Science.gov

Sample records for mold stachybotrys chartarum

  1. Indoor mold, toxigenic fungi, and Stachybotrys chartarum: infectious disease perspective.

    PubMed

    Kuhn, D M; Ghannoum, M A

    2003-01-01

    Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors.

  2. Indoor Mold, Toxigenic Fungi, and Stachybotrys chartarum: Infectious Disease Perspective

    PubMed Central

    Kuhn, D. M.; Ghannoum, M. A.

    2003-01-01

    Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors. PMID:12525430

  3. Facts about Stachybotrys chartarum and Other Molds

    MedlinePlus

    ... Issues Resources Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New National Center for Environmental ... issued additional guidance, the WHO Guidelines for Indoor Air Quality: Dampness and Mould [PDF - 2.52 MB] . Other ...

  4. Biomechanics of conidial dispersal in the toxic mold Stachybotrys chartarum.

    PubMed

    Tucker, Kathryn; Stolze, Jessica L; Kennedy, Aaron H; Money, Nicholas P

    2007-07-01

    Conidial dispersal in Stachybotrys chartarum in response to low-velocity airflow was studied using a microflow apparatus. The maximum rate of spore release occurred during the first 5 min of airflow, followed by a dramatic reduction in dispersal that left more than 99% of the conidia attached to their conidiophores. Micromanipulation of undisturbed colonies showed that micronewton (microN) forces were needed to dislodge spore clusters from their supporting conidiophores. Calculations show that airspeeds that normally prevail in the indoor environment disturb colonies with forces that are 1000-fold lower, in the nanonewton (nN) range. Low-velocity airflow does not, therefore, cause sufficient disturbance to disperse a large proportion of the conidia of S. chartarum.

  5. Biomechanics of conidial dispersal in the toxic mold Stachybotrys chartarum

    PubMed Central

    Tucker, Kathryn; Stolze, Jessica L.; Kennedy, Aaron H.; Money, Nicholas P.

    2007-01-01

    Conidial dispersal in Stachybotrys chartarum in response to low-velocity airflow was studied using a microflow apparatus. The maximum rate of spore release occurred during the first 5 min of airflow, followed by a dramatic reduction in dispersal that left more than 99% of the conidia attached to their conidiophores. Micromanipulation of undisturbed colonies showed that micronewton (μN) forces were needed to dislodge spore clusters from their supporting conidiophores. Calculations show that airspeeds that normally prevail in the indoor environment disturb colonies with forces that are 1,000-fold lower, in the nanonewton (nN) range. Low-velocity airflow does not, therefore, cause sufficient disturbance to disperse a large proportion of the conidia of S. chartarum. PMID:17267247

  6. ELISA MEASUREMENT OF STACHYLYSIN IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Problem- To develop a measurable indicator of human exposure to Stachybotys chartarum.

    Methods- Antibodies were produced against the hemolytic agent stachylysin obtained from the mold S. chartarum. These antibodies were used to develop two enzyme-linked immunosorbent ass...

  7. IS YOUR STACHYBOTRYS CHARTARUM A GENUINE S. CHARTARUM?

    EPA Science Inventory

    The fungus Stachybotrys chartarum is the type species of the genus Stachybotrys. Certain strains of the species are known to produce trichothecene mycotoxins,. It is a celluolytic saprophyte with worldwide distribution and frequently discovered in water-damaged buildings. Evid...

  8. ELISA MEASUREMENT OF STACHYLYSIN (TM) IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Antibodies were produced against the hemolytic agent stachylysin obtained from the mold Stachybotryis chartarum. These antibodies were used to develop two enzyme-linked immunosorbent assay (ELISA) methods for the analysis of stachylysin in human and rat sera and environmental sa...

  9. CHARACTERIZATION OF THE HEMOLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920
    Da as determ...

  10. GROWTH RESPONSE OF STACHYBOTRYS CHARTARUM TO MOISTURE VARIATION ON COMMON BUILDING MATERIALS

    EPA Science Inventory

    The mold Stachybotrys chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants and has been studied for toxin production and its occurrence in water damaged buildings. Growth of S. chartarum on building materials such as drywall has been frequentl...

  11. Genome sequence of Stachybotrys chartarum Strain 51-11

    EPA Science Inventory

    Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina Hiseq 2000 and PacBio long read technology. Since Stachybotrys chartarum has been implicated in health impacts within water-damaged buildings, any information extracted from the geno...

  12. CHARACTERISTIC GROWTH REQUIREMENTS OF THE TOXIC MOLD STACHYBOTRYS CHARTARAM

    EPA Science Inventory

    The paper discusses the results of a study of the environmental factors leading to the growth of the mold Stachybotrys chartarum. S. chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants, and its toxin production and occurrence in water damaged...

  13. Satratoxin G from the black mold Stachybotrys chartarum evokes olfactory sensory neuron loss and inflammation in the murine nose and brain.

    PubMed

    Islam, Zahidul; Harkema, Jack R; Pestka, James J

    2006-07-01

    Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the "black mold" suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose-response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 microg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 microg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 microg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-alpha, interleukin-6 (IL-6) , and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings.

  14. Complete Genome of Stachybotrys chartarum strain 51-11

    EPA Pesticide Factsheets

    Complete genome sequence of the fungus Stachybotrys chartarum. Sequences can be used to identify genes, genetic pathways, gene clusters, genetic organization, etc. utilizing appropriate bioinformatics software.This dataset is associated with the following publication:Betancourt , D., T. Dean , J. Kim, and J. Levy. Genome sequence of Stachybotrys chartarum Strain 51-11. Genome Announcements. American Society for Microbiology, Washington, DC, USA, 3(6): 1114-1115, (2015).

  15. The relative allergenicity of Stachybotrys chartarum compared to house dust mite extracts in a mouse model

    EPA Science Inventory

    A report by the Institute of Medicine suggested that more research is needed to better understand mold effects on allergic disease, particularly asthma development. The authors compared the ability of the fungus Stachybotrys chartarum (SCE) and house dust mite (HDM) extracts to i...

  16. CHARACTERIZATION OF MICROBIAL VOLATILE ORGANIC COMPOUNDS (MVOC) EMITTED BY STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a filamentous fungi usually found in water-damaged buildings. Severe illnesses have been reported after indoor exposure to this mold. Toxicity has caused the production of secondary metabolites or mycotoxins, and the emission of by-products, specifically...

  17. CHARACTERIZATION OF THE HEMOLYSIN, STACHYLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage/hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its monomeric form, has a molecular wieght of 11,920 daltons as determined by m...

  18. STACHYLYSIN MAY BE CAUSE OF HEMORRAHAGING IN STACHYBOTRYS CHARTARUM EXPOSURES

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns like nasal bleeding in adults and pulmonary hemosiderosis (PH) in infants. Stachylysin is a glycosylated protein, with the deglycosylated molecular mass of 21.5 kDa. Seven of eight ...

  19. EVALUATION OF STACHYBOTRYS CHARTARUM IN THE HOUSE OF AN INFANT WITH PULMONARY HEMORRHAGE: QUANTITATIVE ASSESSMENT BEFORE, DURING, AND AFTER REMEDIATION

    EPA Science Inventory

    Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...

  20. Occurrence of Stachybotrys chartarum chemotype S in dried culinary herbs.

    PubMed

    Biermaier, Barbara; Gottschalk, Christoph; Schwaiger, Karin; Gareis, Manfred

    2015-02-01

    Stachybotrys (S.) chartarum is an omnipresent cellulolytic mould which produces secondary metabolites, such as the highly toxic macrocyclic trichothecenes. While it is known to occur in animal feed like hay and straw as well as in water-damaged indoor environments, there is little knowledge about the occurrence of S. chartarum and its secondary metabolites in food. The objective of the present study was to examine selected dried culinary herbs for the presence of S. chartarum chemotype S, to assess the potential risk of a contamination of foods with macrocyclic trichothecenes. In total, 50 Stachybotrys isolates from different types of culinary herbs (n=100) such as marjoram (Origanum majorana Linné (L.)), oregano (Origanum vulgare L.), thyme (Thymus vulgaris L.), and savory (Satureja hortensis L.) were examined by MTT-cell culture test (effect-based bioassay), ELISA, and by liquid chromatography tandem mass spectrometry (LC-MS/MS). Selected toxic and non-toxic isolates (n=15) were genetically characterized by PCR and sequencing. Five isolates (10%) were highly toxic in the MTT-cell culture test, and the production of macrocyclic trichothecenes was proven by ELISA and LC-MS/MS. These five isolates were genetically confirmed as S. chartarum chemotype S. To the best of our knowledge, this is the first report about a contamination of dried culinary herbs with toxigenic S. chartarum.

  1. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  2. SOLVENT COMPARISON IN THE ISOLATION, SOLUBILIZATION, AND TOXICITY OF STACHYBOTRYS CHARTARUM SPORE TRICHOTHECENE MYCOTOXINS IN AN ESTABLISHED IN VITRO LUMINESCENCE PROTEIN TRANSLATION INHIBITION ASSAY

    EPA Science Inventory

    It is well known that non-viable mold contaminants such as macrocyclic trichothecene mycotoxins of Stachybotrys chartarum are highly toxinigenic to humans. However, there is no agreed upon method of recovering native mycotoxin. The purpose of this study was to provide quantitativ...

  3. GERMINATION, VIABILITY AND CLEARANCE OF STACHYBOTRYS CHARTARUM IN THE LUNGS OF INFANT RATS

    EPA Science Inventory

    The fungus Stachybotrys chartarum has been associated with many adverse health effects including the condition known as idiopathic pulmonary hemorrhage in infants. In order to gain some insight into possible mechanisms, viable conidia of S. chartarum were instilled into the lung...

  4. AN EXTRACT OF STACHYBOTRYS CHARTARUM CAUSES ALLERGIC RESPONSE IN A BALB/C MOUSE MODEL

    EPA Science Inventory

    ABSTRACT
    Environmental exposure to Stachybotrys chartarum has been associated with adverse health effects in humans. The goal of this study was to assess soluble components of this fungus for allergenic potential. Five isolates of S. chartarum were combined and extracted to fo...

  5. IDENTIFICATION OF SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenitic relati...

  6. The role of fungal proteinases in pathophysiology of Stachybotrys chartarum.

    PubMed

    Yike, Iwona; Rand, Thomas; Dearborn, Dorr G

    2007-10-01

    The adverse health effects of Stachybotrys chartarum have often been linked to exposure to the trichothecene mycotoxins. Recent studies have shown that in addition to mycotoxins this fungus is capable of producing and secreting in vivo proteins such as hemolysins and proteinases. Spore extracts obtained from a high trichothecene producing isolate JS 58-17 exhibited a significantly lower proteolytic activity compared to the low trichothecene producer, JS 58-06. Growing isolates on rice or potato dextrose agar results in higher proteolytic activity of the spores compared to those grown on drywall. Proteinases in the spore extracts can hydrolyze gelatin and collagen I and IV. Analysis of zymograms shows the presence of several proteins with proteolytic activity in the spores of S. chartarum. Human tracheal epithelial cells exposed to spore extracts produced significantly higher levels of IL-6, IL-8, and TNF-alpha than control cells. This stimulation of cytokine production was completely abolished by Pefabloc, a serine protease inhibitor. Neutrophil numbers and proinflammatory cytokine (IL1-beta and TNF-alpha) concentrations were highly elevated in the lungs of 7 day old rat pups exposed intratracheally to 4 x 10(4) spores/gm body weight compared to control. No significant differences in those inflammatory indices in vivo were noted between the treatments with the high trichothecene producer, isolate JS 58-17 and JS 58-06, which does not produce macrocyclic trichothecenes. Immunohistochemistry revealed reduced collagen IV labeling in spore-induced lung granulomas in rat pups exposed to both isolates. These results suggest that proteinases from S. chartarum spores significantly contribute to lung inflammation and injury.

  7. INITIAL CHARACTERIZATION OF MONOCLONAL ANTIBODIES AGAINST THE FUNGAL HEMOLYSIN STACHYLYSIN FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is known to produce the hemolysin stachylysin and its detection in human serum has been proposed as a biomarker for exposure to the fungus. In this study we report the initial characterization of monoclonal antibodies (mAbs) against stachylysin and the dev...

  8. IDENTIFICATION OF PUTATIVE SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachbotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relatio...

  9. DESTRUCTION OF ASPERGILLUS VERSICOLOR, PENICILLIUM CRYSOGENUM, STACHYBOTRYS CHARTARUM, AND CLADOSPORIUM CLADOSPORIDES SPORES USING CHEMICAL OXIDATION TREATMENT PROCESS

    EPA Science Inventory

    The survival of aqueous suspensions of Penicillium chrysogenum, Stachybotrys chartarum, Aspergillus versicolor, and Cladosporium cladosporioides spores was evaluated using various combinations of hydrogen peroxide and iron (II) as catalyst. Spores were suspended in water and trea...

  10. Identification of putative sequence specific PCR primers for detection of the toxigenic fungal species Stachybotrys chartarum.

    PubMed

    Haugland, R A; Heckman, J L

    1998-12-01

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relationships of these organisms and to search for sequence specific polymerase chain reaction (PCR) primers for S. chartarum in the internal transcribed spacer (ITS) regions. Searches for candidate primers were performed both by computer using the commercially available Oligo(R) v5.0 primer analysis software package and by manual inspection of the aligned sequences. Primers identified in both types of searches were evaluated for their specificities using a priming efficiency analysis algorithm available in the Oligo(R) 5.0 software. The automated computer searches were unsuccessful in finding S. chartarum-specific primers but did identify a group-specific reverse primer (designated as StacR4) for a phylogenetically related cluster of species that included S. chartarum. Manual searches led to the identification of a reverse primer (designated as StacR3) that was predicted to be specific for only S. chartarum and one other species of Stachybotrys. Experimental PCR analyses using these primers in conjunction with a universal forward primer indicated that the computer-generated amplification efficiency predictions were correct in most instances. A notable exception was the finding that StacR3 was specific only for S. chartarum. The relative merits of different PCR strategies for the detection of S. chartarum employing either one or both of the primers identified in this study are discussed.

  11. AN EXTRACT OF STACHYBOTRYS CHARTARUM CAUSES ALLERGIC RESPONSES IN A BALB/C MOUSE MODEL: I. BIOCHEMICAL AND PATHOLOGICAL RESPONSES

    EPA Science Inventory

    Environmental exposure to Stachybotrys chartarum has been associated with adverse health effects in humans. The goal of this study was to assess soluble components of this fungus for allergenic potential. Five isolates of S. chartarum were combined and extracted to form a crude...

  12. Stachybotrys chartarum alters surfactant-related phospholipid synthesis and CTP:cholinephosphate cytidylyltransferase activity in isolated fetal rat type II cells.

    PubMed

    Hastings, C; Rand, T; Bergen, H T; Thliveris, J A; Shaw, A R; Lombaert, G A; Mantsch, H H; Giles, B L; Dakshinamurti, S; Scott, J E

    2005-03-01

    Stachybotry chartarum, a fungal contaminant of water-damaged buildings commonly grows on damp cellulose-containing materials. It produces a complex array of mycotoxins. Their mechanisms of action on the pulmonary system are not entirely clear. Previous studies suggest spore products may depress formation of disaturated phosphatidylcholine (DSPC), the major surface-active component of pulmonary surfactant (PS). If S. chartarum can indeed affect formation of this phospholipid, then mold exposure may be a significant issue for pulmonary function in both mature lung and developing fetal lung. To address this possibility, fetal rat type II cells, the principal source of DSPC, were used to assess effects of S. chartarum extract on formation of DSPC. Isolated fetal rat lung type II cells prelabeled with 3H-choline and incubated with spore extract showed decreased incorporation of 3H-choline into DSPC. The activity of CTP:cholinephosphate cytidylyltransferase (CPCT), the rate-limiting enzyme in phosphatidylcholine synthesis was reduced by approximately 50% by a 1:10 dilution of spore extract. Two different S. chartarum extracts (isolates from S. chartarum (Cleveland) and S. chartarum (Hawaiian)) were used to compare activity of CPCT in the presence of phosphatidylglycerol (PG), a known activator. PG produced an approximate two-fold increase in CPCT activity. The spore isolate from Hawaii did not alter enzyme activity. S. chartarum (Cleveland) eliminated the PG-induced activation of CPCT. These results support previous observations that mold products alter PS metabolism and may pose a risk in developing lung, inhibiting surfactant synthesis. Different isolates of the same species of fungus are not equivalent in terms of potential exposure risks.

  13. Toxicity screening of materials from buildings with fungal indoor air quality problems (Stachybotrys chartarum).

    PubMed

    E, J; M, G; S, Y C; E-L, H; M, N; B, J; R, D

    1998-06-01

    Samples of building materials visibly contaminated with moisture-related fungi (drywall, fiberglass, wallpaper, wood) were tested with indirect (FFL) and direct (MTT) cytotoxicity screening tests that are particularly sensitive toStachybotrys chartarum toxins. In addition, microscopic, chemical, immunochemical (Roridin A enzyme immunoassay) and mycological culture analyses were performed. In all cases in which building occupants had reported verifiable skin, mucous membrane, respiratory, central nervous system or neuropsychological abnormalities, cytotoxicity was identified. Results of a cytotoxicity screening test of field samples, such as the direct MTT test method, will give investigators of health problems related to indoor air quality problems important toxicity information.

  14. Molecular and phenotypic descriptions of Stachybotrys chlorohalonata sp. nov. and two chemotypes of Stachybotrys chartarum found in water-damaged buildings.

    PubMed

    Andersen, Birgitte; Nielsen, Kristian F; Thrane, Ulf; Szaro, Tim; Taylor, John W; Jarvis, Bruce B

    2003-01-01

    Twenty-five Stachybotrys isolates from two previous studies have been examined and compared, using morphological, chemical and phylogenetic methods. The results show that S. chartarum sensu lato can be segregated into two chemotypes and one new species. The new species, S. chlorohalonata, differs morphologically from S. chartarum by having smooth conidia, being more restricted in growth and producing a green extracellular pigment on the medium CYA. S. chlorohalonata and S. chartarum also have different tri5, chs1 and tub1 gene fragment sequences. The two chemotypes of S. chartarum, chemotype S and chemotype A, have similar morphology but differ in production of metabolites. Chemotype S produces macrocyclic trichothecenes, satratoxins and roridins, while chemotype A produces atranones and dolabellanes. There is no difference between the two chemotypes in the tub1 gene fragment, but there is a one nucleotide difference in each of the tri5 and the chs1 gene fragments.

  15. Effects of Stachybotrys chartarum (atra) conidia and isolated toxin on lung surfactant production and homeostasis.

    PubMed

    Mason, C D; Rand, T G; Oulton, M; MacDonald, J M; Scott, J E

    1998-01-01

    This study evaluated the effects of Stachybotrys chartarum conidia and a trichothecene, isosatratoxin-F, on choline incorporation into DSPC by fetal rabbit alveolar type II cells and on alveolar surfactant subtypes in mice. Exposure of fetal rabbit type II cells to S. chartarum conidia at concentrations of 10(3) to 10(6) conidia ml(-1) significantly depressed [3H] choline incorporation after 24 h of exposure. Exposure of the rabbit cells to 10(5) to 10(6) conidia ml(-1) also resulted in significantly depressed [3H] choline uptake after 48 h. Additionally, fetal rabbit alveolar type II cells exposed to isosatratoxin-F in concentrations ranging from 10(-9) to 10(-4) M showed a significant reduction in [3H] choline incorporation into DSPC. Alveolar surfactant phospholipid concentrations in the different metabolic subfractions of lung lavage fluid of mice intratracheally exposed to either 50 microl of 10(7) ml(-1) S. chartarum conidia or 50 microl 10(-7) M isosatratoxin-F showed some significant changes at 12, 24, 48, and 72 h post-exposure, compared to the surfactant subfractions of control mice which were either untreated, exposed to saline or to 50 microl of 10(-7) ml(-1) Cladosporium cladosporioides conidia. In both the S. chartarum- and the isosatratoxin-F-treated mice, exposure significantly increased P10, P100, and S100 phospholipid concentrations, while the P60 phospholipid concentrations were depressed. In contrast, C. cladosporioides-treated mice showed only one significant change in subfraction phospholipid concentration: P60 was depressed at 48 h post-exposure. These results reveal that alveolar type II cells are sensitive to exposure to S. chartarum conidia and to isosatratoxin F. Sensitivity is manifest by alterations in the normal metabolic processing of alveolar surfactant. In exposed mice, this effect appears to involve a significant increase in newly secreted surfactant and an accumulation of the used surfactant forms.

  16. QUANTIFICATION OF SIDEROPHORE AND HEMOLYSIN FROM STACHYBOTRYS CHARTARUM STRAINS, INCLUDING A STRAIN ISOLATED FROM THE LUNG OF A CHILD WITH PULMONARY HEMORRHAGE AND HEMOSIDEROSIS

    EPA Science Inventory

    A strain of Stachybotrys chartarum was recently isolated from the lung of a pulmonary hemorrhage and hemosiderosis (PH) patient in Texas (designated the Houston strain). This is the first time that S. chartarum has been isolated from the lung of a PH patient. In this study, the ...

  17. Building-associated pulmonary disease from exposure to Stachybotrys chartarum and Aspergillus versicolor.

    PubMed

    Hodgson, M J; Morey, P; Leung, W Y; Morrow, L; Miller, D; Jarvis, B B; Robbins, H; Halsey, J F; Storey, E

    1998-03-01

    The authors present an outbreak of disease associated with exposure to Stachybotrys chartarum and Aspergillus species. A courthouse and two associated office buildings had generated discomfort among employees for two years since initial occupancy. Multiple interventions had been unsuccessful An initial evaluation of 14 individuals identified three with potential asthma and three with symptoms consistent with interstitial lung disease. A clinical screening protocol to identify individuals who should be removed from work identified three likely and seven possible cases of building-related asthma. Detailed environmental and engineering assessments of the building identified major problems in mechanical system design, building construction, and operational strategies leading to excess moisture and elevated relative humidities. Moisture-damaged interior surfaces in both buildings were contaminated with S. chartarum, A. versicolor, and Penicillium species. Aspergillus species, especially A. versicolor, at concentrations of 10(1) to 10(4)/m3 dominated the indoor air under normal operating conditions. Bulk samples also revealed large quantities of Stachybotrys. A questionnaire survey of the three case and two control buildings documented between three- and 15-fold increases in symptoms. A nested case-control study suggested emphysematous-like disease in individuals meeting questionnaire definitions for cases. Replication of analysis strategies used in similar previous investigations suggested an association between worsening symptoms and decreased diffusing capacity of the lung. Performance on neuropsychological measures was similar for both cases and controls, although workers with symptoms reported increased levels of current but not past psychiatric symptomatology. Chemical analyses demonstrated the presence of satratoxins G and H. Cytotoxic laboratory analyses demonstrated the presence of agents with biological effectiveness in bulk materials. No association was seen

  18. Synergistic interaction in simultaneous exposure to Streptomyces californicus and Stachybotrys chartarum.

    PubMed Central

    Huttunen, Kati; Pelkonen, Jukka; Nielsen, Kristian Fogg; Nuutinen, Ulla; Jussila, Juha; Hirvonen, Maija-Riitta

    2004-01-01

    The microbial exposure associated with health complaints in moldy houses consists of a heterogeneous group of components, including both living and dead bacteria, fungi, and their metabolites and active compounds. However, little is known about the interactions between different microbes and their metabolites, although the cytotoxicity and inflammatory potential of certain individual microbes have been reported. In this study, we investigated the inflammatory responses of mouse RAW264.7 macrophages after exposure to six indoor air microbes (Aspergillus versicolor, Penicillium spinulosum, Stachybotrys chartarum, Bacillus cereus, Mycobacterium terrae, and Pseudomonas fluorescens) alone and together with the actinomycete Streptomyces californicus. The production of nitric oxide, levels of the proinflammatory cytokines tumor necrosis factor alpha (TNF-alpha) and interleukin-6 (IL-6), and cytotoxicity were measured. The coexposure to Sta. chartarum and Str. californicus caused a synergistic increase in the production of IL-6 but not other cytokines. In further experiments, the metabolites from Sta. chartarum or from closely related fungi (atranones B and E, satratoxin G, trichodermin, 7-alpha-hydroxytrichodermol, staplabin, and SMTP-7) and the known fungal toxins sterigmatocystin, citrinin, and ochratoxin A were each tested with Str. californicus. The testing revealed a synergistic response in TNF-alpha and IL-6 production after coexposure to Str. californicus with both trichodermin and 7-alpha-hydroxytrichodermol. Finally, the synergistic inflammatory response caused by Str. californicus and trichodermin together was studied by analyzing for the presence of nuclear factor-kappa-B (NF-kappa-B) in nuclear extracts of the exposed cells. The exposure to Str. californicus induced the binding of NF-kappa-B proteins to the NF-kappa-B consensus sequence as well as to the natural NF-kappa-B site of the IL-6 promoter. Adding trichodermin to the exposure did not increase the DNA

  19. ASSESSMENT OF STACHYBOTRYS REGROWTH ON CONTAMINATED WALLBOARD AFTER TREATMENT WITH COMMON SURFACE CLEANERS/DISINFECTANTS

    EPA Science Inventory

    The paper describes results of experiments assessing the efficacy of treating mold-contaminated gypsum wallboard with cleaners and/or disinfectants. Although the accepted recommendations for handling Stachybotrys chartarum contaminated gypsum wallboard are removal and replacement...

  20. STACHYBOTRYS CHARTARU Trichothecene Mycotoxins and Damp Building-Related Illness: New Insights into a Public Health Enigma

    EPA Science Inventory

    Damp building-related illnesses (DBRI) include a myriad of respiratory, immunologic, and neurologic symptoms that are sometimes etiologically linked to aberrant indoor growth of the toxic black mold, Stachybotrys chartarum. Although supportive evidence for such linkages is limite...

  1. Identification and Characterisation of a Novel Protein FIP-sch3 from Stachybotrys chartarum

    PubMed Central

    Li, Shuying; Zhao, Leiming; Xu, Wenyi; Jiang, Zhonghao; Kang, Jun; Wang, Fengzhong; Xin, Fengjiao

    2016-01-01

    In this study, a novel FIP named FIP-sch3 has been identified and characterised. FIP-sch3 was identified in the ascomycete Stachybotrys chartarum, making it the second FIP to be identified outside the order of Basidiomycota. Recombinant FIP-sch3 (rFIP-shc3) was produced in Escherichia coli and purified using GST-affinity magnetic beads. The bioactive characteristics of FIP-sch3 were compared to those of well-known FIPs LZ-8 from Ganoderma lucidum and FIP-fve from Flammulina velutipes, which were produced and purified using the same method. The purified rFIP-sch3 exhibited a broad spectrum of anti-tumour activity in several types of tumour cells but had no cytotoxicity in normal human embryonic kidney 293 cells. Assays that were implemented to study these properties indicated that rFIP-sch3 significantly suppressed cell proliferation, induced apoptosis and inhibited cell migration in human lung adenocarcinoma A549 cells. The anti-tumour effects of rFIP-sch3 in A549 cells were comparable to those of rLZ-8, but they were significantly greater than those of rFIP-fve. Molecular assays that were built on real-time PCR further revealed potential mechanisms related to apoptosis and migration and that underlie phenotypic effects. These results indicate that FIP-shc3 has a unique anti-tumour bioactive profile, as do other FIPs, which provide a foundation for further studies on anti-tumour mechanisms. Importantly, this study also had convenient access to FIP-sch3 with potential human therapeutic applications. PMID:27997578

  2. Biological Responses of Raw 264.7 Macrophage Exposed to Two Strains of Stachybotrys chartarum Spores Grown on Four Different Wallboard Types

    EPA Science Inventory

    The focus of this research was to provide a better understanding of the health impacts caused by Stachybotrys chartarum (Houston and 51-11) spores grown on four gypsum products two of which were resistant to microbes. Raw 264.7 cells were exposed to whole spores and fragmented 51...

  3. Co-cultivation of Streptomyces californicus and Stachybotrys chartarum stimulates the production of cytostatic compound(s) with immunotoxic properties

    SciTech Connect

    Penttinen, Piia . E-mail: Piia.Penttinen@ktl.fi; Pelkonen, Jukka; Huttunen, Kati; Hirvonen, Maija-Riitta

    2006-12-15

    We have recently shown that the actinobacterium Streptomyces californicus and the fungus Stachybotrys chartarum originating from moisture damaged buildings possess both immunotoxic and immunostimulatory characteristics, which are synergistically potentiated by microbial interaction. In the search for the causative agent(s) behind the immunotoxicity, the cytostatic effects of the co-cultivated spores of S. californicus and S. chartarum were compared to those caused by widely used cytostatic agents produced by streptomycetes. The RAW264.7 macrophages were exposed to four doses of doxorubicin (DOX), actinomycin D (AMD), mitomycin C (MMC) or phleomycin (PHLEO) for 24 h. Kinetics of the spores of the co-cultivated and the separately cultivated microbes (1 x 10{sup 6} spores/ml) was compared to DOX (0.15 {mu}M). Apoptotic responses were analyzed by measuring DNA content and mitochondria membrane depolarization with flow cytometer, and by the fluorometric caspase-3 assay. The present data indicate that interactions during co-cultivation of S. californicus and S. chartarum stimulate the production of an unidentified cytostatic compound(s) capable of inducing mitochondria mediated apoptosis and cell cycle arrest at S-G{sub 2}/M. The spores of co-cultivated microbes caused a 4-fold collapse of mitochondrial membrane potential and an almost 6-fold caspase-3 activation and DNA fragmentation when compared to control. Similar responses were induced by DNA cleaving compounds, especially DOX and AMD, at the relatively low concentrations, but not the spores of the same microbes when they were grown separately. These data suggest that when growing in the same habitat, interactions between S. californicus and S. chartarum stimulates the production of an unknown cytostatic compound(s) which evoke immunotoxic effects similar to those by chemotherapeutic drugs.

  4. Co-cultivation of Streptomyces californicus and Stachybotrys chartarum stimulates the production of cytostatic compound(s) with immunotoxic properties.

    PubMed

    Penttinen, Piia; Pelkonen, Jukka; Huttunen, Kati; Hirvonen, Maija-Riitta

    2006-12-15

    We have recently shown that the actinobacterium Streptomyces californicus and the fungus Stachybotrys chartarum originating from moisture damaged buildings possess both immunotoxic and immunostimulatory characteristics, which are synergistically potentiated by microbial interaction. In the search for the causative agent(s) behind the immunotoxicity, the cytostatic effects of the co-cultivated spores of S. californicus and S. chartarum were compared to those caused by widely used cytostatic agents produced by streptomycetes. The RAW264.7 macrophages were exposed to four doses of doxorubicin (DOX), actinomycin D (AMD), mitomycin C (MMC) or phleomycin (PHLEO) for 24 h. Kinetics of the spores of the co-cultivated and the separately cultivated microbes (1x10(6) spores/ml) was compared to DOX (0.15 muM). Apoptotic responses were analyzed by measuring DNA content and mitochondria membrane depolarization with flow cytometer, and by the fluorometric caspase-3 assay. The present data indicate that interactions during co-cultivation of S. californicus and S. chartarum stimulate the production of an unidentified cytostatic compound(s) capable of inducing mitochondria mediated apoptosis and cell cycle arrest at S-G(2)/M. The spores of co-cultivated microbes caused a 4-fold collapse of mitochondrial membrane potential and an almost 6-fold caspase-3 activation and DNA fragmentation when compared to control. Similar responses were induced by DNA cleaving compounds, especially DOX and AMD, at the relatively low concentrations, but not the spores of the same microbes when they were grown separately. These data suggest that when growing in the same habitat, interactions between S. californicus and S. chartarum stimulates the production of an unknown cytostatic compound(s) which evoke immunotoxic effects similar to those by chemotherapeutic drugs.

  5. FACTORS RELATING TO THE RELEASE OF STACHYBOTRYS CHARTARUM SPORES FROM CONTAMINATED SOURCES

    EPA Science Inventory

    The paper describes preliminary results of a research project to determine the factors that control the release of S. chartarum spores from a contaminated source and test ways to reduce spore release and thus exposure. As anticipated, S. chartarum spore emissions from gypsum boar...

  6. Microbial Volatile Organic Compound Emissions from Stachybotrys chartarum growing on Gypsum Wallboard and Ceiling tile

    EPA Science Inventory

    This study compared seven toxigenic strains of S. chartarum found in water-damaged buildings to characterize the microbial volatile organic compound (MVOC) emissions profile while growing on gypsum wallboard (W) and ceiling tile (C) coupons. The inoculated coupons with their sub...

  7. Laboratory research on the efficacy of chlorine dioxide fumigation for the remediation of mold-contaminated buildings--conference paper

    EPA Science Inventory

    The purpose of this project was to determine the efficacy ofCl02 fumigation to inactivate viable mold, mycotoxins, and allergens on building materials. Alternaria alternata, Aspergillus versicolor, Aspergillus Jumigatus, Chaetomium globosum, and Stachybotrys chartarum were indivi...

  8. Visualization of the structural changes in plywood and gypsum board during the growth of Chaetomium globosum and Stachybotrys chartarum.

    PubMed

    Lewinska, Anna M; Hoof, Jakob B; Peuhkuri, Ruut H; Rode, Carsten; Lilje, Osu; Foley, Matthew; Trimby, Patrick; Andersen, Birgitte

    2016-10-01

    Fungal growth in indoor environments is associated with many negative health effects. Many studies focus on brown- and white-rot fungi and their effect on wood, but there is none that reveals the influence of soft-rot fungi, such as Stachybotrys spp. and Chaetomium spp., on the structure of building materials such as plywood and gypsum wallboard. This study focuses on using micro-computed tomography (microCT) to investigate changes of the structure of plywood and gypsum wallboard during fungal degradation by S. chartarum and C. globosum. Changes in the materials as a result of dampness and fungal growth were determined by measuring porosity and pore shape via microCT. The results show that the composition of the building material influenced the level of penetration by fungi as shown by scanning electron microscopy (SEM). Plywood appeared to be the most affected, with the penetration of moisture and fungi throughout the whole thickness of the sample. Conversely, fungi grew only on the top cardboard in the gypsum wallboard and they did not have significant influence on the gypsum wallboard structure. The majority of the observed changes in gypsum wallboard occurred due to moisture. This paper suggests that the mycelium distribution within building materials and the structural changes, caused by dampness and fungal growth, depend on the type of the material.

  9. IMMUNOCYTOCHEMICAL LOCALIZATION OF STACHYLYSIN IN STACHYBOTRYS CHARTARUM SPORES AND SPORE-IMPACTED MOUSE AND RAT LUNG TISSUES

    EPA Science Inventory

    Stachylysin is a proteinaceous hemolytic agent that is producted by S. chartarum. Stachylysin was found, using immunohistochemistical and immunocytochemical methods, to be localized in S. chartarum spores/mycelia primarily in the inner wall suggesting that it is constitutively ...

  10. TESTING ANTIMICROBIAL PAINT EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Often mold contaminated building materials are not properly removed, some surface cleaning is performed and paint is applied in an attempt to alleviate the problem. The efficacy of antimicrobial paints to eliminate or control mold regrowth on surfaces can easily be tested on non-...

  11. TESTING ANTIMICROBIAL CLEANER EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Reducing occupant exposure to indoor mold growth is the goal of this research, through the efficacy testing of antimicrobial cleaners. Often mold contaminated building materials are not properly removed, but instead surface cleaners are applied in an attempt to alleviate the prob...

  12. Interactions between Streptomyces californicus and Stachybotrys chartarum can induce apoptosis and cell cycle arrest in mouse RAW264.7 macrophages

    SciTech Connect

    Penttinen, Piia . E-mail: Piia.Penttinen@ktl.fi; Pelkonen, Jukka; Huttunen, Kati; Toivola, Mika; Hirvonen, Maija-Riitta

    2005-02-01

    Exposure to complex mixtures of bacteria and fungi in moisture-damaged buildings is a potential cause of inflammatory related symptoms among occupants. The present study assessed interactions between two characteristic moldy house microbes Streptomyces californicus and Stachybotrys chartarum. Differences in cytotoxic and inflammatory responses in mouse (RAW264.7) macrophages were studied after exposure to the spores of co-cultivated microbes, the mixture of separately cultivated spores, and the spores of either of these microbes cultivated alone. The RAW264.7 cells were exposed to six doses (1 x 10{sup 4} to 3 x 10{sup 6} spores/ml) for 24 h, and the time course of the induced responses was evaluated after 4, 8, 16, and 24 h of exposure (1 x 10{sup 6} spores/ml). The cytotoxic potential of the spores was characterized by the MTT test, DNA content analysis, and enzyme assay for caspase-3 activity. The production of cytokines (IL-1{beta}, IL-6, IL-10, TNF{alpha}, and MIP2) was measured immunochemically and nitric oxide by the Griess method. Co-cultivation increased the ability of the spores to cause apoptosis by more than 4-fold and the proportion of RAW264.7 cells at the G{sub 2}/M stage increased nearly 2-fold when compared to the response induced by the mixture of spores. In contrast, co-cultivation decreased significantly the ability of the spores to trigger the production of NO and IL-6 in RAW264.7 cells. In conclusion, these data suggest that co-culture of S. californicus and S. chartarum can result in microbial interactions that significantly potentiate the ability of the spores to cause apoptosis and cell cycle arrest in mammalian cells.

  13. DNA damage, redox changes, and associated stress-inducible signaling events underlying the apoptosis and cytotoxicity in murine alveolar macrophage cell line MH-S by methanol-extracted Stachybotrys chartarum toxins

    SciTech Connect

    Wang Huiyan; Yadav, Jagjit S. . E-mail: Jagjit.Yadav@uc.edu

    2006-08-01

    Spore-extracted toxins of the indoor mold Stachybotrys chartarum (SC) caused cytotoxicity (release of lactate dehydrogenase), inhibition of cell proliferation, and cell death in murine alveolar macrophage cell line MH-S in a dose- and time-dependent manner. Apoptotic cell death, confirmed based on morphological changes, DNA ladder formation, and caspase 3/7 activation, was detectable as early as at 3 h during treatment with a toxin concentration of 1 spore equivalent/macrophage and was preceded by DNA damage beginning at 15 min, as evidenced by DNA comet formation in single cell gel electrophoresis assay. The apoptotic dose of SC toxins did not induce detectable nitric oxide and pro-inflammatory cytokines (IL-1{beta}, IL-6, and TNF-{alpha}) but showed exacerbated cytotoxicity in presence of a non-apoptotic dose of the known pro-inflammatory agent LPS (10 ng/ml). Intracellular reduced glutathione (GSH) level showed a significant decrease beginning at 9 h of the toxin treatment whereas oxidized glutathione (GSSG) showed a corresponding significant increase, indicating a delayed onset of oxidative stress in the apoptosis process. The toxin-treated macrophages accumulated p53, an indicator of DNA damage response, and showed activation of the stress-inducible MAP kinases, JNK, and p38, in a time-dependent manner. Chemical blocking of either p38 or p53 inhibited in part the SC toxin-induced apoptosis whereas blocking of JNK did not show any such effect. This study constitutes the first report on induction of DNA damage and associated p53 activation by SC toxins, and demonstrates the involvement of p38- and p53-mediated signaling events in SC toxin-induced apoptosis of alveolar macrophages.

