pathogen infecting over 90% of the population. Much of the success of the virus is attributed to its ability to maintain latency. The detailed mechanisms underlying the establishment and maintenance of EBV latency remain poorly understood. A microRNA profiling study revealed differential expression of many cellular miRNAs between types I and III latency cells, suggesting cellular miRNAs may play roles in regulating EBV latency. mir-190 is the most differentially up-regulated miRNA in type I latency cells as compared with type III latency cells and the up-regulation appears to be attributed to EBER RNAs that express in higher levels in type I latency cells than type III cells. With the aide of a lentiviral overexpression system and microarray analysis, several cellular mRNAs are identified as potential targets of mir-190. By targeting TP53INP1, miR-190 enhances cell survival by preventing apoptosis and relieving G0/G1 cell cycle arrest. Additionally, miR-190 down-regulates NR4A3, a cellular immediate-early gene for EBV reactivation, and inhibits the expression of the viral immediate-early gene bzlf1 and viral lytic DNA replication. Taken together, our data revealed a mechanism that EBV utilizes a cellular microRNA to promote host cell survival and prevent virus from entering lytic life cycle for latency maintenance.

  20. A multi-step process of viral adaptation to a mutagenic nucleoside analogue by modulation of transition types leads to extinction-escape.

    PubMed

    Agudo, Rubén; Ferrer-Orta, Cristina; Arias, Armando; de la Higuera, Ignacio; Perales, Celia; Pérez-Luque, Rosa; Verdaguer, Nuria; Domingo, Esteban

    2010-08-26

    Resistance of viruses to mutagenic agents is an important problem for the development of lethal mutagenesis as an antiviral strategy. Previous studies with RNA viruses have documented that resistance to the mutagenic nucleoside analogue ribavirin (1-β-D-ribofuranosyl-1-H-1,2,4-triazole-3-carboxamide) is mediated by amino acid substitutions in the viral polymerase that either increase the general template copying fidelity of the enzyme or decrease the incorporation of ribavirin into RNA. Here we describe experiments that show that replication of the important picornavirus pathogen foot-and-mouth disease virus (FMDV) in the presence of increasing concentrations of ribavirin results in the sequential incorporation of three amino acid substitutions (M296I, P44S and P169S) in the viral polymerase (3D). The main biological effect of these substitutions is to attenuate the consequences of the mutagenic activity of ribavirin -by avoiding the biased repertoire of transition mutations produced by this purine analogue-and to maintain the replicative fitness of the virus which is able to escape extinction by ribavirin. This is achieved through alteration of the pairing behavior of ribavirin-triphosphate (RTP), as evidenced by in vitro polymerization assays with purified mutant 3Ds. Comparison of the three-dimensional structure of wild type and mutant polymerases suggests that the amino acid substitutions alter the position of the template RNA in the entry channel of the enzyme, thereby affecting nucleotide recognition. The results provide evidence of a new mechanism of resistance to a mutagenic nucleoside analogue which allows the virus to maintain a balance among mutation types introduced into progeny genomes during replication under strong mutagenic pressure.

  1. Viral Gastroenteritis (Stomach Flu)

    MedlinePlus

    Diseases and Conditions Viral gastroenteritis (stomach flu) By Mayo Clinic Staff Viral gastroenteritis is an intestinal infection marked by watery diarrhea, abdominal cramps, nausea or vomiting, and ...

  2. A Teleost Bactericidal Permeability-Increasing Protein Kills Gram-Negative Bacteria, Modulates Innate Immune Response, and Enhances Resistance against Bacterial and Viral Infection

    PubMed Central

    Sun, Yuan-yuan; Sun, Li

    2016-01-01

    Bactericidal/permeability-increasing protein (BPI) is an important factor of innate immunity that in mammals is known to take part in the clearance of invading Gram-negative bacteria. In teleost, the function of BPI is unknown. In the present work, we studied the function of tongue sole (Cynoglossus semilaevis) BPI, CsBPI. We found that CsBPI was produced extracellularly by peripheral blood leukocytes (PBL). Recombinant CsBPI (rCsBPI) was able to bind to a number of Gram-negative bacteria but not Gram-positive bacteria. Binding to bacteria led to bacterial death through membrane permeabilization and structural destruction, and the bound bacteria were more readily taken up by PBL. In vivo, rCsBPI augmented the expression of a wide arrange of genes involved in antibacterial and antiviral immunity. Furthermore, rCsBPI enhanced the resistance of tongue sole against bacterial as well as viral infection. These results indicate for the first time that a teleost BPI possesses immunoregulatory effect and plays a significant role in antibacterial and antiviral defense. PMID:27105425

  3. The Arabidopsis AtNPR1 inversely modulates defense responses against fungal, bacterial, or viral pathogens while conferring hypersensitivity to abiotic stresses in transgenic rice.

    PubMed

    Quilis, Jordi; Peñas, Gisela; Messeguer, Joaquima; Brugidou, Christophe; San Segundo, Blanca

    2008-09-01

    The nonexpressor of pathogenesis-related (PR) genes (NPR1) protein plays an important role in mediating defense responses activated by pathogens in Arabidopsis. In rice, a disease-resistance pathway similar to the Arabidopsis NPR1-mediated signaling pathway one has been described. Here, we show that constitutive expression of the Arabidopsis NPR1 (AtNPR1) gene in rice confers resistance against fungal and bacterial pathogens. AtNPR1 exerts its protective effects against fungal pathogens by priming the expression of salicylic acid (SA)-responsive endogenous genes, such as the PR1b, TLP (PR5), PR10, and PBZ1. However, expression of AtNPR1 in rice has negative effects on viral infections. The AtNPR1-expressing rice plants showed a higher susceptibility to infection by the Rice yellow mottle virus (RYMV) which correlated well with a misregulation of RYMV-responsive genes, including expression of the SA-regulated RNA-dependent RNA polymerase 1 gene (OsRDR1). Moreover, AtNPR1 negatively regulates the expression of genes playing a role in the plant response to salt and drought stress (rab21, salT, and dip1), which results in a higher sensitivity of AtNPR1 rice to the two types of abiotic stress. These observations suggest that AtNPR1 has both positive and negative regulatory roles in mediating defense responses against biotic and abiotic stresses.

  4. A Teleost Bactericidal Permeability-Increasing Protein Kills Gram-Negative Bacteria, Modulates Innate Immune Response, and Enhances Resistance against Bacterial and Viral Infection.

    PubMed

    Sun, Yuan-Yuan; Sun, Li

    2016-01-01

    Bactericidal/permeability-increasing protein (BPI) is an important factor of innate immunity that in mammals is known to take part in the clearance of invading Gram-negative bacteria. In teleost, the function of BPI is unknown. In the present work, we studied the function of tongue sole (Cynoglossus semilaevis) BPI, CsBPI. We found that CsBPI was produced extracellularly by peripheral blood leukocytes (PBL). Recombinant CsBPI (rCsBPI) was able to bind to a number of Gram-negative bacteria but not Gram-positive bacteria. Binding to bacteria led to bacterial death through membrane permeabilization and structural destruction, and the bound bacteria were more readily taken up by PBL. In vivo, rCsBPI augmented the expression of a wide arrange of genes involved in antibacterial and antiviral immunity. Furthermore, rCsBPI enhanced the resistance of tongue sole against bacterial as well as viral infection. These results indicate for the first time that a teleost BPI possesses immunoregulatory effect and plays a significant role in antibacterial and antiviral defense.

  5. Human viral cardiomyopathy.

    PubMed

    Maisch, Bernhard; Ristic, Arsen D; Portig, Irene; Pankuweit, Sabine

    2003-01-01

    Viral infection of the heart is relatively common, usually asymptomatic and has a spontaneous and complete resolution. It can, however, in rare cases, lead to substantial cardiac damage, development of viral cardiomyopathy and congestive heart failure. Viral cardiomyopathy is defined as viral persistence in a dilated heart. It may be accompanied by myocardial inflammation and then termed inflammatory viral cardiomyopathy (or viral myocarditis with cardiomegaly). If no inflammation is observed in the biopsy of a dilated heart (<14 lymphocytes and macrophages/mm ) the term viral cardiomyopathy or viral persistence in dilated cardiomyopathy should be applied. The diagnosis of myocarditis and viral cardiomyopathy can be made only by endomyocardial biopsy, implementing the WHO/WHF criteria, and PCR techniques for identification of viral genome. The most frequent cardiotropic viruses detected by endomyocardial biopsy are Parvo B19, enteroviruses, adenoviruses, cytomegalovirus, and less frequently Epstein-Barr virus, and influenza virus.

  6. Differential Modulation of IgT and IgM upon Parasitic, Bacterial, Viral, and Dietary Challenges in a Perciform Fish.

    PubMed

    Piazzon, Maria C; Galindo-Villegas, Jorge; Pereiro, Patricia; Estensoro, Itziar; Calduch-Giner, Josep A; Gómez-Casado, Eduardo; Novoa, Beatriz; Mulero, Victoriano; Sitjà-Bobadilla, Ariadna; Pérez-Sánchez, Jaume

    2016-01-01

    Three different immunoglobulin (Ig) isotypes can be found in teleost fish, IgM, IgD, and the teleost-specific IgT. IgM is considered to have a systemic activity, and IgT is attributed a mucosal role, similar to mammalian IgA. In this study, the complete sequence of gilthead sea bream IgM and IgT in their membrane (m) and soluble (s) forms are described for the first time in a perciform fish. Their constitutive gene expression is analyzed in different tissues, and their regulation upon viral, bacterial, parasitic, mucosal vaccination and dietary challenges are studied. GCB IgM and IgT have the prototypical structure when compared to other fish Igs. The constitutive expression of sIgM was the highest overall in all tissues, whereas mIgT expression was highest in mucosal tissues, such as gills and intestine. IgM and IgT were differentially regulated upon infection. IgT was highly upregulated locally upon infection with the intestinal parasite Enteromyxum leei or systemically after Nodavirus infection. Long-term intestinal parasitic infections increased the serum titer of both isotypes. Mucosal vaccination against Photobacterium damselae subsp. piscicida finely regulated the Ig response inducing a systemic increase of IgM titers in serum and a local IgT response in skin mucus when animals were exposed to the pathogen by bath challenge. Interestingly, plant-based diets inhibit IgT upregulation upon intestinal parasitic challenge, which was related to a worse disease outcome. All these results corroborate the mucosal role of IgT and emphasize the importance of a finely tuned regulation of Ig isotypes upon infection, which could be of special interest in vaccination studies.

  7. The prostacyclin agonist iloprost aggravates fibrosis and enhances viral replication in enteroviral myocarditis by modulation of ERK signaling and increase of iNOS expression.

    PubMed

    Gruhle, Stefan; Sauter, Martina; Szalay, Gudrun; Ettischer, Nicole; Kandolf, Reinhard; Klingel, Karin

    2012-09-01

    Enteroviruses, such as coxsackieviruses of group B (CVB), are able to induce a chronic inflammation of the myocardium, which may finally lead to the loss of functional tissue, remodeling processes and the development of fibrosis, thus affecting the proper contractile function of the heart. In other fibrotic diseases like scleroderma, the prostacyclin agonist iloprost was found to inhibit the extracellular signal-regulated kinase (ERK, p44/42 MAPK), a mitogen-activated protein kinase, and consecutively, the expression of the profibrotic cytokine connective tissue growth factor (CTGF), thereby preventing the development of fibrosis. As CTGF was found to mediate fibrosis in chronic CVB3 myocarditis as well, we evaluated whether the in vivo application of iloprost is capable to reduce the development of ERK/CTGF-mediated fibrosis in enteroviral myocarditis. Unexpectedly, the application of iloprost resulted in a prolonged myocardial inflammation and an aggravated fibrosis and failed to reduce activation of ERK and expression of CTGF at later stages of the disease. In addition, viral replication was found to be increased in iloprost-treated mice. Notably, the expression of cardiac inducible nitric oxide synthase (iNOS), which is known to aggravate myocardial damage in CVB3-infected mice, was strongly enhanced by iloprost. Using cultivated bone marrow macrophages (BMM), we confirmed these results, proving that iloprost potentiates the expression of iNOS mRNA and protein in CVB3-infected and IFN-gamma stimulated BMM. In conclusion, these results suggest a critical reflection of the clinical use of iloprost, especially in patients possibly suffering from an enteroviral myocarditis.

  8. Differential Modulation of IgT and IgM upon Parasitic, Bacterial, Viral, and Dietary Challenges in a Perciform Fish

    PubMed Central

    Piazzon, Maria C.; Galindo-Villegas, Jorge; Pereiro, Patricia; Estensoro, Itziar; Calduch-Giner, Josep A.; Gómez-Casado, Eduardo; Novoa, Beatriz; Mulero, Victoriano; Sitjà-Bobadilla, Ariadna; Pérez-Sánchez, Jaume

    2016-01-01

    Three different immunoglobulin (Ig) isotypes can be found in teleost fish, IgM, IgD, and the teleost-specific IgT. IgM is considered to have a systemic activity, and IgT is attributed a mucosal role, similar to mammalian IgA. In this study, the complete sequence of gilthead sea bream IgM and IgT in their membrane (m) and soluble (s) forms are described for the first time in a perciform fish. Their constitutive gene expression is analyzed in different tissues, and their regulation upon viral, bacterial, parasitic, mucosal vaccination and dietary challenges are studied. GCB IgM and IgT have the prototypical structure when compared to other fish Igs. The constitutive expression of sIgM was the highest overall in all tissues, whereas mIgT expression was highest in mucosal tissues, such as gills and intestine. IgM and IgT were differentially regulated upon infection. IgT was highly upregulated locally upon infection with the intestinal parasite Enteromyxum leei or systemically after Nodavirus infection. Long-term intestinal parasitic infections increased the serum titer of both isotypes. Mucosal vaccination against Photobacterium damselae subsp. piscicida finely regulated the Ig response inducing a systemic increase of IgM titers in serum and a local IgT response in skin mucus when animals were exposed to the pathogen by bath challenge. Interestingly, plant-based diets inhibit IgT upregulation upon intestinal parasitic challenge, which was related to a worse disease outcome. All these results corroborate the mucosal role of IgT and emphasize the importance of a finely tuned regulation of Ig isotypes upon infection, which could be of special interest in vaccination studies. PMID:28082977

  9. Interaction between chronically HIV-infected promonocytic cells and human umbilical vein endothelial cells: role of proinflammatory cytokines and chemokines in viral expression modulation

    PubMed Central

    Borghi, M O; Panzeri, P; Shattock, R; Sozzani, S; Dobrina, A; Meroni, P L

    2000-01-01

    HIV type 1 expression was significantly up-regulated in chronically infected promonocytic cell line (U1) co-cultured with human umbilical vein endothelial cells (HUVEC). Virus replication, evaluated as supernatant p24 release, was higher when U1 were co-cultured with IL-1β-activated HUVEC than with unstimulated HUVEC. When non-adherent U1 were removed from co-cultures, the remaining U1 cells adherent to the endothelial monolayer still showed enhanced HIV replication in comparison with an equal number of U1 cultured alone. While addition of adhesion molecule blocking antibodies (anti-intercellular adhesion molecule-1 (ICAM-1), -vascular cell adhesion molecule-1 (VCAM-1), -CD18 and -very late antigen-4 (VLA-4)) strongly inhibited adherence of U1 cells to endothelial monolayers, such treatment resulted in only a partial reduction in p24 release. Furthermore, HIV replication in U1 cells was enhanced on culture in HUVEC-conditioned media. Such data suggest that soluble mediators secreted by endothelial monolayers may modulate HIV-1 expression. Indeed, addition of cytokine and chemokine antagonists to both U1/HUVEC co-cultures and to U1 cultured in HUVEC-conditioned media clearly down-regulated p24 release. Anti-IL-6, anti-tumour necrosis factor-alpha (TNF-α) and, particularly, anti-MCP-1 MoAbs reduced p24 release, while anti-IL-8 polyclonal antiserum and IL-1 receptor antagonist (IL-1Ra) had no significant effect. Thus, the interaction between HUVEC and infected monocytic cells up-regulates HIV-1 replication predominantly through production of endothelium-derived soluble factors including MCP-1, TNF-α and IL-6. This phenomenon may influence the passage of HIV-1 from latency to productive replication and enhance virus spreading during physiological and/or pathological contact of monocytes with endothelium. PMID:10759769

  10. Viral Hemorrhagic Fevers

    MedlinePlus

    ... The CDC Cancel Submit Search The CDC Viral Hemorrhagic Fevers (VHFs) Note: Javascript is disabled or is not ... please visit this page: About CDC.gov . Viral Hemorrhagic Fevers (VHFs) Virus Families Arenaviruses Old World/New World ...

  11. Oxygen tension level and human viral infections.

    PubMed

    Morinet, Frédéric; Casetti, Luana; François, Jean-Hugues; Capron, Claude; Pillet, Sylvie

    2013-09-01

    The role of oxygen tension level is a well-known phenomenon that has been studied in oncology and radiotherapy since about 60 years. Oxygen tension may inhibit or stimulate propagation of viruses in vitro as well as in vivo. In turn modulating oxygen metabolism may constitute a novel approach to treat viral infections as an adjuvant therapy. The major transcription factor which regulates oxygen tension level is hypoxia-inducible factor-1 alpha (HIF-1α). Down-regulating the expression of HIF-1α is a possible method in the treatment of chronic viral infection such as human immunodeficiency virus infection, chronic hepatitis B and C viral infections and Kaposi sarcoma in addition to classic chemotherapy. The aim of this review is to supply an updating concerning the influence of oxygen tension level in human viral infections and to evoke possible new therapeutic strategies regarding this environmental condition.

  12. Subversion of the actin cytoskeleton during viral infection

    PubMed Central

    Taylor, Matthew P.; Koyuncu, Orkide O.; Enquist, Lynn W.

    2011-01-01

    Viral infection converts the normal functions of a cell to optimize viral replication and virion production. One striking observation of this conversion is the reconfiguration and reorganization of cellular actin, affecting every stage of the viral life cycle, from entry through assembly to egress. The extent and degree of cytoskeletal reorganization varies among different viral infections, suggesting the evolution of myriad viral strategies. In this Review, we describe how the interaction of viral proteins with the cell modulates the structure and function of the actin cytoskeleton to initiate, sustain and spread infections. The molecular biology of such interactions continues to engage virologists in their quest to understand viral replication and informs cell biologists about the role of the cytoskeleton in the uninfected cell. PMID:21522191

  13. Ocean plankton. Patterns and ecological drivers of ocean viral communities.

    PubMed

    Brum, Jennifer R; Ignacio-Espinoza, J Cesar; Roux, Simon; Doulcier, Guilhem; Acinas, Silvia G; Alberti, Adriana; Chaffron, Samuel; Cruaud, Corinne; de Vargas, Colomban; Gasol, Josep M; Gorsky, Gabriel; Gregory, Ann C; Guidi, Lionel; Hingamp, Pascal; Iudicone, Daniele; Not, Fabrice; Ogata, Hiroyuki; Pesant, Stéphane; Poulos, Bonnie T; Schwenck, Sarah M; Speich, Sabrina; Dimier, Celine; Kandels-Lewis, Stefanie; Picheral, Marc; Searson, Sarah; Bork, Peer; Bowler, Chris; Sunagawa, Shinichi; Wincker, Patrick; Karsenti, Eric; Sullivan, Matthew B

    2015-05-22

    Viruses influence ecosystems by modulating microbial population size, diversity, metabolic outputs, and gene flow. Here, we use quantitative double-stranded DNA (dsDNA) viral-fraction metagenomes (viromes) and whole viral community morphological data sets from 43 Tara Oceans expedition samples to assess viral community patterns and structure in the upper ocean. Protein cluster cataloging defined pelagic upper-ocean viral community pan and core gene sets and suggested that this sequence space is well-sampled. Analyses of viral protein clusters, populations, and morphology revealed biogeographic patterns whereby viral communities were passively transported on oceanic currents and locally structured by environmental conditions that affect host community structure. Together, these investigations establish a global ocean dsDNA viromic data set with analyses supporting the seed-bank hypothesis to explain how oceanic viral communities maintain high local diversity.

  14. Regulation of viral oncogenesis by microRNAs

    PubMed Central

    Xu, Xiaojie; Ye, Qinong

    2014-01-01

    Viral infection may play a causative role in human cancers, for example hepatitis B virus (HBV) or hepatitis C virus (HCV) in liver cancer, human papilloma virus (HPV) in cervical cancer, and Epstein–Barr virus (EBV) in nasopharyngeal carcinoma. Virally infected cells express viral-encoded genes that are critical for oncogenesis. Some viruses also encode microRNA (miRNA) species. miRNAs are small noncoding RNA molecules that play an important role in cancer development and progression. Recent studies indicate an important interplay among viral oncoproteins, virus-encoded miRNAs, cellular miRNAs, and cellular genes. This review focuses on modulation of HBV-, HCV-, HPV-, and EBV-associated cancers by cellular and/or viral miRNA. An understanding of the mechanisms underlying the regulation of viral carcinogenesis by miRNAs may provide new targets for the development of specific viral therapies. PMID:27308317

  15. RNA Structural Elements of Hepatitis C Virus Controlling Viral RNA Translation and the Implications for Viral Pathogenesis

    PubMed Central

    Piñeiro, David; Martinez-Salas, Encarnación

    2012-01-01

    Hepatitis C virus (HCV) genome multiplication requires the concerted action of the viral RNA, host factors and viral proteins. Recent studies have provided information about the requirement of specific viral RNA motifs that play an active role in the viral life cycle. RNA regulatory motifs controlling translation and replication of the viral RNA are mostly found at the 5' and 3' untranslated regions (UTRs). In particular, viral protein synthesis is under the control of the internal ribosome entry site (IRES) element, a complex RNA structure located at the 5'UTR that recruits the ribosomal subunits to the initiator codon. Accordingly, interfering with this RNA structural motif causes the abrogation of the viral cycle. In addition, RNA translation initiation is modulated by cellular factors, including miRNAs and RNA-binding proteins. Interestingly, a RNA structural motif located at the 3'end controls viral replication and establishes long-range RNA-RNA interactions with the 5'UTR, generating functional bridges between both ends on the viral genome. In this article, we review recent advances on virus-host interaction and translation control modulating viral gene expression in infected cells. PMID:23202462

  16. Oxygen tension level and human viral infections

    SciTech Connect

    Morinet, Frédéric; Casetti, Luana; François, Jean-Hugues; Capron, Claude; Pillet, Sylvie

    2013-09-15

    The role of oxygen tension level is a well-known phenomenon that has been studied in oncology and radiotherapy since about 60 years. Oxygen tension may inhibit or stimulate propagation of viruses in vitro as well as in vivo. In turn modulating oxygen metabolism may constitute a novel approach to treat viral infections as an adjuvant therapy. The major transcription factor which regulates oxygen tension level is hypoxia-inducible factor-1 alpha (HIF-1α). Down-regulating the expression of HIF-1α is a possible method in the treatment of chronic viral infection such as human immunodeficiency virus infection, chronic hepatitis B and C viral infections and Kaposi sarcoma in addition to classic chemotherapy. The aim of this review is to supply an updating concerning the influence of oxygen tension level in human viral infections and to evoke possible new therapeutic strategies regarding this environmental condition. - Highlights: • Oxygen tension level regulates viral replication in vitro and possibly in vivo. • Hypoxia-inducible factor 1 (HIF-1α) is the principal factor involved in Oxygen tension level. • HIF-1α upregulates gene expression for example of HIV, JC and Kaposi sarcoma viruses. • In addition to classical chemotherapy inhibition of HIF-1α may constitute a new track to treat human viral infections.

  17. Amino-terminal domains of kainate receptors determine the differential dependence on Neto auxiliary subunits for trafficking.

    PubMed

    Sheng, Nengyin; Shi, Yun Stone; Nicoll, Roger A

    2017-01-31

    The kainate receptor (KAR), a subtype of glutamate receptor, mediates excitatory synaptic responses at a subset of glutamatergic synapses. However, the molecular mechanisms underlying the trafficking of its different subunits are poorly understood. Here we use the CA1 hippocampal pyramidal cell, which lacks KAR-mediated synaptic currents, as a null background to determine the minimal requirements for the extrasynaptic and synaptic expression of the GluK2 subunit. We find that the GluK2 receptor itself, in contrast to GluK1, traffics to the neuronal surface and synapse efficiently and the auxiliary subunits Neto1 and Neto2 caused no further enhancement of these two trafficking processes. However, the regulation of GluK2 biophysical properties by Neto proteins is the same as that of GluK1. We further determine that it is the amino-terminal domains (ATDs) of GluK1 and GluK2 that control the strikingly different trafficking properties between these two receptors. Moreover, the ATDs are critical for synaptic expression of heteromeric receptors at mossy fiber-CA3 synapses and also mediate the differential dependence on Neto proteins for surface and synaptic trafficking of GluK1 and GluK2. These results highlight the fundamental differences between the two major KAR subunits and their interplay with Neto auxiliary proteins.

  18. Semicarbazide-sensitive amine oxidase in vascular smooth muscle cells: differentiation-dependent expression and role in glucose uptake.

    PubMed

    El Hadri, Khadija; Moldes, Marthe; Mercier, Nathalie; Andreani, Marise; Pairault, Jacques; Feve, Bruno

    2002-01-01

    Cultured vascular smooth muscle cells (VSMCs) derived from rat aortic media were used to examine semicarbazide-sensitive amine oxidase (SSAO) expression during their differentiation process. In a defined serum-free medium permissive for in vitro VSMC differentiation, there was a large increase in SSAO mRNA and protein levels and in the related enzyme activity during the course of cell culture. This pattern of expression was concomitant with that of some smooth muscle-specific mRNA markers of differentiation. mRNAs in differentiated cultured VSMCs were comparable to those detected in total aorta and media. Pharmacological properties of SSAO present in VSMCs were similar to enzyme activities previously described in the aortic wall. In this model, we also demonstrated that methylamine, a physiological substrate of SSAO, activated 2-deoxyglucose transport in a time- and dose-dependent manner. This methylamine effect was reproduced by other SSAO substrates and was prevented by the SSAO inhibitor semicarbazide. It was antagonized in the presence of catalase, suggesting that SSAO-activated glucose transport was mediated through H(2)O(2) production. In addition, methylamine promoted glucose transporter 1 accumulation at the cell surface. Thus, we demonstrate for the first time the differentiation-dependent expression of SSAO in VSMCs and its role in the regulation of VSMC glucose uptake.

  19. Bats as Viral Reservoirs.

    PubMed

    Hayman, David T S

    2016-09-29

    Bats are hosts of a range of viruses, including ebolaviruses, and many important human viral infections, such as measles and mumps, may have their ancestry traced back to bats. Here, I review viruses of all viral families detected in global bat populations. The viral diversity in bats is substantial, and viruses with all known types of genomic structures and replication strategies have been discovered in bats. However, the discovery of viruses is not geographically even, with some apparently undersampled regions, such as South America. Furthermore, some bat families, including those with global or wide distributions such as Emballonuridae and Miniopteridae, are underrepresented on viral databases. Future studies, including those that address these sampling gaps along with those that develop our understanding of viral-host relationships, are highlighted.

  20. Viral Disease Networks?

    NASA Astrophysics Data System (ADS)

    Gulbahce, Natali; Yan, Han; Vidal, Marc; Barabasi, Albert-Laszlo

    2010-03-01

    Viral infections induce multiple perturbations that spread along the links of the biological networks of the host cells. Understanding the impact of these cascading perturbations requires an exhaustive knowledge of the cellular machinery as well as a systems biology approach that reveals how individual components of the cellular system function together. Here we describe an integrative method that provides a new approach to studying virus-human interactions and its correlations with diseases. Our method involves the combined utilization of protein - protein interactions, protein -- DNA interactions, metabolomics and gene - disease associations to build a ``viraldiseasome''. By solely using high-throughput data, we map well-known viral associated diseases and predict new candidate viral diseases. We use microarray data of virus-infected tissues and patient medical history data to further test the implications of the viral diseasome. We apply this method to Epstein-Barr virus and Human Papillomavirus and shed light into molecular development of viral diseases and disease pathways.

  1. APOBEC3 Interference during Replication of Viral Genomes.

    PubMed

    Willems, Luc; Gillet, Nicolas Albert

    2015-06-11

    Co-evolution of viruses and their hosts has reached a fragile and dynamic equilibrium that allows viral persistence, replication and transmission. In response, infected hosts have developed strategies of defense that counteract the deleterious effects of viral infections. In particular, single-strand DNA editing by Apolipoprotein B Editing Catalytic subunits proteins 3 (APOBEC3s) is a well-conserved mechanism of mammalian innate immunity that mutates and inactivates viral genomes. In this review, we describe the mechanisms of APOBEC3 editing during viral replication, the viral strategies that prevent APOBEC3 activity and the consequences of APOBEC3 modulation on viral fitness and host genome integrity. Understanding the mechanisms involved reveals new prospects for therapeutic intervention.

  2. APOBEC3 Interference during Replication of Viral Genomes

    PubMed Central

    Willems, Luc; Gillet, Nicolas Albert

    2015-01-01

    Co-evolution of viruses and their hosts has reached a fragile and dynamic equilibrium that allows viral persistence, replication and transmission. In response, infected hosts have developed strategies of defense that counteract the deleterious effects of viral infections. In particular, single-strand DNA editing by Apolipoprotein B Editing Catalytic subunits proteins 3 (APOBEC3s) is a well-conserved mechanism of mammalian innate immunity that mutates and inactivates viral genomes. In this review, we describe the mechanisms of APOBEC3 editing during viral replication, the viral strategies that prevent APOBEC3 activity and the consequences of APOBEC3 modulation on viral fitness and host genome integrity. Understanding the mechanisms involved reveals new prospects for therapeutic intervention. PMID:26110583

  3. Viruses and viral proteins.

    PubMed

    Verdaguer, Nuria; Ferrero, Diego; Murthy, Mathur R N

    2014-11-01

    For more than 30 years X-ray crystallography has been by far the most powerful approach for determining the structures of viruses and viral proteins at atomic resolution. The information provided by these structures, which covers many important aspects of the viral life cycle such as cell-receptor recognition, viral entry, nucleic acid transfer and genome replication, has extensively enriched our vision of the virus world. Many of the structures available correspond to potential targets for antiviral drugs against important human pathogens. This article provides an overview of the current knowledge of different structural aspects of the above-mentioned processes.

  4. Viruses and viral proteins

    PubMed Central

    Verdaguer, Nuria; Ferrero, Diego; Murthy, Mathur R. N.

    2014-01-01

    For more than 30 years X-ray crystallography has been by far the most powerful approach for determining the structures of viruses and viral proteins at atomic resolution. The information provided by these structures, which covers many important aspects of the viral life cycle such as cell-receptor recognition, viral entry, nucleic acid transfer and genome replication, has extensively enriched our vision of the virus world. Many of the structures available correspond to potential targets for antiviral drugs against important human pathogens. This article provides an overview of the current knowledge of different structural aspects of the above-mentioned processes. PMID:25485129

  5. Inflammatory cytokines IL-32 and IL-17 have common signaling intermediates despite differential dependence on TNF-receptor 1.

    PubMed

    Turner-Brannen, Emily; Choi, Ka-Yee Grace; Arsenault, Ryan; El-Gabalawy, Hani; Napper, Scott; Mookherjee, Neeloffer

    2011-06-15

    Cytokines IL-32 and IL-17 are emerging as critical players in the pathophysiology of immune-mediated chronic inflammatory diseases. It has been speculated that the molecular mechanisms governing IL-32- and IL-17-mediated cellular responses are differentially dependent on the TNF pathway. In this study, kinome analysis demonstrated that following stimulation with cytokine IL-32, but not IL-17, there was increased phosphorylation of a peptide target corresponding to TNF-R1. Consistent with this observation, blocking TNF-R1 resulted in a suppression of IL-32-induced downstream responses, indicating that IL-32-mediated activity may be dependent on TNF-R1. In contrast, blocking TNF-R1 did not affect IL-17-induced downstream responses. Kinome analysis also implicated p300 (transcriptional coactivator) and death-associated protein kinase-1 (DAPK-1) as signaling intermediates for both IL-32 and IL-17. Phosphorylation of p300 and DAPK-1 upon stimulation with either IL-32 or IL-17 was confirmed by immunoblots. The presence of common targets was supported by results demonstrating similar downstream responses induced in the presence of IL-32 and IL-17, such as transcriptional responses and the direct activation of NF-κB. Furthermore, knockdown of p300 and DAPK-1 altered downstream responses induced by IL-32 and IL-17, and impacted certain cellular responses induced by TNF-α and IL-1β. We hypothesize that p300 and DAPK-1 represent nodes where the inflammatory networks of IL-32 and IL-17 overlap, and that these proteins would affect both TNF-R1-dependent and -independent pathways. Therefore, p300 and DAPK-1 are viable potential therapeutic targets for chronic inflammatory diseases.

  6. Methods of using viral replicase polynucleotides and polypeptides

    DOEpatents

    Gordon-Kamm, William J.; Lowe, Keith S.; Bailey, Matthew A.; Gregory, Carolyn A.; Hoerster, George J.; Larkins, Brian A.; Dilkes, Brian R.; Burnett, Ronald; Woo, Young Min

    2007-12-18

    The invention provides novel methods of using viral replicase polypeptides and polynucleotides. Included are methods for increasing transformation frequencies, increasing crop yield, providing a positive growth advantage, modulating cell division, transiently modulating cell division, and for providing a means of positive selection.

  7. Viral hemorrhagic septicemia

    USGS Publications Warehouse

    Batts, William N.; Winton, James R.

    2012-01-01

    Viral hemorrhagic septicemia (VHS) is one of the most important viral diseases of finfish worldwide. In the past, VHS was thought to affect mainly rainbow trout Oncorhynchus mykiss reared at freshwater facilities in Western Europe where it was known by various names including Egtved disease and infectious kidney swelling and liver degeneration (Wolf 1988). Today, VHS is known as an important source of mortality for cultured and wild fish in freshwater and marine environments in several regions of the northern hemisphere (Dixon 1999; Gagné et al. 2007; Kim and Faisal 2011; Lumsden et al. 2007; Marty et al. 1998, 2003; Meyers and Winton 1995; Skall et al. 2005b; Smail 1999; Takano et al. 2001). Viral hemorrhagic septicemia is caused by the fish rhabdovirus, viral hemorrhagic septicemia virus (VHSV), a member of the genus Novirhabdovirus of the family Rhabdoviridae

  8. Viral quasispecies complexity measures.

    PubMed

    Gregori, Josep; Perales, Celia; Rodriguez-Frias, Francisco; Esteban, Juan I; Quer, Josep; Domingo, Esteban

    2016-06-01

    Mutant spectrum dynamics (changes in the related mutants that compose viral populations) has a decisive impact on virus behavior. The several platforms of next generation sequencing (NGS) to study viral quasispecies offer a magnifying glass to study viral quasispecies complexity. Several parameters are available to quantify the complexity of mutant spectra, but they have limitations. Here we critically evaluate the information provided by several population diversity indices, and we propose the introduction of some new ones used in ecology. In particular we make a distinction between incidence, abundance and function measures of viral quasispecies composition. We suggest a multidimensional approach (complementary information contributed by adequately chosen indices), propose some guidelines, and illustrate the use of indices with a simple example. We apply the indices to three clinical samples of hepatitis C virus that display different population heterogeneity. Areas of virus biology in which population complexity plays a role are discussed.

  9. Immigration and viral hepatitis.

    PubMed

    Sharma, Suraj; Carballo, Manuel; Feld, Jordan J; Janssen, Harry L A

    2015-08-01

    WHO estimates reveal that the global prevalence of viral hepatitis may be as high as 500 million, with an annual mortality rate of up to 1.3 million individuals. The majority of this global burden of disease is borne by nations of the developing world with high rates of vertical and iatrogenic transmission of HBV and HCV, as well as poor access to healthcare. In 2013, 3.2% of the global population (231 million individuals) migrated into a new host nation. Migrants predominantly originate from the developing countries of the south, into the developed economies of North America and Western Europe. This mass migration of individuals from areas of high-prevalence of viral hepatitis poses a unique challenge to the healthcare systems of the host nations. Due to a lack of universal standards for screening, vaccination and treatment of viral hepatitis, the burden of chronic liver disease and hepatocellular carcinoma continues to increase among migrant populations globally. Efforts to increase case identification and treatment among migrants have largely been limited to small outreach programs in urban centers, such that the majority of migrants with viral hepatitis continue to remain unaware of their infection. This review summarizes the data on prevalence of viral hepatitis and burden of chronic liver disease among migrants, current standards for screening and treatment of immigrants and refugees, and efforts to improve the identification and treatment of viral hepatitis among migrants.

  10. NCBI viral genomes resource.

    PubMed

    Brister, J Rodney; Ako-Adjei, Danso; Bao, Yiming; Blinkova, Olga

    2015-01-01

    Recent technological innovations have ignited an explosion in virus genome sequencing that promises to fundamentally alter our understanding of viral biology and profoundly impact public health policy. Yet, any potential benefits from the billowing cloud of next generation sequence data hinge upon well implemented reference resources that facilitate the identification of sequences, aid in the assembly of sequence reads and provide reference annotation sources. The NCBI Viral Genomes Resource is a reference resource designed to bring order to this sequence shockwave and improve usability of viral sequence data. The resource can be accessed at http://www.ncbi.nlm.nih.gov/genome/viruses/ and catalogs all publicly available virus genome sequences and curates reference genome sequences. As the number of genome sequences has grown, so too have the difficulties in annotating and maintaining reference sequences. The rapid expansion of the viral sequence universe has forced a recalibration of the data model to better provide extant sequence representation and enhanced reference sequence products to serve the needs of the various viral communities. This, in turn, has placed increased emphasis on leveraging the knowledge of individual scientific communities to identify important viral sequences and develop well annotated reference virus genome sets.

  11. Viral induced demyelination.

    PubMed

    Stohlman, S A; Hinton, D R

    2001-01-01

    Viral induced demyelination, in both humans and rodent models, has provided unique insights into the cell biology of oligodendroglia, their complex cell-cell interactions and mechanisms of myelin destruction. They illustrate mechanisms of viral persistence, including latent infections in which no infectious virus is readily evident, virus reactivation and viral-induced tissue damage. These studies have also provided excellent paradigms to study the interactions between the immune system and the central nervous system (CNS). Although of interest in their own right, an understanding of the diverse mechanisms used by viruses to induce demyelination may shed light into the etiology and pathogenesis of the common demyelinating disorder multiple sclerosis (MS). This notion is supported by the persistent view that a viral infection acquired during adolescence might initiate MS after a long period of quiescence. Demyelination in both humans and rodents can be initiated by infection with a diverse group of enveloped and non-enveloped RNA and DNA viruses (Table 1). The mechanisms that ultimately result in the loss of CNS myelin appear to be equally diverse as the etiological agents capable of causing diseases which result in demyelination. Although demyelination can be a secondary result of axonal loss, in many examples of viral induced demyelination, myelin loss is primary and associated with axonal sparing. This suggests that demyelination induced by viral infections can result from: 1) a direct viral infection of oligodendroglia resulting in cell death with degeneration of myelin and its subsequent removal; 2) a persistent viral infection, in the presence or absence of infectious virus, resulting in the loss of normal cellular homeostasis and subsequent oligodendroglial death; 3) a vigorous virus-specific inflammatory response wherein the virus replicates in a cell type other than oligodendroglia, but cytokines and other immune mediators directly damage the

  12. HCV-specific interleukin-21+CD4+ T cells responses associated with viral control through the modulation of HCV-specific CD8+ T cells function in chronic hepatitis C patients.

    PubMed

    Feng, Guohua; Zhang, Ji-Yuan; Zeng, Qing-Lei; Jin, Lei; Fu, Junliang; Yang, Bin; Sun, Ying; Jiang, Tianjun; Xu, Xiangsheng; Zhang, Zheng; Yuan, Jinhong; Wu, Liyuan; Wang, Fu-Sheng

    2013-10-01

    Interleukin-21 (IL-21)+CD4+ T cells are involved in the immune response against hepatitis B virus (HBV) by secreting IL-21. However, the role of IL-21+CD4+ T cells in the immune response against chronic hepatitis C (CHC) virus infection is poorly understood. This study aimed to investigate the role of IL-21+CD4+ T cells in CHC patients and the potential mechanisms. The study subjects included nineteen CHC patients who were grouped by viral load (low, < 10(6) RNA copies/ml, n = 8; high, > 10(6) RNA copies/ml, n = 11). The peripheral frequency of HCV-specific IL-21+CD4+ T cells was higher in the low viral load group and was negatively correlated with the serum HCV RNA viral load in all CHC patients. Meanwhile, IL-21+ cells accumulated in the liver in the low viral load group. In vitro, IL-21 treatment increased the expression of proliferation markers and cytolytic molecules on HCV-specific CD8+ T cells. In summary, these findings suggest that HCV-specific IL-21+CD4+ T cells might contribute to HCV control by rescuing HCV-specific CD8+ T cells in CHC patients.

  13. Concepts in viral pathogenesis II

    SciTech Connect

    Notkins, A.L.; Oldstone, M.B.A.

    1986-01-01

    This paper contains papers divided among 10 sections. The section titles are: Viral Structure and Function; Viral Constructs; Oncogenes, Transfection, and Differentiation; Viral Tropism and Entry into Cells; Immune Recognition of Viruses; Evolving Concepts in Viral Pathogenesis Illustrated by Selected Plant and Animal Models; Evolving Concepts in Viral Pathogenesis Illustrated by Selected Diseases in Humans; New Trends in Diagnosis and Epidemiology; and Vaccines and Antiviral Therapy.

  14. Viral mimicry of cytokines, chemokines and their receptors.

    PubMed

    Alcami, Antonio

    2003-01-01

    Viruses have evolved elegant mechanisms to evade detection and destruction by the host immune system. One of the evasion strategies that have been adopted by large DNA viruses is to encode homologues of cytokines, chemokines and their receptors--molecules that have a crucial role in control of the immune response. Viruses have captured host genes or evolved genes to target specific immune pathways, and so viral genomes can be regarded as repositories of important information about immune processes, offering us a viral view of the host immune system. The study of viral immunomodulatory proteins might help us to uncover new human genes that control immunity, and their characterization will increase our understanding of not only viral pathogenesis, but also normal immune mechanisms. Moreover, viral proteins indicate strategies of immune modulation that might have therapeutic potential.

  15. Acute viral myocarditis

    PubMed Central

    Dennert, Robert; Crijns, Harry J.; Heymans, Stephane

    2008-01-01

    Acute myocarditis is one of the most challenging diagnosis in cardiology. At present, no diagnostic gold standard is generally accepted, due to the insensitivity of traditional diagnostic tests. This leads to the need for new diagnostic approaches, which resulted in the emergence of new molecular tests and a more detailed immunohistochemical analysis of endomyocardial biopsies. Recent findings using these new diagnostic tests resulted in increased interest in inflammatory cardiomyopathies and a better understanding of its pathophysiology, the recognition in overlap of virus-mediated damage, inflammation, and autoimmune dysregulation. Novel results also pointed towards a broader spectrum of viral genomes responsible for acute myocarditis, indicating a shift of enterovirus and adenovirus to parvovirus B19 and human herpes virus 6. The present review proposes a general diagnostic approach, focuses on the viral aetiology and associated autoimmune processes, and reviews treatment options for patients with acute viral myocarditis. PMID:18617482

  16. [Vasculitis and viral infection].

    PubMed

    Martínez Aguilar, N E; Guido Bayardo, R; Vargas Camaño, M E; Compañ González, D; Miranda Feria, A J

    1997-01-01

    Viruses have been implicated in vasculitis. To determine activity of viral infection associated with vasculitis. 17 patients with vasculitis had been in immunological and antiviral antibodies evaluation. Twenty five healthy controls sex and age matched with hematic biometry (BH) and AA. All subjects were negative to HIV and HBV. Viral activity was demonstrated in eight patients; vascular purpura (5), Takayasu disease (1), polyarteritis nodosa (1), erythema nodosum (1). None subject of control group had IgM activity. Antibodies response of IgG in patients were of lesser intensity than in control group. 14 abnormalities in BH were found in patients and 4 in control group. Immune response in patients, measured by lymphocyte subpopulations and circulating immune complexes was abnormal. In conclusion 47% showed viral activity, but the dominant feature was abnormal immune response in 82%.

  17. Viral infections and allergies.

    PubMed

    Xepapadaki, Paraskevi; Papadopoulos, Nikolaos G

    2007-01-01

    Respiratory viral infections have been implicated in the origin of, protection from and exacerbation of allergy-related symptoms in a variety of ways. Viral infections are closely linked to infantile wheezing. Severe bronchiolitis in early infancy may predispose to chronic childhood asthma as well as allergic sensitization; alternatively it could represent a marker of susceptible individuals. In contrast, repeated mild infections in early life may have a protective role in the development of asthma or atopy by driving the immune system towards Th1 responses. However, evidence on this hypothesis is not consistent as far as respiratory viruses are concerned. Several factors, including the presence of an atopic environment, timing of exposure and severity of the infection, interactively contribute to the allergy-infection relationship. In the present report, recent data on the role of viral infections in the development and progression of allergy and asthma are reviewed.

  18. Modeling Viral Capsid Assembly

    PubMed Central

    2014-01-01

    I present a review of the theoretical and computational methodologies that have been used to model the assembly of viral capsids. I discuss the capabilities and limitations of approaches ranging from equilibrium continuum theories to molecular dynamics simulations, and I give an overview of some of the important conclusions about virus assembly that have resulted from these modeling efforts. Topics include the assembly of empty viral shells, assembly around single-stranded nucleic acids to form viral particles, and assembly around synthetic polymers or charged nanoparticles for nanotechnology or biomedical applications. I present some examples in which modeling efforts have promoted experimental breakthroughs, as well as directions in which the connection between modeling and experiment can be strengthened. PMID:25663722

  19. Viral apoptotic mimicry.

    PubMed

    Amara, Ali; Mercer, Jason

    2015-08-01

    As opportunistic pathogens, viruses have evolved many elegant strategies to manipulate host cells for infectious entry and replication. Viral apoptotic mimicry, defined by the exposure of phosphatidylserine - a marker for apoptosis - on the pathogen surface, is emerging as a common theme used by enveloped viruses to promote infection. Focusing on the four best described examples (vaccinia virus, dengue virus, Ebola virus and pseudotyped lentivirus), we summarize our current understanding of apoptotic mimicry as a mechanism for virus entry, binding and immune evasion. We also describe recent examples of non-enveloped viruses that use this mimicry strategy, and discuss future directions and how viral apoptotic mimicry could be targeted therapeutically.

  20. Advances in viral oncology

    SciTech Connect

    Klein, G.

    1987-01-01

    Volume 6 of Advances in Viral Oncology presents experimental approaches to multifactorial interactions in tumor development. Included are in-depth analyses of malignant phenotypes by oncogene complementation, as well as studies of complementary interactions among DNA viral oncogenes; multiple cell-derived sequences in single retroviral genomes; and sequences that influence the transforming activity and expression of the mos oncogene. The genetic regulation of tumorigenic expression in somatic cell hybrids, the inhibition of oncogenes by cellular genes, and the interaction of genes that favor and genes that suppress tumorigenesis are examined in detail. The book concludes with a study of the relationship of oncogenes to the evolution of the metastatic phenotype.

  1. Viral dependence on cellular ion channels - an emerging anti-viral target?

    PubMed

    Hover, Samantha; Foster, Becky; Barr, John; Mankouri, Jamel

    2017-01-22

    The broad range of cellular functions governed by ion channels represents an attractive target for viral manipulation. Indeed, modulation of host cell ion channel activity by viral proteins is being increasingly identified as an important virus-host interaction. Recent examples have demonstrated that virion entry, virus-egress and the maintenance of a cellular environment conducive to virus persistence are in part, dependent on virus manipulation of ion channel activity. Most excitingly, evidence has emerged that targeting ion channels pharmacologically can impede virus lifecycles. Here we discuss current examples of virus-ion channel interactions and the potential of targeting ion channel function as a new, pharmacologically safe and broad ranging anti-viral therapeutic strategy.

  2. BIOMARKERS OF VIRAL EXPOSURE

    EPA Science Inventory

    Viral and protozoan pathogens associated with raw sludge can cause encephalitis, gastroenteritis, hepatitis, myocarditis, and a number of other diseases. Raw sludge that has been treated to reduce these pathogens can be used for land application according to the regulations spec...

  3. Leafhopper viral pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Four newly discovered viral pathogens in leafhopper vectors of Pierce’s disease of grapes, have been shown to replicate in sharpshooter leafhoppers; the glassy-winged sharpshooter, GWSS, Homalodisca vitripennis, and Oncometopia nigricans (Hemiptera: Cicadellidae). The viruses were classified as memb...

  4. Marine Viral Pathogens.

    DTIC Science & Technology

    2007-11-02

    toxin producing microalgae (Raphidophyceae). Although we have not definitively shown that the pathogen is viral, it has many characteristics that...Society America, Miami, FL, June 1994. 40.Hennes, K.P. and C.A. Suttle. 1994. The use of cyanine dyes for quantifying free viruses in natural water

  5. Vpr-host interactions during HIV-1 viral life cycle.

    PubMed

    Zhao, Richard Y; Li, Ge; Bukrinsky, Michael I

    2011-06-01

    Human immunodeficiency virus type 1 (HIV-1) viral protein R (Vpr) is a multifunctional viral protein that plays important role at multiple stages of the HIV-1 viral life cycle. Although the molecular mechanisms underlying these activities are subject of ongoing investigations, overall, these activities have been linked to promotion of viral replication and impairment of anti-HIV immunity. Importantly, functional defects of Vpr have been correlated with slow disease progression of HIV-infected patients. Vpr is required for efficient viral replication in non-dividing cells such as macrophages, and it promotes, to some extent, viral replication in proliferating CD4+ T cells. The specific activities of Vpr include modulation of fidelity of viral reverse transcription, nuclear import of the HIV-1 pre-integration complex, transactivation of the HIV-1 LTR promoter, induction of cell cycle G2 arrest and cell death via apoptosis. In this review, we focus on description of the cellular proteins that specifically interact with Vpr and discuss their significance with regard to the known Vpr activities at each step of the viral life cycle in proliferating and non-proliferating cells.

  6. Cytoplasmic RNA Granules and Viral Infection

    PubMed Central

    Tsai, Wei-Chih; Lloyd, Richard E.

    2016-01-01

    RNA granules are dynamic cellular structures essential for proper gene expression and homeostasis. The two principle types of cytoplasmic RNA granules are stress granules (SGs), which contain stalled translation initiation complexes, and processing bodies (P-bodies, PBs), which concentrate factors involved in mRNA degradation. RNA granules are associated with gene silencing of transcripts, thus, viruses repress RNA granule functions to favor replication. This review discusses the breadth of viral interactions with cytoplasmic RNA granules, focusing on mechanisms that modulate the functions of RNA granules and that typically promote viral replication. Currently mechanisms for virus manipulation of RNA granules can be loosely grouped into three non-exclusive categories; i) cleavage of key RNA granule factors, ii) regulation of PKR activation and iii) co-opting RNA granule factors for new roles in viral replication. Viral repression of RNA granules supports productive infection by inhibiting their gene silencing functions and counteracting their role in linking stress sensing with innate immune activation. PMID:26958719

  7. Herpes viral culture of lesion

    MedlinePlus

    ... virus; Herpes simplex virus culture Images Viral lesion culture References Costello M, Sabatini LM, Yungbluth M. Viral infections. In: McPherson RA, Pincus MR, eds. Henry's Clinical Diagnosis and Management by Laboratory Methods . 22nd ed. Philadelphia, PA: Elsevier ...

  8. Viral membrane fusion.

    PubMed

    Harrison, Stephen C

    2015-05-01

    Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a "fusion loop" or "fusion peptide") engages the target-cell membrane and collapse of the bridging intermediate thus formed draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics.

  9. Viral Vector Production: Adenovirus.

    PubMed

    Kim, Julius W; Morshed, Ramin A; Kane, J Robert; Auffinger, Brenda; Qiao, Jian; Lesniak, Maciej S

    2016-01-01

    Adenoviral vectors have proven to be valuable resources in the development of novel therapies aimed at targeting pathological conditions of the central nervous system, including Alzheimer's disease and neoplastic brain lesions. Not only can some genetically engineered adenoviral vectors achieve remarkably efficient and specific gene delivery to target cells, but they also may act as anticancer agents by selectively replicating within cancer cells.Due to the great interest in using adenoviral vectors for various purposes, the need for a comprehensive protocol for viral vector production is especially apparent. Here, we describe the process of generating an adenoviral vector in its entirety, including the more complex process of adenoviral fiber modification to restrict viral tropism in order to achieve more efficient and specific gene delivery.

  10. Viral membrane fusion

    PubMed Central

    Harrison, Stephen C

    2008-01-01

    Infection by viruses having lipid-bilayer envelopes proceeds through fusion of the viral membrane with a membrane of the target cell. Viral ‘fusion proteins’ facilitate this process. They vary greatly in structure, but all seem to have a common mechanism of action, in which a ligand-triggered, large-scale conformational change in the fusion protein is coupled to apposition and merger of the two bilayers. We describe three examples—the influenza virus hemagglutinin, the flavivirus E protein and the vesicular stomatitis virus G protein—in some detail, to illustrate the ways in which different structures have evolved to implement this common mechanism. Fusion inhibitors can be effective antiviral agents. PMID:18596815

  11. Viral membrane fusion

    PubMed Central

    Harrison, Stephen C.

    2015-01-01

    Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formed draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. PMID:25866377

  12. Viral membrane fusion

    SciTech Connect

    Harrison, Stephen C.

    2015-05-15

    Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formed draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. - Highlights: • Viral fusion proteins overcome the high energy barrier to lipid bilayer merger. • Different molecular structures but the same catalytic mechanism. • Review describes properties of three known fusion-protein structural classes. • Single-virion fusion experiments elucidate mechanism.

  13. Beyond Viral Neutralization.

    PubMed

    Lewis, George K; Pazgier, Marzena; Evans, David; Ferrari, Guido; Bournazos, Stylianos; Parsons, Matthew S; Bernard, Nicole F; Finzi, Andrés

    2017-01-13

    It has been known for more than 30 years that Human Immunodeficiency Virus 1 (HIV-1) infection drives a very potent B cell response resulting in the production of anti-HIV-1 antibodies targeting several viral proteins, particularly its envelope glycoproteins (Env). Env epitopes are exposed on the surfaces of viral particles and infected cells where they are targets of potentially protective antibodies. These antibodies can interdict infection by neutralization and there is strong evidence suggesting that Fc-mediated effector function can also contribute to protection. Current evidence suggests that Fc-mediated effector function plays a role in protection against infection by broadly neutralizing antibodies (bnAbs) and it might be important for protection by non-neutralizing antibodies. Fc-mediated effector function includes diverse mechanisms that include antibody-dependent cellular cytotoxicity (ADCC), antibody-mediated complement activation (ADC), antibody-dependent cellular phagocytosis (ADCP), antibody-dependent cell-mediated virus inhibition (ADCVI), antibody-mediated trancytosis inhibition, and antibody-mediated virus opsonization. All these functions could be beneficial in fighting viral infections including HIV-1. In this perspective, we discuss the latest developments for ADCC responses discussed at the HIVR4P satellite session on non-neutralizing antibodies, with emphasis on the mechanisms of ADCC resistance employed by HIV-1, the structural basis of epitopes recognized by antibodies that mediate ADCC, NK-cell education and ADCC, and murine models to study ADCC against HIV-1.

  14. KSHV Rta Promoter Specification and Viral Reactivation

    PubMed Central

    Guito, Jonathan; Lukac, David M.

    2011-01-01

    Viruses are obligate intracellular pathogens whose biological success depends upon replication and packaging of viral genomes, and transmission of progeny viruses to new hosts. The biological success of herpesviruses is enhanced by their ability to reproduce their genomes without producing progeny viruses or killing the host cells, a process called latency. Latency permits a herpesvirus to remain undetected in its animal host for decades while maintaining the potential to reactivate, or switch, to a productive life cycle when host conditions are conducive to generating viral progeny. Direct interactions between many host and viral molecules are implicated in controlling herpesviral reactivation, suggesting complex biological networks that control the decision. One viral protein that is necessary and sufficient to switch latent Kaposi’s sarcoma-associated herpesvirus (KSHV) into the lytic infection cycle is called K-Rta. K-Rta is a transcriptional activator that specifies promoters by binding DNA directly and interacting with cellular proteins. Among these cellular proteins, binding of K-Rta to RBP-Jk is essential for viral reactivation. In contrast to the canonical model for Notch signaling, RBP-Jk is not uniformly and constitutively bound to the latent KSHV genome, but rather is recruited to DNA by interactions with K-Rta. Stimulation of RBP-Jk DNA binding requires high affinity binding of Rta to repetitive and palindromic “CANT DNA repeats” in promoters, and formation of ternary complexes with RBP-Jk. However, while K-Rta expression is necessary for initiating KSHV reactivation, K-Rta’s role as the switch is inefficient. Many factors modulate K-Rta’s function, suggesting that KSHV reactivation can be significantly regulated post-Rta expression and challenging the notion that herpesviral reactivation is bistable. This review analyzes rapidly evolving research on KSHV K-Rta to consider the role of K-Rta promoter specification in regulating the progression

  15. Optimizing Viral Discovery in Bats

    PubMed Central

    Young, Cristin C. W.; Olival, Kevin J.

    2016-01-01

    Viral discovery studies in bats have increased dramatically over the past decade, yet a rigorous synthesis of the published data is lacking. We extract and analyze data from 93 studies published between 2007–2013 to examine factors that increase success of viral discovery in bats, and specific trends and patterns of infection across host taxa and viral families. Over the study period, 248 novel viruses from 24 viral families have been described. Using generalized linear models, at a study level we show the number of host species and viral families tested best explained number of viruses detected. We demonstrate that prevalence varies significantly across viral family, specimen type, and host taxonomy, and calculate mean PCR prevalence by viral family and specimen type across all studies. Using a logistic model, we additionally identify factors most likely to increase viral detection at an individual level for the entire dataset and by viral families with sufficient sample sizes. Our analysis highlights major taxonomic gaps in recent bat viral discovery efforts and identifies ways to improve future viral pathogen detection through the design of more efficient and targeted sample collection and screening approaches. PMID:26867024

  16. [Viral safety of biologicals].

    PubMed

    Barin, F

    2008-06-01

    The viral safety of biologicals, either human blood derivatives or animal products or recombinant proteins issued from biotechnology, relies on the quality of the starting material, the manufacturing process and, if necessary, the control of the final product. The quality of the starting material is highly guaranteed for blood derivatives due to the individual screening for specific markers (antigens, genome, antibodies) for major blood borne viruses such as hepatitis B and C viruses (HBV, HCV) and human immunodeficiency virus (HIV). It can be reinforced by the detection through amplification procedures (polymerase chain reaction) in the plasma pool of genomes from viruses that have been implicated in contaminations of blood derivatives in the past (parvovirus B19, hepatitis A virus). The association in the manufacturing process of different steps dedicated to purification of plasma proteins (partitioning), virus inactivation (solvent/detergent treatment, heat inactivation) or specific procedures allowing virus removal (nanofiltration) allows to reduce the viral risk very efficiently. The validation studies using scaled down systems and model viruses allow to evaluate the virus safety of any product quantitatively. The aim of these procedures is to guarantee the lack of infectivity due to any virus, either known or unknown.