  14. EMISSION EXPOSURE MODEL FOR TRANSPORT OF TOXIC MOLD

    EPA Science Inventory

    The paper presents the results of a study of the release of Stachybotrys chartarum spores from contaminated gypsum wallboard and of tests on the effects of environmental conditions on the release of viable and non-viable spores and fragments. Biocontaminants such as mold spores a...

  15. Production and characterization of IgM monoclonal antibodies against hyphal antigens of Stachybotrys species

    EPA Science Inventory

    Stachybotrys is a hydrophilic fungal genus that is well known for its ability to colonize water-damaged building materials in indoor environments. Personal exposure to Stachybotrys chartarum allergens, mycotoxins, cytolytic peptides, and other immunostimulatory macromolecules has...

  16. Mold infestation of wet spray-applied cellulose insulation.

    PubMed

    Godish, Thad J; Godish, Diana R

    2006-01-01

    Mold investigations were conducted in four buildings that had been insulated with wet spray-applied cellulose insulation (WSACI). Bulk WSACI samples were collected and analyzed by quantitative polymerase chain reaction (QPCR) methods. Airborne mold was evaluated using both Burkard total mold spore and Andersen culturable/viable sampling methods. Although reportedly treated with biocidal borates, QPCR analyses indicated that elevated concentrations of mold cells (reported as spore equivalents per gram) may be present in WSACI. QPCR analyses showed the following: (1) very high concentrations of Penicillium chrysogenum in samples from two of four buildings; (2) very high concentrations of Stachybotrys chartarum in samples from one building and a more moderate presence in a second; (3) moderately high concentrations of Aspergillus versicolor in samples from one building and more moderate concentrations in a second; (4) the presence of the opportunistic pathogen, Aspergillus fumigatus, in samples from three of the four buildings, and (5) the presence of 22 of 23 target mold species. Elevated airborne total mold spore concentrations were observed in all four of the buildings investigated. Culturable/viable airborne mold concentrations were moderately elevated in three of the four buildings. Mold genera/types present were relatively consistent among airborne mold samples collected by both methods and bulk sample analyses. Results of this study suggest that WSACI has the potential to cause elevated airborne mold levels in buildings where it has been applied and pose significant mold exposure and public health risks.

  17. Mass Spectrometry-Based Strategy for Direct Detection and Quantification of Some Mycotoxins Produced by Stachybotrys and Aspergillus spp. in Indoor Environments▿

    PubMed Central

    Bloom, Erica; Bal, Karol; Nyman, Eva; Must, Aime; Larsson, Lennart

    2007-01-01

    Dampness in buildings has been linked to adverse health effects, but the specific causative agents are unknown. Mycotoxins are secondary metabolites produced by molds and toxic to higher vertebrates. In this study, mass spectrometry was used to demonstrate the presence of mycotoxins predominantly produced by Aspergillus spp. and Stachybotrys spp. in buildings with either ongoing dampness or a history of water damage. Verrucarol and trichodermol, hydrolysis products of macrocyclic trichothecenes (including satratoxins), and trichodermin, predominately produced by Stachybotrys chartarum, were analyzed by gas chromatography-tandem mass spectrometry, whereas sterigmatocystin (mainly produced by Aspergillus versicolor), satratoxin G, and satratoxin H were analyzed by high-performance liquid chromatography-tandem mass spectrometry. These mycotoxin analytes were demonstrated in 45 of 62 building material samples studied, in three of eight settled dust samples, and in five of eight cultures of airborne dust samples. This is the first report on the use of tandem mass spectrometry for demonstrating mycotoxins in dust settled on surfaces above floor level in damp buildings. The direct detection of the highly toxic sterigmatocystin and macrocyclic trichothecene mycotoxins in indoor environments is important due to their potential health impacts. PMID:17483261

  18. Epidemics of mold poisoning past and present.

    PubMed

    Meggs, William J

    2009-01-01

    Molds are ubiquitous throughout the biosphere of planet earth and cause infectious, allergic, and toxic diseases. Toxic diseases arise from exposure to mycotoxins produced by molds. Throughout history, there have been a number of toxic epidemics associated with exposure to mycotoxins. Acute epidemics of ergotism are caused by consumption of grain infested by fungi of the genus Claviceps, which produce the bioactive amine ergotamine that mimics the neurotransmitters norepinephrine, serotonin, and dopamine. Acute aflatoxin outbreaks have occurred from ingestion of corn stored in damp conditions that potentiate growth of the molds of the species Aspergillus. Contemporary construction methods that use cellulose substrates such as fiber board and indoor moisture have caused an outbreak of contaminated buildings with Stachybotrys chartarum, with the extent of health effects still a subject of debate and ongoing research. This article reviews several of the more prominent epidemics and discusses the nature of the toxins. Two diseases that were leading causes of childhood mortality in England in the 1970s and vanished with changing dietary habits, putrid malignant fever, and slow nervous fever were most likely toxic mold epidemics.

  19. Mold remediation in a hospital.

    PubMed

    Lee, Tang G

    2009-01-01

    As occupants in a hospital, patients are susceptible to air contaminants that can include biological agents dispersed throughout the premise. An exposed patient can become ill and require medical intervention. A consideration for patients is that they may have become environmentally sensitive and require placement in an environment that does not compromise their health. Unfortunately, the hospital environment often contains more biological substances than can be expected in an office or home environment. When a hospital also experiences water intrusion such as flooding or water leaks, resulting mold growth can seriously compromise the health of patients and others such as nursing staff and physicians (Burge, Indoor Air and Infectious Disease. Occupational Medicine: State of the Art Reviews, 1980; Lutz et al., Clinical Infectious Diseases 37: 786-793, 2003). Micro-organism growth can propagate if the water is not addressed quickly and effectively. Immunocompromised patients are particularly at risk when subjected to fungal infection such that the US Center for Disease Control issued guideline for building mold in health care facilities (Centers for Disease and Control [CDC], Centers for Disease and Control: Questions and Answers on Stachybotrys chartarum and Other Molds, 2000). This paper is based on mold remediation of one portion of a hospital unit due to water from construction activity and inadequate maintenance, resulting in mold growth. A large proportion of the hospital staff, primarily nurses in the dialysis unit, exhibited health symptoms consistent with mold exposure. Unfortunately, the hospital administrators did not consider the mold risk to be serious and refused an independent consultant retained by the nurse's union to examine the premise (Canadian Broadcasting Corporation [CBC], Nurses file complaints over mold at Foothills. Canadian Broadcasting Corporation, 2003). The nurse's union managed to have the premise examined by submitting a court order of

  20. Environmental Mold and Mycotoxin Exposures Elicit Specific Cytokine and Chemokine Responses

    PubMed Central

    Rosenblum Lichtenstein, Jamie H.; Hsu, Yi-Hsiang; Gavin, Igor M.; Donaghey, Thomas C.; Molina, Ramon M.; Thompson, Khristy J.; Chi, Chih-Lin; Gillis, Bruce S.; Brain, Joseph D.

    2015-01-01

    Background Molds can cause respiratory symptoms and asthma. We sought to use isolated peripheral blood mononuclear cells (PBMCs) to understand changes in cytokine and chemokine levels in response to mold and mycotoxin exposures and to link these levels with respiratory symptoms in humans. We did this by utilizing an ex vivo assay approach to differentiate mold-exposed patients and unexposed controls. While circulating plasma chemokine and cytokine levels from these two groups might be similar, we hypothesized that by challenging their isolated white blood cells with mold or mold extracts, we would see a differential chemokine and cytokine release. Methods and Findings Peripheral blood mononuclear cells (PBMCs) were isolated from blood from 33 patients with a history of mold exposures and from 17 controls. Cultured PBMCs were incubated with the most prominent Stachybotrys chartarum mycotoxin, satratoxin G, or with aqueous mold extract, ionomycin, or media, each with or without PMA. Additional PBMCs were exposed to spores of Aspergillus niger, Cladosporium herbarum and Penicillium chrysogenum. After 18 hours, cytokines and chemokines released into the culture medium were measured by multiplex assay. Clinical histories, physical examinations and pulmonary function tests were also conducted. After ex vivo PBMC exposures to molds or mycotoxins, the chemokine and cytokine profiles from patients with a history of mold exposure were significantly different from those of unexposed controls. In contrast, biomarker profiles from cells exposed to media alone showed no difference between the patients and controls. Conclusions These findings demonstrate that chronic mold exposures induced changes in inflammatory and immune system responses to specific mold and mycotoxin challenges. These responses can differentiate mold-exposed patients from unexposed controls. This strategy may be a powerful approach to document immune system responsiveness to molds and other inflammation

  1. Molds

    MedlinePlus

    ... touching mold or mold spores may cause allergic reactions or asthma attacks in sensitive people. Molds can cause fungal infections. In addition, mold exposure may irritate your eyes, skin, nose, ...

  2. Potential of the volatile-producing fungus Muscodor albus for control of building molds.

    PubMed

    Mercier, Julien; Jiménez, Jorge I

    2007-03-01

    The possibility of using the volatile-producing fungus Muscodor albus for biofumigation against building molds was investigated. Several species of Aspergillus and Penicillium as well as fungi belonging to nine other genera were inhibited or killed in vitro by volatiles produced by potato dextrose agar or rye grain cultures of M. albus. Trichoderma viride was the only fungus that was not inhibited by M. albus volatiles. To test biofumigation as a preventative treatment against fungal colonization of building material, dry pieces of gypsum drywall were fumigated with grain cultures of M. albus in closed boxes. After a simulated water damage and incubation under saturated humidity for 2 weeks, untreated drywall developed natural fungal populations of about 10(5)-10(6) cfu/cm2, while drywall fumigated with M. albus culture (20 g/11 L) had nondetectable fungal populations. To test for curative ability, moist pieces of drywall heavily colonized with Cladosporium cladosporioides, Aspergillus niger, or Stachybotrys chartarum were fumigated for 48 h with grain cultures of M. albus. Cladosporium cladosporioides was eliminated within 48 h, while A. niger and S. chartarum were usually more resistant. However, a longer curative fumigation of 96 h was effective in reducing A. niger or naturally occurring mold populations by about 5 log values. The production of volatile organic compounds from 20 g of rye grain culture in 11 L containers was monitored by solid-phase micro extraction and gas chromatography. Concentrations of isobutyric acid, the most abundant volatile, increased gradually in the headspace until it reached 25 microg/L (m/v) within 96 h. The second and third most abundant compounds, 2-methyl-1-butanol and isobutanol, peaked at about 10 and 5 microg/L (m/v), respectively, within the first 24 h and declined gradually afterwards.

  3. Mold Allergy

    MedlinePlus

    ... Home ▸ Conditions & Treatments ▸ Allergies ▸ Mold Allergy Share | Mold Allergy Overview Symptoms & Diagnosis Treatment & Management Mold Allergy Overview Molds are tiny fungi whose spores float ...

  4. MOLDING APPARATUS

    DOEpatents

    Fleming, P.G.

    1963-10-01

    Molding apparatus capable of coating multiple elements each molding cycle is described. The apparatus comprises a centrally disposed reservoir penetrated by a plurality of circumferentially arranged and radially extending passageways. These passageways, in turn, communicate with passages in a separable annular member that retains selectively configured molds and mold seating arrangements. Each mold, which is readily removable from its respective seat, is adapted to retain an element therein in spaced relation to the interior of the mold by utilizing element positioning means within the mold seat and the mold so that coating material may flow about the entire outer surface of the element. (AEC)

  5. ELISA MEASUREMENT FOR STACHYLYSIN

    EPA Science Inventory

    The consumption of food commodities contaminated with the mold, Stachybotrys charatrum, has a long history of causing severe illness, and even death, in humans and animals. More recently, negative health effects have been linked to indoor inhalation exposures to S. chartarum. F...

  6. Prevalence and airborne spore levels of Stachybotrys spp. in 200 houses with water incursions in Houston, Texas.

    PubMed

    Kuhn, Ryan C; Trimble, Mingyi W; Hofer, Vasanthi; Lee, Michael; Nassof, Russell S

    2005-01-01

    Two hundred homes with a history of water incursion were sampled for fungi to determine the prevalence and airborne spore levels of Stachybotrys spp. Sampling methods included room air, surface, and wall cavity air sampling. Stachybotrys spp. were detected with at least one of the methods in 58.5% of the houses tested, but only 9.6% of the room air samples contained Stachybotrys spores. Aerosolization of Stachybotrys spores was correlated with both wall cavity and surface contamination. However, after adjustment for the surface effect, Stachybotrys spores detected in wall cavities were not a significant factor contributing to spores detected in room air samples. We conclude that Stachybotrys spp. are commonly found on water-damaged building materials. In addition, the observations made in this study suggest that the impact on the living space air is low if the fungal spores are contained within a wall cavity.

  7. The effect of spaceflight on growth of Ulocladium chartarum colonies on the international space station.

    PubMed

    Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

    2013-01-01

    The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions.

  8. The Effect of Spaceflight on Growth of Ulocladium chartarum Colonies on the International Space Station

    PubMed Central

    Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

    2013-01-01

    The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions. PMID:23637980

  9. DETECTION OF STACHYBOTRYS CHARTARUM USING rRNA, tri5, AND Β-TUBULIN PRIMERS AND DETERMINING THEIR RELATIVE COPY NUMBER BY REAL TIME PCR

    EPA Science Inventory

    This research utilizes the quantitative polymerase chain reaction (qPCR) to determine ribosomal copy number of fungal organisms found in unhealthy indoor environments. Knowing specific copy numbers will allow for greater accuracy in quantification when utilizing current pQCR tec...

  10. Mold Charlatans.

    ERIC Educational Resources Information Center

    Woody, Daniel

    2002-01-01

    Offers a primer on toxic mold and its removal, warning against ignorant or unethical mold remediation companies and offering five considerations (checking references, considering the big picture, sampling more than the air, considering release, and considering the source) when hiring such services. (EV)

  11. MOLD POLLUTION

    EPA Science Inventory

    Mold pollution is the growth of molds in a building resulting in a negative impact on the use of that structure. The negative impacts generally fall into two categories: destruction of the structure itself and adverse health impacts on the building's occupants. It is estimated...

  12. Identification of a Novel Fungus, Leptosphaerulina chartarum SJTU59 and Characterization of Its Xylanolytic Enzymes

    PubMed Central

    Wu, Qiong; Li, Yaqian; Li, Yingying; Gao, Shigang; Wang, Meng; Zhang, Tailong; Chen, Jie

    2013-01-01

    Xylanolytic enzymes are widely used in processing industries, e.g., pulp and paper, food, livestock feeds, and textile. Furthermore, certain xylanotic enzymes have demonstrated the capability to improve the resistance and immunity of plants. Screening of high-yield microbial xylanolytic enzyme producers is significant for improving large-scale cost-effective xylanolytic enzyme production. This study provided new evidence of high-level xylanolytic enzyme production by a novel fungus, designated Leptosphaerulina chartarum SJTU59. Under laboratory conditions, L. chartarum SJTU59 produced xylanolytic enzymes of up to 17.566 U/mL (i.e., 878.307 U/g substrate). The enzyme solution was relatively stable over a wide range of pH (pH 3.0 to pH 9.0) and temperature (40°C to 65°C) while showing high resistance to the majority of metal ions tested. Composition analysis of the hydrolytic products of xylan showed sufficient degradation by xylanolytic enzymes from L. chartarum SJTU59, mainly the monosaccharide xylose, and a small amount of xylobiose were enzymatically produced; whereas in the presence of sufficient xylan substrates, mainly xylooligosaccharides, an emerging prebiotic used in food industry, were produced. In addition, the xylanolytic enzyme preparation from L. chartarum SJTU59 could initiate tissue necrosis and oxidative burst in tobacco leaves, which may be related to enhanced plant defense to adversity and disease. L. chartarum SJTU59 possessed a complex xylanolytic enzyme system, from which two novel endo-β-1,4-xylanases of the glycoside hydrolase (GH) family 10, one novel endo-β-1,4-xylanase of the GH family 11, and one novel β-xylosidase of the GH family 43 were obtained via rapid amplification of complementary DNA ends. Given the high yield and stable properties of xylanolytic enzymes produced by L. chartarum SJTU59, future studies will be conducted to characterize the properties of individual xylanolytic enzymes from L. chartarum SJTU59. xylanolytic

  13. Mold Allergy

    MedlinePlus

    ... Reduce Mold in Your Whole House: Use an electric dehumidifier to remove moisture and keep humidity in ... Find a Local Support Group Join Our Action Network Kids With Food Allergies AAFA Research Grants Health ...

  14. An investigation into techniques for cleaning mold-contaminated home contents.

    PubMed

    Wilson, S C; Brasel, T L; Carriker, C G; Fortenberry, G D; Fogle, M R; Martin, J M; Wu, C; Andriychuk, L A; Karunasena, E; Straus, D C

    2004-07-01

    This study examined the efficacy of the following treatments to reduce selected fungal spore and mycotoxin levels on materials commonly found in home contents: (1) gamma irradiation at a 10-13 kiloGray exposure, (2) a detergent/bleach wash, and (3) a steam cleaning technique. A minimum of six replicates were performed per treatment. Paper, cloth, wood, and carpet were inoculated with either fungal spores (Stachybotrys chartarum, Aspergillus niger, Penicillium chrysogenum, or Chaetomium globosum) at 240,000 spores/2.54 cm2 of material or with the mycotoxins roridin A, T-2, and verrucarin A at 10 microg per 2.54 cm2 of material. Treatments were evaluated with an agar plating technique for fungal spores and a yeast toxicity culture assay for mycotoxins. Results showed that gamma irradiation inactivated fungal spores, but the treatment was not successful in inactivating mycotoxins. The washing technique completely inactivated or removed spores on all materials except for C. globosum, which was reduced on all items except paper (p < 0.05). Washing inactivated all mycotoxins on paper and cloth but not on carpet or untreated wood (p < 0.001). The steam cleaning treatment did not completely eliminate any fungal spores; however, it reduced P. chrysogenum numbers on all materials, C. globosum was reduced on wood and carpet, and S. chartarum was reduced on wood (p < 0.05). Steam cleaning was unsuccessful in inactivating any of the tested mycotoxins. These results show that the bleach/detergent washing technique was more effective overall in reducing spore and mycotoxin levels than gamma irradiation or steam cleaning. However, the other examined techniques were successful in varying degrees.

  15. Mold and Health

    EPA Pesticide Factsheets

    Molds have the potential to cause health problems. Molds produce allergens (substances that can cause allergic reactions) and irritants. Inhaling or touching mold or mold spores may cause allergic reactions in sensitive individuals.

  16. INGOT MOLD

    DOEpatents

    Mangold, A.J. Jr.; MaHaffey, J.W.; Reese, S.L.

    1958-04-29

    An improved ingot-mold assembly is described, consisting of a body having a cavity and a recess extending through to the bottom of the body from the cavity, and the bottom of the cavity having an internal shoulder extending downward and a plug having an external shoulder. The plug extends above the shoulders and below the bottom of the body.

  17. Floods and Mold Growth

    EPA Pesticide Factsheets

    Mold growth may be a problem after flooding. Excess moisture in the home is cause for concern about indoor air quality primarily because it provides breeding conditions for pests, molds and other microorganisms.

  18. QUANTIFYING INDOOR MOLDS

    EPA Science Inventory

    There is growing awareness that indoor molds/fungi may be connected to such conditions as asthma, allergies, hemorrhaging, chronic rhinosinusitis, memory loss, and a symptom complex called sick-building-syndrome. In addition, molds cause frequently fatal nosocomical infections. ...

  19. Mold and Children's Health.

    ERIC Educational Resources Information Center

    Tuscano, Antoinette

    1998-01-01

    Mold can seriously affect the health of children with asthma or allergies. Indoor air problems related to mold can be difficult to identify, but when several students who spend time in the same classroom area show allergic symptoms, it is important to consider mold and air quality. Failure to respond promptly can have serious consequences. (SM)

  20. Interactive Mold House Tour

    EPA Pesticide Factsheets

    Get a quick glimpse of some of the most important ways to protect your home from mold by this interactive tour of the Mold House. Room-by-room, you'll learn about common mold issues and how to address them.

  1. Bleach Neutralizes Mold Allergens

    ERIC Educational Resources Information Center

    Science Teacher, 2005

    2005-01-01

    Researchers at National Jewish Medical and Research Center have demonstrated that dilute bleach not only kills common household mold, but may also neutralize the mold allergens that cause most mold-related health complaints. The study, published in the Journal of Allergy and Clinical Immunology, is the first to test the effect on allergic…

  2. Mold-Resistant Construction.

    ERIC Educational Resources Information Center

    Huckabee, Christopher

    2003-01-01

    Asserts that one of the surest ways to prevent indoor air quality and mold issues is to use preventive construction materials, discussing typical resistance to dealing with mold problems (usually budget-related) and describing mold-resistant construction, which uses concrete masonry, brick, and stone and is intended to withstand inevitable…

  3. Laboratory experiments on membrane filter sampling of airborne mycotoxins produced by Stachybotrys atra corda

    NASA Astrophysics Data System (ADS)

    Pasanen, A.-L.; Nikulin, M.; Tuomainen, M.; Berg, S.; Parikka, P.; Hintikka, E.-L.

    A membrane filter method for sampling of airborne stachybotrystoxins was studied in the laboratory. Toxigenic strains of Stachybotrys atra on wallpaper, grain, hay and straw were used as toxin sources in the experiments. Air samples were collected on cellulose nitrate and polycarbonate membrane filters at air flow rates of 10-20 ℓ min -1. After the filter sampling, the air was passed through methanol. The results showed that stachybotrystoxins (trichothecenes) were concentrated in airborne fungal propagules, and thus can be collected on filters. Polycarbonate filters with a pore size of 0.2 μm collected the highest percentage of toxic samples. The laboratory experiments indicated that polycarbonate filter sampling for the collection of airborne mycotoxins is a promising method for extension to field measurements.

  4. Immunotherapy for mold allergy.

    PubMed

    Coop, Christopher A

    2014-12-01

    The objective of this article is to review the available studies regarding mold immunotherapy. A literature search was conducted in MEDLINE to identify peer-reviewed articles related to mold immunotherapy using the following keywords: mold, allergy, asthma, and immunotherapy. In addition, references cited within these articles were also reviewed. Articles were selected based on their relevance to the topic. Allergic responses to inhaled mold antigens are a recognized factor in allergic rhinitis and asthma. There are significant problems with respect to the production of relevant allergen material for the diagnosis and treatment of mold allergy with immunotherapy. Mold allergens contain proteases and should not be mixed with other allergens for immunotherapy. Most of the immunotherapy studies focus on two molds, Alternaria and Cladosporium. There is a lack of randomized placebo-controlled trials when evaluating the efficacy of mold immunotherapy with trials only focusing on immunotherapy to Alternaria and Cladosporium. Additional studies are needed regarding mold allergy and immunotherapy focusing on which molds are important for causing allergic disease.

  5. Investigations on hydrolytic activities from Stachybotrys microspora and their use as an alternative in yeast DNA extraction.

    PubMed

    Abdeljalil, Salma; Ben Hmad, Ines; Saibi, Walid; Amouri, Bahia; Maalej, Wiem; Kaaniche, Marwa; Koubaa, Aida; Gargouri, Ali

    2014-02-01

    Stachybotrys microspora is a filamentous fungus characterized by the secretion of multiple hydrolytic activities (cellulolytic and non-cellulolytic enzymes). The production of these biocatalysts was studied under submerged culture using glucose, cellulose, and wheat bran as carbon sources. Endoglucanases, pectinases, xylanases, β-glucanases, chitinases, and proteases were induced on cellulose-based medium and repressed on glucose in both strains with higher amounts produced by the mutant. β-glucosidases were roughly equally produced by both strains under glucose and cellulose conditions. The yield of chitinases, β-glucanases, and proteases produced by Stachybotrys strains was as much higher than the commercialized lysing enzyme called "zymolyase," currently used in yeast DNA extraction. In this context, we showed that S. microspora hydrolases can be successfully applied in the extraction of yeast DNA.

  6. 53. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    53. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL MOLDS IN THE MORAVIAN POTTERY AND TILE WORKS COLLECTION, AND ARE USED TO PRESS TILES. THE FACTORY KEEPS TEN PRODUCTION MOLDS FOR EACH IMAGE. THE ORIGINAL MOLDS ARE NOT USED IN PRODUCTION. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  7. Molded Magnetic Article

    NASA Technical Reports Server (NTRS)

    Bryant, Robert G. (Inventor); Namkung, Min (Inventor); Wincheski, Russell A. (Inventor); Fulton, James P. (Inventor); Fox, Robert L. (Inventor)

    2000-01-01

    A molded magnetic article and fabrication method are provided. Particles of ferromagnetic material embedded in a polymer binder are molded under heat and pressure into a geometric shape. Each particle is an oblate spheroid having a radius-to-thickness aspect ratio approximately in the range of 15-30. Each oblate spheroid has flattened poles that are substantially in perpendicular alignment to a direction of the molding pressure throughout the geometric shape.

  8. Guide to Molds at School.

    ERIC Educational Resources Information Center

    Healthy Schools Network, Inc., Albany, NY.

    Asserting that molds growing in schools can be harmful to children's health and learning, this guide offers information about the issue. It provides an overview of the basics, then addresses testing, types of molds, molds and health, monitoring schools for mold, mold prevention and clean-up tips for schools, and what parents should do if they…

  9. BRITISH MOLDING MACHINE, PBQ AUTOMATIC COPE AND DRAG MOLDING MACHINE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    BRITISH MOLDING MACHINE, PBQ AUTOMATIC COPE AND DRAG MOLDING MACHINE MAKES BOTH MOLD HALVES INDIVIDUALLY WHICH ARE LATER ROTATED, ASSEMBLED, AND LOWERED TO POURING CONVEYORS BY ASSISTING MACHINES. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  10. Mold Allergy: Proper Humidifier Care

    MedlinePlus

    ... Training Home Conditions Allergy Allergy: Overview Allergy: Allergens Mold Allergy Proper Humidifier Care Proper Humidifier Care Make ... neglected humidifier can be a major source of mold and mold spores. Learn how to keep a ...

  11. Rapid mold replication

    SciTech Connect

    Heestand, G.M.; Beeler, R.G. Jr.; Brown, D.L.

    1995-06-01

    The desire to reduce tooling costs have driven manufacturers to investigate new manufacturing methods and materials. In the plastics injection molding industry replicating molds to meet production needs is time consuming (up to 6 months) and costly in terms of lost business. We have recently completed a feasibility study demonstrating the capability of high rate Electron Beam Physical Vapor Deposition (EBPVD) in producing mold inserts in days, not months. In the current practice a graphite mandrel, in the shape of the insert`s negative image, was exposed to a jet of metal vapor atoms emanating from an electron beam heated source of an aluminum-bronze alloy. The condensation rate of the metal atoms on the mandrel was sufficient to allow the deposit to grow at over 30 {mu}m/min or 1.2 mils per minute. The vaporization process continued for approximately 14 hours after which the mandrel and deposit were removed from the EBPVD vacuum chamber. The mandrel and condensate were easily separated resulting in a fully dense aluminum-bronze mold insert about 2.5 cm or one inch thick. This mold was subsequently cleaned and drilled for water cooling passages and mounted on a fixture for operation in an actual injection molding machine. Results of the mold`s operation were extremely successful showing great promise for this technique. This paper describes the EBPVD feasibility demonstration in more detail and discusses future development work needed to bring this technique into practice.

  12. Phenolic Molding Compounds

    NASA Astrophysics Data System (ADS)

    Koizumi, Koji; Charles, Ted; de Keyser, Hendrik

    Phenolic Molding Compounds continue to exhibit well balanced properties such as heat resistance, chemical resistance, dimensional stability, and creep resistance. They are widely applied in electrical, appliance, small engine, commutator, and automotive applications. As the focus of the automotive industry is weight reduction for greater fuel efficiency, phenolic molding compounds become appealing alternatives to metals. Current market volumes and trends, formulation components and its impact on properties, and a review of common manufacturing methods are presented. Molding processes as well as unique advanced techniques such as high temperature molding, live sprue, and injection/compression technique provide additional benefits in improving the performance characterisitics of phenolic molding compounds. Of special interest are descriptions of some of the latest innovations in automotive components, such as the phenolic intake manifold and valve block for dual clutch transmissions. The chapter also characterizes the most recent developments in new materials, including long glass phenolic molding compounds and carbon fiber reinforced phenolic molding compounds exhibiting a 10-20-fold increase in Charpy impact strength when compared to short fiber filled materials. The role of fatigue testing and fatigue fracture behavior presents some insight into long-term reliability and durability of glass-filled phenolic molding compounds. A section on new technology outlines the important factors to consider in modeling phenolic parts by finite element analysis and flow simulation.

  13. Mold design with simulation for chalcogenide glass precision molding

    NASA Astrophysics Data System (ADS)

    Zhang, Yunlong; Wang, Zhibin; Li, Junqi; Zhang, Feng; Su, Ying; Wang, Zhongqiang

    2016-10-01

    Compare with the manufacturing of the traditional infrared material, such as signal crystal germanium, zinc sulfide, zinc selenide etc, chalcogenide infrared glass is suitable for precision molding for the low soften temperature to have large mass industry production. So the researches of precision glass molding are necessary, especially for the fast development of infrared product. The mold design is one of the key technologies of precision glass molding. In this paper, the mold processing of a sample chalcogenide glass from the technical drawing, mold design, molding to the lens are introduced. From the result of the precision molding, the technology of finite element simulation is a useful way to guiding the mold design. The molded lens by using mold process fit the design requirement.

  14. Silicon micro-mold

    DOEpatents

    Morales, Alfredo M.

    2006-10-24

    The present invention describes a method for rapidly fabricating a robust 3-dimensional silicon-mold for use in preparing complex metal micro-components. The process begins by depositing a conductive metal layer onto one surface of a silicon wafer. A thin photoresist and a standard lithographic mask are then used to transfer a trace image pattern onto the opposite surface of the wafer by exposing and developing the resist. The exposed portion of the silicon substrate is anisotropically etched through the wafer thickness down to conductive metal layer to provide an etched pattern consisting of a series of rectilinear channels and recesses in the silicon which serve as the silicon micro-mold. Microcomponents are prepared with this mold by first filling the mold channels and recesses with a metal deposit, typically by electroplating, and then removing the silicon micro-mold by chemical etching.

  15. Glass molding process with mold lubrication

    DOEpatents

    Davey, Richard G.

    1978-06-27

    Improvements are provided in glass forming processes of the type wherein hot metal blank molds are employed by using the complementary action of a solid film lubricant layer, of graphite dispersed in a cured thermoset organopolysiloxane, along with an overspray of a lubricating oil.

  16. Airborne Mold and Endotoxin Concentrations in New Orleans, Louisiana, after Flooding, October through November 2005

    PubMed Central

    Solomon, Gina M.; Hjelmroos-Koski, Mervi; Rotkin-Ellman, Miriam; Hammond, S. Katharine

    2006-01-01

    Background The hurricanes and flooding in New Orleans, Louisiana, in October and November 2005 resulted in damp conditions favorable to the dispersion of bioaerosols such as mold spores and endotoxin. Objective Our objective in this study was to assess potential human exposure to bioaerosols in New Orleans after the flooding of the city. Methods A team of investigators performed continuous airborne sampling for mold spores and endotoxin outdoors in flooded and nonflooded areas, and inside homes that had undergone various levels of remediation, for periods of 5–24 hr during the 2 months after the flooding. Results The estimated 24-hr mold concentrations ranged from 21,000 to 102,000 spores/m3 in outdoor air and from 11,000 to 645,000 spores/m3 in indoor air. The mean outdoor spore concentration in flooded areas was roughly double the concentration in nonflooded areas (66,167 vs. 33,179 spores/m3; p < 0.05). The highest concentrations were inside homes. The most common mold species were from the genera of Cladosporium and Aspergillus/Penicillium; Stachybotrys was detected in some indoor samples. The airborne endotoxin concentrations ranged from 0.6 to 8.3 EU (endo-toxin units)/m3 but did not vary with flooded status or between indoor and outdoor environments. Conclusions The high concentration of mold measured indoors and outdoors in the New Orleans area is likely to be a significant respiratory hazard that should be monitored over time. Workers and returning residents should use appropriate personal protective equipment and exposure mitigation techniques to prevent respiratory morbidity and long-term health effects. PMID:16966092

  17. Resin film infusion mold tooling and molding method

    NASA Technical Reports Server (NTRS)

    Burgess, Roger (Inventor); Grossheim, Brian (Inventor); Mouradian, Karbis (Inventor); Thrash, Patrick J. (Inventor)

    1999-01-01

    A mold apparatus and method for resin film infusion molding including an outer mold tool having a facing sheet adapted to support a resin film and preform assembly. The facing sheet includes attachment features extending therefrom. An inner mold tool is positioned on the facing sheet to enclose the resin film and preform assembly for resin film infusion molding. The inner mold tool includes a plurality of mandrels positioned for engagement with the resin film and preform assembly. Each mandrel includes a slot formed therein. A plurality of locating bars cooperate with the slots and with the attachment features for locating the mandrels longitudinally on the outer mold tool.

  18. 92. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    92. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL MOLDS IN THE MORAVIAN POTTERY AND TILE WORKS COLLECTION, AND ARE USED TO PRESS TILES. THE FACTORY KEEPS TEN PRODUCTION MOLDS FOR EACH IMAGE. THE ORIGINAL MOLDS ARE NOT USED IN PRODUCTION. SAME VIEW AS PA-107-53. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  19. Molds in the Environment

    MedlinePlus

    ... Issues Resources Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New National Center for Environmental ... issued additional guidance, the WHO Guidelines for Indoor Air Quality: Dampness and Mould [PDF – 2.52 MB] . Other ...

  20. Mold: Cleanup and Remediation

    MedlinePlus

    ... Issues Resources Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New National Center for Environmental ... prevention ... more Fact Sheet: Flood Cleanup - Avoiding Indoor Air Quality Problems Flooding in a home or building can ...

  1. Breaking the Mold.

    ERIC Educational Resources Information Center

    Huckabee, Christopher

    2003-01-01

    Using the example of a Texas elementary school, describes how to eliminate mold and mildew from school facilities, including discovering the problem, responding quickly, reconstructing the area, and crisis planning and prevention. (EV)

  2. Newborn head molding

    MedlinePlus

    ... molding. In: Graham JM, Sanchez-Lara PA, eds. Smiths' Recognizable Patterns of Human Deformation . 4th ed. Philadelphia, PA: Elsevier; 2016:chap 35. Smith J. Initial evaluation. In: Gleason CA, Devaskar SU, ...

  3. Mold After a Disaster

    MedlinePlus

    ... ceiling tiles, insulation material, some clothing, leather, paper, wood, and food. Removal and cleaning are important because ... wish to disinfect, refer to the U.S. Environmental Protection Agency (EPA) document, A Brief Guide to Mold ...

  4. Allergies, asthma, and molds

    MedlinePlus

    ... furnace and air conditioner filters often. Use high efficiency particulate air (HEPA) filters to best remove mold from the air. In the bathroom: Use an exhaust fan when you shower or take baths. Use a ...

  5. MOLDS FOR CASTING PLUTONIUM

    DOEpatents

    Anderson, J.W.; Miley, F.; Pritchard, W.C.

    1962-02-27

    A coated mold for casting plutonium comprises a mold base portion of a material which remains solid and stable at temperatures as high as the pouring temperature of the metal to be cast and having a thin coating of the order of 0.005 inch thick on the interior thereof. The coating is composed of finely divided calcium fluoride having a particle size of about 149 microns. (AEC)

  6. FILLING MOLDS MADE ON THE BRITISH MOLDING MACHINE, AUTOMATIC COPE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    FILLING MOLDS MADE ON THE BRITISH MOLDING MACHINE, AUTOMATIC COPE AND DRAG (BMM) FROM MOBILE LADLE. EMPTY BULL LADLE IN FOREGROUND. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  7. TENDING THE MOLD, DURING THE TRANSFER FROM TUNDISH TO MOLD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    TENDING THE MOLD, DURING THE TRANSFER FROM TUNDISH TO MOLD TO CONTAINMENT CHAMBER IS CONTINUOUS CASTING OPERATOR, CALVIN ANDERS. - U.S. Steel, Fairfield Works, Continuous Caster, Fairfield, Jefferson County, AL

  8. Pressure molding of powdered materials improved by rubber mold insert

    NASA Technical Reports Server (NTRS)

    1964-01-01

    Pressure molding tungsten microspheres is accomplished by applying hydraulic pressure to a silicone rubber mold insert with several barrel shaped chambers which is placed in a steel die cavity. This technique eliminates castings containing shear fractures.

  9. Molding process for imidazopyrrolone polymers

    NASA Technical Reports Server (NTRS)

    Johnson, C. L. (Inventor)

    1973-01-01

    A process is described for producing shaped articles of imidazopyrrolone polymers comprising molding imidazopyrrolone polymer molding power under pressure and at a temperature greater than 475 C. Moderate pressures may be employed. Preferably, prior to molding, a preform is prepared by isostatic compression. The preform may be molded at a relatively low initial pressure and temperature; as the temperature is increased to a value greater than 475 C., the pressure is also increased.

  10. REFRACTORY COATING FOR GRAPHITE MOLDS

    DOEpatents

    Stoddard, S.D.

    1958-06-24

    Refractory coating for graphite molds used in the casting of uranium is described. The coating is an alumino-silicate refractory composition which may be used as a mold surface in solid form or as a coating applied to the graphite mold. The composition consists of a mixture of ball clay, kaolin, alumina cement, alumina, water, sodium silicate, and sodium carbonate.

  11. High Cost/High Risk Components to Chalcogenide Molded Lens Model: Molding Preforms and Mold Technology

    SciTech Connect

    Bernacki, Bruce E.