  17. Human viral gastroenteritis.

    PubMed Central

    Christensen, M L

    1989-01-01

    During the last 15 years, several different groups of fastidious viruses that are responsible for a large proportion of acute viral gastroenteritis cases have been discovered by the electron microscopic examination of stool specimens. This disease is one of the most prevalent and serious clinical syndromes seen around the world, especially in children. Rotaviruses, in the family Reoviridae, and fastidious fecal adenoviruses account for much of the viral gastroenteritis in infants and young children, whereas the small caliciviruses and unclassified astroviruses, and possibly enteric coronaviruses, are responsible for significantly fewer cases overall. In addition to electron microscopy, enzyme immunoassays and other rapid antigen detection systems have been developed to detect rotaviruses and fastidious fecal adenoviruses in the stool specimens of both nonhospitalized patients and those hospitalized for dehydration and electrolyte imbalance. Experimental rotavirus vaccines have also been developed, due to the prevalence and seriousness of rotavirus infection. The small, unclassified Norwalk virus and morphologically similar viruses are responsible for large and small outbreaks of acute gastroenteritis in older children, adolescents, and adults. Hospitalization of older patients infected with these viruses is usually not required, and their laboratory diagnoses have been limited primarily to research laboratories. Images PMID:2644024

  18. Viral infections of rabbits.

    PubMed

    Kerr, Peter J; Donnelly, Thomas M

    2013-05-01

    Viral diseases of rabbits have been used historically to study oncogenesis (e.g. rabbit fibroma virus, cottontail rabbit papillomavirus) and biologically to control feral rabbit populations (e.g. myxoma virus). However, clinicians seeing pet rabbits in North America infrequently encounter viral diseases although myxomatosis may be seen occasionally. The situation is different in Europe and Australia, where myxomatosis and rabbit hemorrhagic disease are endemic. Advances in epidemiology and virology have led to detection of other lapine viruses that are now recognized as agents of emerging infectious diseases. Rabbit caliciviruses, related to rabbit hemorrhagic disease, are generally avirulent, but lethal variants are being identified in Europe and North America. Enteric viruses including lapine rotavirus, rabbit enteric coronavirus and rabbit astrovirus are being acknowledged as contributors to the multifactorial enteritis complex of juvenile rabbits. Three avirulent leporid herpesviruses are found in domestic rabbits. A fourth highly pathogenic virus designated leporid herpesvirus 4 has been described in Canada and Alaska. This review considers viruses affecting rabbits by their clinical significance. Viruses of major and minor clinical significance are described, and viruses of laboratory significance are mentioned.

  19. Saliva and viral infections.

    PubMed

    Corstjens, Paul L A M; Abrams, William R; Malamud, Daniel

    2016-02-01

    Over the last 10 years there have been only a handful of publications dealing with the oral virome, which is in contrast to the oral microbiome, an area that has seen considerable interest. Here, we survey viral infections in general and then focus on those viruses that are found in and/or are transmitted via the oral cavity; norovirus, rabies, human papillomavirus, Epstein-Barr virus, herpes simplex viruses, hepatitis C virus, and HIV. Increasingly, viral infections have been diagnosed using an oral sample (e.g. saliva mucosal transudate or an oral swab) instead of blood or urine. The results of two studies using a rapid and semi-quantitative lateral flow assay format demonstrating the correlation of HIV anti-IgG/sIgA detection with saliva and serum samples are presented. When immediate detection of infection is important, point-of-care devices that obtain a non-invasive sample from the oral cavity can be used to provide a first line diagnosis to assist in determining appropriate counselling and therapeutic path for an increasing number of diseases.

  20. Viral noncoding RNAs: more surprises

    PubMed Central

    Tycowski, Kazimierz T.; Guo, Yang Eric; Lee, Nara; Moss, Walter N.; Vallery, Tenaya K.; Xie, Mingyi

    2015-01-01

    Eukaryotic cells produce several classes of long and small noncoding RNA (ncRNA). Many DNA and RNA viruses synthesize their own ncRNAs. Like their host counterparts, viral ncRNAs associate with proteins that are essential for their stability, function, or both. Diverse biological roles—including the regulation of viral replication, viral persistence, host immune evasion, and cellular transformation—have been ascribed to viral ncRNAs. In this review, we focus on the multitude of functions played by ncRNAs produced by animal viruses. We also discuss their biogenesis and mechanisms of action. PMID:25792595

  1. Impact of tumor microenvironment on oncolytic viral therapy

    PubMed Central

    Wojton, Jeffrey; Kaur, Balveen

    2010-01-01

    Interactions between tumor cells and their microenvironment have been shown to play a very significant role in the initiation, progression, and invasiveness of cancer. These tumor-stromal interactions are capable of altering the delivery and effectiveness of therapeutics into the tumor and are also known to influence future resistance and re-growth after treatment. Here we review recent advances in the understanding of the tumor microenvironment and its response to oncolytic viral therapy. The multifaceted environmental response to viral therapy can influence viral infection, replication, and propagation within the tumor. Recent studies have unveiled the complicated temporal changes in the tumor vasculature post OV treatment, and their impact on tumor biology. Similarly, the secreted extracellular matrix in solid tumors can affect both infection and spread of the therapeutic virus. Together, these complex changes in the tumor microenvironment also modulate the activation of the innate antiviral host immune response, leading to quick and efficient viral clearance. In order to combat these detrimental responses, viruses have been combined with pharmacological adjuvants and “armed” with therapeutic genes in order to suppress the pernicious environmental conditions following therapy. In this review we will discuss the impact of the tumor environment on viral therapy and examine some of the recent literature investigating methods of modulating this environment to enhance oncolysis. PMID:20399700

  2. Viral causes of diarrhea.

    PubMed

    Goodgame, R W

    2001-09-01

    Viruses are important causes of diarrhea. In healthy adults, the main clinical manifestation is acute, self-limited gastroenteritis. Advances in molecular diagnostics have shown that epidemics of acute gastroenteritis most frequently are due to caliciviruses spread through contaminated food or through person-to-person contact. Application of similar technology is needed to make a definitive statement about the role of such candidate viruses as rotavirus, astrovirus, and adenovirus as the cause of nonepidemic acute gastroenteritis in adults. Rarely a previously healthy adult gets acute CMV colitis. CMV and EBV mainly cause diarrhea in immunocompromised patients, however. Advances in prophylaxis and treatment have reduced the frequency and severity of these diseases. Acute infantile gastroenteritis is caused by rotavirus, calcivirus, astrovirus, and adenovirus. These viral diseases of the gut are seen by the physician as routine and rare clinical problems.

  3. [Viral hemorrhagic fever].

    PubMed

    Kager, P A

    1998-02-28

    Viral haemorrhagic fevers, such as Lassa fever and yellow fever, cause tens of thousands of deaths annually outside the Netherlands. The viruses are mostly transmitted by mosquitoes, ticks or via excreta of rodents. Important to travellers are yellow fever, dengue and Lassa and Ebola fever. For yellow fever there is an efficacious vaccine. Dengue is frequently observed in travellers; prevention consists in avoiding mosquito bites, the treatment is symptomatic. Lassa and Ebola fever are extremely rare among travellers; a management protocol can be obtained from the Netherlands Ministry of Health, Welfare and Sports. Diagnostics of a patient from the tropics with fever and haemorrhagic diathesis should be aimed at treatable disorders such as malaria, typhoid fever, rickettsiosis or bacterial sepsis, because the probability of such a disease is much higher than that of Lassa or Ebola fever.

  4. Viral Hemorrhagic Fever Diagnostics

    PubMed Central

    Racsa, Lori D.; Kraft, Colleen S.; Olinger, Gene G.; Hensley, Lisa E.

    2016-01-01

    There are 4 families of viruses that cause viral hemorrhagic fever (VHF), including Filoviridae. Ebola virus is one virus within the family Filoviridae and the cause of the current outbreak of VHF in West Africa. VHF-endemic areas are found throughout the world, yet traditional diagnosis of VHF has been performed in large reference laboratories centered in Europe and the United States. The large amount of capital needed, as well as highly trained and skilled personnel, has limited the availability of diagnostics in endemic areas except in conjunction with governmental and nongovernmental entities. However, rapid diagnosis of VHF is essential to efforts that will limit outbreaks. In addition, increased global travel suggests VHF diagnoses may be made outside of the endemic areas. Thus, understanding how to diagnose VHF is imperative for laboratories worldwide. This article reviews traditional and current diagnostic modalities for VHF. PMID:26354968

  5. Viral Quasispecies Evolution

    PubMed Central

    Sheldon, Julie; Perales, Celia

    2012-01-01

    Summary: Evolution of RNA viruses occurs through disequilibria of collections of closely related mutant spectra or mutant clouds termed viral quasispecies. Here we review the origin of the quasispecies concept and some biological implications of quasispecies dynamics. Two main aspects are addressed: (i) mutant clouds as reservoirs of phenotypic variants for virus adaptability and (ii) the internal interactions that are established within mutant spectra that render a virus ensemble the unit of selection. The understanding of viruses as quasispecies has led to new antiviral designs, such as lethal mutagenesis, whose aim is to drive viruses toward low fitness values with limited chances of fitness recovery. The impact of quasispecies for three salient human pathogens, human immunodeficiency virus and the hepatitis B and C viruses, is reviewed, with emphasis on antiviral treatment strategies. Finally, extensions of quasispecies to nonviral systems are briefly mentioned to emphasize the broad applicability of quasispecies theory. PMID:22688811

  6. Dengue viral infections

    PubMed Central

    Malavige, G; Fernando, S; Fernando, D; Seneviratne, S

    2004-01-01

    Dengue viral infections are one of the most important mosquito borne diseases in the world. They may be asymptomatic or may give rise to undifferentiated fever, dengue fever, dengue haemorrhagic fever (DHF), or dengue shock syndrome. Annually, 100 million cases of dengue fever and half a million cases of DHF occur worldwide. Ninety percent of DHF subjects are children less than 15 years of age. At present, dengue is endemic in 112 countries in the world. No vaccine is available for preventing this disease. Early recognition and prompt initiation of appropriate treatment are vital if disease related morbidity and mortality are to be limited. This review outlines aspects of the epidemiology of dengue infections, the dengue virus and its mosquito vector, clinical features and pathogenesis of dengue infections, and the management and control of these infections. PMID:15466994

  7. Dengue viral infections.

    PubMed

    Malavige, G N; Fernando, S; Fernando, D J; Seneviratne, S L

    2004-10-01

    Dengue viral infections are one of the most important mosquito borne diseases in the world. They may be asymptomatic or may give rise to undifferentiated fever, dengue fever, dengue haemorrhagic fever (DHF), or dengue shock syndrome. Annually, 100 million cases of dengue fever and half a million cases of DHF occur worldwide. Ninety percent of DHF subjects are children less than 15 years of age. At present, dengue is endemic in 112 countries in the world. No vaccine is available for preventing this disease. Early recognition and prompt initiation of appropriate treatment are vital if disease related morbidity and mortality are to be limited. This review outlines aspects of the epidemiology of dengue infections, the dengue virus and its mosquito vector, clinical features and pathogenesis of dengue infections, and the management and control of these infections.

  8. Viral quasispecies evolution.

    PubMed

    Domingo, Esteban; Sheldon, Julie; Perales, Celia

    2012-06-01

    Evolution of RNA viruses occurs through disequilibria of collections of closely related mutant spectra or mutant clouds termed viral quasispecies. Here we review the origin of the quasispecies concept and some biological implications of quasispecies dynamics. Two main aspects are addressed: (i) mutant clouds as reservoirs of phenotypic variants for virus adaptability and (ii) the internal interactions that are established within mutant spectra that render a virus ensemble the unit of selection. The understanding of viruses as quasispecies has led to new antiviral designs, such as lethal mutagenesis, whose aim is to drive viruses toward low fitness values with limited chances of fitness recovery. The impact of quasispecies for three salient human pathogens, human immunodeficiency virus and the hepatitis B and C viruses, is reviewed, with emphasis on antiviral treatment strategies. Finally, extensions of quasispecies to nonviral systems are briefly mentioned to emphasize the broad applicability of quasispecies theory.

  9. The repressing and enhancing functions of the herpes simplex virus regulatory protein ICP27 map to C-terminal regions and are required to modulate viral gene expression very early in infection.

    PubMed Central

    McMahan, L; Schaffer, P A

    1990-01-01

    The phenotypic properties of ICP27 temperature-sensitive and deletion mutants and the results of transient expression assays have demonstrated that ICP27 has a modulatory effect on viral gene expression induced by ICPs 0 and 4. In order to identify the regions of the ICP27 molecule that are responsible for its enhancing and repressing activities, 10 nonsense and 3 in-frame deletion mutations were introduced into the coding sequence of the cloned ICP27 gene. These mutant genes were tested in transient expression assays for their ability to complement an ICP27 null mutant and to enhance and repress expression from a spectrum of herpes simplex virus type 1 promoters in reporter CAT genes when expression was induced by ICP0 or ICP4. The results of assays with cloned mutant genes demonstrate that the ICP27 polypeptide contains two regions, located between amino acid residues 327 and 407 and residues 465 and 511, that contribute to its repressing activity. The amino acid region located between the two repressing regions (residues 407 to 465) is able to interfere with ICP27 repressing activity. None of the mutant genes exhibited efficient enhancing activity for any of the herpes simplex type 1 promoters tested, demonstrating that amino acids comprising the carboxy-terminal half of the ICP27 molecule, including the terminal phenylalanine residue, are required for wild-type enhancement as well as for efficient complementation of an ICP27 null mutant. Phenotypic characterization of an in-frame deletion mutant, vd3, and a previously isolated null mutant, 5dl 1.2 (A. M. McCarthy, L. and P. A. Schaffer, J. Virol. 63:18-27, 1989), demonstrated that ICP27 is required to induce the expression of all classes of viral genes very early in infection and confirmed the requirement for ICP27 later in infection (i) to repress early gene expression, (ii) to induce wild-type levels of delayed-early or gamma 1 gene expression, and (iii) to induce true late or gamma 2 gene expression. The vd3

  10. Confined aquifers as viral reservoirs.

    PubMed

    Smith, Renee J; Jeffries, Thomas C; Roudnew, Ben; Seymour, Justin R; Fitch, Alison J; Simons, Keryn L; Speck, Peter G; Newton, Kelly; Brown, Melissa H; Mitchell, James G

    2013-10-01

    Knowledge about viral diversity and abundance in deep groundwater reserves is limited. We found that the viral community inhabiting a deep confined aquifer in South Australia was more similar to reclaimed water communities than to the viral communities in the overlying unconfined aquifer community. This similarity was driven by high relative occurrence of the single-stranded DNA viral groups Circoviridae, Geminiviridae and Microviridae, which include many known plant and animal pathogens. These groups were present in a 1500-year-old water situated 80 m below the surface, which suggests the potential for long-term survival and spread of potentially pathogenic viruses in deep, confined groundwater. Obtaining a broader understanding of potentially pathogenic viral communities within aquifers is particularly important given the ability of viruses to spread within groundwater ecosystems.

  11. Mechanical Properties of Viral Capsids

    NASA Astrophysics Data System (ADS)

    Zandi, Roya; Reguera, David

    2005-03-01

    Viral genomes, whether they involve RNA or DNA molecules, are invariably protected by a rigid, single-protein-thick, shell referred to as ``capsid.'' Viral capsids are known to tolerate wide ranges of pH and salt conditions and to withstand internal pressures as high as 100 atms. We study the mechanical properties of viral capsids, calling explicit attention to the inhomogeneity of the shells that is inherent in their being discrete/polyhedral rather than continuous/spherical. We analyze the distribution of stress in these capsids due to isotropic internal pressure (arising, for instance, from genome confinement and/or osmotic activity), and compare the results with appropriate generalizations of classical elasticity theory. We also examine the competing mechanisms for viral shell failure, e.g., in-plane crack formation vs radial bursting. The biological consequences of the special stabilities and stress distributions of viral capsids are also discussed.

  12. Influenza virus RNA polymerase: insights into the mechanisms of viral RNA synthesis

    PubMed Central

    te Velthuis, Aartjan J.W.; Fodor, Ervin

    2016-01-01

    The genome of influenza viruses consists of multiple segments of single stranded negative-sense RNA. Each of these segments is bound by the heterotrimeric viral RNA-dependent RNA polymerase and multiple copies of nucleoprotein, forming viral ribonucleoprotein (vRNP) complexes. It is in the context of these vRNPs that the viral RNA polymerase carries out transcription of viral genes and replication of the viral RNA genome. In this Review, we discuss our current knowledge of the structure of the influenza virus RNA polymerase, how it carries out transcription and replication, and how its activities are modulated by viral and host factors. Furthermore, we discuss how advances in our understanding of polymerase function could help identifying new antiviral targets. PMID:27396566

  13. [Epidemiology of viral hepatitis].

    PubMed

    Kaić, Bernard; Vilibić-Cavlek, Tatjana; Filipović, Sanja Kurecić; Nemeth-Blazić, Tatjana; Pem-Novosel, Iva; Vucina, Vesna Visekruna; Simunović, Aleksandar; Zajec, Martina; Radić, Ivan; Pavlić, Jasmina; Glamocanin, Marica; Gjenero-Margan, Ira

    2013-10-01

    Understanding the country-specific epidemiology of disease, which may vary greatly among countries, is crucial for identifying the most appropriate preventive and control measures. An overview of the local epidemiology of viral hepatitis in Croatia is given in this paper. The overall prevalence of hepatitis B in Croatia is low (less than 2% HBsAg carriers in the general population). Hepatitis B incidence and prevalence began to decline significantly following the introduction of universal hepatitis B vaccination in 1999. Information on HBsAg seroprevalence is derived from routine testing of certain subpopulations (pregnant women, blood donors) and seroprevalence studies mostly targeted at high-risk populations. Universal childhood vaccination against hepatitis B remains the main preventive measure. We recommend testing for immunity one to two months after the third dose of hepatitis B vaccine for health-care workers. The incidence and prevalence of hepatitis C have also been declining in the general population. The main preventive measures are ensuring safety of blood products, prevention of drug abuse, and harm reduction programs for intravenous drug users. Hepatitis A incidence has declined dramatically since fifty years ago, when thousands of cases were reported annually. In the last five years, an average of twenty cases have been reported per year. The reduction of hepatitis A is a consequence of improved personal and community hygiene and sanitation. Hepatitis D has not been reported in Croatia. The risk of hepatitis D will get to be even smaller as the proportion of population vaccinated against hepatitis B builds up. Hepatitis E is reported only sporadically in Croatia, mostly in persons occupationally in contact with pigs and in travelers to endemic countries. In conclusion, Croatia is a low prevalence country for hepatitides A, B and C. Hepatitis D has not been reported to occur in Croatia and there are only sporadic cases of hepatitis E. Since hepatitis

  14. Surveillance for Viral Hepatitis - United States, 2014

    MedlinePlus

    ... Historical reported cases and estimates Quick Links to Hepatitis … A | B | C | D | E Viral Hepatitis Home ... Programs Resource Center Viral Hepatitis Surveillance for Viral Hepatitis – United States, 2014 Recommend on Facebook Tweet Share ...

  15. Insulated Foamy Viral Vectors.

    PubMed

    Browning, Diana L; Collins, Casey P; Hocum, Jonah D; Leap, David J; Rae, Dustin T; Trobridge, Grant D

    2016-03-01

    Retroviral vector-mediated gene therapy is promising, but genotoxicity has limited its use in the clinic. Genotoxicity is highly dependent on the retroviral vector used, and foamy viral (FV) vectors appear relatively safe. However, internal promoters may still potentially activate nearby genes. We developed insulated FV vectors, using four previously described insulators: a version of the well-studied chicken hypersensitivity site 4 insulator (650cHS4), two synthetic CCCTC-binding factor (CTCF)-based insulators, and an insulator based on the CCAAT box-binding transcription factor/nuclear factor I (7xCTF/NF1). We directly compared these insulators for enhancer-blocking activity, effect on FV vector titer, and fidelity of transfer to both proviral long terminal repeats. The synthetic CTCF-based insulators had the strongest insulating activity, but reduced titers significantly. The 7xCTF/NF1 insulator did not reduce titers but had weak insulating activity. The 650cHS4-insulated FV vector was identified as the overall most promising vector. Uninsulated and 650cHS4-insulated FV vectors were both significantly less genotoxic than gammaretroviral vectors. Integration sites were evaluated in cord blood CD34(+) cells and the 650cHS4-insulated FV vector had fewer hotspots compared with an uninsulated FV vector. These data suggest that insulated FV vectors are promising for hematopoietic stem cell gene therapy.

  16. Neuroanatomy goes viral!

    PubMed Central

    Nassi, Jonathan J.; Cepko, Constance L.; Born, Richard T.; Beier, Kevin T.

    2015-01-01

    The nervous system is complex not simply because of the enormous number of neurons it contains but by virtue of the specificity with which they are connected. Unraveling this specificity is the task of neuroanatomy. In this endeavor, neuroanatomists have traditionally exploited an impressive array of tools ranging from the Golgi method to electron microscopy. An ideal method for studying anatomy would label neurons that are interconnected, and, in addition, allow expression of foreign genes in these neurons. Fortuitously, nature has already partially developed such a method in the form of neurotropic viruses, which have evolved to deliver their genetic material between synaptically connected neurons while largely eluding glia and the immune system. While these characteristics make some of these viruses a threat to human health, simple modifications allow them to be used in controlled experimental settings, thus enabling neuroanatomists to trace multi-synaptic connections within and across brain regions. Wild-type neurotropic viruses, such as rabies and alpha-herpes virus, have already contributed greatly to our understanding of brain connectivity, and modern molecular techniques have enabled the construction of recombinant forms of these and other viruses. These newly engineered reagents are particularly useful, as they can target genetically defined populations of neurons, spread only one synapse to either inputs or outputs, and carry instructions by which the targeted neurons can be made to express exogenous proteins, such as calcium sensors or light-sensitive ion channels, that can be used to study neuronal function. In this review, we address these uniquely powerful features of the viruses already in the neuroanatomist’s toolbox, as well as the aspects of their biology that currently limit their utility. Based on the latter, we consider strategies for improving viral tracing methods by reducing toxicity, improving control of transsynaptic spread, and

  17. Viral hepatitis and the surgeon

    PubMed Central

    Cohen, A. J.; Assy, N.; Moser, M.

    2005-01-01

    Background. Viral hepatitis is an infection of the liver caused by one or more of six known (HAV-HGV) hepatotropic viruses. It is a common problem among health care workers and their patients. Surgeons are at particular risk of both acquiring and transmitting some of these viruses from and to their patients. Unfortunately, specific immunoprophylaxis for viral hepatitis is presently limited to protecting against the spread of hepatitis A and B viral infections, leaving a high degree of vigilance and careful surgical technique as the only means available to prevent the transmission of other viruses relative to the surgeon. The purpose of this paper is to review the various forms of viral hepatitis including the nature of the virus, serologic testing, clinical features, epidemiology (with specific reference to those issues that arise in surgical practice), treatment and prevention. PMID:18333162

  18. Viral infections of the face.

    PubMed

    Avci, Oktay; Ertam, Ilgen

    2014-01-01

    Viral infections affecting the face may cause significant morbidity, cosmetic disfigurement, and psychological distress. The success of therapy needs whole and correct evaluation of the clinical signs and symptoms. Some viruses such as Papillomaviridae, Herpesviridae, and Polyomaviridae primarily infect the facial skin, whereas others affect the face infrequently, as in parapox virus infections. Sometimes, involvement of the face can be a part of more generalized eruption and systemic symptoms in viral infections caused by Todaviridae, Flaviviridae, Arenaviridiae, and Flaviviridae. Clinical diagnosis can be challenging in various viral diseases when they occur in nonendemic geographic areas. The objective of this review was to concentrate on epidemiologic and clinical characteristics of the viral illnesses with facial skin involvement.

  19. Statistical Mechanics of Viral Entry

    NASA Astrophysics Data System (ADS)

    Zhang, Yaojun; Dudko, Olga K.

    2015-01-01

    Viruses that have lipid-membrane envelopes infect cells by fusing with the cell membrane to release viral genes. Membrane fusion is known to be hindered by high kinetic barriers associated with drastic structural rearrangements—yet viral infection, which occurs by fusion, proceeds on remarkably short time scales. Here, we present a quantitative framework that captures the principles behind the invasion strategy shared by all enveloped viruses. The key to this strategy—ligand-triggered conformational changes in the viral proteins that pull the membranes together—is treated as a set of concurrent, bias field-induced activated rate processes. The framework results in analytical solutions for experimentally measurable characteristics of virus-cell fusion and enables us to express the efficiency of the viral strategy in quantitative terms. The predictive value of the theory is validated through simulations and illustrated through recent experimental data on influenza virus infection.

  20. FastStats: Viral Hepatitis

    MedlinePlus

    ... Submit What's this? Submit Button NCHS Home Viral Hepatitis Recommend on Facebook Tweet Share Compartir Data are for the U.S. Morbidity Number of new hepatitis A cases: 1,781 (2013) Number of new ...

  1. Cytokine determinants of viral tropism.

    PubMed

    McFadden, Grant; Mohamed, Mohamed R; Rahman, Masmudur M; Bartee, Eric

    2009-09-01

    The specificity of a given virus for a cell type, tissue or species - collectively known as viral tropism - is an important factor in determining the outcome of viral infection in any particular host. Owing to the increased prevalence of zoonotic infections and the threat of emerging and re-emerging pathogens, gaining a better understanding of the factors that determine viral tropism has become particularly important. In this Review, we summarize our current understanding of the central role of antiviral and pro-inflammatory cytokines, particularly the interferons and tumour necrosis factor, in dictating viral tropism and how these cytokine pathways can be exploited therapeutically for cancer treatment and to better counter future threats from emerging zoonotic pathogens.

  2. Viral RNAs Are Unusually Compact

    PubMed Central

    Gopal, Ajaykumar; Egecioglu, Defne E.; Yoffe, Aron M.; Ben-Shaul, Avinoam; Rao, Ayala L. N.; Knobler, Charles M.; Gelbart, William M.

    2014-01-01

    A majority of viruses are composed of long single-stranded genomic RNA molecules encapsulated by protein shells with diameters of just a few tens of nanometers. We examine the extent to which these viral RNAs have evolved to be physically compact molecules to facilitate encapsulation. Measurements of equal-length viral, non-viral, coding and non-coding RNAs show viral RNAs to have among the smallest sizes in solution, i.e., the highest gel-electrophoretic mobilities and the smallest hydrodynamic radii. Using graph-theoretical analyses we demonstrate that their sizes correlate with the compactness of branching patterns in predicted secondary structure ensembles. The density of branching is determined by the number and relative positions of 3-helix junctions, and is highly sensitive to the presence of rare higher-order junctions with 4 or more helices. Compact branching arises from a preponderance of base pairing between nucleotides close to each other in the primary sequence. The density of branching represents a degree of freedom optimized by viral RNA genomes in response to the evolutionary pressure to be packaged reliably. Several families of viruses are analyzed to delineate the effects of capsid geometry, size and charge stabilization on the selective pressure for RNA compactness. Compact branching has important implications for RNA folding and viral assembly. PMID:25188030

  3. Viral RNAs are unusually compact.

    PubMed

    Gopal, Ajaykumar; Egecioglu, Defne E; Yoffe, Aron M; Ben-Shaul, Avinoam; Rao, Ayala L N; Knobler, Charles M; Gelbart, William M

    2014-01-01

    A majority of viruses are composed of long single-stranded genomic RNA molecules encapsulated by protein shells with diameters of just a few tens of nanometers. We examine the extent to which these viral RNAs have evolved to be physically compact molecules to facilitate encapsulation. Measurements of equal-length viral, non-viral, coding and non-coding RNAs show viral RNAs to have among the smallest sizes in solution, i.e., the highest gel-electrophoretic mobilities and the smallest hydrodynamic radii. Using graph-theoretical analyses we demonstrate that their sizes correlate with the compactness of branching patterns in predicted secondary structure ensembles. The density of branching is determined by the number and relative positions of 3-helix junctions, and is highly sensitive to the presence of rare higher-order junctions with 4 or more helices. Compact branching arises from a preponderance of base pairing between nucleotides close to each other in the primary sequence. The density of branching represents a degree of freedom optimized by viral RNA genomes in response to the evolutionary pressure to be packaged reliably. Several families of viruses are analyzed to delineate the effects of capsid geometry, size and charge stabilization on the selective pressure for RNA compactness. Compact branching has important implications for RNA folding and viral assembly.

  4. Virus Variation Resource – improved response to emergent viral outbreaks

    PubMed Central

    Hatcher, Eneida L.; Zhdanov, Sergey A.; Bao, Yiming; Blinkova, Olga; Nawrocki, Eric P.; Ostapchuck, Yuri; Schäffer, Alejandro A.; Brister, J. Rodney

    2017-01-01

    The Virus Variation Resource is a value-added viral sequence data resource hosted by the National Center for Biotechnology Information. The resource is located at http://www.ncbi.nlm.nih.gov/genome/viruses/variation/ and includes modules for seven viral groups: influenza virus, Dengue virus, West Nile virus, Ebolavirus, MERS coronavirus, Rotavirus A and Zika virus. Each module is supported by pipelines that scan newly released GenBank records, annotate genes and proteins and parse sample descriptors and then map them to controlled vocabulary. These processes in turn support a purpose-built search interface where users can select sequences based on standardized gene, protein and metadata terms. Once sequences are selected, a suite of tools for downloading data, multi-sequence alignment and tree building supports a variety of user directed activities. This manuscript describes a series of features and functionalities recently added to the Virus Variation Resource. PMID:27899678

  5. Spontaneous Clearance of Viral Infections by Mesoscopic Fluctuations

    PubMed Central

    Chaudhury, Srabanti; Perelson, Alan S.; Sinitstyn, Nikolai A.

    2012-01-01

    Spontaneous disease extinction can occur due to a rare stochastic fluctuation. We explore this process, both numerically and theoretically, in two minimal models of stochastic viral infection dynamics. We propose a method that reduces the complexity in models of viral infections so that the remaining dynamics can be studied by previously developed techniques for analyzing epidemiological models. Using this technique, we obtain an expression for the infection clearance time as a function of kinetic parameters. We apply our theoretical results to study stochastic infection clearance for specific stages of HIV and HCV dynamics. Our results show that the typical time for stochastic clearance of a viral infection increases exponentially with the size of the population, but infection still can be cleared spontaneously within a reasonable time interval in a certain population of cells. We also show that the clearance time is exponentially sensitive to the viral decay rate and viral infectivity but only linearly dependent on the lifetime of an infected cell. This suggests that if standard drug therapy fails to clear an infection then intensifying therapy by adding a drug that reduces the rate of cell infection rather than immune modulators that hasten infected cell death may be more useful in ultimately clearing remaining pockets of infection. PMID:22693646

  6. Viral Serpin Therapeutics: From Concept to Clinic

    PubMed Central

    Chen, Hao; Zheng, Donghang; Davids, Jennifer; Bartee, Mee Yong; Dai, Erbin; Liu, Liying; Petrov, Lyubomir; Macaulay, Colin; Thoburn, Robert; Sobel, Eric; Moyer, Richard; McFadden, Grant; Lucas, Alexandra

    2012-01-01

    Over the past 19 years, we have developed a novel myxoma virus-derived anti-inflammatory serine protease inhibitor, termed a serpin, as a new class of immunomodulatory therapeutic. This review will describe the initial identification of viral serpins with anti-inflammatory potential, beginning with preclinical analysis of viral pathogenesis and proceeding to cell and molecular target analyses, and successful clinical trial. The central aim of this review is to describe the development of two serpins, Serp-1 and Serp-2, as a new class of immune modulating drug, from inception to implementation. We begin with an overview of the approaches used for successful mining of the virus for potential serpin immunomodulators in viruses. We then provide a methodological overview of one inflammatory animal model used to test for serpin anti-inflammatory activity followed by methods used to identify cells in the inflammatory response system targeted by these serpins and molecular responses to serpin treatment. Finally, we provide an overview of our findings from a recent, successful clinical trial of the secreted myxomaviral serpin, Serp-1, in patients with unstable inflammatory coronary arterial disease. PMID:21683260

  7. The enzymes LSD1 and Set1A cooperate with the viral protein HBx to establish an active hepatitis B viral chromatin state

    PubMed Central

    Alarcon, Valentina; Hernández, Sergio; Rubio, Lorena; Alvarez, Francisca; Flores, Yvo; Varas-Godoy, Manuel; De Ferrari, Giancarlo V.; Kann, Michael; Villanueva, Rodrigo A.; Loyola, Alejandra

    2016-01-01

    With about 350 million people chronically infected around the world hepatitis B is a major health problem. Template for progeny HBV synthesis is the viral genome, organized as a minichromosome (cccDNA) inside the hepatocyte nucleus. How viral cccDNA gene expression is regulated by its chromatin structure; more importantly, how the modulation of this structure impacts on viral gene expression remains elusive. Here, we found that the enzyme SetDB1 contributes to setting up a repressed cccDNA chromatin state. This repressive state is activated by the histone lysine demethylase-1 (LSD1). Consistently, inhibiting or reducing LSD1 levels led to repression of viral gene expression. This correlates with the transcriptionally repressive mark H3K9 methylation and reduction on the activating marks H3 acetylation and H3K4 methylation on viral promoters. Investigating the importance of viral proteins we found that LSD1 recruitment to viral promoters was dependent on the viral transactivator protein HBx. Moreover, the histone methyltransferase Set1A and HBx are simultaneously bound to the core promoter, and Set1A expression correlates with cccDNA H3K4 methylation. Our results shed light on the mechanisms of HBV regulation mediated by the cccDNA chromatin structure, offering new therapeutic targets to develop drugs for the treatment of chronically infected HBV patients. PMID:27174370

  8. The enzymes LSD1 and Set1A cooperate with the viral protein HBx to establish an active hepatitis B viral chromatin state.

    PubMed

    Alarcon, Valentina; Hernández, Sergio; Rubio, Lorena; Alvarez, Francisca; Flores, Yvo; Varas-Godoy, Manuel; De Ferrari, Giancarlo V; Kann, Michael; Villanueva, Rodrigo A; Loyola, Alejandra

    2016-05-13

    With about 350 million people chronically infected around the world hepatitis B is a major health problem. Template for progeny HBV synthesis is the viral genome, organized as a minichromosome (cccDNA) inside the hepatocyte nucleus. How viral cccDNA gene expression is regulated by its chromatin structure; more importantly, how the modulation of this structure impacts on viral gene expression remains elusive. Here, we found that the enzyme SetDB1 contributes to setting up a repressed cccDNA chromatin state. This repressive state is activated by the histone lysine demethylase-1 (LSD1). Consistently, inhibiting or reducing LSD1 levels led to repression of viral gene expression. This correlates with the transcriptionally repressive mark H3K9 methylation and reduction on the activating marks H3 acetylation and H3K4 methylation on viral promoters. Investigating the importance of viral proteins we found that LSD1 recruitment to viral promoters was dependent on the viral transactivator protein HBx. Moreover, the histone methyltransferase Set1A and HBx are simultaneously bound to the core promoter, and Set1A expression correlates with cccDNA H3K4 methylation. Our results shed light on the mechanisms of HBV regulation mediated by the cccDNA chromatin structure, offering new therapeutic targets to develop drugs for the treatment of chronically infected HBV patients.

  9. Hepatitis B virus: pathogenesis, viral intermediates, and viral replication.

    PubMed

    Lee, Jia-Yee; Locarnini, Stephen

    2004-05-01

    Although HBV has the potential to generate an almost limitless spectrum of quasispecies during chronic infection, the viability of the majority of these quasispecies is almost certainly impaired due to constraints imposed by the remarkably compact organization of the HBV genome. On the other hand, single mutations may affect more than one gene and result in complex and unpredictable effects on viral phenotype. Better understanding of the constraints imposed by gene overlap and of genotype-phenotype relationships should help in the development of improved antiviral strategies and management approaches. Although the probability of developing viral resistance is directly proportional to the intensity of selection pressure and the diversity of quasispecies, potent inhibition of HBV replication should be able to prevent development of drug resistance because mutagenesis is replication dependent. If viral replication can be suppressed for a sufficient length of time, viral load should decline to a point where the continued production of quasispecies with the potential to resist new drug treatments no longer occurs. Clinical application of this concept will require optimization of combination therapies analogous to highly active antiretroviral therapy (HAART) for HIV infection. Total cure of hepatitis B will require elimination of the intranuclear pool of viral minichromosomes, which will probably only be achieved by normal cell turnover, reactivation of host immunity, or elucidation of the antiviral mechanisms operating during cytokine clearance in acute hepatitis B (see Fig. 1).

  10. Viral Vector-Mediated Antisense Therapy for Genetic Diseases

    PubMed Central

    Imbert, Marine; Dias-Florencio, Gabriella; Goyenvalle, Aurélie

    2017-01-01

    RNA plays complex roles in normal health and disease and is becoming an important target for therapeutic intervention; accordingly, therapeutic strategies that modulate RNA function have gained great interest over the past decade. Antisense oligonucleotides (AOs) are perhaps the most promising strategy to modulate RNA expression through a variety of post binding events such as gene silencing through degradative or non-degradative mechanisms, or splicing modulation which has recently demonstrated promising results. However, AO technology still faces issues like poor cellular-uptake, low efficacy in target tissues and relatively rapid clearance from the circulation which means repeated injections are essential to complete therapeutic efficacy. To overcome these limitations, viral vectors encoding small nuclear RNAs have been engineered to shuttle antisense sequences into cells, allowing appropriate subcellular localization with pre-mRNAs and permanent correction. In this review, we outline the different strategies for antisense therapy mediated by viral vectors and provide examples of each approach. We also address the advantages and limitations of viral vector use, with an emphasis on their clinical application. PMID:28134780

  11. Brd4 Activates Early Viral Transcription upon Human Papillomavirus 18 Infection of Primary Keratinocytes

    PubMed Central

    McKinney, Caleb C.; Kim, Min Jung; Chen, Dan

    2016-01-01

    ABSTRACT  Human papillomaviruses (HPVs) replicate in the cutaneous and mucosal epithelia, and the infectious cycle is synchronous with the differentiation program of the host keratinocytes. The virus initially infects dividing cells in the lower layers of the epithelium, where it establishes a persistent infection. The viral genome is maintained as a low-copy-number, extrachromosomal element in these proliferating cells but switches to the late stage of the life cycle in differentiated cells. The cellular chromatin adaptor protein Brd4 is involved in several stages and processes of the viral life cycle. In concert with the viral transcriptional regulator E2, Brd4 can repress transcription from the early viral promoter. Brd4 and E2 form a complex with the viral genome that associates with host chromosomes to partition the viral genome in dividing cells; Brd4 also localizes to active sites of productive HPV DNA replication. However, because of the difficulties in producing HPV viral particles, the role of Brd4 in modulating viral transcription and replication at the initial stage of infection is unclear. In this study, we have used an HPV18 quasivirus-based genome delivery system to assess the role of Brd4 in the initial infectivity of primary human keratinocytes. We show that, upon infection of primary human keratinocytes with HPV18 quasivirus, Brd4 activates viral transcription and replication. Furthermore, this activation is independent of the functional interaction between Brd4 and the HPV18 E2 protein. PMID:27879331

  12. Viral infections of nonhuman primates.

    PubMed

    Kalter, S S; Heberling, R L; Cooke, A W; Barry, J D; Tian, P Y; Northam, W J

    1997-10-01

    Approximately 53,000 serologic tests and viral isolation studies were performed on 1,700 nonhuman primate specimens for evidence of past and/or current viral infection. Information, other than the requested test, generally was not provided with the specimen. This lack of information does not permit any attempt at interpretation of results. Requested testing included a large number of diverse viral agents in approximately 40 primate species. The resulting data are in keeping with those of previous studies and offer an insight into the needs of colony management, as well as some general information on the overall frequency of infection with the indicated viruses. Inasmuch as the results represent testing of single specimens, they are not to be construed as "diagnostic," and simply indicate past infection as represented by the presence of antibody in the test animal. Viral isolation results are listed, and the number of positive results versus the number of animals tested emphasizes the limitations of the procedure. Investigations such as these continue to assist in the maintenance of healthy nonhuman primate colonies. This information also supports continued use of nonhuman primates for research in human viral infections and may be helpful in terms of animal selection for use in xenotransplants.

  13. Viral metagenomics and blood safety.

    PubMed

    Sauvage, V; Eloit, M

    2016-02-01

    The characterization of the human blood-associated viral community (also called blood virome) is essential for epidemiological surveillance and to anticipate new potential threats for blood transfusion safety. Currently, the risk of blood-borne agent transmission of well-known viruses (HBV, HCV, HIV and HTLV) can be considered as under control in high-resource countries. However, other viruses unknown or unsuspected may be transmitted to recipients by blood-derived products. This is particularly relevant considering that a significant proportion of transfused patients are immunocompromised and more frequently subjected to fatal outcomes. Several measures to prevent transfusion transmission of unknown viruses have been implemented including the exclusion of at-risk donors, leukocyte reduction of donor blood, and physicochemical treatment of the different blood components. However, up to now there is no universal method for pathogen inactivation, which would be applicable for all types of blood components and, equally effective for all viral families. In addition, among available inactivation procedures of viral genomes, some of them are recognized to be less effective on non-enveloped viruses, and inadequate to inactivate higher viral titers in plasma pools or derivatives. Given this, there is the need to implement new methodologies for the discovery of unknown viruses that may affect blood transfusion. Viral metagenomics combined with High Throughput Sequencing appears as a promising approach for the identification and global surveillance of new and/or unexpected viruses that could impair blood transfusion safety.

  14. Viral Inhibition of PRR-Mediated Innate Immune Response: Learning from KSHV Evasion Strategies

    PubMed Central

    Lee, Hye-Ra; Choi, Un Yung; Hwang, Sung-Woo; Kim, Stephanie; Jung, Jae U.

    2016-01-01

    The innate immune system has evolved to detect and destroy invading pathogens before they can establish systemic infection. To successfully eradicate pathogens, including viruses, host innate immunity is activated through diverse pattern recognition receptors (PRRs) which detect conserved viral signatures and trigger the production of type I interferon (IFN) and pro-inflammatory cytokines to mediate viral clearance. Viral persistence requires that viruses co-opt cellular pathways and activities for their benefit. In particular, due to the potent antiviral activities of IFN and cytokines, viruses have developed various strategies to meticulously modulate intracellular innate immune sensing mechanisms to facilitate efficient viral replication and persistence. In this review, we highlight recent advances in the study of viral immune evasion strategies with a specific focus on how Kaposi’s sarcoma-associated herpesvirus (KSHV) effectively targets host PRR signaling pathways. PMID:27871174

  15. Viral Inhibition of PRR-Mediated Innate Immune Response: Learning from KSHV Evasion Strategies.

    PubMed

    Lee, Hye-Ra; Choi, Un Yung; Hwang, Sung-Woo; Kim, Stephanie; Jung, Jae U

    2016-11-30

    The innate immune system has evolved to detect and destroy invading pathogens before they can establish systemic infection. To successfully eradicate pathogens, including viruses, host innate immunity is activated through diverse pattern recognition receptors (PRRs) which detect conserved viral signatures and trigger the production of type I interferon (IFN) and pro-inflammatory cytokines to mediate viral clearance. Viral persistence requires that viruses co-opt cellular pathways and activities for their benefit. In particular, due to the potent antiviral activities of IFN and cytokines, viruses have developed various strategies to meticulously modulate intracellular innate immune sensing mechanisms to facilitate efficient viral replication and persistence. In this review, we highlight recent advances in the study of viral immune evasion strategies with a specific focus on how Kaposi's sarcoma-associated herpesvirus (KSHV) effectively targets host PRR signaling pathways.

  16. [Novel treatments for hepatitis C viral infection and the hepatic fibrosis].

    PubMed

    Lugo-Baruqui, Alejandro; Bautista López, Carlos Alfredo; Armendáriz-Borunda, Juan

    2009-02-01

    Hepatitis C virus (HCV) infection represents a global health problem due to its evolution to hepatic cirrhosis and hepatocellular carcinoma. The viral pathogenesis and infectious processes are not yet fully understood. The development of natural viral resistance towards the host immune system represents a mayor challenge for the design of alternative therapeutic interventions and development of viral vaccines. The molecular mechanisms of hepatic fibrosis are well described. New alternatives for the treatment of patients with HCV infection and hepatic cirrhosis are under intensive research. New drugs such as viral protease inhibitors and assembly inhibitors, as well as immune modulators have been studied in clinical trials. Additional alternatives include antifibrotic drugs, which reverse the hepatic cellular damage caused by HCV infection. This review makes reference to viral infective mechanisms, molecular pathways of liver fibrosis and overviews conventional and new treatments for HCV infection and liver fibrosis.

  17. Developmental toxicity of 4-ring polycyclic aromatic hydrocarbons in zebrafish is differentially dependent on AH receptor isoforms and hepatic cytochrome P4501A metabolism

    SciTech Connect

    Incardona, John P. . E-mail: john.incardona@noaa.gov; Day, Heather L.; Collier, Tracy K.; Scholz, Nathaniel L.

    2006-12-15

    Polycyclic aromatic hydrocarbons (PAHs) derived from fossil fuels are ubiquitous contaminants and occur in aquatic habitats as highly variable and complex mixtures of compounds containing 2 to 6 rings. For aquatic species, PAHs are generally accepted as acting through either of two modes of action: (1) 'dioxin-like' toxicity mediated by activation of the aryl hydrocarbon receptor (AHR), which controls a battery of genes involved in PAH metabolism, such as cytochrome P4501A (CYP1A) and (2) 'nonpolar narcosis', in which tissue uptake is dependent solely on hydrophobicity and toxicity is mediated through non-specific partitioning into lipid bilayers. As part of a systematic analysis of mechanisms of PAH developmental toxicity in zebrafish, we show here that three tetracyclic PAHs (pyrene, chrysene, and benz[a]anthracene) activate the AHR pathway tissue-specifically to induce distinct patterns of CYP1A expression. Using morpholino knockdown of ahr1a, ahr2, and cyp1a, we show that distinct embryolarval syndromes induced by exposure to two of these compounds are differentially dependent on tissue-specific activation of AHR isoforms or metabolism by CYP1A. Exposure of embryos with and without circulation (silent heart morphants) resulted in dramatically different patterns of CYP1A induction, with circulation required to deliver some compounds to internal tissues. Therefore, biological effects of PAHs cannot be predicted simply by quantitative measures of AHR activity or a compound's hydrophobicity. These results indicate that current models of PAH toxicity in fish are greatly oversimplified and that individual PAHs are pharmacologically active compounds with distinct and specific cellular targets.

  18. IL-33 markedly activates murine eosinophils by an NF-κB-dependent mechanism differentially dependent upon an IL-4-driven autoinflammatory loop.

    PubMed

    Bouffi, Carine; Rochman, Mark; Zust, Christopher B; Stucke, Emily M; Kartashov, Andrey; Fulkerson, Patricia C; Barski, Artem; Rothenberg, Marc E

    2013-10-15

    Eosinophils are major effector cells in type 2 inflammatory responses and become activated in response to IL-4 and IL-33, yet the molecular mechanisms and cooperative interaction between these cytokines remain unclear. Our objective was to investigate the molecular mechanism and cooperation of IL-4 and IL-33 in eosinophil activation. Eosinophils derived from bone marrow or isolated from Il5-transgenic mice were activated in the presence of IL-4 or IL-33 for 1 or 4 h, and the transcriptome was analyzed by RNA sequencing. The candidate genes were validated by quantitative PCR and ELISA. We demonstrated that murine-cultured eosinophils respond to IL-4 and IL-33 by phosphorylation of STAT-6 and NF-κB, respectively. RNA sequence analysis of murine-cultured eosinophils indicated that IL-33 induced 519 genes, whereas IL-4 induced only 28 genes, including 19 IL-33-regulated genes. Interestingly, IL-33 induced eosinophil activation via two distinct mechanisms, IL-4 independent and IL-4 secretion/autostimulation dependent. Anti-IL-4 or anti-IL-4Rα Ab-treated cultured and mature eosinophils, as well as Il4- or Stat6-deficient cultured eosinophils, had attenuated protein secretion of a subset of IL-33-induced genes, including Retnla and Ccl17. Additionally, IL-33 induced the rapid release of preformed IL-4 protein from eosinophils by a NF-κB-dependent mechanism. However, the induction of most IL-33-regulated transcripts (e.g., Il6 and Il13) was IL-4 independent and blocked by NF-κB inhibition. In conclusion, we have identified a novel activation pathway in murine eosinophils that is induced by IL-33 and differentially dependent upon an IL-4 auto-amplification loop.

  19. Going Viral with Fluorescent Proteins.

    PubMed

    Costantini, Lindsey M; Snapp, Erik L

    2015-10-01

    Many longstanding questions about dynamics of virus-cell interactions can be answered by combining fluorescence imaging techniques with fluorescent protein (FP) tagging strategies. Successfully creating a FP fusion with a cellular or viral protein of interest first requires selecting the appropriate FP. However, while viral architecture and cellular localization often dictate the suitability of a FP, a FP's chemical and physical properties must also be considered. Here, we discuss the challenges of and offer suggestions for identifying the optimal FPs for studying the cell biology of viruses.

  20. A combination HIV reporter virus system for measuring post-entry event efficiency and viral outcome in primary CD4+ T cell subsets.

    PubMed

    Tilton, Carisa A; Tabler, Caroline O; Lucera, Mark B; Marek, Samantha L; Haqqani, Aiman A; Tilton, John C

    2014-01-01

    Fusion between the viral membrane of human immunodeficiency virus (HIV) and the host cell marks the end of the HIV entry process and the beginning of a series of post-entry events including uncoating, reverse transcription, integration, and viral gene expression. The efficiency of post-entry events can be modulated by cellular factors including viral restriction factors and can lead to several distinct outcomes: productive, latent, or abortive infection. Understanding host and viral proteins impacting post-entry event efficiency and viral outcome is critical for strategies to reduce HIV infectivity and to optimize transduction of HIV-based gene therapy vectors. Here, we report a combination reporter virus system measuring both membrane fusion and viral promoter-driven gene expression. This system enables precise determination of unstimulated primary CD4+ T cell subsets targeted by HIV, the efficiency of post-entry viral events, and viral outcome and is compatible with high-throughput screening and cell-sorting methods.

  1. Viral Inhibition of the IFN-Induced JAK/STAT Signalling Pathway: Development of Live Attenuated Vaccines by Mutation of Viral-Encoded IFN-Antagonists

    PubMed Central

    Fleming, Stephen B.

    2016-01-01

    The interferon (IFN) induced anti-viral response is amongst the earliest and most potent of the innate responses to fight viral infection. The induction of the Janus kinase/signal transducer and activation of transcription (JAK/STAT) signalling pathway by IFNs leads to the upregulation of hundreds of interferon stimulated genes (ISGs) for which, many have the ability to rapidly kill viruses within infected cells. During the long course of evolution, viruses have evolved an extraordinary range of strategies to counteract the host immune responses in particular by targeting the JAK/STAT signalling pathway. Understanding how the IFN system is inhibited has provided critical insights into viral virulence and pathogenesis. Moreover, identification of factors encoded by viruses that modulate the JAK/STAT pathway has opened up opportunities to create new anti-viral drugs and rationally attenuated new generation vaccines, particularly for RNA viruses, by reverse genetics. PMID:27367734

  2. The Paradigm of Viral Communication.

    ERIC Educational Resources Information Center

    Welker, Carl B.

    2002-01-01

    Introduces the concepts of idea viruses and viral communication, a technology-based communication that spreads ideas quickly. Explains its applicability in the area of direct marketing and discusses a technology platform that provides the opportunity of sending a message to a large number of people and emotional or pecuniary incentives to…

  3. Viral Subversion of Nucleocytoplasmic Trafficking

    PubMed Central

    Yarbrough, Melanie L.; Mata, Miguel A.; Sakthivel, Ramanavelan; Fontoura, Beatriz M. A.

    2014-01-01

    Trafficking of proteins and RNA into and out of the nucleus occurs through the nuclear pore complex (NPC). Due to its critical function in many cellular processes, the NPC and transport factors are common targets of several viruses that disrupt key constituents of the machinery to facilitate viral replication. Many viruses such as poliovirus and severe acute respiratory syndrome (SARS) virus inhibit protein import into the nucleus, while viruses such as influenza A virus target and disrupt host mRNA nuclear export. Current evidence indicates that these viruses may employ such strategies to avert the host immune response. Conversely, many viruses co-opt nucleocytoplasmic trafficking to facilitate transport of viral RNAs. Since viral proteins interact with key regulators of the host nuclear transport machinery, viruses have served as invaluable tools of discovery that led to the identification of novel constituents of nuclear transport pathways. In addition, this review explores the importance of nucleocytoplasmic trafficking to viral pathogenesis as these studies revealed new antiviral therapeutic strategies and exposed previously unknown cellular mechanisms. Further understanding of nuclear transport pathways will determine whether such therapeutics will be useful treatments for important human pathogens. PMID:24289861

  4. Nosocomial Spread of Viral Disease

    PubMed Central

    Aitken, Celia; Jeffries, Donald J.

    2001-01-01

    Viruses are important causes of nosocomial infection, but the fact that hospital outbreaks often result from introduction(s) from community-based epidemics, together with the need to initiate specific laboratory testing, means that there are usually insufficient data to allow the monitoring of trends in incidences. The most important defenses against nosocomial transmission of viruses are detailed and continuing education of staff and strict adherence to infection control policies. Protocols must be available to assist in the management of patients with suspected or confirmed viral infection in the health care setting. In this review, we present details on general measures to prevent the spread of viral infection in hospitals and other health care environments. These include principles of accommodation of infected patients and approaches to good hygiene and patient management. They provide detail on individual viral diseases accompanied in each case with specific information on control of the infection and, where appropriate, details of preventive and therapeutic measures. The important areas of nosocomial infection due to blood-borne viruses have been extensively reviewed previously and are summarized here briefly, with citation of selected review articles. Human prion diseases, which present management problems very different from those of viral infection, are not included. PMID:11432812

  5. Roles of the Picornaviral 3C Proteinase in the Viral Life Cycle and Host Cells

    PubMed Central

    Sun, Di; Chen, Shun; Cheng, Anchun; Wang, Mingshu

    2016-01-01

    The Picornaviridae family comprises a large group of non-enveloped viruses that have a major impact on human and veterinary health. The viral genome contains one open reading frame encoding a single polyprotein that can be processed by viral proteinases. The crucial 3C proteinases (3Cpros) of picornaviruses share similar spatial structures and it is becoming apparent that 3Cpro plays a significant role in the viral life cycle and virus host interaction. Importantly, the proteinase and RNA-binding activity of 3Cpro are involved in viral polyprotein processing and the initiation of viral RNA synthesis. In addition, 3Cpro can induce the cleavage of certain cellular factors required for transcription, translation and nucleocytoplasmic trafficking to modulate cell physiology for viral replication. Due to interactions between 3Cpro and these essential factors, 3Cpro is also involved in viral pathogenesis to support efficient infection. Furthermore, based on the structural conservation, the development of irreversible inhibitors and discovery of non-covalent inhibitors for 3Cpro are ongoing and a better understanding of the roles played by 3Cpro may provide insights into the development of potential antiviral treatments. In this review, the current knowledge regarding the structural features, multiple functions in the viral life cycle, pathogen host interaction, and development of antiviral compounds for 3Cpro is summarized. PMID:26999188

  6. Roles of the Picornaviral 3C Proteinase in the Viral Life Cycle and Host Cells.

    PubMed

    Sun, Di; Chen, Shun; Cheng, Anchun; Wang, Mingshu

    2016-03-17

    The Picornaviridae family comprises a large group of non-enveloped viruses that have a major impact on human and veterinary health. The viral genome contains one open reading frame encoding a single polyprotein that can be processed by viral proteinases. The crucial 3C proteinases (3C(pro)s) of picornaviruses share similar spatial structures and it is becoming apparent that 3C(pro) plays a significant role in the viral life cycle and virus host interaction. Importantly, the proteinase and RNA-binding activity of 3C(pro) are involved in viral polyprotein processing and the initiation of viral RNA synthesis. In addition, 3C(pro) can induce the cleavage of certain cellular factors required for transcription, translation and nucleocytoplasmic trafficking to modulate cell physiology for viral replication. Due to interactions between 3C(pro) and these essential factors, 3C(pro) is also involved in viral pathogenesis to support efficient infection. Furthermore, based on the structural conservation, the development of irreversible inhibitors and discovery of non-covalent inhibitors for 3C(pro) are ongoing and a better understanding of the roles played by 3C(pro) may provide insights into the development of potential antiviral treatments. In this review, the current knowledge regarding the structural features, multiple functions in the viral life cycle, pathogen host interaction, and development of antiviral compounds for 3C(pro) is summarized.

  7. Autistic disorder and viral infections.

    PubMed

    Libbey, Jane E; Sweeten, Thayne L; McMahon, William M; Fujinami, Robert S

    2005-02-01

    Autistic disorder (autism) is a behaviorally defined developmental disorder with a wide range of behaviors. Although the etiology of autism is unknown, data suggest that autism results from multiple etiologies with both genetic and environmental contributions, which may explain the spectrum of behaviors seen in this disorder. One proposed etiology for autism is viral infection very early in development. The mechanism, by which viral infection may lead to autism, be it through direct infection of the central nervous system (CNS), through infection elsewhere in the body acting as a trigger for disease in the CNS, through alteration of the immune response of the mother or offspring, or through a combination of these, is not yet known. Animal models in which early viral infection results in behavioral changes later in life include the influenza virus model in pregnant mice and the Borna disease virus model in newborn Lewis rats. Many studies over the years have presented evidence both for and against the association of autism with various viral infections. The best association to date has been made between congenital rubella and autism; however, members of the herpes virus family may also have a role in autism. Recently, controversy has arisen as to the involvement of measles virus and/or the measles, mumps, rubella (MMR) vaccine in the development of autism. Biological assays lend support to the association between measles virus or MMR and autism whereas epidemiologic studies show no association between MMR and autism. Further research is needed to clarify both the mechanisms whereby viral infection early in development may lead to autism and the possible involvement of the MMR vaccine in the development of autism.

  8. Combining genomic sequencing methods to explore viral diversity and reveal potential virus-host interactions

    PubMed Central

    Chow, Cheryl-Emiliane T.; Winget, Danielle M.; White, Richard A.; Hallam, Steven J.; Suttle, Curtis A.

    2015-01-01

    Viral diversity and virus-host interactions in oxygen-starved regions of the ocean, also known as oxygen minimum zones (OMZs), remain relatively unexplored. Microbial community metabolism in OMZs alters nutrient and energy flow through marine food webs, resulting in biological nitrogen loss and greenhouse gas production. Thus, viruses infecting OMZ microbes have the potential to modulate community metabolism with resulting feedback on ecosystem function. Here, we describe viral communities inhabiting oxic surface (10 m) and oxygen-starved basin (200 m) waters of Saanich Inlet, a seasonally anoxic fjord on the coast of Vancouver Island, British Columbia using viral metagenomics and complete viral fosmid sequencing on samples collected between April 2007 and April 2010. Of 6459 open reading frames (ORFs) predicted across all 34 viral fosmids, 77.6% (n = 5010) had no homology to reference viral genomes. These fosmids recruited a higher proportion of viral metagenomic sequences from Saanich Inlet than from nearby northeastern subarctic Pacific Ocean (Line P) waters, indicating differences in the viral communities between coastal and open ocean locations. While functional annotations of fosmid ORFs were limited, recruitment to NCBI's non-redundant “nr” database and publicly available single-cell genomes identified putative viruses infecting marine thaumarchaeal and SUP05 proteobacteria to provide potential host linkages with relevance to coupled biogeochemical cycling processes in OMZ waters. Taken together, these results highlight the power of coupled analyses of multiple sequence data types, such as viral metagenomic and fosmid sequence data with prokaryotic single cell genomes, to chart viral diversity, elucidate genomic and ecological contexts for previously unclassifiable viral sequences, and identify novel host interactions in natural and engineered ecosystems. PMID:25914678

  9. Endemic Poultry Viral Diseases 2016 Research Update

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Viral infections of the avian gastrointestinal tract negatively impact poultry production; however, determining the complex etiologies of the viral enteric diseases in poultry has been difficult. Project scientists are continuing to investigate the species specificity, molecular phylogenetics, and p...