    2012-10-05

    This brief report contains a critique of two key components of FiveFocal's cost model for glass compression molding of chalcogenide lenses for infrared applications. Molding preforms and mold technology have the greatest influence on the ultimate cost of the product and help determine the volumes needed to select glass molding over conventional single-point diamond turning or grinding and polishing. This brief report highlights key areas of both technologies with recommendations for further study.

  12. World Allergy Organization Study on Aerobiology for Creating First Pollen and Mold Calendar With Clinical Significance in Islamabad, Pakistan; A Project of World Allergy Organization and Pakistan Allergy, Asthma & Clinical Immunology Centre of Islamabad

    PubMed Central

    2012-01-01

    Pollen and mold allergies are highly problematic in Islamabad. This study was conducted to investigate the type and concentration of airborne pollens/molds causing allergic diseases in susceptible individuals. A volumetric spore trap (Burkard) was placed at the height of 11 m and ran continuously for 3 years. Once a week, the collecting drum was prepared by affixing Melinex tape with a double sided adhesive that was coated with a thin layer of silicone grease. Every Sunday at 9:00 AM the drum was replaced by another drum and the pollen/mold spores were removed and permanently mounted on slides. Using a microscope, the trapped particles were identified and recorded as counts per cubic meter of air per hour. From these data, the pollen and mold calendars were constructed and expressed as counts per cubic meter of air per day. Skin prick tests were performed on more than 1000 patients attending the Pakistan Allergy, Asthma & Clinical Immunology Centre of Islamabad. The results indicated that there were 2 main pollen plants that contributed to seasonal allergies. These were Broussonetia papyrifera and Cannabis sativa during the March/April season and the July/September season, respectively. Although mold spores were continuously detected throughout the year, the most prominent mold was undetected mold and unconfirmed mold species similar to Stachybotrys species, which was high from July to September/October. Two additional molds contributing to allergic reactions were Pithomyces species and Cladosporium species, which were active during January and April, with the latter also being detected between October and November. These results may prove beneficial to both patients and physicians in planning a therapeutic protocol for avoidance and amelioration. PMID:23283209

  13. Effect of Chlorine Dioxide Gas on Fungi and Mycotoxins Associated with Sick Building Syndrome

    PubMed Central

    Wilson, S. C.; Wu, C.; Andriychuk, L. A.; Martin, J. M.; Brasel, T. L.; Jumper, C. A.; Straus, D. C.

    2005-01-01

    The growth of indoor molds and their resulting products (e.g., spores and mycotoxins) can present health hazards for human beings. The efficacy of chlorine dioxide gas as a fumigation treatment for inactivating sick building syndrome-related fungi and their mycotoxins was evaluated. Filter papers (15 per organism) featuring growth of Stachybotrys chartarum, Chaetomium globosum, Penicillium chrysogenum, and Cladosporium cladosporioides were placed in gas chambers containing chlorine dioxide gas at either 500 or 1,000 ppm for 24 h. C. globosum was exposed to the gas both as colonies and as ascospores without asci and perithecia. After treatment, all organisms were tested for colony growth using an agar plating technique. Colonies of S. chartarum were also tested for toxicity using a yeast toxicity assay with a high specificity for trichothecene mycotoxins. Results showed that chlorine dioxide gas at both concentrations completely inactivated all organisms except for C. globosum colonies which were inactivated an average of 89%. More than 99% of ascospores of C. globosum were nonculturable. For all ascospore counts, mean test readings were lower than the controls (P < 0.001), indicating that some ascospores may also have been destroyed. Colonies of S. chartarum were still toxic after treatment. These data show that chlorine dioxide gas can be effective to a degree as a fumigant for the inactivation of certain fungal colonies, that the perithecia of C. globosum can play a slightly protective role for the ascospores and that S. chartarum, while affected by the fumigation treatment, still remains toxic. PMID:16151130

  14. Fabrication of Molded Magnetic Article

    NASA Technical Reports Server (NTRS)

    Bryant, Robert G. (Inventor); Namkung, Min (Inventor); Wincheski, Russell A. (Inventor); Fox, Robert L. (Inventor)

    2001-01-01

    A molded magnetic article and fabrication method are provided. Particles of ferromagnetic material embedded in a polymer binder are molded under heat and pressure into a geometric shape. Each particle is an oblate spheroid having a radius-to-thickness aspect ratio approximately in the range of 15-30. Each oblate spheroid has flattened poles that are substantially in perpendicular alignment to a direction of the molding pressure throughout the geometric shape.

  15. Method for molding ceramic powders

    DOEpatents

    Janney, M.A.

    1990-01-16

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, where after the product may be sintered.

  16. Method for molding ceramic powders

    DOEpatents

    Janney, Mark A.

    1990-01-01

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, whereafter the product may be sintered.

  17. A RAPID METHOD FOR THE EXTRACTION OF FUNGAL DNA FROM ENVIRONMENTAL SAMPLES: EVALUATION IN THE QUANTITATIVE ANALYSIS OF MEMNONIELLA ECHINATA CONIDIA USING REAL TIME DETECTION OF PCR PRODUCTS

    EPA Science Inventory

    New technologies are creating the potential for using nucleic acid sequence detection to perform routine microbiological analyses of environmental samples. Our laboratory has recently reported on the development of a method for the quantitative detection of Stachybotrys chartarum...

  18. 8. VIEW OF A MOLD FOR PRECISION CASTING. THE MOLD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. VIEW OF A MOLD FOR PRECISION CASTING. THE MOLD WAS USED IN FOUNDRY OPERATIONS THAT CAST PLUTONIUM EITHER AS INGOTS SUITABLE FOR ROLLING AND FURTHER WROUGHT PROCESSING OR INTO SHAPES AMENABLE TO DIRECT MACHINING OPERATIONS. (5/6/59) - Rocky Flats Plant, Plutonium Fabrication, Central section of Plant, Golden, Jefferson County, CO

  19. MOLD SPECIFIC QUANTITATIVE PCR: THE EMERGING STANDARD IN MOLD ANALYSIS

    EPA Science Inventory

    Today I will talk about the use of quantitative or Real time PCR for the standardized identification and quantification of molds. There are probably at least 100,000 species of molds or fungi. But there are actually about 100 typically found indoors. Some pose a threat to human...

  20. Mold Materials For Permanent Molding of Aluminum Alloys

    SciTech Connect

    John F Wallace; David Schwam; Wen Hong dxs11@po.cwru.edu

    2001-09-14

    A test that involves immersion of the potential mod materials for permanent molds has been developed that provides a thermal cycle that is similar to the experienced during casting of aluminum in permanent molds. This test has been employed to determine the relative thermal fatigue resistance of several different types of mold materials. Four commercial mold coatings have been evaluated for their insulating ability, wear resistance and roughness. The results indicate that composition and structure of the mold materials have considerable effect on their thermal fatigue cracking behavior. Irons with a gray iron structure are the most prone to thermal fatigue cracking followed by compacted graphite irons with the least thermal fatigue cracking of the cast irons experienced by ductile iron. The composition of these various irons affects their behavior.

  1. INDOOR MOLDS AND ALLERGIC POTENTIAL

    EPA Science Inventory

    Rationale: Damp/moldy environments have been associated with asthma exacerbation, but mold¿s role in allergic asthma induction is less clear. Recently, 5 molds were statistically associated with water-damaged asthmatic homes in the Cleveland area. The asthma exacerbation...

  2. Twistable mold for helicopter blades

    NASA Technical Reports Server (NTRS)

    Carter, E. S.; Kiely, E. F.

    1972-01-01

    Design is described of mold for fabrication of blades composed of sets of aerodynamic shells having same airfoil section characteristics but different distributions. Mold consists of opposing stacks of thin templates held together by long bolts. When bolts are loosened, templates can be set at different positions with respect to each other and then locked in place.

  3. INJECTION-MOLDING APPARATUS

    DOEpatents

    Lobell, G.M.

    1958-02-11

    This patent is drawn to an injection molding apparatus for producing a tube closed at one end wherein the normally unsupported end of the core located in the cavity during the injection of the molten material to fill the space between the core and cavity wall, which supporting means is automatically removed from operation during the forming of the closed end of the tube. This support means is a plug extending through the end of the core into a recess in the bottom of the cavity where the closed end of the tube is to be formed. The plug is spring pressed into said recess and is forced out of the recess by a slidable bushing at the top of the cavity which is moved against the force of the spring by the molten material when it fills the uppormost open end portion of the cavity, thereby permitting the closed end of the tube to be formed.

  4. Isolation of mycoparasitic-related transcripts by SSH during interaction of the mycoparasite Stachybotrys elegans with its host Rhizoctonia solani.

    PubMed

    Morissette, Danielle C; Dauch, Amélie; Beech, Robin; Masson, Luke; Brousseau, Roland; Jabaji-Hare, Suha

    2008-02-01

    Mycoparasitism by antagonistic fungi involves changes in the biochemistry and physiology of both partners. Analysis of genes that are expressed during mycoparasite-host interaction represents a powerful strategy to obtain insight into the molecular events underlying these changes. The aim of this study is to identify genes whose expression is upregulated when the mycoparasite Stachybotrys elegans is in direct confrontation with its host Rhizoctonia solani. Suppression subtractive hybridization (SSH) was used to create a subtracted cDNA library, and differential screening was applied to identify the over-expressed transcripts. We report the analysis of 2,166 clones, among which 47% were upregulated during mycoparasitism. Two hundred and sixty-one clones were sequenced that corresponded to 94 unique genes. Forty-four of these were identified as novel genes, while the remainder showed similarity to a broad diversity of genes with putative functions related to toxin production, pathogenicity, and metabolism. As a result of mycoparasitism, 15 genes belonged to R. solani among which 9 genes were assigned putative functions. Quantitative RT-PCR was used to examine the upregulation of 12 genes during the course of mycoparasitism. Seven genes showed significant upregulation at least at one-time point during interaction of the mycoparasite with its host. This study describes a first step toward knowledge of S. elegans genome. The results present the useful application of EST analysis on S. elegans and provide preliminary indication of gene expression putatively involved in mycoparasitism.

  5. Rapid control of mold temperature during injection molding process

    SciTech Connect

    Liparoti, Sara; Titomanlio, Giuseppe; Hunag, Tsang Min; Cakmak, Mukerrem; Sorrentino, Andrea

    2015-05-22

    The control of mold surface temperature is an important factor that determines surface morphology and its dimension in thickness direction. It can also affect the frozen molecular orientation and the mold surface replicability in injection molded products. In this work, thin thermally active films were used to quickly control the mold surface temperature. In particular, an active high electrical conductivity carbon black loaded polyimide composites sandwiched between two insulating thin polymeric layers was used to condition the mold surface. By controlling the heating time, it was possible to control precisely the temporal variation of the mold temperature surface during the entire cycle. The surface heating rate was about 40°C/s and upon contact with the polymer the surface temperature decreased back to 40°C within about 5 s; the overall cycle time increased only slightly. The effect on cross section sample morphology of samples of iPP were analyzed and discussed on the basis of the recorded temperature evolution.

  6. Mold Cleanup in Your Home

    EPA Pesticide Factsheets

    If you found mold in your household, you will want to clean it up. Some considerations on how you will clean it up depend on the size of the area, the contaminated materials, and any additional health concerns.

  7. White mold of Jerusalem artichoke

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Jerusalem artichoke (Helianthus tuberosus) is a Native American food plant closely related to the common sunflower (Helianthus annuus). Tubers of Jerusalem artichoke are increasingly available in retail grocery outlets. White mold (Sclerotinia stem rot), caused by the fungus, Sclerotinia sclerotioru...

  8. Molded polymer solar water heater

    DOEpatents

    Bourne, Richard C.; Lee, Brian E.

    2004-11-09

    A solar water heater has a rotationally-molded water box and a glazing subassembly disposed over the water box that enhances solar gain and provides an insulating air space between the outside environment and the water box. When used with a pressurized water system, an internal heat exchanger is integrally molded within the water box. Mounting and connection hardware is included to provide a rapid and secure method of installation.

  9. Survey Of Present Lens Molding Techniques

    NASA Astrophysics Data System (ADS)

    Pollicove, Harvey M.

    1988-07-01

    This survey will provide an overview of glass molding technologies, with a concentration in the newest of the technologies - Precision Glass Molding (PGM). A brief description of various forms of glass molding, including an historical review of patents associated with precision molding, is given. A worldwide survey of known commercial availability and recent innovations in PGM at Kodak are presented as examples of the potential of the precision molding technology.

  10. Effects of amoebae on the growth of microbes isolated from moisture-damaged buildings.

    PubMed

    Yli-Pirilä, Terhi; Kusnetsov, Jaana; Hirvonen, Maija-Riitta; Seuri, Markku; Nevalainen, Aino

    2006-04-01

    Dampness, moisture, and mold in buildings are associated with adverse health outcomes. In addition to fungi and bacteria, amoebae have been found in moisture-damaged building materials. Amoebae and a growing list of bacteria have been shown to have mutual effects on each other's growth, but the interactions between amoebae and microbes common in moisture-damaged buildings have not been reported. We co-cultivated the amoeba Acanthamoeba polyphaga with bacteria and fungi isolated from moisture-damaged buildings in laboratory conditions for up to 28 days. The microbes selected were the bacteria Streptomyces californicus, Bacillus cereus, and Pseudomonas fluorescens, and the fungi Stachybotrys chartarum, Aspergillus versicolor, and Penicillium spinulosum. Fungi and bacteria generally benefited from the presence of the amoebae, whereas the growth of amoebae was hindered by Streptomyces californicus, Stachybotrys chartarum, and Bacillus cereus. Pseudomonas fluorescens slightly enhanced amoebae viability. Amoebae were indifferent to the presence of Aspergillus versicolor and Penicillium spinulosum. Thus, our results show that amoebae can alter the survival and growth of some microbes in moisture-damaged buildings.

  11. Aerodynamic characteristics and respiratory deposition of fungal fragments

    NASA Astrophysics Data System (ADS)

    Cho, Seung-Hyun; Seo, Sung-Chul; Schmechel, Detlef; Grinshpun, Sergey A.; Reponen, Tiina

    The purpose of this study was to investigate the aerodynamic characteristics of fungal fragments and to estimate their respiratory deposition. Fragments and spores of three different fungal species ( Aspergillus versicolor, Penicillium melinii, and Stachybotrys chartarum) were aerosolized by the fungal spore source strength tester (FSSST). An electrical low-pressure impactor (ELPI) measured the size distribution in real-time and collected the aerosolized fungal particles simultaneously onto 12 impactor stages in the size range of 0.3-10 μm utilizing water-soluble ZEF-X10 coating of the impaction stages to prevent spore bounce. For S. chartarum, the average concentration of released fungal fragments was 380 particles cm -3, which was about 514 times higher than that of spores. A. versicolor was found to release comparable amount of spores and fragments. Microscopic analysis confirmed that S. chartarum and A. versicolor did not show any significant spore bounce, whereas the size distribution of P. melinii fragments was masked by spore bounce. Respiratory deposition was calculated using a computer-based model, LUDEP 2.07, for an adult male and a 3-month-old infant utilizing the database on the concentration and size distribution of S. chartarum and A. versicolor aerosols measured by the ELPI. Total deposition fractions for fragments and spores were 27-46% and 84-95%, respectively, showing slightly higher values in an infant than in an adult. For S. chartarum, fragments demonstrated 230-250 fold higher respiratory deposition than spores, while the number of deposited fragments and spores of A. versicolor were comparable. It was revealed that the deposition ratio (the number of deposited fragments divided by that of deposited spores) in the lower airways for an infant was 4-5 times higher than that for an adult. As fungal fragments have been shown to contain mycotoxins and antigens, further exposure assessment should include the measurement of fungal fragments for

  12. Rotationally Molded Liquid Crystalline Polymers

    NASA Technical Reports Server (NTRS)

    Rogers, Martin; Scribben, Eric; Baird, Donald; Hulcher, Bruce

    2002-01-01

    Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semirigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers. This paper will also highlight the interactions between academia and small businesses in developing new products and processes.

  13. Rotationally Molded Liquid Crystalline Polymers

    NASA Technical Reports Server (NTRS)

    Rogers, Martin; Stevenson, Paige; Scribben, Eric; Baird, Donald; Hulcher, Bruce

    2002-01-01

    Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers advantages of low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semi-rigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers.

  14. Injection molding of engineering plastics

    NASA Astrophysics Data System (ADS)

    Kalyon, Dilhan M.

    1991-03-01

    This final report summarizes the findings of a study in injection molding of engineering plastics. Two engineering plastic resins, i.e., unmodified grades of a polyetherimide and a poly (2,6-dimethyl-1,4-phenylene ether) were thoroughly characterized. The characterization included rheology, thermal properties and P-V-T behavior. The data were employed to predict various microstructural distributions including density, residual stress and birefringence distributions in compression and injection molded specimens of these two engineering plastics. The detailed microstructural distributions were also studied experimentally upon processing the two engineering plastics, employing instrumented machines and industrial practices. The experimental findings were elucidated under the light of the numerical simulation results. Overall, this study should furnish a first order understanding of the microstructure development in articles injection molded from amorphous engineering plastic resins.

  15. Flow behavior in liquid molding

    NASA Technical Reports Server (NTRS)

    Hunston, D.; Phelan, F.; Parnas, R.

    1992-01-01

    The liquid molding (LM) process for manufacturing polymer composites with structural properties has the potential to significantly lower fabrication costs and increase production rates. LM includes both resin transfer molding and structural reaction injection molding. To achieve this potential, however, the underlying science base must be improved to facilitate effective process optimization and implementation of on-line process control. The National Institute of Standards and Technology (NIST) has a major program in LM that includes materials characterization, process simulation models, on-line process monitoring and control, and the fabrication of test specimens. The results of this program are applied to real parts through cooperative projects with industry. The key feature in the effort is a comprehensive and integrated approach to the processing science aspects of LM. This paper briefly outlines the NIST program and uses several examples to illustrate the work.

  16. Staged mold for encapsulating hazardous wastes

    DOEpatents

    Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

    1990-01-01

    A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

  17. Staged mold for encapsulating hazardous wastes

    DOEpatents

    Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

    1988-01-01

    A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

  18. Mold and Indoor Air Quality in Schools

    MedlinePlus

    ... Twitter Google+ Pinterest Contact Us Mold and Indoor Air Quality in Schools Mold and Moisture in Schools Webinar ... premier resource on this issue is the Indoor Air Quality Tools for Schools kit. Our schools-related resources ...

  19. Contamination Barrier For Contour-Molding Material

    NASA Technical Reports Server (NTRS)

    Adams, James F.

    1988-01-01

    Release agent prevents molding compound from adhering to or contaminating surface. Cleaning agent, Turco 4215 NCLT, forms barrier preventing silicone molding compound from sticking to surface and leaving contaminating residue. Also see MFS-29243.

  20. National Allergy Bureau Pollen and Mold Report

    MedlinePlus

    ... Search Search AAAAI National Allergy Bureau Pollen and Mold Report Date: April 12, 2017 Location: San Antonio ( ... Service can automatically email you daily pollen and mold reports. Click here sign up! Return to Map ...

  1. MOLD-SPECIFIC QUANTITATIVE PCR: THE EMERGING STANDARD IN MOLD ANALYSIS

    EPA Science Inventory

    Molds can cause health problems like infections and allergies, destroy crops, and contaminate our food or pharmaceuticals. We can't avoid molds. Molds are essential players in the biological processes on earth, but we can now identify and quantify the molds that will be most pr...

  2. Making Internal Molds Of Long, Curved Tubes

    NASA Technical Reports Server (NTRS)

    Burley, Richard K.

    1989-01-01

    Mold material carried to internal weld joint and removed after impression taken. Remotely operated device makes impression mold of interior surface of tube at weld joint. Mold provides indication of extent of mismatch between members at joint. Maneuvered to weld inspected through curved tube 3 in. in diameter by 50 in. long. Readily adapted to making molds to measure depth of corrosion in boiler tubes or other pipes.

  3. Blow molding of melt processible rubber

    SciTech Connect

    Abell, W.R.; Stuart, R.E.; Myrick, R.E.

    1991-07-01

    This article discusses the advantages of making hollow rubber parts by blow molding thermoplastic elastomers (TPEs) versus conventional rubber processing. It describes the various types of blow molding processes and it provides some insight into the rheological properties of melt processible rubber (MPR) and how MPR should be molded by each of these processes. A number of blow molded applications for MPR are also discussed.

  4. Injection Molding of Plastics from Agricultural Materials

    SciTech Connect

    Bhattacharya, M.; Ruan, R.

    2001-02-22

    The objective of this research was to conduct a systematic study to relate injection molding parameters to properties of blends of starch and synthetic polymer. From this study, we wished to develop a thorough understanding of the injection molding process and gain significant insight into designing molds and aiding in developing products cheaply and efficiently.

  5. The Mold that Almost Ate the Principal

    ERIC Educational Resources Information Center

    Barry, Wayne; Bishop, Chuck; Byars, Jennifer

    2006-01-01

    New-building mold was a bane for many home construction companies and new homeowners during the 1990s. It was not unusual to read or watch the news and see the tragedy played out in one's local community. Untold, however, is the story of the toll new-building mold can take on school systems and their principals, especially as these mold problems…

  6. Planning an Injection Mold Design Training Program.

    ERIC Educational Resources Information Center

    Allyn, Edward P.

    With the increased use of plastics worldwide the shortage of trained personnel in moldmaking and design for plastic injection molds is becoming critical. Local schools and community colleges should provide courses in mold design and mold making, since most workers presently learn while working under experienced designers on the job. Following this…

  7. Surface Replication of Molded Products with Microneedle Features in Injection Molding

    NASA Astrophysics Data System (ADS)

    Uchiumi, Kazuyasu; Takayama, Tetsuo; Ito, Hiroshi; Inou, Akinori

    Micro-molding of microneedle features was conducted using several injection-molding techniques. Injection compression molding and injection molding were performed with supercritical carbon dioxide fluid and with or without vacuum processing inside the mold cavity. Effects of process parameters on processability and surface replication of the molded parts were evaluated. The height replication ratio for microneedles was improved using injection compression molding. At a shorter compression stroke, the needle height was improved, and the influence of compression delay time was also small. Moreover, the effects of vacuum processing inside the mold cavity under the filling process were slight. The height replication ratio for microneedles showed the highest values using injection molding using supercritical carbon dioxide fluid with vacuum inside the mold cavity.

  8. Is Mold the New Asbestos?

    ERIC Educational Resources Information Center

    Colgan, Craig

    2003-01-01

    Mold and indoor air quality (IAQ) are matters of major concern to architects and their educational clients. The Environmental Protection Agency's Indoor Air Quality Tools for Schools program offers help to districts seeking to tackle IAQ issues. Strengthening community relations is one way to be ready in case of a bad environmental or IAQ report.…

  9. ALLERGIC POTENTIAL OF INDOOR MOLDS

    EPA Science Inventory

    Many fungi have been associated with allergic lung disease, but few are well studied and even fewer allergens of fungal origin are well characterized. Exposure to damp moldy environments has been associated with the exacerbation of asthma, but the role of molds in the induction o...

  10. Mold production for polymer optics

    NASA Astrophysics Data System (ADS)

    Boerret, Rainer; Raab, Jonas; Speich, Marco

    2014-09-01

    The fields of application for polymer optics are huge and thus the need for polymer optics is steadily growing. Most polymer optics are produced in high numbers by injection molding. Therefore molds and dies that fulfill special requirements are needed. Polishing is usually the last process in the common process chain for production of molds for polymer optics. Usually this process step is done manually by experienced polishers. Due to the small number of skilled professionals and health problems because of the monotonous work the idea was to support or probably supersede manual polishing. Polishing using an industrial robot as movement system enables totally new possibilities in automated polishing. This work focuses on the surface generation with a newly designed polishing setup and on the code generation for the robot movement. The process starts on ground surfaces and with different tools and polishing agents surfaces that fulfill the requirements for injection molding of optics can be achieved. To achieve this the attention has to be focused not only on the process itself but also on tool path generation. A proprietary software developed in the Centre for Optical Technologies in Aalen University allows the tool path generation on almost any surface. This allows the usage of the newly developed polishing processes on different surfaces and enables an easy adaption. Details of process and software development will be presented as well as results from different polishing tests on different surfaces.

  11. Molded Concrete Center Mine Wall

    NASA Technical Reports Server (NTRS)

    Lewis, E. V.

    1987-01-01

    Proposed semiautomatic system forms concrete-foam wall along middle of coal-mine passage. Wall helps support roof and divides passage into two conduits needed for ventilation of coal face. Mobile mold and concrete-foam generator form sections of wall in place.

  12. ANIMAL MODELS OF MOLD ALLERGY

    EPA Science Inventory

    The concept of molds as causative agents for allergy/asthma is not new. In fact many fungal genera have been associated with allergic lung disease, but only a few fungi are well studied and even fewer fungal allergens well characterized. The complexity and variety of fungal pro...

  13. Precision injection molding of freeform optics

    NASA Astrophysics Data System (ADS)

    Fang, Fengzhou; Zhang, Nan; Zhang, Xiaodong

    2016-08-01

    Precision injection molding is the most efficient mass production technology for manufacturing plastic optics. Applications of plastic optics in field of imaging, illumination, and concentration demonstrate a variety of complex surface forms, developing from conventional plano and spherical surfaces to aspheric and freeform surfaces. It requires high optical quality with high form accuracy and lower residual stresses, which challenges both optical tool inserts machining and precision injection molding process. The present paper reviews recent progress in mold tool machining and precision injection molding, with more emphasis on precision injection molding. The challenges and future development trend are also discussed.

  14. HIGH TEMPERATURE REFRACTORY COATING FOR GRAPHITE MOLDS

    DOEpatents

    Stoddard, S.D.

    1958-10-21

    An improved foundry mold coating for use with graphite molds used in the casting of uranium is presented. The refractory mold coating serves to keep the molten uranium from contact with graphite of the mold and thus prevents carbon pickup by the molten metal. The refractory coating is made by dry mixing certain specific amounts of aluminum oxide, bentonite, Tennessee ball clay, and a soluble silicate salt. Water is then added to the mixture and the suspension thus formed is applied by spraying onto the mold.

  15. High Temperature Transfer Molding Resins

    NASA Technical Reports Server (NTRS)

    Connell, John W. (Inventor); Smith, Joseph G., Jr. (Inventor); Hergenrother, Paul M. (Inventor)

    2000-01-01

    High temperature resins containing phenylethynyl groups that are processable by transfer molding have been prepared. These phenylethynyl containing oligomers were prepared from aromatic diamines containing phenylethynyl groups and various ratios of phthalic anhydride and 4-phenylethynlphthalic anhydride in glacial acetic acid to form a mixture of imide compounds in one step. This synthetic approach is advantageous since the products are a mixture of compounds and consequently exhibit a relatively low melting temperature. In addition, these materials exhibit low melt viscosities which are stable for several hours at 210-275 C, and since the thermal reaction of the phenylethynyl group does not occur to any appreciable extent at temperatures below 300 C, these materials have a broad processing window. Upon thermal cure at approximately 300-350 C, the phenylethynyl groups react to provide a crosslinked resin system. These new materials exhibit excellent properties and are potentially useful as adhesives, coatings, films, moldings and composite matrices.

  16. [Mold infections in lung transplants].

    PubMed

    Solé, Amparo; Ussetti, Piedad

    2014-01-01

    Invasive infections by molds, mainly Aspergillus infections, account for more than 10% of infectious complications in lung transplant recipients. These infections have a bimodal presentation: an early one, mainly invading bronchial airways, and a late one, mostly focused on lung or disseminated. The Aspergillus colonization at any time in the post-transplant period is one of the major risk factors. Late colonization, together with chronic rejection, is one of the main causes of late invasive forms. A galactomannan value of 0.5 in bronchoalveolar lavage is currently considered a predictive factor of pulmonary invasive infection. There is no universal strategy in terms of prophylaxis. Targeted prophylaxis and preemptive treatment instead of universal prophylaxis, are gaining more followers. The therapeutic drug monitoring level of azoles is highly recommended in the treatment. Monotherapy with voriconazole is the treatment of choice in invasive aspergillosis; combined antifungal therapies are only recommended in severe, disseminated, and other infections due to non-Aspergillus molds.

  17. Compression molding of aerogel microspheres

    DOEpatents

    Pekala, Richard W.; Hrubesh, Lawrence W.

    1998-03-24

    An aerogel composite material produced by compression molding of aerogel microspheres (powders) mixed together with a small percentage of polymer binder to form monolithic shapes in a cost-effective manner. The aerogel composites are formed by mixing aerogel microspheres with a polymer binder, placing the mixture in a mold and heating under pressure, which results in a composite with a density of 50-800 kg/m.sup.3 (0.05-0.80 g/cc). The thermal conductivity of the thus formed aerogel composite is below that of air, but higher than the thermal conductivity of monolithic aerogels. The resulting aerogel composites are attractive for applications such as thermal insulation since fabrication thereof does not require large and expensive processing equipment. In addition to thermal insulation, the aerogel composites may be utilized for filtration, ICF target, double layer capacitors, and capacitive deionization.

  18. Compression molding of aerogel microspheres

    DOEpatents

    Pekala, R.W.; Hrubesh, L.W.

    1998-03-24

    An aerogel composite material produced by compression molding of aerogel microspheres (powders) mixed together with a small percentage of polymer binder to form monolithic shapes in a cost-effective manner is disclosed. The aerogel composites are formed by mixing aerogel microspheres with a polymer binder, placing the mixture in a mold and heating under pressure, which results in a composite with a density of 50--800 kg/m{sup 3} (0.05--0.80 g/cc). The thermal conductivity of the thus formed aerogel composite is below that of air, but higher than the thermal conductivity of monolithic aerogels. The resulting aerogel composites are attractive for applications such as thermal insulation since fabrication thereof does not require large and expensive processing equipment. In addition to thermal insulation, the aerogel composites may be utilized for filtration, ICF target, double layer capacitors, and capacitive deionization. 4 figs.

  19. Onychomycosis due to opportunistic molds*

    PubMed Central

    Martínez-Herrera, Erick Obed; Arroyo-Camarena, Stefanie; Tejada-García, Diana Luz; Porras-López, Carlos Francisco; Arenas, Roberto

    2015-01-01

    BACKGROUND: Onychomycosis are caused by dermatophytes and Candida, but rarely by non- dermatophyte molds. These opportunistic agents are filamentous fungi found as soil and plant pathogens. OBJECTIVES: To determine the frequency of opportunistic molds in onychomycosis. METHODS: A retrospective analysis of 4,220 cases with onychomycosis, diagnosed in a 39-month period at the Institute of Dermatology and Skin surgery "Prof. Dr. Fernando A. Cordero C." in Guatemala City, and confirmed with a positive KOH test and culture. RESULTS: 32 cases (0.76%) of onychomycosis caused by opportunistic molds were confirmed. The most affected age group ranged from 41 to 65 years (15 patients, 46.9%) and females were more commonly affected (21 cases, 65.6%) than males. Lateral and distal subungual onychomycosis (OSD-L) was detected in 20 cases (62.5%). The microscopic examination with KOH showed filaments in 19 cases (59.4%), dermatophytoma in 9 cases (28.1%), spores in 2 cases (6.25%), and filaments and spores in 2 cases (6.25%). Etiologic agents: Aspergillus sp., 11 cases (34.4%); Scopulariopsis brevicaulis, 8 cases (25.0%); Cladosporium sp., 3 cases (9.4%); Acremonium sp., 2 cases (6.25%); Paecilomyces sp., 2 cases (6.25%); Tritirachium oryzae, 2 cases (6.25%); Fusarium sp., Phialophora sp., Rhizopus sp. and Alternaria alternate, 1 case (3.1%) each. CONCLUSIONS: We found onychomycosis by opportunistic molds in 0.76% of the cases and DLSO was present in 62.5%. The most frequent isolated etiological agents were: Aspergillus sp. and Scopulariopsis brevicaulis. PMID:26131862

  20. Capillarity in metal casting mold filling

    NASA Astrophysics Data System (ADS)

    Hilden, Jon L.

    In metal casting processes, surface tension of the molten metal typically resists filling of the metal into the mold. The effects are greater for smaller mold cavities, and ultimately, the smallest cavities may not be filled. Surface tension forces can be overcome by applying pressure (head) to the molten metal, thus forcing metal into the cavities. However, a pressure-window will exist, too little pressure resulting in non-filled cavities and too much pressure resulting in penetration of the mold, which is itself porous. Filling-pressure windows are investigated for cylindrical-shaped mold cavities on both a theoretical and experimental basis. The lower bound of the filling pressure window is examined by treating cylindrical mold cavities as cylinders lined with packed spheres representing mold particles. The upper bound is examined by treating the mold as a 3-D array of close-packed spheres. The experimental work concerns industrial-scale vacuum investment casting of superalloy IN718 into molds containing various cylindrical mold cavities at various heights (heads). The experimental results are found to be in good agreement with the numerical modeling predictions for filling of rough (sphere-lined) cylindrical mold cavities.

  1. Amorphous materials molded IR lens progress report

    NASA Astrophysics Data System (ADS)

    Hilton, A. R., Sr.; McCord, James; Timm, Ronald; Le Blanc, R. A.

    2008-04-01

    Amorphous Materials began in 2000 a joint program with Lockheed Martin in Orlando to develop molding technology required to produce infrared lenses from chalcogenide glasses. Preliminary results were reported at this SPIE meeting by Amy Graham1 in 2003. The program ended in 2004. Since that time, AMI has concentrated on improving results from two low softening glasses, Amtir 4&5. Both glasses have been fully characterized and antireflection coatings have been developed for each. Lenses have been molded from both glasses, from Amtir 6 and from C1 Core glass. A Zygo unit is used to evaluate the results of each molded lens as a guide to improving the molding process. Expansion into a larger building has provided room for five production molding units. Molded lens sizes have ranged from 8 mm to 136 mm in diameter. Recent results will be presented

  2. Gating of Permanent Molds for ALuminum Casting

    SciTech Connect

    David Schwam; John F. Wallace; Tom Engle; Qingming Chang

    2004-03-30

    This report summarizes a two-year project, DE-FC07-01ID13983 that concerns the gating of aluminum castings in permanent molds. The main goal of the project is to improve the quality of aluminum castings produced in permanent molds. The approach taken was determine how the vertical type gating systems used for permanent mold castings can be designed to fill the mold cavity with a minimum of damage to the quality of the resulting casting. It is evident that somewhat different systems are preferred for different shapes and sizes of aluminum castings. The main problems caused by improper gating are entrained aluminum oxide films and entrapped gas. The project highlights the characteristic features of gating systems used in permanent mold aluminum foundries and recommends gating procedures designed to avoid common defects. The study also provides direct evidence on the filling pattern and heat flow behavior in permanent mold castings.

  3. Hydrogen silsesquioxane mold coatings for improved replication of nanopatterns by injection molding

    NASA Astrophysics Data System (ADS)

    Hobæk, Thor Christian; Matschuk, Maria; Kafka, Jan; Pranov, Henrik J.; Larsen, Niels B.

    2015-03-01

    We demonstrate the replication of nanosized pillars in polymer (cyclic olefin copolymer) by injection molding using nanostructured thermally cured hydrogen silsesquioxane (HSQ) ceramic coatings on stainless steel mold inserts with mold nanostructures produced by a simple embossing process. At isothermal mold conditions, the average pillar height increases by up to 100% and a more uniform height distribution is observed compared to a traditional metal mold insert. Thermal heat transfer simulations predict that the HSQ film retards the cooling of the polymer melt during the initial stages of replication, thus allowing more time to fill the nanoscale cavities compared to standard metal molds. A monolayer of a fluorinated silane (heptadecafluorotrichlorosilane) deposited on the mold surface reduces the mold/polymer interfacial energy to support demolding of the polymer replica. The mechanical stability of thermally cured HSQ makes it a promising material for nanopattern replication on an industrial scale without the need for slow and energy intensive variotherm processes.

  4. Mold For Casting Radius-Inspection Specimens

    NASA Technical Reports Server (NTRS)

    Ball, Robert N.

    1988-01-01

    Thin replicas viewed on comparator without sectioning. New mold machined from piece of transparent poly(methyl methacrylate). Fits around base of post. Two slots machined into inner surface form channels for casting inspection sections. Bottom of mold fits flush against surface around bottom of post. When surface slanted, mold automatically aligns in proper orientation. Time required to inspect elliptical radii located at bottoms of series of small posts reduced from 18 hours to 3 hours.

  5. Mold in My School: What Do I Do?

    ERIC Educational Resources Information Center

    National Clearinghouse for Educational Facilities, Washington, DC.

    This publication provides information on the most important indoor mold-related health concerns and discusses how school districts can keep school facilities mold-free and avoid these problems. The document addresses when to be concerned, how molds cause health problems, symptoms caused by mold allergies, indoor molds that form toxins, who is most…

  6. Chalcogenide-mold interactions during precision glass molding (PGM) of GeAsSe glasses

    NASA Astrophysics Data System (ADS)

    Gleason, B.; Wachtel, P.; Musgraves, J. D.; Steinkopf, R.; Eberhardt, R.; Richardson, K.

    2013-09-01

    Five chalcogenide glasses in the GeAsSe ternary glass system were melted, fabricated into flats, and molded between planar, uncoated, binderless WC molds using a laboratory-scale precision glass molding machine. The five glasses originate at the binary arsenic triselenide (As40Se60) and are modified by replacing As with Se in 5 mol% increments, or by locking the As:Se ratio and adding Ge, also in 5 mol% increments. The glasses are separated into two groups, one for the Ge-free compositions and the other for the Ge-containing compositions. This effort analyzes the differences between the Ge-containing and the Ge-free glasses on the post-molded glass and mold surface behavior, as well as the mold lifetime. Fabrication features, such as scratch and/or dig marks were present on the glass and mold surfaces prior to the PGM process. White light interferometry analysis of the surfaces shows an overall reduction in the RMS roughness of the glass after molding, and an increase of the roughness of the molds, after 15 molding cycles. After molding, the quantity of observable defects, primarily deposits and dig marks are increased for both the glass and mold surfaces. Deposits found on the WC molds and glasses were analyzed using Electron Dispersive X-ray Spectroscopy (EDS) and showed no evidence of being due to material transfer between the WC molds and the glass constituents. In general the main observable difference in the analysis of the two post molded sets, despite the changes in chemistry, is the quantity of molding induced defects near the edge of the GeAsSe samples.

  7. Mold Infections of the Central Nervous System

    PubMed Central

    McCarthy, Matthew; Rosengart, Axel; Schuetz, Audrey N.; Kontoyiannis, Dimitrios P.; Walsh, Thomas J.

    2016-01-01

    The recent outbreak of exserohilum rostratum meningitis linked to epidural injections of methylprednisolone acetate has brought renewed attention to mold infections of the central nervous system (CNS).1 Although uncommon, these infections are often devastating and difficult to treat. This focused review of the epidemiologic aspects, clinical characteristics, and treatment of mold infections of the CNS covers a group of common pathogens: aspergillus, fusarium, and scedosporium species, molds in the order Mucorales, and dematiaceous molds. Infections caused by these pathogen groups have distinctive epidemiologic profiles, clinical manifestations, microbiologic characteristics, and therapeutic implications, all of which clinicians should understand. PMID:25006721

  8. Mold and Human Health: a Reality Check.

    PubMed

    Borchers, Andrea T; Chang, Christopher; Eric Gershwin, M

    2017-03-16

    There are possibly millions of mold species on earth. The vast majority of these mold spores live in harmony with humans, rarely causing disease. The rare species that does cause disease does so by triggering allergies or asthma, or may be involved in hypersensitivity diseases such as allergic bronchopulmonary aspergillosis or allergic fungal sinusitis. Other hypersensitivity diseases include those related to occupational or domiciliary exposures to certain mold species, as in the case of Pigeon Breeder's disease, Farmer's lung, or humidifier fever. The final proven category of fungal diseases is through infection, as in the case of onchomycosis or coccidiomycosis. These diseases can be treated using anti-fungal agents. Molds and fungi can also be particularly important in infections that occur in immunocompromised patients. Systemic candidiasis does not occur unless the individual is immunodeficient. Previous reports of "toxic mold syndrome" or "toxic black mold" have been shown to be no more than media hype and mass hysteria, partly stemming from the misinterpreted concept of the "sick building syndrome." There is no scientific evidence that exposure to visible black mold in apartments and buildings can lead to the vague and subjective symptoms of memory loss, inability to focus, fatigue, and headaches that were reported by people who erroneously believed that they were suffering from "mycotoxicosis." Similarly, a causal relationship between cases of infant pulmonary hemorrhage and exposure to "black mold" has never been proven. Finally, there is no evidence of a link between autoimmune disease and mold exposure.

  9. Porous media heat transfer for injection molding

    DOEpatents

    Beer, Neil Reginald

    2016-05-31

    The cooling of injection molded plastic is targeted. Coolant flows into a porous medium disposed within an injection molding component via a porous medium inlet. The porous medium is thermally coupled to a mold cavity configured to receive injected liquid plastic. The porous medium beneficially allows for an increased rate of heat transfer from the injected liquid plastic to the coolant and provides additional structural support over a hollow cooling well. When the temperature of the injected liquid plastic falls below a solidifying temperature threshold, the molded component is ejected and collected.

  10. Analysis of optical properties in injection-molded and compression-molded optical lenses.

    PubMed

    Wang, Chung Yen; Wang, Pei Jen

    2014-04-10

    Numerical mold-flow simulations and experimental measurements for injection-molded lenses have been investigated in form accuracy on a two-cavity mold with various process conditions. First, form profiles of the molded lenses have been measured together with the corresponding simulated mold-temperature distribution and displacement distribution of the lens in the z direction. A flow-through type layout of cooling channels has been devised for balance of mold-temperature distribution in mold cavities with various parametric distances for assessments in uniformity of temperature distribution. Finally, a compression-molding process is proposed for the post-process of birefringence relaxation as well as adequate form accuracy of lenses. In conclusion, optimization of process parameters to achieve good form accuracy in a multicavity mold with symmetric geometry but nonuniform cooling conditions is difficult. A good design of cooling channels plus optimized process conditions could provide uniform mold-temperature distribution so that molded lenses of good quality would be possible. Then, the profile deviation of lenses could be further compensated by profile geometry corrections. In conclusion, the post-compression-molding process could make birefringence-free plastic lenses with good form accuracy.

  11. Commercial and Residential Water Damage: The Mold Connection.

    ERIC Educational Resources Information Center

    Williams, Del

    2002-01-01

    Describes the problem of toxic mold in residential and commercial property resulting from excess moisture. Includes common sources of unwanted moisture, design and construction flaws, determining the presence of mold, and advice for identifying and hiring reputable mold remediators. (PKP)

  12. Use of acrylic sheet molds for elastomeric products

    NASA Technical Reports Server (NTRS)

    Heisman, R. M.; Koerner, A. E.; Messineo, S. M.

    1970-01-01

    Molds constructed of acrylic sheet are more easily machined than metal, are transparent to ensure complete filling during injection, and have smooth surfaces free of contamination. Technique eliminates flashing on molded parts and mold release agents.

  13. Plastic molds reduce cost of encapsulating electric cable connectors

    NASA Technical Reports Server (NTRS)

    Knott, D.

    1964-01-01

    Resin casting of the aluminum master pattern forms a plastic mold for encapsulating a cable connector. An elastomer is injected into the mold and cured. The mold is disassembled leaving an elastomeric encapsulation around the connector.

  14. Mold

    MedlinePlus

    ... Homes Partnership project. The routine sampling included measuring air quality factors such as temperature, relative humidity, air circulation, ... World Health Organization) . 2009. WHO guidelines for indoor air quality: dampness and mould. Germany: Druckpartner Moser. 4 NTP ( ...

  15. Process for Making Ceramic Mold

    NASA Technical Reports Server (NTRS)

    Buck, Gregory M. (Inventor); Vasquez, Peter (Inventor)

    2001-01-01

    An improved process for slip casting molds that can be more economically automated and that also exhibits greater dimensional stability is disclosed. The process involves subjecting an investment pattern, preferably made from wax, to successive cycles of wet-dipping in a slurry of colloidal, silica-based binder and dry powder-coating, or stuccoing with plaster of Paris or calcium sulfate mixtures to produce a multi-layer shell over the pattern. The invention as claimed entails applying a primary and a secondary coating to the investment pattern. At least two wet-dipping on in a primary slurry and dry-stuccoing cycles provide the primary coating, and an additional two wet-dippings and dry-stuccoing cycles provide the secondary, or back-up, coating. The primary and secondary coatings produce a multi-layered shell pattern. The multi-layered shell pattern is placed in a furnace first to cure and harden, and then to vaporize the investment pattern, leaving a detailed, high precision shell mold.

  16. Mold Remediation in Schools and Commercial Buildings.

    ERIC Educational Resources Information Center

    Environmental Protection Agency, Washington, DC. Office of Radiation and Indoor Air.

    This document describes how to investigate and evaluate moisture and mold problems in educational facilities, and presents the key steps for implementing a remediation plan. A checklist is provided for conducting mold remediation efforts along with a resource list of helpful organizations and governmental agencies. Appendices contain a glossary,…

  17. EXPOSURE OF CHILDREN TO INDOOR MOLDS

    EPA Science Inventory

    Children now spend more than 90% of their time indoors. Thus, any exposure to indoor pollutants may be critical to their health. Molds are one of the most important pollutants children are exposed to indoors. Molds produce hundreds of allergens and toxins. These products ha...

  18. Dynamic Feed Control For Injection Molding

    DOEpatents

    Kazmer, David O.

    1996-09-17

    The invention provides methods and apparatus in which mold material flows through a gate into a mold cavity that defines the shape of a desired part. An adjustable valve is provided that is operable to change dynamically the effective size of the gate to control the flow of mold material through the gate. The valve is adjustable while the mold material is flowing through the gate into the mold cavity. A sensor is provided for sensing a process condition while the part is being molded. During molding, the valve is adjusted based at least in part on information from the sensor. In the preferred embodiment, the adjustable valve is controlled by a digital computer, which includes circuitry for acquiring data from the sensor, processing circuitry for computing a desired position of the valve based on the data from the sensor and a control data file containing target process conditions, and control circuitry for generating signals to control a valve driver to adjust the position of the valve. More complex embodiments include a plurality of gates, sensors, and controllable valves. Each valve is individually controllable so that process conditions corresponding to each gate can be adjusted independently. This allows for great flexibility in the control of injection molding to produce complex, high-quality parts.

  19. The Thermal Distortion of a Funnel Mold

    NASA Astrophysics Data System (ADS)

    Hibbeler, Lance C.; Thomas, Brian G.; Schimmel, Ronald C.; Abbel, Gert

    2012-10-01

    This article investigates the thermal distortion of a funnel mold for continuous casting of thin slabs and explores the implications on taper and solidification of the steel shell. The three-dimensional mold temperatures are calculated using shell-mold heat flux and cooling water profiles that were calibrated with plant measurements. The thermal stresses and distorted shape of the mold are calculated with a detailed finite-element model of a symmetric fourth of the entire mold and waterbox assembly, and they are validated with plant thermocouple data and measurements of the wear of the narrow-face copper mold plates. The narrow-face mold distorts into the typical parabolic arc, and the wide face distorts into a "W" shape owing to the large variation in bolt stiffnesses. The thermal expansion of the wide face works against the applied narrow-face taper and funnel effects, so the effect of thermal distortion must be considered to accurately predict the ideal mold taper.

  20. 21ST CENTURY MOLD ANALYSIS IN FOOD

    EPA Science Inventory

    Traditionally, the indoor air community has relied on mold analysis performed by either microscopic observations or the culturing of molds on various media to assess indoor air quality. These techniques were developed in the 19th century and are very laborious and time consumin...

  1. The use of IR thermography to show the mold and part temperature evolution in injection molding

    NASA Astrophysics Data System (ADS)

    Bula, Karol; Różański, Leszek; Marciniak-Podsadna, Lidia; Wróbel, Dawid

    2016-12-01

    This study concerns the application of infrared camera for injection molding analysis by measuring temperatures of both injection molded parts and injection mold cavities in a function of injection cycles. The mold with two cavities, differing in thickness (1 and 3 mm), and a cold direct runner was used. Isotactic polypropylene homopolymer was utilized to produce parts. Mold temperature was set at 22°C and controlled by a water chiller. Five measuring points were determined: SP1, SP2 (placed in the 3 mm cavity), SP3, SP4 (located in the 1 mm cavity) and SP5 around an injection molding gate. Our investigations showed that the highest temperature is localized around SP2 point and the lowest at SP4. Also, it was proved that even after 62 injection molding cycles, temperatures of cavities were not stable, revealing their further increase with each cycle.

  2. Grinding technologies of small optical element molds

    NASA Astrophysics Data System (ADS)

    Katsuki, Masahide; Urushibata, Kazunori

    2003-05-01

    The high-precision grinding technology is making contribution in every field, which is especially remarkable in the optics-related field. Lenses for digital camera and projector, which are mass-produced, for instance, are molded by the injection molding machine and glass molding-press machine. Concerning materials of high-precision molds, nickel alloy is mainly used in plastic-molding. And brittle material such as tungsten carbide and ceramic is used in glass-molding because the molding temperature is generally high. High-precision machining of nickel alloy is possible with a single-crystal diamond tool. Brittle material is ground by means of a diamond wheel, etc. Glass is being widely used for the lenses and other optical elements due to its favorable characteristics and life. As a result, needs for advancement of the high-precision grinding technology are being heightened. In grinding of small, fine and complex profiles, consideration for wheel truing and wear is a key point. Also, as many optical mold products are convex, mold profile is mainly concave. Especially, grinding of a small-aperture mold with small radius of curvature is difficult. In other words, a wheel whose diameter is larger than the radius of curvature of a mold to be ground cannot be used, and use of a small-diameter wheel is required inevitably. Influence of wheel wear and wheel diameter input errors at creation of grinding program becomes large. To eliminate such errors, a cycle of grinding, measurement and compensation grinding is normally repeated in mold machining until the target accuracy is obtained. Recently, needs for molding optical elements of small body of non-revolution such as prism and cylinder lens are on the increase, in addition to the body of revolution including lens. As one example, we introduce the compensation grinding and its results when grinding molds for an extremely small-aperture lens used for optical communication and a cylindrical lens array used for semi

  3. Recent advancements in optical microstructure fabrication through glass molding process

    NASA Astrophysics Data System (ADS)

    Zhou, Tianfeng; Liu, Xiaohua; Liang, Zhiqiang; Liu, Yang; Xie, Jiaqing; Wang, Xibin

    2017-02-01

    Optical microstructures are increasingly applied in several fields, such as optical systems, precision measurement, and microfluid chips. Microstructures include microgrooves, microprisms, and microlenses. This paper presents an overview of optical microstructure fabrication through glass molding and highlights the applications of optical microstructures in mold fabrication and glass molding. The glass-mold interface friction and adhesion are also discussed. Moreover, the latest advancements in glass molding technologies are detailed, including new mold materials and their fabrication methods, viscoelastic constitutive modeling of glass, and microstructure molding process, as well as ultrasonic vibrationassisted molding technology.

  4. Strong, easy-to-mold, spiral buttress thread

    NASA Technical Reports Server (NTRS)

    Heier, W. C.

    1971-01-01

    Buttress thread with steep taper connects two molded plastic cylinders without changing wall thickness or sacrificing longitudinal strength at the juncture. Technique lends itself to conventional molding methods.

  5. Castable plastic mold with electroplatable base

    DOEpatents

    Domeier, Linda A.; Morales, Alfredo M.; Gonzales, Marcela G.; Keifer, Patrick M.

    2004-01-20

    A sacrificial plastic mold having an electroplatable backing is provided as are methods of making such a mold via the infusion of a castable liquid formulation through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale master mold. Upon casting and demolding, the porous metal substrate is embedded within the cast formulation and projects a plastic structure with features determined by the mold tool. The plastic structure provides a sacrificial plastic mold mechanically bonded to the porous metal substrate, which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved, leaving the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

  6. IC chip stress during plastic package molding

    SciTech Connect

    Palmer, D.W.; Benson, D.A.; Peterson, D.W.; Sweet, J.N.

    1998-02-01

    Approximately 95% of the world`s integrated chips are packaged using a hot, high pressure transfer molding process. The stress created by the flow of silica powder loaded epoxy can displace the fine bonding wires and can even distort the metalization patterns under the protective chip passivation layer. In this study the authors developed a technique to measure the mechanical stress over the surface of an integrated circuit during the molding process. A CMOS test chip with 25 diffused resistor stress sensors was applied to a commercial lead frame. Both compression and shear stresses were measured at all 25 locations on the surface of the chip every 50 milliseconds during molding. These measurements have a fine time and stress resolution which should allow comparison with computer simulation of the molding process, thus allowing optimization of both the manufacturing process and mold geometry.

  7. Mold Simulator Study of the Initial Solidification of Molten Steel in Continuous Casting Mold: Part II. Effects of Mold Oscillation and Mold Level Fluctuation

    NASA Astrophysics Data System (ADS)

    Zhang, Haihui; Wang, Wanlin

    2016-04-01

    The surface quality of the continuous casting strands is closely related to the initial solidification of liquid steel in the vicinity of the mold meniscus, and thus the clear understanding of the behavior of molten steel initial solidification would be of great importance for the control of the quality of final slab. With the development of the mold simulator techniques, the complex interrelationship between the solidified shell surface profile, heat flux, shell thickness, mold level fluctuation, and the infiltrated slag film was well illustrated in our previous study. As the second part, this article investigated the effect of the mold oscillation frequency, stroke, and mold level fluctuation on the initial solidification of the molten steel through the conduction of five different experiments. Results suggested that in the case of the stable mold level, the oscillation marks (OMs) exhibit equally spaced horizon depressions on the shell surface, where the heat flux at the meniscus area raises rapidly during negative strip time (NST) period and the presence of each OMs on the shell surface is corresponding to a peak value of the heat flux variation rate. Otherwise, the shell surface is poorly defined by the existence of wave-type defects, such as ripples or deep depressions, and the heat flux variation is irregular during NST period. The rising of the mold level leads to the longer-pitch and deeper OMs formation; conversely, the falling of mold level introduces shorter-pitch and shallower OMs. With the increase of the mold oscillation frequency, the average value of the low-frequency heat flux at the meniscus increases; however, it decreases when the mold oscillation stroke increases. Additionally, the variation amplitude of the high-frequency temperature and the high-frequency heat flux decreases with the increase of the oscillation frequency and the reduction of the oscillation stroke.

  8. Medical diagnostics for indoor mold exposure.

    PubMed

    Hurraß, Julia; Heinzow, Birger; Aurbach, Ute; Bergmann, Karl-Christian; Bufe, Albrecht; Buzina, Walter; Cornely, Oliver A; Engelhart, Steffen; Fischer, Guido; Gabrio, Thomas; Heinz, Werner; Herr, Caroline E W; Kleine-Tebbe, Jörg; Klimek, Ludger; Köberle, Martin; Lichtnecker, Herbert; Lob-Corzilius, Thomas; Merget, Rolf; Mülleneisen, Norbert; Nowak, Dennis; Rabe, Uta; Raulf, Monika; Seidl, Hans Peter; Steiß, Jens-Oliver; Szewszyk, Regine; Thomas, Peter; Valtanen, Kerttu; Wiesmüller, Gerhard A

    2017-04-01

    In April 2016, the German Society of Hygiene, Environmental Medicine and Preventative Medicine (Gesellschaft für Hygiene, Umweltmedizin und Präventivmedizin (GHUP)) together with other scientific medical societies, German and Austrian medical societies, physician unions and experts has provided an AWMF (Association of the Scientific Medical Societies) guideline 'Medical diagnostics for indoor mold exposure'. This guideline shall help physicians to advise and treat patients exposed indoors to mold. Indoor mold growth is a potential health risk, even without a quantitative and/or causal association between the occurrence of individual mold species and health effects. Apart from the allergic bronchopulmonary aspergillosis (ABPA) and the mycoses caused by mold, there is only sufficient evidence for the following associations between moisture/mold damages and different health effects: Allergic respiratory diseases, asthma (manifestation, progression, exacerbation), allergic rhinitis, exogenous allergic alveolitis and respiratory tract infections/bronchitis. In comparison to other environmental allergens, the sensitizing potential of molds is estimated to be low. Recent studies show a prevalence of sensitization of 3-10% in the total population of Europe. The evidence for associations to mucous membrane irritation and atopic eczema (manifestation, progression, exacerbation) is classified as limited or suspected. Inadequate or insufficient evidence for an association is given for COPD, acute idiopathic pulmonary hemorrhage in children, rheumatism/arthritis, sarcoidosis, and cancer. The risk of infections from indoor molds is low for healthy individuals. Only molds that are capable to form toxins can cause intoxications. The environmental and growth conditions and especially the substrate determine whether toxin formation occurs, but indoor air concentrations are always very low. In the case of indoor moisture/mold damages, everyone can be affected by odor effects and

  9. Mold management of wetted carpet.

    PubMed

    Ong, Kee-Hean; Dixit, Anupma; Lewis, Roger D; MacDonald Perkins, Maureen; Backer, Denis; Condoor, Sridhar; Emo, Brett; Yang, Mingan

    2014-01-01

    This study evaluated the growth and removal of fungi on wetted carpet using newly designed technologies that rely on physical principles of steam, heat, and fluid flow. Sixty samples of carpet were embedded with heat-treated house dust, followed by embedding, wearing with a hexapod, and wetting. Samples were inoculated using a liquid suspension of Cladosporium sphaerospermum prior to placement over a water-saturated foam pad. Incubation times were 24 hr, 7 days, and 30 days. Cleaning was performed using three methods; high-flow hot water extraction, hot water and detergent, and steam. Fungal loading increased from approximately 1500 colony forming units per area (CFU/cm(2)) in 24 hr to a maximum of approximately 10,200 CFU/cm(2) after 7 days with a slight decline to 9700 CFU/cm(2) after 30 days incubation. Statistically significant differences were found among all three methods for removal of fungi for all three time periods (p < 0.05). Steam-vapor was significantly better than the alternative methods (p <0.001) with over 99% efficiency in mold spore decline from wetted carpet after 24 hr and 30 days, and over 92% efficiency after 7 days. The alternative methods exhibited lower efficiencies with a decline over time, from a maximum of 82% and 81% at 24 hr down to 60% and 43% at 30 days for detergent-hot water and high-flow, hot water extraction, respectively. The net effect of the mold management study demonstrates that while steam has a consistent fungal removal rate, the detergent and high-flow, hot water methods decline in efficiency with increasing incubation time.

  10. Challenges in mold manufacturing for high precision molded diffractive optical elements

    NASA Astrophysics Data System (ADS)

    Pongs, Guido; Bresseler, Bernd; Schweizer, Klaus; Bergs, Thomas

    2016-09-01

    Isothermal precision glass molding of imaging optics is the key technology for mass production of precise optical elements. Especially for numerous consumer applications (e.g. digital cameras, smart phones, …), high precision glass molding is applied for the manufacturing of aspherical lenses. The usage of diffractive optical elements (DOEs) can help to further reduce the number of lenses in the optical systems which will lead to a reduced weight of hand-held optical devices. But today the application of molded glass DOEs is limited due to the technological challenges in structuring the mold surfaces. Depending on the application submicrometer structures are required on the mold surface. Furthermore these structures have to be replicated very precisely to the glass lens surface. Especially the micro structuring of hard and brittle mold materials such as Tungsten Carbide is very difficult and not established. Thus a multitude of innovative approaches using diffractive optical elements cannot be realized. Aixtooling has investigated in different mold materials and different suitable machining technologies for the micro- and sub-micrometer structuring of mold surfaces. The focus of the work lays on ultra-precision grinding to generate the diffractive pattern on the mold surfaces. This paper presents the latest achievements in diffractive structuring of Tungsten Carbide mold surfaces by ultra-precision grinding.

  11. Cloning, molecular characterization, and mRNA expression of the thermostable family 3 β-glucosidase from the rare fungus Stachybotrys microspora.

    PubMed

    Abdeljalil, Salma; Trigui-Lahiani, Héla; Lazzez, Houcine; Gargouri, Ali

    2013-07-01

    The filamentous fungus Stachybotrys microspora possess a rich β-glucosidase system composed of five β-glucosidases. Three of them were already purified to homogeneity and characterized. In order to isolate the β-glucosidase genes from S. microspora and study their regulation, a PCR strategy using consensus primers was used as a first step. This approach enabled the isolation of three different fragments of family 3 β-glucosidase gene. A representative genomic library was constructed and probed with one amplified fragment gene belonging to family 3 of β-glucosidase. After two rounds of hybridization, seven clones were obtained and the analysis of DNA plasmids leads to the isolation of one clone (CF3) with the largest insert of 7 kb. The regulatory region shows multiple TC-rich elements characteristic of constitutive promoter, explaining the expression of this gene under glucose condition, as shown by zymogram and RT-PCR analysis. The tertiary structure of the deduced amino acid sequence of Smbgl3 was predicted and has shown three conserved domains: an (α/β)8 triose phosphate isomerase (TIM) barrel, (α/β)5 sandwich, and fibronectin type III domain involved in protein thermostability. Zymogram analysis highlighted such thermostable character of this novel β-glucosidase.

  12. Stachybotrys microspora triprenyl phenol-7, a novel fibrinolytic agent, suppresses superoxide production, matrix metalloproteinase-9 expression, and thereby attenuates ischemia/reperfusion injury in rat brain.

    PubMed

    Akamatsu, Yosuke; Saito, Atsushi; Fujimura, Miki; Shimizu, Hiroaki; Mekawy, Moataz; Hasumi, Keiji; Tominaga, Teiji

    2011-10-03

    Stachybotrys microspora triprenyl phenol-7 (SMTP-7) is a novel fibrinolytic agent with anti-inflammatory effect. Previous study demonstrated that SMTP-7 further ameliorated infarction volume in a mouse embolic stroke model compared with tissue type plasminogen activator (tPA), but the reason SMTP-7 has more beneficial effect than tPA has not yet been determined. In the present study, we investigated whether SMTP-7 has an intrinsic neuroprotective effect against transient focal cerebral ischemia (tFCI). Sprague-Dawley rats were subjected to tFCI by intraluminal middle cerebral artery occlusion for 2h. Following induction of tFCI, rats were randomized into two groups based on the agent administered: SMTP-7 group and vehicle group. We examined cerebral infarction volume 24h after reperfusion, and evaluated superoxide production, the expressions of nitrotyrosine and matrix metalloproteinase-9 (MMP-9), which play major roles in secondary brain injury and hemorrhagic transformation. The findings showed that SMTP-7 significantly suppressed superoxide production, the expression of nitrotyrosine and MMP-9 after tFCI, and consequently attenuated ischemic neuronal damage. These results suggest that SMTP-7 has an intrinsic neuroprotective effect on ischemia/reperfusion injury through the suppression of oxidative stress and MMP-9 activation.

  13. Aerosolization of Particulate (1→3)-β-d-Glucan from Moldy Materials▿

    PubMed Central

    Seo, Sung-Chul; Reponen, Tiina; Levin, Linda; Borchelt, Tiffany; Grinshpun, Sergey A.

    2008-01-01

    Mold-damaged building materials may contain biologically active agents, such as (1→3)-β-d-glucan, allergens, and mycotoxins, which have been associated with adverse health effects. The release of these components from contaminated surfaces into the air is not well understood. The purpose of this study was to characterize the release of particulate (1→3)-β-d-glucan from the surface of artificially mold-contaminated materials. Aspergillus versicolor and Stachybotrys chartarum were grown on malt extract agar (MEA), white ceiling tiles, and a wall-papered gypsum board for 1 and 6 months. The (1→3)-β-d-glucan on the surfaces of moldy materials and in air samples collected from these materials was analyzed by the Limulus amebocyte lysate assay. The aerosolization ratio was defined as the amount of (1→3)-β-d-glucan in the air divided by the amount on the surface. The results showed that the aerosolization of particulate (1→3)-β-d-glucan was influenced mainly by the type of material and the fungal species. For A. versicolor, the aerosolization ratios of particulate (1→3)-β-d-glucan released from the three types of material were not significantly different. However, the ratios for S. chartarum released from ceiling tiles and gypsum board were significantly higher than the ratios for this organism released from MEA (P < 0.001) and were comparable to those for A. versicolor. These findings indicate that the use of MEA in aerosolization experiments is likely to underestimate the release of S. chartarum particles from building materials. These results provide important background information for design of future laboratory or animal experiments, as well as for interpretation of field measurement data. PMID:18065630

  14. RUN OUTS OCCUR WHEN IRON HAS UNSEATED MOLDING SAND AND ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    RUN OUTS OCCUR WHEN IRON HAS UNSEATED MOLDING SAND AND RUN OUT OF THE MOLD UNDER POURING JACKETS AND SPILLS ONTO THE MOLDING PLATFORM. WORKERS GENERALLY WAIT SEVERAL MINUTES FOR THE IRON TO SOLIDIFY AND, WHILE IT IS STILL RED-HOT, REMOVE IT FROM THE PLATFORM AND SCRAP THE MOLD. - Southern Ductile Casting Company, Centerville Foundry, 101 Airport Road, Centreville, Bibb County, AL

  15. INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER, R. L. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER, R. L. BRANDY MOLDING A RAIL CASTING (LAWLER NO. 1337, A 16' x 35' MOLD WITH A 5' COPE AND A 4' DRAG). DRAG IS FILLED WITH SAND. - Lawler Machine & Foundry Company, Molding Area, 760 North Forty-fourth Street, Birmingham, Jefferson County, AL

  16. Online Measurement for Transient Mold Friction Based on the Hydraulic Oscillators of Continuous-Casting Mold

    NASA Astrophysics Data System (ADS)

    Wang, Xudong; Wang, Zhaofeng; Yao, Man

    2013-12-01

    The interaction of the strand shell surface and mold copper plates has significant effects on the slab surface quality and casting productivity. This article focuses on developing a reliable approach to measure the transient friction force between the slab and the mold for the purpose of the investigation of lubrication and friction behavior inside a mold. This method is presented to monitor transient mold frictions for the slab continuous caster equipped with hydraulic oscillators. A mathematical model is also developed to calculate the empty working force of the no casting state, and a new algorithm, based on the particle swarm optimization, is proposed to predict the dynamic characteristic parameters of mold oscillation. The results have shown that the method has a sufficient sensitivity to variation, especially to the periodical variation of the mold friction, and it has been identified that the transient mold friction can be used as an effective index with regard to detecting mold oscillation and optimizing the casting parameters for process control. It may lay the practical foundation for the online detection of powder lubrication and the visualization of the continuous-casting mold process.

  17. Custom molded thermal MRg-FUS phantom

    NASA Astrophysics Data System (ADS)

    Eames, Matthew D. C.; Snell, John W.; Hananel, Arik; Kassell, Neal F.

    2012-11-01

    This article describes a method for creating custom-molded thermal phantoms for use with MR-guided focused ultrasound systems. The method is defined here for intracranial applications, though it may be modified for other anatomical targets.

  18. Sacrificial Plastic Mold With Electroplatable Base

    DOEpatents

    Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.

    2005-08-16

    A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

  19. Sacrificial plastic mold with electroplatable base

    DOEpatents

    Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.

    2002-01-01

    A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

  20. Organic materials for ceramic molding processes

    NASA Technical Reports Server (NTRS)

    Saito, K.

    1984-01-01

    Ceramic molding processes are examined. Binders, wetting agents, lubricants, plasticizers, surface active agents, dispersants, etc., for pressing, rubber pressing, sip casting, injection casting, taping, extrusion, etc., are described, together with forming machines.

  1. Injection molded optical backplane for broadcast architecture

    NASA Astrophysics Data System (ADS)

    Rosenberg, Paul; Mathai, Sagi; Sorin, Wayne V.; McLaren, Moray; Straznicky, Joseph; Panotopoulos, Georgios; Warren, David; Morris, Terry; Tan, Michael R. T.

    2012-01-01

    A low cost, blind mate, injection molded optical backplane is presented. The optical backplane is comprised of 12 channel optical broadcast buses, operating at 10Gbps/channel with six blindmate optical output ports spaced 1U apart.

  2. Antimicrobial Treatments of Indoor Mold and Bacteria

    EPA Science Inventory

    Biological contaminants especially mold in buildings are known to act as sources of indoor air pollution, discomfort, asthma and pulmonary disease to building occupants. Sick buildings are evidence of extremely problematic indoor air quality (IAQ), often resulting from unacceptab...

  3. Binding agent for molding ceramic items

    NASA Technical Reports Server (NTRS)

    Beshentsev, B. D.; Vityuk, N. P.; Volkov, A. V.; Yevdokimov, A. I.; Novikov, M. N.; Piskunov, Y. G.; Pobortsev, E. P.; Sadovnichaya, L. M.

    1983-01-01

    The invention refers to the fabrication of ceramic items by the molding method. It can be used to produce items of complicated configuration, in particular composition of binding agent for electroceramic items.

  4. Traditional Mold Analysis Compared to a DNA-based Method of Mold Analysis with Applications in Asthmatics' Homes

    EPA Science Inventory

    Traditional environmental mold analysis is based-on microscopic observations and counting of mold structures collected from the air on a sticky surface or culturing of molds on growth media for identification and quantification. A DNA-based method of mold analysis called mol...

  5. Indoor Molds and Respiratory Hypersensitivity: A Comparison of Selected Molds and House Dust Mite Induced Responses in a Mouse Model**

    EPA Science Inventory

    Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases. Damp/moldy environments have been associated with asthma exacerbation, but mold's role in allergic asthma induction is less clear. The molds selected for these studies are commonl...

  6. Molding apparatus. [for thermosetting plastic compositions

    NASA Technical Reports Server (NTRS)

    Heier, W. C. (Inventor)

    1974-01-01

    Apparatus for compression molding of thermosetting plastics compositions including interfitting hollow male and female components is reported. The components are adapted to be compressed to form a rocket nozzle in a cavity. A thermal jacket is provided exteriorly adjacent to the female component for circulating a thermal transfer fluid to effect curing of a thermosetting plastics material being molded. Each of the male and female components is provided with suitable inlets and outlets for circulating a thermal transfer fluid.

  7. TOPICAL REVIEW: Review on micro molding of thermoplastic polymers

    NASA Astrophysics Data System (ADS)

    Heckele, M.; Schomburg, W. K.

    2004-03-01

    Molding of micro components from thermoplastic polymers has become a routinely used industrial production process. This paper describes both the more than 30-year-old history and the present state of development and applications. Hot embossing, injection molding, reaction injection molding, injection compression molding, thermoforming, and various types of tool fabrication are introduced and their advantages and drawbacks are discussed. In addition, design considerations, process limitations, and commercially available micro molding machines are presented.

  8. Mold contamination and air handling units.

    PubMed

    Wilson, Stephen C; Palmatier, Robert N; Andriychuk, Larysa A; Martin, Jared M; Jumper, Cynthia A; Holder, Homer W; Straus, David C

    2007-07-01

    An investigation was conducted on selected locations in air handling units (AHUs) to (a) identify common mold species found on these locations, (b) determine whether some locations (and subsets) featured mold growth sites more frequently than others, (c) ascertain whether the operating condition of AHUs is related to mold contamination, and (d) provide a basis for a microbial sampling protocol for AHUs. A total of 566 tape lifts and 570 swab samples were collected from the blower wheel fan blades, insulation, cooling coil fins, and ductwork from 25 AHUs. All AHU conditions were numerically rated using a heating, ventilation and air-conditioning (HVAC) survey. Results showed that Cladosporium sp. fungi were commonly recovered in terms of growth sites and deposited spores, and they were found mainly in the blower wheel fan blades, the ductwork, and the cooling coil fins. Subsections of the fan blades, insulation, and cooling coil fins showed no preferred area for mold growth sites. Other organisms such as Penicillium sp., Aspergillus sp., and Paecilomyces sp. were recovered from the cooling coil fins and insulation. Because of the widespread prevalence of Cladosporium sp., there was no relationship between mold growth and operating condition. However, the presence of different species of molds in locations other than the blower wheel blades may indicate that the AHU condition is not optimal. A suggested microbial sampling protocol including interpretations of sample results is presented.

  9. Integrated mold/surface-micromachining process

    SciTech Connect

    Barron, C.C.; Fleming, J.G.; Montague, S.; Sniegowski, J.J.; Hetherington, D.L.

    1996-03-01

    We detail a new monolithically integrated silicon mold/surface-micromachining process which makes possible the fabrication of stiff, high-aspect-ratio micromachined structures integrated with finely detailed, compliant structures. An important example, which we use here as our process demonstration vehicle, is that of an accelerometer with a large proof mass and compliant suspension. The proof mass is formed by etching a mold into the silicon substrate, lining the mold with oxide, filling it with mechanical polysilicon, and then planarizing back to the level of the substrate. The resulting molded structure is recessed into the substrate, forming a planar surface ideal for subsequent processing. We then add surface-micromachined springs and sense contacts. The principal advantage of this new monolithically integrated mold/surface-micromachining process is that it decouples the design of the different sections of the device: In the case of a sensitive accelerometer, it allows us to optimize independently the proof mass, which needs to be as large, stiff, and heavy as possible, and the suspension, which needs to be as delicate and compliant as possible. The fact that the high-aspect-ratio section of the device is embedded in the substrate enables the monolithic integration of high-aspect-ratio parts with surface-micromachined mechanical parts, and, in the future, also electronics. We anticipate that such an integrated mold/surface micromachining/electronics process will offer versatile high-aspect-ratio micromachined structures that can be batch-fabricated and monolithically integrated into complex microelectromechanical systems.

  10. Gating of Permanent Molds for Aluminum Casting

    SciTech Connect

    David Schwam; John F. Wallace; Tom Engle; Qingming Chang

    2004-01-01

    This report summarizes a two-year project, DE-FC07-011D13983 that concerns the gating of aluminum castings in permanent molds. The main goal of the project is to improve the quality of aluminum castings produced in permanent molds. The approach taken was to determine how the vertical type gating systems used for permanent mold castings can be designed to fill the mold cavity with a minimum of damage to the quality of the resulting casting. It is evident that somewhat different systems are preferred for different shapes and sizes of aluminum castings. The main problems caused by improper gating are entrained aluminum oxide films and entrapped gas. The project highlights the characteristic features of gating systems used in permanent mold aluminum foundries and recommends gating procedures designed to avoid common defects. The study also provides direct evidence on the filling pattern and heat flow behavior in permanent mold castings. Equipment and procedure for real time X-Ray radiography of molten aluminum flow into permanent molds have been developed. Other studies have been conducted using water flow and behavior of liquid aluminum in sand mold using real time photography. This investigation utilizes graphite molds transparent to X-Rays making it possible to observe the flow pattern through a number of vertically oriented grating systems. These have included systems that are choked at the base of a rounded vertical sprue and vertical gating systems with a variety of different ingates into the bottom of a mold cavity. These systems have also been changed to include gating systems with vertical and horizontal gate configurations. Several conclusions can be derived from this study. A sprue-well, as designed in these experiments, does not eliminate the vena contracta. Because of the swirling at the sprue-base, the circulating metal begins to push the entering metal stream toward the open runner mitigating the intended effect of the sprue-well. Improved designs of

  11. Onychomycosis Due to Nondermatophytic Molds

    PubMed Central

    Hwang, Sung Min; Ha, Gyoung Yim

    2012-01-01

    Background Although there have been many studies about onychomycosis due to nondermatophytic molds (NDM), few studies about etiologic agents including NDM in onychomycosis have been reported in Korea. Objective: This study investigated onychomycosis due to NDM in the Gyeongju area of Korea. Objective This study investigated onychomycosis due to NDM in the Gyeongju area of Korea. Methods In the 10-year period from 1999~2009, we reviewed 59 patients with onychomycosis due to NDM. The etiologic agents were identified by cultures on Sabouraud's Dextrose agar with and without cycloheximide. In some cases, internal transcribed spacer sequence analysis was done. NDM isolated considered pathogens when the presence of fungal elements was identified by direct microscopy observation and in follow-up cultures yielding the same fungi. Results Onychomycosis due to NDM comprised 2.3% of all onychomycosis. Of the 59 patients with onychomycosis due to NDM, 84.7% were toenail onychomycosis and 15.3% were fingernail onychomycosis. The incidence rate was highest in the fifth decade (27.1%). The ratio of male to female patients was 1:1.6. The frequency of associated diseases, in descending order, was hypertension, diabetes mellitus, and cerebral hematoma. Distal and lateral subungual onychomycosis (86.4%) was the most common clinical type of onychomycosis. Aspergillus spp. was the most frequently isolated etiologic agent of onychomycosis due to NDM (83.0%). Other causative agents were Scopulariopsis brevicaulis (10.2%), Acremonium spp. (3.4%), Fusarium solani (1.7%), and Chaetomium globosum (1.7%). Conclusion Because of the increase in onychomycosis due to NDM, we suggest the need of a careful mycological examination in patients with onychomycosis. PMID:22577268

  12. A simple multiplex polymerase chain reaction assay for the identification of four environmentally relevant fungal contaminants.