  10. Canine viral enteritis. Recent developments.

    PubMed

    Pollock, R V; Carmichael, L

    1979-05-01

    Two apparently novel viral gastroenteritides of dogs were recognized in 1978: one caused by a parvo-like virus (CPV) and one by a corona-like virus (CCV). A rotavirus has also been tentatively associated with neonatal pup enteritis. Canine viral enteritis is characterized by a sudden onset of vomiting and diarrhea, rapid spread and high morbidity. Treatment is only supportive but must be initiated promptly. Infected animals should be isolated immediately; the extremely contagious nature of these diseases makes them difficult to contain. Feces from infected dogs appear to be the primary means of transmission. Sodium hypochlorite solutions (eg, Clorox) are recommended for disinfection. The development of effective vaccines is an immediate and pressing problem.

  11. [Recent acquisitions on viral hepatitis].

    PubMed

    Resti, M; Tucci, F; Vierucci, A

    1990-01-01

    In the last years the research on viral hepatitis let to better understand the biological, molecular, immunological and epidemiologic characteristics of the viruses that are responsible for hepatitis. The first studied virus was hepatitis B virus (HBv). The scientific attention is still, today, focused on that virus since new markers of infectivity and biological importance in early diagnosis and in disease evolution have been found. The most important result in the last years in the field of viral hepatitis has been, however, the identification of agents responsible for Non-A-Non-B hepatitis. Its epidemiology and clinical importance are discussed in the present paper. Virus C is the most important parenteral agent of NANB hepatitis. Its epidemiology in at risk populations and its role in post-transfusional and cryptogenetic hepatitis are here discussed. The research of new markers of HCV infection is today considered a main goal since the role of the only marker now available is still under discussion.

  12. Neutrophil Extracellular Traps Go Viral

    PubMed Central

    Schönrich, Günther; Raftery, Martin J.

    2016-01-01

    Neutrophils are the most numerous immune cells. Their importance as the first line of defense against bacterial and fungal pathogens is well described. In contrast, the role of neutrophils in controlling viral infections is less clear. Bacterial and fungal pathogens can stimulate neutrophils extracellular traps (NETs) in a process called NETosis. Although NETosis has previously been described as a special form of programmed cell death, there are forms of NET production that do not end with the demise of neutrophils. As an end result of NETosis, genomic DNA complexed with microbicidal proteins is expelled from neutrophils. These structures can kill pathogens or at least prevent their local spread within host tissue. On the other hand, disproportionate NET formation can cause local or systemic damage. Only recently, it was recognized that viruses can also induce NETosis. In this review, we discuss the mechanisms by which NETs are produced in the context of viral infection and how this may contribute to both antiviral immunity and immunopathology. Finally, we shed light on viral immune evasion mechanisms targeting NETs. PMID:27698656

  13. Recycling Endosomes and Viral Infection

    PubMed Central

    Vale-Costa, Sílvia; Amorim, Maria João

    2016-01-01

    Many viruses exploit specific arms of the endomembrane system. The unique composition of each arm prompts the development of remarkably specific interactions between viruses and sub-organelles. This review focuses on the viral–host interactions occurring on the endocytic recycling compartment (ERC), and mediated by its regulatory Ras-related in brain (Rab) GTPase Rab11. This protein regulates trafficking from the ERC and the trans-Golgi network to the plasma membrane. Such transport comprises intricate networks of proteins/lipids operating sequentially from the membrane of origin up to the cell surface. Rab11 is also emerging as a critical factor in an increasing number of infections by major animal viruses, including pathogens that provoke human disease. Understanding the interplay between the ERC and viruses is a milestone in human health. Rab11 has been associated with several steps of the viral lifecycles by unclear processes that use sophisticated diversified host machinery. For this reason, we first explore the state-of-the-art on processes regulating membrane composition and trafficking. Subsequently, this review outlines viral interactions with the ERC, highlighting current knowledge on viral-host binding partners. Finally, using examples from the few mechanistic studies available we emphasize how ERC functions are adjusted during infection to remodel cytoskeleton dynamics, innate immunity and membrane composition. PMID:27005655

  14. Pediatric Asthma and Viral Infection.

    PubMed

    Garcia-Garcia, M Luz; Calvo Rey, Cristina; Del Rosal Rabes, Teresa

    2016-05-01

    Respiratory viral infections, particularly respiratory syncytial virus (RSV) and rhinovirus, are the most importance risk factors for the onset of wheezing in infants and small children. Bronchiolitis is the most common acute respiratory infection in children under 1year of age, and the most common cause of hospitalization in this age group. RSV accounts for approximately 70% of all these cases, followed by rhinovirus, adenovirus, metapneumovirus and bocavirus. The association between bronchiolitis caused by RSV and the development of recurrent wheezing and/or asthma was first described more than 40years ago, but it is still unclear whether bronchiolitis causes chronic respiratory symptoms, or if it is a marker for children with a genetic predisposition for developing asthma in the medium or long term. In any case, sufficient evidence is available to corroborate the existence of this association, which is particularly strong when the causative agent of bronchiolitis is rhinovirus. The pathogenic role of respiratory viruses as triggers for exacerbations in asthmatic patients has not been fully characterized. However, it is clear that respiratory viruses, and in particular rhinovirus, are the most common causes of exacerbation in children, and some type of respiratory virus has been identified in over 90% of children hospitalized for an episode of wheezing. Changes in the immune response to viral infections in genetically predisposed individuals are very likely to be the main factors involved in the association between viral infection and asthma.

  15. Viral Hepatitis: Information for Gay and Bisexual Men

    MedlinePlus

    VIRAL HEPATITIS Information for Gay and Bisexual Men What is viral hepatitis? Viral hepatitis is an infection of the liver caused by ... United States, the most common types of viral hepatitis are Hepatitis A, Hepatitis B, and Hepatitis C. ...

  16. Hepatitis C viral protein translation: mechanisms and implications in developing antivirals.

    PubMed

    Hoffman, Brett; Liu, Qiang

    2011-11-01

    Hepatitis C viral protein translation occurs in a cap-independent manner through the use of an internal ribosomal entry site (IRES) present within the viral 5'-untranslated region. The IRES is composed of highly conserved structural domains that directly recruit the 40S ribosomal subunit to the viral genomic RNA. This frees the virus from relying on a large number of translation initiation factors that are required for cap-dependent translation, conferring a selective advantage to the virus especially in times when the availability of such factors is low. Although the mechanism of translation initiation on the Hepatitis C virus (HCV) IRES is well established, modulation of the HCV IRES activity by both cellular and viral factors is not well understood. As the IRES is essential in the HCV life cycle and as such remains well conserved in an otherwise highly heterogenic virus, the process of HCV protein translation represents an attractive target in the development of novel antivirals. This review will focus on the mechanisms of HCV protein translation and how this process is postulated to be modulated by cis-acting viral factors, as well as trans-acting viral and cellular factors. Numerous therapeutic approaches investigated in targeting HCV protein translation for the development of novel antivirals will also be discussed.

  17. Rabies Virus Infection Induces the Formation of Stress Granules Closely Connected to the Viral Factories

    PubMed Central

    Nikolic, Jovan; Civas, Ahmet; Lagaudrière-Gesbert, Cécile; Blondel, Danielle

    2016-01-01

    Stress granules (SGs) are membrane-less dynamic structures consisting of mRNA and protein aggregates that form rapidly in response to a wide range of environmental cellular stresses and viral infections. They act as storage sites for translationally silenced mRNAs under stress conditions. During viral infection, SG formation results in the modulation of innate antiviral immune responses, and several viruses have the ability to either promote or prevent SG assembly. Here, we show that rabies virus (RABV) induces SG formation in infected cells, as revealed by the detection of SG-marker proteins Ras GTPase-activating protein-binding protein 1 (G3BP1), T-cell intracellular antigen 1 (TIA-1) and poly(A)-binding protein (PABP) in the RNA granules formed during viral infection. As shown by live cell imaging, RABV-induced SGs are highly dynamic structures that increase in number, grow in size by fusion events, and undergo assembly/disassembly cycles. Some SGs localize in close proximity to cytoplasmic viral factories, known as Negri bodies (NBs). Three dimensional reconstructions reveal that both structures remain distinct even when they are in close contact. In addition, viral mRNAs synthesized in NBs accumulate in the SGs during viral infection, revealing material exchange between both compartments. Although RABV-induced SG formation is not affected in MEFs lacking TIA-1, TIA-1 depletion promotes viral translation which results in an increase of viral replication indicating that TIA-1 has an antiviral effect. Inhibition of PKR expression significantly prevents RABV-SG formation and favors viral replication by increasing viral translation. This is correlated with a drastic inhibition of IFN-B gene expression indicating that SGs likely mediate an antiviral response which is however not sufficient to fully counteract RABV infection. PMID:27749929

  18. Reverse transcriptase directs viral evolution in a deep ocean methane seep

    NASA Astrophysics Data System (ADS)

    Paul, B. G.; Bagby, S. C.

    2013-12-01

    Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.

  19. Viral vector-based tools advance knowledge of basal ganglia anatomy and physiology

    PubMed Central

    Sizemore, Rachel J.; Seeger-Armbruster, Sonja; Hughes, Stephanie M.

    2016-01-01

    Viral vectors were originally developed to deliver genes into host cells for therapeutic potential. However, viral vector use in neuroscience research has increased because they enhance interpretation of the anatomy and physiology of brain circuits compared with conventional tract tracing or electrical stimulation techniques. Viral vectors enable neuronal or glial subpopulations to be labeled or stimulated, which can be spatially restricted to a single target nucleus or pathway. Here we review the use of viral vectors to examine the structure and function of motor and limbic basal ganglia (BG) networks in normal and pathological states. We outline the use of viral vectors, particularly lentivirus and adeno-associated virus, in circuit tracing, optogenetic stimulation, and designer drug stimulation experiments. Key studies that have used viral vectors to trace and image pathways and connectivity at gross or ultrastructural levels are reviewed. We explain how optogenetic stimulation and designer drugs used to modulate a distinct pathway and neuronal subpopulation have enhanced our mechanistic understanding of BG function in health and pathophysiology in disease. Finally, we outline how viral vector technology may be applied to neurological and psychiatric conditions to offer new treatments with enhanced outcomes for patients. PMID:26888111

  20. Long noncoding RNAs in viral infections

    PubMed Central

    Fortes, Puri; Morris, Kevin

    2015-01-01

    Viral infections induce strong modifications in the cell transcriptome. Among the RNAs whose expression is altered by infection are long noncoding RNAs (lncRNAs). LncRNAs are transcripts with potential to function as RNA molecules. Infected cells may express viral lncRNAs, cellular lncRNAs and chimeric lncRNAs formed by viral and cellular sequences. Some viruses express viral lncRNAs whose function is essential for viral viability. They are transcribed by polymerase II or III and some of them can be processed by unique maturation steps performed by host cell machineries. Some viral lncRNAs control transcription, stability or translation of cellular and viral genes. Surprisingly, similar functions can be exerted by cellular lncRNAs induced by infection. Expression of cellular lncRNAs may be altered in response to viral replication or viral protein expression. However, many cellular lncRNAs respond to the antiviral pathways induced by infection. In fact, many lncRNAs function as positive or negative regulators of the innate antiviral response. Our current knowledge about the identity and function of lncRNAs in infected cells is very limited. However, research into this field has already helped in the identification of novel cellular pathways and may help in the development of therapeutic tools for the treatment of viral infections, autoimmune diseases, neurological disorders and cancer. PMID:26454188

  1. Viral diseases of marine invertebrates

    NASA Astrophysics Data System (ADS)

    Johnson, P. T.

    1984-03-01

    Approximately 40 viruses are known from marine sponges; turbellarian and monogenetic flatworms; cephalopod, bivalve, and gastropod mollusks; nereid polychaetes; and isopod and decapod crustaceans. Most of the viruses can be tentatively assigned to the Herpesviridae, Baculoviridae, Iridoviridae, Adenoviridae, Papovaviridae, Reoviridae, “Birnaviridae”, Bunyaviridae, Rhabdoviridae, and Picornaviridae. Viruslike particles found in oysters might be representatives of the Togaviridae and Retroviridae. Enveloped single-stranded RNA viruses from crustaceans have developmental and morphological characteristics intermediate between families, and some show evidence of relationships to the Paramyxoviridae as well as the Bunyaviridae or Rhabdoviridae. Certain small viruses of shrimp cannot be assigned, even tentatively, to a particular family. Some viruses cause disease in wild and captive hosts, others are associated with disease states but may not be primary instigators, and many occur in apparently normal animals. The frequency of viral disease in natural populations of marine invertebrates is unknown. Several viruses that cause disease in captive animals, with or without experimental intervention, have also been found in diseased wild hosts, including herpeslike viruses of crabs and oysters, iridovirus of octopus, and reolike and bunyalike viruses of crabs. Iridolike viruses have been implicated in massive mortalities of cultured oysters. Baculoviruses, and IHHN virus, which is of uncertain affinities, cause economically damaging diseases in cultured penaeid shrimp. Double or multiple viral infection is common in crabs. For example, a reolike virus and associated rhabdolike virus act synergistically to cause paralytic and fatal disease in Callinectes sapidus. Information on host range, most susceptible stage, and viral latency is available only for viruses of shrimp. One baculovirus attacks five species of New World penaeid shrimp. IHHN virus infects three species of

  2. [The ABC of viral hepatitis].

    PubMed

    Van Bambeke, F

    2008-03-01

    Viral hepatitis has long been under-diagnosed. Hepatitis A is an acute disease, while patients infected by hepatitis B and hepatitis C viruses are likely to develop chronical infections and severe complications (cancer, cirrhosis). The current treatment of hepatitis B and C consists in alpha interferon (preferably under its pegylated form), in combination with ribavirin for hepatitis C. The frequent and severe adverse effects of interferon-based therapy constitute, however, a major limiting factor (reactions at the injection site, flu-like syndrome, neurological disorders, ...). For hepatitis B, two alternatives are available so far, namely lamivudine and adefovir (used as a prodrug with highe oral bioavailability).

  3. Modulation techniques

    NASA Technical Reports Server (NTRS)

    Schilling, D. L.

    1982-01-01

    Bandwidth efficient digital modulation techniques, proposed for use on and/or applied to satellite channels, are reviewed. In a survey of recent works on digital modulation techniques, the performance of several schemes operating in various environments are compared. Topics covered include: (1) quadrature phase shift keying; (2) offset - QPSK and MSK; (3) combined modulation and coding; and (4) spectrally efficient modulation techniques.

  4. Viral Infection in Renal Transplant Recipients

    PubMed Central

    Cukuranovic, Jovana; Ugrenovic, Sladjana; Jovanovic, Ivan; Visnjic, Milan; Stefanovic, Vladisav

    2012-01-01

    Viruses are among the most common causes of opportunistic infection after transplantation. The risk for viral infection is a function of the specific virus encountered, the intensity of immune suppression used to prevent graft rejection, and other host factors governing susceptibility. Although cytomegalovirus is the most common opportunistic pathogen seen in transplant recipients, numerous other viruses have also affected outcomes. In some cases, preventive measures such as pretransplant screening, prophylactic antiviral therapy, or posttransplant viral monitoring may limit the impact of these infections. Recent advances in laboratory monitoring and antiviral therapy have improved outcomes. Studies of viral latency, reactivation, and the cellular effects of viral infection will provide clues for future strategies in prevention and treatment of viral infections. This paper will summarize the major viral infections seen following transplant and discuss strategies for prevention and management of these potential pathogens. PMID:22654630

  5. Membrane dynamics associated with viral infection.

    PubMed

    de Armas-Rillo, Laura; Valera, María-Soledad; Marrero-Hernández, Sara; Valenzuela-Fernández, Agustín

    2016-05-01

    Viral replication and spreading are fundamental events in the viral life cycle, accounting for the assembly and egression of nascent virions, events that are directly associated with viral pathogenesis in target hosts. These processes occur in cellular compartments that are modified by specialized viral proteins, causing a rearrangement of different cell membranes in infected cells and affecting the ER, mitochondria, Golgi apparatus, vesicles and endosomes, as well as processes such as autophagic membrane flux. In fact, the activation or inhibition of membrane trafficking and other related activities are fundamental to ensure the adequate replication and spreading of certain viruses. In this review, data will be presented that support the key role of membrane dynamics in the viral cycle, especially in terms of the assembly, egression and infection processes. By defining how viruses orchestrate these events it will be possible to understand how they successfully complete their route of infection, establishing viral pathogenesis and provoking disease.

  6. Population Dynamics of Viral Inactivation

    NASA Astrophysics Data System (ADS)

    Freeman, Krista; Li, Dong; Behrens, Manja; Streletzky, Kiril; Olsson, Ulf; Evilevitch, Alex

    We have investigated the population dynamics of viral inactivation in vitrousing time-resolved cryo electron microscopy combined with light and X-ray scattering techniques. Using bacteriophage λ as a model system for pressurized double-stranded DNA viruses, we found that virions incubated with their cell receptor eject their genome in a stochastic triggering process. The triggering of DNA ejection occurs in a non synchronized manner after the receptor addition, resulting in an exponential decay of the number of genome-filled viruses with time. We have explored the characteristic time constant of this triggering process at different temperatures, salt conditions, and packaged genome lengths. Furthermore, using the temperature dependence we determined an activation energy for DNA ejections. The dependences of the time constant and activation energy on internal DNA pressure, affected by salt conditions and encapsidated genome length, suggest that the triggering process is directly dependent on the conformational state of the encapsidated DNA. The results of this work provide insight into how the in vivo kinetics of the spread of viral infection are influenced by intra- and extra cellular environmental conditions. This material is based upon work supported by the National Science Foundation Graduate Research Fellowship under Grant No. DGE-1252522.

  7. Sequencing Needs for Viral Diagnostics

    SciTech Connect

    Gardner, S N; Lam, M; Mulakken, N J; Torres, C L; Smith, J R; Slezak, T

    2004-01-26

    We built a system to guide decisions regarding the amount of genomic sequencing required to develop diagnostic DNA signatures, which are short sequences that are sufficient to uniquely identify a viral species. We used our existing DNA diagnostic signature prediction pipeline, which selects regions of a target species genome that are conserved among strains of the target (for reliability, to prevent false negatives) and unique relative to other species (for specificity, to avoid false positives). We performed simulations, based on existing sequence data, to assess the number of genome sequences of a target species and of close phylogenetic relatives (''near neighbors'') that are required to predict diagnostic signature regions that are conserved among strains of the target species and unique relative to other bacterial and viral species. For DNA viruses such as variola (smallpox), three target genomes provide sufficient guidance for selecting species-wide signatures. Three near neighbor genomes are critical for species specificity. In contrast, most RNA viruses require four target genomes and no near neighbor genomes, since lack of conservation among strains is more limiting than uniqueness. SARS and Ebola Zaire are exceptional, as additional target genomes currently do not improve predictions, but near neighbor sequences are urgently needed. Our results also indicate that double stranded DNA viruses are more conserved among strains than are RNA viruses, since in most cases there was at least one conserved signature candidate for the DNA viruses and zero conserved signature candidates for the RNA viruses.

  8. Controlling viral outbreaks: Quantitative strategies

    PubMed Central

    2017-01-01

    Preparing for and responding to outbreaks of serious livestock infectious diseases are critical measures to safeguard animal health, public health, and food supply. Almost all of the current control strategies are empirical, and mass culling or “stamping out” is frequently the principal strategy for controlling epidemics. However, there are ethical, ecological, and economic reasons to consider less drastic control strategies. Here we use modeling to quantitatively study the efficacy of different control measures for viral outbreaks, where the infectiousness, transmissibility and death rate of animals commonly depends on their viral load. We develop a broad theoretical framework for exploring and understanding this heterogeneity. The model includes both direct transmission from infectious animals and indirect transmission from an environmental reservoir. We then incorporate a large variety of control measures, including vaccination, antivirals, isolation, environmental disinfection, and several forms of culling, which may result in fewer culled animals. We provide explicit formulae for the basic reproduction number, R0, for each intervention and for combinations. We evaluate the control methods for a realistic simulated outbreak of low pathogenic avian influenza on a mid-sized turkey farm. In this simulated outbreak, culling results in more total dead birds and dramatically more when culling all of the infected birds. PMID:28187137

  9. Role of CCL5 (RANTES) in viral lung disease.

    PubMed

    Culley, Fiona J; Pennycook, Alasdair M J; Tregoning, John S; Dodd, Jonathan S; Walzl, Gerhard; Wells, Timothy N; Hussell, Tracy; Openshaw, Peter J M

    2006-08-01

    CCL5/RANTES is a key proinflammatory chemokine produced by virus-infected epithelial cells and present in respiratory secretions of asthmatics. To examine the role of CCL5 in viral lung disease, we measured its production during primary respiratory syncytial virus (RSV) infection and during secondary infection after sensitizing vaccination that induces Th2-mediated eosinophilia. A first peak of CCL5 mRNA and protein production was seen at 18 to 24 h of RSV infection, before significant lymphocyte recruitment occurred. Treatment in vivo with Met-RANTES (a competitive chemokine receptor blocker) throughout primary infection decreased CD4+ and CD8+ cell recruitment and increased viral replication. In RSV-infected, sensitized mice with eosinophilic disease, CCL5 production was further augmented; Met-RANTES treatment again reduced inflammatory cell recruitment and local cytokine production. A second wave of CCL5 production occurred on day 7, attributable to newly recruited T cells. Paradoxically, mice treated with Met-RANTES during primary infection demonstrated increased cellular infiltration during reinfection. We therefore show that RSV induces CCL5 production in the lung and this causes the recruitment of RSV-specific cells, including those making additional CCL5. If this action is blocked with Met-RANTES, inflammation decreases and viral clearance is delayed. However, the exact effects of chemokine modulation depend critically on time of administration, a factor that may potentially complicate the use of chemokine blockers in inflammatory diseases.

  10. Assessing ubiquitination of viral proteins: lessons from flavivirus NS5

    PubMed Central

    Taylor, R. Travis; Best, Sonja M.

    2011-01-01

    Ubiquitin (Ub) conjugation to a substrate protein is a widely used cellular mechanism for control of protein stability and function, modulation of signal transduction pathways and antiviral responses. Identification and characterization of ubiquitinated viral proteins is an important step in understanding novel mechanisms of viral protein regulation as well as elucidating cellular antiviral strategies. Here we describe a protocol to easily detect and characterize the ubiquitination status of a viral substrate protein expressed either during infection or ectopically expressed as a fusion with a biotinylatable epitope tag. This tag provides advantages over current immunoprecipitation techniques by making use of the extremely tight biotin-streptavidin interaction. We provide an example of this protocol using the nonstructural protein 5 (NS5) from Langat virus (LGTV), a member of the tick-borne encephalitis virus (TBEV) serocomplex within the Flavivirus genus. Using the protocols outlined here, we describe some of the pitfalls inherent in determination of Ub linkage and demonstrate that NS5 is modified by at least two distinct ubiquitination types, multiubiquitination and K48-linked polyubiquitin chains. PMID:21855635

  11. Role of the innate immune system in acute viral myocarditis.

    PubMed

    Huang, Chien-Hua; Vallejo, Jesus G; Kollias, George; Mann, Douglas L

    2009-05-01

    Although the adaptive immune system is thought to play an important role in the pathogenesis of viral myocarditis, the role of the innate immune system has not been well defined. To address this deficiency, we employed a unique line of mice that harbor a genomic "knock in" of a mutated TNF gene lacking the AU rich element (TNF(ARE/ARE)) that is critical for TNF mRNA stability and translation, in order to examine the contribution of the innate immune system in encephalomyocarditis-induced myocarditis (EMCV). Heterozygous mice (TNF(ARE/+)) were infected with 500 plaque-forming units of EMCV. TNF(ARE/+)mice had a significantly higher 14-day mortality and myocardial inflammation when compared to littermate control mice. Virologic studies showed that the viral load at 14 days was significantly lower in the hearts of TNF(ARE/+) mice. TNF(ARE/+) mice had an exaggerated proinflammatory cytokine and chemokine response in the heart following EMCV infection. Modulation of the innate immune response in TNF(ARE/+) mice by the late administration of prednisolone resulted in a significant improvement in survival and decreased cardiac inflammation, whereas early administration of prednisolone resulted in a blunted innate response and increased mortality in littermate control mice. Viewed together, these data suggest that the duration and degree of activation of the innate immune system plays a critical role in determining host outcomes in experimental viral myocarditis.

  12. Assessing ubiquitination of viral proteins: Lessons from flavivirus NS5.

    PubMed

    Taylor, R Travis; Best, Sonja M

    2011-10-01

    Ubiquitin (Ub) conjugation to a substrate protein is a widely used cellular mechanism for control of protein stability and function, modulation of signal transduction pathways and antiviral responses. Identification and characterization of ubiquitinated viral proteins is an important step in understanding novel mechanisms of viral protein regulation as well as elucidating cellular antiviral strategies. Here we describe a protocol to easily detect and characterize the ubiquitination status of a viral substrate protein expressed either during infection or ectopically expressed as a fusion with a biotinylatable epitope tag. This tag provides advantages over current immunoprecipitation techniques by making use of the extremely tight biotin-streptavidin interaction. We provide an example of this protocol using the nonstructural protein 5 (NS5) from Langat virus (LGTV), a member of the tick-borne encephalitis virus (TBEV) serocomplex within the Flavivirus genus. Using the protocols outlined here, we describe some of the pitfalls inherent in determination of Ub linkage and demonstrate that NS5 is modified by at least two distinct ubiquitination types, multiubiquitination and K48-linked polyubiquitin chains.

  13. Mosquito defense strategies against viral infection

    PubMed Central

    Cheng, Gong; Liu, Yang; Wang, Penghua; Xiao, Xiaoping

    2015-01-01

    Mosquito-borne viral diseases are a major concern of global health and result in significant economic losses in many countries. As natural vectors, mosquitoes are very permissive to and allow systemic and persistent arbovirus infection. Intriguingly, persistent viral propagation in mosquito tissues neither results in dramatic pathological sequelae nor impairs the vectorial behavior or lifespan, indicating that mosquitoes have evolved mechanisms to tolerate persistent infection and developed efficient antiviral strategies to restrict viral replication to non-pathogenic levels. Here, we provide an overview of recent progress in understanding mosquito antiviral immunity and advances in the strategies by which mosquitoes control viral infection in specific tissues. PMID:26626596

  14. Iron withholding: a defense against viral infections.

    PubMed

    Weinberg, E D

    1996-10-01

    A variety of laboratory and clinical investigations during the past 15 years have observed that one of the dangers of excessive iron is its ability to favor animal viral infections. The metal is essential for host cell synthesis of virions and can also impair defense cell function and increase oxidative stress. In both animal models and humans, viral infections cause upregulation of the iron withholding defense system. Factors that suppress the system enhance viral progression; factors that strengthen the system augment host defense. Procedures designed to reinforce the system are being developed and tested; some of these may become useful adjuncts in prevention and management of viral diseases.

  15. FANCD2 Binds Human Papillomavirus Genomes and Associates with a Distinct Set of DNA Repair Proteins to Regulate Viral Replication

    PubMed Central

    Spriggs, Chelsey C.

    2017-01-01

    ABSTRACT The life cycle of human papillomavirus (HPV) is dependent on the differentiation state of its host cell. HPV genomes are maintained as low-copy episomes in basal epithelial cells and amplified to thousands of copies per cell in differentiated layers. Replication of high-risk HPVs requires the activation of the ataxia telangiectasia-mutated (ATM) and ATM and Rad3-related (ATR) DNA repair pathways. The Fanconi anemia (FA) pathway is a part of the DNA damage response and mediates cross talk between the ATM and ATR pathways. Our studies show that HPV activates the FA pathway, leading to the accumulation of a key regulatory protein, FANCD2, in large nuclear foci. These HPV-dependent foci colocalize with a distinct population of DNA repair proteins, including ATM components γH2AX and BRCA1, but infrequently with p-SMC1, which is required for viral genome amplification in differentiated cells. Furthermore, FANCD2 is found at viral replication foci, where it is preferentially recruited to viral genomes compared to cellular chromosomes and is required for maintenance of HPV episomes in undifferentiated cells. These findings identify FANCD2 as an important regulator of HPV replication and provide insight into the role of the DNA damage response in the differentiation-dependent life cycle of HPV. PMID:28196964

  16. DNA methyltransferase DNMT3A associates with viral proteins and impacts HSV-1 infection.

    PubMed

    Rowles, Daniell L; Tsai, Yuan-Chin; Greco, Todd M; Lin, Aaron E; Li, Minghao; Yeh, Justin; Cristea, Ileana M

    2015-06-01

    Viral infections can alter the cellular epigenetic landscape, through modulation of either DNA methylation profiles or chromatin remodeling enzymes and histone modifications. These changes can act to promote viral replication or host defense. Herpes simplex virus type 1 (HSV-1) is a prominent human pathogen, which relies on interactions with host factors for efficient replication and spread. Nevertheless, the knowledge regarding its modulation of epigenetic factors remains limited. Here, we used fluorescently-labeled viruses in conjunction with immunoaffinity purification and MS to study virus-virus and virus-host protein interactions during HSV-1 infection in primary human fibroblasts. We identified interactions among viral capsid and tegument proteins, detecting phosphorylation of the capsid protein VP26 at sites within its UL37-binding domain, and an acetylation within the major capsid protein VP5. Interestingly, we found a nuclear association between viral capsid proteins and the de novo DNA methyltransferase DNA (cytosine-5)-methyltransferase 3A (DNMT3A), which we confirmed by reciprocal isolations and microscopy. We show that drug-induced inhibition of DNA methyltransferase activity, as well as siRNA- and shRNA-mediated DNMT3A knockdowns trigger reductions in virus titers. Altogether, our results highlight a functional association of viral proteins with the mammalian DNA methyltransferase machinery, pointing to DNMT3A as a host factor required for effective HSV-1 infection.

  17. Actin-binding Protein Drebrin Regulates HIV-1-triggered Actin Polymerization and Viral Infection*

    PubMed Central

    Gordón-Alonso, Mónica; Rocha-Perugini, Vera; Álvarez, Susana; Ursa, Ángeles; Izquierdo-Useros, Nuria; Martinez-Picado, Javier; Muñoz-Fernández, María A.; Sánchez-Madrid, Francisco

    2013-01-01

    HIV-1 contact with target cells triggers F-actin rearrangements that are essential for several steps of the viral cycle. Successful HIV entry into CD4+ T cells requires actin reorganization induced by the interaction of the cellular receptor/co-receptor complex CD4/CXCR4 with the viral envelope complex gp120/gp41 (Env). In this report, we analyze the role of the actin modulator drebrin in HIV-1 viral infection and cell to cell fusion. We show that drebrin associates with CXCR4 before and during HIV infection. Drebrin is actively recruited toward cell-virus and Env-driven cell to cell contacts. After viral internalization, drebrin clustering is retained in a fraction of the internalized particles. Through a combination of RNAi-based inhibition of endogenous drebrin and GFP-tagged expression of wild-type and mutant forms, we establish drebrin as a negative regulator of HIV entry and HIV-mediated cell fusion. Down-regulation of drebrin expression promotes HIV-1 entry, decreases F-actin polymerization, and enhances profilin local accumulation in response to HIV-1. These data underscore the negative role of drebrin in HIV infection by modulating viral entry, mainly through the control of actin cytoskeleton polymerization in response to HIV-1. PMID:23926103

  18. Viral haemorrhagic fever in children.

    PubMed

    MacDermott, Nathalie E; De, Surjo; Herberg, Jethro A

    2016-05-01

    Viral haemorrhagic fevers (VHFs) are currently at the forefront of the world's attention due to the recent Zaire ebola virus epidemic in West Africa. This epidemic has highlighted the frailty of the world's public health response mechanisms and demonstrated the potential risks to nations around the world of imported cases of epidemic diseases. While imported cases in children are less likely, the potential for such a scenario remains. It is therefore essential that paediatricians are aware of and prepared for potential imported cases of tropical diseases, VHFs being of particular importance due to their propensity to cause nosocomial spread. Examining the four families of viruses--Filoviridae, Arenaviridae, Bunyaviridae and Flaviviridae--we describe the different types of VHFs, with emphasis on differentiation from other diseases through detailed history-taking, their presentation and management from a paediatric perspective.

  19. Addressing viral resistance through vaccines

    PubMed Central

    Laughlin, Catherine; Schleif, Amanda; Heilman, Carole A

    2015-01-01

    Antimicrobial resistance is a serious healthcare concern affecting millions of people around the world. Antiviral resistance has been viewed as a lesser threat than antibiotic resistance, but it is important to consider approaches to address this growing issue. While vaccination is a logical strategy, and has been shown to be successful many times over, next generation viral vaccines with a specific goal of curbing antiviral resistance will need to clear several hurdles including vaccine design, evaluation and implementation. This article suggests that a new model of vaccination may need to be considered: rather than focusing on public health, this model would primarily target sectors of the population who are at high risk for complications from certain infections. PMID:26604979

  20. Viral Ancestors of Antiviral Systems

    PubMed Central

    Villarreal, Luis P.

    2011-01-01

    All life must survive their corresponding viruses. Thus antiviral systems are essential in all living organisms. Remnants of virus derived information are also found in all life forms but have historically been considered mostly as junk DNA. However, such virus derived information can strongly affect host susceptibility to viruses. In this review, I evaluate the role viruses have had in the origin and evolution of host antiviral systems. From Archaea through bacteria and from simple to complex eukaryotes I trace the viral components that became essential elements of antiviral immunity. I conclude with a reexamination of the ‘Big Bang’ theory for the emergence of the adaptive immune system in vertebrates by horizontal transfer and note how viruses could have and did provide crucial and coordinated features. PMID:22069523

  1. Structure unifies the viral universe.

    PubMed

    Abrescia, Nicola G A; Bamford, Dennis H; Grimes, Jonathan M; Stuart, David I

    2012-01-01

    Is it possible to meaningfully comprehend the diversity of the viral world? We propose that it is. This is based on the observation that, although there is immense genomic variation, every infective virion is restricted by strict constraints in structure space (i.e., there are a limited number of ways to fold a protein chain, and only a small subset of these have the potential to construct a virion, the hallmark of a virus). We have previously suggested the use of structure for the higher-order classification of viruses, where genomic similarities are no longer observable. Here, we summarize the arguments behind this proposal, describe the current status of structural work, highlighting its power to infer common ancestry, and discuss the limitations and obstacles ahead of us. We also reflect on the future opportunities for a more concerted effort to provide high-throughput methods to facilitate the large-scale sampling of the virosphere.

  2. Viral ancestors of antiviral systems.

    PubMed

    Villarreal, Luis P

    2011-10-01

    All life must survive their corresponding viruses. Thus antiviral systems are essential in all living organisms. Remnants of virus derived information are also found in all life forms but have historically been considered mostly as junk DNA. However, such virus derived information can strongly affect host susceptibility to viruses. In this review, I evaluate the role viruses have had in the origin and evolution of host antiviral systems. From Archaea through bacteria and from simple to complex eukaryotes I trace the viral components that became essential elements of antiviral immunity. I conclude with a reexamination of the 'Big Bang' theory for the emergence of the adaptive immune system in vertebrates by horizontal transfer and note how viruses could have and did provide crucial and coordinated features.

  3. The V3 Loop of HIV-1 Env Determines Viral Susceptibility to IFITM3 Impairment of Viral Infectivity.

    PubMed

    Wang, Yimeng; Pan, Qinghua; Ding, Shilei; Wang, Zhen; Yu, Jingyou; Finzi, Andrés; Liu, Shan-Lu; Liang, Chen

    2017-04-01

    Interferon-inducible transmembrane proteins (IFITMs) inhibit a broad spectrum of viruses, including HIV-1. IFITM proteins deter HIV-1 entry when expressed in target cells and also impair HIV-1 infectivity when expressed in virus producer cells. However, little is known about how viruses resist IFITM inhibition. In this study, we have investigated the susceptibilities of different primary isolates of HIV-1 to the inhibition of viral infectivity by IFITMs. Our results demonstrate that the infectivity of different HIV-1 primary isolates, including transmitted founder viruses, is diminished by IFITM3 to various levels, with strain AD8-1 exhibiting strong resistance. Further mutagenesis studies revealed that HIV-1 Env, and the V3 loop sequence in particular, determines the extent of inhibition of viral infectivity by IFITM3. IFITM3-sensitive Env proteins are also more susceptible to neutralization by soluble CD4 or the 17b antibody than are IFITM3-resistant Env proteins. Together, data from our study suggest that the propensity of HIV-1 Env to sample CD4-bound-like conformations modulates viral sensitivity to IFITM3 inhibition.IMPORTANCE Results of our study have revealed the key features of the HIV-1 envelope protein that are associated with viral resistance to the IFITM3 protein. IFITM proteins are important effectors in interferon-mediated antiviral defense. A variety of viruses are inhibited by IFITMs at the virus entry step. Although it is known that envelope proteins of several different viruses resist IFITM inhibition, the detailed mechanisms are not fully understood. Taking advantage of the fact that envelope proteins of different HIV-1 strains exhibit different degrees of resistance to IFITM3 and that these HIV-1 envelope proteins share the same domain structure and similar sequences, we performed mutagenesis studies and determined the key role of the V3 loop in this viral resistance phenotype. We were also able to associate viral resistance to IFITM3

  4. Uncovering Viral Protein-Protein Interactions and their Role in Arenavirus Life Cycle

    PubMed Central

    Loureiro, Maria Eugenia; D’Antuono, Alejandra; Levingston Macleod, Jesica M.; López, Nora

    2012-01-01

    The Arenaviridae family includes widely distributed pathogens that cause severe hemorrhagic fever in humans. Replication and packaging of their single-stranded RNA genome involve RNA recognition by viral proteins and a number of key protein-protein interactions. Viral RNA synthesis is directed by the virus-encoded RNA dependent-RNA polymerase (L protein) and requires viral RNA encapsidation by the Nucleoprotein. In addition to the role that the interaction between L and the Nucleoprotein may have in the replication process, polymerase activity appears to be modulated by the association between L and the small multifunctional Z protein. Z is also a structural component of the virions that plays an essential role in viral morphogenesis. Indeed, interaction of the Z protein with the Nucleoprotein is critical for genome packaging. Furthermore, current evidence suggests that binding between Z and the viral envelope glycoprotein complex is required for virion infectivity, and that Z homo-oligomerization is an essential step for particle assembly and budding. Efforts to understand the molecular basis of arenavirus life cycle have revealed important details on these viral protein-protein interactions that will be reviewed in this article. PMID:23170177

  5. Macrophages and the Viral Dissemination Super Highway

    PubMed Central

    Klepper, Arielle; Branch, Andrea D

    2016-01-01

    Monocytes and macrophages are key components of the innate immune system yet they are often the victims of attack by infectious agents. This review examines the significance of viral infection of macrophages. The central hypothesis is that macrophage tropism enhances viral dissemination and persistence, but these changes may come at the cost of reduced replication in cells other than macrophages. PMID:26949751

  6. Viral kinetic modeling: state of the art

    SciTech Connect

    Canini, Laetitia; Perelson, Alan S.

    2014-06-25

    Viral kinetic modeling has led to increased understanding of the within host dynamics of viral infections and the effects of therapy. Here we review recent developments in the modeling of viral infection kinetics with emphasis on two infectious diseases: hepatitis C and influenza. We review how viral kinetic modeling has evolved from simple models of viral infections treated with a drug or drug cocktail with an assumed constant effectiveness to models that incorporate drug pharmacokinetics and pharmacodynamics, as well as phenomenological models that simply assume drugs have time varying-effectiveness. We also discuss multiscale models that include intracellular events in viral replication, models of drug-resistance, models that include innate and adaptive immune responses and models that incorporate cell-to-cell spread of infection. Overall, viral kinetic modeling has provided new insights into the understanding of the disease progression and the modes of action of several drugs. In conclusion, we expect that viral kinetic modeling will be increasingly used in the coming years to optimize drug regimens in order to improve therapeutic outcomes and treatment tolerability for infectious diseases.

  7. Molecular biology of bovine viral diarrhea virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bovine viral diarrhea viruses (BVDV) are arguably the most important viral pathogen of ruminants worldwide and can cause severe economic loss. Clinical symptoms of the disease caused by BVDV range from subclinical to severe acute hemorrhagic syndrome, with the severity of disease being strain depend...

  8. Origins and challenges of viral dark matter.

    PubMed

    Krishnamurthy, Siddharth R; Wang, David

    2017-02-09

    The accurate classification of viral dark matter - metagenomic sequences that originate from viruses but do not align to any reference virus sequences - is one of the major obstacles in comprehensively defining the virome. Depending on the sample, viral dark matter can make up from anywhere between 40 and 90% of sequences. This review focuses on the specific nature of dark matter as it relates to viral sequences. We identify three factors that contribute to the existence of viral dark matter: the divergence and length of virus sequences, the limitations of alignment based classification, and limited representation of viruses in reference sequence databases. We then discuss current methods that have been developed to at least partially circumvent these limitations and thereby reduce the extent of viral dark matter.

  9. Non-random patterns in viral diversity.

    PubMed

    Anthony, Simon J; Islam, Ariful; Johnson, Christine; Navarrete-Macias, Isamara; Liang, Eliza; Jain, Komal; Hitchens, Peta L; Che, Xiaoyu; Soloyvov, Alexander; Hicks, Allison L; Ojeda-Flores, Rafael; Zambrana-Torrelio, Carlos; Ulrich, Werner; Rostal, Melinda K; Petrosov, Alexandra; Garcia, Joel; Haider, Najmul; Wolfe, Nathan; Goldstein, Tracey; Morse, Stephen S; Rahman, Mahmudur; Epstein, Jonathan H; Mazet, Jonna K; Daszak, Peter; Lipkin, W Ian

    2015-09-22

    It is currently unclear whether changes in viral communities will ever be predictable. Here we investigate whether viral communities in wildlife are inherently structured (inferring predictability) by looking at whether communities are assembled through deterministic (often predictable) or stochastic (not predictable) processes. We sample macaque faeces across nine sites in Bangladesh and use consensus PCR and sequencing to discover 184 viruses from 14 viral families. We then use network modelling and statistical null-hypothesis testing to show the presence of non-random deterministic patterns at different scales, between sites and within individuals. We show that the effects of determinism are not absolute however, as stochastic patterns are also observed. In showing that determinism is an important process in viral community assembly we conclude that it should be possible to forecast changes to some portion of a viral community, however there will always be some portion for which prediction will be unlikely.

  10. Non-random patterns in viral diversity

    PubMed Central

    Anthony, Simon J.; Islam, Ariful; Johnson, Christine; Navarrete-Macias, Isamara; Liang, Eliza; Jain, Komal; Hitchens, Peta L.; Che, Xiaoyu; Soloyvov, Alexander; Hicks, Allison L.; Ojeda-Flores, Rafael; Zambrana-Torrelio, Carlos; Ulrich, Werner; Rostal, Melinda K.; Petrosov, Alexandra; Garcia, Joel; Haider, Najmul; Wolfe, Nathan; Goldstein, Tracey; Morse, Stephen S.; Rahman, Mahmudur; Epstein, Jonathan H.; Mazet, Jonna K.; Daszak, Peter; Lipkin, W. Ian

    2015-01-01

    It is currently unclear whether changes in viral communities will ever be predictable. Here we investigate whether viral communities in wildlife are inherently structured (inferring predictability) by looking at whether communities are assembled through deterministic (often predictable) or stochastic (not predictable) processes. We sample macaque faeces across nine sites in Bangladesh and use consensus PCR and sequencing to discover 184 viruses from 14 viral families. We then use network modelling and statistical null-hypothesis testing to show the presence of non-random deterministic patterns at different scales, between sites and within individuals. We show that the effects of determinism are not absolute however, as stochastic patterns are also observed. In showing that determinism is an important process in viral community assembly we conclude that it should be possible to forecast changes to some portion of a viral community, however there will always be some portion for which prediction will be unlikely. PMID:26391192

  11. Ethical Considerations in Research Participation Virality.

    PubMed

    Ellis-Barton, Carol

    2016-07-01

    This article seeks to commence and encourage discussion around the upcoming ethical challenges of virality in network structures. When the call for participation in a research project on lupus in Ireland went from an advertisement in a newsletter to a meme (unit of transmissible information) on a closed Facebook page, the ethical considerations of virality were raised. The article analyzes the Association of Internet Researchers guidelines, Facebook policies, and the context of privacy in relation to virality. Virality creates the leverage for methodological pluralism. The nature of the inquiry can determine the method rather than the other way around. Viral ethical considerations are evolving due to the cyber world becoming the primary meme of communication, with flexibility in the researcher's protocol providing opportunities for efficient, cost-effective, and diverse recruitment.

  12. HTLV-1 Rex is required for viral spread and persistence in vivo but is dispensable for cellular immortalization in vitro.

    PubMed

    Ye, Jianxin; Silverman, Lee; Lairmore, Michael D; Green, Patrick L

    2003-12-01

    Human T-cell leukemia virus type 1 (HTLV-1) is associated with leukemia/lymphoma and neurologic disorders. Although the viral transcriptional activator Tax is the critical viral oncoprotein, Rex, which regulates the expression of the viral structural and enzymatic genes, is essential for efficient viral replication. Herein, we investigate the contribution of Rex in HTLV-1 immortalization of primary T cells in vitro and viral survival in an infectious rabbit animal model. A Rex-deficient HTLV-1 (HTLVRex-) was constructed and characterized for viral gene expression, protein production, and immortalization capacity. Cells transiently transfected with the HTLVRex- proviral clone produced low detectable levels of p19 Gag. 729HTLVRex- stable transfectants produced functional Tax, but undetectable levels of Rex or p19 Gag. Coculture of irradiated 729HTLVRex- cells with peripheral blood mononuclear cells (PBMCs) resulted in sustained interleukin-2 (IL-2)-dependent growth of primary T lymphocytes. These cells carried the HTLVRex- genome and expressed tax/rex mRNA but produced no detectable Rex or p19 Gag. Rabbits inoculated with irradiated 729HTLVRex- cells or 729HTLVRex- cells transiently transfected with a Rex cDNA expression plasmid failed to become persistently infected or mount a detectable antibody response to the viral gene products. Together, our results provide the first direct evidence that Rex and its function to modulate viral gene expression and virion production is not required for in vitro immortalization by HTLV-1. However, Rex is critical for efficient infection of cells and persistence in vivo.

  13. [Viral hepatitis of enteric origin].

    PubMed

    Debord, T; Buisson, Y

    1998-01-01

    Hepatitis viruses of oral-fecal origin are responsible for a high morbidity and mortality throughout the world, even if they never result in chronic hepatitis. Two viruses, the virus of hepatitis A (VHA) and of hepatitis E (VHE) are at present the cause of severe viral hepatitis of enteric origin. Water is the principle vector in the spread of these viruses. However, the epidemiological aspects vary according to the pathogenic agent. VHA is excreted in a highly concentrated form in the feces for a relatively short period of time. Since it resists in an exterior environment, the virus remains infectious for a long time. VHE is excreted for a short period of time and in low concentrations. The viral particles are fragile in vitro and their variability in the environment is little known. The possible reservoir role of certain animals has been envisaged. Epidemics arise especially in countries suffering from poor hygiene and massive water pollution. Hepatitis A should no longer be considered a benign disease of childhood. The progress made in hygiene and economic development in industrialized countries have made contacts with this virus scarce, rendering the populations more receptive to it and epidemics more widespread. When the sickness occurs later in life, infection is more often symptomatic and can be serious, resulting sometimes long-term indisposition. Hepatitis E has a vast distribution throughout the world and manifests itself either in epidemic or endemic-sporadic form in many poor countries. In developed countries, it comes about mostly as a result of imported pathology, even if there exists a "substratum" of infection in these areas. The main clinical aspects, such as we were able to study them in 39 cases of military men from Tchad, Guyana and Somalia, are comparable to those of hepatitis A. The reasons for the particular gravity of symptoms in pregnant women are unknown. These affections have no specific treatment. In the field of prevention, vaccination

  14. Module Configuration

    DOEpatents

    Oweis, Salah; D'Ussel, Louis; Chagnon, Guy; Zuhowski, Michael; Sack, Tim; Laucournet, Gaullume; Jackson, Edward J.

    2002-06-04

    A stand alone battery module including: (a) a mechanical configuration; (b) a thermal management configuration; (c) an electrical connection configuration; and (d) an electronics configuration. Such a module is fully interchangeable in a battery pack assembly, mechanically, from the thermal management point of view, and electrically. With the same hardware, the module can accommodate different cell sizes and, therefore, can easily have different capacities. The module structure is designed to accommodate the electronics monitoring, protection, and printed wiring assembly boards (PWAs), as well as to allow airflow through the module. A plurality of modules may easily be connected together to form a battery pack. The parts of the module are designed to facilitate their manufacture and assembly.

  15. Lactoferrin for prevention of common viral infections.

    PubMed

    Wakabayashi, Hiroyuki; Oda, Hirotsugu; Yamauchi, Koji; Abe, Fumiaki

    2014-11-01

    Although lactoferrin has many biological functions, the host-protective effects against pathogenic microorganisms including bacteria, fungi, and viruses are regarded as one of the most important. Here, we review research on the protective role of lactoferrin administration against common viral infections. Many studies have shown the in vitro antiviral activity of lactoferrin against viral pathogens that cause common infections such as the common cold, influenza, gastroenteritis, summer cold, and herpes, where lactoferrin inhibits mainly viral attachment to the target cells. Recently, studies indicating the in vivo protective effects of lactoferrin by oral administration against common viral infections have been increasing. For instance, norovirus is an extremely important emerging human pathogen that causes a majority of gastroenteritis outbreaks worldwide that may be a target candidate for lactoferrin. Lactoferrin consumption reduced the incidence of noroviral gastroenteritis in children and a similar effect was observed in a wide range of ages in a preliminary survey. A recent in vitro study reported that lactoferrin inhibits both cellular attachment of the murine norovirus, a virus closely-related to the human norovirus, and viral replication in the cells by inducing antiviral cytokines interferon (IFN)-α/β. Lactoferrin administration also enhances NK cell activity and Th1 cytokine responses, which lead to protection against viral infections. In conclusion, lactoferrin consumption may protect the host from viral infections through inhibiting the attachment of a virus to the cells, replication of the virus in the cells, and enhancement of systemic immune functions.

  16. Viral kinetic modeling: state of the art

    DOE PAGES

    Canini, Laetitia; Perelson, Alan S.

    2014-06-25

    Viral kinetic modeling has led to increased understanding of the within host dynamics of viral infections and the effects of therapy. Here we review recent developments in the modeling of viral infection kinetics with emphasis on two infectious diseases: hepatitis C and influenza. We review how viral kinetic modeling has evolved from simple models of viral infections treated with a drug or drug cocktail with an assumed constant effectiveness to models that incorporate drug pharmacokinetics and pharmacodynamics, as well as phenomenological models that simply assume drugs have time varying-effectiveness. We also discuss multiscale models that include intracellular events in viralmore » replication, models of drug-resistance, models that include innate and adaptive immune responses and models that incorporate cell-to-cell spread of infection. Overall, viral kinetic modeling has provided new insights into the understanding of the disease progression and the modes of action of several drugs. In conclusion, we expect that viral kinetic modeling will be increasingly used in the coming years to optimize drug regimens in order to improve therapeutic outcomes and treatment tolerability for infectious diseases.« less

  17. Immunological techniques in viral hepatitis.

    PubMed

    Rehermann, Barbara; Naoumov, Nikolai V

    2007-03-01

    The need to quantitate and monitor immune responses of large patient cohorts with standardized techniques is increasing due to the growing range of treatment options for hepatitis B and hepatitis C, the development of combination therapies, and candidate experimental vaccines for HCV. In addition, advances in immunological techniques have provided new tools for detailed phenotypic and functional analysis of cellular immune responses. At present, there is substantial variation in laboratory protocols, reagents, controls and analysis and presentation of results. Standardization of immunological assays would therefore allow better comparison of results amongst individual laboratories and patient cohorts. The EASL-sponsored and AASLD-endorsed Monothematic Conference on Clinical Immunology in Viral Hepatitis was held at the University College London, United Kingdom, Oct 7-8, 2006 to bring together investigators with research experience in clinical immunology of hepatitis B virus (HBV) and hepatitis C virus (HCV) infections for in-depth discussion, critical evaluation and standardization of immunological assays. This report summarizes the information presented and discussed at the conference, but is not intended to represent a consensus statement. Our aim is to highlight topics and issues that were supported by general agreement and those that were controversial, as well as to provide suggestions for future work.

  18. Ebola viral disease and pregnancy

    PubMed Central

    Caluwaerts, Séverine; Achar, Jay

    2015-01-01

    Ebola viral disease’s interaction with pregnancy is poorly understood and remains a particular challenge for medical and para-medical personnel responding to an outbreak. This review article is written with the benefit of hindsight and experience from the largest recorded Ebola outbreak in history. We have provided a broad overview of the issues that arise for pregnant women and for the professionals treating them during an Ebola outbreak. The discussion focuses on the specifics of Ebola infection in pregnancy and possible management strategies, including the delivery of an infected woman. We have also discussed the wider challenges posed to pregnant women and their carers during an epidemic, including the identification of suspected Ebola-infected pregnant women and the impact of the disease on pre-existing health services. This paper outlines current practices in the field, as well as highlighting the gaps in our knowledge and the paramount need to protect the health-care workers directly involved in the management of pregnant women. PMID:26457118

  19. [Treatment of viral hepatitis C].

    PubMed

    Chassany, O

    1996-12-14

    Viral hepatitis C is a serious public health problem in France by the number of infected patients, the evolutive profile and by the lack of fully efficient therapeutics. However, the risk of developing cirrhosis and hepatocellular carcinoma may not be so high as it has been stated until now. Interferon alpha is at the present time, the only approved drug for the treatment of chronic hepatitis C. Its efficiency on criteria such as normalization of aminotransferases values or negativation of viremia is obtained in less than 25% of patients. The present recommendation is to use 3 MU of interferon alpha, 3 times per week during 12 months. While interferon leads to improvement of histologic lesions, it is not yet proved that a treatment by interferon can reduce, years after, the incidence of cirrhosis and hepatocellular carcinoma. No therapeutic strategy has been defined yet for the frequent situations of "no response", relapses or presence of factors that reduce the efficacy of treatment (high initial viremia level, genotype 1b, cirrhosis). It is possible that the course of patients having low or no elevation of aminotransferases and/or minimal histologic lesions, is good without any treatment. The efficacy of interferon alone appears insufficient. Thus trials in progress concern associations of antiviral drugs such as vidarabine. In lack of vaccine, preventive treatment is essential and depends upon knowledge of conditions of transmission of the virus. Transmission through blood and intravenous drug addiction represent 60 to 70% of cases of hepatitis C.

  20. Alpha-Synuclein Expression Restricts RNA Viral Infections in the Brain

    PubMed Central

    Beatman, Erica L.; Massey, Aaron; Shives, Katherine D.; Burrack, Kristina S.; Chamanian, Mastooreh; Morrison, Thomas E.

    2015-01-01

    ABSTRACT We have discovered that native, neuronal expression of alpha-synuclein (Asyn) inhibits viral infection, injury, and disease in the central nervous system (CNS). Enveloped RNA viruses, such as West Nile virus (WNV), invade the CNS and cause encephalitis, yet little is known about the innate neuron-specific inhibitors of viral infections in the CNS. Following WNV infection of primary neurons, we found that Asyn protein expression is increased. The infectious titer of WNV and Venezuelan equine encephalitis virus (VEEV) TC83 in the brains of Asyn-knockout mice exhibited a mean increase of 104.5 infectious viral particles compared to the titers in wild-type and heterozygote littermates. Asyn-knockout mice also exhibited significantly increased virus-induced mortality compared to Asyn heterozygote or homozygote control mice. Virus-induced Asyn localized to perinuclear, neuronal regions expressing viral envelope protein and the endoplasmic reticulum (ER)-associated trafficking protein Rab1. In Asyn-knockout primary neuronal cultures, the levels of expression of ER signaling pathways, known to support WNV replication, were significantly elevated before and during viral infection compared to those in Asyn-expressing primary neuronal cultures. We propose a model in which virus-induced Asyn localizes to ER-derived membranes, modulates virus-induced ER stress signaling, and inhibits viral replication, growth, and injury in the CNS. These data provide a novel and important functional role for the expression of native alpha-synuclein, a protein that is closely associated with the development of Parkinson's disease. IMPORTANCE Neuroinvasive viruses such as West Nile virus are able to infect neurons and cause severe disease, such as encephalitis, or infection of brain tissue. Following viral infection in the central nervous system, only select neurons are infected, implying that neurons exhibit innate resistance to viral infections. We discovered that native neuronal

  1. A skeptical look at viral immune evasion.

    PubMed

    Davis, I A; Rouse, B T

    1997-12-01

    In the past several years, many viral gene products have been found to encode proteins which interfere with immune defense mechanisms. Whether these interactions between virus and immune system components are actually evasion mechanisms used during viral infections in their natural hosts remains to be proven. In vitro studies do, however, reveal several tactics which may aid viral replication and dissemination by interfering with components of both the innate and adaptive immune systems. In this manuscript, we discuss the more intensively studied of these putative in vitro evasion tactics and ponder their relevance in in vivo situations.

  2. Vaccines in the Prevention of Viral Pneumonia.

    PubMed

    Fraser, Clementine S; Jha, Akhilesh; Openshaw, Peter J M

    2017-03-01

    Pneumonia is of great global public health importance. Viral infections play both direct and indirect parts in its cause across the globe. Influenza is a leading cause of viral pneumonia in both children and adults, and respiratory syncytial virus is increasingly recognized as causing disease at both extremes of age. Vaccination offers the best prospect for prevention but current influenza vaccines do not provide universal and durable protection, and require yearly reformulation. In the future, it is hoped that influenza vaccines will give better and universal protection, and that new vaccines can be found for other causes of viral pneumonia.

  3. Some vexations that challenge viral immunology

    PubMed Central

    Rouse, Barry T.; Mueller, Scott N.

    2016-01-01

    The field of viral immunology seeks to understand mechanisms of virus-host interaction with a view of applying this knowledge to the design of effective vaccines and immunomodulators that control viral infections. This brief review discusses several areas of the field that hold substantial promise for translation, but where further work is critically required to find solutions. We emphasize that our fundamental understanding of virus-host relationships is moving in leaps and bounds, but we lag behind in applying this knowledge to the successful control of many viral infections. PMID:27303640

  4. Viral Evasion of Natural Killer Cell Activation.

    PubMed

    Ma, Yi; Li, Xiaojuan; Kuang, Ersheng

    2016-04-12

    Natural killer (NK) cells play a key role in antiviral innate defenses because of their abilities to kill infected cells and secrete regulatory cytokines. Additionally, NK cells exhibit adaptive memory-like antigen-specific responses, which represent a novel antiviral NK cell defense mechanism. Viruses have evolved various strategies to evade the recognition and destruction by NK cells through the downregulation of the NK cell activating receptors. Here, we review the recent findings on viral evasion of NK cells via the impairment of NK cell-activating receptors and ligands, which provide new insights on the relationship between NK cells and viral actions during persistent viral infections.