    PubMed

    Dean, Timothy R; Roop, Barbara; Betancourt, Doris; Menetrez, Marc Y

    2005-04-01

    Historically, identification of filamentous fungal (mold) species has been based on morphological characteristics, both macroscopic and microscopic. These methods may often be time-consuming and inaccurate, necessitating the development of identification protocols that are rapid, sensitive, and precise. The polymerase chain reaction (PCR) has shown great promise in its ability to identify and quantify individual organisms from a mixed culture environment; however, the cost effectiveness of single organism PCR reactions is quickly becoming an issue. Our laboratory has developed a simple method to identify multiple fungal species, Stachybotrys chartarum, Aspergillus versicolor, Penicillium purpurogenum, and Cladosporium spp. by performing multiplex PCR and distinguishing the different reaction products by their mobility during agarose gel electrophoresis. The amplified genes include the beta-Tubulin gene from A. versicolor, the Tri5 gene from S. chartarum, and ribosomal sequences from both P. purpurogenum and Cladosporium spp. This method was found to be both rapid and easy to perform, while maintaining high sensitivity and specificity for characterizing isolates, even from a mixed culture.

  13. Effects of mold geometry on fiber orientation of powder injection molded metal matrix composites

    SciTech Connect

    Ahmad, Faiz Aslam, Muhammad Altaf, Khurram Shirazi, Irfan

    2015-07-22

    Fiber orientations in metal matrix composites have significant effect on improving tensile properties. Control of fiber orientations in metal injection molded metal composites is a difficult task. In this study, two mold cavities of dimensions 6x6x90 mm and 10x20x180 mm were used for comparison of fiber orientation in injection molded metal composites test parts. In both mold cavities, convergent and divergent flows were developed by modifying the sprue dimensions. Scanning electron microscope (SEM) was used to examine the fiber orientations within the test samples. The results showed highly aligned fiber in injection molded test bars developed from the convergent melt flow. Random orientation of fibers was noted in the composites test bars produced from divergent melt flow.

  14. Injection molding simulation with variothermal mold temperature control of highly filled polyphenylene sulfide

    NASA Astrophysics Data System (ADS)

    Birkholz, A.; Tschiersky, M.; Wortberg, J.

    2015-05-01

    For the installation of a fuel cell stack to convert chemical energy into electricity it is common to apply bipolar plates to separate and distribute reaction gases and cooling agents. For reducing manufacturing costs of bipolar plates a fully automated injection molding process is examined. The high performance thermoplastic matrix material, polyphenylene sulfide (PPS), defies against the chemical setting and the operation temperature up to 200 °C. To adjust also high electrical and thermal conductivity, PPS is highly filled with various carbon fillers up to an amount of 65 percentage by volume. In the first step two different structural plates (one-sided) with three different gate heights and molds are designed according to the characteristics of a bipolar plate. To cope with the approach that this plate should be producible on standard injection molding machines with variothermal mold temperature control, injection molding simulation is used. Additionally, the simulation should allow to formulate a quality prediction model, which is transferrable to bipolar plates. Obviously, the basis for a precise simulation output is an accurate description of the material properties and behavior of the highly filled compound. This, the design of the structural plate and mold and the optimization via simulation is presented, as well. The influence of the injection molding process parameters, e.g. injection time, cycle times, packing pressure, mold temperature, and melt temperature on the form filling have been simulated to determine optimal process conditions. With the aid of the simulation and the variothermal mold temperature control it was possible to reduce the required melt temperature below the decomposition temperature of PPS. Thereby, hazardous decomposition products as hydrogen sulfide are obviated. Thus, the health of the processor, the longevity of the injection molding machine as well as the material and product properties can be protected.

  15. The research of UV curing injection molding

    NASA Astrophysics Data System (ADS)

    Xie, Pengcheng; Chang, Le; Song, Le; Cai, Tianze; Ding, Yumei; Yang, Weimin

    2015-05-01

    The micro-injection molding technology and the UV (ultraviolet) curing technique are combined to bring about a new plastic forming method, UV curing injection molding. The mean weight of micro-product is an important process characteristic for UV curing injection molding as well as the surface quality of micro-features is another important process characteristic for this new plastic forming method. This research investigates three effects of processing factors on the mass-change rate of micro-product and the surface quality of micro-features. In every particular, the following two factors are considered: UV material system temperature and the packing pressure. The study revealed that as usual, the micro-products gain weight with the imported increasing UV material system temperature and the improved packing pressure. Meanwhile, the increasing packing pressure also improves the surface quality, yet, warming the UV system temperature up has no effect on the quality of the product.

  16. High rate fabrication of compression molded components

    DOEpatents

    Matsen, Marc R.; Negley, Mark A.; Dykstra, William C.; Smith, Glen L.; Miller, Robert J.

    2016-04-19

    A method for fabricating a thermoplastic composite component comprises inductively heating a thermoplastic pre-form with a first induction coil by inducing current to flow in susceptor wires disposed throughout the pre-form, inductively heating smart susceptors in a molding tool to a leveling temperature with a second induction coil by applying a high-strength magnetic field having a magnetic flux that passes through surfaces of the smart susceptors, shaping the magnetic flux that passes through surfaces of the smart susceptors to flow substantially parallel to a molding surface of the smart susceptors, placing the heated pre-form between the heated smart susceptors; and applying molding pressure to the pre-form to form the composite component.

  17. Ultrasonically-assisted Polymer Molding: An Evaluation

    NASA Astrophysics Data System (ADS)

    Moles, Matthew; Roy, Anish; Silberschmidt, Vadim

    Energy reduction in extrusion and injection molding processes can be achieved by the introduction of ultrasonic energy. Polymer flow can be enhanced on application of ultrasonic vibration, which can reduce the thermal and pressure input requirements to produce the same molding; higher productivity may also be achieved. In this paper, a design of an ultrasound-assisted injection mold machine is explored. An extrusion-die design was augmented with a commercial 1.5 kW ultrasonic transducer and sonotrode designed to resonate close to 20 kHz with up to 100 μm vibration amplitude. The design was evaluated with modal and thermal analysis using finite-element analysis software. The use of numerical techniques, including computational fluid dynamics, fluid-structure interaction and coupled Lagrangian-Eulerian method, to predict the effect of ultrasound on polymer flow was considered. A sonotrode design utilizing ceramic to enhance thermal isolation was also explored.

  18. Method for encapsulating hazardous wastes using a staged mold

    DOEpatents

    Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

    1989-01-01

    A staged mold and method for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

  19. Numerical recipes for mold filling simulation

    SciTech Connect

    Kothe, D.; Juric, D.; Lam, K.; Lally, B.

    1998-07-01

    Has the ability to simulate the filling of a mold progressed to a point where an appropriate numerical recipe achieves the desired results? If results are defined to be topological robustness, computational efficiency, quantitative accuracy, and predictability, all within a computational domain that faithfully represents complex three-dimensional foundry molds, then the answer unfortunately remains no. Significant interfacial flow algorithm developments have occurred over the last decade, however, that could bring this answer closer to maybe. These developments have been both evolutionary and revolutionary, will continue to transpire for the near future. Might they become useful numerical recipes for mold filling simulations? Quite possibly. Recent progress in algorithms for interface kinematics and dynamics, linear solution methods, computer science issues such as parallelization and object-oriented programming, high resolution Navier-Stokes (NS) solution methods, and unstructured mesh techniques, must all be pursued as possible paths toward higher fidelity mold filling simulations. A detailed exposition of these algorithmic developments is beyond the scope of this paper, hence the authors choose to focus here exclusively on algorithms for interface kinematics. These interface tracking algorithms are designed to model the movement of interfaces relative to a reference frame such as a fixed mesh. Current interface tracking algorithm choices are numerous, so is any one best suited for mold filling simulation? Although a clear winner is not (yet) apparent, pros and cons are given in the following brief, critical review. Highlighted are those outstanding interface tracking algorithm issues the authors feel can hamper the reliable modeling of today`s foundry mold filling processes.

  20. Mold Simulator Study of Heat Transfer Phenomenon During the Initial Solidification in Continuous Casting Mold

    NASA Astrophysics Data System (ADS)

    Zhang, Haihui; Wang, Wanlin

    2017-01-01

    In this paper, mold simulator trials were firstly carried out to study the phenomena of the initial shell solidification of molten steel and the heat transfer across the initial shell to the infiltrated mold/shell slag film and mold. Second, a one-dimensional inverse heat transfer problem for solidification (1DITPS) was built to determine the temperature distribution and the heat transfer behavior through the solidifying shell from the measured shell thickness. Third, the mold wall temperature field was recovered by a 2DIHCP mathematical model from the measured in-mold wall temperatures. Finally, coupled with the measured slag film thickness and the calculations of 1DITPS and 2DIHCP, the thermal resistance and the thickness of liquid slag film in the vicinity of the meniscus were evaluated. The experiment results show that: the total mold/shell thermal resistance, the mold/slag interfacial thermal resistance, the liquid film thermal resistance, and the solid film thermal resistance is 8.0 to 14.9 × 10-4, 2.7 to 4.8 × 10-4, 1.5 to 4.6 × 10-4, and 3.9 to 6.8 × 10-4 m2 K/W, respectively. The percentage of mold/slag interfacial thermal resistance, liquid film thermal resistance, and solid film thermal resistance over the total mold/shell thermal resistance is 27.5 to 34.4, 17.2 to 34.0, and 38.5 to 48.8 pct, respectively. The ratio of radiation heat flux is around 14.1 to 51.9 pct in the liquid slag film.

  1. Mold Simulator Study of Heat Transfer Phenomenon During the Initial Solidification in Continuous Casting Mold

    NASA Astrophysics Data System (ADS)

    Zhang, Haihui; Wang, Wanlin

    2017-04-01

    In this paper, mold simulator trials were firstly carried out to study the phenomena of the initial shell solidification of molten steel and the heat transfer across the initial shell to the infiltrated mold/shell slag film and mold. Second, a one-dimensional inverse heat transfer problem for solidification (1DITPS) was built to determine the temperature distribution and the heat transfer behavior through the solidifying shell from the measured shell thickness. Third, the mold wall temperature field was recovered by a 2DIHCP mathematical model from the measured in-mold wall temperatures. Finally, coupled with the measured slag film thickness and the calculations of 1DITPS and 2DIHCP, the thermal resistance and the thickness of liquid slag film in the vicinity of the meniscus were evaluated. The experiment results show that: the total mold/shell thermal resistance, the mold/slag interfacial thermal resistance, the liquid film thermal resistance, and the solid film thermal resistance is 8.0 to 14.9 × 10-4, 2.7 to 4.8 × 10-4, 1.5 to 4.6 × 10-4, and 3.9 to 6.8 × 10-4 m2 K/W, respectively. The percentage of mold/slag interfacial thermal resistance, liquid film thermal resistance, and solid film thermal resistance over the total mold/shell thermal resistance is 27.5 to 34.4, 17.2 to 34.0, and 38.5 to 48.8 pct, respectively. The ratio of radiation heat flux is around 14.1 to 51.9 pct in the liquid slag film.

  2. Manufacturing Science of Improved Molded Optics

    DTIC Science & Technology

    2013-12-05

    Forrer, “Interaction of N-FK5 and L- BAL35 optical glass with various carbide and other precision glass mold tooling”, SPIE Optifab 2013 Conference...Richardson, S. Mourad, M. Huber, A. Kunz, M. Forrer. Interaction of N-FK5 and L-BAL35 optical glass with various carbide and other precision glass mold...stoichiometric compounds. As an example, if silicon and oxygen are present in a material, then it was assumed that they are present in the form of

  3. Relationship Between Casting Distortion, Mold Filling, and Interfacial Heat Transfer in Sand Molds

    SciTech Connect

    J. K. Parker; K. A. Woodbury; T. S. Piwonka; Y. Owusu

    1999-09-30

    This project sought to determine the relationship between casting dimensions and interfacial heat transfer in aluminum alloy sand castings. The program had four parts; measurement of interfacial heat transfer coefficients in resin bonded and green sand molds, the measurement of gap formation in these molds, the analysis of castings made in varying gatings, orientations and thicknesses, and the measurement of residual stresses in castings in the as-cast and gate removed condition. New values for interfacial heat transfer coefficients were measured, a novel method for gap formation was developed, and the variation of casting dimensions with casting method, gating, and casting orientation in the mold was documented.

  4. Chemotaxis in the Plasmodial Slime Mold, Physarum polycephalum.

    ERIC Educational Resources Information Center

    Bozzone, Donna M.; Martin, Denise A.

    1998-01-01

    Describes a biology unit designed so that students pose their own questions and perform experiments to answer these questions. Plasmodial slime mold is employed as the focus of the study with background information about the mold provided. (DDR)

  5. INTERIOR VIEW WITH CORE SET IN MOLD HALF IN BOX ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR VIEW WITH CORE SET IN MOLD HALF IN BOX FLOOR AREA. AWAITING OTHER MOLD HALF TO BE PLACED ON TOP. - Stockham Pipe & Fittings Company, Ductile Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  6. Looking east inside of the ingot mold stripeer building at ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Looking east inside of the ingot mold stripeer building at a mold being stripped from an ingot. - U.S. Steel Edgar Thomson Works, 44" Slab Mill, Along Monongahela River, Braddock, Allegheny County, PA

  7. HUNTER 20 MATCHPLATE MOLDING MACHINE 'SQUEEZING' BOTH HALVES OF A ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    HUNTER 20 MATCHPLATE MOLDING MACHINE 'SQUEEZING' BOTH HALVES OF A MOLD SURROUNDING A MATCHPLATE PATTERN, DENNIS GRAY OPERATOR. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  8. MOLD SPECIFIC QUANTITATIVE PCR FOR RAPID IDENTIFICATION AND ENUMERATION

    EPA Science Inventory

    There is growing awareness that indoor molds/fungi may be connected to such conditions as asthma, allergies, hemorrhaging, chronic rhinosinusitis, memory loss, and a symptom complex called sick-building-syndrome. In addition, molds cause frequently fatal nosocomical infections. ...

  9. 20. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON GREY IRON UNIT NO. 1 MOLD CONVEYOR. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  10. 19. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    19. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON GREY IRON UNIT NO. 1 MOLD CONVEYOR. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  11. MOLD MACHINE, BRASS FOUNDRY, USED TO COMPRESS CONDITIONED SAND IN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MOLD MACHINE, BRASS FOUNDRY, USED TO COMPRESS CONDITIONED SAND IN FLASKS OVER PATTERNS TO CREATE MOLD CAVITIES WHICH ARE LATER FILLED WITH MOLTEN BRONZE. - Stockham Pipe & Fittings Company, Brass Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  12. Exploring the problem of mold growth and the efficacy of various mold inhibitor methods during moisture sorption isotherm measurements.

    PubMed

    Yu, X; Martin, S E; Schmidt, S J

    2008-03-01

    Mold growth is a common problem during the equilibration of food materials at high relative humidity values using the standard saturated salt slurry method. Exposing samples to toluene vapor and mixing samples with mold inhibitor chemicals are suggested methods for preventing mold growth while obtaining isotherms. However, no published research was found that examined the effect of mold growth on isotherm performance or the efficacy of various mold inhibitor methods, including their possible effect on the physicochemical properties of food materials. Therefore, the objectives of this study were to (1) explore the effect of mold growth on isotherm performance in a range of food materials, (2) investigate the effectiveness of 4 mold inhibitor methods, irradiation, 2 chemical inhibitors (potassium sorbate and sodium acetate), and toluene vapor, on mold growth on dent corn starch inoculated with A. niger, and (3) examine the effect of mold inhibitor methods on the physicochemical properties of dent corn starch, including isotherm performance, pasting properties, gelatinization temperature, and enthalpy. Mold growth was found to affect starch isotherm performance by contributing to weight changes during sample equilibration. Among the 4 mold inhibitor methods tested, irradiation and toluene vapor were found to be the most effective for inhibiting growth of A. niger on dent cornstarch. However, both methods exhibited a significant impact on the starches' physiochemical properties, suggesting the need to probe the efficacy of other mold inhibitor methods and explore the use of new rapid isotherm instruments, which hamper mold growth by significantly decreasing measurement time.

  13. TRUFLO GONDOLA, USED WITH THE HUNTER 10 MOLDING MACHINE, OPERATES ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    TRUFLO GONDOLA, USED WITH THE HUNTER 10 MOLDING MACHINE, OPERATES THE SAME AS THE TWO LARGER TRUFLOS USED IN CONJUNCTION WITH THE TWO HUNTER 20S. EACH GONDOLA IS CONNECTED TO THE NEXT AND RIDES ON A SINGLE TRACK RAIL FROM MOLDING MACHINES THROUGH POURING AREAS CARRYING A MOLD AROUND TWICE BEFORE THE MOLD IS PUSHED OFF ONTO A VIBRATING SHAKEOUT CONVEYOR. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  14. 56. ORIGINAL MOLDS. THE MORAVIAN POTTERY AND TILE WORKS HAS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    56. ORIGINAL MOLDS. THE MORAVIAN POTTERY AND TILE WORKS HAS APPROXIMATELY 6,000 PLASTER MOLDS OF VARIOUS TYPES, INCLUDING THE DEEP CAVITY MOLDS IN THE CENTER OF THE PHOTOGRAPH. THESE MOLDS PRODUCED ALLEGORICAL FIGURES TO BE INSTALLED AROUND THE CORNICES OF PUBLIC SCHOOLS. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  15. Damage Tolerance of Resin Transfer Molded Composite Sandwich Constructions

    DTIC Science & Technology

    1999-05-01

    cost manufacturing techniques to produce panels included; resin transfer molding ( RTM ), vacuum assisted resin infusion/transfer molding ( VARTM ), co...analysis conducted revealed that in terms of failure characteristics, the RTM / VARTM processed sandwich composites yielded similar performance as those...injection VARTM and vacuum assisted compression molding (VACM). Detailed experimental impact studies were performed under three scenarios low velocity

  16. 1928 MALLEABLE FOUNDRY MOLD CONVEYOR #1 SHOWING CONVEYOR AND TRACK ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1928 MALLEABLE FOUNDRY MOLD CONVEYOR #1 SHOWING CONVEYOR AND TRACK ARRANGEMENTS WITH OVERHEAD POURING WEIGHTS THAT REST ON A MOLD'S TOP SURFACE TO ENSURE THAT IRON DOES NOT FLOW OUT OF THE MOLD WHEN IT IS BEING POURED THROUGH THE OPENING IN THE WEIGHT. - Stockham Pipe & Fittings Company, Malleable Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  17. Improved mold release for filled-silicone compounds

    NASA Technical Reports Server (NTRS)

    Accountius, O. E.

    1973-01-01

    Ceramic and filled-plastic materials used for fabrication of tiles are relatively brittle and easily break as they are being removed from molds. Dusting mold surfaces with commercially available glass microspheres provides mold release superior to existing spray releases. Glass-microsphere dusting also permits removal of uncured tile which has very little strength.

  18. 17. INTERIOR VIEW WITH GREY UNIT NO. 1 MOLD CONVEYOR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. INTERIOR VIEW WITH GREY UNIT NO. 1 MOLD CONVEYOR SHOWING CHAIN HELD WEIGHTS THAT TRAVEL AT THE SAME SPEED AS THE CONVEYOR AND REST ON COMPLETED MOLDS TO HOLD THE SAND SEAMS TOGETHER AS MOLTED IRON IS POURED INTO THE MOLD CAVITY. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  19. HUNTER 20 MATCHPLATE MOLDING MACHINE, OPERATING THE SAME AS THE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    HUNTER 20 MATCHPLATE MOLDING MACHINE, OPERATING THE SAME AS THE HUNTER 10 AND OTHER HUNTER 20 COMPRESSES BOTH MOLD HALVES OVER A DOUBLE-SIDED MATCH PLATE PATTERN. DENNIS GRAY TESTS A MOLD'S HARDNESS TO ENSURE SAND MIXTURE AND MACHINE COMPRESSIBILITY ARE CORRECT. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  20. 14. INTERIOR VIEW WITH JOHNNY TAYLOR REMOVING A MOLD HALF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. INTERIOR VIEW WITH JOHNNY TAYLOR REMOVING A MOLD HALF FROM THE PATTERN ON THE MOLDING MACHINE, REVEALING THE CAVITY THAT WILL BE FILLED WITH MOLTEN IRON AFTER IT IS ASSEMBLED WITH THE OTHER MOLD HALF INSIDE GREY IRON UNIT NO. 1. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  1. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Middle ear mold. 874.3430 Section 874.3430 Food... DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  2. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Middle ear mold. 874.3430 Section 874.3430 Food... DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  3. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Middle ear mold. 874.3430 Section 874.3430 Food... DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  4. Molding cork sheets to complex shapes

    NASA Technical Reports Server (NTRS)

    Sharpe, M. H.; Simpson, W. G.; Walker, H. M.

    1977-01-01

    Partially cured cork sheet is easily formed to complex shapes and then final-cured. Temperature and pressure levels required for process depend upon resin system used and final density and strength desired. Sheet can be bonded to surface during final cure, or can be first-formed in mold and bonded to surface in separate step.

  5. Photorefractive polymer composites fabricated by injection molding

    NASA Astrophysics Data System (ADS)

    Herlocker, J. A.; Fuentes-Hernandez, C.; Wang, J. F.; Peyghambarian, N.; Kippelen, B.; Zhang, Q.; Marder, S. R.

    2002-02-01

    We report on the fabrication of bulk samples of photorefractive polymers using the injection molding technique. The photorefractive properties of these materials are evaluated by four-wave mixing and two-beam coupling experiments. Samples with good optical quality, high diffraction efficiency, and net optical gain are obtained.

  6. Onychomycosis by molds. Report of 78 cases.

    PubMed

    Bonifaz, Alexandro; Cruz-Aguilar, Pamela; Ponce, Rosa María

    2007-01-01

    A retrospective study of onychomycohosis by molds was carried out during a 14-year period (1992-2005). All cases were clinically and mycologically proven (repetitive KOH and culture) and then each of the molds was identified. A total of 5,221 cases of onychomycosis were evaluated, 78 of which were molds (1.49%). Mean patient age was 44.1 years. 75/78 cases occurred in toenails. Associated factors were detected in 39/78 (50.0%) cases, with the major ones being: peripheral vascular disease, contact with soil, and trauma. The most frequent clinical presentation was distal and lateral subungual onychomycosis (DLSO), in 54/78 cases (69%). The most frequent causative agents were: Scopulariopsis brevicaulis in 34/78 cases and Aspergillus niger in 13/78 cases. Onychomycoses by molds are infrequent; in this study they accounted for 1.49% of cases. The clinical features are virtually similar to those caused by dermatophytes, which makes the clinicomycological tests necessary.

  7. Neuropsychological exploration of alleged mold neurotoxicity.

    PubMed

    Reinhard, Matthew J; Satz, Paul; Scaglione, Cris A; D'Elia, Louis F; Rassovsky, Yuri; Arita, Anthony A; Hinkin, Charles H; Thrasher, Delaney; Ordog, Gary

    2007-05-01

    Cognitive and emotional correlates of toxic mold exposure and potential dose-response effects for both outcomes were investigated. Self-reported length of exposure, time since last exposure, and serum immunoglobulin (IgG) levels were assessed. Despite CNS complaints often seen with mold exposed individuals, overall results did not uncover concomitant cognitive deficits suggested in previous studies or a significant reduction in intellectual functioning. Fewer subjects were excluded as result of failing effort/motivation assessment than expected. Correlations of IgG and cognitive function are discussed. A dose-effect for self-reported length of exposure and cognitive outcome was not seen. The sample's overall Minnesota Multiphasic Personality Inventory II (MMPI-2) profile indicated elevations on scales 1, 2, 3, 7 and 8. MMPI-2 clinical scales 1 and 3 were significantly correlated with length of exposure. The MMPI-2 may be sensitive to increasing physical and emotional sequelae as length of exposure increases. A potential subgroup of cognitively impaired outliers within mold exposure litigants is explored. Limitations of self-reported and objective measurements for mold exposure and exploratory statistical methodology are discussed.

  8. Bell X-5 Model and Molds

    NASA Technical Reports Server (NTRS)

    1953-01-01

    A Langley model maker examines the molds used to form a model of the Bell X-5, a variable sweep craft that first flew in June of 1951. Photograph published in Winds of Change, 75th Anniversary NASA publication (page 64), by James Schultz.

  9. A REVOLUTION IN MOLD IDENTIFICATION AND ENUMERATION

    EPA Science Inventory

    More than 100 assay were developed to identify and quantify indoor molds using quantitiative PCR (QPCR) assays. This technology incorporates fluorigenic 5' nuclease (TaqMan�) chemistry directed at the nuclear ribosomal RNA operon internal transcribed spacer regions (ITS1 or ITS2...

  10. Flexible Interior-Impression-Molding Tray

    NASA Technical Reports Server (NTRS)

    Anders, Jeffrey E.

    1991-01-01

    Device used inside combustion chamber of complicated shape for nondestructive evaluation of qualities of welds, including such features as offset, warping, misalignment of parts, and dropthrough. Includes flexible polypropylene tray trimmed to fit desired interior surface contour. Two neodymium boron magnets and inflatable bladder attached to tray. Tray and putty inserted in cavity to make mold of interior surface.

  11. Mold Die Making. 439-322/324.

    ERIC Educational Resources Information Center

    Yunke, P.; And Others

    Each unit in this curriculum guide on mold die making contains an introduction, objectives, materials required, lessons, space for notes, figures, and diagrams. There are 10 units in this guide: (1) introduction to Electrical Discharge Machining (EDM); (2) EDM principles; (3) the single pulse; (4) EDM safety; (5) electrode material; (6) electrode…

  12. An Education Belief Worth Reflection: Molding Intellectuals

    ERIC Educational Resources Information Center

    Lu, Jie

    2006-01-01

    Molding intellectuals is one of the expectations people have, which comes from a deep-rooted belief in education. The humanity hypothesis of this belief is to take knowledge and the pursuit of knowledge as the only prescription for human beings. This hypothesis overturns the relation of knowledge and life. Intellectuals make scientific paradigm as…

  13. Molding Compound For Inspection Of Internal Contours

    NASA Technical Reports Server (NTRS)

    Adams, Jim; Ricklefs, Steve

    1988-01-01

    Material clean, sets rapidly, and easy to use. Silicone elastomer, Citrocon or equivalent, commonly used in dentistry, in combination with mold-release agent (Also see MFS-29240), speeds and facilitates making of impressions of interior surfaces so surface contours examined. Elastomer easily moved around in cavity until required location found.

  14. Process for preparing sand cores and molds

    SciTech Connect

    Varnum, N.C.; Kraemer, J.F.

    1984-11-27

    An improved process for preparing foundry cores and molds using a foundry aggregate and a binder therefor wherein the aggregate is mixed with an aqueous suspension of cereal flour and then with a core oil, the improvement comprising mixing the aggregate with phosphoric acid or sulfuric acid before mixing with the aqueous suspension of the cereal flour.

  15. Illinois Occupational Skill Standards: Plastics Molding Cluster.

    ERIC Educational Resources Information Center

    Illinois Occupational Skill Standards and Credentialing Council, Carbondale.

    This document, which is intended to serve as a guide for work force preparation program providers, details the Illinois occupational skill standards for programs preparing students for employment in jobs in the plastics molding industry. Agency partners involved in this project include: the Illinois State Board of Education, Illinois Community…

  16. Clinical reactivity to ingestion challenge with mixed mold extract may be enhanced in subjects sensitized to molds.

    PubMed

    Luccioli, Stefano; Malka-Rais, Jonathan; Nsouli, Talal M; Bellanti, Joseph A

    2009-01-01

    Manifestations of mold allergy are classically associated with inhalation of mold spores leading to symptoms of asthma and other respiratory illnesses. It is largely unknown, however, whether ingestion of aeroallergenic molds, mold spores, or other fungi found in food can also elicit hypersensitivity reactions in mold-sensitive individuals. The aim of this study was to evaluate the association between exposure to molds by oral challenge and elicitation of symptoms in mold- versus nonmold-sensitive individuals. Thirty-four adult atopic subjects were randomized into mold-sensitive groups based on skin test reactivity by skin percutaneous testing (SPT) and/or intradermal (ID) testing to a mixed mold (MM) extract preparation. All subjects underwent a single-blinded, placebo-controlled food challenge to the MM preparation. A modified scoring system was used to grade the clinical severity of symptoms elicited by challenge. All subjects tolerated challenges to the maximal oral mold dose concentration. However, higher symptom scores after challenge were found in mold-sensitive subjects compared with nonmold-sensitive subjects (p = 0.01). When mold-sensitive subjects were compared based on SPT and/or ID reactivity, higher symptom scores and lower symptom-eliciting concentrations of mold were associated with the SPT reactive subgroup compared with the subgroup with ID reactivity alone. In summary, based on our challenge results and scoring model, mold-sensitive subjects compared with nonmold-sensitive subjects experienced cumulatively higher symptom scores after oral challenge to an MM extract preparation. Future studies are warranted to confirm whether ingestion of aeroallergenic molds in food may be another contributor to symptoms in mold-sensitive individuals.

  17. Matched metal die compression molded structural random fiber sheet molding compound flywheel

    DOEpatents

    Kulkarni, Satish V.; Christensen, Richard M.; Toland, Richard H.

    1985-01-01

    A flywheel (10) is described that is useful for energy storage in a hybrid vehicle automotive power system or in some stationary applications. The flywheel (10) has a body of essentially planar isotropic high strength structural random fiber sheet molding compound (SMC-R). The flywheel (10) may be economically produced by a matched metal die compression molding process. The flywheel (10) makes energy intensive efficient use of a fiber/resin composite while having a shape designed by theory assuming planar isotropy.

  18. Matched metal die compression molded structural random fiber sheet molding compound flywheel. [Patent application

    DOEpatents

    Kulkarni, S.V.; Christensen, R.M.; Toland, R.H.

    1980-09-24

    A flywheel is described that is useful for energy storage in a hybrid vehicle automotive power system or in some stationary applications. The flywheel has a body of essentially planar isotropic high strength structural random fiber sheet molding compound (SMC-R). The flywheel may be economically produced by a matched metal die compression molding process. The flywheel makes energy intensive efficient use of a fiber/resin composite while having a shape designed by theory assuming planar isotropy.

  19. Indoor Molds and Respiratory Hypersensitivity: A Comparison of Selected Molds and House Dust Mite Induced Responses in a Mouse Model

    EPA Science Inventory

    Introduction/Study Goal Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases including allergic lung diseases. The Institute of Medicine reports and WHO gUidelines concluded that the role of molds in asthma induction is not clear bu...

  20. Pressurized Shell Molds For Metal-Matrix Composites

    NASA Technical Reports Server (NTRS)

    Kashalikar, Uday K.; Lusignea, Richard N.; Cornie, James

    1993-01-01

    Balanced-pressure molds used to make parts in complex shapes from fiber-reinforced metal-matrix composite materials. In single step, molding process makes parts in nearly final shapes; only minor finishing needed. Because molding pressure same on inside and outside, mold does not have to be especially strong and can be made of cheap, nonstructural material like glass or graphite. Fibers do not have to be cut to conform to molds. Method produces parts with high content of continuous fibers. Parts stiff but light in weight, and coefficients of thermal expansion adjusted. Parts resistant to mechanical and thermal fatigue superior to similar parts made by prior fabrication methods.

  1. Testing single point incremental forming molds for thermoforming operations

    NASA Astrophysics Data System (ADS)

    Afonso, Daniel; de Sousa, Ricardo Alves; Torcato, Ricardo

    2016-10-01

    Low pressure polymer processing processes as thermoforming or rotational molding use much simpler molds then high pressure processes like injection. However, despite the low forces involved with the process, molds manufacturing for this operations is still a very material, energy and time consuming operation. The goal of the research is to develop and validate a method for manufacturing plastically formed sheets metal molds by single point incremental forming (SPIF) operation for thermoforming operation. Stewart platform based SPIF machines allow the forming of thick metal sheets, granting the required structural stiffness for the mold surface, and keeping the short lead time manufacture and low thermal inertia.

  2. A comparison of molding procedures - Contact, injection and vacuum injection

    NASA Astrophysics Data System (ADS)

    Cathiard, G.

    1980-06-01

    The technical and economic aspects of the contact, injection and vacuum injection molding of reinforced plastic components are compared for the example of a tractor roof with a gel-coated surface. Consideration is given to the possibility of reinforcement, number of smooth faces, condition of the gel-coated surface, reliability, and labor and workplace requirements of the three processes, and advantages of molding between the mold and a countermold in smooth faces, reliability, labor requirements, working surface and industrial hygiene are pointed out. The times and labor requirements of each step in the molding cycles are examined, and material requirements and yields, investment costs, amortization and product cost prices of the processes are compared. It is concluded that, for the specific component examined, the processes of vacuum injection and injection molding appear very interesting, with injection molding processes resulting in lower cost prices than contact molding for any production volume.

  3. Effect of process parameters on cavity pressure in injection molding

    NASA Astrophysics Data System (ADS)

    Wang, Quan; Zhen, Mengxiang; Wu, Zhenghuan; Cai, Yujun

    2017-03-01

    In this study, an experimental work is performed on the effect of injection molding parameters on the polymer pressure inside the mold cavity. Different process parameters of the injection molding are considered during the experimental work (packing pressure, packing time, injection pressure, mold temperature, and melt temperature). A set analyses are carried out by combining the process parameters based on the L16(45)Taguchi orthogonal design. The cavity pressure is measured with time by using Kistler pressure sensor at different injection molding cycles. The results show the packing pressure is significant factor of affecting the maximum of diverse spline cavity pressure. The results obtained specify well the developing of the cavity pressure inside the mold cavity during the injection molding cycles.

  4. Ultra-precision molding of chalcogenide glass aspherical lens

    NASA Astrophysics Data System (ADS)

    Zhang, Feng; Wang, Zhibin; Zhang, Yunlong; Su, Ying; Guo, Rui; Xu, Zengqi; Liu, Xuanmin

    2016-10-01

    With the development of infrared optical systems in military and civil areas, chalcogenide glass aspherical lens possess some advantages, such as large infrared transmission, good thermal stability performance and image quality. Aspherical lens using chalcogenide glass can satisfy the requirements of modern infrared optical systems. Therefore, precision manufacturing of chalcogenide glass aspheric has received more and more attention. The molding technology of chalcogenide glass aspheric has become a research hotspot, because it can achieve mass and low cost manufacturing. The article of molding technology is focusing on a kind of chalcogenide glass aspherical lens. We report on design and fabrication of the mold that through simulation analysis of molding. Finally, through molding test, the fabrication of mold's surface and parameters of molding has been optimized, ensuring the indicators of chalcogenide glass aspherical lens meet the requirements.

  5. Direct molding of pavement tiles made of ground tire rubber

    NASA Astrophysics Data System (ADS)

    Quadrini, Fabrizio; Gagliardi, Donatella; Tedde, Giovanni Matteo; Santo, Loredana; Musacchi, Ettore

    2016-10-01

    Large rubber products can be molded by using only ground tire rubber (GTR) without any additive or binder due to a new technology called "direct molding". Rubber granules and powders from tire recycling are compression molded at elevated temperatures and pressures. The feasibility of this process was clearly shown in laboratory but the step to the industrial scale was missing. Thanks to an European Project (SMART "Sustainable Molding of Articles from Recycled Tires") this step has been made and some results are reported in this study. The press used for compression molding is described. Some tests were made to measure the energy consumption so as to evaluate costs for production in comparison with conventional technologies for GTR molding (by using binders). Results show that 1 m2 tiles can be easily molded with several thicknesses in a reasonable low time. Energy consumption is higher than conventional technologies but it is lower than the cost for binders.

  6. Research of forming characteristic of precision glass molding

    NASA Astrophysics Data System (ADS)

    Wang, Zhibin; Li, Junqi; Qin, Hui; Zhang, Yunlong; Zhang, Feng; Su, Ying

    2016-10-01

    Chalcogenide glass is widely used in infrared area for its cheap and good performance of infrared transmittance. Compare with the traditional material signal crystal germanium, zinc sulfide, zinc selenide etc. Chalcogenide glass is suit for precision molding for the low soften temperature which is suit for large mass industry production. And precision glass molding(PGM) is a kind of technology involving the molding machine, mold material, the glass, molding parameters etc. So the researches on the forming characteristic of precision glass molding are necessary. In this paper, the FEM simulation is used to assist research of the forming characteristic, especially the friction coefficient effect on the forming. At the last the surface profile compensation and micro-replication of molding is discussed.

  7. Mold exposure and health effects following hurricanes Katrina and Rita.

    PubMed

    Barbeau, Deborah N; Grimsley, L Faye; White, LuAnn E; El-Dahr, Jane M; Lichtveld, Maureen

    2010-01-01

    The extensive flooding in the aftermath of Hurricanes Katrina and Rita created conditions ideal for indoor mold growth, raising concerns about the possible adverse health effects associated with indoor mold exposure. Studies evaluating the levels of indoor and outdoor molds in the months following the hurricanes found high levels of mold growth. Homes with greater flood damage, especially those with >3 feet of indoor flooding, demonstrated higher levels of mold growth compared with homes with little or no flooding. Water intrusion due to roof damage was also associated with mold growth. However, no increase in the occurrence of adverse health outcomes has been observed in published reports to date. This article considers reasons why studies of mold exposure after the hurricane do not show a greater health impact.