  5. Limiting influenza virus, HIV and dengue virus infection by targeting viral proteostasis

    PubMed Central

    Heaton, Nicholas S.; Moshkina, Natasha; Fenouil, Romain; Gardner, Thomas J.; Aguirre, Sebastian; Shah, Priya S.; Zhao, Nan; Manganaro, Lara; Hultquist, Judd; Noel, Justine; Sachs, David; Hamilton, Jennifer; Leon, Paul E.; Chawdury, Amit; Tripathy, Shashank; Melegari, Camilla; Campisi, Laura; Hai, Rong; Metreveli, Giorgi; Gamarnik, Andrea V.; García-Sastre, Adolfo; Greenbaum, Benjamin; Simon, Viviana; Fernandez-Sesma, Ana; Krogan, Nevan; Mulder, Lubbertus C.F.; van Bakel, Harm; Tortorella, Domenico; Taunton, Jack; Palese, Peter; Marazzi, Ivan

    2016-01-01

    Viruses are obligate parasites as they require the machinery of the host cell to replicate. Inhibition of host factors co-opted during active infection is a strategy to suppress viral replication and a potential pan antiviral therapy. To define the cellular proteins and processes required for a virus during infection is thus crucial to understanding the mechanisms of virally induced disease. In this report, we generated fully infectious tagged influenza viruses and used infection-based proteomics to identify pivotal arms of cellular signaling required for influenza virus growth and infectivity. Using mathematical modeling, genetic, and pharmacologic approaches, we revealed that modulation of Sec61-mediated cotranslational translocation selectively impaired glycoprotein proteostasis of influenza as well as HIV and dengue viruses, and led to inhibition of viral growth and infectivity. Thus, by studying virus-human protein-protein interactions in the context of active replication we have identified targetable host factors for broad-spectrum antiviral therapies. PMID:26789921

  6. Module Evaluation

    DTIC Science & Technology

    2006-02-01

    various testing methodologies for the evaluation and characterization of Transmit /Receive (T/R) modules for phased array radars. Discussed are techniques...for characterizing T/R modules in transmit and receive modes under ideal and emulated operation environments. Further, techniques for life testing...characteristics of T/R modules developed during the early and mid 1980’s. Data provided shows the performance in terms of gain and phase for both transmit

  7. Translation initiation of viral mRNAs.

    PubMed

    López-Lastra, Marcelo; Ramdohr, Pablo; Letelier, Alejandro; Vallejos, Maricarmen; Vera-Otarola, Jorge; Valiente-Echeverría, Fernando

    2010-05-01

    Viruses depend on cells for their replication but have evolved mechanisms to achieve this in an efficient and, in some instances, a cell-type-specific manner. The expression of viral proteins is frequently subject to translational control. The dominant target of such control is the initiation step of protein synthesis. Indeed, during the early stages of infection, viral mRNAs must compete with their host counterparts for the protein synthetic machinery, especially for the limited pool of eukaryotic translation initiation factors (eIFs) that mediate the recruitment of ribosomes to both viral and cellular mRNAs. To circumvent this competition viruses use diverse strategies so that ribosomes can be recruited selectively to viral mRNAs. In this review we focus on the initiation of protein synthesis and outline some of the strategies used by viruses to ensure efficient translation initiation of their mRNAs.

  8. Theory of conformational transitions of viral shells

    NASA Astrophysics Data System (ADS)

    Guérin, Thomas; Bruinsma, Robijn

    2007-12-01

    We propose a continuum theory for the conformational transitions of viral shells. Conformational transitions of viral shells, as encountered during viral maturation, are associated with a soft mode instability of the capsid proteins [F. Tama and C. L. Brooks, J. Mol. Biol. 345(2), 299 (2005)]. The continuum theory presented here is an adaptation of the Ginzburg-Landau theory of soft-mode structural phase transitions of solids to viral shells. The theory predicts that the conformational transitions are characterized by a pronounced softening of the shell elasticity in the critical region. We demonstrate that the thermodynamics of the conformational transition can be probed quantitatively by a micromechanical atomic force microscope study. The external force can drive a capsid into a state of phase coexistence characterized by a highly nonlinear force deformation curve.

  9. Mechanisms of influenza viral membrane fusion.

    PubMed

    Blijleven, Jelle S; Boonstra, Sander; Onck, Patrick R; van der Giessen, Erik; van Oijen, Antoine M

    2016-12-01

    Influenza viral particles are enveloped by a lipid bilayer. A major step in infection is fusion of the viral and host cellular membranes, a process with large kinetic barriers. Influenza membrane fusion is catalyzed by hemagglutinin (HA), a class I viral fusion protein activated by low pH. The exact nature of the HA conformational changes that deliver the energy required for fusion remains poorly understood. This review summarizes our current knowledge of HA structure and dynamics, describes recent single-particle experiments and modeling studies, and discusses their role in understanding how multiple HAs mediate fusion. These approaches provide a mechanistic picture in which HAs independently and stochastically insert into the target membrane, forming a cluster of HAs that is collectively able to overcome the barrier to membrane fusion. The new experimental and modeling approaches described in this review hold promise for a more complete understanding of other viral fusion systems and the protein systems responsible for cellular fusion.

  10. Viral fitness: definitions, measurement, and current insights

    USGS Publications Warehouse

    Wargo, Andrew R.; Kurath, Gael

    2012-01-01

    Viral fitness is an active area of research, with recent work involving an expanded number of human, non-human vertebrate, invertebrate, plant, and bacterial viruses. Many publications deal with RNA viruses associated with major disease emergence events, such as HIV-1, influenza virus, and Dengue virus. Study topics include drug resistance, immune escape, viral emergence, host jumps, mutation effects, quasispecies diversity, and mathematical models of viral fitness. Important recent trends include increasing use of in vivo systems to assess vertebrate virus fitness, and a broadening of research beyond replicative fitness to also investigate transmission fitness and epidemiologic fitness. This is essential for a more integrated understanding of overall viral fitness, with implications for disease management in the future.

  11. Viral fitness: definitions, measurement, and current insights.

    PubMed

    Wargo, Andrew R; Kurath, Gael

    2012-10-01

    Viral fitness is an active area of research, with recent work involving an expanded number of human, non-human vertebrate, invertebrate, plant, and bacterial viruses. Many publications deal with RNA viruses associated with major disease emergence events, such as HIV-1, influenza virus, and Dengue virus. Study topics include drug resistance, immune escape, viral emergence, host jumps, mutation effects, quasispecies diversity, and mathematical models of viral fitness. Important recent trends include increasing use of in vivo systems to assess vertebrate virus fitness, and a broadening of research beyond replicative fitness to also investigate transmission fitness and epidemiologic fitness. This is essential for a more integrated understanding of overall viral fitness, with implications for disease management in the future.

  12. Viral load distribution in SARS outbreak.

    PubMed

    Chu, Chung-Ming; Cheng, Vincent C C; Hung, Ivan F N; Chan, Kin-Sang; Tang, Bone S F; Tsang, Thomas H F; Chan, Kwok-Hung; Yuen, Kwok-Yung

    2005-12-01

    An unprecedented community outbreak of severe acute respiratory syndrome (SARS) occurred in the Amoy Gardens, a high-rise residential complex in Hong Kong. Droplet, air, contaminated fomites, and rodent pests have been proposed to be mechanisms for transmitting SARS in a short period. We studied nasopharyngeal viral load of SARS patients on admission and their geographic distribution. Higher nasopharyngeal viral load was found in patients living in adjacent units of the same block inhabited by the index patient, while a lower but detectable nasopharyngeal viral load was found in patients living further away from the index patient. This pattern of nasopharyngeal viral load suggested that airborne transmission played an important part in this outbreak in Hong Kong. Contaminated fomites and rodent pests may have also played a role.

  13. Rapid and highly fieldable viral diagnostic

    DOEpatents

    McKnight, Timothy E.

    2016-12-20

    The present invention relates to a rapid, highly fieldable, nearly reagentless diagnostic to identify active RNA viral replication in a live, infected cells, and more particularly in leukocytes and tissue samples (including biopsies and nasal swabs) using an array of a plurality of vertically-aligned nanostructures that impale the cells and introduce a DNA reporter construct that is expressed and amplified in the presence of active viral replication.

  14. Neutrophil in Viral Infections, Friend or Foe?

    PubMed Central

    Drescher, Brandon; Bai, Fengwei

    2012-01-01

    Polymorphonuclear leukocytes or neutrophils are the first immune cells to the site of injury and microbial infection. Neutrophils are crucial players in controlling bacterial and fungal infections, and in particular secondary infections, by phagocytosis, degranulation and neutrophil extracellular traps (NETs). While neutrophils have been shown to play important roles in viral pathogenesis, there is a lack of detailed investigation. In this article, we will review recent progresses toward understanding the role of neutrophils in viral pathogenesis. PMID:23178588

  15. Viral Immunotherapy to Eradicate Subclinical Brain Metastases

    DTIC Science & Technology

    2012-09-01

    re-activated to enter and destroy early BM by viral infection of Her2-positive breast BM by a recombinant vesicular stomatitis virus (VSV), which...memory T-cells can be re-activated to enter and destroy early BM by viral infection of Her2-positive breast BM by a recombinant vesicular stomatitis ...delivered to CSF macrophages (Months 0-9) a. Generate donor survivor animals by treatment with replicating recombinant Vesicular Stomatitis Virus (rrVSV

  16. The contribution of viral genotype to plasma viral set-point in HIV infection.

    PubMed

    Hodcroft, Emma; Hadfield, Jarrod D; Fearnhill, Esther; Phillips, Andrew; Dunn, David; O'Shea, Siobhan; Pillay, Deenan; Leigh Brown, Andrew J

    2014-05-01

    Disease progression in HIV-infected individuals varies greatly, and while the environmental and host factors influencing this variation have been widely investigated, the viral contribution to variation in set-point viral load, a predictor of disease progression, is less clear. Previous studies, using transmission-pairs and analysis of phylogenetic signal in small numbers of individuals, have produced a wide range of viral genetic effect estimates. Here we present a novel application of a population-scale method based in quantitative genetics to estimate the viral genetic effect on set-point viral load in the UK subtype B HIV-1 epidemic, based on a very large data set. Analyzing the initial viral load and associated pol sequence, both taken before anti-retroviral therapy, of 8,483 patients, we estimate the proportion of variance in viral load explained by viral genetic effects to be 5.7% (CI 2.8-8.6%). We also estimated the change in viral load over time due to selection on the virus and environmental effects to be a decline of 0.05 log10 copies/mL/year, in contrast to recent studies which suggested a reported small increase in viral load over the last 20 years might be due to evolutionary changes in the virus. Our results suggest that in the UK epidemic, subtype B has a small but significant viral genetic effect on viral load. By allowing the analysis of large sample sizes, we expect our approach to be applicable to the estimation of the genetic contribution to traits in many organisms.

  17. Host - hepatitis C viral interactions: The role of genetics.

    PubMed

    Heim, Markus H; Bochud, Pierre-Yves; George, Jacob

    2016-10-01

    Hepatitis C virus (HCV) is a major cause of chronic viral hepatitis that can lead to cirrhosis and hepatocellular carcinoma. Only a minority of patients can clear the virus spontaneously. Elimination of HCV during acute infection correlates with a rapid induction of innate, especially interferon (IFN)-induced genes, and a delayed induction of adaptive immune responses. There is a strong association between genetic variants in the IFNλ (IL28B) locus with the rate of spontaneous clearance. Individuals with the ancestral IFNλ4 allele capable of producing a fully active IFNλ4 are paradoxically not able to clear HCV in the acute phase and develop chronic hepatitis C (CHC) with more than 90% probability. In the chronic phase of HCV infection, the wild-type IFNλ4 genotype is strongly associated with an induction of hundreds of classical type I/type III IFN stimulated genes in hepatocytes. However, the activation of the endogenous IFN system in the liver is ineffective in clearing HCV, and is even associated with impaired therapeutic responses to pegylated (Peg)IFNα containing treatments. While the role of genetic variation in the IFNλ locus to the outcome of CHC treatment has declined, it is clear that variation not only at this locus, but also at other loci, modulate clinically important liver phenotypes, including inflammation, fibrosis progression and the development of hepatocellular cancer. In this review, we summarize current knowledge about the role of genetics in the host response to viral hepatitis and the potential future evolution of knowledge in understanding host-viral interactions.

  18. Generating viral metagenomes from the coral holobiont

    PubMed Central

    Wood-Charlson, Elisha M.; Suttle, Curtis A.; van Oppen, Madeleine J. H.

    2014-01-01

    Reef-building corals comprise multipartite symbioses where the cnidarian animal is host to an array of eukaryotic and prokaryotic organisms, and the viruses that infect them. These viruses are critical elements of the coral holobiont, serving not only as agents of mortality, but also as potential vectors for lateral gene flow, and as elements encoding a variety of auxiliary metabolic functions. Consequently, understanding the functioning and health of the coral holobiont requires detailed knowledge of the associated viral assemblage and its function. Currently, the most tractable way of uncovering viral diversity and function is through metagenomic approaches, which is inherently difficult in corals because of the complex holobiont community, an extracellular mucus layer that all corals secrete, and the variety of sizes and structures of nucleic acids found in viruses. Here we present the first protocol for isolating, purifying and amplifying viral nucleic acids from corals based on mechanical disruption of cells. This method produces at least 50% higher yields of viral nucleic acids, has very low levels of cellular sequence contamination and captures wider viral diversity than previously used chemical-based extraction methods. We demonstrate that our mechanical-based method profiles a greater diversity of DNA and RNA genomes, including virus groups such as Retro-transcribing and ssRNA viruses, which are absent from metagenomes generated via chemical-based methods. In addition, we briefly present (and make publically available) the first paired DNA and RNA viral metagenomes from the coral Acropora tenuis. PMID:24847321

  19. Viral Metagenomics: MetaView Software

    SciTech Connect

    Zhou, C; Smith, J

    2007-10-22

    The purpose of this report is to design and develop a tool for analysis of raw sequence read data from viral metagenomics experiments. The tool should compare read sequences of known viral nucleic acid sequence data and enable a user to attempt to determine, with some degree of confidence, what virus groups may be present in the sample. This project was conducted in two phases. In phase 1 we surveyed the literature and examined existing metagenomics tools to educate ourselves and to more precisely define the problem of analyzing raw read data from viral metagenomic experiments. In phase 2 we devised an approach and built a prototype code and database. This code takes viral metagenomic read data in fasta format as input and accesses all complete viral genomes from Kpath for sequence comparison. The system executes at the UNIX command line, producing output that is stored in an Oracle relational database. We provide here a description of the approach we came up with for handling un-assembled, short read data sets from viral metagenomics experiments. We include a discussion of the current MetaView code capabilities and additional functionality that we believe should be added, should additional funding be acquired to continue the work.

  20. Viral encephalitis: current treatments and future perspectives.

    PubMed

    Domingues, Renan Barros

    2012-12-01

    Several viruses may cause central nervous system infections that lead to a broad range of clinical manifestations. The course of the viral encephalitis can be acute, sub acute, or chronic. Some viruses have the ability to enter into the brain and cause direct injury, while others activate inflammatory cells that attack the central nervous system (CNS) secondarily. Some types of viral encephalitis occur in previously healthy individuals, while others affect immunocompromised patients. The epidemiology of viral encephalitis has undergone changes in recent years. Factors such as evolving lifestyles and ecological changes have had a considerable impact on the epidemiology of some types of viral encephalitis. The result is a change in the etiology spectrum of viral encephalitis, with new types of encephalitis arising or returning from time to time. Many scientific achievements in neuroimaging, molecular diagnosis, antiviral therapy, immunomodulatory treatments, and neurointensive care have allowed more precise and earlier diagnoses and more efficient treatments, resulting in improved outcomes. Despite these advances, there is still considerable morbidity and mortality related to these disorders. This aim of this article is to review the current knowledge of the current drugs used in the management of the most important viral encephalitis, focusing on the mechanisms of action, efficacy, and side effects of the drugs. In addition, future perspectives in this area will be addressed. Despite the technological advances, much effort has yet to be undertaken to reduce the impact of these potentially devastating diseases.

  1. Bioinformatics tools for analysing viral genomic data.

    PubMed

    Orton, R J; Gu, Q; Hughes, J; Maabar, M; Modha, S; Vattipally, S B; Wilkie, G S; Davison, A J

    2016-04-01

    The field of viral genomics and bioinformatics is experiencing a strong resurgence due to high-throughput sequencing (HTS) technology, which enables the rapid and cost-effective sequencing and subsequent assembly of large numbers of viral genomes. In addition, the unprecedented power of HTS technologies has enabled the analysis of intra-host viral diversity and quasispecies dynamics in relation to important biological questions on viral transmission, vaccine resistance and host jumping. HTS also enables the rapid identification of both known and potentially new viruses from field and clinical samples, thus adding new tools to the fields of viral discovery and metagenomics. Bioinformatics has been central to the rise of HTS applications because new algorithms and software tools are continually needed to process and analyse the large, complex datasets generated in this rapidly evolving area. In this paper, the authors give a brief overview of the main bioinformatics tools available for viral genomic research, with a particular emphasis on HTS technologies and their main applications. They summarise the major steps in various HTS analyses, starting with quality control of raw reads and encompassing activities ranging from consensus and de novo genome assembly to variant calling and metagenomics, as well as RNA sequencing.

  2. Modulation of signaling pathways by RNA virus capsid proteins.

    PubMed

    Urbanowski, Matthew D; Ilkow, Carolina S; Hobman, Tom C

    2008-07-01

    Capsid proteins are structural components of virus particles. They are nucleic acid-binding proteins whose main recognized function is to package viral genomes into protective structures called nucleocapsids. Research over the last 10 years indicates that in addition to their role as genome guardians, viral capsid proteins modulate host cell signaling networks. Disruption or alteration of intracellular signaling pathways by viral capsids may benefit replication of the virus by affecting innate immunity and in some cases, may underlie disease progression. In this review, we describe how the capsid proteins from medically relevant RNA viruses interact with host cell signaling pathways.

  3. Viral infections in type 1 diabetes mellitus — why the β cells?

    PubMed Central

    2017-01-01

    Type 1 diabetes mellitus (T1DM) is caused by progressive autoimmune-mediated loss of pancreatic β-cell mass via apoptosis. The onset of T1DM depends on environmental factors that interact with predisposing genes to induce an autoimmune assault against β cells. Epidemiological, clinical and pathology studies in humans support viral infection — particularly by enteroviruses (for example, coxsackievirus) — as an environmental trigger for the development of T1DM. Many candidate genes for T1DM, such as MDA5, PTPN2 and TYK2, regulate antiviral responses in both β cells and the immune system. Cellular permissiveness to viral infection is modulated by innate antiviral responses that vary among different tissues or cell types. Some data indicate that pancreatic islet α cells trigger a more efficient antiviral response to infection with diabetogenic viruses than do β cells, and so are able to eradicate viral infections without undergoing apoptosis. This difference could account for the varying ability of islet-cell subtypes to clear viral infections and explain why chronically infected pancreatic β cells, but not α cells, are targeted by an autoimmune response and killed during the development of T1DM. These issues and attempts to target viral infection as a preventive therapy for T1DM are discussed in the present Review. PMID:27020257

  4. Paternally transmitted mitochondria express a new gene of potential viral origin.

    PubMed

    Milani, Liliana; Ghiselli, Fabrizio; Maurizii, Maria Gabriella; Nuzhdin, Sergey V; Passamonti, Marco

    2014-02-01

    Mitochondrial ORFans (open reading frames having no detectable homology and with unknown function) were discovered in bivalve molluscs with doubly uniparental inheritance (DUI) of mitochondria. In these animals, two mitochondrial lineages are present, one transmitted through eggs (F-type), the other through sperm (M-type), each showing a specific ORFan. In this study, we used in situ hybridization and immunocytochemistry to provide evidence for the expression of Ruditapes philippinarum male-specific ORFan (orf21): both the transcript and the protein (RPHM21) were localized in spermatogenic cells and mature spermatozoa; the protein was localized in sperm mitochondria and nuclei, and in early embryos. Also, in silico analyses of orf21 flanking region and RPHM21 structure supported its derivation from viral sequence endogenization. We propose that RPHM21 prevents the recognition of M-type mitochondria by the degradation machinery, allowing their survival in the zygote. The process might involve a mechanism similar to that of Modulators of Immune Recognition, viral proteins involved in the immune recognition pathway, to which RPHM21 showed structural similarities. A viral origin of RPHM21 may also support a developmental role, because some integrated viral elements are involved in development and sperm differentiation of their host. Mitochondrial ORFans could be responsible for or participate in the DUI mechanism and their viral origin could explain the acquired capability of M-type mitochondria to avoid degradation and invade the germ line, that is what viruses do best: to elude host immune system and proliferate.

  5. Viral infections in type 1 diabetes mellitus--why the β cells?

    PubMed

    Op de Beeck, Anne; Eizirik, Decio L

    2016-05-01

    Type 1 diabetes mellitus (T1DM) is caused by progressive autoimmune-mediated loss of pancreatic β-cell mass via apoptosis. The onset of T1DM depends on environmental factors that interact with predisposing genes to induce an autoimmune assault against β cells. Epidemiological, clinical and pathology studies in humans support viral infection--particularly by enteroviruses (for example, coxsackievirus)--as an environmental trigger for the development of T1DM. Many candidate genes for T1DM, such as MDA5, PTPN2 and TYK2, regulate antiviral responses in both β cells and the immune system. Cellular permissiveness to viral infection is modulated by innate antiviral responses that vary among different tissues or cell types. Some data indicate that pancreatic islet α cells trigger a more efficient antiviral response to infection with diabetogenic viruses than do β cells, and so are able to eradicate viral infections without undergoing apoptosis. This difference could account for the varying ability of islet-cell subtypes to clear viral infections and explain why chronically infected pancreatic β cells, but not α cells, are targeted by an autoimmune response and killed during the development of T1DM. These issues and attempts to target viral infection as a preventive therapy for T1DM are discussed in the present Review.

  6. The anti-obesity drug orlistat reveals anti-viral activity.

    PubMed

    Ammer, Elisabeth; Nietzsche, Sandor; Rien, Christian; Kühnl, Alexander; Mader, Theresa; Heller, Regine; Sauerbrei, Andreas; Henke, Andreas

    2015-12-01

    The administration of drugs to inhibit metabolic pathways not only reduces the risk of obesity-induced diseases in humans but may also hamper the replication of different viral pathogens. In order to investigate the value of the US Food and Drug Administration-approved anti-obesity drug orlistat in view of its anti-viral activity against different human-pathogenic viruses, several anti-viral studies, electron microscopy analyses as well as fatty acid uptake experiments were performed. The results indicate that administrations of non-cytotoxic concentrations of orlistat reduced the replication of coxsackievirus B3 (CVB3) in different cell types significantly. Moreover, orlistat revealed cell protective effects and modified the formation of multi-layered structures in CVB3-infected cells, which are necessary for viral replication. Lowering fatty acid uptake from the extracellular environment by phloretin administrations had only marginal impact on CVB3 replication. Finally, orlistat reduced also the replication of varicella-zoster virus moderately but had no significant influence on the replication of influenza A viruses. The data support further experiments into the value of orlistat as an inhibitor of the fatty acid synthase to develop new anti-viral compounds, which are based on the modulation of cellular metabolic pathways.

  7. Comparative analysis of viral RNA signatures on different RIG-I-like receptors

    PubMed Central

    Sanchez David, Raul Y; Combredet, Chantal; Sismeiro, Odile; Dillies, Marie-Agnès; Jagla, Bernd; Coppée, Jean-Yves; Mura, Marie; Guerbois Galla, Mathilde; Despres, Philippe; Tangy, Frédéric; Komarova, Anastassia V

    2016-01-01

    The RIG-I-like receptors (RLRs) play a major role in sensing RNA virus infection to initiate and modulate antiviral immunity. They interact with particular viral RNAs, most of them being still unknown. To decipher the viral RNA signature on RLRs during viral infection, we tagged RLRs (RIG-I, MDA5, LGP2) and applied tagged protein affinity purification followed by next-generation sequencing (NGS) of associated RNA molecules. Two viruses with negative- and positive-sense RNA genome were used: measles (MV) and chikungunya (CHIKV). NGS analysis revealed that distinct regions of MV genome were specifically recognized by distinct RLRs: RIG-I recognized defective interfering genomes, whereas MDA5 and LGP2 specifically bound MV nucleoprotein-coding region. During CHIKV infection, RIG-I associated specifically to the 3’ untranslated region of viral genome. This study provides the first comparative view of the viral RNA ligands for RIG-I, MDA5 and LGP2 in the presence of infection. DOI: http://dx.doi.org/10.7554/eLife.11275.001 PMID:27011352

  8. Paternally Transmitted Mitochondria Express a New Gene of Potential Viral Origin

    PubMed Central

    Milani, Liliana; Ghiselli, Fabrizio; Maurizii, Maria Gabriella; Nuzhdin, Sergey V.; Passamonti, Marco

    2014-01-01

    Mitochondrial ORFans (open reading frames having no detectable homology and with unknown function) were discovered in bivalve molluscs with doubly uniparental inheritance (DUI) of mitochondria. In these animals, two mitochondrial lineages are present, one transmitted through eggs (F-type), the other through sperm (M-type), each showing a specific ORFan. In this study, we used in situ hybridization and immunocytochemistry to provide evidence for the expression of Ruditapes philippinarum male-specific ORFan (orf21): both the transcript and the protein (RPHM21) were localized in spermatogenic cells and mature spermatozoa; the protein was localized in sperm mitochondria and nuclei, and in early embryos. Also, in silico analyses of orf21 flanking region and RPHM21 structure supported its derivation from viral sequence endogenization. We propose that RPHM21 prevents the recognition of M-type mitochondria by the degradation machinery, allowing their survival in the zygote. The process might involve a mechanism similar to that of Modulators of Immune Recognition, viral proteins involved in the immune recognition pathway, to which RPHM21 showed structural similarities. A viral origin of RPHM21 may also support a developmental role, because some integrated viral elements are involved in development and sperm differentiation of their host. Mitochondrial ORFans could be responsible for or participate in the DUI mechanism and their viral origin could explain the acquired capability of M-type mitochondria to avoid degradation and invade the germ line, that is what viruses do best: to elude host immune system and proliferate. PMID:24500970

  9. An Odyssey to Viral Pathogenesis.

    PubMed

    Oldstone, Michael B A

    2016-05-23

    polishing by Karl Habel (a superb senior virologist who left the National Institutes of Health and came to Scripps), and the gifted postdoctoral fellows who joined my laboratory over four decades form the log of my scientific voyage. The strong friendships and collaborations developed with other young but growing experimentalists like Bernie Fields and Abner Notkins are the fabric of the tale I will weave and were pivotal in the establishment of viral pathogenesis as a discipline.

  10. Update on chronic viral hepatitis

    PubMed Central

    Walsh, K; Alexander, G

    2001-01-01

    Many recent and significant advances in the field of chronic viral hepatitis, including therapy, suggest that an update on chronic hepatitis is timely.
Chronic hepatitis B virus infection remains a significant worldwide cause of liver cirrhosis and hepatocellular carcinoma, despite the wide availability of a long established and effective vaccine. Transmission occurs via perinatal, sexual, and parenteral routes (particularly intravenous drug abuse and although blood products still carry a risk, this is now extremely low in Western countries). Only a minority of infected adult cases develop chronic hepatitis but in children under 1 year, 90% develop chronic hepatitis. The clinical spectrum of chronic liver injury ranges from mild inflammation to end stage liver cirrhosis. Interferon alfa has been the mainstay of treatment for patients with active disease but nucleoside analogues (lamivudine and adefovir) are now available with similar efficacy. Patients with end stage liver disease and hepatocellular carcinoma can be offered transplantation but infection in the graft is commonplace. The combination of hepatitis B immunoglobulin and newer antiviral drugs reduce the incidence and severity of graft infection significantly.
The hepatitis C virus epidemic of the latter half of the 20th century now affects more than 1% of populations worldwide. This RNA virus is spread parenterally and is becoming the leading indication for liver transplantation. The majority of patients develop chronic hepatitis, which may be progressive, evolving to significant liver disease (cirrhosis or hepatocellular carcinoma) in about 20% cases after decades. Treatment with the combination of interferon alfa and ribavirin is successful in up to 40% cases. Liver transplantation is a therapeutic option for some but graft infection is universal and often complicated by progressive liver fibrosis. A vaccine remains a remote prospect so that prevention is crucial.
Hepatitis D virus infection

  11. Duck hepatitis A virus serotype 1 minigenome: a model for studying the viral 3'UTR effect on viral translation.

    PubMed

    Liang, Ruiying; Li, Chuanfeng; Jin, Hongyan; Meng, Chunchun; Chen, Zongyan; Zhu, Jie; Miao, Qiuhong; Ding, Chan; Liu, Guangqing

    2015-12-01

    To date, the genetic replication and translation mechanisms as well as the pathogenesis of duck hepatitis A virus type 1 (DHAV-1) have not been adequately characterized due to the lack of a reliable and efficient cell culture system. Although the full-length infections clone system is the best platform to manipulate the virus, it is relatively difficult to assemble this system due to the lack of a suitable cell line. It has been proven that the minigenome system an efficient reverse genetics system for the study of RNA viruses. In some cases, it can be used to displace the infectious clone of RNA viruses. Here, we generated a minigenome for DHAV-1 with two luciferase reporter genes, firefly luciferase (Fluc) and Renilla luciferase (Rluc). The Rluc gene was used as a reference gene for the normalization of the Fluc gene expression in transfected cells, which provided a platform for studying the regulatory mechanisms of DHAV-1. Furthermore, to investigate the role of DHAV-3'UTR in the regulation of viral protein translation, deletions in the 3'UTR were introduced into the DHAV-1 minigenome. Luciferase activity, an indicator of virus translation, was then determined. These results showed that a minigenome system for DHAV-1 was successfully constructed for the first time and that the complete or partial deletion of the DHAV-3'UTR did not affect the expression level of the reporter gene, indicating that DHAV-1 translation may not be modulated by the viral genomic 3'UTR sequence.

  12. Raw Sewage Harbors Diverse Viral Populations

    PubMed Central

    Cantalupo, Paul G.; Calgua, Byron; Zhao, Guoyan; Hundesa, Ayalkibet; Wier, Adam D.; Katz, Josh P.; Grabe, Michael; Hendrix, Roger W.; Girones, Rosina; Wang, David; Pipas, James M.

    2011-01-01

    ABSTRACT At this time, about 3,000 different viruses are recognized, but metagenomic studies suggest that these viruses are a small fraction of the viruses that exist in nature. We have explored viral diversity by deep sequencing nucleic acids obtained from virion populations enriched from raw sewage. We identified 234 known viruses, including 17 that infect humans. Plant, insect, and algal viruses as well as bacteriophages were also present. These viruses represented 26 taxonomic families and included viruses with single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), positive-sense ssRNA [ssRNA(+)], and dsRNA genomes. Novel viruses that could be placed in specific taxa represented 51 different families, making untreated wastewater the most diverse viral metagenome (genetic material recovered directly from environmental samples) examined thus far. However, the vast majority of sequence reads bore little or no sequence relation to known viruses and thus could not be placed into specific taxa. These results show that the vast majority of the viruses on Earth have not yet been characterized. Untreated wastewater provides a rich matrix for identifying novel viruses and for studying virus diversity. Importance At this time, virology is focused on the study of a relatively small number of viral species. Specific viruses are studied either because they are easily propagated in the laboratory or because they are associated with disease. The lack of knowledge of the size and characteristics of the viral universe and the diversity of viral genomes is a roadblock to understanding important issues, such as the origin of emerging pathogens and the extent of gene exchange among viruses. Untreated wastewater is an ideal system for assessing viral diversity because virion populations from large numbers of individuals are deposited and because raw sewage itself provides a rich environment for the growth of diverse host species and thus their viruses. These studies suggest that

  13. Prospects for cannabinoid therapies in viral encephalitis.

    PubMed

    Solbrig, Marylou V; Fan, Yijun; Hazelton, Paul

    2013-11-06

    Cannabinoids are promising therapies to support neurogenesis and decelerate disease progression in neuroinflammatory and degenerative disorders. Whether neuroprotective effects of cannabinoids are sustainable during persistent viral infection of the CNS is not known. Using a rodent model of chronic viral encephalitis based on Borna Disease (BD) virus, in which 1 week treatment with the general cannabinoid WIN 55,212-2 has been shown to be neuroprotective (Solbrig et al., 2010), we examine longer term (2 week treatment) effects of a general (CB1 and CB2) cannabinoid receptor agonist WIN55,212-2 (1mg/kg ip twice per day) or a specific (CB2) cannabinoid receptor agonist HU-308 (5mg/kg ip once daily) on histopathology, measures of frontostriatal neurogenesis and gliogenesis, and viral load. We find that WIN and HU-308 differ in their ability to protect new BrdU(+) cells. The selective CB2 agonist HU increases BrdU(+) cells in prefrontal cortex (PFC), significantly increases BrdU(+) cells in striatum, differentially regulates polydendrocytes vs. microglia/macrophages, and reduces immune activation at a time WIN-treated rats appear tolerant to the anti-inflammatory effect of their cannabinoid treatment. WIN and HU had little direct viral effect in PFC and striatum, yet reduced viral signal in hippocampus. Thus, HU-308 action on CB2 receptors, receptors known to be renewed during microglia proliferation and action, is a nontolerizing mechanism of controlling CNS inflammation during viral encephalitis by reducing microglia activation, as well as partially limiting viral infection, and uses a nonpsychotropic cannabinoid agonist.

  14. Molecular piracy: the viral link to carcinogenesis.

    PubMed

    Flaitz, C M; Hicks, M J

    1998-11-01

    The vast majority of the human experience with viral infections is associated with acute symptoms, such as malaise, fever, chills, rhinitis and diarrhea. With this acute or lytic phase, the immune system mounts a response and eliminates the viral agent while acquiring antibodies to that specific viral subtype. With latent or chronic infections, the viral agent becomes incorporated into the human genome. Viral agents capable of integration into the host's genetic material are particularly dangerous and may commandeer the host's ability to regulate normal cell growth and proliferation. The oncogenic viruses may immortalize the host cell, and facilitate malignant transformation. Cell growth and proliferation may be enhanced by viral interference with tumor suppressor gene function (p53 and pRb). Viruses may act as vectors for mutated proto-oncogenes (oncogenes). Overexpression of these oncogenes in viral-infected cells interferes with normal cell function and allows unregulated cell growth and proliferation, which may lead to malignant transformation and tumour formation. Development of oral neoplasms, both benign and malignant, has been linked to several viruses. Epstein-Barr virus is associated with oral hairy leukoplakia, lymphoproliferative disease, lymphoepithelial carcinoma, B-cell lymphomas, and nasopharyngeal carcinoma. Human herpesvirus-8 has been implicated in all forms of Kaposi's sarcoma, primary effusion lymphomas, multiple myeloma, angioimmunoblastic lymphadenopathy, and Castleman's disease. Human herpesvirus-6 has been detected in lymphoproliferative disease, lymphomas, Hodgkin's disease, and oral squamous cell carcinoma. The role of human papillomavirus in benign (squamous papilloma, focal epithelial hyperplasia, condyloma acuminatum, verruca vulgaris), premalignant (oral epithelial dysplasia), and malignant (squamous cell carcinoma) neoplasms within the oral cavity is well recognized. Herpes simplex virus may participate as a cofactor in oral squamous

  15. Viral Macro Domains Reverse Protein ADP-Ribosylation

    PubMed Central

    Li, Changqing; Debing, Yannick; Jankevicius, Gytis; Neyts, Johan; Ahel, Ivan

    2016-01-01

    ABSTRACT ADP-ribosylation is a posttranslational protein modification in which ADP-ribose is transferred from NAD+ to specific acceptors to regulate a wide variety of cellular processes. The macro domain is an ancient and highly evolutionarily conserved protein domain widely distributed throughout all kingdoms of life, including viruses. The human TARG1/C6orf130, MacroD1, and MacroD2 proteins can reverse ADP-ribosylation by acting on ADP-ribosylated substrates through the hydrolytic activity of their macro domains. Here, we report that the macro domain from hepatitis E virus (HEV) serves as an ADP-ribose-protein hydrolase for mono-ADP-ribose (MAR) and poly(ADP-ribose) (PAR) chain removal (de-MARylation and de-PARylation, respectively) from mono- and poly(ADP)-ribosylated proteins, respectively. The presence of the HEV helicase in cis dramatically increases the binding of the macro domain to poly(ADP-ribose) and stimulates the de-PARylation activity. Abrogation of the latter dramatically decreases replication of an HEV subgenomic replicon. The de-MARylation activity is present in all three pathogenic positive-sense, single-stranded RNA [(+)ssRNA] virus families which carry a macro domain: Coronaviridae (severe acute respiratory syndrome coronavirus and human coronavirus 229E), Togaviridae (Venezuelan equine encephalitis virus), and Hepeviridae (HEV), indicating that it might be a significant tropism and/or pathogenic determinant. IMPORTANCE Protein ADP-ribosylation is a covalent posttranslational modification regulating cellular protein activities in a dynamic fashion to modulate and coordinate a variety of cellular processes. Three viral families, Coronaviridae, Togaviridae, and Hepeviridae, possess macro domains embedded in their polyproteins. Here, we show that viral macro domains reverse cellular ADP-ribosylation, potentially cutting the signal of a viral infection in the cell. Various poly(ADP-ribose) polymerases which are notorious guardians of cellular

  16. LL37 and Cationic Peptides Enhance TLR3 Signaling by Viral Double-stranded RNAs

    PubMed Central

    Lai, Yvonne; Adhikarakunnathu, Sreedevi; Bhardwaj, Kanchan; Ranjith-Kumar, C. T.; Wen, Yahong; Jordan, Jarrat L.; Wu, Linda H.; Dragnea, Bogdan; Mateo, Lani San; Kao, C. Cheng

    2011-01-01

    Background Toll-like Receptor 3 (TLR3) detects viral dsRNA during viral infection. However, most natural viral dsRNAs are poor activators of TLR3 in cell-based systems, leading us to hypothesize that TLR3 needs additional factors to be activated by viral dsRNAs. The anti-microbial peptide LL37 is the only known human member of the cathelicidin family of anti-microbial peptides. LL37 complexes with bacterial lipopolysaccharide (LPS) to prevent activation of TLR4, binds to ssDNA to modulate TLR9 and ssRNA to modulate TLR7 and 8. It synergizes with TLR2/1, TLR3 and TLR5 agonists to increase IL8 and IL6 production. This work seeks to determine whether LL37 enhances viral dsRNA recognition by TLR3. Methodology/Principal Findings Using a human bronchial epithelial cell line (BEAS2B) and human embryonic kidney cells (HEK 293T) transiently transfected with TLR3, we found that LL37 enhanced poly(I:C)-induced TLR3 signaling and enabled the recognition of viral dsRNAs by TLR3. The presence of LL37 also increased the cytokine response to rhinovirus infection in BEAS2B cells and in activated human peripheral blood mononuclear cells. Confocal microscopy determined that LL37 could co-localize with TLR3. Electron microscopy showed that LL37 and poly(I:C) individually formed globular structures, but a complex of the two formed filamentous structures. To separate the effects of LL37 on TLR3 and TLR4, other peptides that bind RNA and transport the complex into cells were tested and found to activate TLR3 signaling in response to dsRNAs, but had no effect on TLR4 signaling. This is the first demonstration that LL37 and other RNA-binding peptides with cell penetrating motifs can activate TLR3 signaling and facilitate the recognition of viral ligands. Conclusions/Significance LL37 and several cell-penetrating peptides can enhance signaling by TLR3 and enable TLR3 to respond to viral dsRNA. PMID:22039520

  17. Human Cytomegalovirus UL97 Phosphorylates the Viral Nuclear Egress Complex

    PubMed Central

    Sharma, Mayuri; Bender, Brian J.; Kamil, Jeremy P.; Lye, Ming F.; Pesola, Jean M.; Reim, Natalia I.; Hogle, James M.

    2014-01-01

    ABSTRACT Herpesvirus nucleocapsids exit the host cell nucleus in an unusual process known as nuclear egress. The human cytomegalovirus (HCMV) UL97 protein kinase is required for efficient nuclear egress, which can be explained by its phosphorylation of the nuclear lamina component lamin A/C, which disrupts the nuclear lamina. We found that a dominant negative lamin A/C mutant complemented the replication defect of a virus lacking UL97 in dividing cells, validating this explanation. However, as complementation was incomplete, we investigated whether the HCMV nuclear egress complex (NEC) subunits UL50 and UL53, which are required for nuclear egress and recruit UL97 to the nuclear rim, are UL97 substrates. Using mass spectrometry, we detected UL97-dependent phosphorylation of UL50 residue S216 (UL50-S216) and UL53-S19 in infected cells. Moreover, UL53-S19 was specifically phosphorylated by UL97 in vitro. Notably, treatment of infected cells with the UL97 inhibitor maribavir or infection with a UL97 mutant led to a punctate rather than a continuous distribution of the NEC at the nuclear rim. Alanine substitutions in both UL50-S216 and UL53-S19 resulted in a punctate distribution of the NEC in infected cells and also decreased virus production and nuclear egress in the absence of maribavir. These results indicate that UL97 phosphorylates the NEC and suggest that this phosphorylation modulates nuclear egress. Thus, the UL97-NEC interaction appears to recruit UL97 to the nuclear rim both for disruption of the nuclear lamina and phosphorylation of the NEC. IMPORTANCE Human cytomegalovirus (HCMV) causes birth defects and it can cause life-threatening diseases in immunocompromised patients. HCMV assembles in the nucleus and then translocates to the cytoplasm in an unusual process termed nuclear egress, an attractive target for antiviral therapy. A viral enzyme, UL97, is important for nuclear egress. It has been proposed that this is due to its role in disruption of the

  18. Recombination-dependent concatemeric viral DNA replication.

    PubMed

    Lo Piano, Ambra; Martínez-Jiménez, María I; Zecchi, Lisa; Ayora, Silvia

    2011-09-01

    The initiation of viral double stranded (ds) DNA replication involves proteins that recruit and load the replisome at the replication origin (ori). Any block in replication fork progression or a programmed barrier may act as a factor for ori-independent remodelling and assembly of a new replisome at the stalled fork. Then replication initiation becomes dependent on recombination proteins, a process called recombination-dependent replication (RDR). RDR, which is recognized as being important for replication restart and stability in all living organisms, plays an essential role in the replication cycle of many dsDNA viruses. The SPP1 virus, which infects Bacillus subtilis cells, serves as a paradigm to understand the links between replication and recombination in circular dsDNA viruses. SPP1-encoded initiator and replisome assembly proteins control the onset of viral replication and direct the recruitment of host-encoded replisomal components at viral oriL. SPP1 uses replication fork reactivation to switch from ori-dependent θ-type (circle-to-circle) replication to σ-type RDR. Replication fork arrest leads to a double strand break that is processed by viral-encoded factors to generate a D-loop into which a new replisome is assembled, leading to σ-type viral replication. SPP1 RDR proteins are compared with similar proteins encoded by other viruses and their possible in vivo roles are discussed.

  19. Chronic viral hepatitis: the histology report.

    PubMed

    Guido, Maria; Mangia, Alessandra; Faa, Gavino

    2011-03-01

    In chronic viral hepatitis, the role of liver biopsy as a diagnostic test has seen a decline, paralleled by its increasing importance for prognostic purposes. Nowadays, the main indication for liver biopsy in chronic viral hepatitis is to assess the severity of the disease, in terms of both necro-inflammation (grade) and fibrosis (stage), which is important for prognosis and therapeutic management. Several scoring systems have been proposed for grading and staging chronic viral hepatitis and there is no a general consensus on the best system to be used in the daily practice. All scoring systems have their drawbacks and all may be affected by sampling and observer variability. Whatever the system used, a histological score is a reductive approach since damage in chronic viral hepatitis is a complex biological process. Thus, scoring systems are not intended to replace the detailed, descriptive, pathology report. In fact, lesions other than those scored for grading and staging may have clinical relevance and should be assessed and reported. This paper aims to provide a systematic approach to the interpretation of liver biopsies obtained in cases of chronic viral hepatitis, with the hope of helping general pathologists in their diagnostic practice.

  20. Lethal Mutagenesis Failure May Augment Viral Adaptation

    PubMed Central

    Paff, Matthew L.; Stolte, Steven P.; Bull, James J.

    2014-01-01

    Lethal mutagenesis, the attempt to extinguish a population by elevating its mutation rate, has been endorsed in the virology literature as a promising approach for treating viral infections. In support of the concept, in vitro studies have forced viral extinction with high doses of mutagenic drugs. However, the one known mutagenic drug used on patients commonly fails to cure infections, and in vitro studies typically find a wide range of mutagenic conditions permissive for viral growth. A key question becomes how subsequent evolution is affected if the viral population is mutated but avoids extinction—Is viral adaptation augmented rather than suppressed? Here we consider the evolution of highly mutated populations surviving mutagenesis, using the DNA phage T7. In assays using inhibitory hosts, whenever resistance mutants were observed, the mutagenized populations exhibited higher frequencies, but some inhibitors blocked plaque formation by even the mutagenized stock. Second, outgrowth of previously mutagenized populations led to rapid and potentially complete fitness recovery but polymorphism was slow to decay, and mutations exhibited inconsistent patterns of change. Third, the combination of population bottlenecks with mutagenesis did cause fitness declines, revealing a vulnerability that was not apparent from mutagenesis of large populations. The results show that a population surviving high mutagenesis may exhibit enhanced adaptation in some environments and experience little negative fitness consequences in many others. PMID:24092771

  1. Bovine viral diarrhea virus: biotypes and disease.

    PubMed Central

    Deregt, D; Loewen, K G

    1995-01-01

    Bovine viral diarrhea virus continues to produce significant economic losses for the cattle industry and challenges investigators with the complexity of diseases it produces and the mechanisms by which it causes disease. This paper updates and attempts to clarify information regarding the roles of noncytopathic and cytopathic bovine viral diarrhea viruses in persistent infections and mucosal disease. It also covers, in brief, what is known of the new diseases: thrombocytopenia and hemorrhagic disease, and a disease resembling mucosal disease that is apparently caused solely by noncytopathic virus. Although a good understanding of the roles of the 2 biotypes in the production of persistent infections and the precipitation of mucosal disease has been obtained, there are still unanswered questions regarding the origin of cytopathic viruses and the mechanism by which they cause pathological changes in cells. It is apparent, however, that cytopathic bovine viral diarrhea viruses arise by mutation of noncytopathic viruses, and it is known that p80 is the marker protein for cytopathic viruses. The previous distinction between mild bovine viral diarrhea and fatal mucosal disease has been eroded with the emergence of new virulent bovine viral diarrhea viruses. The new diseases pose a threat to the cattle industry and present a new challenge for investigators. Index Veterinarius (1984-1994) and Medline (1985-1994) databases and personal files updated since 1987 from BIOSIS Previews and Biosciences Information Services were used to search the literature. Images Figure 1. PMID:7648541

  2. Fish viral infections in northwest of Spain.

    PubMed

    Ledo, A; Lupiani, B; Dopazo, C P; Toranzo, A E; Barja, J L

    1990-06-01

    During a three years survey, a total of 149 samples from 20 farms of rainbow trout, salmon and turbot were examined for the presence of virus with the purpose to study the viral infections affecting cultured fish and their incidence in the fishfarms of Northwestern Spain. Infectious pancreatic necrosis virus (IPNV) was the only viral agent isolated from salmonid fish. Fry and fingerlings of trout showed the highest infection rate (24%). This virus was not detected in broodstock or embryonated eggs, although it was isolated from ovaric and seminal fluids and from juvenile carriers. From 24 samples of salmon analyzed, IPNV was only detected in one sample of juveniles. Examination of turbot led the isolation of a new virus belonging to the reoviridae family, which affected to the ongrowing population. All of the IPNV tested belonged to serotype Sp regardless of the origin of the trout stocks. During the monitorization of imported embryonated eggs, no virus was detected from any of the samples. However, in some case, IPNV was isolated when testing the fry obtained in our laboratory from those samples of imported eggs. Our findings indicate that: i) the analysis of fingerlings increase the probability to detect viral infections allowing us an optimal control of importations, and ii) most of the viral infections of fish take place in the own fish farms. The detection of mixed viral and bacterial infections emphasize the importance of carrying out an integral microbiological analysis to determine the causal agent(s) of fish mortalities.

  3. Viral kinetic modeling: state of the art.

    PubMed

    Canini, Laetitia; Perelson, Alan S

    2014-10-01

    Viral kinetic (VK) modeling has led to increased understanding of the within host dynamics of viral infections and the effects of therapy. Here we review recent developments in the modeling of viral infection kinetics with emphasis on two infectious diseases: hepatitis C and influenza. We review how VK modeling has evolved from simple models of viral infections treated with a drug or drug cocktail with an assumed constant effectiveness to models that incorporate drug pharmacokinetics and pharmacodynamics, as well as phenomenological models that simply assume drugs have time varying-effectiveness. We also discuss multiscale models that include intracellular events in viral replication, models of drug-resistance, models that include innate and adaptive immune responses and models that incorporate cell-to-cell spread of infection. Overall, VK modeling has provided new insights into the understanding of the disease progression and the modes of action of several drugs. We expect that VK modeling will be increasingly used in the coming years to optimize drug regimens in order to improve therapeutic outcomes and treatment tolerability for infectious diseases.

  4. Viral-associated glomerulopathies in children

    PubMed Central

    Wenderfer, Scott E.

    2015-01-01

    Viral infections associate temporally with the onset of many glomerular diseases, particularly in children. In other cases of glomerulonephritis, when infection is clinically silent, viral syndromes can still be implicated as a trigger. However, strong evidence for viral causality in most glomerular disease is still lacking. While numerous case reports in children document the occurrence of specific forms of glomerular disease after seroconversion to a wide range of viruses, relatively few reports provide pathologic evidence of viral infection associated with glomerular lesions on kidney biopsy. Strong associations between hepatitis viruses and glomerular injury have been acknowledged in adults, but hepatitis C virus appears not to be an etiology in children. In the context of treating glomerular diseases, when diagnosed, the treatment of hepatitis B virus, cytomegalovirus and human immunodeficiency virus in children with membranoproliferative, membranous and collapsing glomerulopathy plays an important role. Otherwise, there is no evidence suggesting that the identification of a viral infection in a child with glomerulopathy should change the management of the infection or the glomerulonephritis. Therefore, additional research into this topic is very much needed. PMID:25752759

  5. Bacterial and viral infections associated with influenza.

    PubMed

    Joseph, Carol; Togawa, Yu; Shindo, Nahoko

    2013-09-01

    Influenza-associated bacterial and viral infections are responsible for high levels of morbidity and death during pandemic and seasonal influenza episodes. A review was undertaken to assess and evaluate the incidence, epidemiology, aetiology, clinical importance and impact of bacterial and viral co-infection and secondary infection associated with influenza. A review was carried out of published articles covering bacterial and viral infections associated with pandemic and seasonal influenza between 1918 and 2009 (and published through December 2011) to include both pulmonary and extra-pulmonary infections. While pneumococcal infection remains the predominant cause of bacterial pneumonia, the review highlights the importance of other co- and secondary bacterial and viral infections associated with influenza, and the emergence of newly identified dual infections associated with the 2009 H1N1 pandemic strain. Severe influenza-associated pneumonia is often bacterial and will necessitate antibiotic treatment. In addition to the well-known bacterial causes, less common bacteria such as Legionella pneumophila may also be associated with influenza when new influenza strains emerge. This review should provide clinicians with an overview of the range of bacterial and viral co- or secondary infections that could present with influenza illness.

  6. Molecular imaging of oncolytic viral therapy

    PubMed Central

    Haddad, Dana; Fong, Yuman

    2015-01-01

    Oncolytic viruses have made their mark on the cancer world as a potential therapeutic option, with the possible advantages of reduced side effects and strengthened treatment efficacy due to higher tumor selectivity. Results have been so promising, that oncolytic viral treatments have now been approved for clinical trials in several countries. However, clinical studies may benefit from the ability to noninvasively and serially identify sites of viral targeting via molecular imaging in order to provide safety, efficacy, and toxicity information. Furthermore, molecular imaging of oncolytic viral therapy may provide a more sensitive and specific diagnostic technique to detect tumor origin and, more importantly, presence of metastases. Several strategies have been investigated for molecular imaging of viral replication broadly categorized into optical and deep tissue imaging, utilizing several reporter genes encoding for fluorescence proteins, conditional enzymes, and membrane protein and transporters. Various imaging methods facilitate molecular imaging, including computer tomography, magnetic resonance imaging, positron emission tomography, single photon emission CT, gamma-scintigraphy, and photoacoustic imaging. In addition, several molecular probes are used for medical imaging, which act as targeting moieties or signaling agents. This review will explore the preclinical and clinical use of in vivo molecular imaging of replication-competent oncolytic viral therapy. PMID:27119098

  7. Viral Vectors: The Road to Reducing Genotoxicity.

    PubMed

    David, Rhiannon M; Doherty, Ann T

    2017-02-01

    Viral vector use in gene therapy has highlighted several safety concerns, including genotoxic events. Generally, vector-mediated genotoxicity results from upregulation of cellular proto-oncogenes via promoter insertion, promoter activation, or gene transcript truncation, with enhancer-mediated activation of nearby genes the primary mechanism reported in gene therapy trials. Vector-mediated genotoxicity can be influenced by virus type, integration target site, and target cell type; different vectors have distinct integration profiles which are cell-specific. Non-viral factors, including patient age, disease, and dose can also influence genotoxic potential, thus the choice of test models and clinical trial populations is important to ensure they are indicative of efficacy and safety. Efforts have been made to develop viral vectors with less risk of insertional mutagenesis, including self-inactivating (SIN) vectors, enhancer-blocking insulators, and microRNA targeting of vectors, although insertional mutagenesis is not completely abrogated. Here we provide an overview of the current understanding of viral vector-mediated genotoxicity risk from factors contributing to viral vector-mediated genotoxicity to efforts made to reduce genotoxicity, and testing strategies required to adequately assess the risk of insertional mutagenesis. It is clear that there is not a 'one size fits all' approach to vector modification for reducing genotoxicity, and addressing these challenges will be a key step in the development of therapies such as CRISPR-Cas9 and delivery of future gene-editing technologies.

  8. [Viral safety: European and French directives].

    PubMed

    Rossi, F; Legras, J F

    2000-05-01

    The viral safety of IVIg is defined by transposition of European Directives. Directive 89/381/CEE defines plasma-derived medicinal products (pd-MP) which should be registred through a Marketing Authorization (75/318/CEE) and requires specific criteria for donation acceptability and fractionation processing. Recommendations and Notes for Guidance are prepared by the "Biotechnology Working Party" (BWP), Committee for Proprietary Medicinal Products (CPMP) ad hoc group. "Note for Guidance on Virus Validation Studies: CPMP/BWP/268/95" defines, for conventional viruses, the validation study as regards viral elimination /inactivation steps (relevant virus, scale reduction system and statistical interpretation of the results). "Note for Guidance on 'blood products'- CPMP/BWP/269/95" defines the key issues of viral safety: starting material, viral elimination /inactivation steps within the fractionation processing and in process controls. Pd-MP used as excipients are also covered. BWP/CPMP recommends that exclusion criteria only be considered for sporadic, familial or iatrogenic Creutzfeldt-Jakob disease (CJD), while withdrawal should be undertaken, according to the precaution principle, when a donor is suffering from nv-CJD (February 1998). Also, screening tests currently under development for transmissible spongiform encephalopathies are encouraged to be introduced for fractionation products (January 1999). Some donor exclusion criteria for conventional viruses and prions are specific to France. In conclusion, measures taken to ensure pd-MP viral safety are constantly changing. Its evaluation can only be done when considering numerous parameters within a global context.

  9. Association of Bovine Viral Diarrhea Virus with Multiple Viral Infections in Bovine Respiratory Disease Outbreaks

    PubMed Central

    Richer, Lisette; Marois, Paul; Lamontagne, Lucie

    1988-01-01

    We investigated eleven outbreaks of naturally occurring bovine respiratory diseases in calves and adult animals in the St-Hyacinthe area of Quebec. Specific antibodies to bovine herpesvirus-1, bovine viral diarrhea virus, respiratory syncytial virus, parainfluenza type 3 virus, reovirus type 3, and serotypes 1 to 7 of bovine adenovirus were found in paired sera from diseased animals. Several bovine viruses with respiratory tropism were involved concomitantly in herds during an outbreak of bovine respiratory disease. In addition, concomitant fourfold rises of antibody titers were frequently observed to two or more viral agents in seroconverted calves (61%) or adult animals (38%). Bovine viral diarrhea virus was found to be the most frequent viral agent associated with multiple viral infection in calves only (92%). PMID:17423116

  10. Diagnosis and Control of Viral Diseases of Reproductive Importance: Infectious Bovine Rhinotracheitis and Bovine Viral Diarrhea.

    PubMed

    Newcomer, Benjamin W; Givens, Daniel

    2016-07-01

    Both bovine viral diarrhea virus and bovine herpesvirus 1 can have significant negative reproductive impacts on cattle health. Vaccination is the primary control method for the viral pathogens in US cattle herds. Polyvalent, modified-live vaccines are recommended to provide optimal protection against various viral field strains. Of particular importance to bovine viral diarrhea control is the limitation of contact of pregnant cattle with potential viral reservoirs during the critical first 125 days of gestation.

  11. Modulated Entry

    NASA Technical Reports Server (NTRS)

    Grant, Frederick C.

    1960-01-01

    The technique of modulation, or variable coefficients, is discussed and the analytical formulation is reviewed. Representative numerical results of the use of modulation are shown for the lifting and nonlifting cases. These results include the effects of modulation on peak acceleration, entry corridor, and heat absorption. Results are given for entry at satellite speed and escape speed. The indications are that coefficient modulation on a vehicle with good lifting capability offers the possibility of sizable loading reductions or, alternatively, wider corridors; thus, steep entries become practical from the loading standpoint. The amount of steepness depends on the acceptable heating penalty. The price of sizable fractions of the possible gains does not appear to be excessive.

  12. Controlling viral capsid assembly with templating

    NASA Astrophysics Data System (ADS)

    Hagan, Michael F.

    2008-05-01

    We develop coarse-grained models that describe the dynamic encapsidation of functionalized nanoparticles by viral capsid proteins. We find that some forms of cooperative interactions between protein subunits and nanoparticles can dramatically enhance rates and robustness of assembly, as compared to the spontaneous assembly of subunits into empty capsids. For large core-subunit interactions, subunits adsorb onto core surfaces en masse in a disordered manner, and then undergo a cooperative rearrangement into an ordered capsid structure. These assembly pathways are unlike any identified for empty capsid formation. Our models can be directly applied to recent experiments in which viral capsid proteins assemble around functionalized inorganic nanoparticles [Sun , Proc. Natl. Acad. Sci. U.S.A. 104, 1354 (2007)]. In addition, we discuss broader implications for understanding the dynamic encapsidation of single-stranded genomic molecules during viral replication and for developing multicomponent nanostructured materials.

  13. Human viral oncogenesis: a cancer hallmarks analysis.

    PubMed

    Mesri, Enrique A; Feitelson, Mark A; Munger, Karl

    2014-03-12

    Approximately 12% of all human cancers are caused by oncoviruses. Human viral oncogenesis is complex, and only a small percentage of the infected individuals develop cancer, often many years to decades after the initial infection. This reflects the multistep nature of viral oncogenesis, host genetic variability, and the fact that viruses contribute to only a portion of the oncogenic events. In this review, the Hallmarks of Cancer framework of Hanahan and Weinberg (2000 and 2011) is used to dissect the viral, host, and environmental cofactors that contribute to the biology of multistep oncogenesis mediated by established human oncoviruses. The viruses discussed include Epstein-Barr virus (EBV), high-risk human papillomaviruses (HPVs), hepatitis B and C viruses (HBV and HCV, respectively), human T cell lymphotropic virus-1 (HTLV-1), and Kaposi's sarcoma herpesvirus (KSHV).

  14. Controlling Viral Capsid Assembly with Templating

    PubMed Central

    Hagan, Michael F.

    2009-01-01

    We develop coarse-grained models that describe the dynamic encapsidation of functionalized nanoparticles by viral capsid proteins. We find that some forms of cooperative interactions between protein subunits and nanoparticles can dramatically enhance rates and robustness of assembly, as compared to the spontaneous assembly of subunits into empty capsids. For large core-subunit interactions, subunits adsorb onto core surfaces en masse in a disordered manner, and then undergo a cooperative rearrangement into an ordered capsid structure. These assembly pathways are unlike any identified for empty capsid formation. Our models can be directly applied to recent experiments in which viral capsid proteins assemble around the functionalized inorganic nanoparticles [Sun et al., Proc. Natl. Acad. Sci (2007) 104, 1354]. In addition, we discuss broader implications for understanding the dynamic encapsidation of single-stranded genomic molecules during viral replication and for developing multicomponent nanostructured materials. PMID:18643099

  15. Shedding new light on viral photosynthesis.

    PubMed

    Puxty, Richard J; Millard, Andrew D; Evans, David J; Scanlan, David J

    2015-10-01

    Viruses infecting the environmentally important marine cyanobacteria Prochlorococcus and Synechococcus encode 'auxiliary metabolic genes' (AMGs) involved in the light and dark reactions of photosynthesis. Here, we discuss progress on the inventory of such AMGs in the ever-increasing number of viral genome sequences as well as in metagenomic datasets. We contextualise these gene acquisitions with reference to a hypothesised fitness gain to the phage. We also report new evidence with regard to the sequence and predicted structural properties of viral petE genes encoding the soluble electron carrier plastocyanin. Viral copies of PetE exhibit extensive modifications to the N-terminal signal peptide and possess several novel residues in a region responsible for interaction with redox partners. We also highlight potential knowledge gaps in this field and discuss future opportunities to discover novel phage-host interactions involved in the photosynthetic process.