  8. Exposures to Molds in School Classrooms of Children with Asthma

    PubMed Central

    Baxi, Sachin N.; Muilenberg, Michael L.; Rogers, Christine A.; Sheehan, William J.; Gaffin, Jonathan; Permaul, Perdita; Kopel, Lianne S.; Lai, Peggy S.; Lane, Jeffrey P.; Bailey, Ann; Petty, Carter R.; Fu, Chunxia; Gold, Diane R.; Phipatanakul, Wanda

    2013-01-01

    Background Students spend a large portion of their day in classrooms which may be a source of mold exposure. We examined the diversity and concentrations of molds in inner-city schools and described differences between classrooms within the same school. Methods Classroom airborne mold spores, collected over a 2 day period, were measured twice during the school year by direct microscopy. Results There were 180 classroom air samples collected from 12 schools. Mold was present in 100% of classrooms. Classrooms within the same school had differing mold levels and mold diversity scores. The total mold per classroom was 176.6 ± 4.2 spores/m3 (geometric mean ± standard deviation) and ranged from 11.2 to 16,288.5 spores/m3. Mold diversity scores for classroom samples ranged from 1 to 19 (7.7 ± 3.5). The classroom accounted for the majority of variance (62%) in the total mold count, and for the majority of variance (56%) in the mold diversity score versus the school. The species with the highest concentrations and found most commonly included Cladosporium (29.3 ± 4.2 spores/m3), Penicillium/Aspergillus (15.0 ± 5.4 spores/m3), smut spores (12.6 ± 4.0 spores/m3), and basidiospores (6.6 ± 7.1 spores/m3). Conclusions Our study found that the school is a source of mold exposure, but particularly the classroom microenvironment varies in quantity of spores and species among classrooms within the same school. We also verified that visible mold may be a predictor for higher mold spore counts. Further studies are needed to determine the clinical significance of mold exposure relative to asthma morbidity in sensitized and non-sensitized asthmatic children. PMID:24112429

  9. Simulation of low carbon steel solidification and mold flux crystallization in continuous casting using a multi-mold simulator

    NASA Astrophysics Data System (ADS)

    Ko, Eun-Yi; Choi, Joo; Park, Jun-Yong; Sohn, Il

    2014-01-01

    An inverted water-cooled multi-mold continuous casting simulator was used to investigate initial solidification of low-carbon steels and crystallization of mold flux. Embedded mold thermocouples showed characteristic temperature profiles dependent on parameters including casting speed, oscillation frequency, and stroke. Higher maximum temperatures for thermocouples at higher casting speeds, higher frequencies, and lower stroke lengths were observed. The surface of the as-cast steel strips showed oscillation marks similar to those of industrially cast slabs and higher casting speeds resulted in shallower oscillation marks. The measured pitch agreed well with the theoretical pitch suggesting the multi-mold simulator to be a cost-effective alternative to pursue fundamental studies on initial solidification in the mold. Analysis of the mold flux taken between the copper mold and solidified steel shell showed highly dendritic uni-directional crystallization occurring within the flux film suggesting that the heat transfer direction is dominantly horizontal towards the water-cooled copper mold. In addition, the solidified flux located at the upper to lower part of the mold suggested morphological differences in the size and shape of the crystalline phases indicating that crystallization ratio can increase depending upon the retention in the mold and subsequently decrease radiative heat transfer as the flux traverses down the mold.

  10. MONITORING MYCOTOXIN PRODUCTION AT THE GENETIC LEVEL ON VARIOUS GROWTH SUBSTRATES USING QUANTITATIVE REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION?EXPERIMENT DESIGN

    EPA Science Inventory

    The paper describes a method of analyzing the production of mycotoxins at the genetic level by monitoring the intracellular levels of messenger RNA (mRNA). Initial work will focus on threshing out the mycotoxin gene clusters in Stachybotrys chartarum followed by analysis of toxin...

  11. Molds on Food: Are They Dangerous?

    MedlinePlus

    ... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Molds on Food: Are they dangerous? Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...

  12. Mechanical behaviors of molded pulp material

    NASA Astrophysics Data System (ADS)

    Ji, Hongwei; Wang, Huaiwen; Chen, Jinlong

    2008-11-01

    Many mechanical phenomena of interest for web-like materials, such as molded pulp, take place at the micro-scale. A SEM (scanning electron microscope) with SHIMADZU electrohydraulic servo experimental system was employed to study the micro-scale mechanical behavior of molded pulp materials. Uniaxial tension tests of molded pulp specimens were carried out, resulting in the stress-strain curves. Experimental results indicated that the material is not only elasticplastic, but also emplastic. The surface morphology evolution of the tensile specimen was visually monitored during the process of loading, and some SEM micrographs were captured under different load levels. Full-field deformations over an area of 190x170 μm2 were obtained using the digital image correlation method. The higher strains occurred at the fibre fines zone or around voids whereas the lower strains were obviously found at long fibres, demonstrating that the strain distribution is obviously uneven. The reason may be due to the random orientation and the fraction of the fibres, and the presence of impurities and voids as well.

  13. Characterization of airborne fungal levels after mold remediation.

    PubMed

    Kleinheinz, G T; Langolf, B M; Englebert, E

    2006-01-01

    The overall objective of this project was to evaluate levels of airborne fungi present after a mold remediation project and determine the effectiveness of this remediation using airborne mold levels to determine the success of these projects. Andersen N6 (viable) and Air-O-Cell (non-viable) sampling techniques were utilized. Both test methodologies demonstrated that levels of mold in the successfully remediated portions of buildings were significantly different (p<0.05) from the levels found in non-complaint and outdoor samples from the same building, respectively. Conversely, levels in unsuccessful remediation projects were not significantly different (p>0.05) to non-complaint and outdoor samples. Both techniques showed high variability in the overall mold levels found between sites; however, the ratios of specific mold groups in each area tested, within the same site, were remarkably similar. The use of either viable or non-viable mold sampling techniques after mold remediation is essential for determining the success of such projects. This project demonstrates the relationship between mold levels and the success of a mold remediation projects, and will assist in the interpretation of data collected at the conclusion of a mold remediation project.

  14. Heat pipe cooling of an aerospace foam mold manufacturing process

    SciTech Connect

    Hahn, D.R.; Feldman, K.T.; Marjon, P.L.

    1980-01-01

    A passive heat pipe cooling system was developed to cool a Bendix foam mold used to manufacture aerospace foam parts. The cooling system consists of ten copper-water heat pipes with cooling fins implanted into the aluminum mold and cooled by a domestic size fan blowing ambient air. The number and location of the heat pipes was determined to provide the most effective cooling and mold isothermalization based on experimental measurements of mold temperatures during the exothermic foaming process and from practical considerations of the mold geometry and use. Performance tests were cnducted on an individual heat pipe and on the ten heat pipes implanted in the mold. Both exothermic foam heating and internal electrical heat input were used in the experiments. The experimental test results indicate that the heat pipe cooling system with a fan is four to six times faster than free convection cooling of the mold with no heat pipes or fan and nearly twice as fast as cooling by the fan only. Similarly fast increases in mold heating time in the cure furnace could be realized if the heat pipes are used during this part of the production process. The heat pipes also cool hot spots in the mold and help isothermalize the mold so that better quality foam parts should be produced.

  15. Evacuated, displacement compression mold. [of tubular bodies from thermosetting plastics

    NASA Technical Reports Server (NTRS)

    Heier, W. C. (Inventor)

    1974-01-01

    A process of molding long thin-wall tubular bodies from thermosetting plastic molding compounds is described wherein the tubular body lengths may be several times the diameters. The process is accomplished by loading a predetermined quantity of molding compound into a female mold cavity closed at one end by a force mandrel. After closing the other end of the female mold with a balance mandrel, the loaded cavity is evacuated by applying a vacuum of from one-to-five mm pressure for a period of fifteen-to-thirty minutes. The mold temperature is raised to the minimum temperature at which the resin constituent of the compound will soften or plasticize and a pressure of 2500 psi is applied.

  16. Replication of the nano-scale mold fabricated with focused ion beam

    NASA Astrophysics Data System (ADS)

    Gao, J. X.; Chan-Park, M. B.; Xie, D. Z.; Ngoi, Bryan K. A.

    2004-12-01

    Silicon mold fabricated with Focused Ion Beam lithography (FIB) was used to make silicone elastomer molds. The silicon mold is composed of lattice of holes which the diameter and depth are about 200 nm and 60 nm, respectively. The silicone elastomer material was then used to replicate slavery mold. Our study show the replication process with the elastomer mold had been performed successfully and the diameter of humps on the elastomer mold is near to that of holes on the master mold. But the height of humps in the elastomer mold is only 42 nm and it is different from the depth of holes in the master mold.

  17. Advanced Polymer Composite Molding Through Intelligent Process Analysis and Control

    DTIC Science & Technology

    2007-03-30

    assisted resin transfer molding ( VARTM ) and Seemann Composite Resin Infusion Molding Process (SCRIMPT M). All variations of RTM are suitable for the...numerical simulations have been used to design the vent and gate locations for molds used for RTM , VARTM and SCRIMPTM [2,3,7-14]. Regardless of the research...200 Words) To prevent dry spot formation in RTM , a control interface and four different adaptive control algorithms were developed and tested with

  18. Three-dimensional pattern transfer and nanolithography: modified soft molding

    NASA Astrophysics Data System (ADS)

    Kim, Y. S.; Park, Joonhyung; Lee, Hong H.

    2002-08-01

    One-step transfer of molded three-dimensional polymer structures into underlying substrate is reported. The one-step transfer is made possible by a molding technique presented here in the form of modified soft molding. Formation of a desired three-dimensional structure in a polymer film by this method, followed by one-step reactive ion etching, is utilized for the transfer. The technique is also shown to be effective in transferring sub-100-nm features.

  19. Preliminary concepts for high-temperature mold heating and cooling

    SciTech Connect

    Larson, J.P.

    1990-12-01

    The feasibility and limitations of various methods for mold heating and cooling were investigated. Two methods were chosen for evaluation: electrical heating and water cooling, and electrical heating and heat pipe conduction cooling. A model mold of each method was built. Test results indicated that the electrical heating and circulated water cooling was the better method. An injection mold utilizing this method was fabricated and temperature-cycled between 300 and 770{degree}F. 1 ref., 2 figs., 7 tabs.

  20. Understanding the impact of molds on indoor air quality and ...

    EPA Pesticide Factsheets

    Molds are multi-celled, colony forming, eukaryotic microorganisms lacking chlorophyll belonging to the Kingdom Fungi. Furthermore, molds are ubiquitous in both indoor and outdoor environments. There are more than 200 different types of fungi to which people are routinely exposed (NAS. 2000). The growth of molds in homes, schools, offices, and other public buildings has been implicated as the cause of a wide variety of adverse health effects. Headlines resulting from moldy, water-damaged homes, particularly

  1. Design and development of injection molded Fresnel lenses for point-focus photovoltaic systems

    SciTech Connect

    Grendol, C.L.

    1987-05-01

    A summary of work performed on a method of injection molding an 80% efficient point-focus Fresnel lens is presented. A current optical design for compression molded lenses yields a 68.5% efficiency when translated directly to injection molding. An optical design optimized for injection molding, with a mold and process developed for high efficiency Fresnel lenses, yields an 82% efficiency.

  2. Pre-contamination of new gypsum wallboard with potentially harmful fungal species.

    PubMed

    Andersen, B; Dosen, I; Lewinska, A M; Nielsen, K F

    2017-01-01

    Gypsum wallboard is a popular building material, but is also very frequently overgrown by Stachybotrys chartarum after severe and/or undetected water damage. The purpose of this study was to determine whether Stachybotrys and other fungi frequently isolated from wet gypsum wallboard are already present in the panels directly from the factory. Surface-disinfected gypsum disks were wetted with sterile water, sealed, and incubated for 70 days. The results showed that Neosartorya hiratsukae (≡ Aspergillus hiratsukae) was the most dominant fungus on the gypsum wallboard followed by Chaetomium globosum and Stachybotrys chartarum. Our results suggest that these three fungal species are already embedded in the materials, presumably in the paper/carton layer surrounding the gypsum core, before the panels reach the retailers/building site.

  3. A hybrid optimization approach in non-isothermal glass molding

    NASA Astrophysics Data System (ADS)

    Vu, Anh-Tuan; Kreilkamp, Holger; Krishnamoorthi, Bharathwaj Janaki; Dambon, Olaf; Klocke, Fritz

    2016-10-01

    Intensively growing demands on complex yet low-cost precision glass optics from the today's photonic market motivate the development of an efficient and economically viable manufacturing technology for complex shaped optics. Against the state-of-the-art replication-based methods, Non-isothermal Glass Molding turns out to be a promising innovative technology for cost-efficient manufacturing because of increased mold lifetime, less energy consumption and high throughput from a fast process chain. However, the selection of parameters for the molding process usually requires a huge effort to satisfy precious requirements of the molded optics and to avoid negative effects on the expensive tool molds. Therefore, to reduce experimental work at the beginning, a coupling CFD/FEM numerical modeling was developed to study the molding process. This research focuses on the development of a hybrid optimization approach in Non-isothermal glass molding. To this end, an optimal configuration with two optimization stages for multiple quality characteristics of the glass optics is addressed. The hybrid Back-Propagation Neural Network (BPNN)-Genetic Algorithm (GA) is first carried out to realize the optimal process parameters and the stability of the process. The second stage continues with the optimization of glass preform using those optimal parameters to guarantee the accuracy of the molded optics. Experiments are performed to evaluate the effectiveness and feasibility of the model for the process development in Non-isothermal glass molding.

  4. Addressing environmental health Implications of mold exposure after major flooding.

    PubMed

    Metts, Tricia A

    2008-03-01

    Extensive water damage resulting from major flooding is often associated with mold growth if materials are not quickly and thoroughly dried. Exposure to fungal contamination can lead to several infectious and noninfectious health effects impacting the respiratory system, skin, and eyes. Adverse health effects can be categorized as infections, allergic or hypersensitivity reactions, or toxic-irritant reactions. Workers and building occupants can minimize their exposure to mold by avoiding areas with excessive mold growth, using personal protective equipment, and implementing environmental controls. Occupational health professionals should encourage workers to seek health care if they experience any symptoms that may be linked to mold exposure.

  5. Effect of Electromagnetic Brake on Decreasing Unbalanced Flow in Mold

    NASA Astrophysics Data System (ADS)

    Miki, Yuji; Furumai, Kohei

    2015-06-01

    In order to clarify the mechanism of suppression of unbalanced flow in the mold under high throughput conditions in continuous casting, the effect of using an electromagnetic brake on decreasing molten steel momentum and suppressing unbalanced flow in the mold was investigated. (1) The measured value of the effect of the electromagnetic brake on decreasing molten steel momentum was consistent with the calculated value. Molten steel momentum could be reduced by more than 50% when the Stuart number was more than 3. 5. (2) Increased mold level fluctuations caused by unbalanced flow in the mold are suppressed by applying the optimum magnetic flux density with an electromagnetic brake, even under high throughput conditions.

  6. Study on Nonisothermal Glass Molding Press for Aspherical Lens

    NASA Astrophysics Data System (ADS)

    Zhou, Tianfeng; Yan, Jiwang; Yoshihara, Nobuhito; Kuriyagawa, Tsunemoto

    Nonisothermal glass molding press (NGMP) was proposed to fabricate aspherical lenses, and its characteristics were studied by both experiments and finite element method (FEM) simulations in comparison with the traditional isothermal glass molding press (IGMP). The cycle time, form accuracy, surface roughness, stress/strain distributions of the aspherical lenses made by IGMP and NGMP were examined and compared. Experimental results and simulation results show that NGMP is an effective way to improve the molding efficiency and prolong the service life of the molding dies.

  7. Absorbable plate strength loss during molding.

    PubMed

    Ballard, Tiffany N S; Kelly, Kevin J; Zaydfudim, Victor; Walcutt, Noah L; Lahijani, Soheil S; Shack, R Bruce; Thayer, Wesley P

    2010-05-01

    Bioabsorbable plating systems play an integral role in cranial vault remodeling. After experiencing a case of plate failure requiring emergent reexploration, we investigated the potential causes. We hypothesize that extended submersion in the molding bath during plate preparation might advance the rate of hydrolysis and compromise plate structural integrity. Using an absorbable poly-D/L-lactic acid plating system, we assessed the effect of extended submersion on plate strength and stiffness when loaded in a cantilever fashion and with pure tension. We assessed these differences with the Student t test and linear regression modeling. We also generated a computer model of the plates for finite element analysis. When left in the molding bath for extended periods, the plates changed color and lost strength. After 5 minutes, 30% of maximum plate load capacity was lost in a cantilever beam test (P < 0.001) consistent with use of a 15% thinner plate. Tensile testing revealed the initial elastic modulus of 6.42 +/- 0.13 GPa decreased 16% to 5.41 +/- 0.50 GPa after 5 minutes of submersion (P = 0.027). The changes in plate strength and elastic modulus both worsened with increased submersion times. Finite element analysis of the plates also predicted clinically significant increases in plate deviation under normal loading conditions. Our study demonstrates that extended submersion of absorbable plates during molding results in a significant loss of plate strength and stiffness. Further, our computer model predicts that these changes could result in an unacceptable plate deviation under normal loading conditions. Together, these data caution against overmolding of plates to avoid compromising their structural integrity.

  8. Precision grinding of tungsten carbide mold insert for molding of sub-millimeter glass aspheric lenses

    NASA Astrophysics Data System (ADS)

    Chao, Choung-Lii; Chang, Chia-Jung; Chen, Chun-Chieh; Chou, Wen-Chen; Ma, Kung-Jeng

    2013-06-01

    As the demand for precision optical components with sub-millimeter feature size steadily increasing, numerous efforts have been made in developing new techniques and in improving the existing approaches to efficiently and economically produce those components. Glass molding process (GMP) is one of these methods to enable mass production of precision glass optical components in recent years. One of the key issues in GMP is precision mold insert fabrication. Since the mould are normally made of hard and brittle materials such as tungsten carbide (WC) and silicon carbide (SiC), precision diamond grinding is by far the principal choice used to machine the GMP mould. As the feature size of optical component gets smaller, the size of mould and grinding wheel used to fabricate the mould gets smaller too. This makes the grinding process a very time consuming and expensive task. This research aimed to improve the small mold fabrication processes by developing an effective way of producing small diamond wheels and in-process monitoring wheel profile. Diamond wheels of around 0.2mm to 0.5mm in diameter after truing and WC aspheric mold insert of form accuracy around 0.47μm were successfully produced in this research.

  9. Injection-molded capsular device for oral pulsatile release: development of a novel mold.

    PubMed

    Zema, Lucia; Loreti, Giulia; Macchi, Elena; Foppoli, Anastasia; Maroni, Alessandra; Gazzaniga, Andrea

    2013-02-01

    The development of a purposely devised mold and a newly set up injection molding (IM) manufacturing process was undertaken to prepare swellable/erodible hydroxypropyl cellulose-based capsular containers. When orally administered, such devices would be intended to achieve pulsatile and/or colonic time-dependent delivery of drugs. An in-depth evaluation of thermal, rheological, and mechanical characteristics of melt formulations/molded items made of the selected polymer (Klucel® LF) with increasing amounts of plasticizer (polyethylene glycol 1500, 5%-15% by weight) was preliminarily carried out. On the basis of the results obtained, a new mold was designed that allowed, through an automatic manufacturing cycle of 5 s duration, matching cap and body items to be prepared. These were subsequently filled and coupled to give a closed device of constant 600 μm thickness. As compared with previous IM systems having the same composition, such capsules showed improved closure mechanism, technological properties, especially in terms of reproducibility of the shell thickness, and release performance. Moreover, the ability of the capsular container to impart a constant lag phase before the liberation of the contents was demonstrated irrespective of the conveyed formulation.

  10. Investigations on injection molded, glass-fiber reinforced polyamide 6 integral foams using breathing mold technology

    NASA Astrophysics Data System (ADS)

    Roch, A.; Kehret, L.; Huber, T.; Henning, F.; Elsner, P.

    2015-05-01

    Investigations on PA6-GF50 integral foams have been carried out using different material systems: longfiber- and shortfiber-reinforced PA6 as well as unreinforced PA6 as a reference material. Both chemical and physical blowing agents were applied. Breathing mold technology (decompression of the mold) was selected for the foaming process. The integral foam design, which can be conceived as a sandwich structure, helps to save material in the neutral axis area and maintains a distance between load-bearing, unfoamed skin layers. For all test series an initial mold gap of 2.5 mm was chosen and the same amount of material was injected. In order to realize different density reductions, the mold opening stroke was varied. The experiments showed that, at a constant mass per unit area, integral polyamide 6 foams have a significantly higher bending stiffness than compact components, due to their higher area moment of inertia after foaming. At a constant surface weight the bending stiffness in these experiments could be increased by up to 600 %. Both shortfiber- and longfiber-reinforced polyamide 6 showed an increase in energy absorption during foaming.

  11. Dip-molded t-shaped cannula

    NASA Technical Reports Server (NTRS)

    Broyles, H. F.; Cuddihy, E. F.; Moacanin, J.

    1978-01-01

    Cannula, fabricated out of polyetherurethane, has been designed for long-term service. Improved cannula is T-shaped to collect blood from both directions, thus replacing two conventional cannulas that are usually required and eliminating need for large surgical wound. It is fabricated by using dip-molding process that can be adapted to other elastomeric objects having complex shapes. Dimensions of cannula were chosen to optimize its blood-flow properties and to reduce danger of excessive clotting, making it suitable for continuous service up to 21 days in vein or artery of patient.

  12. Ordered framboids in dwarfed biotic molds

    NASA Astrophysics Data System (ADS)

    El-Dahhar, M. A.

    Abundant framboids of an ordered nature are encountered in some dwarfed biotic molds which were collected from an integral part of the Eocene sedimentary succession exposed at Garret Gehannan area, Fayoum Province, Egypt. These framboids are either clustered in polyframboids or occur as discrete individuals. Pyrite and/or limonite microaggregates constitute the internal makeup of both types. Morphology and other characteristics of the framboids and a genetic appraisal is further discussed. The invoked mechanism strongly suggests the necessity of a precursor in developing the framboid texture.

  13. Resin transfer molding of textile composites

    NASA Technical Reports Server (NTRS)

    Falcone, Anthony; Dursch, Harry; Nelson, Karl; Avery, William

    1993-01-01

    The design and manufacture of textile composite panels, tubes, and angle sections that were provided to NASA for testing and evaluation are documented. The textile preform designs and requirements were established by NASA in collaboration with Boeing and several vendors of textile reinforcements. The following four types of preform architectures were used: stitched uniweave, 2D-braids, 3D-braids, and interlock weaves. The preforms consisted primarily of Hercules AS4 carbon fiber; Shell RSL-1895 resin was introduced using a resin transfer molding process. All the finished parts were inspected using ultrasonics.

  14. Thermal stress analysis in permanent mold processing determining mold life and utilizing a combined thermomechanical finite element model

    SciTech Connect

    Fackeldey, M.; Guan, J.; Helling, V.; Sahm, P.R.

    1995-12-31

    Permanent mold casting offers various advantages, but its process control requires high technical skill, especially when cast iron is utilized. Thermal stresses resulting from non-uniform cooling and hindering of shrinkage frequently cause cracks, which can lead to a destruction of the permanent mold. In this paper an in-house 3-dimensional finite element model is presented, which allows an easy and comfortable analysis of the origin of thermal and residual stresses. By varying single parameters, i.e. the initial temperature as well as the mold geometry, the process may be evaluated. This leads to an optimization of the process and allows an assessment of the mold life.

  15. Characteristics of medium carbon steel solidification and mold flux crystallization using the multi-mold simulator

    NASA Astrophysics Data System (ADS)

    Park, Jun-Yong; Ko, Eun-yi; Choi, Joo; Sohn, Il

    2014-11-01

    An oscillating multi-mold simulator with embedded thermocouples was used to study the initial solidification of medium carbon steels and crystallization characteristics of the mold flux. Casting speed variations in the simulator from 0.7 m/min to 1.4 m/min at fixed oscillation frequency and stroke resulted in higher copper mold temperatures. Frequency modifications from 2.5 Hz to 5.0 Hz and stroke changes from 8.1 mm to 5.4 mm at fixed casting speeds also resulted in higher copper mold temperatures. Surface profile analysis of as-cast steel strips showed characteristic oscillation marks comparable to the narrow faces of the industrial cast slabs. The apparent effect of casting variables on the temperature and surface profiles during the solidification of the medium carbon steels could be correlated to the variations in the negative strip time and subsequent changes in the extent of mold flux infiltration. Back scattered scanning electron microscope analysis of the full length of the retrieved flux film after casting showed cuspidine crystallization ratio that increased from the upper to lower portion of the flux film. This dynamic crystallization and growth of the cuspidine phase increases as the flux is sustained at high temperatures for longer periods. Additional experiments with industrial fluxes designed for soft cooling of medium carbon steel grades showed comparable infiltration thickness of the flux, but the crystallization characteristics were significantly different, which could have a significant impact on the heat transfer rate and mechanism through the flux film.

  16. Integrally cored ceramic investment casting mold fabricated by ceramic stereolithography

    NASA Astrophysics Data System (ADS)

    Bae, Chang-Jun

    Superalloy airfoils are produced by investment casting (IC), which uses ceramic cores and wax patterns with ceramic shell molds. Hollow cored superalloy airfoils in a gas turbine engine are an example of complex IC parts. The complex internal hollow cavities of the airfoil are designed to conduct cooling air through one or more passageways. These complex internal passageways have been fabricated by a lost wax process requiring several processing steps; core preparation, injection molding for wax pattern, and dipping process for ceramic shell molds. Several steps generate problems such as high cost and decreased accuracy of the ceramic mold. For example, costly tooling and production delay are required to produce mold dies for complex cores and wax patterns used in injection molding, resulting in a big obstacle for prototypes and smaller production runs. Rather than using separate cores, patterns, and shell molds, it would be advantageous to directly produce a mold that has the casting cavity and the ceramic core by one process. Ceramic stereolithography (CerSLA) can be used to directly fabricate the integrally cored ceramic casting mold (ICCM). CerSLA builds ceramic green objects from CAD files from many thin liquid layers of powder in monomer, which are solidified by polymerization with a UV laser, thereby "writing" the design for each slice. This dissertation addresses the integrally cored casting ceramic mold (ICCM), the ceramic core with a ceramic mold shell in a single patternless construction, fabricated by ceramic stereolithography (CerSLA). CerSLA is considered as an alternative method to replace lost wax processes, for small production runs or designs too complex for conventional cores and patterns. The main topic is the development of methods to successfully fabricate an ICCM by CerSLA from refractory silica, as well as related issues. The related issues are the segregation of coarse fused silica powders in a layer, the degree of segregation parameter to

  17. Effect of antioxidants of aflatoxigenic molds

    SciTech Connect

    Ahmad, M.M.

    1986-01-01

    Growth and aflatoxin production by Aspergillus flavus and A. parasiticus were measured in synthetic media and chicken feed treated with butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethoxyquin (EXQ), propyl gallate (PG) or t-butylhydroquinone (TBHQ) at 50-250 ..mu..g/g and 50-1000 ..mu..g/g, respectively. BHA at 50 ..mu..g/g in broth or agar inhibited growth and alfatoxin production by both molds. In poultry feeds, 1000 ..mu..g/g BHA was required to depress CO/sub 2/ production at day 5 of incubation, while 200 ..mu..g/g decreased aflatoxin B/sub 1/ 23.8%. BHT, EXQ, and PG had slight effects on mold growth while TBHQ enhanced growth on broth but reduced it on agar. Afaltoxin B/sub 1/ production was stimulated by EXQ, although G/sub 1/ production declines. Measurement of cellular constituents released from mycelia over 5 hours indicated that BHA doubled the release of UV-absorbing materials and increase by threefold the release of previously incorporated radiolabeled compounds. Furthermore, BHA inhibited the uptake of /sup 14/C-amino acids 8 and 44%, /sup 3/H-uridine 65 and 91%, and /sup 3/H-methyl thymidine 67 and 71%, for A. flavus and A. parasiticus, respectively, compared to untreated controls.

  18. Method for collecting spores from a mold

    DOEpatents

    Au, Frederick H. F.; Beckert, Werner F.

    1977-01-01

    A technique and apparatus used therewith for determining the uptake of plutonium and other contaminants by soil microorganisms which, in turn, gives a measure of the plutonium and/or other contaminants available to the biosphere at that particular time. A measured quantity of uncontaminated spores of a selected mold is added to a moistened sample of the soil to be tested. The mixture is allowed to sit a predetermined number of days under specified temperature conditions. An agar layer is then applied to the top of the sample. After three or more days, when spores of the mold growing in the sample have formed, the spores are collected by a miniature vacuum collection apparatus operated under preselected vacuum conditions, which collect only the spores with essentially no contamination by mycelial fragments or culture medium. After collection, the fungal spores are dried and analyzed for the plutonium and/or other contaminants. The apparatus is also suitable for collection of pollen, small insects, dust and other small particles, material from thin-layer chromatography plates, etc.

  19. The cellular slime mold: eukaryotic model microorganism.

    PubMed

    Urushihara, Hideko

    2009-04-01

    Cellular slime molds are eukaryotic microorganisms in the soil. They feed on bacteria as solitary amoebae but conditionally construct multicellular forms in which cell differentiation takes place. Therefore, they are attractive for the study of fundamental biological phenomena such as phagocytosis, cell division, chemotactic movements, intercellular communication, cell differentiation, and morphogenesis. The most widely used species, Dictyostelium discoideum, is highly amenable to experimental manipulation and can be used with most recent molecular biological techniques. Its genome and cDNA analyses have been completed and well-annotated data are publicly available. A larger number of orthologues of human disease-related genes were found in D. discoideum than in yeast. Moreover, some pathogenic bacteria infect Dictyostelium amoebae. Thus, this microorganism can also offer a good experimental system for biomedical research. The resources of cellular slime molds, standard strains, mutants, and genes are maintained and distributed upon request by the core center of the National BioResource Project (NBRP-nenkin) to support Dictyostelium community users as well as new users interested in new platforms for research and/or phylogenic consideration.

  20. Rotational molding of bio-polymers

    NASA Astrophysics Data System (ADS)

    Greco, Antonio; Maffezzoli, Alfonso; Forleo, Stefania

    2014-05-01

    This paper is aimed to study the suitability of bio-polymers, including poly-lactic acid (PLLA) and Mater-Bi, for the production of hollow components by rotational molding. In order to reduce the brittleness of PLLA, the material was mixed with two different plasticizers, bis-ethyl-hexyl-phthalate (DEHP) and poly-ethylene-glycol (PEG). The materials were characterized in terms of sinterability. To this purpose, thermomechanical (TMA) analysis was performed at different heating rates, in order to identify the endset temperatures of densification and the onset temperatures of degradation. Results obtained indicated that the materials are characterized by a very fast sintering process, occurring just above the melting temperature, and an adequately high onset of degradation. The difference between the onset of degradation and the endset of sintering, defined as the processing window of the polymer, is sufficiently wide, indicating that the polymers can be efficiently processed by rotational molding. Therefore, a laboratory scale apparatus was used for the production of PLLA and Mater-Bi prototypes. The materials were processed using very similar conditions to those used for LLDPE. The production of void-free samples of uniform wall thickness was considered as an indication of the potentiality of the process for the production of biodegradable containers.

  1. Composite fabrication via resin transfer molding technology

    SciTech Connect

    Jamison, G.M.; Domeier, L.A.

    1996-04-01

    The IMPReS (Integrated Modeling and Processing of Resin-based Structures) Program was funded in FY95 to consolidate, evaluate and enhance Sandia`s capabilities in the design and fabrication of composite structures. A key driver of this and related programs was the need for more agile product development processes and for model based design and fabrication tools across all of Sandia`s material technologies. A team of polymer, composite and modeling personnel was assembled to benchmark Sandia`s existing expertise in this area relative to industrial and academic programs and to initiate the tasks required to meet Sandia`s future needs. RTM (Resin Transfer Molding) was selected as the focus composite fabrication technology due to its versatility and growing use in industry. Modeling efforts focused on the prediction of composite mechanical properties and failure/damage mechanisms and also on the uncured resin flow processes typical of RTM. Appropriate molds and test composites were fabricated and model validation studies begun. This report summarizes and archives the modeling and fabrication studies carried out under IMPReS and evaluates the status of composite technology within Sandia. It should provide a complete and convenient baseline for future composite technology efforts within Sandia.

  2. ASTHMATIC HUMAN SERUM IGE-REACTIVITY WITH MOLD EXTRACTS

    EPA Science Inventory

    Although molds have demonstrated the ability to induce allergic asthma-like responses in mouse models, their role in human disease is unclear. This study was undertaken to provide insight into the prevalence of human IgE-reactivity and identify the target mold protein(s). The st...

  3. ISOSTATIC COMPACTION OF METAL POWDERS IN CONVENTIONAL MOLDING TOOLS,

    DTIC Science & Technology

    plastisols . The plastisol formulation (by weight) which appeared to be most suited for pliable molds consisted of 100 parts vinyl chloride resin, 60 parts...plasticizer, and 3 part epoxy resin. Curing the plastisol mix at a temperature of 350 = 10F for 30 = 2 minutes/inch of mold thickness proved to be

  4. Optimization of Mold Yield in MultiCavity Sand Castings

    NASA Astrophysics Data System (ADS)

    Shinde, Vasudev D.; Joshi, Durgesh; Ravi, B.; Narasimhan, K.

    2013-06-01

    The productivity of ductile iron foundries engaging in mass production of castings for the automobile and other engineering sectors depends on the number of cavities per mold. A denser packing of cavities, however, results in slower heat transfer from adjacent cavities, leading to delayed solidification, possible shrinkage defects, and lower mechanical properties. In this article, we propose a methodology to optimize mold yield by selecting the correct combination of the mold box size and the number of cavities based on solidification time and mold temperature. Simulation studies were carried out by modeling solid and hollow cube castings with different values of cavity-wall gap and finding the minimum value of the gap beyond which there is no change in casting solidification time. Then double-cavity molds were modeled with different values of cavity-cavity gap, and simulated to find the minimum value of gap. The simulation results were verified by melting and pouring ductile iron in green sand molds instrumented with thermocouples, and recording the temperature in mold at predetermined locations. The proposed approach can be employed to generate a technological database of minimum gaps for various combinations of part geometry, metal and process, which will be very useful to optimize the mold cavity layouts.

  5. Crack-resistant siloxane molding compounds. [Patent application

    DOEpatents

    McFarland, J.W.; Swearngin, C.B.

    1980-11-03

    The crack resistance of phenyl silicone molding resins containing siliceous fillers is improved by incorporating therein about 0.5 to 5.5% by weight of ..beta..-eucryptite, a lithium aluminum silicate having a negative thermal expansion coefficient. These molding resins are particularly suitable for encapsulating electronic devices such as diodes, coils, resistors, and the like.

  6. New methods and materials for molding and casting ice formations

    NASA Technical Reports Server (NTRS)

    Reehorst, Andrew L.; Richter, G. Paul

    1987-01-01

    This study was designed to find improved materials and techniques for molding and casting natural or simulated ice shapes that could replace the wax and plaster method. By utilizing modern molding and casting materials and techniques, a new methodology was developed that provides excellent reproduction, low-temperature capability, and reasonable turnaround time. The resulting casts are accurate and tough.

  7. View of foundrymen casting ingot molds; The flames from the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of foundrymen casting ingot molds; The flames from the mold in the center-right of the photo are present immediately after the pour has been completed - Bethlehem Steel Corporation, South Bethlehem Works, Iron Foundry, Along Lehigh River, North of Fourth Street, West of Minsi Trail Bridge, Bethlehem, Northampton County, PA

  8. Occurrence of household mold and efficacy of sodium hypochlorite disinfectant.

    PubMed

    Reynolds, Kelly A; Boone, Stephanie; Bright, Kelly R; Gerba, Charles P

    2012-01-01

    The occurrence and distribution of mold on household surfaces and the efficacy of bleach-based (sodium hypochlorite, NaOCl) disinfectants on mold viability and allergenicity was documented. Household microenvironments prone to increased moisture were specifically targeted. Using the sticky tape method, 1330 samples were collected from non-porous indoor surfaces of 160 homes across the United States, and analyzed for mold. Homes were randomly selected and recruited via phone interviews. Culture and immunoassays were used to measure the viability and reduction of allergenic properties of Aspergillus fumigatus following 2.4% NaOCl treatment. All homes and 72.9% of surfaces tested positive for mold. Windowsills were the most frequently contaminated site (87.5%) and Cladosporium the most commonly identified mold (31.0%). Five-minute exposures to 2.4% NaOCl resulted in a >3 to >6-log₁₀ reduction of culturable mold counts in controlled laboratory studies. Organisms were nonculturable after 5- and 10-min contact times on non-porous and porous ceramic carriers, respectively, and A. fumigatus spore-eluted allergen levels were reduced by an average 95.8% in 30 sec, as indicated by immunoassay. All homes are contaminated with some level of mold, and regrowth is likely in moisture-prone microenvironments. The use of low concentrations (2.4%) of NaOCl for the reduction of culturable indoor mold and related allergens is effective and recommended.

  9. 42. PRESSING A SLAB OF CLAY ONTO A MOSAIC MOLD. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    42. PRESSING A SLAB OF CLAY ONTO A MOSAIC MOLD. THE MOLD, WHICH HAS A RAISED DESIGN, LEAVES AND OUTLINE IN THE SLAB, THE PIECES THUS DEFINED, ARE THEN CUT APART TO BE FIRED SEPARATELY AND REASSEMBLED. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  10. 30. SECOND FLOOR, NORTHEAST ROOM, SOUTH WALL. Bolection mold fireplace ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    30. SECOND FLOOR, NORTHEAST ROOM, SOUTH WALL. Bolection mold fireplace surround probably original with house and only remaining one thus. Note bolection panel molds on raised-panel door, also probably original with house. - Mulberry, Cooper River, West Branch, Moncks Corner, Berkeley County, SC

  11. 25. CORES, WHICH FORM THE INTERIOR SURFACES OF MOLDS BY ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    25. CORES, WHICH FORM THE INTERIOR SURFACES OF MOLDS BY PROVIDING A SOLID STRUCTURE FOR MOLTEN IRON TO FLOW AROUND ARE CAREFULLY PLACED INTO THE CAVITIES OF MOLDS IN THE BRASS FOUNDRY, CA. 1950. - Stockham Pipe & Fittings Company, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  12. Looking east inside of the ingot mold stripper building for ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Looking east inside of the ingot mold stripper building for the 44" slab mill at a row of ingots. A row of ingot molds are pictured east on the left. - U.S. Steel Edgar Thomson Works, 44" Slab Mill, Along Monongahela River, Braddock, Allegheny County, PA

  13. Grinding aspheric and freeform micro-optical molds

    NASA Astrophysics Data System (ADS)

    Tohme, Yazid E.

    2007-02-01

    Fueled by the need for better performing optics, glass optics are now replacing plastic optics in many industrial and consumer electronic devices. One of these devices is the mobile phone camera. The optical sub-assembly in a mobile phone includes several micro lenses that are spherical and/or aspherical in shape and require form tolerances in the submicron range. These micro glass lenses are mass produced by a replication process known as glass press molding. The process entails the compression of a glass gob between two precise optical quality molds at an elevated temperature, usually near the transition temperature of the glass material. The elevated forces and temperatures required in the glass molding process limits the materials of the molds to very tough materials such as tungsten carbide or silicon carbide. These materials can withstand large pressing forces at high temperatures without any significant deformation. These materials offer great mechanical properties for glass press molding but they are also a challenge to machine to submicron accuracy. The work in this paper discusses a deterministic micro grinding manufacturing process referred to as wheel normal grinding, which is utilized to produce these optical quality molds. Wheel normal grinding is more accurate and more deterministic than most other grinding techniques and can produce molds to the form and finish tolerances required for optical molding. This method relies on the ability to recognize and compensate for grinding wheel wear and machine repeatable errors. Results will be presented to illustrate the accuracy of this micro grinding technique.