  16. Developments in Viral Vector-Based Vaccines

    PubMed Central

    Ura, Takehiro; Okuda, Kenji; Shimada, Masaru

    2014-01-01

    Viral vectors are promising tools for gene therapy and vaccines. Viral vector-based vaccines can enhance immunogenicity without an adjuvant and induce a robust cytotoxic T lymphocyte (CTL) response to eliminate virus-infected cells. During the last several decades, many types of viruses have been developed as vaccine vectors. Each has unique features and parental virus-related risks. In addition, genetically altered vectors have been developed to improve efficacy and safety, reduce administration dose, and enable large-scale manufacturing. To date, both successful and unsuccessful results have been reported in clinical trials. These trials provide important information on factors such as toxicity, administration dose tolerated, and optimized vaccination strategy. This review highlights major viral vectors that are the best candidates for clinical use. PMID:26344749

  17. Hepatitis viral load correlates to glutathione levels.

    PubMed

    1998-01-01

    Several recent scientific articles have found a direct correlation between Glutathione levels and viral activity for hepatitis B and C. When viral load increases, Glutathione decreases. Researchers from Germany report that adding NAC (N-acetyl cysteine) to HBV producing cells lines can reduce hepatitis viral load 50 fold. Glutathione is used by the liver to help break down toxins. Patients who have chronic infection for more than 90 days should ask their physicians to check their Glutathione levels. A test kit is available from ImmunoSciences Labs; contact information is included. An amino acid, L-Glutamine, can be used with Alpha Lipoic Acid and NAC to increase Glutathione levels. Chlorophyll also offers benefits to people with hepatitis and other infections. Instructions on how to use a special retention enema containing chlorophyll, water, and apple cider vinegar are provided.

  18. [Viral retinitis following intravitreal triamcinolone injection].

    PubMed

    Zghal, I; Malek, I; Amel, C; Soumaya, O; Bouguila, H; Nacef, L

    2013-09-01

    Necrotizing viral retinitis is associated with infection by the Herpes family of viruses, especially herpes simplex virus (HSV), varicella zoster virus (VZV) and occasionally cytomegalovirus (CMV). When the diagnosis is suspected clinically, antiviral therapy must be instituted immediately. We report the case of a patient presenting with necrotizing viral retinitis 3 months following intravitreal injection of triamcinolone acetonide for diabetic macular edema. Fluorescein angiography demonstrated a superior temporal occlusive vasculitis. A diagnostic anterior chamber paracentesis was performed to obtain deoxyribo-nucleic acid (DNA) for a polymerase chain reaction (PCR) test for viral retinitis. PCR was positive for CMV. The patient was placed on intravenous ganciclovir. CMV retinitis is exceedingly rare in immunocompetent patients; however, it remains the most common cause of posterior uveitis in immunocompromised patients. The incidence of this entity remains unknown. Local immunosuppression, the dose and the frequency of injections may explain the occurrence of this severe retinitis.

  19. Molecular basis of viral and microbial pathogenesis

    SciTech Connect

    Rott, R.; Goebel, W.

    1988-01-01

    The contents of this book are: Correlation Between Viroid Structure and Pathogenicty; Antigenicity of the Influenza Haemagglutinia Membrane Glycoprotein; Viral Glycoproteins as Determinants of Pathogenicity; Virus Genes Involved in Host Range and Pathogenicity; Molecular Heterogenetiy of Pathogenic Herpus Viruses; Recombination of Foreign (Viral) DNA with Host Genome: Studies in Vivo and in a Cell-Free system; Disorders of Cellular Neuro-Functions by Persistent Viral Infection; Pathogenic Aspects of Measles Virus-Persistent Infections in Man; Analysis of the Dual Lineage Specificity of E26 Avian Leukemia Virus; Mx Gene Control of Influenza Virus Susceptibility; Shiga and Shika-Like Toxins: A Family of Related Cytokinons; and Molecular Mechanisms of Pathogenicity in Shigella Flexneri.

  20. Viral vector-based influenza vaccines

    PubMed Central

    de Vries, Rory D.; Rimmelzwaan, Guus F.

    2016-01-01

    ABSTRACT Antigenic drift of seasonal influenza viruses and the occasional introduction of influenza viruses of novel subtypes into the human population complicate the timely production of effective vaccines that antigenically match the virus strains that cause epidemic or pandemic outbreaks. The development of game-changing vaccines that induce broadly protective immunity against a wide variety of influenza viruses is an unmet need, in which recombinant viral vectors may provide. Use of viral vectors allows the delivery of any influenza virus antigen, or derivative thereof, to the immune system, resulting in the optimal induction of virus-specific B- and T-cell responses against this antigen of choice. This systematic review discusses results obtained with vectored influenza virus vaccines and advantages and disadvantages of the currently available viral vectors. PMID:27455345

  1. Characterization of a defective interfering RNA that contains a mosaic of a plant viral genome

    SciTech Connect

    Morris, T.J.; Jackson, A.O.

    1991-01-01

    Our lab was the first to describe and characterize a defective interfering RNA (DI RNAs or DIs) in association with a small RNA plant virus. The features of the DIs that we discovered in infections of tomato bushy stunt virus were compatible with the properties of DIs identified in many animal virus infections. Animal virologists have generally recognized the importance of studying DIs because they are invaluable tools for identifying cis-acting sequences important in virus multiplication and because they offer the opportunity to elucidate mechanisms involved in viral persistence and disease attenuation. Hence our discovery offered a comparably valuable tool for use in plant virus studies for the first time. Since then, we have also discovered the second example of plant viral DI RNAs associated with turnip crinkle virus (TCV), a virus structurally related to TBSV. We proposed a thorough characterization of this unique class of symptom modulating RNAs with the overall objective of identifying viral RNA nucleotide, sequences involved in such fundamental processes as virus replication and encapsidation as well as the degree of symptom expression resulting from the viral-DI-host interaction. The proposed research focused on the molecular characterization of the DI RNAs and the helper virus. We had demonstrated that the DIs were collinear deletion mutants of the genome of a cherry strain of tomato bushy stunt virus (TBSV). We had also shown that these low molecular weight RNAs interfered with the helper plant virus and modulated disease expression by preventing the development of a lethal necrotic disease in susceptible host plants. We also suggested that by exploring the mechanisms associated with the symptom attenuation effect, we might be able to devise novel strategies useful for engineering viral disease resistance.

  2. Latent Herpes Viral Reactivation in Astronauts

    NASA Technical Reports Server (NTRS)

    Pierson, D. L.; Mehta, S. K.; Stowe, R.

    2008-01-01

    Latent viruses are ubiquitous and reactivate during stressful periods with and without symptoms. Latent herpes virus reactivation is used as a tool to predict changes in the immune status in astronauts and to evaluate associated health risks. Methods: Viral DNA was detected by real time polymerase chain reaction in saliva and urine from astronauts before, during and after short and long-duration space flights. Results and Discussion: EpsteinBarr virus (EBV), cytomegalovirus (CMV), and varicella zoster virus (VZV) reactivated, and viral DNA was shed in saliva (EBV and VZV) or urine (CMV). EBV levels in saliva during flight were 10fold higher than baseline levels. Elevations in EBV specific CD8+ T-cells, viral antibody titers, and specific cytokines were consistent with viral reactivation. Intracellular levels of cytokines were reduced in EBVspecific Tcells. CMV, rarely present in urine of healthy individuals, was shed in urine of 27% of astronauts during all phases of spaceflight. VZV, not found in saliva of asymptomatic individuals, was found in saliva of 50% of astronauts during spaceflight and 35 days after flight. VZV recovered from astronaut saliva was found to be live, infectious virus. DNA sequencing demonstrated that the VZV recovered from astronauts was from the common European strain of VZV. Elevation of stress hormones accompanied viral reactivation indicating involvement of the hypothalmic-pituitary-adrenal and sympathetic adrenal-medullary axes in the mechanism of viral reactivation in astronauts. A study of 53 shingles patients found that all shingles patients shed VZV DNA in their saliva and the VZV levels correlated with the severity of the disease. Lower VZV levels in shingles patients were similar to those observed in astronauts. We proposed a rapid, simple, and cost-effective assay to detect VZV in saliva of patients with suspected shingles. Early detection of VZV infection allows early medical intervention.

  3. Metatranscriptomic analysis of extremely halophilic viral communities

    PubMed Central

    Santos, Fernando; Moreno-Paz, Mercedes; Meseguer, Inmaculada; López, Cristina; Rosselló-Mora, Ramon; Parro, Víctor; Antón, Josefa

    2011-01-01

    Hypersaline environments harbour the highest number of viruses reported for aquatic environments. In crystallizer ponds from solar salterns, haloviruses coexist with extremely halophilic Archaea and Bacteria and present a high diversity although little is known about their activity. In this work, we analyzed the viral expression in one crystallizer using a metatranscriptomic approach in which clones from a metaviromic library were immobilized in a microarray and used as probes against total mRNA extracted from the hypersaline community. This approach has two advantages: (i) it overcomes the fact that there is no straightforward, unambiguous way to extract viral mRNA from bulk mRNAs and (ii) it makes the sequencing of all mRNAs unnecessary. Transcriptomic data indicated that the halovirus assemblage was highly active at the time of sampling and the viral groups with the highest expression levels were those related to high GC content haloarchaea and Salinibacter representatives, which are minor components in the environment. Moreover, the changes in the viral expression pattern and in the numbers of free viral particles were analyzed after submitting the samples to two stress conditions: ultraviolet-radiation and dilution. Results showed that Archaea were more sensitive than Bacteria to these stress conditions. The overexpression in the predicted archaeal virus fraction raised and the total numbers of free viruses increased. Furthermore, we identified some very closely related viral clones, displaying single-nucleotide polymorphisms, which were expressed only under certain conditions. These clones could be part of very closely related virus genomes for which we propose the term ‘ecoviriotypes'. PMID:21490689

  4. The Etiology and Pathogenesis of Viral Gastroenteritis.

    DTIC Science & Technology

    1983-07-31

    function in viral gastroenteritis. Ann.Int.Med. 22:370-373,1980. 8. Parrino , T.A., Schreiber, D.S., Trier, J.S., Kapikian, A.Z., Blacklow, N.R.: Clin- ical...subclinical illness. 8. Parrino , T.A., Schreiber, D.S., Trier, J.S., Kapikian, A.Z., Blacklow, N.R.: Clinical immunity in acute gastroenteritis caused...gastric motor function in viral gastroenteritis. Ann.Int.Med. 22:370-373,1980. 8. Parrino , T.A., Schreiber,D.S.,Trier,J.S.,Kapikian,A.Z.,Blacklow, N.R

  5. Arrhythmias in viral myocarditis and pericarditis.

    PubMed

    Baksi, A John; Kanaganayagam, G Sunthar; Prasad, Sanjay K

    2015-06-01

    Acute viral myocarditis and acute pericarditis are self-limiting conditions that run a benign course and that may not involve symptoms that lead to medical assessment. However, ventricular arrhythmia is frequent in viral myocarditis. Myocarditis is thought to account for a large proportion of sudden cardiac deaths in young people without prior structural heart disease. Identification of acute myocarditis either with or without pericarditis is therefore important. However, therapeutic interventions are limited and nonspecific. Identifying those at greatest risk of a life-threatening arrhythmia is critical to reducing the mortality. This review summarizes current understanding of this challenging area in which many questions remain.

  6. Engineering targeted viral vectors for gene therapy.

    PubMed

    Waehler, Reinhard; Russell, Stephen J; Curiel, David T

    2007-08-01

    To achieve therapeutic success, transfer vehicles for gene therapy must be capable of transducing target cells while avoiding impact on non-target cells. Despite the high transduction efficiency of viral vectors, their tropism frequently does not match the therapeutic need. In the past, this lack of appropriate targeting allowed only partial exploitation of the great potential of gene therapy. Substantial progress in modifying viral vectors using diverse techniques now allows targeting to many cell types in vitro. Although important challenges remain for in vivo applications, the first clinical trials with targeted vectors have already begun to take place.

  7. Membranes, peptides, and disease: unraveling the mechanisms of viral proteins with solid state nuclear magnetic resonance spectroscopy.

    PubMed

    Eddy, Matthew T; Yu, Tsyr-Yan

    2014-01-01

    The interplay between peptides and lipid bilayers drives crucial biological processes. For example, a critical step in the replication cycle of enveloped viruses is the fusion of the viral membrane and host cell endosomal membrane, and these fusion events are controlled by viral fusion peptides. Thus such membrane-interacting peptides are of considerable interest as potential pharmacological targets. Deeper insight is needed into the mechanisms by which fusion peptides and other viral peptides modulate their surrounding membrane environment, and also how the particular membrane environment modulates the structure and activity of these peptides. An important step toward understanding these processes is to characterize the structure of viral peptides in environments that are as biologically relevant as possible. Solid state nuclear magnetic resonance (ssNMR) is uniquely well suited to provide atomic level information on the structure and dynamics of both membrane-associated peptides as well as the lipid bilayer itself; further ssNMR can delineate the contribution of specific membrane components, such as cholesterol, or changing cellular conditions, such as a decrease in pH on membrane-associating peptides. This paper highlights recent advances in the study of three types of membrane associated viral peptides by ssNMR to illustrate the more general power of ssNMR in addressing important biological questions involving membrane proteins.

  8. Naf1 Regulates HIV-1 Latency by Suppressing Viral Promoter-Driven Gene Expression in Primary CD4+ T Cells.

    PubMed

    Li, Chuan; Wang, Hai-Bo; Kuang, Wen-Dong; Ren, Xiao-Xin; Song, Shu-Ting; Zhu, Huan-Zhang; Li, Qiang; Xu, Li-Ran; Guo, Hui-Jun; Wu, Li; Wang, Jian-Hua

    2017-01-01

    HIV-1 latency is characterized by reversible silencing of viral transcription driven by the long terminal repeat (LTR) promoter of HIV-1. Cellular and viral factors regulating LTR activity contribute to HIV-1 latency, and certain repressive cellular factors modulate viral transcription silencing. Nef-associated factor 1 (Naf1) is a host nucleocytoplasmic shuttling protein that regulates multiple cellular signaling pathways and HIV-1 production. We recently reported that nuclear Naf1 promoted nuclear export of unspliced HIV-1 gag mRNA, leading to increased Gag production. Here we demonstrate new functions of Naf1 in regulating HIV-1 persistence. We found that Naf1 contributes to the maintenance of HIV-1 latency by inhibiting LTR-driven HIV-1 gene transcription in a nuclear factor kappa B-dependent manner. Interestingly, Naf1 knockdown significantly enhanced viral reactivation in both latently HIV-1-infected Jurkat T cells and primary central memory CD4(+) T cells. Furthermore, Naf1 knockdown in resting CD4(+) T cells from HIV-1-infected individuals treated with antiretroviral therapy significantly increased viral reactivation upon T-cell activation, suggesting an important role of Naf1 in modulating HIV-1 latency in vivo Our findings provide new insights for a better understanding of HIV-1 latency and suggest that inhibition of Naf1 activity to activate latently HIV-1-infected cells may be a potential therapeutic strategy.

  9. ViralORFeome: an integrated database to generate a versatile collection of viral ORFs

    PubMed Central

    Pellet, J.; Tafforeau, L.; Lucas-Hourani, M.; Navratil, V.; Meyniel, L.; Achaz, G.; Guironnet-Paquet, A.; Aublin-Gex, A.; Caignard, G.; Cassonnet, P.; Chaboud, A.; Chantier, T.; Deloire, A.; Demeret, C.; Le Breton, M.; Neveu, G.; Jacotot, L.; Vaglio, P.; Delmotte, S.; Gautier, C.; Combet, C.; Deleage, G.; Favre, M.; Tangy, F.; Jacob, Y.; Andre, P.; Lotteau, V.; Rabourdin-Combe, C.; Vidalain, P. O.

    2010-01-01

    Large collections of protein-encoding open reading frames (ORFs) established in a versatile recombination-based cloning system have been instrumental to study protein functions in high-throughput assays. Such ‘ORFeome’ resources have been developed for several organisms but in virology, plasmid collections covering a significant fraction of the virosphere are still needed. In this perspective, we present ViralORFeome 1.0 (http://www.viralorfeome.com), an open-access database and management system that provides an integrated set of bioinformatic tools to clone viral ORFs in the Gateway® system. ViralORFeome provides a convenient interface to navigate through virus genome sequences, to design ORF-specific cloning primers, to validate the sequence of generated constructs and to browse established collections of virus ORFs. Most importantly, ViralORFeome has been designed to manage all possible variants or mutants of a given ORF so that the cloning procedure can be applied to any emerging virus strain. A subset of plasmid constructs generated with ViralORFeome platform has been tested with success for heterologous protein expression in different expression systems at proteome scale. ViralORFeome should provide our community with a framework to establish a large collection of virus ORF clones, an instrumental resource to determine functions, activities and binding partners of viral proteins. PMID:20007148

  10. ViralORFeome: an integrated database to generate a versatile collection of viral ORFs.

    PubMed

    Pellet, J; Tafforeau, L; Lucas-Hourani, M; Navratil, V; Meyniel, L; Achaz, G; Guironnet-Paquet, A; Aublin-Gex, A; Caignard, G; Cassonnet, P; Chaboud, A; Chantier, T; Deloire, A; Demeret, C; Le Breton, M; Neveu, G; Jacotot, L; Vaglio, P; Delmotte, S; Gautier, C; Combet, C; Deleage, G; Favre, M; Tangy, F; Jacob, Y; Andre, P; Lotteau, V; Rabourdin-Combe, C; Vidalain, P O

    2010-01-01

    Large collections of protein-encoding open reading frames (ORFs) established in a versatile recombination-based cloning system have been instrumental to study protein functions in high-throughput assays. Such 'ORFeome' resources have been developed for several organisms but in virology, plasmid collections covering a significant fraction of the virosphere are still needed. In this perspective, we present ViralORFeome 1.0 (http://www.viralorfeome.com), an open-access database and management system that provides an integrated set of bioinformatic tools to clone viral ORFs in the Gateway(R) system. ViralORFeome provides a convenient interface to navigate through virus genome sequences, to design ORF-specific cloning primers, to validate the sequence of generated constructs and to browse established collections of virus ORFs. Most importantly, ViralORFeome has been designed to manage all possible variants or mutants of a given ORF so that the cloning procedure can be applied to any emerging virus strain. A subset of plasmid constructs generated with ViralORFeome platform has been tested with success for heterologous protein expression in different expression systems at proteome scale. ViralORFeome should provide our community with a framework to establish a large collection of virus ORF clones, an instrumental resource to determine functions, activities and binding partners of viral proteins.

  11. Viral hepatitis in the Arctic. A review from a Circumpolar Workshop on Viral hepatitis, ICCH13.

    PubMed

    Tulisov, Andrei; McMahon, Brian J; Koch, Anders; Minuk, Gerald; Chulanov, Vladimir; Bruce, Michael G; Uhanova, Julia; Børresen, Malene; Williams, James; Osiowy, Carla; Gelvan, Allan; Alexeeva, Marfa; Larke, Bryce; Watt, Kymberly

    2007-01-01

    This article is a review of the viral hepatitis workshop, held during the 13th International Congress of the Circumpolar Health consists of a review of data on viral hepatitis in the Arctic territories of four countries: Canada, Greenland, Russia and United States (Alaska). The main purpose of the workshop was to exchange knowledge on viral hepatitis in the Arctic and identify further needs for collaborative hepatitis research, which is planned to be implemented through the established Viral Hepatitis Working Group in the Arctic. The review is based on the available published research results, surveillance data and professional opinions of the authors. The information is presented by Arctic country. Viral hepatitis constitutes an important problem among Aboriginal peoples of the Arctic; the incidence of most types of viral hepatitis is higher among indigenous populations than in the general public. However, due to differences in the available information from each of the four Arctic countries, it is difficult to compare differences in types of disease in them. The main areas for future research are: HBV genotypes distribution, relations between different types of HBV, HCV and disease outcomes, HBV mutation rate and specific substitutions in the HBV genome over time in the Arctic, and occurrence of active liver disease in HBsAg carriers living in the Arctic, as well as further research in viral hepatitis A, C, D and E.

  12. Right Cervical Vagotomy Aggravates Viral Myocarditis in Mice Via the Cholinergic Anti-inflammatory Pathway

    PubMed Central

    Li-Sha, Ge; Xing-Xing, Chen; Lian-Pin, Wu; De-Pu, Zhou; Xiao-Wei, Li; Jia-Feng, Lin; Yue-Chun, Li

    2017-01-01

    The autonomic nervous system dysfunction with increased sympathetic activity and withdrawal of vagal activity may play an important role in the pathogenesis of viral myocarditis. The vagus nerve can modulate the immune response and control inflammation through a ‘cholinergic anti-inflammatory pathway’ dependent on the α7-nicotinic acetylcholine receptor (α7nAChR). Although the role of β-adrenergic stimulation on viral myocarditis has been investigated in our pervious studies, the direct effect of vagal tone in this setting has not been yet studied. Therefore, in the present study, we investigated the effects of cervical vagotomy in a murine model of viral myocarditis. In a coxsackievirus B3 murine myocarditis model (Balb/c), effects of right cervical vagotomy and nAChR agonist nicotine on echocardiography, myocardial histopathology, viral RNA, and proinflammatory cytokine levels were studied. We found that right cervical vagotomy inhibited the cholinergic anti-inflammatory pathway, aggravated myocardial lesions, up-regulated the expression of TNF-α, IL-1β, and IL-6, and worsened the impaired left ventricular function in murine viral myocarditis, and these changes were reversed by co-treatment with nicotine by activating the cholinergic anti-inflammatory pathway. These results indicate that vagal nerve plays an important role in mediating the anti-inflammatory effect in viral myocarditis, and that cholinergic stimulation with nicotine also plays its peripheral anti-inflammatory role relying on α7nAChR, without requirement for the integrity of vagal nerve in the model. The findings suggest that vagus nerve stimulation mediated inhibition of the inflammatory processes likely provide important benefits in myocarditis treatment. PMID:28197102

  13. MicroRNA regulation of viral immunity, latency, and carcinogenesis of selected tumor viruses and HIV.

    PubMed

    Wang, Ling; Li, Guangyu; Yao, Zhi Q; Moorman, Jonathan P; Ning, Shunbin

    2015-09-01

    MicroRNAs (miRNAs) function as key regulators in immune responses and cancer development. In the contexts of infection with oncogenic viruses, miRNAs are engaged in viral persistence, latency establishment and maintenance, and oncogenesis. In this review, we summarize the potential roles and mechanisms of viral and cellular miRNAs in the host-pathogen interactions during infection with selected tumor viruses and HIV, which include (i) repressing viral replication and facilitating latency establishment by targeting viral transcripts, (ii) evading innate and adaptive immune responses via toll-like receptors, RIG-I-like receptors, T-cell receptor, and B-cell receptor pathways by targeting signaling molecules such as TRAF6, IRAK1, IKKε, and MyD88, as well as downstream targets including regulatory cytokines such as tumor necrosis factor α, interferon γ, interleukin 10, and transforming growth factor β, (iii) antagonizing intrinsic and extrinsic apoptosis pathways by targeting pro-apoptotic or anti-apoptotic gene transcripts such as the Bcl-2 family and caspase-3, (iv) modulating cell proliferation and survival through regulation of the Wnt, PI3K/Akt, Erk/MAPK, and Jak/STAT signaling pathways, as well as the signaling pathways triggered by viral oncoproteins such as Epstein-Barr Virus LMP1, by targeting Wnt-inhibiting factor 1, SHIP, pTEN, and SOCSs, and (v) regulating cell cycle progression by targeting cell cycle inhibitors such as p21/WAF1 and p27/KIP1. Further elucidation of the interaction between miRNAs and these key biological events will facilitate our understanding of the pathogenesis of viral latency and oncogenesis and may lead to the identification of miRNAs as novel targets for developing new therapeutic or preventive interventions.

  14. Firefighting Module

    NASA Technical Reports Server (NTRS)

    1978-01-01

    NASA and the U.S. Coast Guard are working jointly to develop a helicopter transportable firefighting module that can shave precious minutes in combating shipboard or harbor fires. The program was undertaken in 1975, after a series of disastrous fires on oil tankers indicated a need for a lightweight, self-contained system that could be moved quickly to the scene of a fire. A prototype module was delivered to the Coast Guard last year and service testing is under way. The compact module weighs little more than a ton but it contains everything needed to fight a fire. The key component is a high output pump, which delivers up to 2,000 gallons of sea water a minute; the pump can be brought up to maximum output in only one minute after turning on the power source, a small Allison gas turbine engine. The module also contains hose, a foam nozzle and a spray nozzle, three sets of protective clothing for firefighters, and fuel for three hours operation. Designed to be assembled without special tools, the module can be set up for operation in less than 20 minutes.

  15. Inhibition of LSD1 reduces herpesvirus infection, shedding, and recurrence by promoting epigenetic suppression of viral genomes

    PubMed Central

    Hill, James M.; Quenelle, Debra C.; Cardin, Rhonda D.; Vogel, Jodi L.; Clement, Christian; Bravo, Fernando J.; Foster, Timothy P.; Bosch-Marce, Marta; Raja, Priya; Lee, Jennifer S.; Bernstein, David I.; Krause, Philip R.; Knipe, David M.; Kristie, Thomas M.

    2015-01-01

    The high prevalence of Herpesviruses in the population and the maintenance of lifelong latent reservoirs are challenges to the control of herpetic diseases, despite the availability of antiviral pharmaceuticals that target viral DNA replication. In addition to oral and genital lesions, herpes simplex virus infections and recurrent reactivations from the latent pool can result in severe pathology including neonatal infection and mortality, blindness due to ocular keratitis, and viral-induced complications in immunosuppressed individuals. Herpesviruses, like their cellular hosts, are subject to the regulatory impacts of chromatin and chromatin modulation machinery that promotes or suppresses gene expression. The initiation of herpes simplex virus infection and reactivation from latency is dependent on a transcriptional coactivator complex that contains two required histone demethylases, LSD1 and JMJD2s. Inhibition of either of these enzymes results in heterochromatic suppression of the viral genome and a block to infection and reactivation in vitro. Here, the concept of epigenetic suppression of viral infection is demonstrated in three animal models of herpes simplex virus infection and disease. Inhibition of LSD1 via treatment of animals with the monoamine oxidase inhibitor tranylcypromine results in suppression of viral lytic infection, subclinical shedding, and reactivation from latency in vivo. Phenotypic suppression is correlated with enhanced epigenetic suppression of the viral genome and suggests that, even during latency, the chromatin state of the virus is dynamic. Given the expanding development of epipharmaceuticals, this approach has substantial potential for anti-herpetic treatments with distinct advantages over the present pharmaceutical options. PMID:25473037

  16. Non-viral gene delivery using nanoparticles.

    PubMed

    Ditto, Andrew J; Shah, Parth N; Yun, Yang H

    2009-11-01

    Although the potential benefits of gene therapy for the treatment of acquired and inherited genetic diseases have been demonstrated through preclinical studies, the results of human gene therapy trials have been disappointing. Recombinant viruses are the primary vectors of choice because of their ability to protect genetic materials, cross cellular membranes, escape from endosomes and transport their genetic materials into the nucleus. Unfortunately, viral vectors have been unable to gain widespread clinical application because of their toxicity and immunogenicity. Consequently, the need for safer alternatives has led to the development of liposomes, cationic polyplexes, microparticles and nanoparticles. Although these alternative vectors have shown promise, degradable nanoparticles are the only non-viral vectors that can provide a targeted intracellular delivery with controlled release properties. Furthermore, the potential advantage of degradable nanoparticles over their non-degradable counterparts is the reduced toxicity and the avoidance of accumulation within the target tissue after repeated administration. In this article, current non-viral gene delivery devices are reviewed with a special emphasis on nanoparticle gene delivery systems. Also, the authors highlight their philosophy and efforts on the development of l-tyrosine-based polyphosphate nanoparticle-based non-viral gene delivery systems and assess the potential benefits and shortcomings of their approach.

  17. Viral genome sequencing bt random priming methods

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Most emerging health threats are of zoonotic origin. For the overwhelming majority, their causative agents are viruses which include but are not limited to HIV, Influenza, SARS, Ebola, Dengue, and Hantavirus. Of increasing importance therefore is an understanding of the viral diversity to enable b...

  18. Neutron diffraction studies of viral fusion peptides

    NASA Astrophysics Data System (ADS)

    Bradshaw, Jeremy P.; J. M. Darkes, Malcolm; Katsaras, John; Epand, Richard M.

    2000-03-01

    Membrane fusion plays a vital role in a large and diverse number of essential biological processes. Despite this fact, the precise molecular events that occur during fusion are still not known. We are currently engaged on a study of membrane fusion as mediated by viral fusion peptides. These peptides are the N-terminal regions of certain viral envelope proteins that mediate the process of fusion between the viral envelope and the membranes of the host cell during the infection process. As part of this study, we have carried out neutron diffraction measurements at the ILL, BeNSC and Chalk River, on a range of viral fusion peptides. The peptides, from simian immunodeficiency virus (SIV), influenza A and feline leukaemia virus (FeLV), were incorporated into stacked phospholipid bilayers. Some of the peptides had been specifically deuterated at key amino acids. Lamellar diffraction data were collected and analysed to yield information on the peptide conformation, location and orientation relative to the bilayer.

  19. Interferon Induced Transfer of Viral Resistance

    DTIC Science & Technology

    1980-02-01

    interferon: We decided that rather than first studying induction of tyrosinase in melanoma cells or plasminogen activator in ovarian granulosa cells as...177-184 (HP Publishing, New York). 14. Lockhart, R.Z. (1973). Criteria for acceptance of a viral inhibitor as an interferon and a general

  20. Diagnosis and treatment of viral encephalitis

    PubMed Central

    Chaudhuri, A; Kennedy, P

    2002-01-01

    Acute encephalitis constitutes a medical emergency. In most cases, the presence of focal neurological signs and focal seizures will distinguish encephalitis from encephalopathy. Acute disseminated encephalomyelitis is a non-infective inflammatory encephalitis that may require to be treated with steroids. Acute infective encephalitis is usually viral. Herpes simplex encephalitis (HSE) is the commonest sporadic acute viral encephalitis in the Western world. Magnetic resonance imaging of brain is the investigation of choice in HSE and the diagnosis may be confirmed by the polymerase chain reaction test for the virus in the cerebrospinal fluid. In this article, we review the diagnosis, investigations, and management of acute encephalitis. With few exceptions (for example, aciclovir for HSE), no specific therapy is available for most forms of viral encephalitis. Mortality and morbidity may be high and long term sequelae are known among survivors. The emergence of unusual forms of zoonotic encephalitis has posed an important public health problem. Vaccination and vector control measures are useful preventive strategies in certain arboviral and zoonotic encephalitis. However, we need better antiviral therapy to meet the challenge of acute viral encephalitis more effectively. PMID:12415078

  1. Visualizing viral transport and host infection

    NASA Astrophysics Data System (ADS)

    Son, Kwangmin; Guasto, Jeffrey; Cubillos-Ruiz, Andres; Sullivan, Matthew; Stocker, Roman; MIT Team

    2013-11-01

    A virus is a non-motile infectious agent that can only replicate inside a living host. They consist of a <100 nm diameter capsid which houses their DNA, and a <20 nm diameter tail used to inject DNA to the host, which are classified into three different morphologies by the tail type: short tail (~ 10 nm, podovirus), rigid contractile tail (~ 100 nm, myovirus), or flexible noncontractile tail (~ 300 nm, siphovirus). Combining microfluidics with epifluorescent microscopy, we studied the simultaneous diffusive transport governing the initial encounter and ultimately the infection of a non-motile cyanobacteria host (~ 1 μm prochlorococcus) and their viral (phage) counterparts in real time. This methodology allows us to quantify the virus-host encounter/adsorption dynamics and subsequently the effectiveness of various tail morphologies for viral infection. Viral transport and the role of viral morphology in host-virus interactions are critical to our understanding of both ecosystem dynamics and human health, as well as to the evolution of virus morphology.

  2. Firefighting Module

    NASA Technical Reports Server (NTRS)

    1980-01-01

    Aviation Power Supply's mobile firefighting module called Firefly II is mounted on a trailer pulled by a pickup truck. Trailer unit has two three- inch water cannons, and the pickup carries a six inch cannon. Completely self contained, module pumps 3,000 gallons of water a minute from hydrants or open bodies of water. Stream can go as far as 400 feet or can be employed in a high-loft mode to reach the tops of tall refinery towers. Compact Firefly II weighs only 2,500 pounds when fully fueled. Key component is a specially designed two stage pump. Power for the pump is generated by a gas turbine engine. Module also includes an electronic/pump controller, multiple hose connections, up to 1,500 feet of hose and fuel for four hours operation. Firefly trailer can be backed onto specially-built large fireboat.

  3. Firefighting Module

    NASA Technical Reports Server (NTRS)

    1981-01-01

    Aviation Power Supply's mobile firefighting module called Firefly II is mounted on a trailer pulled by a pickup truck. Trailer unit has two three- inch water cannons, and the pickup carries a six inch cannon. Completely self contained, module pumps 3,000 gallons of water a minute from hydrants or open bodies of water. Stream can go as far as 400 feet or can be employed in a high-loft mode to reach the tops of tall refinery towers. Compact Firefly II weighs only 2,500 pounds when fully fueled. Key component is a specially designed two stage pump. Power for the pump is generated by a gas turbine engine. Module also includes an electronic/pump controller, multiple hose connections, up to 1,500 feet of hose and fuel for four hours operation. Firefly trailer can be backed onto specially-built large fireboat.

  4. Viral detection using DNA functionalized gold filaments†

    PubMed Central

    Perez, Jonas W.; Haselton, Frederick R.

    2010-01-01

    Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5′ [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3′ covalently attached to a 5 cm length of a 100 μm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 μm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 μL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was ~200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting. PMID:20448919

  5. Plant viral vectors for delivery by Agrobacterium.

    PubMed

    Gleba, Yuri Y; Tusé, Daniel; Giritch, Anatoli

    2014-01-01

    Plant viral vectors delivered by Agrobacterium are the basis of several manufacturing processes that are currently in use for producing a wide range of proteins for multiple applications, including vaccine antigens, antibodies, protein nanoparticles such as virus-like particles (VLPs), and other protein and protein-RNA scaffolds. Viral vectors delivered by agrobacterial T-DNA transfer (magnifection) have also become important tools in research. In recent years, essential advances have been made both in the development of second-generation vectors designed using the 'deconstructed virus' approach, as well as in the development of upstream manufacturing processes that are robust and fully scalable. The strategy relies on Agrobacterium as a vector to deliver DNA copies of one or more viral RNA/DNA replicons; the bacteria are delivered into leaves by vacuum infiltration, and the viral machinery takes over from the point of T-DNA transfer to the plant cell nucleus, driving massive RNA and protein production and, if required, cell-to-cell spread of the replicons. Among the most often used viral backbones are those of the RNA viruses Tobacco mosaic virus (TMV), Potato virus X (PVX) and Cowpea mosaic virus (CPMV), and the DNA geminivirus Bean yellow dwarf virus. Prototypes of industrial processes that provide for high yield, rapid scale up and fast manufacturing cycles have been designed, and several GMP-compliant and GMP-certified manufacturing facilities are in place. These efforts have been successful as evidenced by the fact that several antibodies and vaccine antigens produced by magnifection are currently in clinical development.

  6. Thermionic modules

    DOEpatents

    King, Donald B.; Sadwick, Laurence P.; Wernsman, Bernard R.

    2002-06-18

    Modules of assembled microminiature thermionic converters (MTCs) having high energy-conversion efficiencies and variable operating temperatures manufactured using MEMS manufacturing techniques including chemical vapor deposition. The MTCs incorporate cathode to anode spacing of about 1 micron or less and use cathode and anode materials having work functions ranging from about 1 eV to about 3 eV. The MTCs also exhibit maximum efficiencies of just under 30%, and thousands of the devices and modules can be fabricated at modest costs.

  7. Inhibition of viral RNA synthesis in canine distemper virus infection by proanthocyanidin A2.

    PubMed

    Gallina, Laura; Dal Pozzo, Fabiana; Galligioni, Viola; Bombardelli, Ezio; Scagliarini, Alessandra

    2011-12-01

    Canine distemper virus (CDV) is a contagious and multisystemic viral disease that affects domestic and wild canines as well as other terrestrial and aquatic carnivores. The disease in dogs is often fatal and no specific antiviral therapy is currently available. In this study, we evaluated the in vitro antiviral activity against CDV of proanthocyanidin A2 (PA2), a phenolic dimer belonging to the class of condensed tannins present in plants. Our results showed that PA2 exerted in vitro antiviral activity against CDV with a higher selectivity index compared to ribavirin, included in our study for the previously tested anti-CDV activity. The time of addition assay led us to observe that PA2 was able to decrease the viral RNA synthesis and to reduce progeny virus liberation, at different times post infection suggesting multiple mechanisms of action including inhibition of viral replicative complex and modulation of the redox milieu. These data suggest that PA2, isolated from the bark of Aesculus hippocastanum, has potential usefulness as an anti-CDV compound inhibiting viral replication.

  8. US28, a Virally-Encoded GPCR as an Antiviral Target for Human Cytomegalovirus Infection

    PubMed Central

    Lee, Sungjin; Chung, Yoon Hee; Lee, Choongho

    2017-01-01

    Viruses continue to evolve a new strategy to take advantage of every aspect of host cells in order to maximize their survival. Due to their central roles in transducing a variety of transmembrane signals, GPCRs seem to be a prime target for viruses to pirate for their own use. Incorporation of GPCR functionality into the genome of herpesviruses has been demonstrated to be essential for pathogenesis of many herpesviruses-induced diseases. Here, we introduce US28 of human cytomegalovirus (HCMV) as the best-studied example of virally-encoded GPCRs to manipulate host GPCR signaling. In this review, we wish to summarize a number of US28-related topics including its regulation of host signaling pathways, its constitutive internalization, its structural and functional analysis, its roles in HCMV biology and pathogenesis, its proliferative activities and role in oncogenesis, and pharmacological modulation of its biological activities. This review will aid in our understanding of how pathogenic viruses usurp the host GPCR signaling for successful viral infection. This kind of knowledge will enable us to build a better strategy to control viral infection by normalizing the virally-dysregulated host GPCR signaling. PMID:28035083

  9. Positive-strand RNA viruses stimulate host phosphatidylcholine synthesis at viral replication sites

    PubMed Central

    Zhang, Jiantao; Zhang, Zhenlu; Chukkapalli, Vineela; Nchoutmboube, Jules A.; Li, Jianhui; Randall, Glenn; Belov, George A.; Wang, Xiaofeng

    2016-01-01

    All positive-strand RNA viruses reorganize host intracellular membranes to assemble their viral replication complexes (VRCs); however, how these viruses modulate host lipid metabolism to accommodate such membrane proliferation and rearrangements is not well defined. We show that a significantly increased phosphatidylcholine (PC) content is associated with brome mosaic virus (BMV) replication in both natural host barley and alternate host yeast based on a lipidomic analysis. Enhanced PC levels are primarily associated with the perinuclear ER membrane, where BMV replication takes place. More specifically, BMV replication protein 1a interacts with and recruits Cho2p (choline requiring 2), a host enzyme involved in PC synthesis, to the site of viral replication. These results suggest that PC synthesized at the site of VRC assembly, not the transport of existing PC, is responsible for the enhanced accumulation. Blocking PC synthesis by deleting the CHO2 gene resulted in VRCs with wider diameters than those in wild-type cells; however, BMV replication was significantly inhibited, highlighting the critical role of PC in VRC formation and viral replication. We further show that enhanced PC levels also accumulate at the replication sites of hepatitis C virus and poliovirus, revealing a conserved feature among a group of positive-strand RNA viruses. Our work also highlights a potential broad-spectrum antiviral strategy that would disrupt PC synthesis at the sites of viral replication but would not alter cellular processes. PMID:26858414

  10. The universal epitope of influenza A viral neuraminidase fundamentally contributes to enzyme activity and viral replication.

    PubMed

    Doyle, Tracey M; Jaentschke, Bozena; Van Domselaar, Gary; Hashem, Anwar M; Farnsworth, Aaron; Forbes, Nicole E; Li, Changgui; Wang, Junzhi; He, Runtao; Brown, Earl G; Li, Xuguang

    2013-06-21

    The only universally conserved sequence among all influenza A viral neuraminidases is located between amino acids 222 and 230. However, the potential roles of these amino acids remain largely unknown. Through an array of experimental approaches including mutagenesis, reverse genetics, and growth kinetics, we found that this sequence could markedly affect viral replication. Additional experiments revealed that enzymes with mutations in this region demonstrated substantially decreased catalytic activity, substrate binding, and thermostability. Consistent with viral replication analyses and enzymatic studies, protein modeling suggests that these amino acids could either directly bind to the substrate or contribute to the formation of the active site in the enzyme. Collectively, these findings reveal the essential role of this unique region in enzyme function and viral growth, which provides the basis for evaluating the validity of this sequence as a potential target for antiviral intervention and vaccine development.

  11. The role of viral and host microRNAs in the Aujeszky's disease virus during the infection process.

    PubMed

    Timoneda, Oriol; Núñez-Hernández, Fernando; Balcells, Ingrid; Muñoz, Marta; Castelló, Anna; Vera, Gonzalo; Pérez, Lester J; Egea, Raquel; Mir, Gisela; Córdoba, Sarai; Rosell, Rosa; Segalés, Joaquim; Tomàs, Anna; Sánchez, Armand; Núñez, José I

    2014-01-01

    Porcine production is a primary market in the world economy. Controlling swine diseases in the farm is essential in order to achieve the sector necessities. Aujeszky's disease is a viral condition affecting pigs and is endemic in many countries of the world, causing important economic losses in the swine industry. microRNAs (miRNAs) are non-coding RNAs which modulates gene expression in animals, plants and viruses. With the aim of understanding miRNA roles during the Aujeszky's disease virus [ADV] (also known as suid herpesvirus type 1 [SuHV-1]) infection, the expression profiles of host and viral miRNAs were determined through deep sequencing in SuHV-1 infected porcine cell line (PK-15) and in an animal experimental SuHV-1 infection with virulent (NIA-3) and attenuated (Begonia) strains. In the in vivo approach miR-206, miR-133a, miR-133b and miR-378 presented differential expression between virus strains infection. In the in vitro approach, most miRNAs were down-regulated in infected groups. miR-92a and miR-92b-3p were up-regulated in Begonia infected samples. Functional analysis of all this over expressed miRNAs during the infection revealed their association in pathways related to viral infection processes and immune response. Furthermore, 8 viral miRNAs were detected by stem loop RT-qPCR in both in vitro and in vivo approaches, presenting a gene regulatory network affecting 59 viral genes. Most described viral miRNAs were related to Large Latency Transcript (LLT) and to viral transcription activators EP0 and IE180, and also to regulatory genes regarding their important roles in the host-pathogen interaction during viral infection.

  12. Innate immune restriction and antagonism of viral RNA lacking 2'-O methylation

    SciTech Connect

    Hyde, Jennifer L.; Diamond, Michael S.

    2015-05-15

    N-7 and 2′-O methylation of host cell mRNA occurs in the nucleus and results in the generation of cap structures (cap 0, m{sup 7}GpppN; cap 1, m{sup 7}GpppNm) that control gene expression by modulating nuclear export, splicing, turnover, and protein synthesis. Remarkably, RNA cap modification also contributes to mammalian cell host defense as viral RNA lacking 2′-O methylation is sensed and inhibited by IFIT1, an interferon (IFN) stimulated gene (ISG). Accordingly, pathogenic viruses that replicate in the cytoplasm have evolved mechanisms to circumvent IFIT1 restriction and facilitate infection of mammalian cells. These include: (a) generating cap 1 structures on their RNA through cap-snatching or virally-encoded 2′-O methyltransferases, (b) using cap-independent means of translation, or (c) using RNA secondary structural motifs to antagonize IFIT1 binding. This review will discuss new insights as to how specific modifications at the 5′-end of viral RNA modulate host pathogen recognition responses to promote infection and disease.

  13. Cellular versus viral microRNAs in host–virus interaction

    PubMed Central

    Ghosh, Zhumur; Mallick, Bibekanand; Chakrabarti, Jayprokas

    2009-01-01

    MicroRNAs (miRNAs) mark a new paradigm of RNA-directed gene expression regulation in a wide spectrum of biological systems. These small non-coding RNAs can contribute to the repertoire of host-pathogen interactions during viral infection. This interplay has important consequences, both for the virus and the host. There have been reported evidences of host-cellular miRNAs modulating the expression of various viral genes, thereby playing a pivotal role in the host–pathogen interaction network. In the hide-and-seek game between the pathogens and the infected host, viruses have evolved highly sophisticated gene-silencing mechanisms to evade host-immune response. Recent reports indicate that virus too encode miRNAs that protect them against cellular antiviral response. Furthermore, they may exploit the cellular miRNA pathway to their own advantage. Nevertheless, our increasing knowledge of the host–virus interaction at the molecular level should lead us toward possible explanations to viral tropism, latency and oncogenesis along with the development of an effective, durable and nontoxic antiviral therapy. Here, we summarize the recent updates on miRNA-induced gene-silencing mechanism, modulating host–virus interactions with a glimpse of the miRNA-based antiviral therapy for near future. PMID:19095692

  14. Viral immunoblotting: a sensitive method for detecting viral-specific oliogoclonal bands in unconcentrated cerebrospinal fluid.

    PubMed

    Moyle, S; Keir, G; Thompson, E J

    1984-06-01

    A new method for detecting viral antibodies in cerebrospinal fluid is described. The technique has many advantages over previously published methods in that it is highly sensitive eliminating the need to concentrate the CSF, takes 5 h to complete, avoids the use of radionucleides, and most importantly circumvents problems associated with prozone effects which occur in immunoprecipitation reaction since the viral antigen is immobilized on nitrocellulose membranes.

  15. Improving Protection against Viral Aerosols Through Development of Novel Decontamination Methods and Characterization of Viral Aerosol

    DTIC Science & Technology

    2012-04-01

    AFRL-RX-TY-TP-2012-0040 IMPROVING PROTECTION AGAINST VIRAL AEROSOLS THROUGH DEVELOPMENT OF NOVEL DECONTAMINATION METHODS AND CHARACTERIZATION...Include area code) 16-APR-2012 Technical Paper (Thesis) 15-SEP-2007 -- 30-APR-2012 Improving Protection against Viral Aerosols Through Development of...medium showed that artificial saliva (AS) and beef serum extract (BE) produce a protective effect against UV compared to deionized (DI) water, that RH was

  16. Type I IFN Signaling Is Dispensable during Secondary Viral Infection

    PubMed Central

    Hosking, Martin P.; Flynn, Claudia T.; Whitton, J. Lindsay

    2016-01-01

    Innate immune responses in general, and type I interferons (T1IFNs) in particular, play an important and often essential role during primary viral infections, by directly combatting the virus and by maximizing the primary adaptive immune response. Several studies have suggested that T1IFNs also contribute very substantially to the secondary (recall) response; they are thought (i) to be required to drive the early attrition of memory T cells, (ii) to support the subsequent expansion of surviving virus-specific memory cells, and (iii) to assist in the suppression and clearance of the infectious agent. However, many of these observations were predicated upon models in which T1IFN signaling was interrupted prior to a primary immune response, raising the possibility that the resulting memory cells might be intrinsically abnormal. We have directly addressed this by using an inducible-Cre model system in which the host remains genetically-intact during the primary response to infection, and in which T1IFN signaling can be effectively ablated prior to secondary viral challenge. We report that, in stark contrast to primary infection, T1IFN signaling is not required during the recall response. IFNαβR-deficient memory CD8+ and CD4+ memory T cells undergo attrition and expansion with kinetics that are indistinguishable from those of receptor-sufficient cells. Moreover, even in the absence of functional T1IFN signaling, the host’s immune capacity to rapidly suppress, and then to eradicate, a secondary infection remains intact. Thus, this study shows that T1IFN signaling is dispensable during the recall response to a virus infection. Moreover, two broader implications may be drawn. First, a T cell’s requirement for a cytokine is highly dependent on the cell’s maturation / differentiation status. Consequently, second, these data underscore the importance of evaluating a gene’s impact by modulating its expression or function in a temporally-controllable manner. PMID

  17. Phosphorylation events during viral infections provide potential therapeutic targets

    PubMed Central

    Keating, Julie A.; Striker, Rob

    2012-01-01

    SUMMARY For many medically relevant viruses, there is now considerable evidence that both viral and cellular kinases play important roles in viral infection. Ultimately, these kinases, and the cellular signaling pathways that they exploit, may serve as therapeutic targets for treating patients. Currently, small molecule inhibitors of kinases are under investigation as therapy for herpes viral infections. Additionally, a number of cellular or host-directed tyrosine kinase inhibitors that have been previously FDA-approved for cancer treatment are under study in animal models and clinical trials, as they have shown promise for the treatment of various viral infections as well. This review will highlight the wide range of viral proteins phosphorylated by viral and cellular kinases, and the potential for variability of kinase recognition sites within viral substrates to impact phosphorylation and kinase prediction. Research studying kinase-targeting prophylactic and therapeutic treatments for a number of viral infections will also be discussed. PMID:22113983

  18. Comparative Viral Metagenomics of Environmental Samples from Korea

    PubMed Central

    Kim, Min-Soo; Whon, Tae Woong

    2013-01-01

    The introduction of metagenomics into the field of virology has facilitated the exploration of viral communities in various natural habitats. Understanding the viral ecology of a variety of sample types throughout the biosphere is important per se, but it also has potential applications in clinical and diagnostic virology. However, the procedures used by viral metagenomics may produce technical errors, such as amplification bias, while public viral databases are very limited, which may hamper the determination of the viral diversity in samples. This review considers the current state of viral metagenomics, based on examples from Korean viral metagenomic studies-i.e., rice paddy soil, fermented foods, human gut, seawater, and the near-surface atmosphere. Viral metagenomics has become widespread due to various methodological developments, and much attention has been focused on studies that consider the intrinsic role of viruses that interact with their hosts. PMID:24124407

  19. Disparities in HIV/AIDS, Viral Hepatitis, STDs, and TB

    MedlinePlus

    ... Submit Search The CDC Health Disparities in HIV/AIDS, Viral Hepatitis, STDs, and TB Note: Javascript is ... Hawaiians/Other Pacific Islanders MMWR Publications HIV and AIDS Viral Hepatitis STDs Tuberculosis Training and Networking Resources ...

  20. Kinetics of viral shedding provide insights into the epidemiology of viral hemorrhagic septicemia in Pacific herring

    USGS Publications Warehouse

    Hershberger, P.; Gregg, J.; Grady, C.; Collins, R.; Winton, J.

    2010-01-01

    Losses from infectious diseases are an important component of natural mortality among marine fish species, but factors controlling the ecology of these diseases and their potential responses to anthropogenic changes are poorly understood. We used viral hemorrhagic septicemia virus (VHSV) and a laboratory stock of Pacific herring Clupea pallasii to investigate the kinetics of viral shedding and its effect on disease transmission and host mortality. Outbreaks of acute disease, accompanied by mortality and viral shedding, were initiated after waterborne exposure of herring to concentrations of VHSV as low as 10 1 plaque-forming units (pfu) ml-1. Shed virus in flow-through tanks was first detected 4 to 5 d post-exposure, peaked after 6 to 10 d, and was no longer detected after 16 d. Shedding rates, calculated from density, flow and waterborne virus titer reached 1.8 to 5.0 ?? ?10 8 pfu fish-1 d-1. Onset of viral shedding was dose-dependent and preceded initial mortality by 2 d. At 21 d, cumulative mortality in treatment groups ranged from 81 to 100% and was dependent not on challenge dose, but on the kinetics and level of viral shedding by infected fish in the tank. Possible consequences of the viral shedding and disease kinetics are discussed in the context of epizootic initiation and perpetuation among populations of wild Pacific herring. ?? Inter-Research 2010.

  1. Kinetics of viral shedding provide insights into the epidemiology of viral hemorrhagic septicemia in Pacific herring

    USGS Publications Warehouse

    Hershberger, Paul K.; Gregg, Jacob L.; Winton, James R.; Grady, Courtney; Collins, Rachael

    2010-01-01

    Losses from infectious diseases are an important component of natural mortality among marine fish species, but factors controlling the ecology of these diseases and their potential responses to anthropogenic changes are poorly understood. We used viral hemorrhagic septicemia virus (VHSV) and a laboratory stock of Pacific herring Clupea pallasii to investigate the kinetics of viral shedding and its effect on disease transmission and host mortality. Outbreaks of acute disease, accompanied by mortality and viral shedding, were initiated after waterborne exposure of herring to concentrations of VHSV as low as 101 plaque-forming units (pfu) ml–1. Shed virus in flow-through tanks was first detected 4 to 5 d post-exposure, peaked after 6 to 10 d, and was no longer detected after 16 d. Shedding rates, calculated from density, flow and waterborne virus titer reached 1.8 to 5.0 × 108 pfu fish–1 d–1. Onset of viral shedding was dose-dependent and preceded initial mortality by 2 d. At 21 d, cumulative mortality in treatment groups ranged from 81 to 100% and was dependent not on challenge dose, but on the kinetics and level of viral shedding by infected fish in the tank. Possible consequences of the viral shedding and disease kinetics are discussed in the context of epizootic initiation and perpetuation among populations of wild Pacific herring.

  2. Adenovirus-Mediated Gene Therapy Against Viral Biothreat Agents

    DTIC Science & Technology

    2016-04-12

    economy. Vaccine development is an important strategy to thwart the threat of these viral biothreat agents. There is an urgent need to improve...Alberta, Tl A 8K6. Canada E-mail: josh. wu@drdc-rddc.gc.ca .• 78 JoshQ.H. Wu existing vaccines against these agents and to develop new ones. Gene...of vaccines against viral biothreat agents. Genes encoding protective antigens of viral biothreat agents can be carried by these viral vectors and

  3. [Clinical aspects of viral hemorrhagic fever].

    PubMed

    Saijo, Masayuki

    2005-12-01

    Viral hemorrhagic fever (VHF) is defined as virus infections that usually cause pyrexia and hemorrhagic symptoms with multiple organ failure. VHF includes following viral infections: Ebola hemorrhagic fever (EHF), Marburg hemorrhagic fever (MHF), Crimean-Congo hemorrhagic fever (CCHF) and Lassa fever. In particular, the causative agents of EHF, MHF, CCHF, and Lassa fever are Ebola, Marburg, CCHF, Lassa viruses, respectively, and regarded as biosafety level-4 pathogens because of their high virulence to humans. Recently, relatively large outbreaks of EHF and MHF have occurred in Africa, and areas of EHF- and MHF-outbreaks seem to be expanding. Although outbreaks of VHF have not been reported in Japan, there is a possibility that the deadly hemorrhagic fever viruses would be introduced to Japan in future. Therefore, preparedness for possible future outbreaks of VHF is necessary in areas without VHF outbreaks.

  4. Crosslinking in viral capsids via tiling theory.

    PubMed

    Twarock, R; Hendrix, R W

    2006-06-07

    A vital part of a virus is its protein shell, called the viral capsid, that encapsulates and hence protects the viral genome. It has been shown in Twarock [2004. A tiling approach to vius capsids assembly explaining a structural puzzle in virology. J. Theor. Biol. 226, 477-482] that the surface structures of viruses with icosahedrally symmetric capsids can be modelled in terms of tilings that encode the locations of the protein subunits. This theory is extended here to multi-level tilings in order to model crosslinking structures. The new framework is demonstrated for the case of bacteriophage HK97, and it is shown, how the theory can be used in general to decide if crosslinking, and what type of crosslinking, is compatible from a mathematical point of view with the geometrical surface structure of a virus.

  5. Anxiety and Depression: Linkages with Viral Diseases.

    PubMed

    Coughlin, Steven S

    2012-01-01

    Anxiety and mood disorders are common in the general population in countries around the world. This article provides a review of the recent literature on anxiety and depressive disorders with a focus on linkages with several important viral diseases. Although the majority of studies have been conducted in developed countries such as the United States and Great Britain, some studies have been carried out in less developed nations where only a small percentage of persons with mental illness receive treatment for their condition. The studies summarized in this review indicate that there are important linkages between anxiety and depression and viral diseases such as influenza A (H1N1) and other influenza viruses, varicella-zoster virus, herpes simplex virus, human immunodeficiency virus/acquired immune deficiency syndrome, and hepatitis C. Additional studies are needed to further clarify the mechanisms for interactions between mental health and communicable diseases, in order to assist patients and further prevention and control efforts.

  6. Multiplexing Short Primers for Viral Family PCR

    SciTech Connect

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  7. Viral vectors: from virology to transgene expression

    PubMed Central

    Bouard, D; Alazard-Dany, N; Cosset, F-L

    2009-01-01

    In the late 1970s, it was predicted that gene therapy would be applied to humans within a decade. However, despite some success, gene therapy has still not become a routine practise in medicine. In this review, we will examine the problems, both experimental and clinical, associated with the use of viral material for transgenic insertion. We shall also discuss the development of viral vectors involving the most important vector types derived from retroviruses, adenoviruses, herpes simplex viruses and adeno-associated viruses. This article is part of a themed section on Vector Design and Drug Delivery. For a list of all articles in this section see the end of this paper, or visit: http://www3.interscience.wiley.com/journal/121548564/issueyear?year=2009 PMID:18776913

  8. Broad-spectrum antivirals against viral fusion

    PubMed Central

    Vigant, Frederic; Santos, Nuno C.; Lee, Benhur

    2015-01-01

    Effective antivirals have been developed against specific viruses, such as HIV, Hepatitis C virus and influenza virus. This ‘one bug–one drug’ approach to antiviral drug development can be successful, but it may be inadequate for responding to an increasing diversity of viruses that cause significant diseases in humans. The majority of viral pathogens that cause emerging and re-emerging infectious diseases are membrane-enveloped viruses, which require the fusion of viral and cell membranes for virus entry. Therefore, antivirals that target the membrane fusion process represent new paradigms for broad-spectrum antiviral discovery. In this Review, we discuss the mechanisms responsible for the fusion between virus and cell membranes and explore how broad-spectrum antivirals target this process to prevent virus entry. PMID:26075364

  9. Statistical Mechanics and Thermodynamics of Viral Evolution

    NASA Astrophysics Data System (ADS)

    Jones, Barbara; Kaufman, James

    Using methods drawn from physics we study the life cycle of viruses. We analyze a model of viral infection and evolution using the ``grand canonical ensemble'' and formalisms from statistical mechanics and thermodynamics. Using this approach we determine possible genetic states of a model virus and host as a function of two independent pressures-immune response and system temperature. We show the system has a real thermodynamic temperature, and discover a new phase transition between a positive temperature regime of normal replication and a negative temperature ``disordered'' phase of the virus. We distinguish this from previous observations of a phase transition that arises as a function of mutation rate. From an evolutionary biology point of view, at steady state the viruses naturally evolve to distinct quasispecies. The approach used here could be refined to apply to real biological systems, perhaps providing insight into immune escape, the emergence of novel pathogens and other results of viral evolution.

  10. Lytic to temperate switching of viral communities

    NASA Astrophysics Data System (ADS)

    Knowles, B.; Silveira, C. B.; Bailey, B. A.; Barott, K.; Cantu, V. A.; Cobián-Güemes, A. G.; Coutinho, F. H.; Dinsdale, E. A.; Felts, B.; Furby, K. A.; George, E. E.; Green, K. T.; Gregoracci, G. B.; Haas, A. F.; Haggerty, J. M.; Hester, E. R.; Hisakawa, N.; Kelly, L. W.; Lim, Y. W.; Little, M.; Luque, A.; McDole-Somera, T.; McNair, K.; de Oliveira, L. S.; Quistad, S. D.; Robinett, N. L.; Sala, E.; Salamon, P.; Sanchez, S. E.; Sandin, S.; Silva, G. G. Z.; Smith, J.; Sullivan, C.; Thompson, C.; Vermeij, M. J. A.; Youle, M.; Young, C.; Zgliczynski, B.; Brainard, R.; Edwards, R. A.; Nulton, J.; Thompson, F.; Rohwer, F.

    2016-03-01

    Microbial viruses can control host abundances via density-dependent lytic predator-prey dynamics. Less clear is how temperate viruses, which coexist and replicate with their host, influence microbial communities. Here we show that virus-like particles are relatively less abundant at high host densities. This suggests suppressed lysis where established models predict lytic dynamics are favoured. Meta-analysis of published viral and microbial densities showed that this trend was widespread in diverse ecosystems ranging from soil to freshwater to human lungs. Experimental manipulations showed viral densities more consistent with temperate than lytic life cycles at increasing microbial abundance. An analysis of 24 coral reef viromes showed a relative increase in the abundance of hallmark genes encoded by temperate viruses with increased microbial abundance. Based on these four lines of evidence, we propose the Piggyback-the-Winner model wherein temperate dynamics become increasingly important in ecosystems with high microbial densities; thus ‘more microbes, fewer viruses’.

  11. Immunological Features Underlying Viral Hemorrhagic Fevers

    PubMed Central

    Messaoudi, Ilhem; Basler, Christopher F.

    2015-01-01

    Several enveloped RNA viruses of the arenavirus, bunyavirus, filovirus and flavivirus families are associated with a syndrome known as viral hemorrhagic fever (VHF). VHF is characterized by fever, vascular leakage, coagulation defects and multi organ system failure. VHF is currently viewed as a disease precipitated by viral suppression of innate immunity, which promotes systemic virus replication and excessive proinflammatory cytokine responses that trigger the manifestations of severe disease. However, the mechanisms by which immune dysregulation contributes to disease remain poorly understood. Infection of nonhuman primates closely recapitulates human VHF, notably Ebola and yellow fever, thereby providing excellent models to better define the immunological basis for this syndrome. Here we review the current state of our knowledge and suggest future directions that will better define the immunological mechanisms underlying VHF. PMID:26163194

  12. [Viral infections of human central nervous system].

    PubMed

    Agut, Henri

    2016-01-01

    The viruses that can infect the central nervous system of humans are numerous and form a heterogeneous group with respect to their structural, functional and epidemiological properties. The pathophysiological mechanisms leading to associated neurological diseases, mainly meningitis and encephalitis, also are complex and often intertwined. Overall, neurological clinical symptoms correspond either to acute viral diseases associated with primary infections or to acute, subacute or chronic diseases associated with persistent viral infections. The frequent severity of the clinical situation requires in all cases the practice of virological diagnosis for which the PCR techniques applied to cerebrospinal fluid samples occupy a prominent place. The severity of clinical manifestations justifies the use of prophylactic vaccination when available and antiviral treatment as soon as the causative virus is identified or suspected.

  13. Viral haemorrhagic fevers: current status, future threats.

    PubMed

    Speed, B R; Gerrard, M P; Kennett, M L; Catton, M G; Harvey, B M

    1996-01-15

    In developing countries, the major outbreaks of viral haemorrhagic fevers such as Marburg, Ebola and Lassa fever viruses have been nosocomially spread. The high mortality and absence of specific treatment have had a devastating effect. Epidemics of this highly contagious disease remain a constant threat to Australia and, as a result, carefully planned laboratory and public health strategies and clinical infection control measures have been instituted for the management of suspected cases.

  14. The Etiology and Pathogenesis of Viral Gastroenteritis.

    DTIC Science & Technology

    1984-07-31

    gastroenteritis. Ann.Int.Med. 22:370-373,1980. 8. Parrino , T.A.,Schreiber, D.S., Trier, J.S.,Kapikian, A.Z.,Blacklow, N.R.:Clin- ical immunity in acute...gastric motor function in viral gastroenteritis. Ann.Int.Med. 22:370-373,1980. 8. Parrino , T.A., Schreiber’ D.S.,Trier,J.S.,Kapikian,A.Z.,Blacklow

  15. [Bovine viral diarrhea control in Russian Federation].

    PubMed

    Guliukin, M I; Iurov, K P; Glotov, A G; Donchenko, N A

    2013-01-01

    Bovine viral diarrhea (BVD) is one of the greatest challenges for breeding and commercial livestock. It is characterized by lesions of the respiratory and gastrointestinal tract, abortion, infertility, immune deficiency, and persistence of the pathogen. In this work, a set of measures for the rehabilitation and prevention of BVD in cattle is described. It includes the data of the literature, guidance documents for the diagnosis and control of BVD adopted by OIE, EU countries, USA, as well as the results of this research.

  16. Vaginal microbiota and viral sexually transmitted diseases.

    PubMed

    Nardis, C; Mosca, L; Mastromarino, P

    2013-01-01

    Healthy vaginal microbiota is an important biological barrier to pathogenic microorganisms. When this predominantly Lactobacillus community is disrupted, decreased in abundance and replaced by different anaerobes, bacterial vaginosis (BV) may occur. BV is associated with prevalence and incidence of several sexually transmitted infections. This review provides background on BV, discusses the epidemiologic data to support a role of altered vaginal microbiota for acquisition of sexually transmitted diseases and analyzes mechanisms by which lactobacilli could counteract sexually transmitted viral infections.

  17. Viral Oncolytic Therapeutics for Neoplastic Meningitis

    DTIC Science & Technology

    2013-07-01

    Oncol. 2005 May 20;23(15):3605-13. 2. Nakamura H, Kasuya H, Mullen JT, et al. Regulation of Herpes simplex virus g134.5 expression and oncolysis of...diffuse liver metastases by Myb34.5. J Clin Invest 2002;109:871–82. 3. Kuruppu D, Tanabe KK. Viral oncolysis by herpes simplex virus and other viruses...emission tomography of herpes simplex virus 1 oncolysis. Cancer Research. 2007; 67(7): 3295.

  18. Viral infection of human lung macrophages increases PDL1 expression via IFNβ.

    PubMed

    Staples, Karl J; Nicholas, Ben; McKendry, Richard T; Spalluto, C Mirella; Wallington, Joshua C; Bragg, Craig W; Robinson, Emily C; Martin, Kirstin; Djukanović, Ratko; Wilkinson, Tom M A

    2015-01-01

    Lung macrophages are an important defence against respiratory viral infection and recent work has demonstrated that influenza-induced macrophage PDL1 expression in the murine lung leads to rapid modulation of CD8+ T cell responses via the PD1 receptor. This PD1/PDL1 pathway may downregulate acute inflammatory responses to prevent tissue damage. The aim of this study was to investigate the mechanisms of PDL1 regulation by human macrophages in response to viral infection. Ex-vivo viral infection models using influenza and RSV were established in human lung explants, isolated lung macrophages and monocyte-derived macrophages (MDM) and analysed by flow cytometry and RT-PCR. Incubation of lung explants, lung macrophages and MDM with X31 resulted in mean cellular infection rates of 18%, 18% and 29% respectively. Viral infection significantly increased cell surface expression of PDL1 on explant macrophages, lung macrophages and MDM but not explant epithelial cells. Infected MDM induced IFNγ release from autologous CD8+ T cells, an effect enhanced by PDL1 blockade. We observed increases in PDL1 mRNA and IFNβ mRNA and protein release by MDM in response to influenza infection. Knockdown of IFNβ by siRNA, resulted in a 37.5% reduction in IFNβ gene expression in response to infection, and a significant decrease in PDL1 mRNA. Furthermore, when MDM were incubated with IFNβ, this cytokine caused increased expression of PDL1 mRNA. These data indicate that human macrophage PDL1 expression modulates CD8+ cell IFNγ release in response to virus and that this expression is regulated by autologous IFNβ production.

  19. Firefighting Module

    NASA Technical Reports Server (NTRS)

    1984-01-01

    Firefly II pump module is NASA's Marshall Space Flight Center's commercial offshoot of a NASA/US Coast Guard program involving development of a lightweight, helicopter-transportable firefighting module for a quick response in combating shipboard or harbor fires. Operable on land or water, the Amphib One is equipped with 3 water cannons. When all 3 are operating, unit pumps more than 3,000 gallons a minute. Newly developed model used by U.S. Coast Guard can pump 5,000 gallons per minute. It was designed for applications such as firefighting onboard ship fires, emergency dockside water pumping, dewatering ships in danger of sinking, flood control, and emergency water supply at remote locations.

  20. Viral antibody dynamics in a chiropteran host.

    PubMed

    Baker, Kate S; Suu-Ire, Richard; Barr, Jennifer; Hayman, David T S; Broder, Christopher C; Horton, Daniel L; Durrant, Christopher; Murcia, Pablo R; Cunningham, Andrew A; Wood, James L N

    2014-03-01

    Bats host many viruses that are significant for human and domestic animal health, but the dynamics of these infections in their natural reservoir hosts remain poorly elucidated. In these, and other, systems, there is evidence that seasonal life-cycle events drive infection dynamics, directly impacting the risk of exposure to spillover hosts. Understanding these dynamics improves our ability to predict zoonotic spillover from the reservoir hosts. To this end, we followed henipavirus antibody levels of >100 individual E. helvum in a closed, captive, breeding population over a 30-month period, using a powerful novel antibody quantitation method. We demonstrate the presence of maternal antibodies in this system and accurately determine their longevity. We also present evidence of population-level persistence of viral infection and demonstrate periods of increased horizontal virus transmission associated with the pregnancy/lactation period. The novel findings of infection persistence and the effect of pregnancy on viral transmission, as well as an accurate quantitation of chiropteran maternal antiviral antibody half-life, provide fundamental baseline data for the continued study of viral infections in these important reservoir hosts.

  1. Viral quasispecies assembly via maximal clique enumeration.

    PubMed

    Töpfer, Armin; Marschall, Tobias; Bull, Rowena A; Luciani, Fabio; Schönhuth, Alexander; Beerenwinkel, Niko

    2014-03-01

    Virus populations can display high genetic diversity within individual hosts. The intra-host collection of viral haplotypes, called viral quasispecies, is an important determinant of virulence, pathogenesis, and treatment outcome. We present HaploClique, a computational approach to reconstruct the structure of a viral quasispecies from next-generation sequencing data as obtained from bulk sequencing of mixed virus samples. We develop a statistical model for paired-end reads accounting for mutations, insertions, and deletions. Using an iterative maximal clique enumeration approach, read pairs are assembled into haplotypes of increasing length, eventually enabling global haplotype assembly. The performance of our quasispecies assembly method is assessed on simulated data for varying population characteristics and sequencing technology parameters. Owing to its paired-end handling, HaploClique compares favorably to state-of-the-art haplotype inference methods. It can reconstruct error-free full-length haplotypes from low coverage samples and detect large insertions and deletions at low frequencies. We applied HaploClique to sequencing data derived from a clinical hepatitis C virus population of an infected patient and discovered a novel deletion of length 357±167 bp that was validated by two independent long-read sequencing experiments. HaploClique is available at https://github.com/armintoepfer/haploclique. A summary of this paper appears in the proceedings of the RECOMB 2014 conference, April 2-5.

  2. Enhanced Viral Replication by Cellular Replicative Senescence

    PubMed Central

    Kim, Ji-Ae; Seong, Rak-Kyun

    2016-01-01

    Cellular replicative senescence is a major contributing factor to aging and to the development and progression of aging-associated diseases. In this study, we sought to determine viral replication efficiency of influenza virus (IFV) and Varicella Zoster Virus (VZV) infection in senescent cells. Primary human bronchial epithelial cells (HBE) or human dermal fibroblasts (HDF) were allowed to undergo numbers of passages to induce replicative senescence. Induction of replicative senescence in cells was validated by positive senescence-associated β-galactosidase staining. Increased susceptibility to both IFV and VZV infection was observed in senescent HBE and HDF cells, respectively, resulting in higher numbers of plaque formation, along with the upregulation of major viral antigen expression than that in the non-senescent cells. Interestingly, mRNA fold induction level of virus-induced type I interferon (IFN) was attenuated by senescence, whereas IFN-mediated antiviral effect remained robust and potent in virus-infected senescent cells. Additionally, we show that a longevity-promoting gene, sirtuin 1 (SIRT1), has antiviral role against influenza virus infection. In conclusion, our data indicate that enhanced viral replication by cellular senescence could be due to senescence-mediated reduction of virus-induced type I IFN expression. PMID:27799874

  3. Viral takeover of the host ubiquitin system.

    PubMed

    Gustin, Jean K; Moses, Ashlee V; Früh, Klaus; Douglas, Janet L

    2011-01-01

    Like the other more well-characterized post-translational modifications (phosphorylation, methylation, acetylation, acylation, etc.), the attachment of the 76 amino acid ubiquitin (Ub) protein to substrates has been shown to govern countless cellular processes. As obligate intracellular parasites, viruses have evolved the capability to commandeer many host processes in order to maximize their own survival, whether it be to increase viral production or to ensure the long-term survival of latently infected host cells. The first evidence that viruses could usurp the Ub system came from the DNA tumor viruses and Adenoviruses, each of which use Ub to dysregulate the host cell cycle (Scheffner et al., 1990; Querido et al., 2001). Today, the list of viruses that utilize Ub includes members from almost every viral class, encompassing both RNA and DNA viruses. Among these, there are examples of Ub usage at every stage of the viral life cycle, involving both ubiquitination and de-ubiquitination. In addition to viruses that merely modify the host Ub system, many of the large DNA viruses encode their own Ub modifying machinery. In this review, we highlight the latest discoveries regarding the myriad ways that viruses utilize Ub to their advantage.

  4. Three-Dimensional Imaging of Viral Infections.

    PubMed

    Risco, Cristina; de Castro, Isabel Fernández; Sanz-Sánchez, Laura; Narayan, Kedar; Grandinetti, Giovanna; Subramaniam, Sriram

    2014-11-01

    Three-dimensional (3D) imaging technologies are beginning to have significant impact in the field of virology, as they are helping us understand how viruses take control of cells. In this article we review several methodologies for 3D imaging of cells and show how these technologies are contributing to the study of viral infections and the characterization of specialized structures formed in virus-infected cells. We include 3D reconstruction by transmission electron microscopy (TEM) using serial sections, electron tomography, and focused ion beam scanning electron microscopy (FIB-SEM). We summarize from these methods selected contributions to our understanding of viral entry, replication, morphogenesis, egress and propagation, and changes in the spatial architecture of virus-infected cells. In combination with live-cell imaging, correlative microscopy, and new techniques for molecular mapping in situ, the availability of these methods for 3D imaging is expected to provide deeper insights into understanding the structural and dynamic aspects of viral infection.

  5. Thermoelectric module

    DOEpatents

    Kortier, William E.; Mueller, John J.; Eggers, Philip E.

    1980-07-08

    A thermoelectric module containing lead telluride as the thermoelectric mrial is encapsulated as tightly as possible in a stainless steel canister to provide minimum void volume in the canister. The lead telluride thermoelectric elements are pressure-contacted to a tungsten hot strap and metallurgically bonded at the cold junction to iron shoes with a barrier layer of tin telluride between the iron shoe and the p-type lead telluride element.

  6. Linear modulator

    NASA Technical Reports Server (NTRS)

    1972-01-01

    A study of frequency division multiplexing (FDM) systems was made for the purpose of determining the system performance that can be obtained with available state of the art components. System performance was evaluated on the basis of past experience, system analysis, and component evaluation. The system study was specifically directed to the area of FDM systems using subcarrier channel frequencies from 4 kHz to 200 kHz and channel information bandwidths of dc to 1, 2, 4, 8, and 16 kHz. The evaluation also assumes that the demodulation will be from a tape recorder which produces frequency modulation of + or - 1% on the signal due to the tape recorder wow and flutter. For the modulation system it is assumed that the pilot and carrier channel frequencies are stable to within + or - .005% and that the FM on the channel carriers is negligible. The modulator system was evaluated for the temperature range of -20 degree to +85 degree while the demodulator system was evaluated for operation at room temperature.

  7. [Viral serology in ear diseases of presumably neuritic origin].

    PubMed

    Martin, C; Gaudin, O; Martin, H; Prades, J M; Vidalain, E

    1986-01-01

    A viral etiology is often advanced to explain the origin of Bell's palsy, sudden deafness and certain vertigos. Virology findings were compared in 72 patients with either chicken pox, herpes, zona or other "viral" infections, where the viral origin was not absolutely clear, and a population of healthy volunteers. Results confirmed the indefinite viral nature of these affections. However, recent studies have shown that definite viral disorders are not always associated with an increase in antibody levels, and the intervention of a virus should not be totally discounted in some of these affections, especially as several particularly demonstrative cases have provided confirmation of a virus origin, particularly the Epstein-Barr virus.

  8. Host Transcriptional Response to Influenza and Other Acute Respiratory Viral Infections – A Prospective Cohort Study

    PubMed Central

    Zhai, Yijie; Franco, Luis M.; Atmar, Robert L.; Quarles, John M.; Arden, Nancy; Bucasas, Kristine L.; Wells, Janet M.; Niño, Diane; Wang, Xueqing; Zapata, Gladys E.; Shaw, Chad A.; Belmont, John W.; Couch, Robert B.

    2015-01-01

    To better understand the systemic response to naturally acquired acute respiratory viral infections, we prospectively enrolled 1610 healthy adults in 2009 and 2010. Of these, 142 subjects were followed for detailed evaluation of acute viral respiratory illness. We examined peripheral blood gene expression at 7 timepoints: enrollment, 5 illness visits and the end of each year of the study. 133 completed all study visits and yielded technically adequate peripheral blood microarray gene expression data. Seventy-three (55%) had an influenza virus infection, 64 influenza A and 9 influenza B. The remaining subjects had a rhinovirus infection (N = 32), other viral infections (N = 4), or no viral agent identified (N = 24). The results, which were replicated between two seasons, showed a dramatic upregulation of interferon pathway and innate immunity genes. This persisted for 2-4 days. The data show a recovery phase at days 4 and 6 with differentially expressed transcripts implicated in cell proliferation and repair. By day 21 the gene expression pattern was indistinguishable from baseline (enrollment). Influenza virus infection induced a higher magnitude and longer duration of the shared expression signature of illness compared to the other viral infections. Using lineage and activation state-specific transcripts to produce cell composition scores, patterns of B and T lymphocyte depressions accompanied by a major activation of NK cells were detected in the acute phase of illness. The data also demonstrate multiple dynamic gene modules that are reorganized and strengthened following infection. Finally, we examined pre- and post-infection anti-influenza antibody titers defining novel gene expression correlates. PMID:26070066

  9. Host Transcriptional Response to Influenza and Other Acute Respiratory Viral Infections--A Prospective Cohort Study.

    PubMed

    Zhai, Yijie; Franco, Luis M; Atmar, Robert L; Quarles, John M; Arden, Nancy; Bucasas, Kristine L; Wells, Janet M; Niño, Diane; Wang, Xueqing; Zapata, Gladys E; Shaw, Chad A; Belmont, John W; Couch, Robert B

    2015-06-01

    To better understand the systemic response to naturally acquired acute respiratory viral infections, we prospectively enrolled 1610 healthy adults in 2009 and 2010. Of these, 142 subjects were followed for detailed evaluation of acute viral respiratory illness. We examined peripheral blood gene expression at 7 timepoints: enrollment, 5 illness visits and the end of each year of the study. 133 completed all study visits and yielded technically adequate peripheral blood microarray gene expression data. Seventy-three (55%) had an influenza virus infection, 64 influenza A and 9 influenza B. The remaining subjects had a rhinovirus infection (N = 32), other viral infections (N = 4), or no viral agent identified (N = 24). The results, which were replicated between two seasons, showed a dramatic upregulation of interferon pathway and innate immunity genes. This persisted for 2-4 days. The data show a recovery phase at days 4 and 6 with differentially expressed transcripts implicated in cell proliferation and repair. By day 21 the gene expression pattern was indistinguishable from baseline (enrollment). Influenza virus infection induced a higher magnitude and longer duration of the shared expression signature of illness compared to the other viral infections. Using lineage and activation state-specific transcripts to produce cell composition scores, patterns of B and T lymphocyte depressions accompanied by a major activation of NK cells were detected in the acute phase of illness. The data also demonstrate multiple dynamic gene modules that are reorganized and strengthened following infection. Finally, we examined pre- and post-infection anti-influenza antibody titers defining novel gene expression correlates.

  10. Murine Coronavirus Ubiquitin-Like Domain Is Important for Papain-Like Protease Stability and Viral Pathogenesis

    PubMed Central

    Mielech, Anna M.; Deng, Xufang; Chen, Yafang; Kindler, Eveline; Wheeler, Dorthea L.; Mesecar, Andrew D.; Thiel, Volker; Perlman, Stanley

    2015-01-01

    ABSTRACT Ubiquitin-like domains (Ubls) now are recognized as common elements adjacent to viral and cellular proteases; however, their function is unclear. Structural studies of the papain-like protease (PLP) domains of coronaviruses (CoVs) revealed an adjacent Ubl domain in severe acute respiratory syndrome CoV, Middle East respiratory syndrome CoV, and the murine CoV, mouse hepatitis virus (MHV). Here, we tested the effect of altering the Ubl adjacent to PLP2 of MHV on enzyme activity, viral replication, and pathogenesis. Using deletion and substitution approaches, we identified sites within the Ubl domain, residues 785 to 787 of nonstructural protein 3, which negatively affect protease activity, and valine residues 785 and 787, which negatively affect deubiquitinating activity. Using reverse genetics, we engineered Ubl mutant viruses and found that AM2 (V787S) and AM3 (V785S) viruses replicate efficiently at 37°C but generate smaller plaques than wild-type (WT) virus, and AM2 is defective for replication at higher temperatures. To evaluate the effect of the mutation on protease activity, we purified WT and Ubl mutant PLP2 and found that the proteases exhibit similar specific activities at 25°C. However, the thermal stability of the Ubl mutant PLP2 was significantly reduced at 30°C, thereby reducing the total enzymatic activity. To determine if the destabilizing mutation affects viral pathogenesis, we infected C57BL/6 mice with WT or AM2 virus and found that the mutant virus is highly attenuated, yet it replicates sufficiently to elicit protective immunity. These studies revealed that modulating the Ubl domain adjacent to the PLP reduces protease stability and viral pathogenesis, revealing a novel approach to coronavirus attenuation. IMPORTANCE Introducing mutations into a protein or virus can have either direct or indirect effects on function. We asked if changes in the Ubl domain, a conserved domain adjacent to the coronavirus papain-like protease, altered

  11. Force for ancient and recent life: viral and stem-loop RNA consortia promote life.

    PubMed

    Villarreal, Luis P

    2015-04-01

    Lytic viruses were thought to kill the most numerous host (i.e., kill the winner). But persisting viruses/defectives can also protect against viruses, especially in a ubiquitous virosphere. In 1991, Yarmolinsky et al. discovered the addiction modules of P1 phage, in which opposing toxic and protective functions stabilize persistence. Subsequently, I proposed that lytic and persisting cryptic virus also provide addiction modules that promote group identity. In eukaryotes (and the RNA world), a distinct RNA virus-host relationship exists. Retrovirurses/retroposons are major contributors to eukaryotic genomes. Eukaryotic complexity appears to be mostly mediated by regulatory complexity involving noncoding retroposon-derived RNA. RNA viruses evolve via quasispecies, which contain cooperating, minority, and even opposing RNA types. Quasispecies can also demonstrate group preclusion (e.g., hepatitis C). Stem-loop RNA domains are found in long terminal repeats (and viral RNA) and mediate viral regulation/identity. Thus, stem-loop RNAs may be ancestral regulators. I consider the RNA (ribozyme) world scenario from the perspective of addiction modules and cooperating quasispecies (i.e., subfunctional agents that establish group identity). Such an RNA collective resembles a "gang" but requires the simultaneous emergence of endonuclease, ligase, cooperative catalysis, group identity, and history markers (RNA). I call such a collective a gangen (pathway to gang) needed for life to emerge.

  12. Viral Vectors for in Vivo Gene Transfer

    NASA Astrophysics Data System (ADS)

    Thévenot, E.; Dufour, N.; Déglon, N.

    The transfer of DNA into the nucleus of a eukaryotic cell (gene transfer) is a central theme of modern biology. The transfer is said to be somatic when it refers to non-germline organs of a developed individual, and germline when it concerns gametes or the fertilised egg of an animal, with the aim of transmitting the relevant genetic modification to its descendents [1]. The efficient introduction of genetic material into a somatic or germline cell and the control of its expression over time have led to major advances in understanding how genes work in vivo, i.e., in living organisms (functional genomics), but also to the development of innovative therapeutic methods (gene therapy). The efficiency of gene transfer is conditioned by the vehicle used, called the vector. Desirable features for a vector are as follows: Easy to produce high titer stocks of the vector in a reproducible way. Absence of toxicity related to transduction (transfer of genetic material into the target cell, and its expression there) and no immune reaction of the organism against the vector and/or therapeutic protein. Stability in the expression of the relevant gene over time, and the possibility of regulation, e.g., to control expression of the therapeutic protein on the physiological level, or to end expression at the end of treatment. Transduction of quiescent cells should be as efficient as transduction of dividing cells. Vectors currently used fall into two categories: non-viral and viral vectors. In non-viral vectors, the DNA is complexed with polymers, lipids, or cationic detergents (described in Chap. 3). These vectors have a low risk of toxicity and immune reaction. However, they are less efficient in vivo than viral vectors when it comes to the number of cells transduced and long-term transgene expression. (Naked DNA transfer or electroporation is rather inefficient in the organism. This type of gene transfer will not be discussed here, and the interested reader is referred to the

  13. Advances in Non-Viral DNA Vectors for Gene Therapy

    PubMed Central

    Hardee, Cinnamon L.; Arévalo-Soliz, Lirio Milenka; Hornstein, Benjamin D.; Zechiedrich, Lynn

    2017-01-01

    Uses of viral vectors have thus far eclipsed uses of non-viral vectors for gene therapy delivery in the clinic. Viral vectors, however, have certain issues involving genome integration, the inability to be delivered repeatedly, and possible host rejection. Fortunately, development of non-viral DNA vectors has progressed steadily, especially in plasmid vector length reduction, now allowing these tools to fill in specifically where viral or other non-viral vectors may not be the best options. In this review, we examine the improvements made to non-viral DNA gene therapy vectors, highlight opportunities for their further development, address therapeutic needs for which their use is the logical choice, and discuss their future expansion into the clinic. PMID:28208635

  14. Development of hybrid viral vectors for gene therapy.

    PubMed

    Huang, Shuohao; Kamihira, Masamichi

    2013-01-01

    Adenoviral, retroviral/lentiviral, adeno-associated viral, and herpesviral vectors are the major viral vectors used in gene therapy. Compared with non-viral methods, viruses are highly-evolved, natural delivery agents for genetic materials. Despite their remarkable transduction efficiency, both clinical trials and laboratory experiments have suggested that viral vectors have inherent shortcomings for gene therapy, including limited loading capacity, immunogenicity, genotoxicity, and failure to support long-term adequate transgenic expression. One of the key issues in viral gene therapy is the state of the delivered genetic material in transduced cells. To address genotoxicity and improve the therapeutic transgene expression profile, construction of hybrid vectors have recently been developed. By adding new abilities or replacing certain undesirable elements, novel hybrid viral vectors are expected to outperform their conventional counterparts with improved safety and enhanced therapeutic efficacy. This review provides a comprehensive summary of current achievements in hybrid viral vector development and their impact on the field of gene therapy.

  15. Modulation of Potassium Channels Inhibits Bunyavirus Infection*

    PubMed Central

    Hover, Samantha; King, Barnabas; Hall, Bradley; Loundras, Eleni-Anna; Taqi, Hussah; Daly, Janet; Dallas, Mark; Peers, Chris; Schnettler, Esther; McKimmie, Clive; Kohl, Alain; Barr, John N.; Mankouri, Jamel

    2016-01-01

    Bunyaviruses are considered to be emerging pathogens facilitated by the segmented nature of their genome that allows reassortment between different species to generate novel viruses with altered pathogenicity. Bunyaviruses are transmitted via a diverse range of arthropod vectors, as well as rodents, and have established a global disease range with massive importance in healthcare, animal welfare, and economics. There are no vaccines or anti-viral therapies available to treat human bunyavirus infections and so development of new anti-viral strategies is urgently required. Bunyamwera virus (BUNV; genus Orthobunyavirus) is the model bunyavirus, sharing aspects of its molecular and cellular biology with all Bunyaviridae family members. Here, we show for the first time that BUNV activates and requires cellular potassium (K+) channels to infect cells. Time of addition assays using K+ channel modulating agents demonstrated that K+ channel function is critical to events shortly after virus entry but prior to viral RNA synthesis/replication. A similar K+ channel dependence was identified for other bunyaviruses namely Schmallenberg virus (Orthobunyavirus) as well as the more distantly related Hazara virus (Nairovirus). Using a rational pharmacological screening regimen, two-pore domain K+ channels (K2P) were identified as the K+ channel family mediating BUNV K+ channel dependence. As several K2P channel modulators are currently in clinical use, our work suggests they may represent a new and safe drug class for the treatment of potentially lethal bunyavirus disease. PMID:26677217

  16. Photovoltaic module and module arrays

    DOEpatents

    Botkin, Jonathan [El Cerrito, CA; Graves, Simon [Berkeley, CA; Lenox, Carl J. S. [Oakland, CA; Culligan, Matthew [Berkeley, CA; Danning, Matt [Oakland, CA

    2012-07-17

    A photovoltaic (PV) module including a PV device and a frame. The PV device has a PV laminate defining a perimeter and a major plane. The frame is assembled to and encases the laminate perimeter, and includes leading, trailing, and side frame members, and an arm that forms a support face opposite the laminate. The support face is adapted for placement against a horizontal installation surface, to support and orient the laminate in a non-parallel or tilted arrangement. Upon final assembly, the laminate and the frame combine to define a unitary structure. The frame can orient the laminate at an angle in the range of 3.degree.-7.degree. from horizontal, and can be entirely formed of a polymeric material. Optionally, the arm incorporates integral feature(s) that facilitate interconnection with corresponding features of a second, identically formed PV module.

  17. Photovoltaic module and module arrays

    DOEpatents

    Botkin, Jonathan; Graves, Simon; Lenox, Carl J. S.; Culligan, Matthew; Danning, Matt

    2013-08-27

    A photovoltaic (PV) module including a PV device and a frame, The PV device has a PV laminate defining a perimeter and a major plane. The frame is assembled to and encases the laminate perimeter, and includes leading, trailing, and side frame members, and an arm that forms a support face opposite the laminate. The support face is adapted for placement against a horizontal installation surface, to support and orient the laminate in a non-parallel or tilted arrangement. Upon final assembly, the laminate and the frame combine to define a unitary structure. The frame can orient the laminate at an angle in the range of 3.degree.-7.degree. from horizontal, and can be entirely formed of a polymeric material. Optionally, the arm incorporates integral feature(s) that facilitate interconnection with corresponding features of a second, identically formed PV module.

  18. Cellular Human CLE/C14orf166 Protein Interacts with Influenza Virus Polymerase and Is Required for Viral Replication ▿

    PubMed Central

    Rodriguez, Ariel; Pérez-González, Alicia; Nieto, Amelia

    2011-01-01

    The influenza A virus polymerase associates with a number of cellular transcription-related factors, including RNA polymerase II. We previously described the interaction of influenza virus polymerase subunit PA with human CLE/C14orf166 protein (hCLE), a positive modulator of this cellular RNA polymerase. Here, we show that hCLE also interacts with the influenza virus polymerase complex and colocalizes with viral ribonucleoproteins. Silencing of hCLE causes reduction of viral polymerase activity, viral RNA transcription and replication, virus titer, and viral particle production. Altogether, these findings indicate that the cellular transcription factor hCLE is an important protein for influenza virus replication. PMID:21900157

  19. Viral immunity. Transkingdom control of viral infection and immunity in the mammalian intestine.

    PubMed

    Pfeiffer, Julie K; Virgin, Herbert W

    2016-01-15

    Viruses that infect the intestine include major human pathogens (retroviruses, noroviruses, rotaviruses, astroviruses, picornaviruses, adenoviruses, herpesviruses) that constitute a serious public health problem worldwide. These viral pathogens are members of a large, complex viral community inhabiting the intestine termed "the enteric virome." Enteric viruses have intimate functional and genetic relationships with both the host and other microbial constituents that inhabit the intestine, such as the bacterial microbiota, their associated phages, helminthes, and fungi, which together constitute the microbiome. Emerging data indicate that enteric viruses regulate, and are in turn regulated by, these other microbes through a series of processes termed "transkingdom interactions." This represents a changing paradigm in intestinal immunity to viral infection. Here we review recent advances in the field and propose new ways in which to conceptualize this important area.

  20. Underreporting of viral encephalitis and viral meningitis, Ireland, 2005-2008.

    PubMed

    Kelly, Tara A; O'Lorcain, Piaras; Moran, Joanne; Garvey, Patricia; McKeown, Paul; Connell, Jeff; Cotter, Suzanne

    2013-01-01

    Viral encephalitis (VE) and viral meningitis (VM) have been notifiable infectious diseases under surveillance in the Republic of Ireland since 1981. Laboratories have reported confirmed cases by detection of viral nucleic acid in cerebrospinal fluid since 2004. To determine the prevalence of these diseases in Ireland during 2005-2008, we analyzed 3 data sources: Hospital In-patient Enquiry data (from hospitalized following patients discharge) accessed through Health Intelligence Ireland, laboratory confirmations from the National Virus Reference Laboratory, and events from the Computerised Infectious Disease Reporting surveillance system. We found that the national surveillance system underestimates the incidence of these diseases in Ireland with a 10-fold higher VE hospitalization rate and 3-fold higher VM hospitalization rate than the reporting rate. Herpesviruses were responsible for most specified VE and enteroviruses for most specified VM from all 3 sources. Recommendations from this study have been implemented to improve the surveillance of these diseases in Ireland.

  1. Reinfection results in accumulation of unintegrated viral DNA in cytopathic and persistent human immunodeficiency virus type 1 infection of CEM cells

    PubMed Central

    1990-01-01

    High levels of unintegrated viral DNA accumulate during human immunodeficiency virus type 1 (HIV-1) infection of CEM T cells. Reinfection of already infected cells is required to attain these levels and reinfection also promotes the development of HIV-induced cytopathology. Rates of virus production, however, are independent of the accumulation of unintegrated viral DNA. Neutralizing antibody added soon after infection reduced viral DNA levels without appreciably affecting the production of cell-free viral p24 antigen or reverse transcriptase activity. Only 50 pM AZT were required to reduce the accumulation of unintegrated viral DNA by 50% in contrast to the 25 nM required to inhibit virus production by 50%. Cytopathology, as measured by number of syncytia in infected cell cultures, was correlated with highly elevated levels of unintegrated viral DNA. The minimal levels of unintegrated viral DNA present constitutively in the persistently infected HCEM cell line were consonant with the absence of cytopathic effects in these cells. These data demonstrate that inhibiting the reinfection of already infected cells modulates cytopathic HIV-1 infection to a form that is persistent and noncytopathic. PMID:2212939

  2. Recombinant protein-based viral disease diagnostics in veterinary medicine.

    PubMed

    Balamurugan, Vinayagamurthy; Venkatesan, Gnanavel; Sen, Arnab; Annamalai, Lakshmanan; Bhanuprakash, Veerakyathappa; Singh, Raj Kumar

    2010-09-01

    Identification of pathogens or antibody response to pathogens in human and animals modulates the treatment strategies for naive population and subsequent infections. Diseases can be controlled and even eradicated based on the epidemiology and effective prophylaxis, which often depends on development of efficient diagnostics. In addition, combating newly emerging diseases in human as well as animal healthcare is challenging and is dependent on developing safe and efficient diagnostics. Detection of antibodies directed against specific antigens has been the method of choice for documenting prior infection. Other than zoonosis, development of inexpensive vaccines and diagnostics is a unique problem in animal healthcare. The advent of recombinant DNA technology and its application in the biotechnology industry has revolutionized animal healthcare. The use of recombinant DNA technology in animal disease diagnosis has improved the rapidity, specificity and sensitivity of various diagnostic assays. This is because of the absence of host cellular proteins in the recombinant derived antigen preparations that dramatically decrease the rate of false-positive reactions. Various recombinant products are used for disease diagnosis in veterinary medicine and this article discusses recombinant-based viral disease diagnostics currently used for detection of pathogens in livestock and poultry.

  3. Inducible viral receptor, A possible concept to induce viral protection in primitive immune animals

    PubMed Central

    2011-01-01

    A pseudolysogen (PL) is derived from the lysogenic Vibrio harveyi (VH) which is infected with the VHS1 (Vibrio harveyi Siphoviridae-like 1) bacteriophage. The lysogenic Vibrio harveyi undergoes an unequivalent division of the extra-chromosomal VHS1 phage genome and its VH host chromosome and produces a true lysogen (TL) and pseudolysogen (PL). The PL is tolerant to super-infection of VHS1, as is of the true lysogen (TL), but the PL does not contain the VHS1 phage genome while the TL does. However, the PL can become susceptible to VHS1 phage infection if the physiological state of the PL is changed. It is postulated that this is due to a phage receptor molecule which can be inducible to an on-and-off regulation influence by an alternating condition of the bacterial host cell. This characteristic of the PL leads to speculate that this phenomenon can also occur in high organisms with low immunity such as shrimp. This article proposes a hypothesis that the viral receptor molecule on the target cell can play a crucial role in which the invertebrate aquaculture animals can become tolerant to viral infection. A possible mechanism may be that the target cell disrupts the viral receptor molecule to prevent super infection. This concept can explain a mechanism for the prevention of viral infection in invertebrate animals which do not have acquired immunity in response to pathogens. It can guide us to develop a mechanism of immunity to viral infection in low-evolved-immune animals. Also, it can be an additional mechanism that exists in high immune organism, as in human for the prevention of viral infection PMID:21711515

  4. Viral load, gene expression and mapping of viral integration sites in HPV16-associated HNSCC cell lines

    PubMed Central

    Olthof, Nadine C.; Huebbers, Christian U.; Kolligs, Jutta; Henfling, Mieke; Ramaekers, Frans C.S.; Cornet, Iris; van Lent-Albrechts, Josefa A.; Stegmann, Sander P.A.; Silling, Steffi; Wieland, Ulrike; Carey, Thomas E.; Walline, Heather M.; Gollin, Susanne M.; Hoffmann, Thomas K.; de Winter, Johan; Kremer, Bernd; Klussmann, Jens-Peter; Speel, Ernst-Jan M.

    2017-01-01

    HPV-related HNSCC generally have a better prognosis than HPV-negative HNSCC. However, a subgroup of HPV-positive tumors with poor prognosis has been recognized, particularly related to smoking, EGFR overexpression and chromosomal instability. Viral integration into the host genome might contribute to carcinogenesis, as is shown for cervical carcinomas. Therefore, all HPV16-positive HNSCC cell lines currently available have been carefully analysed for viral and host genome parameters. The viral integration status, viral load, viral gene expression and the presence of aneusomies was evaluated in the cell lines UD-SCC-2, UM-SCC-047, UM-SCC-104, UPCI:SCC090, UPCI:SCC152, UPCI:SCC154 and 93VU147T. HPV integration was examined using FISH, APOT-PCR and DIPS-PCR. Viral load and the expression of the viral genes E2, E6 and E7 were determined via quantitative PCR. All cell lines showed integration-specific staining patterns and signals indicating transcriptional activity using FISH. APOT- and DIPS-PCR identified integration-derived fusion products in six cell lines, and only episomal products for UM-SCC-104. Despite the observed differences in viral load and the number of viral integration sites, this did not relate to the identified viral oncogene expression. Furthermore, cell lines exhibited EGFR expression, and aneusomy (except UPCI:SCC154). In conclusion, all HPV16-positive HNSCC cell lines showed integrated and/or episomal viral DNA that is transcriptionally active, although viral oncogene expression was independent of viral copy number and the number of viral integration sites. Because these cell lines also contain EGFR expression and aneusomy, which are parameters of poor prognosis, they should be considered suitable model systems for the development of new antiviral therapies. PMID:25082736

  5. Viral load, gene expression and mapping of viral integration sites in HPV16-associated HNSCC cell lines.

    PubMed

    Olthof, Nadine C; Huebbers, Christian U; Kolligs, Jutta; Henfling, Mieke; Ramaekers, Frans C S; Cornet, Iris; van Lent-Albrechts, Josefa A; Stegmann, Alexander P A; Silling, Steffi; Wieland, Ulrike; Carey, Thomas E; Walline, Heather M; Gollin, Susanne M; Hoffmann, Thomas K; de Winter, Johan; Kremer, Bernd; Klussmann, Jens P; Speel, Ernst-Jan M

    2015-03-01

    HPV-related HNSCC generally have a better prognosis than HPV-negative HNSCC. However, a subgroup of HPV-positive tumors with poor prognosis has been recognized, particularly related to smoking, EGFR overexpression and chromosomal instability. Viral integration into the host genome might contribute to carcinogenesis, as is shown for cervical carcinomas. Therefore, all HPV16-positive HNSCC cell lines currently available have been carefully analyzed for viral and host genome parameters. The viral integration status, viral load, viral gene expression and the presence of aneusomies was evaluated in the cell lines UD-SCC-2, UM-SCC-047, UM-SCC-104, UPCI:SCC090, UPCI:SCC152, UPCI:SCC154 and 93VU147T. HPV integration was examined using FISH, APOT-PCR and DIPS-PCR. Viral load and the expression of the viral genes E2, E6 and E7 were determined via quantitative PCR. All cell lines showed integration-specific staining patterns and signals indicating transcriptional activity using FISH. APOT- and DIPS-PCR identified integration-derived fusion products in six cell lines and only episomal products for UM-SCC-104. Despite the observed differences in viral load and the number of viral integration sites, this did not relate to the identified viral oncogene expression. Furthermore, cell lines exhibited EGFR expression and aneusomy (except UPCI:SCC154). In conclusion, all HPV16-positive HNSCC cell lines showed integrated and/or episomal viral DNA that is transcriptionally active, although viral oncogene expression was independent of viral copy number and the number of viral integration sites. Because these cell lines also contain EGFR expression and aneusomy, which are parameters of poor prognosis, they should be considered suitable model systems for the development of new antiviral therapies.

  6. Cutaneous viral infections in organ transplant patients.

    PubMed

    Piaserico, S; Sandini, E; Peserico, A; Alaibac, M

    2014-08-01

    Cutaneous infections might occur in up to 80% of organ transplant recipients (OTR) and viral infections are the most common them. The risk of different skin infection is among related to the intensity of immunosuppression. During the first post-transplant period, herpes viruses are most common. After some months following transplantation, human papilloma viruses represent the most significant infections among OTR. Reactivation of herpes simplex virus in OTR can become more invasive, takes longer to heal, and shows greater potential for dissemination to visceral organs compared to the general population. Specific immunosuppressive drugs (namely muromonab and mycophenolate mofetil) have been associated with an increased risk of herpes virus reactivation after transplantation. On the other hand, there is evidence that the mTOR inhibitors, such as everolimus, may be associated with a decreased incidence of herpesvirus infections in transplant recipients. The incidence of herpes zoster in OTR is 10 to 100 fold higher than the general population, ranging from 1% to 12%. The chronic immunosuppression performed in OTR may lead to persistent replication of herpesviruses, dissemination of the virus with multivisceral involvement (hepatitis, pneumonitis, myocarditis, encephalitis and disseminated intravascular coagulation) and eventually, the emergence of antiviral-drug resistance. Viral warts are the most common cutaneous infection occurring in OTR. The number of warts increases with the duration of immunosuppressive therapy. Since warts in organ recipients are frequently multiple and only rarely undergo spontaneous regression, the therapeutic management of warts in patients treated with immunosuppressive drugs might be challenging. Imiquimod, 1% cidofovir ointment, acitretin proved to be useful off-label strategies for recalcitrant cutaneous viral warts in OTR. Extensive and atypical presentation of molluscum contagiosum has been also reported in OTR, with a prevalence

  7. Reconstructing contact network parameters from viral phylogenies

    PubMed Central

    McCloskey, Rosemary M.; Liang, Richard H.; Poon, Art F.Y.

    2016-01-01

    Models of the spread of disease in a population often make the simplifying assumption that the population is homogeneously mixed, or is divided into homogeneously mixed compartments. However, human populations have complex structures formed by social contacts, which can have a significant influence on the rate of epidemic spread. Contact network models capture this structure by explicitly representing each contact which could possibly lead to a transmission. We developed a method based on approximate Bayesian computation (ABC), a likelihood-free inference strategy, for estimating structural parameters of the contact network underlying an observed viral phylogeny. The method combines adaptive sequential Monte Carlo for ABC, Gillespie simulation for propagating epidemics though networks, and a kernel-based tree similarity score. We used the method to fit the Barabási-Albert network model to simulated transmission trees, and also applied it to viral phylogenies estimated from ten published HIV sequence datasets. This model incorporates a feature called preferential attachment (PA), whereby individuals with more existing contacts accumulate new contacts at a higher rate. On simulated data, we found that the strength of PA and the number of infected nodes in the network can often be accurately estimated. On the other hand, the mean degree of the network, as well as the total number of nodes, was not estimable with ABC. We observed sub-linear PA power in all datasets, as well as higher PA power in networks of injection drug users. These results underscore the importance of considering contact structures when performing phylodynamic inference. Our method offers the potential to quantitatively investigate the contact network structure underlying viral epidemics. PMID:27818787

  8. Bovine viral diarrhoea: pathogenesis and diagnosis.

    PubMed

    Lanyon, Sasha R; Hill, Fraser I; Reichel, Michael P; Brownlie, Joe

    2014-02-01

    Bovine viral diarrhoea virus (BVDV) is the most prevalent infectious disease of cattle. It causes financial losses from a variety of clinical manifestations and is the subject of a number of mitigation and eradication schemes around the world. The pathogenesis of BVDV infection is complex, with infection pre- and post-gestation leading to different outcomes. Infection of the dam during gestation results in fetal infection, which may lead to embryonic death, teratogenic effects or the birth of persistently infected (PI) calves. PI animals shed BVDV in their excretions and secretions throughout life and are the primary route of transmission of the virus. These animals can usually be readily detected by virus or viral antigen detection assays (RT-PCR, ELISA), except in the immediate post-natal period where colostral antibodies may mask virus presence. PI calves in utero (the 'Trojan cow' scenario) currently defy detection with available diagnostic tests, although dams carrying PI calves have been shown to have higher antibody levels than seropositive cows carrying non-PI calves. Acute infection with BVDV results in transient viraemia prior to seroconversion and can lead to reproductive dysfunction and immunosuppression leading to an increased incidence of secondary disease. Antibody assays readily detect virus exposure at the individual level and can also be used in pooled samples (serum and milk) to determine herd exposure or immunity. Diagnostic tests can be used to diagnose clinical cases, establish disease prevalence in groups and detect apparently normal but persistently infected animals. This review outlines the pathogenesis and pathology of BVD viral infection and uses this knowledge to select the best diagnostic tests for clinical diagnosis, monitoring, control and eradication efforts. Test methods, types of samples and problems areas of BVDV diagnosis are discussed.

  9. Phylodynamic analysis of a viral infection network

    PubMed Central

    Shiino, Teiichiro

    2012-01-01

    Viral infections by sexual and droplet transmission routes typically spread through a complex host-to-host contact network. Clarifying the transmission network and epidemiological parameters affecting the variations and dynamics of a specific pathogen is a major issue in the control of infectious diseases. However, conventional methods such as interview and/or classical phylogenetic analysis of viral gene sequences have inherent limitations and often fail to detect infectious clusters and transmission connections. Recent improvements in computational environments now permit the analysis of large datasets. In addition, novel analytical methods have been developed that serve to infer the evolutionary dynamics of virus genetic diversity using sample date information and sequence data. This type of framework, termed “phylodynamics,” helps connect some of the missing links on viral transmission networks, which are often hard to detect by conventional methods of epidemiology. With sufficient number of sequences available, one can use this new inference method to estimate theoretical epidemiological parameters such as temporal distributions of the primary infection, fluctuation of the pathogen population size, basic reproductive number, and the mean time span of disease infectiousness. Transmission networks estimated by this framework often have the properties of a scale-free network, which are characteristic of infectious and social communication processes. Network analysis based on phylodynamics has alluded to various suggestions concerning the infection dynamics associated with a given community and/or risk behavior. In this review, I will summarize the current methods available for identifying the transmission network using phylogeny, and present an argument on the possibilities of applying the scale-free properties to these existing frameworks. PMID:22993510

  10. Vaccines for viral diseases with dermatologic manifestations.

    PubMed

    Brentjens, Mathijs H; Yeung-Yue, Kimberly A; Lee, Patricia C; Tyring, Stephen K

    2003-04-01

    Vaccines against infectious diseases have been available since the 1800s, when an immunization strategy against smallpox developed by Jenner gained wide acceptance. Until recently, the only vaccination strategies available involved the use of protein-based, whole killed, and attenuated live virus vaccines. These strategies have led to the development of effective vaccines against a variety of diseases with primary or prominent cutaneous manifestations. Effective and safe vaccines now used worldwide include those directed against measles and rubella (now commonly used together with a mumps vaccine as the trivalent MMR), chickenpox, and hepatitis B. The eradication of naturally occurring smallpox remains one of the greatest successes in the history of modern medicine, but stockpiles of live smallpox exist in the United States and Russia. Renewed interest in the smallpox vaccine reflects concerns about a possible bioterrorist threat using this virus. Yellow fever is a hemorrhagic virus endemic to tropical areas of South America and Africa. An effective vaccine for this virus has existed since 1937, and it is used widely in endemic areas of South America, and to a lesser extent in Africa. This vaccine is recommended once every 10 years for people who are traveling to endemic areas. Advances in immunology have led to a greater understanding of immune system function in viral diseases. Progress in genetics and molecular biology has allowed researchers to design vaccines with novel mechanisms of action (eg, DNA, vector, and VLP vaccines). Vaccines have also been designed to specifically target particular viral components, allowing for stimulation of various arms of the immune system as desired. Ongoing research shows promise in prophylactic and therapeutic vaccination for viral infections with cutaneous manifestations. Further studies are necessary before vaccines for HSV, HPV, and HIV become commercially available.

  11. Interferon Lambda: Modulating Immunity in Infectious Diseases

    PubMed Central

    Syedbasha, Mohammedyaseen; Egli, Adrian

    2017-01-01

    Interferon lambdas (IFN-λs; IFNL1-4) modulate immunity in the context of infections and autoimmune diseases, through a network of induced genes. IFN-λs act by binding to the heterodimeric IFN-λ receptor (IFNLR), activating a STAT phosphorylation-dependent signaling cascade. Thereby hundreds of IFN-stimulated genes are induced, which modulate various immune functions via complex forward and feedback loops. When compared to the well-characterized IFN-α signaling cascade, three important differences have been discovered. First, the IFNLR is not ubiquitously expressed: in particular, immune cells show significant variation in the expression levels of and susceptibilities to IFN-λs. Second, the binding affinities of individual IFN-λs to the IFNLR varies greatly and are generally lower compared to the binding affinities of IFN-α to its receptor. Finally, genetic variation in the form of a series of single-nucleotide polymorphisms (SNPs) linked to genes involved in the IFN-λ signaling cascade has been described and associated with the clinical course and treatment outcomes of hepatitis B and C virus infection. The clinical impact of IFN-λ signaling and the SNP variations may, however, reach far beyond viral hepatitis. Recent publications show important roles for IFN-λs in a broad range of viral infections such as human T-cell leukemia type-1 virus, rotaviruses, and influenza virus. IFN-λ also potentially modulates the course of bacterial colonization and infections as shown for Staphylococcus aureus and Mycobacterium tuberculosis. Although the immunological processes involved in controlling viral and bacterial infections are distinct, IFN-λs may interfere at various levels: as an innate immune cytokine with direct antiviral effects; or as a modulator of IFN-α-induced signaling via the suppressor of cytokine signaling 1 and the ubiquitin-specific peptidase 18 inhibitory feedback loops. In addition, the modulation of adaptive immune functions via macrophage and

  12. APOBEC3 Proteins in Viral Immunity

    PubMed Central

    Stavrou, Spyridon; Ross, Susan R.

    2015-01-01

    Apolipoprotein B Editing Complex (APOBEC3) family members are cytidine deaminases that play important roles in intrinsic responses to infection by retroviruses and have also been implicated in the control of other viruses such as parvoviruses, herpesviruses, papillomaviruses, hepatitis B virus and retrotransposons. While their direct effect on modification of viral DNA has been clearly demonstrated, whether they play additional roles in innate and adaptive immunity to viruses is less clear. Here we review the data regarding the various steps in the innate and adaptive immune response to virus infection in which APOBEC3 proteins have been implicated. PMID:26546688

  13. [The other types of viral hepatitis].

    PubMed

    Miguet, J P; Coaquette, A; Bresson-Hadni, S; Lab, M

    1990-06-21

    Hepatitis due to viruses other than A, B, C, D, E are numerous but uncommon in adults. Among the group of Herpesviridae (HSV, CMV, EBV, VZV), clinical hepatitis is usually suggestive of disseminated viral infection. Fulminant hepatitis occasionally observed in immunocompromised hosts are due to HSV, and VZV, but exceptionally to EBV. Many new techniques using specific monoclonal antibodies permit an accurate and fast diagnosis. Three drugs (vidarabine, acyclovir, ribavirine) have been shown to be efficient in the treatment of severe forms of the disease. Hepatitis due to exotic viruses (Amaril, Ebola, Lassa) are exceptional in France, but require specific prophylactic measures.

  14. The Etiology and Pathogenesis of Viral Gastroenteritis.

    DTIC Science & Technology

    1982-07-31

    22:370-373,1980. 8. Parrino ,T.A.,Schreiber,D.S.,Trier,J.S.,Kapikian,A.Z.,Blacklow,N.R.: Clinical immunity in acute gastroenteritis caused by Norwalk...for evidence of infection with Norwalk virus. Such studies have already shown the epidemiologic importance of Norwalk 8. Parrino ,T.A.,Schreiber,D.S...function in viral gastroenteritis. Ann.Int.Med. 22:370-373,1980. 8. Parrino , T.A., Schreiber, D.S., Trier, J.S.,Kapikian,A.Z.,Blacklow,N.R.: Clini- cal

  15. Bovine viral diarrhea virus: global status.

    PubMed

    Ridpath, Julia F

    2010-03-01

    Despite the success of regional bovine viral diarrhea viruses (BVDV) eradication programs, infections remain a source of economic loss for producers. The wide variation among BVDV results in differences in genotype, biotype, virulence, and types of infections. BVDV infect a range of domestic and wild ruminants. Clinical presentation varies depending on strain of virus, species of host, immune status of host, reproductive status of host, age of host, and concurrent infections. Recent advances in BVDV research and diagnostics have led to the development of regional eradication/control programs, the most efficacious of which focus on biosecurity, surveillance, and control.

  16. Non-viral causes of hepatocellular carcinoma

    PubMed Central

    Blonski, Wojciech; Kotlyar, David S; Forde, Kimberly A

    2010-01-01

    Hepatocellular carcinoma (HCC) is the most common primary liver malignancy and represents an international public health concern as one of the most deadly cancers worldwide. The main etiology of HCC is chronic infection with hepatitis B and hepatitis C viruses. However, there are other important factors that contribute to the international burden of HCC. Among these are obesity, diabetes, non-alcoholic steatohepatitis and dietary exposures. Emerging evidence suggests that the etiology of many cases of HCC is in fact multifactorial, encompassing infectious etiologies, comorbid conditions and environmental exposures. Clarification of relevant non-viral causes of HCC will aid in preventative efforts to curb the rising incidence of this disease. PMID:20677332

  17. Viral Oncolytic Therapeutics for Neoplastic Meningitis

    DTIC Science & Technology

    2012-07-01

    Herpes simplex virus g134.5 expression and oncolysis of diffuse liver metastases by Myb34.5. J Clin...Invest 2002;109:871–82. Kuruppu D, Tanabe KK. Viral oncolysis by herpes simplex virus and other viruses. Cancer Biology & Therapy. 2005; 4(5...524-31 Kuruppu D, Brownell A, Zhu A, Yu M, Wang X, Kulu Y, Fuchs B, Kawasaki H, Tanabe KK. Positron emission tomography of herpes simplex virus 1 oncolysis. Cancer Research. 2007; 67(7): 3295.

  18. Viral decay and viral production rates in continental-shelf and deep-sea sediments of the Mediterranean Sea.

    PubMed

    Corinaldesi, Cinzia; Dell'Anno, Antonio; Magagnini, Mirko; Danovaro, Roberto

    2010-05-01

    Here, for the first time, we have carried out synoptic measurements of viral production and decay rates in continental-shelf and deep-sea sediments of the Mediterranean Sea to explore the viral balance. The net viral production and decay rates (1.1-61.2 and 0.6-13.5 x 10(7) viruses g(-1) h(-1), respectively) were significantly correlated, and were also related to prokaryotic heterotrophic production. The addition of enzymes increased the decay rates in the surface sediments, but not in the subsurface sediments. Both the viral production and the decay rates decreased significantly in the deeper sediment layers, while the virus-to-prokaryote abundance ratio increased, suggesting a high preservation of viruses in the subsurface sediments. Viral decay did not balance viral production at any of the sites investigated, accounting on average for c. 32% of the gross viral production in the marine sediments. We estimate that the carbon (C) released by viral decay contributed 6-23% to the total C released by the viral shunt. Because only c. 2% of the viruses produced can infect other prokaryotes, the majority is not subjected to direct lysis and potentially remains as a food source for benthic consumers. The results reported here suggest that viral decay can play an important role in biogeochemical cycles and benthic trophodynamics.