  14. A programmable nanoreplica molding for the fabrication of nanophotonic devices

    NASA Astrophysics Data System (ADS)

    Liu, Longju; Zhang, Jingxiang; Badshah, Mohsin Ali; Dong, Liang; Li, Jingjing; Kim, Seok-Min; Lu, Meng

    2016-03-01

    The ability to fabricate periodic structures with sub-wavelength features has a great potential for impact on integrated optics, optical sensors, and photovoltaic devices. Here, we report a programmable nanoreplica molding process to fabricate a variety of sub-micrometer periodic patterns using a single mold. The process utilizes a stretchable mold to produce the desired periodic structure in a photopolymer on glass or plastic substrates. During the replica molding process, a uniaxial force is applied to the mold and results in changes of the periodic structure, which resides on the surface of the mold. Direction and magnitude of the force determine the array geometry, including the lattice constant and arrangement. By stretching the mold, 2D arrays with square, rectangular, and triangular lattice structures can be fabricated. As one example, we present a plasmonic crystal device with surface plasmon resonances determined by the force applied during molding. In addition, photonic crystal slabs with different array patterns are fabricated and characterized. This unique process offers the capability of generating various periodic nanostructures rapidly and inexpensively.

  15. 47 CFR 76.805 - Access to molding.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Access to molding. 76.805 Section 76.805 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES MULTICHANNEL VIDEO AND CABLE TELEVISION SERVICE Cable Inside Wiring § 76.805 Access to molding. (a) An MVPD shall be...

  16. Injection molded polymer optics in the 21st Century

    NASA Astrophysics Data System (ADS)

    Beich, William S.

    2005-08-01

    Precision polymer optics, manufactured by injection molding techniques, has been a key enabling technology for several decades now. The technology, which can be thought of as a subset of the wider field of precision optics manufacturing, was pioneered in the United States by companies such as Eastman Kodak, US Precision Lens, and Polaroid. In addition to suppliers in the U.S. there are several companies worldwide that design and manufacture precision polymer optics, for example Philips High Tech Plastics in Europe and Fujinon in Japan. Designers who are considering using polymer optics need a fundamental understanding of exactly how the optics are created. This paper will survey the technology and processes that are employed in the successful implementation of a polymer optic solution from a manufacturer's perspective. Special emphasis will be paid to the unique relationship between the molds and the optics that they produce. We will discuss the key elements of production: molding resins, molds and molding equipment, and metrology. Finally we will offer a case study to illustrate just how the optics designer carries a design concept through to production. The underlying theme throughout the discussion of polymer optics is the need for the design team to work closely with an experienced polymer optics manufacturer with a solid track record of success in molded optics. As will be seen shortly, the complex interaction between thermoplastics, molds, and molding machines dictates the need for working closely with a supplier who has the critical knowledge needed to manage all aspects of the program.

  17. 34. THESE INGOT MOLDS OF STEEL 32' X 83' ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    34. THESE INGOT MOLDS OF STEEL - 32' X 83' IN SIZE - ARE READY TO BE TAKEN TO THE STRIPPER, WHERE THE MOLDS WILL BE REMOVED. INGOTS WILL NEXT BE PLACED INTO A 'SOAKING PIT,' WHERE THEY ARE HEATED TO A UNIFORM TEMPERATURE PRIOR TO ROLLING. - Corrigan, McKinney Steel Company, 3100 East Forty-fifth Street, Cleveland, Cuyahoga County, OH

  18. THE CHALLENGE OF MOLDS FOR THE U.S. ARMY

    EPA Science Inventory

    The US Army and all armies have been interested in molds since there were armies. The most obvious interest was human infections by molds like trench foot. Then there were losses of military animals and contamination of their fodder, most notably the Soviet loss of thousands o...

  19. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  20. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  1. 18. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON GREY IRON UNIT NO. 1 MOLD CONVEYOR WITH MOLTEN IRON FROM MOBILE LADLES AS THEY STAND ON WHAT USED TO BE A PLATFORM MOVING AT THE SAME RATE OF SPEED AS THE CONVEYOR. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  2. Folding tool for preparing FCC molded-plug terminations

    NASA Technical Reports Server (NTRS)

    Campbell, E. C.; Chambers, C. M.

    1971-01-01

    Assemblies consist of window piece, conductor spacer, insulator, outer seal, and molded portion that integrates all components. Preparation of FCC for molded plug termination requires that terminated ends of conductors in each cable be accurately folded simultaneously into spacer end and groove.

  3. 14. IN 1922, PRIOR TO THE INSTALLATION OF MOLDING MACHINES ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. IN 1922, PRIOR TO THE INSTALLATION OF MOLDING MACHINES AND CONVEYORS, MOLDERS, SUCH AS THESE FROM THE GREY IRON FOUNDRY, HAND PACKED MOLDS AND LAID THEM OUT IN ROWS ON THE FLOOR TO BE POURED BY HAND-HELD CRUCIBLES, SHAKEN OUT, AND CLEANED. - Stockham Pipe & Fittings Company, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  4. SPECIFIC MOLDS ASSOCIATED WITH ASTHMA IN WATER-DAMAGED HOMES

    EPA Science Inventory

    Objective: We sought to determine if specific molds were found in significantly higher concentrations in the water-damaged homes of asthmatic children compared to homes with no visible water damage. Methods: The mold concentrations in the dust in asthmatic children's bedrooms i...

  5. IGE IN ASTHMATIC HUMAN SERA IS REACTIVE AGAINST MOLD EXTRACTS

    EPA Science Inventory

    Molds have been associated with various health effects including asthma, but their role in induction of asthma is unclear. However, the presence of mold-specific IgE indicates their capacity to induce allergic responses and possibly exacerbate asthma symptoms. This study was und...

  6. MOLD GROWTH ON GYPSUM WALLBOARD--A RESEARCH SUMMARY

    EPA Science Inventory

    Reducing occupant exposure to mold growing on damp gypsum wallboard is a research objective of the U.S. Environmental Protection Agency. Often mold contaminated building materials are not properly removed but instead surface cleaners are used and then paint is applied in an attem...

  7. Improved molding process ensures plastic parts of higher tensile strength

    NASA Technical Reports Server (NTRS)

    Heier, W. C.

    1968-01-01

    Single molding process ensures that plastic parts /of a given mechanical design/ produced from a conventional thermosetting molding compound will have a maximum tensile strength. The process can also be used for other thermosetting compounds to produce parts with improved physical properties.

  8. A programmable nanoreplica molding for the fabrication of nanophotonic devices

    PubMed Central

    Liu, Longju; Zhang, Jingxiang; Badshah, Mohsin Ali; Dong, Liang; Li, Jingjing; Kim, Seok-min; Lu, Meng

    2016-01-01

    The ability to fabricate periodic structures with sub-wavelength features has a great potential for impact on integrated optics, optical sensors, and photovoltaic devices. Here, we report a programmable nanoreplica molding process to fabricate a variety of sub-micrometer periodic patterns using a single mold. The process utilizes a stretchable mold to produce the desired periodic structure in a photopolymer on glass or plastic substrates. During the replica molding process, a uniaxial force is applied to the mold and results in changes of the periodic structure, which resides on the surface of the mold. Direction and magnitude of the force determine the array geometry, including the lattice constant and arrangement. By stretching the mold, 2D arrays with square, rectangular, and triangular lattice structures can be fabricated. As one example, we present a plasmonic crystal device with surface plasmon resonances determined by the force applied during molding. In addition, photonic crystal slabs with different array patterns are fabricated and characterized. This unique process offers the capability of generating various periodic nanostructures rapidly and inexpensively. PMID:26925828

  9. THE DURABILITY OF LARGE-SCALE ADDITIVE MANUFACTURING COMPOSITE MOLDS

    SciTech Connect

    Post, Brian K; Love, Lonnie J; Duty, Chad; Vaidya, Uday; Pipes, R. Byron; Kunc, Vlastimil

    2016-01-01

    Oak Ridge National Laboratory s Big Area Additive Manufacturing (BAAM) technology permits the rapid production of thermoplastic composite molds using a carbon fiber filled Acrylonitrile-Butadiene-Styrene (ABS) thermoplastic. Demonstration tools (i.e. 0.965 m X 0.559 m X 0.152 m) for composite part fabrication have been printed, coated, and finished with a traditional tooling gel. We present validation results demonstrating the stability of thermoplastic printed molds for room temperature Vacuum Assisted Resin Transfer Molding (VARTM) processes. Arkema s Elium thermoplastic resin was investigated with a variety of reinforcement materials. Experimental results include dimensional characterization of the tool surface using laser scanning technique following demolding of 10 parts. Thermoplastic composite molds offer rapid production compared to traditionally built thermoset molds in that near-net deposition allows direct digital production of the net geometry at production rate of 45 kg/hr.

  10. Prevalence of dampness and mold in European housing stock.

    PubMed

    Haverinen-Shaughnessy, Ulla

    2012-09-01

    An assessment of the prevalence of dampness and mold in European housing stock was carried out. It is based on general indicators of dampness and mold in dwellings reported in the literature. The assessment relies on recent studies, taking into account regional and climatic differences, as well as differences in study design, methodology, and definitions. Data were available from 31 European countries. Weighted prevalence estimates are 12.1% for damp, 10.3% for mold, 10.0% for water damage, and 16.5% for a combination of any one or more indicators. Significant (up to 18%) differences were observed for dampness and mold prevalence estimates depending on survey factors, region, and climate. In conclusion, dampness and/or mold problems could be expected to occur in one of every six of the dwellings in Europe. Prevalence and occurrence of different types of problems may vary across geographical areas, which can be partly explained by differences in climate.

  11. Silicon micro-mold and method for fabrication

    DOEpatents

    Morales, Alfredo M.

    2005-01-11

    The present invention describes a method for rapidly fabricating a robust 3-dimensional silicon micro-mold for use in preparing complex metal micro-components. The process begins by depositing a conductive metal layer onto one surface of a silicon wafer. A thin photoresist and a standard lithographic mask are then used to transfer a trace image pattern onto the opposite surface of the wafer by exposing and developing the resist. The exposed portion of the silicon substrate is anisotropically etched through the wafer thickness down to conductive metal layer to provide an etched pattern consisting of a series of rectilinear channels and recesses in the silicon which serve as the silicon micro-mold. Microcomponents are prepared with this mold by first filling the mold channels and recesses with a metal deposit, typically by electroplating, and then removing the silicon micro-mold by chemical etching.

  12. Injection-molded nanocomposites and materials based on wheat gluten.

    PubMed

    Cho, S-W; Gällstedt, M; Johansson, E; Hedenqvist, M S

    2011-01-01

    This is, to our knowledge, the first study of the injection molding of materials where wheat gluten (WG) is the main component. In addition to a plasticizer (glycerol), 5 wt.% natural montmorillonite clay was added. X-ray indicated intercalated clay and transmission electron microscopy indicated locally good clay platelet dispersion. Prior to feeding into the injection molder, the material was first compression molded into plates and pelletized. The filling of the circular mold via the central gate was characterized by a divergent flow yielding, in general, a stronger and stiffer material in the circumferential direction. It was observed that 20-30 wt.% glycerol yielded the best combination of processability and mechanical properties. The clay yielded improved processability, plate homogeneity and tensile stiffness. IR spectroscopy and protein solubility indicated that the injection molding process yielded a highly aggregated structure. The overall conclusion was that injection molding is a very promising method for producing WG objects.

  13. Development of extrusion molded Nd-Fe-B magnets

    SciTech Connect

    Sakata, M.; Ikuma, K. ); Watanabe, R.; Iwasa, T.; Miyadera, H.; McAloon, K.

    1993-01-01

    A new manufacturing process for extrusion molded magnets, composed of isotropic Nd-Fe-B powder and Nylon-12, has been developed. This newly developed extrusion molding process has several interesting features. First, the extruded product contains 72% by volume magnetic powder and yields a (BH)[sub max] of 8.0 MGO[sub e]. Second, through the addition of an anti-oxidant, the viscosity of the magnetic powder-nylon compound remains almost constant during molding. Third, by means of a specially cooled outlet, which is separated from the heated die by a thermal insulator, an optimized temperature profile is obtained which yields uniformly smooth extrusion molded magnets. Both long thin-walled magnets and small arc-shaped (kawala) magnets are easily molded by this new process.

  14. Public health and economic impact of dampness and mold

    SciTech Connect

    Mudarri, David; Fisk, William J.

    2007-06-01

    The public health risk and economic impact of dampness and mold exposures was assessed using current asthma as a health endpoint. Individual risk of current asthma from exposure to dampness and mold in homes from Fisk et al. (2007), and asthma risks calculated from additional studies that reported the prevalence of dampness and mold in homes were used to estimate the proportion of U.S. current asthma cases that are attributable to dampness and mold exposure at 21% (95% confidence internal 12-29%). An examination of the literature covering dampness and mold in schools, offices, and institutional buildings, which is summarized in the appendix, suggests that risks from exposure in these buildings are similar to risks from exposures in homes. Of the 21.8 million people reported to have asthma in the U.S., approximately 4.6 (2.7-6.3) million cases are estimated to be attributable to dampness and mold exposure in the home. Estimates of the national cost of asthma from two prior studies were updated to 2004 and used to estimate the economic impact of dampness and mold exposures. By applying the attributable fraction to the updated national annual cost of asthma, the national annual cost of asthma that is attributable to dampness and mold exposure in the home is estimated to be $3.5 billion ($2.1-4.8 billion). Analysis indicates that exposure to dampness and mold in buildings poses significant public health and economic risks in the U.S. These findings are compatible with public policies and programs that help control moisture and mold in buildings.

  15. Predicting and preventing mold spoilage of food products.

    PubMed

    Dagnas, Stéphane; Membré, Jeanne-Marie

    2013-03-01

    This article is a review of how to quantify mold spoilage and consequently shelf life of a food product. Mold spoilage results from having a product contaminated with fungal spores that germinate and form a visible mycelium before the end of the shelf life. The spoilage can be then expressed as the combination of the probability of having a product contaminated and the probability of mold growth (germination and proliferation) up to a visible mycelium before the end of the shelf life. For products packed before being distributed to the retailers, the probability of having a product contaminated is a function of factors strictly linked to the factory design, process, and environment. The in-factory fungal contamination of a product might be controlled by good manufacturing hygiene practices and reduced by particular processing practices such as an adequate air-renewal system. To determine the probability of mold growth, both germination and mycelium proliferation can be mathematically described by primary models. When mold contamination on the product is scarce, the spores are spread on the product and more than a few spores are unlikely to be found at the same spot. In such a case, models applicable for a single spore should be used. Secondary models can be used to describe the effect of intrinsic and extrinsic factors on either the germination or proliferation of molds. Several polynomial models and gamma-type models quantifying the effect of water activity and temperature on mold growth are available. To a lesser extent, the effect of pH, ethanol, heat treatment, addition of preservatives, and modified atmospheres on mold growth also have been quantified. However, mold species variability has not yet been properly addressed, and only a few secondary models have been validated for food products. Once the probability of having mold spoilage is calculated for various shelf lives and product formulations, the model can be implemented as part of a risk management

  16. Mold damage in homes and wheezing in infants

    PubMed Central

    Cho, Seung-Hyun; Reponen, Tiina; LeMasters, Grace; Levin, Linda; Huang, Jian; Meklin, Teija; Ryan, Patrick; Villareal, Manuel; Bernstein, David

    2007-01-01

    Background In most studies that investigate the association of mold or water damage and respiratory disorders in infants, the analysis is not adjusted for exposure to house dust mite (HDM), which is also a known cause of respiratory illnesses. Objective To investigate the relationship between visually observable mold or water damage and HDM (Der f 1) levels and the prevalence of lower respiratory tract symptoms and allergen sensitization in infants of atopic parents as part of a prospective birth cohort study. Methods On-site home visits (at the infants’ age of 8 months) were performed to evaluate observable mold or water damage and HDM exposure. At a clinic visit near the infant’s first birthday, medical histories, including parent-reported wheezing episodes, and a skin prick test to food and 15 common aeroallergens were conducted in 640 infants. Results More than half of the homes were found to have mold or water damage, and 5% had major mold or water damage with visible mold at 0.2 m2 or more. Only 16% of homes had a HDM allergen (Der f 1) concentration of more than 2 μg/g. Major mold or water damage increased the risk of recurrent wheezing nearly 2 times in infants, 5 times in food or aeroallergen-sensitized infants, and 6 times in aeroallergen-sensitized infants. Neither visible mold or water damage nor HDM exposure was associated with sensitization to either mold or aeroallergens. Conclusions Visible mold was shown to be a significant risk factor for recurrent wheezing in infants at high risk of developing atopic disorders, whereas HDM exposure did not significantly increase the risk. PMID:17069111

  17. ''Heat Transfer at the Mold-Metal Interface in Permanent Mold Casting of Aluminum Alloys'' Final Project Report

    SciTech Connect

    Professor R. D. Pehlke, Principal Investigator, Dr. John M. Cookson, Dr. Shouwei Hao, Dr. Prasad Krishna, Kevin T. Bilkey

    2001-12-14

    This project on heat transfer coefficients in metal permanent mold casting has been conducted in three areas. They are the theoretical study at the University of Michigan, the experimental investigation of squeeze casting at CMI-Tech Center (Now Hayes-Lemmerz Technical Center) and the experimental investigation of low pressure permanent mold casting at Amcast Automotive.

  18. Comparative Study Of Injection Molding Pressure Obtained From A Simulation And From A Monitored Mold

    NASA Astrophysics Data System (ADS)

    Peydró Rasero, M. A.; Juarez Varón, D.; Seguí Llinares, V. J.; Boronat Vitoria, T.

    2009-11-01

    The main objective of the present work is to identify the exact of behavior of ABS when it is injected into a mold. We study the conditions and the most important parameters of the process, emphasizing the injection pressure and cycle time. Another objective is to characterize two of the properties of the material that most influence the injection of thermoplastic materials. For the calculation of viscosity, a capillary rheometer was used, and a Differential Scanning Calorimetry (DSC) was used to determinate specific heat capacity. The final objective of the work is to quantify the accuracy of the data obtained by a computer aided simulation to help determine the best processing conditions. To this end, results obtained from this simulation and results obtained from a mold monitored with sensors were compared. Finally, the possible causes of the differences observed in this comparison are presented.

  19. Injection molding and debinding of micro gears fabricated by micro powder injection molding

    NASA Astrophysics Data System (ADS)

    Ni, Xin-lei; Yin, Hai-qing; Liu, Lin; Yi, Shan-jie; Qu, Xuan-hui

    2013-01-01

    Micro powder injection molding (μPIM) was investigated for possible mass production of micro-components at relatively low cost. However, scaling down to such a level produces challenges in injection molding and debinding. Micro gears were fabricated by μPIM from in-house feedstock. The effect of injection speed and injection pressure on the replication of the micro gear cavity was investigated. Solvent debinding and thermal debinding processes were discussed. The results show that micro gears can be successfully fabricated under the injection pressure of 70 MPa and the 60% injection speed. Either too low or too high injection speed can cause incomplete filling of micro gears. The same is the case with too low injection pressure. Too high injection pressure can bring cracks. Solvent debinding of micro gears was performed in a mixture of petroleum ether and ethanol. Subsequently, micro gears were successfully debound by a multistep heating schedule.

  20. Soft molding lithography of conjugated polymers

    NASA Astrophysics Data System (ADS)

    Pisignano, Dario; Persano, Luana; Cingolani, Roberto; Gigli, Giuseppe; Babudri, Francesco; Farinola, Gianluca M.; Naso, Francesco

    2004-02-01

    We report on the nanopatterning of conjugated polymers by soft molding, and exploit the glass transition of the organic compound in conformal contact with an elastomeric element. We succeeded in printing different compounds with resolution down to 300 nm at temperatures up to 300 °C in vacuum. No significant variation of the photoluminescence (PL) spectra nor heavy degradation of the PL quantum yield was observed after the lithography process. Based on the high resolution achieved and on the well-retained luminescence properties of the patterned compounds, we conclude that high-temperature soft lithography is a valid, flexible and straightforward technique for one-step realization of organic-based devices.

  1. Star Mapping with Slime Mold Physarum Polycephalum

    NASA Astrophysics Data System (ADS)

    Mihklepp, M.; Domnitch, E.; Gelfand, D.; Foing, B. H.; van der Heide, E.

    2014-04-01

    Human curiosity and exploration towards outer space has led to many fantastic inventions and given way to alternative scenarios about the origins of life. In the Space Science in the Arts course together with ESTEC with support from ILEWG. I got interested about unicellular slime mold Physarum polycephalum. There has been and still is a lot of research on Physarum polycephalum. This brainless eucaryotic microbe has its smartness and external memory strategies. Physarum can navigate through a maze made of agar using the shortest route possible when two pieces of food are placed at two separate exits of the maze. It can build efficient networks - Physarum created network similar to the existing Tokyo train system. It is being used to control a robot, in USB-sensor and in sound synthesis. Right now there is a lot of research about using Physarum in bio-computing.

  2. Flexible Nonstick Replica Mold for Transfer Printing of Ag Ink.

    PubMed

    Lee, Bong Kuk; Yu, Han Young; Kim, Yarkyeon; Yoon, Yong Sun; Jang, Won Ik; Do, Lee-Mi; Park, Ji-Ho; Park, Jaehoon

    2016-03-01

    We report the fabrication of flexible replica molds for transfer printing of Ag ink on a rigid glass substrate. As mold precursors, acrylic mixtures were prepared from silsesquioxane-based materials, silicone acrylate, poly(propylene glycol) diacrylate, 3,3,4,4,5,5,6,6,7,7,8,8, 9,9,10,10,10-heptadecafluorodecyl methacrylate, and photoinitiator. By using these materials, the replica molds were fabricated from a silicon master onto a flexible substrate by means of UV-assisted molding process at room temperature. The wettability of Ag ink decreased with increase in the water contact angle of replica molds. On the other hand, the transfer rate of Ag ink onto adhesive-modified substrates increased with increase in the water contact angle of replica molds. Transferred patterns were found to be thermally stable on the photocurable adhesive layer, whereas Ag-ink patterns transferred on non-photocurable adhesives were distorted by thermal treatment. We believe that these characteristics of replica molds and adhesives offer a new strategy for the development of the transfer printing of solution-based ink materials.

  3. Interface conditions of two-shot molded parts

    SciTech Connect

    Kisslinger, Thomas; Bruckmoser, Katharina Resch, Katharina; Lucyshyn, Thomas E-mail: guenter.langecker@unileoben.ac.at; Langecker, Guenter Ruediger E-mail: guenter.langecker@unileoben.ac.at; Holzer, Clemens

    2014-05-15

    The focus of this work is on interfaces of two-shot molded parts. It is well known that e.g. material combination, process parameters and contact area structures show significant effects on the bond strength of multi-component injection molded parts. To get information about the bond strength at various process parameter settings and material combinations a test mold with core back technology was used to produce two-component injection molded tensile test specimens. At the core back process the different materials are injected consecutively, so each component runs through the whole injection molding cycle (two-shot process). Due to this consecutive injection molding processes, a cold interface is generated. This is defined as overmolding of a second melt to a solidified polymer preform. Strong interest lies in the way the interface conditions change during the adhesion formation between the individual components. Hence the interface conditions were investigated by computed tomography and Raman spectroscopy. By analyzing these conditions the understanding of the adhesion development during the multi-component injection molding was improved.

  4. Smart plastic functionalization by nanoimprint and injection molding

    NASA Astrophysics Data System (ADS)

    Zalkovskij, Maksim; Thamdrup, Lasse H.; Smistrup, Kristian; Andén, Thomas; Johansson, Alicia C.; Mikkelsen, Niels Jørgen; Madsen, Morten Hannibal; Garnæs, Jørgen; Kristiansen, Tommy Tungelund; Diemer, Mads; Døssing, Michael; Minzari, Daniel; Tang, Peter Torben; Kristensen, Anders; Taboryski, Rafael; Essendrop, Søren; Nielsen, Theodor; Bilenberg, Brian

    2015-03-01

    In this paper, we present a route for making smart functionalized plastic parts by injection molding with sub-micrometer surface structures. The method is based on combining planar processes well known and established within silicon micro and sub-micro fabrication with proven high resolution and high fidelity with truly freeform injection molding inserts. The link between the planar processes and the freeform shaped injection molding inserts is enabled by the use of nanoimprint with flexible molds for the pattern definition combined with unidirectional sputter etching for transferring the pattern. With this approach, we demonstrate the transfer of down to 140 nm wide holes on large areas with good structure fidelity on an injection molding steel insert. The durability of the sub-micrometer structures on the inserts have been investigated by running two production series of 102,000 and 73,000 injection molded parts, respectively, on two different inserts and inspecting the inserts before and after the production series and the molded parts during the production series.

  5. [Biological monitoring in the molding of plastics and rubbers].

    PubMed

    Fustinoni, S; Campo, L; Cirla, A M; Cirla, P E; Cutugno, V; Lionetti, C; Martinotti, I; Mossini, E; Foà, V

    2007-01-01

    This survey was carried out in the molding of plastics and rubbers, in the "Professional Cancer Prevention Project" sponsored by the Lombardy region with the objective of developing and implementing protocols for evaluating exposure to carcinogens through the biological monitoring. The realities of molding the thermoplastic polymer ABS, rubber, and thermosetting plastics containing formaldehyde were examined. The carcinogenic substances identified in these processes were: 1,3-butadiene, acrylonitrile and styrene in molding ABS, polycyclic aromatic hydrocarbons (PAH) in molding rubber, and formaldehyde in molding the thermosetting plastics. Only for some of these substances biological indicators are available. The limited exposure to airborne chemicals in molding ABS and the intrinsic characteristics of biological indicators available for 1-3 butadiene have determined the non applicability of biological monitoring to this situation. The absence of a biological indicator of exposure to formaldehyde has made this situation not investigable. Exposure in the rubber molding was studied in 19 subjects applying the determination not metabolized PAH in urine. The levels of these indicators were similar to those measured in other groups of subjects without occupational exposure to PAH, confirming a low airborne contamination in this workplace.

  6. Replica mold for nanoimprint lithography from a novel hybrid resin.

    PubMed

    Lee, Bong Kuk; Hong, Lan-Young; Lee, Hea Yeon; Kim, Dong-Pyo; Kawai, Tomoji

    2009-10-06

    The use of durable replica molds with high feature resolution has been proposed as an inexpensive and convenient route for manufacturing nanostructured materials. A simple and fast duplication method, involving the use of a master mold to create durable polymer replicas as imprinting molds, has been demonstrated using both UV- and thermal nanoimprinting lithography (NIL). To obtain a high-durability replicating material, a dual UV/thermal-curable, organic-inorganic hybrid resin was synthesized using a sol-gel-based combinatorial method. The cross-linked hybrid resin exhibited high transparency to UV light and resistance to organic solvents. Molds made of this material showed good mechanical properties (Young's modulus=1.76 GPa) and gas permeability. The low viscosity of the hybrid resin (approximately 29 cP) allowed it to be easily transferred to relief nanostructures on transparent glass substrates using UV-NIL at room temperature and low pressure (0.2 MPa) over a relatively short time (80 s). A low surface energy release agent was successfully coated onto the hybrid mold surface without destroying the imprinted nanostructures, even after O2 plasma treatment. Nanostructures with feature sizes down to 80 nm were successfully reproduced using these molds in both UV- and thermal-NIL processes. After repeating 10 imprinting cycles at relatively high temperature and pressure, no detectable collapse or contamination of the replica surface was observed. These results indicate that the hybrid molds could tolerate repeated UV- and thermal-NIL processes.

  7. Review of small aspheric glass lens molding technologies

    NASA Astrophysics Data System (ADS)

    Yin, Shaohui; Jia, Hongpeng; Zhang, Guanhua; Chen, Fengjun; Zhu, Kejun

    2017-01-01

    Aspheric lens can eliminate spherical aberrations, coma, astigmatism, field distortions, and other adverse factors. This type of lens can also reduce the loss of light energy and obtain high-quality images and optical characteristics. The demand for aspheric lens has increased in recent years because of its advantageous use in the electronics industry, particularly for compact, portable devices and high-performance products. As an advanced manufacturing technology, the glass lens molding process has been recognized as a low-cost and high-efficiency manufacturing technology for machining small-diameter aspheric lens for industrial production. However, the residual stress and profile deviation of the glass lens are greatly affected by various key technologies for glass lens molding, including glass and mold-die material forming, mold-die machining, and lens molding. These key technical factors, which affect the quality of the glass lens molding process, are systematically discussed and reviewed to solve the existing technical bottlenecks and problems, as well as to predict the potential applicability of glass lens molding in the future.

  8. Screening Tools to Estimate Mold Burdens in Homes

    SciTech Connect

    Vesper, Sephen J.; McKinstry, Craig A.; Bradham, Karen; Ashley, Peter; Cox, David F.; DeWalt, Gary; Lin, King-teh N.

    2009-01-01

    Objective: The objective of this study was to develop screening tools that could be used to estimate the mold burden in a home which would indicate whether more detailed testing might be useful. Methods: Previously, in the American Healthy Home Survey, a DNA-based method of analysis called mold specific quantitative PCR was used to measure 36 molds in standard protocol dust samples. This resulted in a national index called the Environmental Relative Moldiness Index. In this current study, two possible screening methods were considered: use of the vacuum cleaner bag dust rather than the standard protocol dust samples and reducing the number of molds needed to be quantified resulting in the creation of a simpler mold burden scale. Results: Comparison of vacuum bag and standard dust samples from 157 of the same homes demonstrated that most molds had higher detection rates in vacuum bag dust compared to the standard dust samples but the ERMI values were still related to each other. The second approach to simplifying the screening for mold burdens produced a correlated (ρ=0.80) index to the ERMI called the American Relative Moldiness Index (ARMI) which requires the analysis of only 12 species. Conclusions: Vacuum bag dust sample ERMI values were predictive in placing a home into the lower or upper 50% of homes on the ERMI scale. If it is not possible to obtain the standard dust sample, the vacuum cleaner bag dust may be a useful screening tool for estimating mold burdens in homes. If the standard sample is available and a simpler screening test is sought to estimate the mold burden in homes, the ARMI scale might be useful.

  9. Atmospheric transport of mold spores in clouds of desert dust.

    PubMed

    Shinn, Eugene A; Griffin, Dale W; Seba, Douglas B

    2003-08-01

    Fungal spores can be transported globally in clouds of desert dust. Many species of fungi (commonly known as molds) and bacteria--including some that are human pathogens--have characteristics suited to long-range atmospheric transport. Dust from the African desert can affect air quality in Africa, Europe, the Middle East, and the Americas. Asian desert dust can affect air quality in Asia, the Arctic, North America, and Europe. Atmospheric exposure to mold-carrying desert dust may affect human health directly through allergic induction of respiratory stress. In addition, mold spores within these dust clouds may seed downwind ecosystems in both outdoor and indoor environments.

  10. Residual orientation in micro-injection molded parts

    SciTech Connect

    Healy, John; Edward, Graham H.; Knott, Robert B.

    2008-06-30

    The residual orientation following micro-injection molding of small rectangular plates with linear polyethylene has been examined using small-angle neutron scattering, and small- and wide-angle X-ray scattering. The effect of changing the molding conditions has been examined, and the residual chain orientation has been compared to the residual orientation of the crystallites as a function of position in the sample. This study has found that, for micromoldings, the orientation of the crystallites decreases with increasing injection speed and increasing mold thickness. The combined data suggest that the majority of the orientation present comes from oriented crystal growth rather than residual chain orientation.

  11. Atmospheric transport of mold spores in clouds of desert dust

    USGS Publications Warehouse

    Shinn, E.A.; Griffin, Dale W.; Seba, D.B.

    2003-01-01

    Fungal spores can be transported globally in clouds of desert dust. Many species of fungi (commonly known as molds) and bacteria--including some that are human pathogens--have characteristics suited to long-range atmospheric transport. Dust from the African desert can affect air quality in Africa, Europe, the Middle East, and the Americas. Asian desert dust can affect air quality in Asia, the Arctic, North America, and Europe. Atmospheric exposure to mold-carrying desert dust may affect human health directly through allergic induction of respiratory stress. In addition, mold spores within these dust clouds may seed downwind ecosystems in both outdoor and indoor environments.

  12. Rapid and Low-cost Prototyping of Medical Devices Using 3D Printed Molds for Liquid Injection Molding

    PubMed Central

    Chung, Philip; Heller, J. Alex; Etemadi, Mozziyar; Ottoson, Paige E.; Liu, Jonathan A.; Rand, Larry; Roy, Shuvo

    2014-01-01

    Biologically inert elastomers such as silicone are favorable materials for medical device fabrication, but forming and curing these elastomers using traditional liquid injection molding processes can be an expensive process due to tooling and equipment costs. As a result, it has traditionally been impractical to use liquid injection molding for low-cost, rapid prototyping applications. We have devised a method for rapid and low-cost production of liquid elastomer injection molded devices that utilizes fused deposition modeling 3D printers for mold design and a modified desiccator as an injection system. Low costs and rapid turnaround time in this technique lower the barrier to iteratively designing and prototyping complex elastomer devices. Furthermore, CAD models developed in this process can be later adapted for metal mold tooling design, enabling an easy transition to a traditional injection molding process. We have used this technique to manufacture intravaginal probes involving complex geometries, as well as overmolding over metal parts, using tools commonly available within an academic research laboratory. However, this technique can be easily adapted to create liquid injection molded devices for many other applications. PMID:24998993

  13. Rapid and low-cost prototyping of medical devices using 3D printed molds for liquid injection molding.

    PubMed

    Chung, Philip; Heller, J Alex; Etemadi, Mozziyar; Ottoson, Paige E; Liu, Jonathan A; Rand, Larry; Roy, Shuvo

    2014-06-27

    Biologically inert elastomers such as silicone are favorable materials for medical device fabrication, but forming and curing these elastomers using traditional liquid injection molding processes can be an expensive process due to tooling and equipment costs. As a result, it has traditionally been impractical to use liquid injection molding for low-cost, rapid prototyping applications. We have devised a method for rapid and low-cost production of liquid elastomer injection molded devices that utilizes fused deposition modeling 3D printers for mold design and a modified desiccator as an injection system. Low costs and rapid turnaround time in this technique lower the barrier to iteratively designing and prototyping complex elastomer devices. Furthermore, CAD models developed in this process can be later adapted for metal mold tooling design, enabling an easy transition to a traditional injection molding process. We have used this technique to manufacture intravaginal probes involving complex geometries, as well as overmolding over metal parts, using tools commonly available within an academic research laboratory. However, this technique can be easily adapted to create liquid injection molded devices for many other applications.

  14. Method of reusably sealing a silicone rubber vacuum bag to a mold for composite manufacture

    NASA Technical Reports Server (NTRS)

    Steinbach, John (Inventor)

    1989-01-01

    A silicone rubber vacuum bag for use in composite article manufacture is reusably sealed to a mold, without mechanical clamping means. The mold-mating portion of the bag is primed with a silicone rubber adhesive, which is cured thereto, and a layer of semiadhesive sealer is applied between the primed mold-mating portion of the bag and the mold.

  15. Mold Simulator Study on the Initial Solidification of Molten Steel Near the Corner of Continuous Casting Mold

    NASA Astrophysics Data System (ADS)

    Lyu, Peisheng; Wang, Wanlin; Zhang, Haihui

    2017-02-01

    Corner cracks are one of the most widespread surface defects of continuous casting slabs, and they are especially severe for peritectic steels and low-alloy steels. Therefore, a clear understanding of molten steel initial solidification around mold corner would be of great importance for the inhibition of corner cracks. This paper has been conducted with the aim to elucidate this understanding, by using a novel mold simulator equipped with a right-angle copper mold. The responding temperatures and heat fluxes across the mold hot-face and corner were firstly calculated through a 2D-inverse heat conduction program mathematical model, and the results suggested that the cooling ability and the fluctuation of heat fluxes around the mold corner are stronger than those for mold hot-face. With the help of power spectral density analysis and fast Fourier transformation, the four characteristic signals of heat fluxes were discussed in this paper. Next, the relation between the thickness of solidified shell and solidification time was fitted with the solidification square root law; as a result, the average solidification factor bar{K} for the hot-face shell is 2.32 mm/s1/2, and it is 2.77 mm/s1/2 for the shell near-corner. For the same oscillation marks (OMs), it appeared that the OMs positions on the shell corner are lower than those on the shell hot-face along the casting direction, because the stronger shrinkage of shell at the corner allows the overflowing steel to penetrate deeper into the larger gap between the shell corner and mold, which is demonstrated through the heat transfer analysis and metallographic examination. Finally, the interrelation between shell profile, mold oscillation, variation rate of heat flux, high-frequency heat flux and high-frequency temperature was discussed for above two cases, and the results suggested that meniscus conditions (heat transfer and melt flow) around the mold corner are more unsteady.

  16. Method and mold for casting thin metal objects

    DOEpatents

    Pehrson, Brandon P; Moore, Alan F

    2014-04-29

    Provided herein are various embodiments of systems for casting thin metal plates and sheets. Typical embodiments include layers of mold cavities that are oriented vertically for casting the metal plates. In some embodiments, the mold cavities include a beveled edge such that the plates that are cast have a beveled edge. In some embodiments, the mold cavities are filled with a molten metal through an open horizontal edge of the cavity. In some embodiments, the mold cavities are filled through one or more vertical feed orifices. Further disclosed are methods for forming a thin cast metal plate or sheet where the thickness of the cast part is in a range from 0.005 inches to 0.2 inches, and the surface area of the cast part is in a range from 16 square inches to 144 square inches.

  17. The Mold Insurance Crisis: Less than It Appears.

    ERIC Educational Resources Information Center

    Mangan, Joseph F.

    2003-01-01

    Discusses two different but closely related problems that must be solved when determining what insurance coverage a campus needs for mold losses: issues of property insurance and of liability insurance. (EV)

  18. VIEW FACING EAST. ORE TRESTLE WINDS AROUND THE INGOT MOLD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW FACING EAST. ORE TRESTLE WINDS AROUND THE INGOT MOLD CONDITIONING BUILDING IN FOREGROUND. PITTSBURGH & LAKE ERIE TRACKS WIND THROUGH TOWN TOWARDS PITTSBURGH AT RIGHT. - Pittsburgh Steel Company, Monessen Works, Donner Avenue, Monessen, Westmoreland County, PA

  19. Diamond machining of steel molds for optical components

    NASA Astrophysics Data System (ADS)

    Bohr, Roland

    2016-08-01

    The requirement of ultra precision diamond machining of lens molds in steel is identified. A solution for this type of machining is presented and results of such a machining in steel compared to standard milling and polishing process are shown.