  19. Capsid-Targeted Viral Inactivation: A Novel Tactic for Inhibiting Replication in Viral Infections

    PubMed Central

    Zhang, Xingcui; Jia, Renyong; Zhou, Jiakun; Wang, Mingshu; Yin, Zhongqiong; Cheng, Anchun

    2016-01-01

    Capsid-targeted viral inactivation (CTVI), a conceptually powerful new antiviral strategy, is attracting increasing attention from researchers. Specifically, this strategy is based on fusion between the capsid protein of a virus and a crucial effector molecule, such as a nuclease (e.g., staphylococcal nuclease, Barrase, RNase HI), lipase, protease, or single-chain antibody (scAb). In general, capsid proteins have a major role in viral integration and assembly, and the effector molecule used in CTVI functions to degrade viral DNA/RNA or interfere with proper folding of viral key proteins, thereby affecting the infectivity of progeny viruses. Interestingly, such a capsid–enzyme fusion protein is incorporated into virions during packaging. CTVI is more efficient compared to other antiviral methods, and this approach is promising for antiviral prophylaxis and therapy. This review summarizes the mechanism and utility of CTVI and provides some successful applications of this strategy, with the ultimate goal of widely implementing CTVI in antiviral research. PMID:27657114

  20. Broad Surveys of DNA Viral Diversity Obtained through Viral Metagenomics of Mosquitoes

    PubMed Central

    Ng, Terry Fei Fan; Willner, Dana L.; Lim, Yan Wei; Schmieder, Robert; Chau, Betty; Nilsson, Christina; Anthony, Simon; Ruan, Yijun; Rohwer, Forest; Breitbart, Mya

    2011-01-01

    Viruses are the most abundant and diverse genetic entities on Earth; however, broad surveys of viral diversity are hindered by the lack of a universal assay for viruses and the inability to sample a sufficient number of individual hosts. This study utilized vector-enabled metagenomics (VEM) to provide a snapshot of the diversity of DNA viruses present in three mosquito samples from San Diego, California. The majority of the sequences were novel, suggesting that the viral community in mosquitoes, as well as the animal and plant hosts they feed on, is highly diverse and largely uncharacterized. Each mosquito sample contained a distinct viral community. The mosquito viromes contained sequences related to a broad range of animal, plant, insect and bacterial viruses. Animal viruses identified included anelloviruses, circoviruses, herpesviruses, poxviruses, and papillomaviruses, which mosquitoes may have obtained from vertebrate hosts during blood feeding. Notably, sequences related to human papillomaviruses were identified in one of the mosquito samples. Sequences similar to plant viruses were identified in all mosquito viromes, which were potentially acquired through feeding on plant nectar. Numerous bacteriophages and insect viruses were also detected, including a novel densovirus likely infecting Culex erythrothorax. Through sampling insect vectors, VEM enables broad survey of viral diversity and has significantly increased our knowledge of the DNA viruses present in mosquitoes. PMID:21674005

  1. Studying the immune response to human viral infections using zebrafish.

    PubMed

    Goody, Michelle F; Sullivan, Con; Kim, Carol H

    2014-09-01

    Humans and viruses have a long co-evolutionary history. Viral illnesses have and will continue to shape human history: from smallpox, to influenza, to HIV, and beyond. Animal models of human viral illnesses are needed in order to generate safe and effective antiviral medicines, adjuvant therapies, and vaccines. These animal models must support the replication of human viruses, recapitulate aspects of human viral illnesses, and respond with conserved immune signaling cascades. The zebrafish is perhaps the simplest, most commonly used laboratory model organism in which innate and/or adaptive immunity can be studied. Herein, we will discuss the current zebrafish models of human viral illnesses and the insights they have provided. We will highlight advantages of early life stage zebrafish and the importance of innate immunity in human viral illnesses. We will also discuss viral characteristics to consider before infecting zebrafish with human viruses as well as predict other human viruses that may be able to infect zebrafish.

  2. Inhibitor-Based Therapeutics for Treatment of Viral Hepatitis.

    PubMed

    Dey, Debajit; Banerjee, Manidipa

    2016-09-28

    Viral hepatitis remains a significant worldwide threat, in spite of the availability of several successful therapeutic and vaccination strategies. Complications associated with acute and chronic infections, such as liver failure, cirrhosis and hepatocellular carcinoma, are the cause of considerable morbidity and mortality. Given the significant burden on the healthcare system caused by viral hepatitis, it is essential that novel, more effective therapeutics be developed. The present review attempts to summarize the current treatments against viral hepatitis, and provides an outline for upcoming, promising new therapeutics. Development of novel therapeutics requires an understanding of the viral life cycles and viral effectors in molecular detail. As such, this review also discusses virally-encoded effectors, found to be essential for virus survival and replication in the host milieu, which may be utilized as potential candidates for development of alternative therapies in the future.

  3. Viral Evasion and Manipulation of Host RNA Quality Control Pathways

    PubMed Central

    2016-01-01

    Viruses have evolved diverse strategies to maximize the functional and coding capacities of their genetic material. Individual viral RNAs are often used as substrates for both replication and translation and can contain multiple, sometimes overlapping open reading frames. Further, viral RNAs engage in a wide variety of interactions with both host and viral proteins to modify the activities of important cellular factors and direct their own trafficking, packaging, localization, stability, and translation. However, adaptations increasing the information density of small viral genomes can have unintended consequences. In particular, viral RNAs have developed features that mark them as potential targets of host RNA quality control pathways. This minireview focuses on ways in which viral RNAs run afoul of the cellular mRNA quality control and decay machinery, as well as on strategies developed by viruses to circumvent or exploit cellular mRNA surveillance. PMID:27226372

  4. Effects of cannabinoids and their receptors on viral infections.

    PubMed

    Tahamtan, Alireza; Tavakoli-Yaraki, Masoumeh; Rygiel, Tomasz P; Mokhtari-Azad, Talat; Salimi, Vahid

    2016-01-01

    Cannabinoids, the active ingredient in marijuana, and their derivatives have received remarkable attention in the last two decades because they can affect tumor growth and metastasis. There is a large body of evidence from in vivo and in vitro models showing that cannabinoids and their receptors influence the immune system, viral pathogenesis, and viral replication. The present study reviews current insights into the role of cannabinoids and their receptors on viral infections. The results reported here indicate that cannabinoids and their receptors have different sequels for viral infection. Although activation or inhibition of cannabinoid receptors in the majority of viral infections are proper targets for development of safe and effective treatments, caution is required before using pharmaceutical cannabinoids as a treatment agent for patients with viral infections.

  5. Viral Evasion and Manipulation of Host RNA Quality Control Pathways.

    PubMed

    Hogg, J Robert

    2016-08-15

    Viruses have evolved diverse strategies to maximize the functional and coding capacities of their genetic material. Individual viral RNAs are often used as substrates for both replication and translation and can contain multiple, sometimes overlapping open reading frames. Further, viral RNAs engage in a wide variety of interactions with both host and viral proteins to modify the activities of important cellular factors and direct their own trafficking, packaging, localization, stability, and translation. However, adaptations increasing the information density of small viral genomes can have unintended consequences. In particular, viral RNAs have developed features that mark them as potential targets of host RNA quality control pathways. This minireview focuses on ways in which viral RNAs run afoul of the cellular mRNA quality control and decay machinery, as well as on strategies developed by viruses to circumvent or exploit cellular mRNA surveillance.

  6. Molecular mechanisms of neuroinflammation and injury during acute viral encephalitis.

    PubMed

    Shives, Katherine D; Tyler, Kenneth L; Beckham, J David

    2017-03-11

    Viral infections in the central nervous system are a major cause of encephalitis. West Nile virus (WNV) and Herpes simplex virus (HSV) are the most common causes of viral encephalitis in the United States. We review the role of neuroinflammation in the pathogenesis of WNV and HSV infections in the central nervous system (CNS). We discuss the role of the innate and cell-mediated immune responses in peripheral control of viral infection, viral invasion of the CNS, and in inflammatory-mediated neuronal injury. By understanding the role of specific inflammatory responses to viral infections in the CNS, targeted therapeutic approaches can be developed to maximize control of acute viral infection while minimizing neuronal injury in the CNS.

  7. Inhibitor-Based Therapeutics for Treatment of Viral Hepatitis

    PubMed Central

    Dey, Debajit; Banerjee, Manidipa

    2016-01-01

    Abstract Viral hepatitis remains a significant worldwide threat, in spite of the availability of several successful therapeutic and vaccination strategies. Complications associated with acute and chronic infections, such as liver failure, cirrhosis and hepatocellular carcinoma, are the cause of considerable morbidity and mortality. Given the significant burden on the healthcare system caused by viral hepatitis, it is essential that novel, more effective therapeutics be developed. The present review attempts to summarize the current treatments against viral hepatitis, and provides an outline for upcoming, promising new therapeutics. Development of novel therapeutics requires an understanding of the viral life cycles and viral effectors in molecular detail. As such, this review also discusses virally-encoded effectors, found to be essential for virus survival and replication in the host milieu, which may be utilized as potential candidates for development of alternative therapies in the future. PMID:27777893

  8. Silencing Viral MicroRNA as a Novel Antiviral Therapy?

    PubMed Central

    Moens, Ugo

    2009-01-01

    Viruses are intracellular parasites that ensure their existence by converting host cells into viral particle producing entities or into hiding places rendering the virus invisible to the host immune system. Some viruses may also survive by transforming the infected cell into an immortal tumour cell. MicroRNAs are small non-coding transcripts that function as posttranscriptional regulators of gene expression. Viruses encode miRNAs that regulate expression of both cellular and viral genes, and contribute to the pathogenic properties of viruses. Hence, neutralizing the action of viral miRNAs expression by complementary single-stranded oligonucleotides or so-called anti-miRNAs may represent a strategy to combat viral infections and viral-induced pathogenesis. This review describes the miRNAs encoded by human viruses, and discusses the possible therapeutic applications of anti-miRNAs against viral diseases. PMID:19704916

  9. Exploring viral infection using single-cell sequencing.

    PubMed

    Rato, Sylvie; Golumbeanu, Monica; Telenti, Amalio; Ciuffi, Angela

    2016-11-02

    Single-cell sequencing (SCS) has emerged as a valuable tool to study cellular heterogeneity in diverse fields, including virology. By studying the viral and cellular genome and/or transcriptome, the dynamics of viral infection can be investigated at single cell level. Most studies have explored the impact of cell-to-cell variation on the viral life cycle from the point of view of the virus, by analyzing viral sequences, and from the point of view of the cell, mainly by analyzing the cellular host transcriptome. In this review, we will focus on recent studies that use single-cell sequencing to explore viral diversity and cell variability in response to viral replication.

  10. Viral sequences integrated into plant genomes.

    PubMed

    Harper, Glyn; Hull, Roger; Lockhart, Ben; Olszewski, Neil

    2002-01-01

    Sequences of various DNA plant viruses have been found integrated into the host genome. There are two forms of integrant, those that can form episomal viral infections and those that cannot. Integrants of three pararetroviruses, Banana streak virus (BSV), Tobacco vein clearing virus (TVCV), and Petunia vein clearing virus (PVCV), can generate episomal infections in certain hybrid plant hosts in response to stress. In the case of BSV and TVCV, one of the parents contains the integrant but is has not been seen to be activated in that parent; the other parent does not contain the integrant. The number of integrant loci is low for BSV and PVCV and high in TVCV. The structure of the integrants is complex, and it is thought that episomal virus is released by recombination and/or reverse transcription. Geminiviral and pararetroviral sequences are found in plant genomes although not so far associated with a virus disease. It appears that integration of viral sequences is widespread in the plant kingdom and has been occurring for a long period of time.

  11. Optimal viral strategies for bypassing RNA silencing.

    PubMed

    Rodrigo, Guillermo; Carrera, Javier; Jaramillo, Alfonso; Elena, Santiago F

    2011-02-06

    The RNA silencing pathway constitutes a defence mechanism highly conserved in eukaryotes, especially in plants, where the underlying working principle relies on the repressive action triggered by the intracellular presence of double-stranded RNAs. This immune system performs a post-transcriptional suppression of aberrant mRNAs or viral RNAs by small interfering RNAs (siRNAs) that are directed towards their target in a sequence-specific manner. However, viruses have evolved strategies to escape from silencing surveillance while promoting their own replication. Several viruses encode suppressor proteins that interact with different elements of the RNA silencing pathway and block it. The different suppressors are not phylogenetically nor structurally related and also differ in their mechanism of action. Here, we adopt a model-driven forward-engineering approach to understand the evolution of suppressor proteins and, in particular, why viral suppressors preferentially target some components of the silencing pathway. We analysed three strategies characterized by different design principles: replication in the absence of a suppressor, suppressors targeting the first protein component of the pathway and suppressors targeting the siRNAs. Our results shed light on the question of whether a virus must opt for devoting more time into transcription or into translation and on which would be the optimal step of the silencing pathway to be targeted by suppressors. In addition, we discussed the evolutionary implications of such designing principles.

  12. Branching dynamics of viral information spreading

    NASA Astrophysics Data System (ADS)

    Iribarren, José Luis; Moro, Esteban

    2011-10-01

    Despite its importance for rumors or innovations propagation, peer-to-peer collaboration, social networking, or marketing, the dynamics of information spreading is not well understood. Since the diffusion depends on the heterogeneous patterns of human behavior and is driven by the participants’ decisions, its propagation dynamics shows surprising properties not explained by traditional epidemic or contagion models. Here we present a detailed analysis of our study of real viral marketing campaigns where tracking the propagation of a controlled message allowed us to analyze the structure and dynamics of a diffusion graph involving over 31 000 individuals. We found that information spreading displays a non-Markovian branching dynamics that can be modeled by a two-step Bellman-Harris branching process that generalizes the static models known in the literature and incorporates the high variability of human behavior. It explains accurately all the features of information propagation under the “tipping point” and can be used for prediction and management of viral information spreading processes.

  13. Branching dynamics of viral information spreading.

    PubMed

    Iribarren, José Luis; Moro, Esteban

    2011-10-01

    Despite its importance for rumors or innovations propagation, peer-to-peer collaboration, social networking, or marketing, the dynamics of information spreading is not well understood. Since the diffusion depends on the heterogeneous patterns of human behavior and is driven by the participants' decisions, its propagation dynamics shows surprising properties not explained by traditional epidemic or contagion models. Here we present a detailed analysis of our study of real viral marketing campaigns where tracking the propagation of a controlled message allowed us to analyze the structure and dynamics of a diffusion graph involving over 31,000 individuals. We found that information spreading displays a non-Markovian branching dynamics that can be modeled by a two-step Bellman-Harris branching process that generalizes the static models known in the literature and incorporates the high variability of human behavior. It explains accurately all the features of information propagation under the "tipping point" and can be used for prediction and management of viral information spreading processes.

  14. An atomistic approach to viral mechanical oscillations

    NASA Astrophysics Data System (ADS)

    Sankey, Otto F.

    2009-03-01

    Viruses are the simplest ``life'' form. These parasites reproduce by borrowing the machinery of their host cell. Many are pathogenic to plants, animals, and humans. Viruses possess an outer protein coat (capsid) that protects its genomic material that resides inside. We have developed a theoretical technique to model the very low frequency mechanical modes of the viral capsid with atomic resolution. The method uses empirical force fields and a mathematical framework borrowed from electronic structure theory for finding low energy states. The low frequency modes can be ``pinged'' with an ultra-short laser pulse and the aim of the light/vibrational coupling is to interfere with the viral life cycle. The theoretical work here is motivated by the recent work of Tsen et al. [2] who have used ultra-short pulsed laser scattering to inactivate viruses. The methodology can be applied to many systems, and the coupled mechanical oscillations of other floppy biomolecules such as a complete ATP binding cassette (ABC transporter) will also be discussed. Co-authors of this work are Dr. Eric Dykeman, Prof. K.-T. Tsen and Daryn Benson. [4pt] [1] E.C. Dykeman et al., Phys. Rev. Lett., 100, 028101 (2008). [0pt] [2] K-T. Tsen et al., J. of Physics -- Cond. Mat. 19, 472201 (2007).

  15. Henipavirus membrane fusion and viral entry.

    PubMed

    Aguilar, Hector C; Iorio, Ronald M

    2012-01-01

    Nipah (NiV) and Hendra (HeV) viruses cause cell-cell fusion (syncytia) in brain, lung, heart, and kidney tissues, leading to encephalitis, pneumonia, and often death. Membrane fusion is essential to both viral entry and virus-induced cell-cell fusion, a hallmark of henipavirus infections. Elucidiation of the mechanism(s) of membrane fusion is critical to understanding henipavirus pathobiology and has the potential to identify novel strategies for the development of antiviral therapeutic agents. Henipavirus membrane fusion requires the coordinated actions of the viral attachment (G) and fusion (F) glycoproteins. Current henipavirus fusion models posit that attachment of NiV or HeV G to its cell surface receptors releases F from its metastable pre-fusion conformation to mediate membrane fusion. The identification of ephrinB2 and ephrinB3 as henipavirus receptors has paved the way for recent advances in our understanding of henipavirus membrane fusion. These advances highlight mechanistic similarities and differences between membrane fusion for the henipavirus and other genera within the Paramyxoviridae family. Here, we review these mechanisms and the current gaps in our knowledge in the field.

  16. Detection of viral hemorrhagic septicemia virus

    USGS Publications Warehouse

    Winton, James; Kurath, Gael; Batts, William

    2007-01-01

    Viral hemorrhagic septicemia virus (VHSV) is considered to be one of the most important viral pathogens of finfish and is listed as reportable by many nations and international organizations (Office International des Epizooties 2006). Prior to 1988, VHSV was thought to be limited to Europe (Wolf 1988; Smail 1999). Subsequently, it was shown that the virus is endemic among many marine and anadromous fish species in both the Pacific and Atlantic Oceans (Meyers and Winton 1995; Skall et al. 2005). Genetic analysis reveals that isolates of VHSV can be divided into four genotypes that generally correlate with geographic location with the North American isolates generally falling into VHSV Genotype IV (Snow et al. 2004). In 2005-2006, reports from the Great Lakes region indicated that wild fish had experienced disease or, in some cases, very large die-offs from VHSV (Elsayed et al. 2006, Lumsden et al. 2007). The new strain from the Great Lakes, now identified as VHSV Genotype IVb, appears most closely related to isolates of VHSV from mortalities that occurred during 2000-2004 in rivers and near-shore areas of New Brunswick and Nova Scotia, Canada (Gagne et al. 2007). The type IVb isolate found in the Great Lakes region is the only strain outside of Europe that has been associated with significant mortality in freshwater species.

  17. Endogenous Viral Elements in Animal Genomes

    PubMed Central

    Katzourakis, Aris; Gifford, Robert J.

    2010-01-01

    Integration into the nuclear genome of germ line cells can lead to vertical inheritance of retroviral genes as host alleles. For other viruses, germ line integration has only rarely been documented. Nonetheless, we identified endogenous viral elements (EVEs) derived from ten non-retroviral families by systematic in silico screening of animal genomes, including the first endogenous representatives of double-stranded RNA, reverse-transcribing DNA, and segmented RNA viruses, and the first endogenous DNA viruses in mammalian genomes. Phylogenetic and genomic analysis of EVEs across multiple host species revealed novel information about the origin and evolution of diverse virus groups. Furthermore, several of the elements identified here encode intact open reading frames or are expressed as mRNA. For one element in the primate lineage, we provide statistically robust evidence for exaptation. Our findings establish that genetic material derived from all known viral genome types and replication strategies can enter the animal germ line, greatly broadening the scope of paleovirological studies and indicating a more significant evolutionary role for gene flow from virus to animal genomes than has previously been recognized. PMID:21124940

  18. Clinical and experimental aspects of viral myocarditis.

    PubMed Central

    Leslie, K; Blay, R; Haisch, C; Lodge, A; Weller, A; Huber, S

    1989-01-01

    Picornaviruses are frequently implicated as the etiological agents of acute myocarditis. This association is based historically on serological evidence of rising antibody titers to specific pathogens and more recently on identification of viral genomic material in endocardial biopsy specimens through in situ hybridization. Only rarely is infectious virus isolated from either the patient or the heart during periods of maximum myocardial inflammation and injury. Thus, despite a probable viral etiology, much interest centers on the role of the immune system in cardiac damage and the likelihood that the infection triggers an autoimmune response to heart-specific antigens. Heart-reactive antibodies and T cells are found in most myocarditis patients, and immunosuppressive therapy has proven beneficial in many, though not all, cases. Furthermore, murine models of coxsackievirus group B type 3-induced myocarditis also demonstrate that virus infection initiates autoimmunity and that these autoimmune effectors are predominately responsible for tissue injury. How virus-host interactions overcome presumed self-tolerance to heart antigens is discussed, and evidence supporting various theories of virus-initiated autoimmunity and disease pathogenesis are delineated. PMID:2650861

  19. Enhancement of viral fusion by nonadsorbing polymers.

    PubMed Central

    Herrmann, A; Clague, M J; Blumenthal, R

    1993-01-01

    Nonadsorbing polymers such as dextran and poly(ethylene glycol) enhance binding as well as extents of fusion of influenza virus with erythrocytes. Kinetics and extent of viral membrane fusion were measured using an assay based on lipid mixing of a fluorescent dye. The effects of nonadsorbing polymers were in the concentration range from 0 to 10 wt%, far below the concentration required to overcome hydration repulsion forces. The enhancing effects were dependent on the molecular weight of nonadsorbing polymer, and only occurred at molecular weight > 1500; this links the phenomena we observe to the so-called "excluded volume effect" of nonadsorbing polymers. The time delay between triggering and the onset of influenza virus fusion was significantly reduced in the presence of nonadsorbing polymers. High molecular weight poly(ethylene glycol) also induced fusion of vesicular stomatitis virus with intact erythrocytes, which do not serve as target of vesicular stomatitis virus fusion in the absence of the polymer. The forces between membranes which determine rate-limiting processes in viral fusion and how they are affected by nonadsorbing polymers are discussed. PMID:7690263

  20. Viral infections associated with haemophagocytic syndrome.

    PubMed

    Maakaroun, Nadine Rouphael; Moanna, Abeer; Jacob, Jesse T; Albrecht, Helmut

    2010-03-01

    Haemophagocytic syndrome (HPS) or haemophagocytic lymphohistiocytosis (HLH) is a rare disease caused by a dysfunction of cytotoxic T cells and NK cells. This T cell/NK cell dysregulation causes an aberrant cytokine release, resulting in proliferation/activation of histiocytes with subsequent haemophagocytosis. Histiocytic infiltration of the reticuloendothelial system results in hepatomegaly, splenomegaly, lymphadenopathy and pancytopenia ultimately leading to multiple organ dysfunctions. Common clinical features include high fevers despite broad spectrum antimicrobials, maculopapular rash, neurological symptoms, coagulopathy and abnormal liver function tests. Haemophagocytic syndrome can be either primary, i.e. due to an underlying genetic defect or secondary, associated with malignancies, autoimmune diseases (also called macrophage activation syndrome) or infections. Infectious triggers are most commonly due to viral infections mainly of the herpes group, with EBV being the most common cause. HPS can be fatal if untreated. Early recognition of the clinical presentation and laboratory abnormalities associated with HPS and prompt initiation of treatment can be life saving. HPS triggered by viral infections generally does not respond to specific antiviral therapy but may be treated with immunosuppressive/immunomodulatory agents and, in refractory cases, with bone marrow transplantation.

  1. Viral hepatitis in hemodialysis: An update

    PubMed Central

    Bernieh, Bassam

    2015-01-01

    Hepatitis outbreaks in hemodialysis (HD) patients and staff were reported in the late 1960s, and a number of hepatotropic viruses transmitted by blood and other body fluids have been identified. Hepatitis B virus (HBV) was the first significant hepatotropic virus to be identified in HD centers. HBV infection has been effectively controlled by active vaccination, screening of blood donors, the use of erythropoietin and segregation of HBV carriers. Hepatitis delta virus is a defective virus that can only infect HBV-positive individuals. Hepatitis C virus (HCV) is the most significant cause of non-A, non-B hepatitis and is mainly transmitted by blood transfusion. The introduction in 1990 of routine screening of blood donors for HCV contributed significantly to the control of HCV transmission. An effective HCV vaccine remains an unsolved challenge; however, pegylation of interferon-alfa has made it possible to treat HCV-positive dialysis patients. Unexplained sporadic outbreaks of hepatitis by the mid-1990s prompted the discovery of hepatitis G virus, hepatitis GB virus C and the TT virus. The vigilant observation of guidelines on universal precaution and regular virologic testing are the cornerstones of the effective control of chronic hepatitis in the setting of HD. Major recent advances in the viral diagnosis technology and the development of new oral, direct-acting antiviral agents allow early diagnosis and better therapeutic response. The current update will review the recent developments, controversies and new treatment of viral hepatitis in HD patients. PMID:27847896

  2. Nuclear Export Signal Masking Regulates HIV-1 Rev Trafficking and Viral RNA Nuclear Export.

    PubMed

    Behrens, Ryan T; Aligeti, Mounavya; Pocock, Ginger M; Higgins, Christina A; Sherer, Nathan M

    2017-02-01

    HIV-1's Rev protein forms a homo-oligomeric adaptor complex linking viral RNAs to the cellular CRM1/Ran-GTP nuclear export machinery through the activity of Rev's prototypical leucine-rich nuclear export signal (NES). In this study, we used a functional fluorescently tagged Rev fusion protein as a platform to study the effects of modulating Rev NES identity, number, position, or strength on Rev subcellular trafficking, viral RNA nuclear export, and infectious virion production. We found that Rev activity was remarkably tolerant of diverse NES sequences, including supraphysiological NES (SNES) peptides that otherwise arrest CRM1 transport complexes at nuclear pores. Rev's ability to tolerate a SNES was both position and multimerization dependent, an observation consistent with a model wherein Rev self-association acts to transiently mask the NES peptide(s), thereby biasing Rev's trafficking into the nucleus. Combined imaging and functional assays also indicated that NES masking underpins Rev's well-known tendency to accumulate at the nucleolus, as well as Rev's capacity to activate optimal levels of late viral gene expression. We propose that Rev multimerization and NES masking regulates Rev's trafficking to and retention within the nucleus even prior to RNA binding.

  3. Are Viral-Encoded MicroRNAs Mediating Latent HIV-1 Infection?

    PubMed Central

    WEINBERG, MARC S.; MORRIS, KEVIN V.

    2010-01-01

    The Human Immunodeficiency Virus type 1 (HIV-1), a member of the lentivirus subfamily, infects both dividing and nondividing cells and, following reverse transcription of the viral RNA genome, integrates into the host chromatin where it enters into a latent state. Many of the factors governing viral latency remain unresolved and current antiviral treatment regimens are largely ineffective at eliminating cellular reservoirs of latent virus. The recent identification of microRNA (miRNA) encoding sequences embedded in the HIV-1 genome, and the discovery of functional virus-derived miRNAs, suggests a role for RNA Interference (RNAi) in the regulation of HIV-1 gene expression. Recently, the mammalian RNAi machinery was shown to regulate gene expression epigenetically by transcriptional modulation, providing a direct link between RNAi and a mechanism for inducing latency. Interestingly, both HIV-1 Tat, and the host TAR RNA-binding protein (TRBP), bind to the transactivating response (TAR) RNA of HIV-1 and affect the function of RNAi in human cells. Specifically, TRBP, a cofactor in Tat-TAR interactions, is a vital component of Dicer-mediated dsRNA processing. These novel observations support a central role for HIV-1 and associated host factors in regulating cellular RNAi and viral gene expression through RNA directed processes. Thus, HIV-1 may have evolved mechanisms to exploit the RNAi pathway at both the transcriptional and posttranscriptional level to affect and/or maintain a latent infection. PMID:16629595

  4. HIV-1 Tat and Viral Latency: What We Can Learn from Naturally Occurring Sequence Variations.

    PubMed

    Kamori, Doreen; Ueno, Takamasa

    2017-01-01

    Despite the effective use of antiretroviral therapy, the remainder of a latently HIV-1-infected reservoir mainly in the resting memory CD4(+) T lymphocyte subset has provided a great setback toward viral eradication. While host transcriptional silencing machinery is thought to play a dominant role in HIV-1 latency, HIV-1 protein such as Tat, may affect both the establishment and the reversal of latency. Indeed, mutational studies have demonstrated that insufficient Tat transactivation activity can result in impaired transcription of viral genes and the establishment of latency in cell culture experiments. Because Tat protein is one of highly variable proteins within HIV-1 proteome, it is conceivable that naturally occurring Tat mutations may differentially modulate Tat functions, thereby influencing the establishment and/or the reversal of viral latency in vivo. In this mini review, we summarize the recent findings of Tat naturally occurring polymorphisms associating with host immune responses and we highlight the implication of Tat sequence variations in relation to HIV latency.

  5. Suppression of Rac1 Signaling by Influenza A Virus NS1 Facilitates Viral Replication

    PubMed Central

    Jiang, Wei; Sheng, Chunjie; Gu, Xiuling; Liu, Dong; Yao, Chen; Gao, Shijuan; Chen, Shuai; Huang, Yinghui; Huang, Wenlin; Fang, Min

    2016-01-01

    Influenza A virus (IAV) is a major human pathogen with the potential to become pandemic. IAV contains only eight RNA segments; thus, the virus must fully exploit the host cellular machinery to facilitate its own replication. In an effort to comprehensively characterize the host machinery taken over by IAV in mammalian cells, we generated stable A549 cell lines with over-expression of the viral non-structural protein (NS1) to investigate the potential host factors that might be modulated by the NS1 protein. We found that the viral NS1 protein directly interacted with cellular Rac1 and facilitated viral replication. Further research revealed that NS1 down-regulated Rac1 activity via post-translational modifications. Therefore, our results demonstrated that IAV blocked Rac1-mediated host cell signal transduction through the NS1 protein to facilitate its own replication. Our findings provide a novel insight into the mechanism of IAV replication and indicate new avenues for the development of potential therapeutic targets. PMID:27869202

  6. HIV-1 Tat and Viral Latency: What We Can Learn from Naturally Occurring Sequence Variations

    PubMed Central

    Kamori, Doreen; Ueno, Takamasa

    2017-01-01

    Despite the effective use of antiretroviral therapy, the remainder of a latently HIV-1-infected reservoir mainly in the resting memory CD4+ T lymphocyte subset has provided a great setback toward viral eradication. While host transcriptional silencing machinery is thought to play a dominant role in HIV-1 latency, HIV-1 protein such as Tat, may affect both the establishment and the reversal of latency. Indeed, mutational studies have demonstrated that insufficient Tat transactivation activity can result in impaired transcription of viral genes and the establishment of latency in cell culture experiments. Because Tat protein is one of highly variable proteins within HIV-1 proteome, it is conceivable that naturally occurring Tat mutations may differentially modulate Tat functions, thereby influencing the establishment and/or the reversal of viral latency in vivo. In this mini review, we summarize the recent findings of Tat naturally occurring polymorphisms associating with host immune responses and we highlight the implication of Tat sequence variations in relation to HIV latency. PMID:28194140

  7. Thermodynamic instability of viral proteins is a pathogen-associated molecular pattern targeted by human defensins

    PubMed Central

    Kudryashova, Elena; Koneru, Pratibha C.; Kvaratskhelia, Mamuka; Strömstedt, Adam A.; Lu, Wuyuan; Kudryashov, Dmitri S.

    2016-01-01

    Human defensins are innate immune defense peptides with a remarkably broad repertoire of anti-pathogen activities. In addition to modulating immune response, inflammation, and angiogenesis, disintegrating bacterial membranes, and inactivating bacterial toxins, defensins are known to intercept various viruses at different stages of their life cycles, while remaining relatively benign towards human cells and proteins. Recently we have found that human defensins inactivate proteinaceous bacterial toxins by taking advantage of their low thermodynamic stability and acting as natural “anti-chaperones”, i.e. destabilizing the native conformation of the toxins. In the present study we tested various proteins produced by several viruses (HIV-1, PFV, and TEV) and found them to be susceptible to destabilizing effects of human α-defensins HNP-1 and HD-5 and the synthetic θ-defensin RC-101, but not β-defensins hBD-1 and hBD-2 or structurally related plant-derived peptides. Defensin-induced unfolding promoted exposure of hydrophobic groups otherwise confined to the core of the viral proteins. This resulted in precipitation, an enhanced susceptibility to proteolytic cleavage, and a loss of viral protein activities. We propose, that defensins recognize and target a common and essential physico-chemical property shared by many bacterial toxins and viral proteins – the intrinsically low thermodynamic protein stability. PMID:27581352

  8. Targeting Viral Proteostasis Limits Influenza Virus, HIV, and Dengue Virus Infection.

    PubMed

    Heaton, Nicholas S; Moshkina, Natasha; Fenouil, Romain; Gardner, Thomas J; Aguirre, Sebastian; Shah, Priya S; Zhao, Nan; Manganaro, Lara; Hultquist, Judd F; Noel, Justine; Sachs, David; Sachs, David H; Hamilton, Jennifer; Leon, Paul E; Chawdury, Amit; Tripathi, Shashank; Melegari, Camilla; Campisi, Laura; Hai, Rong; Metreveli, Giorgi; Gamarnik, Andrea V; García-Sastre, Adolfo; Greenbaum, Benjamin; Simon, Viviana; Fernandez-Sesma, Ana; Krogan, Nevan J; Mulder, Lubbertus C F; van Bakel, Harm; Tortorella, Domenico; Taunton, Jack; Palese, Peter; Marazzi, Ivan

    2016-01-19

    Viruses are obligate parasites and thus require the machinery of the host cell to replicate. Inhibition of host factors co-opted during active infection is a strategy hosts use to suppress viral replication and a potential pan-antiviral therapy. To define the cellular proteins and processes required for a virus during infection is thus crucial to understanding the mechanisms of virally induced disease. In this report, we generated fully infectious tagged influenza viruses and used infection-based proteomics to identify pivotal arms of cellular signaling required for influenza virus growth and infectivity. Using mathematical modeling and genetic and pharmacologic approaches, we revealed that modulation of Sec61-mediated cotranslational translocation selectively impaired glycoprotein proteostasis of influenza as well as HIV and dengue viruses and led to inhibition of viral growth and infectivity. Thus, by studying virus-human protein-protein interactions in the context of active replication, we have identified targetable host factors for broad-spectrum antiviral therapies.

  9. α4-integrins control viral meningoencephalitis through differential recruitment of T helper cell subsets

    PubMed Central

    2014-01-01

    Introduction Natalizumab blocks α4-integrins and is a prototypic agent for a series of anti-inflammatory drugs that impair trafficking of immune cells into the CNS. However, modulation of the access of immune cells to the CNS is associated with impaired immune surveillance and detrimental viral infections of the CNS. Here, we explored the potency of cellular immune responses within the CNS to protect against viral encephalitis in mice with T cell conditional disruption of VLA-4 integrin (α4β1) expression. Results While VLA-4 expression in virus specific Th1 cells is non-redundant for their ability to access the CNS, α4-integrin deficient Th17 cells enter the CNS compartment and generate an inflammatory milieu upon intrathecal vaccinia virus (VV) infection. However, in contrast to Th1 cells that can adopt direct cytotoxic properties, Th17 cells fail to clear the virus due to insufficient Eomes induced perforin-1 expression. Conclusion The quality of the intrathecal cellular antiviral response under conditions of impaired VLA-4 function jeopardizes host protection. Our functional in vivo data extend our mechanistic understanding of anti-viral immunity in the CNS and help to estimate the risk potential of upcoming therapeutic agents that target the trafficking of immune cells into distinct anatomical compartments. PMID:24606807

  10. Viral Evasion Strategies in Type I IFN Signaling – A Summary of Recent Developments

    PubMed Central

    Schulz, Katharina S.; Mossman, Karen L.

    2016-01-01

    The immune system protects the organism against infections and the damage associated with them. The first line of defense against pathogens is the innate immune response. In the case of a viral infection, it induces the interferon (IFN) signaling cascade and eventually the expression of type I IFN, which then causes an antiviral state in the cells. However, many viruses have developed strategies to counteract this mechanism and prevent the production of IFN. In order to modulate or inhibit the IFN signaling cascade in their favor, viruses have found ways to interfere at every single step of the cascade, for example, by inducing protein degradation or cleavage, or by mediate protein polyubiquitination. In this article, we will review examples of viruses that modulate the IFN response and describe the mechanisms they use. PMID:27891131

  11. Bovine viral diarrhea virus in New World camelids.

    PubMed

    Belknap, E B; Collins, J K; Larsen, R S; Conrad, K P

    2000-11-01

    A virus known to cause multiple problems in cattle, bovine viral diarrhea virus, was isolated from 3 different cases in New World camelids. Virus isolation, immunoperoxidase staining, and fluorescent antibody staining were used to detect the virus. The herds involved were screened for antibody titers to bovine viral diarrhea and virus isolation from the buffy coat. Bovine viral diarrhea virus should be considered as a cause of death in young and old New World camelids.

  12. Sensitive Detection of Viral Transcripts in Human Tumor Transcriptomes

    PubMed Central

    Schelhorn, Sven-Eric; Fischer, Matthias; Tolosi, Laura; Altmüller, Janine; Nürnberg, Peter; Pfister, Herbert; Lengauer, Thomas; Berthold, Frank

    2013-01-01

    In excess of % of human cancer incidents have a viral cofactor. Epidemiological studies of idiopathic human cancers indicate that additional tumor viruses remain to be discovered. Recent advances in sequencing technology have enabled systematic screenings of human tumor transcriptomes for viral transcripts. However, technical problems such as low abundances of viral transcripts in large volumes of sequencing data, viral sequence divergence, and homology between viral and human factors significantly confound identification of tumor viruses. We have developed a novel computational approach for detecting viral transcripts in human cancers that takes the aforementioned confounding factors into account and is applicable to a wide variety of viruses and tumors. We apply the approach to conducting the first systematic search for viruses in neuroblastoma, the most common cancer in infancy. The diverse clinical progression of this disease as well as related epidemiological and virological findings are highly suggestive of a pathogenic cofactor. However, a viral etiology of neuroblastoma is currently contested. We mapped transcriptomes of neuroblastoma as well as positive and negative controls to the human and all known viral genomes in order to detect both known and unknown viruses. Analysis of controls, comparisons with related methods, and statistical estimates demonstrate the high sensitivity of our approach. Detailed investigation of putative viral transcripts within neuroblastoma samples did not provide evidence for the existence of any known human viruses. Likewise, de-novo assembly and analysis of chimeric transcripts did not result in expression signatures associated with novel human pathogens. While confounding factors such as sample dilution or viral clearance in progressed tumors may mask viral cofactors in the data, in principle, this is rendered less likely by the high sensitivity of our approach and the number of biological replicates analyzed. Therefore, our

  13. Phosphorylation of the Brome Mosaic Virus Capsid Regulates the Timing of Viral Infection

    PubMed Central

    Hoover, Haley S.; Wang, Joseph Che-Yen; Middleton, Stefani; Ni, Peng; Zlotnick, Adam

    2016-01-01

    ABSTRACT The four brome mosaic virus (BMV) RNAs (RNA1 to RNA4) are encapsidated in three distinct virions that have different disassembly rates in infection. The mechanism for the differential release of BMV RNAs from virions is unknown, since 180 copies of the same coat protein (CP) encapsidate each of the BMV genomic RNAs. Using mass spectrometry, we found that the BMV CP contains a complex pattern of posttranslational modifications. Treatment with phosphatase was found to not significantly affect the stability of the virions containing RNA1 but significantly impacted the stability of the virions that encapsidated BMV RNA2 and RNA3/4. Cryo-electron microscopy reconstruction revealed dramatic structural changes in the capsid and the encapsidated RNA. A phosphomimetic mutation in the flexible N-terminal arm of the CP increased BMV RNA replication and virion production. The degree of phosphorylation modulated the interaction of CP with the encapsidated RNA and the release of three of the BMV RNAs. UV cross-linking and immunoprecipitation methods coupled to high-throughput sequencing experiments showed that phosphorylation of the BMV CP can impact binding to RNAs in the virions, including sequences that contain regulatory motifs for BMV RNA gene expression and replication. Phosphatase-treated virions affected the timing of CP expression and viral RNA replication in plants. The degree of phosphorylation decreased when the plant hosts were grown at an elevated temperature. These results show that phosphorylation of the capsid modulates BMV infection. IMPORTANCE How icosahedral viruses regulate the release of viral RNA into the host is not well understood. The selective release of viral RNA can regulate the timing of replication and gene expression. Brome mosaic virus (BMV) is an RNA virus, and its three genomic RNAs are encapsidated in separate virions. Through proteomic, structural, and biochemical analyses, this work shows that posttranslational modifications

  14. The evolution of bovine viral diarrhea: a review.

    PubMed

    Goens, S Denise

    2002-12-01

    The economic importance of bovine viral diarrhea is increasing with the emergence of seemingly more virulent viruses, as evidenced by outbreaks of hemorrhagic syndrome and severe acute bovine viral diarrhea beginning in the 1980s and 1990s. It appears that evolutionary changes in bovine viral diarrhea virus were responsible for these outbreaks. The genetic properties of the classical bovine viral diarrhea virus that contribute to the basis of current diagnostic tests, vaccines, and our understanding of pathogenic mechanisms are now being reevaluated because of these "new" virus strains. This shift in virulence has confounded both nomenclature and the significance of current bovine viral diarrhea virus categorization. The purpose of this review is to summarize our current understanding of bovine viral diarrhea virus with a chronological review of prevailing scientific tenets and practices as described in clinical and scientific North American veterinary journals and textbooks. The first part of this review describes how we have arrived at our current understanding of the viruses, the diseases, and their nomenclature. The second part of the review deals with current concepts in virology and how these concepts may both explain and predict bovine viral diarrhea virus pathogenesis. By reviewing how knowledge of bovine viral diarrhea has evolved and the theories of how the virus itself is able to evolve, the interpretation of diagnostic tests are more effectively utilized in the control and treatment of bovine viral diarrhea virus associated disease.

  15. Cell Walls and the Convergent Evolution of the Viral Envelope

    PubMed Central

    Buchmann, Jan P.

    2015-01-01

    SUMMARY Why some viruses are enveloped while others lack an outer lipid bilayer is a major question in viral evolution but one that has received relatively little attention. The viral envelope serves several functions, including protecting the RNA or DNA molecule(s), evading recognition by the immune system, and facilitating virus entry. Despite these commonalities, viral envelopes come in a wide variety of shapes and configurations. The evolution of the viral envelope is made more puzzling by the fact that nonenveloped viruses are able to infect a diverse range of hosts across the tree of life. We reviewed the entry, transmission, and exit pathways of all (101) viral families on the 2013 International Committee on Taxonomy of Viruses (ICTV) list. By doing this, we revealed a strong association between the lack of a viral envelope and the presence of a cell wall in the hosts these viruses infect. We were able to propose a new hypothesis for the existence of enveloped and nonenveloped viruses, in which the latter represent an adaptation to cells surrounded by a cell wall, while the former are an adaptation to animal cells where cell walls are absent. In particular, cell walls inhibit viral entry and exit, as well as viral transport within an organism, all of which are critical waypoints for successful infection and spread. Finally, we discuss how this new model for the origin of the viral envelope impacts our overall understanding of virus evolution. PMID:26378223

  16. ViralZone: a knowledge resource to understand virus diversity.

    PubMed

    Hulo, Chantal; de Castro, Edouard; Masson, Patrick; Bougueleret, Lydie; Bairoch, Amos; Xenarios, Ioannis; Le Mercier, Philippe

    2011-01-01

    The molecular diversity of viruses complicates the interpretation of viral genomic and proteomic data. To make sense of viral gene functions, investigators must be familiar with the virus host range, replication cycle and virion structure. Our aim is to provide a comprehensive resource bridging together textbook knowledge with genomic and proteomic sequences. ViralZone web resource (www.expasy.org/viralzone/) provides fact sheets on all known virus families/genera with easy access to sequence data. A selection of reference strains (RefStrain) provides annotated standards to circumvent the exponential increase of virus sequences. Moreover ViralZone offers a complete set of detailed and accurate virion pictures.

  17. Characterization of a defective interfering RNA that contains a mosaic of a plant viral genome. Final report

    SciTech Connect

    Morris, T.J.; Jackson, A.O.

    1991-12-31

    Our lab was the first to describe and characterize a defective interfering RNA (DI RNAs or DIs) in association with a small RNA plant virus. The features of the DIs that we discovered in infections of tomato bushy stunt virus were compatible with the properties of DIs identified in many animal virus infections. Animal virologists have generally recognized the importance of studying DIs because they are invaluable tools for identifying cis-acting sequences important in virus multiplication and because they offer the opportunity to elucidate mechanisms involved in viral persistence and disease attenuation. Hence our discovery offered a comparably valuable tool for use in plant virus studies for the first time. Since then, we have also discovered the second example of plant viral DI RNAs associated with turnip crinkle virus (TCV), a virus structurally related to TBSV. We proposed a thorough characterization of this unique class of symptom modulating RNAs with the overall objective of identifying viral RNA nucleotide, sequences involved in such fundamental processes as virus replication and encapsidation as well as the degree of symptom expression resulting from the viral-DI-host interaction. The proposed research focused on the molecular characterization of the DI RNAs and the helper virus. We had demonstrated that the DIs were collinear deletion mutants of the genome of a cherry strain of tomato bushy stunt virus (TBSV). We had also shown that these low molecular weight RNAs interfered with the helper plant virus and modulated disease expression by preventing the development of a lethal necrotic disease in susceptible host plants. We also suggested that by exploring the mechanisms associated with the symptom attenuation effect, we might be able to devise novel strategies useful for engineering viral disease resistance.

  18. Supported PV module assembly

    DOEpatents

    Mascolo, Gianluigi; Taggart, David F.; Botkin, Jonathan D.; Edgett, Christopher S.

    2013-10-15

    A supported PV assembly may include a PV module comprising a PV panel and PV module supports including module supports having a support surface supporting the module, a module registration member engaging the PV module to properly position the PV module on the module support, and a mounting element. In some embodiments the PV module registration members engage only the external surfaces of the PV modules at the corners. In some embodiments the assembly includes a wind deflector with ballast secured to a least one of the PV module supports and the wind deflector. An array of the assemblies can be secured to one another at their corners to prevent horizontal separation of the adjacent corners while permitting the PV modules to flex relative to one another so to permit the array of PV modules to follow a contour of the support surface.

  19. Coarse-grained Simulations of Viral Assembly

    NASA Astrophysics Data System (ADS)

    Elrad, Oren M.

    2011-12-01

    The formation of viral capsids is a marvel of natural engineering and design. A large number (from 60 to thousands) of protein subunits assemble into complete, reproducible structures under a variety of conditions while avoiding kinetic and thermodynamic traps. Small single-stranded RNA viruses not only assemble their coat proteins in this fashion but also package their genome during the self-assembly process. Recent experiments have shown that the coat proteins are competent to assemble not merely around their own genomes but heterologous RNA, synthetic polyanions and even functionalized gold nanoparticles. Remarkably these viruses can even assemble around cargo not commensurate with their native state by adopting different morphologies. Understanding the properties that confer such exquisite precision and flexibility to the assembly process could aid biomedical research in the search for novel antiviral remedies, drug-delivery vehicles and contrast agents used in bioimaging. At the same time, viral assembly provides an excellent model system for the development of a statistical mechanical understanding of biological self-assembly, in the hopes of that we will identify some universal principles that underly such processes. This work consists of computational studies using coarse-grained representations of viral coat proteins and their cargoes. We find the relative strength of protein-cargo and protein-protein interactions has a profound effect on the assembly pathway, in some cases leading to assembly mechanisms that are markedly different from those found in previous work on the assembly of empty capsids. In the case of polymeric cargo, we find the first evidence for a previously theorized mechanism in which the polymer actively participates in recruiting free subunits to the assembly process through cooperative polymer-protein motions. We find that successful assembly is non-monotonic in protein-cargo affinity, such affinity can be detrimental to assembly if it

  20. Basic residues within the ebolavirus VP35 protein are required for its viral polymerase cofactor function.

    PubMed

    Prins, Kathleen C; Binning, Jennifer M; Shabman, Reed S; Leung, Daisy W; Amarasinghe, Gaya K; Basler, Christopher F

    2010-10-01

    The ebolavirus (EBOV) VP35 protein binds to double-stranded RNA (dsRNA), inhibits host alpha/beta interferon (IFN-α/β) production, and is an essential component of the viral polymerase complex. Structural studies of the VP35 C-terminal IFN inhibitory domain (IID) identified specific structural features, including a central basic patch and a hydrophobic pocket, that are important for dsRNA binding and IFN inhibition. Several other conserved basic residues bordering the central basic patch and a separate cluster of basic residues, called the first basic patch, were also identified. Functional analysis of alanine substitution mutants indicates that basic residues outside the central basic patch are not required for dsRNA binding or for IFN inhibition. However, minigenome assays, which assess viral RNA polymerase complex function, identified these other basic residues to be critical for viral RNA synthesis. Of these, a subset located within the first basic patch is important for VP35-nucleoprotein (NP) interaction, as evidenced by the inability of alanine substitution mutants to coimmunoprecipitate with NP. Therefore, first basic patch residues are likely critical for replication complex formation through interactions with NP. Coimmunoprecipitation studies further demonstrate that the VP35 IID is sufficient to interact with NP and that dsRNA can modulate VP35 IID interactions with NP. Other basic residue mutations that disrupt the VP35 polymerase cofactor function do not affect interaction with NP or with the amino terminus of the viral polymerase. Collectively, these results highlight the importance of conserved basic residues from the EBOV VP35 C-terminal IID and validate the VP35 IID as a potential therapeutic target.

  1. A Murine Viral Outgrowth Assay to Detect Residual HIV Type 1 in Patients With Undetectable Viral Loads

    PubMed Central

    Metcalf Pate, Kelly A.; Pohlmeyer, Christopher W.; Walker-Sperling, Victoria E.; Foote, Jeremy B.; Najarro, Kevin M.; Cryer, Catherine G.; Salgado, Maria; Gama, Lucio; Engle, Elizabeth L.; Shirk, Erin N.; Queen, Suzanne E.; Chioma, Stanley; Vermillion, Meghan S.; Bullock, Brandon; Li, Ming; Lyons, Claire E.; Adams, Robert J.; Zink, M. Christine; Clements, Janice E.; Mankowski, Joseph L.; Blankson, Joel N.

    2015-01-01

    Background. Sensitive assays are needed for detection of residual human immunodeficiency virus (HIV) in patients with undetectable plasma viral loads to determine whether eradication strategies are effective. The gold standard quantitative viral outgrowth assay (QVOA) underestimates the magnitude of the viral reservoir. We sought to determine whether xenograft of leukocytes from HIV type 1 (HIV)–infected patients with undetectable plasma viral loads into immunocompromised mice would result in viral amplification. Methods. Peripheral blood mononuclear cells or purified CD4+ T cells from HIV or simian immunodeficiency virus (SIV)–infected subjects with undetectable plasma viral loads were adoptively transferred into NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ (NSG) mice. The mice were monitored for viremia following depletion of human CD8+ T cells to minimize antiviral activity. In some cases, humanized mice were also treated with activating anti-CD3 antibody. Results. With this murine viral outgrowth assay (MVOA), we successfully amplified replication-competent HIV or SIV from all subjects tested, including 5 HIV-positive patients receiving suppressive antiretroviral therapy (ART) and 6 elite controllers or suppressors who were maintaining undetectable viral loads without ART, including an elite suppressor from whom we were unable to recover virus by QVOA. Conclusions. Our results suggest that the MVOA has the potential to serve as a powerful tool to identify residual HIV in patients with undetectable viral loads. PMID:25883388

  2. HIV community viral load trends in South Carolina.

    PubMed

    Chakraborty, Hrishikesh; Weissman, Sharon; Duffus, Wayne A; Hossain, Akhtar; Varma Samantapudi, Ashok; Iyer, Medha; Albrecht, Helmut

    2017-03-01

    Community viral load is an aggregate measure of HIV viral load in a particular geographic location, community, or subgroup. Community viral load provides a measure of disease burden in a community and community transmission risk. This study aims to examine community viral load trend in South Carolina and identify differences in community viral load trends between selected population subgroups using a state-wide surveillance dataset that maintains electronic records of all HIV viral load measurements reported to the state health department. Community viral load trends were examined using random mixed effects models, adjusting for age, race, gender, residence, CD4 counts, HIV risk group, and initial antiretroviral regimen during the study period, and time. The community viral load gradually decreased from 2004 to 2013 ( p < 0.0001). The number of new infections also decreased ( p = 0.0001) over time. A faster rate of decrease was seen among men compared to women ( p < 0.0001), men who have sex with men ( p = 0.0001) compared to heterosexuals, patients diagnosed in urban areas compared to that in rural areas ( p = 0.0004), and patients prescribed single-tablet regimen compared to multiple-tablet regimen ( p < 0.0001). While the state-wide community viral load decreased over time, the decline was not uniform among residence at diagnosis, HIV risk group, and single-tablet regimen versus multiple-tablet regimen subgroups. Slower declines in community viral load among females, those in rural areas, and heterosexuals suggest possible disparities in care that require further exploration. The association between using single-tablet regimen and faster community viral load decline is noteworthy.

  3. Molecular biology of human herpesvirus 8: novel functions and virus-host interactions implicated in viral pathogenesis and replication.

    PubMed

    Cousins, Emily; Nicholas, John

    2014-01-01

    Human herpesvirus 8 (HHV-8), also known as Kaposi's sarcoma-associated herpesvirus (KSHV), is the second identified human gammaherpesvirus. Like its relative Epstein-Barr virus, HHV-8 is linked to B-cell tumors, specifically primary effusion lymphoma and multicentric Castleman's disease, in addition to endothelial-derived KS. HHV-8 is unusual in its possession of a plethora of "accessory" genes and encoded proteins in addition to the core, conserved herpesvirus and gammaherpesvirus genes that are necessary for basic biological functions of these viruses. The HHV-8 accessory proteins specify not only activities deducible from their cellular protein homologies but also novel, unsuspected activities that have revealed new mechanisms of virus-host interaction that serve virus replication or latency and may contribute to the development and progression of virus-associated neoplasia. These proteins include viral interleukin-6 (vIL-6), viral chemokines (vCCLs), viral G protein-coupled receptor (vGPCR), viral interferon regulatory factors (vIRFs), and viral antiapoptotic proteins homologous to FLICE (FADD-like IL-1β converting enzyme)-inhibitory protein (FLIP) and survivin. Other HHV-8 proteins, such as signaling membrane receptors encoded by open reading frames K1 and K15, also interact with host mechanisms in unique ways and have been implicated in viral pathogenesis. Additionally, a set of micro-RNAs encoded by HHV-8 appear to modulate expression of multiple host proteins to provide conditions conducive to virus persistence within the host and could also contribute to HHV-8-induced neoplasia. Here, we review the molecular biology underlying these novel virus-host interactions and their potential roles in both virus biology and virus-associated disease.

  4. Molecular Biology of Human Herpesvirus 8: Novel Functions and Virus–Host Interactions Implicated in Viral Pathogenesis and Replication

    PubMed Central

    Cousins, Emily; Nicholas, John

    2014-01-01

    Human herpesvirus 8 (HHV-8), also known as Kaposi’s sarcoma-associated herpesvirus (KSHV), is the second identified human gammaherpesvirus. Like its relative Epstein-Barr virus, HHV-8 is linked to B-cell tumors, specifically primary effusion lymphoma and multicentric Castleman’s disease, in addition to endothelial-derived KS. HHV-8 is unusual in its possession of a plethora of “accessory” genes and encoded proteins in addition to the core, conserved herpesvirus and gammaherpesvirus genes that are necessary for basic biological functions of these viruses. The HHV-8 accessory proteins specify not only activities deducible from their cellular protein homologies but also novel, unsuspected activities that have revealed new mechanisms of virus–host interaction that serve virus replication or latency and may contribute to the development and progression of virus-associated neoplasia. These proteins include viral interleukin-6 (vIL-6), viral chemokines (vCCLs), viral G protein–coupled receptor (vGPCR), viral interferon regulatory factors (vIRFs), and viral antiapoptotic proteins homologous to FLICE (FADD-like IL-1β converting enzyme)-inhibitory protein (FLIP) and survivin. Other HHV-8 proteins, such as signaling membrane receptors encoded by open reading frames K1 and K15, also interact with host mechanisms in unique ways and have been implicated in viral pathogenesis. Additionally, a set of micro-RNAs encoded by HHV-8 appear to modulate expression of multiple host proteins to provide conditions conducive to virus persistence within the host and could also contribute to HHV-8-induced neoplasia. Here, we review the molecular biology underlying these novel virus–host interactions and their potential roles in both virus biology and virus-associated disease. PMID:24008302

  5. Lessons from nosocomial viral haemorrhagic fever outbreaks.

    PubMed

    Fisher-Hoch, Susan P

    2005-01-01

    The outbreak of Marburg haemorrhagic fever in Angola in 2004-2005 shows once again the devastating and rapid spread of viral haemorrhagic fevers in medical settings where hygiene practices are poorly applied or ignored. The legacy of years of war and poverty in Angola has resulted in very poor medical education and services. The initial high rate of infection among infants in Angola may have been related to poor hospital practices, possibly administration of vaccines. Though the outbreak in Angola was in a part of Africa not previously known to have filovirus infection, prior ecological modelling had predicted this location and many others. Prevention of future outbreaks will not be easy. The urgent need is dissemination of knowledge and the training, discipline and resources for good clinical practice. Educating the public to demand higher standards could be a powerful tool. Good practices are difficult to establish and maintain on the scale needed.

  6. Viral haemorrhagic fevers in healthcare settings.

    PubMed

    Ftika, L; Maltezou, H C

    2013-03-01

    Viral haemorrhagic fevers (VHFs) typically manifest as rapidly progressing acute febrile syndromes with profound haemorrhagic manifestations and very high fatality rates. VHFs that have the potential for human-to-human transmission and onset of large nosocomial outbreaks include Crimean-Congo haemorrhagic fever, Ebola haemorrhagic fever, Marburg haemorrhagic fever and Lassa fever. Nosocomial outbreaks of VHFs are increasingly reported nowadays, which likely reflects the dynamics of emergence of VHFs. Such outbreaks are associated with an enormous impact in terms of human lives and costs for the management of cases, contact tracing and containment. Surveillance, diagnostic capacity, infection control and the overall preparedness level for management of a hospital-based VHF event are very limited in most endemic countries. Diagnostic capacities for VHFs should increase in the field and become affordable. Availability of appropriate protective equipment and education of healthcare workers about safe clinical practices and infection control is the mainstay for the prevention of nosocomial spread of VHFs.

  7. Hunting Viral Receptors Using Haploid Cells

    PubMed Central

    Pillay, Sirika; Carette, Jan E.

    2016-01-01

    Viruses have evolved intricate mechanisms to gain entry into the host cell. Identification of critical receptors has enabled insights into virus particle internalization, host and tissue tropism, and viral pathogenesis. In this review we discuss the most commonly employed methods for virus receptor discovery, specifically highlighting the use of forward genetic screens in human haploid cells. The ability to generate true knockout alleles at high saturation provides a sensitive means to study virus-host interactions. As an example, haploid genetic screens identified the lysosomal proteins, NPC1 and LAMP1, as intracellular receptors for Ebola virus and Lassa virus, respectively. From these studies emerges the notion that receptor usage by these viruses is highly dynamic involving a programmed switch from cell surface receptor to intracellular receptor. Broad application of genetic knockout approaches will chart functional landscapes of receptors and endocytic pathways hijacked by viruses. PMID:26958914

  8. Prevalence of equine viral arteritis in Algeria.

    PubMed

    Laabassi, F; Amelot, G; Laugier, C; Zientara, S; Nasri, A M; Hans, A

    2014-12-01

    In order to determine the prevalence of equine viral arteritis in Algeria, 268 sera from non-vaccinated horses were collected from the western and eastern regions. Serological analysis of the sera, which were collected from 2009 to 2011, was performed using the virus neutralisation test, as described by the World Organisation for Animal Health. Overall, 20 sera (7.46%) were seropositive, 152 (56.71%) were negative and 96 sera (35.82%) were cytotoxic. Equine arteritis virus (EAV) seroprevalence was significantly higher in the western region (Tiaret) than in the eastern region (Barika and El-Eulma). Interestingly, more than 20% of the tested horses over 16 years old were seropositive for EAV. However, EAV prevalence did not depend on either horse breed or horse gender. This study is the first to describe the circulation of EAV in the Algerian horse population.

  9. Lymphocyte populations in acute viral gastroenteritis.

    PubMed Central

    Dolin, R; Reichman, R C; Fauci, A S

    1976-01-01

    Viral gastroenteritis was induced in 16 of 24 normal volunteers after oral administration of either the Norwalk or Hawaii agents. Clinical illness lasted for 24 to 48 h and resolved spontaneously. During acute illness, a transient lymphopenia was noted which involved all lymphocyte subpopulations (thymus-and bone marrow-derived, and null cells). No circulating lymphocytotoxins were detected, and the lymphocytes remaining in the circulation responded normally to mitogenic stimuli. The acute lymphopenia occurred at the time that mononuclear cell infiltration of the jejunal mucosa has been noted. These findings are consistent with the occurrence of a redistribution of circulating lymphocytes during acute illness, with accumulation of lymphocytes at the site of infection in the gut. PMID:1085751

  10. In vitro translation of plant viral RNA.

    PubMed

    Browning, Karen S; Mayberry, Laura

    2006-06-01

    This unit describes the preparation of a wheat germ extract that provides all the soluble components of the plant translational machinery. Many RNA plant viruses have positive-strand genomes and the viral RNA serves as messenger RNA (mRNA). The preparation of mRNA by in vitro transcription is also described. The translation assay requires optimization of the amount of wheat germ extract, level of mRNA, and the concentration of Mg(2+) and K(+) for each mRNA. The translational efficiency of RNAs or mutants may be compared (e.g., capped versus uncapped RNAs to measure cap-independent translation) or the amount/size of the protein product may be determined.

  11. Trapping mammalian protein complexes in viral particles

    PubMed Central

    Eyckerman, Sven; Titeca, Kevin; Van Quickelberghe, Emmy; Cloots, Eva; Verhee, Annick; Samyn, Noortje; De Ceuninck, Leentje; Timmerman, Evy; De Sutter, Delphine; Lievens, Sam; Van Calenbergh, Serge; Gevaert, Kris; Tavernier, Jan

    2016-01-01

    Cell lysis is an inevitable step in classical mass spectrometry–based strategies to analyse protein complexes. Complementary lysis conditions, in situ cross-linking strategies and proximal labelling techniques are currently used to reduce lysis effects on the protein complex. We have developed Virotrap, a viral particle sorting approach that obviates the need for cell homogenization and preserves the protein complexes during purification. By fusing a bait protein to the HIV-1 GAG protein, we show that interaction partners become trapped within virus-like particles (VLPs) that bud from mammalian cells. Using an efficient VLP enrichment protocol, Virotrap allows the detection of known binary interactions and MS-based identification of novel protein partners as well. In addition, we show the identification of stimulus-dependent interactions and demonstrate trapping of protein partners for small molecules. Virotrap constitutes an elegant complementary approach to the arsenal of methods to study protein complexes. PMID:27122307

  12. Plant RNA silencing in viral defence.

    PubMed

    Pantaleo, Vitantonio

    2011-01-01

    RNA silencing is described in plants and insects as a defence mechanism against foreign nucleic acids, such as invading viruses. The RNA silencing-based antiviral defence involves the production of virus-derived small interfering RNAs and their association to effector proteins, which together drive the sequence specific inactivation of viruses. The entire process of antiviral defence 'borrows' several plant factors involved in other specialized RNA silencing endogenous pathways. Different viruses use variable strategies to infect different host plants, which render the antiviral RNA silencing a complex phenomenon far to be completely clarified. This chapter reports current advances in understanding the main steps of the plant's RNA-silencing response to viral invasion and discusses some of the key questions still to be answered.

  13. Epidemiology of Viral Hepatitis and Hepatocellular Carcinoma

    PubMed Central

    El-Serag, Hashem B.

    2012-01-01

    Most cases of hepatocellular carcinoma (HCC) are associated with cirrhosis related to chronic hepatitis B virus (HBV) or hepatitis C virus (HCV) infection. Changes in the time trends of HCC and most variations in its age-, sex-, and race-specific rates among different regions are likely to be related to differences in hepatitis viruses that are most prevalent in a population, the timing of their spread, and the ages of the individuals the viruses infect. Environmental, host genetic, and viral factors can affect the risk of HCC in individuals with HBV or HCV infection. This review summarizes the risk factors for HCC among HBV- or HCV-infected individuals, based on findings from epidemiological studies and meta-analyses, as well as determinants of patient outcome and the HCC disease burden, globally and in the US. PMID:22537432

  14. Glycosylation, Hypogammaglobulinemia, and Resistance to Viral Infections

    PubMed Central

    Chun, Tae-Wook; Lusso, Paolo; Kaplan, Gerardo; Wolfe, Lynne; Memoli, Matthew J.; He, Miao; Vega, Hugo; Kim, Leo J.Y.; Huang, Yan; Hussein, Nadia; Nievas, Elma; Mitchell, Raquel; Garofalo, Mary; Louie, Aaron; Ireland, Derek C.; Grunes, Claire; Cimbro, Raffaello; Patel, Vyomesh; Holzapfel, Genevieve; Salahuddin, Daniel; Bristol, Tyler; Adams, David; Marciano, Beatriz E.; Hegde, Madhuri; Li, Yuxing; Calvo, Katherine R.; Stoddard, Jennifer; Justement, J. Shawn; Jacques, Jerome; Priel, Debra A. Long; Murray, Danielle; Sun, Peter; Kuhns, Douglas B.; Boerkoel, Cornelius F.; Chiorini, John A.; Di Pasquale, Giovanni; Verthelyi, Daniela; Rosenzweig, Sergio D.

    2014-01-01

    Summary Genetic defects in MOGS, the gene encoding mannosyl-oligosaccharide glucosidase (the first enzyme in the processing pathway of N-linked oligosaccharide), cause the rare congenital disorder of glycosylation type IIb (CDG-IIb), also known as MOGS-CDG. MOGS is expressed in the endoplasmic reticulum and is involved in the trimming of N-glycans. We evaluated two siblings with CDG-IIb who presented with multiple neurologic complications and a paradoxical immunologic phenotype characterized by severe hypogammaglobulinemia but limited clinical evidence of an infectious diathesis. A shortened immunoglobulin half-life was determined to be the mechanism underlying the hypogammaglobulinemia. Impaired viral replication and cellular entry may explain a decreased susceptibility to infections. PMID:24716661

  15. Superresolution imaging of viral protein trafficking

    PubMed Central

    Salka, Kyle; Bhuvanendran, Shivaprasad; Yang, David

    2015-01-01

    The endoplasmic reticulum (ER) membrane is closely apposed to the outer mitochondrial membrane (OMM), which facilitates communication between these organelles. These contacts, known as mitochondria-associated membranes (MAM), facilitate calcium signaling, lipid transfer, as well as antiviral and stress responses. How cellular proteins traffic to the MAM, are distributed therein, and interact with ER and mitochondrial proteins are subject of great interest. The human cytomegalovirus UL37 exon 1 protein or viral mitochondria-localized inhibitor of apoptosis (vMIA) is crucial for viral growth. Upon synthesis at the ER, vMIA traffics to the MAM and OMM, where it reprograms the organization and function of these compartments. vMIA significantly changes the abundance of cellular proteins at the MAM and OMM, including proteins that regulate calcium homeostasis and cell death. Through the use of superresolution imaging, we have shown that vMIA is distributed at the OMM in nanometer scale clusters. This is similar to the clusters reported for the mitochondrial calcium channel, VDAC, as well as electron transport chain, translocase of the OMM complex, and mitochondrial inner membrane organizing system components. Thus, aside from addressing how vMIA targets the MAM and regulates survival of infected cells, biochemical studies and superresolution imaging of vMIA offer insights into the formation, organization, and functioning of MAM. Here, we discuss these insights into trafficking, function, and organization of vMIA at the MAM and OMM and discuss how the use of superresolution imaging is contributing to the study of the formation and trafficking of viruses. PMID:25724304

  16. Papillomaviruses: Viral evolution, cancer and evolutionary medicine.

    PubMed

    Bravo, Ignacio G; Félez-Sánchez, Marta

    2015-01-28

    Papillomaviruses (PVs) are a numerous family of small dsDNA viruses infecting virtually all mammals. PVs cause infections without triggering a strong immune response, and natural infection provides only limited protection against reinfection. Most PVs are part and parcel of the skin microbiota. In some cases, infections by certain PVs take diverse clinical presentations from highly productive self-limited warts to invasive cancers. We propose PVs as an excellent model system to study the evolutionary interactions between the immune system and pathogens causing chronic infections: genotypically, PVs are very diverse, with hundreds of different genotypes infecting skin and mucosa; phenotypically, they display extremely broad gradients and trade-offs between key phenotypic traits, namely productivity, immunogenicity, prevalence, oncogenicity and clinical presentation. Public health interventions have been launched to decrease the burden of PV-associated cancers, including massive vaccination against the most oncogenic human PVs, as well as systematic screening for PV chronic anogenital infections. Anti-PVs vaccines elicit protection against infection, induce cross-protection against closely related viruses and result in herd immunity. However, our knowledge on the ecological and intrapatient dynamics of PV infections remains fragmentary. We still need to understand how the novel anthropogenic selection pressures posed by vaccination and screening will affect viral circulation and epidemiology. We present here an overview of PV evolution and the connection between PV genotypes and the phenotypic, clinical manifestations of the diseases they cause. This differential link between viral evolution and the gradient cancer-warts-asymptomatic infections makes PVs a privileged playground for evolutionary medicine research.

  17. Lunar Module Ascent Stage

    NASA Technical Reports Server (NTRS)

    1969-01-01

    The Lunar Module 'Spider' ascent stage is photographed from the Command/Service Module on the fifth day of the Apollo 9 earth-orbital mission. The Lunar Module's descent stage had already been jettisoned.

  18. Wide deviation phase modulator

    NASA Technical Reports Server (NTRS)

    Couch, R. H.; Hearn, C. P.; Wilson, L. R.

    1974-01-01

    Modulator produces phase-modulated waveform having high modulating linearity. Technique is inherently wideband with respect to carrier frequency and can operate over decade carrier frequency range without adjustments. Circuit performance is both mathematically predictable and highly reproducible.

  19. Additive Promotion of Viral Internal Ribosome Entry Site-Mediated Translation by Far Upstream Element-Binding Protein 1 and an Enterovirus 71-Induced Cleavage Product

    PubMed Central

    Hung, Chuan-Tien; Kung, Yu-An; Li, Mei-Ling; Lee, Kuo-Ming; Liu, Shih-Tung; Shih, Shin-Ru

    2016-01-01

    The 5' untranslated region (5' UTR) of the enterovirus 71 (EV71) RNA genome contains an internal ribosome entry site (IRES) that is indispensable for viral protein translation. Due to the limited coding capacity of their RNA genomes, EV71 and other picornaviruses typically recruit host factors, known as IRES trans-acting factors (ITAFs), to mediate IRES-dependent translation. Here, we show that EV71 viral proteinase 2A is capable of cleaving far upstream element-binding protein 1 (FBP1), a positive ITAF that directly binds to the EV71 5' UTR linker region to promote viral IRES-driven translation. The cleavage occurs at the Gly-371 residue of FBP1 during the EV71 infection process, and this generates a functional cleavage product, FBP11-371. Interestingly, the cleavage product acts to promote viral IRES activity. Footprinting analysis and gel mobility shift assay results showed that FBP11-371 similarly binds to the EV71 5' UTR linker region, but at a different site from full-length FBP1; moreover, FBP1 and FBP11-371 were found to act additively to promote IRES-mediated translation and virus yield. Our findings expand the current understanding of virus-host interactions with regard to viral recruitment and modulation of ITAFs, and provide new insights into translational control during viral infection. PMID:27780225

  20. Viral tropism and pathology associated with viral hemorrhagic septicemia in larval and juvenile Pacific herring

    USGS Publications Warehouse

    Lovy, Jan; Lewis, N.L.; Hershberger, P.K.; Bennett, W.; Meyers, T.R.; Garver, K.A.

    2012-01-01

    Viral hemorrhagic septicemia virus (VHSV) genotype IVa causes mass mortality in wild Pacific herring, a species of economic value, in the Northeast Pacific Ocean. Young of the year herring are particularly susceptible and can be carriers of the virus. To understand its pathogenesis, tissue and cellular tropisms of VHSV in larval and juvenile Pacific herring were investigated with immunohistochemistry, transmission electron microscopy, and viral tissue titer. In larval herring, early viral tropism for epithelial tissues (6d post-exposure) was indicated by foci of epidermal thickening that contained heavy concentrations of virus. This was followed by a cellular tropism for fibroblasts within the fin bases and the dermis, but expanded to cells of the kidney, liver, pancreas, gastrointestinal tract and meninges in the brain. Among wild juvenile herring that underwent a VHS epizootic in the laboratory, the disease was characterized by acute and chronic phases of death. Fish that died during the acute phase had systemic infections in tissues including the submucosa of the gastrointestinal tract, spleen, kidney, liver, and meninges. The disease then transitioned into a chronic phase that was characterized by the appearance of neurological signs including erratic and corkscrew swimming and darkening of the dorsal skin. During the chronic phase viral persistence occurred in nervous tissues including meninges and brain parenchymal cells and in one case in peripheral nerves, while virus was mostly cleared from the other tissues. The results demonstrate the varying VHSV tropisms dependent on the timing of infection and the importance of neural tissues for the persistence and perpetuation of chronic infections in Pacific herring.

  1. Viral load: Roche applies for marketing approval for ultrasensitive test.

    PubMed

    1998-08-07

    Roche Molecular Systems has applied for FDA permission to market a more sensitive viral load test. The Amplicor HIV-1 Monitor UltraSensitive Method tests viral load as low as 50 copies; current tests are only accurate to 400 copies. There is a widespread consensus among physicians that testing below 400 copies would be a valuable treatment tool.

  2. Depth-related gradients of viral activity in Lake Pavin.

    PubMed

    Colombet, J; Sime-Ngando, T; Cauchie, H M; Fonty, G; Hoffmann, L; Demeure, G

    2006-06-01

    High-resolution vertical sampling and determination of viral and prokaryotic parameters in a deep volcanic lake shows that in the absence of thermal stratification but within light, oxygen, and chlorophyll gradients, host availability empirically is prevalent over the physical and chemical environments and favors lytic over lysogenic "viral life cycles."

  3. A strong case for viral genetic factors in HIV virulence.

    PubMed

    Müller, Viktor; Fraser, Christophe; Herbeck, Joshua T

    2011-03-01

    HIV infections show great variation in the rate of progression to disease, and the role of viral genetic factors in this variation had remained poorly characterized until recently. Now a series of four studies [1-4] published within a year has filled this important gap and has demonstrated a robust effect of the viral genotype on HIV virulence.

  4. Correlates of viral richness in bats (order Chiroptera).

    PubMed

    Turmelle, Amy S; Olival, Kevin J

    2009-12-01

    Historic and contemporary host ecology and evolutionary dynamics have profound impacts on viral diversity, virulence, and associated disease emergence. Bats have been recognized as reservoirs for several emerging viral pathogens, and are unique among mammals in their vagility, potential for long-distance dispersal, and often very large, colonial populations. We investigate the relative influences of host ecology and population genetic structure for predictions of viral richness in relevant reservoir species. We test the hypothesis that host geographic range area, distribution, population genetic structure, migratory behavior, International Union for Conservation of Nature and Natural Resources (IUCN) threat status, body mass, and colony size, are associated with known viral richness in bats. We analyze host traits and viral richness in a generalized linear regression model framework, and include a correction for sampling effort and phylogeny. We find evidence that sampling effort, IUCN status, and population genetic structure correlate with observed viral species richness in bats, and that these associations are independent of phylogeny. This study is an important first step in understanding the mechanisms that promote viral richness in reservoir species, and may aid in predicting the emergence of viral zoonoses from bats.

  5. Analysis of host genetic diversity and viral entry as sources of between-host variation in viral load

    USGS Publications Warehouse

    Wargo, Andrew R.; Kell, Alison M.; Scott, Robert J.; Thorgaard, Gary H.; Kurath, Gael

    2012-01-01

    Little is known about the factors that drive the high levels of between-host variation in pathogen burden that are frequently observed in viral infections. Here, two factors thought to impact viral load variability, host genetic diversity and stochastic processes linked with viral entry into the host, were examined. This work was conducted with the aquatic vertebrate virus, Infectious hematopoietic necrosis virus (IHNV), in its natural host, rainbow trout. It was found that in controlled in vivo infections of IHNV, a suggestive trend of reduced between-fish viral load variation was observed in a clonal population of isogenic trout compared to a genetically diverse population of out-bred trout. However, this trend was not statistically significant for any of the four viral genotypes examined, and high levels of fish-to-fish variation persisted even in the isogenic trout population. A decrease in fish-to-fish viral load variation was also observed in virus injection challenges that bypassed the host entry step, compared to fish exposed to the virus through the natural water-borne immersion route of infection. This trend was significant for three of the four virus genotypes examined and suggests host entry may play a role in viral load variability. However, high levels of viral load variation also remained in the injection challenges. Together, these results indicate that although host genetic diversity and viral entry may play some role in between-fish viral load variation, they are not major factors. Other biological and non-biological parameters that may influence viral load variation are discussed.

  6. Interleukin-12 (IL-12), but not IL-23, deficiency ameliorates viral encephalitis without affecting viral control.

    PubMed

    Kapil, Parul; Atkinson, Roscoe; Ramakrishna, Chandran; Cua, Daniel J; Bergmann, Cornelia C; Stohlman, Stephen A

    2009-06-01

    The relative contributions of interleukin-12 (IL-12) and IL-23 to viral pathogenesis have not been extensively studied. IL-12p40 mRNA rapidly increases after neurotropic coronavirus infection. Infection of mice defective in both IL-12 and IL-23 (p40(-/-)), in IL-12 alone (p35(-/-)), and in IL-23 alone (p19(-/-)) revealed that the symptoms of coronavirus-induced encephalitis are regulated by IL-12. IL-17-producing cells never exceeded background levels, supporting a redundant role of IL-23 in pathogenesis. Viral control, tropism, and demyelination were all similar in p35(-/-), p19(-/-), and wild-type mice. Reduced morbidity in infected IL-12 deficient mice was also not associated with altered recruitment or composition of inflammatory cells. However, gamma interferon (IFN-gamma) levels and virus-specific IFN-gamma-secreting CD4 and CD8 T cells were all reduced in the central nervous systems (CNS) of infected p35(-/-) mice. Transcription of the proinflammatory cytokines IL-1beta and IL-6, but not tumor necrosis factor, were initially reduced in infected p35(-/-) mice but increased to wild-type levels during peak inflammation. Furthermore, although transforming growth factor beta mRNA was not affected, IL-10 was increased in the CNS in the absence of IL-12. These data suggest that IL-12 does not contribute to antiviral function within the CNS but enhances morbidity associated with viral encephalitis by increasing the ratio of IFN-gamma to protective IL-10.

  7. Viral metagenomics analysis demonstrates the diversity of viral flora in piglet diarrhoeic faeces in China.

    PubMed

    Zhang, Bin; Tang, Cheng; Yue, Hua; Ren, Yupeng; Song, Zhigang

    2014-07-01

    To investigate the diversity of viral flora, we used metagenomics to study the viral communities in a pooled faecal sample of 27 diarrhoeic piglets from intensive commercial farms in China. The 15 distinct mammalian viruses identified in the pooled diarrhoeic sample were, in order of abundance of nucleic acid sequence, Porcine epidemic diarrhea virus (PEDV), sapovirus, porcine bocavirus-4 (PBoV-4), sapelovirus, torovirus, coronavirus, PBoV-2, stool-associated single-stranded DNA virus (poSCV), astrovirus (AstV), kobuvirus, posavirus-1, porcine enterovirus-9 (PEV-9), porcine circovirus-like (po-circo-like) virus, picobirnavirus (PBV) and Torque teno sus virus 2 (TTSuV-2). The prevalence rate of each virus was verified from diarrhoeic and healthy piglets by PCR assay. A mean of 5.5 different viruses were shed in diarrhoeic piglets, and one piglet was in fact co-infected with 11 different viruses. By contrast, healthy piglets shed a mean of 3.2 different viruses. Compared with samples from healthy piglets, the co-infection of PEDV and PBoV had a high prevalence rate in diarrhoea samples, suggesting a correlation with the appearance of diarrhoea in piglets. Furthermore, we report here for the first time the presence of several recently described viruses in China, and the identification of novel genotypes. Therefore, our investigation results provide an unbiased survey of viral communities and prevalence in faecal samples of piglets.

  8. Immunological aspects in viral hepatitis B and C infection.

    PubMed

    Manea, Irena; Manea, Cristian Nicolae; Miron, Nicolae; Cristea, Victor

    2011-01-01

    Worldwide, viral hepatitis chronic infections are a serious health problem and a very interesting topic for both clinicians and researchers. Viral hepatitis has a variety of clinical forms: mild, inactive or severe and with a slow evolution, whose architectural structure of the hepatic tissue evolves towards cirrhosis or hepatocellular carcinoma. Sometimes, the virally induced hepatic injury evolves spectacularly and rapidly leads to exitus. The factors that generate this evolution pattern depend on the immune response of the host and equally on the viral survival and immune surveillance avoidance strategies. This paper aims to resume new discoveries in the field of immunology of the B and C viral hepatitis infection, from the perspective of the complex interactions between virus and host.

  9. Issues and updates in emerging neurologic viral infections.

    PubMed

    Wilson, Michael R; Tyler, Kenneth L

    2011-07-01

    This review discusses the recent advances in the identification of viral pathogens and other etiologies responsible for cases of suspected viral encephalitis. The authors describe new molecular diagnostic strategies for identifying novel causes of viral encephalitis, including MassTag PCR, DNA microarrays, and high-throughput DNA pyrosequencing. They also highlight the increasing recognition of immune-mediated causes of encephalitis among those cases previously thought to be viral encephalitis of unknown etiology. Lastly, they review some of the most recent updates in the field of emerging neurologic viral infections impacting the United States, including the neurologic complications of H1N1 virus and the reemergence of dengue virus in the Florida Keys.

  10. Viral miRNA targeting of bicistronic and polycistronic transcripts.

    PubMed

    Zhu, Ying; Huang, Yufei; Jung, Jae U; Lu, Chun; Gao, Shou-Jiang

    2014-08-01

    Successful viral infection entails a choreographic regulation of viral gene expression program. Kaposi's sarcoma-associated herpesvirus (KSHV) encodes numerous miRNAs that regulate viral life cycle. However, few viral targets have been identified due to the lack of information on KSHV 3' untranslated regions (3'UTRs). Recent genome-wide mapping of KSHV transcripts and 3'UTRs has revealed abundant bicistronic and polycistronic transcripts. The extended 3'UTRs of the 5' proximal genes of bicistronic and polycistronic transcripts offer additional regulatory targets. Indeed, a genome-wide screening of KSHV 3'UTRs has identified several bicistronic and polycistronic transcripts as the novel targets of viral miRNAs. Together, these works have expanded our knowledge of the unique features of KSHV gene regulation program and provided valuable resources for the research community.

  11. Viral miRNA Targeting of Bicistronic and Polycistronic Transcripts

    PubMed Central

    Zhu, Ying; Huang, Yufei; Jung, Jae U.; Lu, Chun; Gao, Shou-Jiang

    2014-01-01

    Successful viral infection entails a choreographic regulation of viral gene expression program. Kaposi’s sarcoma–associated herpesvirus (KSHV) encodes numerous miRNAs that regulate viral life cycle. However, few viral targets have been identified due to the lack of information on KSHV 3′ untranslated regions (3′UTRs). Recent genome-wide mapping of KSHV transcripts and 3′UTRs has revealed abundant bicistronic and polycistronic transcripts. The extended 3′UTRs of the 5′ proximal genes of bicistronic and polycistronic transcripts offer additional regulatory targets. Indeed, a genome-wide screening of KSHV 3′UTRs has identified several bicistronic and polycistronic transcripts as the novel targets of viral miRNAs. Together, these works have expanded our knowledge of the unique features of KSHV gene regulation program and provided valuable resources for the research community. PMID:24821460

  12. Viroporins Customize Host Cells for Efficient Viral Propagation

    PubMed Central

    Giorda, Kristina M.

    2013-01-01

    Viruses are intracellular parasites that must access the host cell machinery to propagate. Viruses hijack the host cell machinery to help with entry, replication, packaging, and release of progeny to infect new cells. To carry out these diverse functions, viruses often transform the cellular environment using viroporins, a growing class of viral-encoded membrane proteins that promote viral proliferation. Viroporins modify the integrity of host membranes, thereby stimulating the maturation of viral infection, and are critical for virus production and dissemination. Significant advances in molecular and cell biological approaches have helped to uncover some of the roles that viroporins serve in the various stages of the viral life cycle. In this study, the ability of viroporins to modify the cellular environment will be discussed, with particular emphasis on their role in the stepwise progression of the viral life cycle. PMID:23945006

  13. Integrated Evaluation of Latent Viral Reactivation During Spaceflight

    NASA Technical Reports Server (NTRS)

    Pierson, Duane L.; Paloski, W. H. (Technical Monitor)

    2000-01-01

    This application proposes a continuation of our current effort, which has provided the first demonstration of viral reactivation during space flight. We have used the herpesvirus EBV as a model for latent viral reactivation and have shown that increased amounts of EBV DNA were shed by astronauts during space flight. Analysis of the Antarctic space flight analog indicated that the frequency of viral shedding may also increase (along with the increased numbers of virus) during long periods of isolation. However, a number of critical questions remain before the findings may be considered a significant health risk during extended space flight. These include: Are other latent viruses (e.g., other herpesviruses and polyornaviruses) in addition to EBV also reactivated and shed more frequently and/or in higher numbers during space flight? Is the viral reactivation observed in space flight and ground-based analogs mediated through the hypothalamus-pituitary-adrenal (HPA) axis resulting in a decreased cell-mediated immune response? How does detection of viral DNA by PCR analysis correlate with infectious virus? How does the amount of virus found during flight compare with viral levels observed in acute/chronic viral illnesses and in control individuals? This expanded study will examine the phenomenon of viral reactivation from the initiating stress through the HPA axis with the accompanying suppression of the immune system resulting in viral reactivation. This information is essential to determine if latent viral reactivation among crewmembers represents a sufficient medical risk to space travel to require the development of suitable countermeasures.

  14. Role of Viral miRNAs and Epigenetic Modifications in Epstein-Barr Virus-Associated Gastric Carcinogenesis.

    PubMed

    Giudice, Aldo; D'Arena, Giovanni; Crispo, Anna; Tecce, Mario Felice; Nocerino, Flavia; Grimaldi, Maria; Rotondo, Emanuela; D'Ursi, Anna Maria; Scrima, Mario; Galdiero, Massimiliano; Ciliberto, Gennaro; Capunzo, Mario; Franci, Gianluigi; Barbieri, Antonio; Bimonte, Sabrina; Montella, Maurizio

    2016-01-01

    MicroRNAs are short (21-23 nucleotides), noncoding RNAs that typically silence posttranscriptional gene expression through interaction with target messenger RNAs. Currently, miRNAs have been identified in almost all studied multicellular eukaryotes in the plant and animal kingdoms. Additionally, recent studies reported that miRNAs can also be encoded by certain single-cell eukaryotes and by viruses. The vast majority of viral miRNAs are encoded by the herpesviruses family. These DNA viruses including Epstein-Barr virus encode their own miRNAs and/or manipulate the expression of cellular miRNAs to facilitate respective infection cycles. Modulation of the control pathways of miRNAs expression is often involved in the promotion of tumorigenesis through a specific cascade of transduction signals. Notably, latent infection with Epstein-Barr virus is considered liable of causing several types of malignancies, including the majority of gastric carcinoma cases detected worldwide. In this review, we describe the role of the Epstein-Barr virus in gastric carcinogenesis, summarizing the functions of the Epstein-Barr virus-encoded viral proteins and related epigenetic alterations as well as the roles of Epstein-Barr virus-encoded and virally modulated cellular miRNAs.

  15. Role of Viral miRNAs and Epigenetic Modifications in Epstein-Barr Virus-Associated Gastric Carcinogenesis

    PubMed Central

    Giudice, Aldo; D'Arena, Giovanni; Crispo, Anna; Tecce, Mario Felice; Nocerino, Flavia; Grimaldi, Maria; Rotondo, Emanuela; D'Ursi, Anna Maria; Scrima, Mario; Galdiero, Massimiliano; Ciliberto, Gennaro; Capunzo, Mario; Franci, Gianluigi; Barbieri, Antonio; Bimonte, Sabrina; Montella, Maurizio

    2016-01-01

    MicroRNAs are short (21–23 nucleotides), noncoding RNAs that typically silence posttranscriptional gene expression through interaction with target messenger RNAs. Currently, miRNAs have been identified in almost all studied multicellular eukaryotes in the plant and animal kingdoms. Additionally, recent studies reported that miRNAs can also be encoded by certain single-cell eukaryotes and by viruses. The vast majority of viral miRNAs are encoded by the herpesviruses family. These DNA viruses including Epstein-Barr virus encode their own miRNAs and/or manipulate the expression of cellular miRNAs to facilitate respective infection cycles. Modulation of the control pathways of miRNAs expression is often involved in the promotion of tumorigenesis through a specific cascade of transduction signals. Notably, latent infection with Epstein-Barr virus is considered liable of causing several types of malignancies, including the majority of gastric carcinoma cases detected worldwide. In this review, we describe the role of the Epstein-Barr virus in gastric carcinogenesis, summarizing the functions of the Epstein-Barr virus-encoded viral proteins and related epigenetic alterations as well as the roles of Epstein-Barr virus-encoded and virally modulated cellular miRNAs. PMID:26977250

  16. Ballasted photovoltaic module and module arrays

    DOEpatents

    Botkin, Jonathan [El Cerrito, CA; Graves, Simon [Berkeley, CA; Danning, Matt [Oakland, CA

    2011-11-29

    A photovoltaic (PV) module assembly including a PV module and a ballast tray. The PV module includes a PV device and a frame. A PV laminate is assembled to the frame, and the frame includes an arm. The ballast tray is adapted for containing ballast and is removably associated with the PV module in a ballasting state where the tray is vertically under the PV laminate and vertically over the arm to impede overt displacement of the PV module. The PV module assembly can be installed to a flat commercial rooftop, with the PV module and the ballast tray both resting upon the rooftop. In some embodiments, the ballasting state includes corresponding surfaces of the arm and the tray being spaced from one another under normal (low or no wind) conditions, such that the frame is not continuously subjected to a weight of the tray.

  17. Epigenetic Treatment of Persistent Viral Infections.

    PubMed

    Moos, Walter H; Pinkert, Carl A; Irwin, Michael H; Faller, Douglas V; Kodukula, Krishna; Glavas, Ioannis P; Steliou, Kosta

    2017-02-01

    Preclinical Research Approximately 2,500 years ago, Hippocrates used the word herpes as a medical term to describe lesions that appeared to creep or crawl on the skin, advocating heat as a possible treatment. During the last 50 years, pharmaceutical research has made great strides, and therapeutic options have expanded to include small molecule antiviral agents, protease inhibitors, preventive vaccines for a handful of the papillomaviruses, and even cures for hepatitis C virus infections. However, effective treatments for persistent and recurrent viral infections, particularly the highly prevalent herpesviruses, continue to represent a significant unmet medical need, affecting the majority of the world's population. Exploring the population diversity of the human microbiome and the effects its compositional variances have on the immune system, health, and disease are the subjects of intense investigational research and study. Among the collection of viruses, bacteria, fungi, and single-cell eukaryotes that comprise the human microbiome, the virome has been grossly understudied relative to the influence it exerts on human pathophysiology, much as mitochondria have until recently failed to receive the attention they deserve, given their critical biomedical importance. Fortunately, cellular epigenetic machinery offers a wealth of druggable targets for therapeutic intervention in numerous disease indications, including those outlined above. With advances in synthetic biology, engineering our body's commensal microorganisms to seek out and destroy pathogenic species is clearly on the horizon. This is especially the case given recent breakthroughs in genetic manipulation with tools such as the CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated) gene-editing platforms. Tying these concepts together with our previous work on the microbiome and neurodegenerative and neuropsychiatric diseases, we suggest that, because mammalian cells

  18. Enteric Viral Surrogate Reduction by Chitosan.

    PubMed

    Davis, Robert; Zivanovic, Svetlana; Davidson, P Michael; D'Souza, Doris H

    2015-12-01

    Enteric viruses are a major problem in the food industry, especially as human noroviruses are the leading cause of nonbacterial gastroenteritis. Chitosan is known to be effective against some enteric viral surrogates, but more detailed studies are needed to determine the precise application variables. The main objective of this work was to determine the effect of increasing chitosan concentration (0.7-1.5% w/v) on the cultivable enteric viral surrogates, feline calicivirus (FCV-F9), murine norovirus (MNV-1), and bacteriophages (MS2 and phiX174) at 37 °C. Two chitosans (53 and 222 kDa) were dissolved in water (53 kDa) or 1% acetic acid (222 KDa) at 0.7-1.5%, and were then mixed with each virus to obtain a titer of ~5 log plaque-forming units (PFU)/mL. These mixtures were incubated for 3 h at 37 °C. Controls included untreated viruses in phosphate-buffered saline and viruses were enumerated by plaque assays. The 53 kDa chitosan at the concentrations tested reduced FCV-F9, MNV-1, MS2, and phi X174 by 2.6-2.9, 0.1-0.4, 2.6-2.8, and 0.7-0.9 log PFU/mL, respectively, while reduction by 222 kDa chitosan was 2.2-2.4, 0.8-1.0, 2.6-5.2, and 0.5-0.8 log PFU/mL, respectively. The 222 kDa chitosan at 1 and 0.7% w/v in acetic acid (pH 4.5) caused the greatest reductions of MS2 by 5.2 logs and 2.6 logs, respectively. Overall, chitosan treatments showed the greatest reduction of MS2, followed by FCV-F9, phi X174, and MNV-1. These two chitosans may contribute to the reduction of enteric viruses at the concentrations tested but would require use of other hurdles to eliminate food borne viruses.

  19. Module utilization committee

    NASA Technical Reports Server (NTRS)

    Volkmer, K.; Praver, G.

    1984-01-01

    Photovoltaic collector modules were declared surplus to the needs of the U.S. Dept. of Energy. The Module Utilization Committee was formed to make appropriate disposition of the surplus modules on a national basis and to act as a broker for requests for these modules originating outside of the National Photovoltaics Program.

  20. Metagenomic Analysis of the Viral Communities in Fermented Foods▿ †

    PubMed Central

    Park, Eun-Jin; Kim, Kyoung-Ho; Abell, Guy C. J.; Kim, Min-Soo; Roh, Seong Woon; Bae, Jin-Woo

    2011-01-01

    Viruses are recognized as the most abundant biological components on Earth, and they regulate the structure of microbial communities in many environments. In soil and marine environments, microorganism-infecting phages are the most common type of virus. Although several types of bacteriophage have been isolated from fermented foods, little is known about the overall viral assemblages (viromes) of these environments. In this study, metagenomic analyses were performed on the uncultivated viral communities from three fermented foods, fermented shrimp, kimchi, and sauerkraut. Using a high-throughput pyrosequencing technique, a total of 81,831, 70,591 and 69,464 viral sequences were obtained from fermented shrimp, kimchi and sauerkraut, respectively. Moreover, 37 to 50% of these sequences showed no significant hit against sequences in public databases. There were some discrepancies between the prediction of bacteriophages hosts via homology comparison and bacterial distribution, as determined from 16S rRNA gene sequencing. These discrepancies likely reflect the fact that the viral genomes of fermented foods are poorly represented in public databases. Double-stranded DNA viral communities were amplified from fermented foods by using a linker-amplified shotgun library. These communities were dominated by bacteriophages belonging to the viral order Caudovirales (i.e., Myoviridae, Podoviridae, and Siphoviridae). This study indicates that fermented foods contain less complex viral communities than many other environmental habitats, such as seawater, human feces, marine sediment, and soil. PMID:21183634

  1. Immunization with viral antigens: Infectious haematopoietic necrosis

    USGS Publications Warehouse

    Winton, J.R.

    1997-01-01

    Infectious haematopoietic necrosis (IHN) is one of the most important viral diseases of salmonids, especially among juvenile fish where losses can be high. For over 20 years, researchers have tested a variety of preparations for control of IHN. Early vaccines consisted of killed virus and were effective when delivered by injection, but too costly to be practical on a large scale. Attenuated vaccines were developed by serial passage in cell culture and by monoclonal antibody selection. These offered excellent protection and were cost-effective, but residual virulence and uncertainty about their effects on other aquatic species made them poor candidates for licensing. Subunit vaccines using part of the IHNV glycoprotein gene cloned into E. coli or into an attenuated strain of A. salmonicida have been tested, appeared safe and were inexpensive. These vaccines were reported to provide some protection when delivered by immersion. Information on the location of antigenic sites on the glycoprotein led to trials using synthetic peptides, but these did not seem to be economically viable. Recently, plasmid vectors encoding the glycoprotein gene under control of a cytomegalovirus promoter were developed for genetic immunization. The constructs were highly protective when delivered by injection, but a more practical delivery system is needed. Thus, while several vaccine strategies have been tried in order to stimulate specific immunity against IHN, more research is needed to develop a commercially viable product for control of this important disease.

  2. Coarse-grained mechanics of viral shells

    NASA Astrophysics Data System (ADS)

    Klug, William S.; Gibbons, Melissa M.

    2008-03-01

    We present an approach for creating three-dimensional finite element models of viral capsids from atomic-level structural data (X-ray or cryo-EM). The models capture heterogeneous geometric features and are used in conjunction with three-dimensional nonlinear continuum elasticity to simulate nanoindentation experiments as performed using atomic force microscopy. The method is extremely flexible; able to capture varying levels of detail in the three-dimensional structure. Nanoindentation simulations are presented for several viruses: Hepatitis B, CCMV, HK97, and φ29. In addition to purely continuum elastic models a multiscale technique is developed that combines finite-element kinematics with MD energetics such that large-scale deformations are facilitated by a reduction in degrees of freedom. Simulations of these capsid deformation experiments provide a testing ground for the techniques, as well as insight into the strength-determining mechanisms of capsid deformation. These methods can be extended as a framework for modeling other proteins and macromolecular structures in cell biology.

  3. Geographic dynamics of viral encephalitis in Thailand.

    PubMed

    Henrich, Timothy J; Hutchaleelaha, Sombat; Jiwariyavej, Vitaya; Barbazan, Philippe; Nitatpattana, Narong; Yoksan, Sutee; Gonzalez, Jean-Paul

    2003-06-01

    Viral encephalitis (VE) continues to be a major disease in Asia, causing serious illness which may result in death or have neurological sequelae. This study involves an ecological analysis of the climatic, geographic and seasonal patterns of clinically reported VE in Thailand from 1993 to 1998 to investigate regional and seasonal differences in disease incidence. Three thousand eight hundred and twenty nine cases of VE were clinically diagnosed nationwide during the study period by the Thai Ministry of Public Health. Spearman rank correlations of temporal, spatial and geographic variables with disease incidence were performed. The monthly incidence of VE correlated significantly with seasonal changes in temperature, relative humidity and rainfall in the north-northeast region of Thailand (P < 0.001), whereas incidence in the south-central region correlated only with relative humidity (P = 0.003). Spatial analysis revealed a positive correlation of disease with elevation (P < 0.001), and negative correlations with rice-field cover (P < 0.001), agricultural land-use (P < 0.001) and temperature (P = 0.004) in the north-northeast region. No significant spatial correlation was identified in the south-central region. The spatial distribution of VE suggests that etiologic variations may be responsible, in part, for the geographic patterns of disease. Active etiologic surveillance is necessary in a variety of geographic settings in order to provide physicians with information necessary for disease prevention and clinical management.

  4. Liver transplantation for viral hepatitis in 2015

    PubMed Central

    Ferrarese, Alberto; Zanetto, Alberto; Gambato, Martina; Bortoluzzi, Ilaria; Nadal, Elena; Germani, Giacomo; Senzolo, Marco; Burra, Patrizia; Russo, Francesco Paolo

    2016-01-01

    Liver transplantation (LT) is a life-saving treatment for patients with end-stage liver disease and for patients with liver cell cancer related to liver disease. Acute and chronic liver diseases related to hepatitis viruses are between the main indications for liver transplantation. The risk of viral reinfection after transplantation is the main limiting factor in these indications. Before the availability of antiviral prophylaxis, hepatitis B virus (HBV) recurrence was universal in patients who were HBV DNA-positive before transplantation. The natural history of recurrent HBV was accelerated by immunosuppression, and it progressed rapidly to graft failure and death. Introduction of post-transplant prophylaxis with immunoglobulin alone first, and associated to antiviral drugs later, drastically reduced HBV recurrence, resulting in excellent long-term outcomes. On the contrary, recurrence of hepatitis C is the main cause of graft loss in most transplant programs. Overall, patient and graft survival after LT for hepatitis C virus (HCV)-associated cirrhosis is inferior compared with other indications. However, successful pretransplant or post transplant antiviral therapy has been associated with increased graft and overall survival. Until recently, the combination of pegylated interferon and ribavirin was the standard of care for the treatment of patients with chronic hepatitis C. Highly active antiviral compounds have been developed over the past decade, thanks to new in vitro systems to study HCV entry, replication, assembly, and release. PMID:26819523

  5. Suppression of viral infectivity through lethal defection

    PubMed Central

    Grande-Pérez, Ana; Lázaro, Ester; Lowenstein, Pedro; Domingo, Esteban; Manrubia, Susanna C.

    2005-01-01

    RNA viruses replicate with a very high error rate and give rise to heterogeneous, highly plastic populations able to adapt very rapidly to changing environments. Viral diseases are thus difficult to control because of the appearance of drug-resistant mutants, and it becomes essential to seek mechanisms able to force the extinction of the quasispecies before adaptation emerges. An alternative to the use of conventional drugs consists in increasing the replication error rate through the use of mutagens. Here, we report about persistent infections of lymphocytic choriomeningitis virus treated with fluorouracil, where a progressive debilitation of infectivity leading to eventual extinction occurs. The transition to extinction is accompanied by the production of large amounts of RNA, indicating that the replicative ability of the quasispecies is not strongly impaired by the mutagen. By means of experimental and theoretical approaches, we propose that a fraction of the RNA molecules synthesized can behave as a defective subpopulation able to drive the viable class extinct. Our results lead to the identification of two extinction pathways, one at high amounts of mutagen, where the quasispecies completely loses its ability to infect and replicate, and a second one, at lower amounts of mutagen, where replication continues while the infective class gets extinct because of the action of defectors. The results bear on a potential application of increased mutagenesis as an antiviral strategy in that low doses of a mutagenic agent may suffice to drive persistent virus to extinction. PMID:15767582

  6. Evolution of viral virulence: empirical studies

    USGS Publications Warehouse

    Kurath, Gael; Wargo, Andrew R.

    2016-01-01

    The concept of virulence as a pathogen trait that can evolve in response to selection has led to a large body of virulence evolution theory developed in the 1980-1990s. Various aspects of this theory predict increased or decreased virulence in response to a complex array of selection pressures including mode of transmission, changes in host, mixed infection, vector-borne transmission, environmental changes, host vaccination, host resistance, and co-evolution of virus and host. A fundamental concept is prediction of trade-offs between the costs and benefits associated with higher virulence, leading to selection of optimal virulence levels. Through a combination of observational and experimental studies, including experimental evolution of viruses during serial passage, many of these predictions have now been explored in systems ranging from bacteriophage to viruses of plants, invertebrates, and vertebrate hosts. This chapter summarizes empirical studies of viral virulence evolution in numerous diverse systems, including the classic models myxomavirus in rabbits, Marek's disease virus in chickens, and HIV in humans. Collectively these studies support some aspects of virulence evolution theory, suggest modifications for other aspects, and show that predictions may apply in some virus:host interactions but not in others. Finally, we consider how virulence evolution theory applies to disease management in the field.

  7. Viral Hepatitis B: Clinical and Epidemiological Characteristics

    PubMed Central

    Burns, Gregory S.; Thompson, Alexander J.

    2014-01-01

    It is now 50 years since the discovery of the hepatitis B virus (HBV), and, despite the availability of a prophylactic vaccine for more than 20 years, HBV infection remains a disease of significant global health burden. It is estimated that more than 240 million people are chronically infected with HBV and, therefore, are at risk for the development of cirrhosis, hepatic decompensation, and hepatocellular carcinoma (HCC). The risk of clinical complications has traditionally been higher in older males with hepatitis B e antigen (HBeAg)–positive disease, high-grade liver necroinflammation, and progressive fibrosis. Recent advances in the understanding of the natural history of chronic HBV infection have identified an important role for plasma HBV DNA levels as a marker of risk for clinical outcomes. Among adults, persistent high-level HBV replication is associated with an increased risk of cirrhosis, as well as HCC development. This has led to the therapeutic focus on achieving sustained viral suppression. There is an emerging role for quantitative hepatitis B surface antigen (HBsAg) levels as a marker of natural history. Low levels of HBsAg have been associated with sustained immune control, HBsAg seroclearance, as well as lower risk of HCC. In this work, we review the natural history of HBV infection, with a focus on the determinants of clinical outcomes in patients with chronic hepatitis B (CHB) infection. PMID:25359547

  8. Emerging viral diseases of fish and shrimp.

    PubMed

    Walker, Peter J; Winton, James R

    2010-01-01

    The rise of aquaculture has been one of the most profound changes in global food production of the past 100 years. Driven by population growth, rising demand for seafood and a levelling of production from capture fisheries, the practice of farming aquatic animals has expanded rapidly to become a major global industry. Aquaculture is now integral to the economies of many countries. It has provided employment and been a major driver of socio-economic development in poor rural and coastal communities, particularly in Asia, and has relieved pressure on the sustainability of the natural harvest from our rivers, lakes and oceans. However, the rapid growth of aquaculture has also been the source of anthropogenic change on a massive scale. Aquatic animals have been displaced from their natural environment, cultured in high density, exposed to environmental stress, provided artificial or unnatural feeds, and a prolific global trade has developed in both live aquatic animals and their products. At the same time, over-exploitation of fisheries and anthropogenic stress on aquatic ecosystems has placed pressure on wild fish populations. Not surprisingly, the consequence has been the emergence and spread of an increasing array of new diseases. This review examines the rise and characteristics of aquaculture, the major viral pathogens of fish and shrimp and their impacts, and the particular characteristics of disease emergence in an aquatic, rather than terrestrial, context. It also considers the potential for future disease emergence in aquatic animals as aquaculture continues to expand and faces the challenges presented by climate change.

  9. The persistence of bovine viral diarrhea virus.

    PubMed

    Brock, Kenny V

    2003-06-01

    Bovine viral diarrhoea virus (BVDV) has a unique capacity to cause persistent infections of foetuses exposed within the first 150 days of gestation. Preventing foetal BVDV infection will aid in improved control. This unique ability gives BVDV a selective advantage allowing continual mutation and antigenic variation within cattle populations. Therefore, BVDV has become widespread and causes economic losses due to respiratory, reproductive and enteric disease. Vaccination (modified-live or killed) can provide some protection from acute disease and the development of persistently infected foetuses. However, vaccination programmes alone cannot control or eliminate BVDV. In naturally exposed and vaccinated herds, BVDV infections are not self-limiting and may persistent over time. This underscores the ability of the BVDV genome to remain fluid and adapt under selective pressures. Factors influencing persistence of BVDV infections in cattle populations include: non-lytic infections; evasion of host immune responses; foetal infections; acute infections; management practices; contaminated biologics; secondary hosts; defective replicated intermediates; antigenic variation; and replication in privileged anatomical sites.

  10. Membrane-assisted viral DNA ejection.

    PubMed

    Santos-Pérez, Isaac; Oksanen, Hanna M; Bamford, Dennis H; Goñi, Felix M; Reguera, David; Abrescia, Nicola G A

    2017-03-01

    Genome packaging and delivery are fundamental steps in the replication cycle of all viruses. Icosahedral viruses with linear double-stranded DNA (dsDNA) usually package their genome into a preformed, rigid procapsid using the power generated by a virus-encoded packaging ATPase. The pressure and stored energy due to this confinement of DNA at a high density is assumed to drive the initial stages of genome ejection. Membrane-containing icosahedral viruses, such as bacteriophage PRD1, present an additional architectural complexity by enclosing their genome within an internal membrane vesicle. Upon adsorption to a host cell, the PRD1 membrane remodels into a proteo-lipidic tube that provides a conduit for passage of the ejected linear dsDNA through the cell envelope. Based on volume analyses of PRD1 membrane vesicles captured by cryo-electron tomography and modeling of the elastic properties of the vesicle, we propose that the internal membrane makes a crucial and active contribution during infection by maintaining the driving force for DNA ejection and countering the internal turgor pressure of the host. These novel functions extend the role of the PRD1 viral membrane beyond tube formation or the mere physical confinement of the genome. The presence and assistance of an internal membrane might constitute a biological advantage that extends also to other viruses that package their linear dsDNA to high density within an internal vesicle.

  11. The multiple aetiology of viral hepatitis

    PubMed Central

    Zuckerman, A. J.

    1971-01-01

    Infectious hepatitis is epidemiologically and immunologically distinct from serum hepatitis. The Australia antigen is related more specifically to serum hepatitis. The possible role of coronavirus—and paramyxovirus-like particles in the aetiology of some infections of the liver in man and in marmosets inoculated with human infectious hepatitis material is discussed and the difficulties in the interpretation of the currently available data are emphasized. The recent studies in Melbourne of a faecal antigen found in some patients with infectious hepatitis and the discovery of an antiserum in Milan which reacted with an antigen associated with epidemic hepatitis are discussed. Mention is made of the recent isolation in Detroit-6 cells of virus-like particles from patients with infectious hepatitis. It is concluded that viral hepatitis is an infection of multiple aetiology and that the successful cultivation in vitro of the agent or agents of hepatitis remains the outstanding and most urgent problem. ImagesFig. 1Fig. 2Fig. 3Fig. 4 PMID:4327058

  12. Viral factors in influenza pandemic risk assessment

    PubMed Central

    Lipsitch, Marc; Barclay, Wendy; Raman, Rahul; Russell, Charles J; Belser, Jessica A; Cobey, Sarah; Kasson, Peter M; Lloyd-Smith, James O; Maurer-Stroh, Sebastian; Riley, Steven; Beauchemin, Catherine AA; Bedford, Trevor; Friedrich, Thomas C; Handel, Andreas; Herfst, Sander; Murcia, Pablo R; Roche, Benjamin; Wilke, Claus O; Russell, Colin A

    2016-01-01

    The threat of an influenza A virus pandemic stems from continual virus spillovers from reservoir species, a tiny fraction of which spark sustained transmission in humans. To date, no pandemic emergence of a new influenza strain has been preceded by detection of a closely related precursor in an animal or human. Nonetheless, influenza surveillance efforts are expanding, prompting a need for tools to assess the pandemic risk posed by a detected virus. The goal would be to use genetic sequence and/or biological assays of viral traits to identify those non-human influenza viruses with the greatest risk of evolving into pandemic threats, and/or to understand drivers of such evolution, to prioritize pandemic prevention or response measures. We describe such efforts, identify progress and ongoing challenges, and discuss three specific traits of influenza viruses (hemagglutinin receptor binding specificity, hemagglutinin pH of activation, and polymerase complex efficiency) that contribute to pandemic risk. DOI: http://dx.doi.org/10.7554/eLife.18491.001 PMID:27834632

  13. Bacterial, Fungal, Parasitic, and Viral Myositis

    PubMed Central

    Crum-Cianflone, Nancy F.

    2008-01-01

    Infectious myositis may be caused by a broad range of bacterial, fungal, parasitic, and viral agents. Infectious myositis is overall uncommon given the relative resistance of the musculature to infection. For example, inciting events, including trauma, surgery, or the presence of foreign bodies or devitalized tissue, are often present in cases of bacterial myositis. Bacterial causes are categorized by clinical presentation, anatomic location, and causative organisms into the categories of pyomyositis, psoas abscess, Staphylococcus aureus myositis, group A streptococcal necrotizing myositis, group B streptococcal myositis, clostridial gas gangrene, and nonclostridial myositis. Fungal myositis is rare and usually occurs among immunocompromised hosts. Parasitic myositis is most commonly a result of trichinosis or cystericercosis, but other protozoa or helminths may be involved. A parasitic cause of myositis is suggested by the travel history and presence of eosinophilia. Viruses may cause diffuse muscle involvement with clinical manifestations, such as benign acute myositis (most commonly due to influenza virus), pleurodynia (coxsackievirus B), acute rhabdomyolysis, or an immune-mediated polymyositis. The diagnosis of myositis is suggested by the clinical picture and radiologic imaging, and the etiologic agent is confirmed by microbiologic or serologic testing. Therapy is based on the clinical presentation and the underlying pathogen. PMID:18625683

  14. Immunization with viral antigens: infectious haematopoietic necrosis.

    PubMed

    Winton, J R

    1997-01-01

    Infectious haematopoietic necrosis (IHN) is one of the most important viral diseases of salmonids, especially among juvenile fish where losses can be high. For over 20 years, researchers have tested a variety of preparations for control of IHN. Early vaccines consisted of killed virus and were effective when delivered by injection, but too costly to be practical on a large scale. Attenuated vaccines were developed by serial passage in cell culture and by monoclonal antibody selection. These offered excellent protection and were cost-effective, but residual virulence and uncertainty about their effects on other aquatic species made them poor candidates for licensing. Subunit vaccines using part of the IHNV glycoprotein gene cloned into E. coli or into an attenuated strain of A. salmonicida have been tested, appeared safe and were inexpensive. These vaccines were reported to provide some protection when delivered by immersion. Information on the location of antigenic sites on the glycoprotein led to trials using synthetic peptides, but these did not seem to be economically viable. Recently, plasmid vectors encoding the glycoprotein gene under control of a cytomegalovirus promoter were developed for genetic immunization. The constructs were highly protective when delivered by injection, but a more practical delivery system is needed. Thus, while several vaccine strategies have been tried in order to stimulate specific immunity against IHN, more research is needed to develop a commercially viable product for control of this important disease.

  15. Emerging viral diseases of fish and shrimp

    USGS Publications Warehouse

    Winton, James R.; Walker, Peter J.

    2010-01-01

    The rise of aquaculture has been one of the most profound changes in global food production of the past 100 years. Driven by population growth, rising demand for seafood and a levelling of production from capture fisheries, the practice of farming aquatic animals has expanded rapidly to become a major global industry. Aquaculture is now integral to the economies of many countries. It has provided employment and been a major driver of socio-economic development in poor rural and coastal communities, particularly in Asia, and has relieved pressure on the sustainability of the natural harvest from our rivers, lakes and oceans. However, the rapid growth of aquaculture has also been the source of anthropogenic change on a massive scale. Aquatic animals have been displaced from their natural environment, cultured in high density, exposed to environmental stress, provided artificial or unnatural feeds, and a prolific global trade has developed in both live aquatic animals and their products. At the same time, over-exploitation of fisheries and anthropogenic stress on aquatic ecosystems has placed pressure on wild fish populations. Not surprisingly, the consequence has been the emergence and spread of an increasing array of new diseases. This review examines the rise and characteristics of aquaculture, the major viral pathogens of fish and shrimp and their impacts, and the particular characteristics of disease emergence in an aquatic, rather than terrestrial, context. It also considers the potential for future disease emergence in aquatic animals as aquaculture continues to expand and faces the challenges presented by climate change.

  16. Undiagnosed acute viral febrile illnesses, Sierra Leone.

    PubMed

    Schoepp, Randal J; Rossi, Cynthia A; Khan, Sheik H; Goba, Augustine; Fair, Joseph N

    2014-07-01

    Sierra Leone in West Africa is in a Lassa fever-hyperendemic region that also includes Guinea and Liberia. Each year, suspected Lassa fever cases result in submission of ≈500-700 samples to the Kenema Government Hospital Lassa Diagnostic Laboratory in eastern Sierra Leone. Generally only 30%-40% of samples tested are positive for Lassa virus (LASV) antigen and/or LASV-specific IgM; thus, 60%-70% of these patients have acute diseases of unknown origin. To investigate what other arthropod-borne and hemorrhagic fever viral diseases might cause serious illness in this region and mimic Lassa fever, we tested patient serum samples that were negative for malaria parasites and LASV. Using IgM-capture ELISAs, we evaluated samples for antibodies to arthropod-borne and other hemorrhagic fever viruses. Approximately 25% of LASV-negative patients had IgM to dengue, West Nile, yellow fever, Rift Valley fever, chikungunya, Ebola, and Marburg viruses but not to Crimean-Congo hemorrhagic fever virus.

  17. Topological friction strongly affects viral DNA ejection

    PubMed Central

    Marenduzzo, Davide; Micheletti, Cristian; Orlandini, Enzo; Sumners, De Witt

    2013-01-01

    Bacteriophages initiate infection by releasing their double-stranded DNA into the cytosol of their bacterial host. However, what controls and sets the timescales of DNA ejection? Here we provide evidence from stochastic simulations which shows that the topology and organization of DNA packed inside the capsid plays a key role in determining these properties. Even with similar osmotic pressure pushing out the DNA, we find that spatially ordered DNA spools have a much lower effective friction than disordered entangled states. Such spools are only found when the tendency of nearby DNA strands to align locally is accounted for. This topological or conformational friction also depends on DNA knot type in the packing geometry and slows down or arrests the ejection of twist knots and very complex knots. We also find that the family of (2, 2k+1) torus knots unravel gradually by simplifying their topology in a stepwise fashion. Finally, an analysis of DNA trajectories inside the capsid shows that the knots formed throughout the ejection process mirror those found in gel electrophoresis experiments for viral DNA molecules extracted from the capsids. PMID:24272939

  18. Sindbis viral vectors target hematopoietic malignant cells.

    PubMed

    Suzme, R; Tseng, J-C; Levin, B; Ibrahim, S; Meruelo, D; Pellicer, A

    2012-11-01

    Sindbis viral vectors target and inhibit the growth of various solid tumors in mouse models. However, their efficacy against blood cancer has not been well established. Here, we show that Sindbis vectors infect and efficiently trigger apoptosis in mouse BW5147 malignant hematopoietic T-cells, but only at low levels in human lymphoma and leukemia cells (Jurkat, Karpas, CEM, DHL and JB). The Mr 37/67 kD laminin receptor (LAMR) has been suggested to be the receptor for Sindbis virus. However, JB cells, which are infected by Sindbis at low efficiency, express high levels of LAMR, revealing that additional factors are involved in Sindbis tropism. To test the infectivity and therapeutic efficacy of Sindbis vectors against malignant hematopoietic cells in vivo, we injected BW5147 cells intraperitoneally into (C3HXAKR) F1 hybrid mice. We found that Sindbis vectors targeted the tumors and significantly prolonged survival of tumor-bearing mice. We also tested the Sindbis vectors in a transgenic CD4-Rgr model, which spontaneously develop thymic lymphomas. However, infectivity in this model was less efficient. Taken together, these results demonstrate that Sindbis vectors have the potential to target and kill hematopoietic malignancies in mice, but further research is needed to evaluate the mechanism underlining the susceptibility of human lymphoid malignancies to Sindbis therapy.

  19. Animal models of viral hemorrhagic fever.

    PubMed

    Smith, Darci R; Holbrook, Michael R; Gowen, Brian B

    2014-12-01

    The term "viral hemorrhagic fever" (VHF) designates a syndrome of acute febrile illness, increased vascular permeability and coagulation defects which often progresses to bleeding and shock and may be fatal in a significant percentage of cases. The causative agents are some 20 different RNA viruses in the families Arenaviridae, Bunyaviridae, Filoviridae and Flaviviridae, which are maintained in a variety of animal species and are transferred to humans through direct or indirect contact or by an arthropod vector. Except for dengue, which is transmitted among humans by mosquitoes, the geographic distribution of each type of VHF is determined by the range of its animal reservoir. Treatments are available for Argentine HF and Lassa fever, but no approved countermeasures have been developed against other types of VHF. The development of effective interventions is hindered by the sporadic nature of most infections and their occurrence in geographic regions with limited medical resources. Laboratory animal models that faithfully reproduce human disease are therefore essential for the evaluation of potential vaccines and therapeutics. The goal of this review is to highlight the current status of animal models that can be used to study the pathogenesis of VHF and test new countermeasures.

  20. A viral peptide for intracellular delivery

    NASA Astrophysics Data System (ADS)

    Falanga, Annarita; Tarallo, Rossella; Cantisani, Marco; Della Pepa, Maria Elena; Galdiero, Massimiliano; Galdiero, Stefania

    2012-10-01

    Biological membranes represent a critical hindrance for administering active molecules which are often unable to reach their designated intracellular target sites. In order to overcome this barrier-like behavior not easily circumvented by many pharmacologically-active molecules, synthetic transporters have been exploited to promote cellular uptake. Linking or complexing therapeutic molecules to peptides that can translocate through the cellular membranes could enhance their internal delivery, and consequently, a higher amount of active compound would reach the site of action. Use of cell penetrating peptides (CPPs) is one of the most promising strategy to efficiently translocate macromolecules through the plasma membrane, and have attracted a lot of attention. New translocating peptides are continuously described and in the present review, we will focus on viral derived peptides, and in particular a peptide (gH625) derived from the herpes simplex virus type 1 (HSV-1) glycoprotein H (gH) that has proved to be a useful delivery vehicle due to its intrinsic properties of inducing membrane perturbation.