  20. 10. VIEW OF DEPLETED URANIUM INGOT AND MOLD IN FOUNDRY. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. VIEW OF DEPLETED URANIUM INGOT AND MOLD IN FOUNDRY. (11/11/56) - Rocky Flats Plant, Non-Nuclear Production Facility, South of Cottonwood Avenue, west of Seventh Avenue & east of Building 460, Golden, Jefferson County, CO

  1. 36. LARGE MOLD MAKING MACHINE, GREY IRON UNIT #4 SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    36. LARGE MOLD MAKING MACHINE, GREY IRON UNIT #4 SHOWING PATTERNS THAT FLASKS FIT OVER PRIOR TO BEING FILLED WITH SAND AND COMPRESSED. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  2. Cork is used to make tooling patterns and molds

    NASA Technical Reports Server (NTRS)

    Hoffman, F. J.

    1965-01-01

    Sheet and waste cork are cemented together to provide a tooling pattern or mold. The cork form withstands moderately high temperatures under vacuum or pressure with minimum expansion, shrinkage, or distortion.

  3. PNEUMATICALLY CLEANING TOP HALF OF LARGE MOLD IN BOX FLOOR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    PNEUMATICALLY CLEANING TOP HALF OF LARGE MOLD IN BOX FLOOR AREA TO REMOVE ANY EXCESS OR LOOSE SAND. - Stockham Pipe & Fittings Company, Ductile Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  4. 55. August 17, 1913 "Clearing off mold from surface ground, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    55. August 17, 1913 "Clearing off mold from surface ground, Pinnacles Road, mile six. Note mould raked aside and piled up preparatory to burning." - Crater Lake National Park Roads, Klamath Falls, Klamath County, OR

  5. SOUTHERN DUCTILE CASTING COMPANY, BACK SIDE OF FURNACE AND MOLDING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    SOUTHERN DUCTILE CASTING COMPANY, BACK SIDE OF FURNACE AND MOLDING BUILDINGS SHOWING CONNECTIONS TO LOCAL POWER GRID, PRIMARILY FOR ELECTRIC FURNACES. - Southern Ductile Casting Company, Bessemer Foundry, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  6. 31. FLOOR MOLDING PROCESS. THE WORKER IS 'PARTING DOWN' THE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. FLOOR MOLDING PROCESS. THE WORKER IS 'PARTING DOWN' THE MOULDING SAND TO REMOVE THE PATTERN FROM THE FLASK LOADED WITH SAND. WORKER: GEORGE URIARTE. - Knight Foundry, 13 Eureka Street, Sutter Creek, Amador County, CA

  7. INTERIOR VIEW, PREPARING LARGE MOLD IN BOX FLOOR AREA. WORKERS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR VIEW, PREPARING LARGE MOLD IN BOX FLOOR AREA. WORKERS JUST FILLED THE FLASK WITH SAND FROM A HIGH VELOCITY MECHANICAL SAND THRUSTER. - Stockham Pipe & Fittings Company, Ductile Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  8. High-throughput plastic microlenses fabricated using microinjection molding techniques

    NASA Astrophysics Data System (ADS)

    Appasamy, Sreeram; Li, Weizhuo; Lee, Se Hwan; Boyd, Joseph T.; Ahn, Chong H.

    2005-12-01

    A novel fabrication scheme to develop high-throughput plastic microlenses using injection-molding techniques is realized. The initial microlens mold is fabricated using the well-known reflow technique. The reflow process is optimized to obtain reliable and repeatable microlens patterns. The master mold insert for the injection-molding process is fabricated using metal electroforming. The electroplating process is optimized for obtaining a low stress electroform. Two new plastic materials, cyclo olefin copolymer (COC) and Poly IR 2 are introduced in this work for fabricating microlenses. The plastic microlenses have been characterized for their focal lengths that range from 200 µm to 1.9 mm. This technique enables high-volume production of plastic microlenses with cycle times for a single chip being of the order of 60 s.

  9. SHAKE OUT WORKER DUMPING COOLED MOLDS ONTO THE VIBRATING CONVEYOR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    SHAKE OUT WORKER DUMPING COOLED MOLDS ONTO THE VIBRATING CONVEYOR THAT TRANSPORTS SAND AND CASTINGS TO THE SEPARATION SCREEN. - Southern Ductile Casting Company, Centerville Foundry, 101 Airport Road, Centreville, Bibb County, AL

  10. Newel post and balustrade (west passage), column (seminary), crown molding ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Newel post and balustrade (west passage), column (seminary), crown molding (second floor), window sill (second floor), and baseboard (second floor). - Russian Bishop's House, 501 Lincoln Street, Sitka, Sitka Borough, AK

  11. Mold Heating and Cooling Pump Package Operator Interface Controls Upgrade

    SciTech Connect

    Josh A. Salmond

    2009-08-07

    The modernization of the Mold Heating and Cooling Pump Package Operator Interface (MHC PP OI) consisted of upgrading the antiquated single board computer with a proprietary operating system to off-the-shelf hardware and off-the-shelf software with customizable software options. The pump package is the machine interface between a central heating and cooling system that pumps heat transfer fluid through an injection or compression mold base on a local plastic molding machine. The operator interface provides the intelligent means of controlling this pumping process. Strict temperature control of a mold allows the production of high quality parts with tight tolerances and low residual stresses. The products fabricated are used on multiple programs.

  12. EVALUATION OF POLLUTION PREVENTION OPPORTUNITIES FOR MOLD RELEASE AGENTS

    EPA Science Inventory

    The report gives results of an assessment of the processes, materials, installation practices, and emission characteristics associated with the application of mold release agents (MRAs). Emissions were estimated based on available information on MRA composition and consumption. V...

  13. Printable Version of Mold Remediation in Schools and Commercial Buildings

    EPA Pesticide Factsheets

    This document presents guidelines for the remediation/cleanup of mold and moisture problems in schools and commercial buildings; these guidelines include measures designed to protect the health of building occupants and remediators.

  14. 21. First floor, west wall, detail of molding trim ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    21. First floor, west wall, detail of molding trim - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

  15. 31. View from mezzanine showing balcony and stage. (note molding ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. View from mezzanine showing balcony and stage. (note molding trim around speakers, set into stage wall); view is to the south. - Fort Ord, Soldiers' Club, California State Highway 1 near Eighth Street, Seaside, Monterey County, CA

  16. A corneal mold to restore normal corneal dimensions.

    PubMed

    Swinger, C A; Kornmehl, E W; York, S; Forman, J S

    1986-01-01

    A corneal mold is described that provides an MK corneal button of normal thickness and curvature from an edematous, post-mortem button. The uniform, processed tissue can then be used for experimental refractive surgery.

  17. Detail, capital molding on corner boards at northwest corner of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Detail, capital molding on corner boards at northwest corner of two-story block, forming corner pilaster. This is the only extant corner board capital. - Drew-Sherwood Farm, House, 7927 Elk Grove Boulevard, Elk Grove, Sacramento County, CA

  18. Molded composite pyrogen igniter for rocket motors. [solid propellant ignition

    NASA Technical Reports Server (NTRS)

    Heier, W. C.; Lucy, M. H. (Inventor)

    1978-01-01

    A lightweight pyrogen igniter assembly including an elongated molded plastic tube adapted to contain a pyrogen charge was designed for insertion into a rocket motor casing for ignition of the rocket motor charge. A molded plastic closure cap provided for the elongated tube includes an ignition charge for igniting the pyrogen charge and an electrically actuated ignition squib for igniting the ignition charge. The ignition charge is contained within a portion of the closure cap, and it is retained therein by a noncorrosive ignition pellet retainer or screen which is adapted to rest on a shoulder of the elongated tube when the closure cap and tube are assembled together. A circumferentially disposed metal ring is provided along the external circumference of the closure cap and is molded or captured within the plastic cap in the molding process to provide, along with O-ring seals, a leakproof rotary joint.

  19. Residual stresses in injection molded shape memory polymer parts

    NASA Astrophysics Data System (ADS)

    Katmer, Sukran; Esen, Huseyin; Karatas, Cetin

    2016-03-01

    Shape memory polymers (SMPs) are materials which have shape memory effect (SME). SME is a property which has the ability to change shape when induced by a stimulator such as temperature, moisture, pH, electric current, magnetic field, light, etc. A process, known as programming, is applied to SMP parts in order to alter them from their permanent shape to their temporary shape. In this study we investigated effects of injection molding and programming processes on residual stresses in molded thermoplastic polyurethane shape memory polymer, experimentally. The residual stresses were measured by layer removal method. The study shows that injection molding and programming process conditions have significantly influence on residual stresses in molded shape memory polyurethane parts.

  20. 22. INTERIOR VIEW WITH INTERIOR VIEW OF MOLDING SANDS CONTROL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. INTERIOR VIEW WITH INTERIOR VIEW OF MOLDING SANDS CONTROL AND TEST LAB FOR UNIT NO. 2 GREY IRON DISAMATIC. SAND CASTING TECHNICIAN, ROY BATES, TESTS THE WEIGHT OF THE SAND, DRYS IT, AND WEIGHT IT AGAINST STANDARDS TO CALCULATE THE CORRECT MOISTURE NEEDED FOR DIFFERENT MOLDS. THE SAND MIX VARY WITH THE SIZE AND COMPOSITION OF THE CASTING. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  1. CAE for Injection Molding — Past, Present and the Future

    NASA Astrophysics Data System (ADS)

    Wang, Kuo K.

    2004-06-01

    It is well known that injection molding is the most effective process for mass-producing discrete plastic parts of complex shape to the highest precision at the lowest cost. However, due to the complex property of polymeric materials undergoing a transient non-isothermal process, it is equally well recognized that the quality of final products is often difficult to be assured. This is particularly true when a new mold or material is encountered. As a result, injection molding has often been viewed as an art than a science. During the past few decades, numerical simulation of injection molding process based on analytic models has become feasible for practical use as computers became faster and cheaper continually. A research effort was initiated at the Cornell Injection Molding Program (CIMP) in 1974 under a grant from the National Science Foundation. Over a quarter of the century, CIMP has established some scientific bases ranging from materials characterization, flow analysis, to prediction of part quality. Use of such CAE tools has become common place today in industry. Present effort has been primarily aimed at refinements of many aspects of the process. Computational efficiency and user-interface have been main thrusts by commercial software developers. Extension to 3-dimensional flow analysis for certain parts has drawn some attention. Research activities are continuing on molding of fiber-filled materials and reactive polymers. Expanded molding processes such as gas-assisted, co-injection, micro-molding and many others are continually being investigated. In the future, improvements in simulation accuracy and efficiency will continue. This will include in-depth studies on materials characterization. Intelligent on-line process control may draw more attention in order to achieve higher degree of automation. As Internet technology continues to evolve, Web-based CAE tools for design, production, remote process monitoring and control can come to path. The CAE

  2. Evaluation of Additive Manufacturing for Composite Part Molds

    SciTech Connect

    Duty, Chad E.; Springfield, Robert M.

    2015-02-01

    The ORNL Manufacturing Demonstration Facility (MDF) collaborated with Tru-Design to test the quality and durability of molds used for making fiber reinforced composites using additive manufacturing. The partners developed surface treatment techniques including epoxy coatings and machining to improve the quality of the surface finish. Test samples made using the printed and surface finished molds demonstrated life spans suitable for one-of-a-kind and low-volume applications, meeting the project objective.

  3. Molding of top skull in the treatment of Apert syndrome.

    PubMed

    Shen, Weimin; Cui, Jie; Chen, Jianbin; Weiping, Shen

    2015-03-01

    Patients with Apert syndrome have bilateral coronal craniosynostosis, along with a distinguishing feature of their many deformity, called tower skull. Surgical correction of this deformity is the mainstay of treatment. We describe 3 patients molded top skull after front bone osteotomy orbital bar advancement. This successfully restricted growth of their top skull while allowing growth in other dimensions. Utilization of top-skull molding after cranial surgery shows promise of satisfaction in this setting.

  4. Material flow data for numerical simulation of powder injection molding

    NASA Astrophysics Data System (ADS)

    Duretek, I.; Holzer, C.

    2017-01-01

    The powder injection molding (PIM) process is a cost efficient and important net-shape manufacturing process that is not completely understood. For the application of simulation programs for the powder injection molding process, apart from suitable physical models, exact material data and in particular knowledge of the flow behavior are essential in order to get precise numerical results. The flow processes of highly filled polymers are complex. Occurring effects are very hard to separate, like shear flow with yield stress, wall slip, elastic effects, etc. Furthermore, the occurrence of phase separation due to the multi-phase composition of compounds is quite probable. In this work, the flow behavior of a 316L stainless steel feedstock for powder injection molding was investigated. Additionally, the influence of pre-shearing on the flow behavior of PIM-feedstocks under practical conditions was examined and evaluated by a special PIM injection molding machine rheometer. In order to have a better understanding of key factors of PIM during the injection step, 3D non-isothermal numerical simulations were conducted with a commercial injection molding simulation software using experimental feedstock properties. The simulation results were compared with the experimental results. The mold filling studies amply illustrate the effect of mold temperature on the filling behavior during the mold filling stage. Moreover, the rheological measurements showed that at low shear rates no zero shear viscosity was observed, but instead the viscosity further increased strongly. This flow behavior could be described with the Cross-WLF approach with Herschel-Bulkley extension very well.

  5. Mold Susceptibility of Rapidly Renewable Building Materials Used in Wall Construction

    DTIC Science & Technology

    2007-12-01

    16 Ideal Conditions and Requirements for Mold Growth ..........................................17 Mold Spores, Germination , and Growth...and a food source can become a hospitable environment for mold to grow and germinate —including indoor areas (Owen, 2006). Since the energy...creates and sends out spores, • Fungicide: a chemical used to kill fungi or mold growth, • Germling: first product from the germination of a mold

  6. Morphology Evolution during Injection Molding: effect of packing pressure

    NASA Astrophysics Data System (ADS)

    Pantani, R.; Coccorullo, I.; Speranza, V.; Titomanlio, G.

    2007-04-01

    Injection molding is one of the most widely employed methods for manufacturing polymeric products. The final properties and the quality of an injection molded part are to a great extent affected by morphology. Thus, the prediction of microstructure formation is of technological importance, also for optimizing processing variables, in order to cut down on the expensive costs of tooling and the trial-and-error procedures. In this work, some injection molding tests were performed with the aim of studying the effects of packing pressure on morphology distribution. The resulting morphology of the moldings was in fact characterized by adopting different experimental techniques and, in order to underline the effects of holding pressure, it was compared with previous results gathered on samples obtained applying a lower holding pressure. Furthermore, the molding tests were simulated by means of a code developed at University of Salerno, which implements procedures able to model molecular orientation, crystallization kinetics and morphology evolution. The results obtained show that on increasing holding pressure the molecular orientation inside the samples increases, and simulations show that this is due mainly to the increase of relaxation time caused by the higher pressures. Furthermore, a sensible reduction of the percentage of α-phase is found on increasing the holding pressure, whereas the percentage of mesomorphic phase increases and a small fraction of γ-phase is found, which was not present in the samples molded at lower holding pressures.

  7. Mold-filling experiments for validation of modeling encapsulation. Part 1, "wine glass" mold.

    SciTech Connect

    Castaneda, Jaime N.; Grillet, Anne Mary; Altobelli, Stephen A.; Cote, Raymond O.; Mondy, Lisa Ann

    2005-06-01

    The C6 project 'Encapsulation Processes' has been designed to obtain experimental measurements for discovery of phenomena critical to improving these processes, as well as data required in the verification and validation plan (Rao et al. 2001) for model validation of flow in progressively complex geometries. We have observed and recorded the flow of clear, Newtonian liquids and opaque, rheologically complex suspensions in two mold geometries. The first geometry is a simple wineglass geometry in a cylinder and is reported here in Part 1. The results in a more realistic encapsulation geometry are reported in Part 2.

  8. Infrared curing simulations of liquid composites molding

    NASA Astrophysics Data System (ADS)

    Nakouzi, S.; Pancrace, J.; Schmidt, F. M.; Le Maoult, Y.; Berthet, F.

    2011-05-01

    Infrared radiation is an effective energy source to cure thermosetting polymers. Its usage is expected to reduce curing time in comparison with thermal heating and mold thermally regulated. In addition, because of the polymerization mechanism and instant on-off control of this power, an improvement in the final properties of the material is also expected. In this paper, we studied the infrared interaction with carbon (or glass) fibers reinforced epoxy matrix, where Liquid resin infusion (LRI) is used to manufacture the composite. Temperature of the composite is a key parameter that affects its mechanical properties and is controlled by the infrared emitters and the exothermic heat released from the polymerization. Radiative heat flux is computed using the in-lab developed software RAYHEAT. Then, the heat flux (or absorbed energy for glass fibers) is exported to the finite element based program COMSOLMULTIPHYSICS where heat balance equation is solved. This equation is coupled with the exothermic heat released during the curing process in order to predict the composite temperature versus time and degree of cure. Numerical simulations will be performed on planar parts (sheet shape) as well as curvilinear shapes. Experimental validations of the infrared curing carbon (glass)-epoxy composite system are presented in this paper Sheet surface temperature distribution are measured thanks to infrared camera. Kinetic parameters were estimated from differential scanning calorimeter (DSC) experimental data.

  9. Thermomechanical Behavior of Molded Metallic Glass Nanowires

    PubMed Central

    Magagnosc, Daniel J.; Chen, Wen; Kumar, Golden; Schroers, Jan; Gianola, Daniel S.

    2016-01-01

    Metallic glasses are disordered materials that offer the unique ability to perform thermoplastic forming operations at low thermal budget while preserving excellent mechanical properties such as high strength, large elastic strain limits, and wear resistance owing to the metallic nature of bonding and lack of internal defects. Interest in molding micro- and nanoscale metallic glass objects is driven by the promise of robust and high performance micro- and nanoelectromechanical systems and miniature energy conversion devices. Yet accurate and efficient processing of these materials hinges on a robust understanding of their thermomechanical behavior. Here, we combine large-scale thermoplastic tensile deformation of collections of Pt-based amorphous nanowires with quantitative thermomechanical studies of individual nanowires in creep-like conditions to demonstrate that superplastic-like flow persists to small length scales. Systematic studies as a function of temperature, strain-rate, and applied stress reveal the transition from Newtonian to non-Newtonian flow to be ubiquitous across the investigated length scales. However, we provide evidence that nanoscale specimens sustain greater free volume generation at elevated temperatures resulting in a flow transition at higher strain-rates than their bulk counterparts. Our results provide guidance for the design of thermoplastic processing methods and methods for verifying the flow response at the nanoscale. PMID:26787400

  10. Infrared curing simulations of liquid composites molding

    SciTech Connect

    Nakouzi, S.; Pancrace, J.; Schmidt, F. M.; Le Maoult, Y.; Berthet, F.

    2011-05-04

    Infrared radiation is an effective energy source to cure thermosetting polymers. Its usage is expected to reduce curing time in comparison with thermal heating and mold thermally regulated. In addition, because of the polymerization mechanism and instant on-off control of this power, an improvement in the final properties of the material is also expected. In this paper, we studied the infrared interaction with carbon (or glass) fibers reinforced epoxy matrix, where Liquid resin infusion (LRI) is used to manufacture the composite. Temperature of the composite is a key parameter that affects its mechanical properties and is controlled by the infrared emitters and the exothermic heat released from the polymerization. Radiative heat flux is computed using the in-lab developed software RAYHEAT. Then, the heat flux (or absorbed energy for glass fibers) is exported to the finite element based program COMSOLMULTIPHYSICS where heat balance equation is solved. This equation is coupled with the exothermic heat released during the curing process in order to predict the composite temperature versus time and degree of cure. Numerical simulations will be performed on planar parts (sheet shape) as well as curvilinear shapes. Experimental validations of the infrared curing carbon (glass)-epoxy composite system are presented in this paper Sheet surface temperature distribution are measured thanks to infrared camera. Kinetic parameters were estimated from differential scanning calorimeter (DSC) experimental data.

  11. Thermomechanical Behavior of Molded Metallic Glass Nanowires.

    PubMed

    Magagnosc, Daniel J; Chen, Wen; Kumar, Golden; Schroers, Jan; Gianola, Daniel S

    2016-01-20

    Metallic glasses are disordered materials that offer the unique ability to perform thermoplastic forming operations at low thermal budget while preserving excellent mechanical properties such as high strength, large elastic strain limits, and wear resistance owing to the metallic nature of bonding and lack of internal defects. Interest in molding micro- and nanoscale metallic glass objects is driven by the promise of robust and high performance micro- and nanoelectromechanical systems and miniature energy conversion devices. Yet accurate and efficient processing of these materials hinges on a robust understanding of their thermomechanical behavior. Here, we combine large-scale thermoplastic tensile deformation of collections of Pt-based amorphous nanowires with quantitative thermomechanical studies of individual nanowires in creep-like conditions to demonstrate that superplastic-like flow persists to small length scales. Systematic studies as a function of temperature, strain-rate, and applied stress reveal the transition from Newtonian to non-Newtonian flow to be ubiquitous across the investigated length scales. However, we provide evidence that nanoscale specimens sustain greater free volume generation at elevated temperatures resulting in a flow transition at higher strain-rates than their bulk counterparts. Our results provide guidance for the design of thermoplastic processing methods and methods for verifying the flow response at the nanoscale.

  12. Investigation of Heat Transfer at the Mold/Metal Interface in Permanent Mold Casting of Light Alloys

    SciTech Connect

    Robert D. Pehlke; John T. Berry

    2005-12-16

    Accurate modeling of the metal casting process prior to creating a mold design demands reliable knowledge of the interfacial heat transfer coefficient at the mold metal interface as a function of both time and location. The phenomena concerned with the gap forming between the mold and the solidifying metal are complex but need to be understood before any modeling is attempted. The presence of mold coatings further complicates the situation. A commercial casting was chosen and studied in a gravity permanent mold casting process. The metal/mold interfacial heat transfer coefficient (IHTC) was the focus of the research. A simple, direct method has been used to evaluate the IHTC. Both the simulation and experiments have shown that a reasonably good estimate of the heat transfer coefficient could be made in the case studied. It has been found that there is a good agreement between experiments and simulations in the temperature profiles during the solidification process, given that the primary mechanism of heat transfer across the gap in permanent mold casting of light alloys is by conduction across the gap. The procedure utilized to determine the interfacial heat transfer coefficient can be applied to other casting processes. A recently completed project involving The University of Michigan and Mississippi State University, together with several industrial partners, which was supported by the USDOE through the Cast Metals Coalition, examined a number of cases of thermal contact. In an investigation which gave special consideration to the techniques of measurement, several mold coatings were employed and results presented as a function of time. Realistic conditions of coating thickness and type together with an appropriate combination of mold preheat and metal pouring temperature were strictly maintained throughout the investigation. Temperature sensors, in particular thermocouples, play an important part in validating the predictions of solidification models. Cooling

  13. Rapid localized heating of graphene coating on a silicon mold by induction for precision molding of polymer optics.

    PubMed

    Zhang, Lin; Zhou, Wenchen; Yi, Allen Y

    2017-04-01

    In compression molding of polymer optical components with micro/nanoscale surface features, rapid heating of the mold surface is critical for the implementation of this technology for large-scale applications. In this Letter, a novel method of a localized rapid heating process is reported. This process is based on induction heating of a thin conductive coating deposited on a silicon mold. Since the graphene coating is very thin (∼45  nm), a high heating rate of 10∼20°C/s can be achieved by employing a 1200 W 30 kHz electrical power unit. Under this condition, the graphene-coated surface and the polymer substrate can be heated above the polymer's glass transition temperature within 30 s and subsequently cooled down to room temperature within several tens of seconds after molding, resulting in an overall thermal cycle of about 3 min or shorter. The feasibility of this process was validated by fabrication of optical gratings, micropillar matrices, and microlens arrays on polymethylmethacrylate (PMMA) substrates with very high precision. The uniformity and surface geometries of the replicated optical elements are evaluated using an optical profilometer, a diffraction test setup, and a Shack-Hartmann wavefront sensor built with a molded PMMA microlens array. Compared with the conventional bulk heating molding process, this novel rapid localized induction heating process could improve replication efficiency with better geometrical fidelity.

  14. Effect of cross sectional geometry on PDMS micro peristaltic pump performance: comparison of SU-8 replica molding vs. micro injection molding.

    PubMed

    Graf, Neil J; Bowser, Michael T

    2013-10-07

    Two different fabrication methods were employed to fabricate micropumps with different cross-sectional channel geometries. The first was to fabricate rectangular cross-sectional microchannel geometries using the well known fabrication method of replica molding (REM). The second, and far less utilized fabrication technique, was to create microchannel molds using an in-house fabricated handheld micro injection molding apparatus. The injection mold apparatus was designed for use with elastomeric room temperature vulcanization (RTV) polymers, as opposed to most other injection molding machines, which are designed for use with thermoplastic polymers. The injection mold's bottom plate was used as a microchannel molding template. The molding template was created by threading a small-diameter wire (150 μm or less) through the injection mold's bottom plate, with subsequent adhesion and smoothing of a thin piece of aluminum foil over the wire-raised injection mold template. When molded against, the template produced a rounded/Gaussian-shaped PDMS microchannel. The design of the injection mold will be presented, along with a direct comparison for micropump performance metrics such as flow rate, valving characteristics, and maximum backpressures attainable for each of the respective micropump channel geometries.

  15. The possible role of fungal contamination in sick building syndrome.

    PubMed

    Straus, David C

    2011-01-01

    The following is a review of some of the work that we have done since 2007 regarding the importance of molds in the phenomenon of sick building syndrome (SBS). In these studies we first examined mold contamination in air handling units (AHU). Our results showed that Cladosporium sp. were commonly recovered in AHU as growth sites and free spores. They were found mainly on the blower wheel fan blades, the ductwork, and cooling coil fans. Our results showed that the presence of species of molds other than Cladosporium in locations other than the blower wheel blades indicated that the AHU condition was not optimal. In a series of three papers, we examined growth and mycotoxin production by Chaetomium globosum (CG). In these studies we showed that CG produces two potent mycotoxins, chaetoglobosin A (Ch-A) and chaetoglobosin C (Ch-C) when grown on building material. We discovered that these toxins break down when exposed to temperatures in excess of 75 degrees C. We also showed that growth and mycotoxin production by CG is favored at a neutral pH. In another study, we showed that mycotoxins can be detected in body fluids and human tissues from patients exposed to mycotoxin producing molds, and we showed which human tissues or fluids were the most likely to give positive results for detection of these compounds. Finally, we showed that the macrocyclic trichothecene mycotoxins (MTM) produced by Stachybotrys chartarum (SC) are detectable in experimental animals soon after exposure and we described the dynamics of MTM tissue loading.

  16. An in-mold packaging process for plastic fluidic devices.

    PubMed

    Yoo, Y E; Lee, K H; Je, T J; Choi, D S; Kim, S K

    2011-01-01

    Micro or nanofluidic devices have many channel shapes to deliver chemical solutions, body fluids or any fluids. The channels in these devices should be covered to prevent the fluids from overflowing or leaking. A typical method to fabricate an enclosed channel is to bond or weld a cover plate to a channel plate. This solid-to-solid bonding process, however, takes a considerable amount of time for mass production. In this study, a new process for molding a cover layer that can enclose open micro or nanochannels without solid-to-solid bonding is proposed and its feasibility is estimated. First, based on the design of a model microchannel, a brass microchannel master core was machined and a plastic microchannel platform was injection-molded. Using this molded platform, a series of experiments was performed for four process or mold design parameters. Some feasible conditions were successfully found to enclosed channels without filling the microchannels for the injection molding of a cover layer over the plastic microchannel platform. In addition, the bond strength and seal performance were estimated in a comparison with those done by conventional bonding or welding processes.

  17. Diversity and Significance of Mold Species in Norwegian Drinking Water▿

    PubMed Central

    Hageskal, Gunhild; Knutsen, Ann Kristin; Gaustad, Peter; de Hoog, G. Sybren; Skaar, Ida

    2006-01-01

    In order to determine the occurrence, distribution, and significance of mold species in groundwater- and surface water-derived drinking water in Norway, molds isolated from 273 water samples were identified. Samples of raw water, treated water, and water from private homes and hospital installations were analyzed by incubation of 100-ml membrane-filtered samples on dichloran-18% glycerol agar. The total count (number of CFU per 100 ml) of fungal species and the species diversity within each sample were determined. The identification of mold species was based on morphological and molecular methods. In total, 94 mold species belonging to 30 genera were identified. The mycobiota was dominated by species of Penicillium, Trichoderma, and Aspergillus, with some of them occurring throughout the drinking water system. Several of the same species as isolated from water may have the potential to cause allergic reactions or disease in humans. Other species are common contaminants of food and beverages, and some may cause unwanted changes in the taste or smell of water. The present results indicate that the mycobiota of water should be considered when the microbiological safety and quality of drinking water are assessed. In fact, molds in drinking water should possibly be included in the Norwegian water supply and drinking water regulations. PMID:17028226

  18. Mold and mycotoxin problems encountered during malting and brewing.

    PubMed

    Wolf-Hall, Charlene E

    2007-10-20

    Fusarium infections in grains can have severe effects on malt and beer. While some degree of Fusarium mycotoxins, such as deoxynivalenol, present in infected barley may be lost during steeping, the Fusarium mold is still capable of growth and mycotoxin production during steeping, germination and kilning. Therefore, detoxification of grain before malting may not be practical unless further growth of the mold is also prevented. Methods to reduce the amount of mold growth during malting are needed. Physical, chemical and biological methods are reviewed. Irradiation looks very promising as a means to prevent Fusarium growth during malting, but the effect on the surviving mold to produce mycotoxins and the effect on malt quality needs further study. Chemical treatments such as ozonation, which would not leave residual chemical in the beer also appear to be promising. Although biological control methods may be desirable, due to the use of "natural" inhibition, the effects of these inhibitors on malt and beer quality requires further investigation. It may also be possible to incorporate detoxifying genes into fermentation yeasts, which would result in detoxification of the wort when mold growth is no longer a problem. Development of these types of technological interventions should help improve the safety of products, such as beer, made from Fusarium infected grain.

  19. Complete qualification methodology for coatings of precision glass molding tools

    NASA Astrophysics Data System (ADS)

    Klocke, Fritz; Georgiadis, Kyriakos; Dambon, Olaf; Bouzakis, Konstantinos Dionysios; Gerardis, Stefanos; Skordaris, Georgios

    2012-07-01

    Precision glass molding is the technology of choice for the production of complex-shaped optical components. Protective coatings can significantly extend the lifetime of the molding tools, but the coating properties have to be exactly customized for individual application conditions. The current biggest challenge is to ensure the reliability of newly developed coatings without resorting to extensive and expensive practical testing. However, the usual coating qualification methods either cannot be used or don't provide meaningful results. In this work a new three-tier, application-specific methodology for the qualification such coatings is presented. First, the basic characterization of coating properties is discussed, taking into account the specific characteristics of the coatings used for precision glass molding tools. In the second step, application-specific testing methods are devised, based on the analysis of the loads during glass molding. Finally, a new machine for testing the lifetime of the coated molding tools is proposed. Three case studies are presented where nanoscratch, nanoimpact and glass contact tests are performed with Pt-Ir, TiAlN, and CrAlN-coated samples in combination with various glass types, showcasing the usefulness of the proposed three-tier methodology.

  20. Simulation of cracking cores when molding piston components

    NASA Astrophysics Data System (ADS)

    Petrenko, Alena; Soukup, Josef

    2014-08-01

    The article deals with pistons casting made from aluminum alloy. Pistons are casting at steel mold with steel core. The casting is provided by gravity casting machine. The each machine is equipped by two metal molds, which are preheated above temperature 160 °C before use. The steel core is also preheated by flame. The metal molds and cores are heated up within the casting process. The temperature of the metal mold raise up to 200 °C and temperature of core is higher. The surface of the core is treated by nitration. The mold and core are cooled down by water during casting process. The core is overheated and its top part is finally cracked despite its intensive water-cooling. The life time cycle of the core is decreased to approximately 5 to 15 thousands casting, which is only 15 % of life time cycle of core for production of other pistons. The article presents the temperature analysis of the core.

  1. An investigation into the injection molding of PMR-15 polyimide

    NASA Technical Reports Server (NTRS)

    Colaluca, M. A.

    1984-01-01

    The chemorheological behavior of the PRM-15 molding compounds were characterized, the range of suitable processing parameters for injection molding in a reciprocating screw injection molding machine was determined, and the effects of the injection molding processing parameters on the mechanical properties of molded PMR-15 parts were studied. The apparatus and procedures for measuring viscosity and for determining the physical response of the material during heating are described. Results show that capillary rheometry can be effectively used with thermosets if the equipment is designed to overcome some of the inherent problems of these materials. A uniform temperature was provided in the barrel by using a circulating hot oil system. Standard capillary rheometry methods can provide the dependence of thermoset apparent viscosity on shear rate, temperature, and time. Process conditions resulting in complete imidization should be carefully defined. Specification of controlled oven temperature is inadequate and can result in incomplete imidization. For completely imidized PMR-15 heat at 15 C/min melt flow without gas evolution occurs in the temperature range of 325 C to 400 C.

  2. Mold behavior and its influence on quality in the continuous casting of steel slabs: Part i. Industrial trials, mold temperature measurements, and mathematical modeling

    NASA Astrophysics Data System (ADS)

    Mahapatra, R. B.; Brimacombe, J. K.; Samarasekera, I. V.; Walker, N.; Paterson, E. A.; Young, J. D.

    1991-12-01

    An extensive study has been conducted to elucidate mold behavior and its influence on quality during the continuous casting of slabs. The study combined industrial measurements, mathe matical modeling, and metallographic examination of cast slab samples. The industrial mea surements involved instrumenting an operating slab mold with 114 thermocouples in order to determine the axial mold wall temperature profiles for a wide range of casting conditions. A three-dimensional (3-D) heat-flow model of the mold wall was developed to characterize the heat fluxes in the mold quantitatively from the measured mold temperature data. Furthermore, heat-flow models were developed to examine steel solidification phenomena and mold flux behavior at the meniscus. Slab samples collected during the industrial trials were examined metallographically to evaluate the cast structure and defects. Owing to the length of the study, it is presented in two parts, the first of which describes the experimental techniques employed in the instrumentation of the mold together with the details of the industrial trials and mold temperature measurements. Also, the mathematical modeling technique applied to determine the axial heat-flux profiles from the measured mold temperature data is presented. It is shown that a fully 3-D model of the mold wall is needed to convert the measured temperatures to heat-flux profiles properly.

  3. Treatment principles for the management of mold infections.

    PubMed

    Kontoyiannis, Dimitrios P; Lewis, Russell E

    2014-11-06

    Survival rates among immunocompromised patients with invasive mold infections have markedly improved over the last decade with earlier diagnosis and new antifungal treatment options. Yet, increasing antifungal resistance, breakthrough infections with intrinsically resistant fungi, and potentially life-threatening adverse effects and drug interactions are becoming more problematic, especially with prolonged therapy. Evidence-based recommendations for treating invasive aspergillosis and mucormycosis provide excellent guidance on the initial workup and treatment of these molds, but they cannot address all of the key management issues. Herein, we discuss 10 general treatment principles in the management of invasive mold disease in immunocompromised patients and discuss how these principles can be integrated to develop an effective, individualized treatment plan.

  4. Decontamination formulation with additive for enhanced mold remediation

    DOEpatents

    Tucker, Mark D.; Irvine, Kevin; Berger, Paul; Comstock, Robert

    2010-02-16

    Decontamination formulations with an additive for enhancing mold remediation. The formulations include a solubilizing agent (e.g., a cationic surfactant), a reactive compound (e.g., hydrogen peroxide), a carbonate or bicarbonate salt, a water-soluble bleaching activator (e.g., propylene glycol diacetate or glycerol diacetate), a mold remediation enhancer containing Fe or Mn, and water. The concentration of Fe.sup.2+ or Mn.sup.2+ ions in the aqueous mixture is in the range of about 0.0001% to about 0.001%. The enhanced formulations can be delivered, for example, as a foam, spray, liquid, fog, mist, or aerosol for neutralization of chemical compounds, and for killing certain biological compounds or agents and mold spores, on contaminated surfaces and materials.

  5. Applications of thin carbon coatings and films in injection molding

    NASA Astrophysics Data System (ADS)

    Cabrera, Eusebio Duarte

    In this research, the technical feasibility of two novel applications of thin carbon coatings is demonstrated. The first application consists of using thin carbon coatings on molds for molding ultra-thin plastic parts (<0.5 mm thickness) with lower pressures by promoting wall slip. The second application consists of a new approach to provide electromagnetic interference (EMI) shielding for plastic parts using in mold coated nanoparticle thin films or nanopapers to create a conductive top layer. During this research, the technical feasibility of a new approach was proven which provides injection molding of ultra-thin parts at lower pressures, without the need of fast heating/fast cooling or other expensive mold modification. An in-house developed procedure by other members of our group, was employed for coating the mold surface using chemical vapor deposition (CVD) resulting in a graphene coating with carbide bonding to the mold surface. The coating resulted in a significant decrease of surface friction and consequently easiness of flow when compared to their uncoated counterparts. Thermoplastic polymers and their composites are a very attractive alternative but are hindered by the non-conductive nature of polymers. There are two general approaches used to date to achieve EMI shielding for plastic products. One is to spray a conductive metal coating onto the plastic surface forming a layer that must maintain its shielding effectiveness (SE), and its adhesion to the plastic throughout the expected life of the product. However, metal coatings add undesirable weight and tend to corrode over time. Furthermore, scratching the coating may create shielding failure; therefore, a protective topcoat may be required. The other approach is to use polymer composites filled with conductive fillers such as carbon black (CB), carbon nanofiber (CNF), and carbon nanotube (CNT). While conductive fillers may increase the electrical conductivity of polymer composites, the loading of

  6. Influence of melt mixer on injection molding of thermoset elastomers

    NASA Astrophysics Data System (ADS)

    Rochman, Arif; Zahra, Keith

    2016-10-01

    One of the drawbacks in injection molding is that the plasticizing screw is short such that polymers having high concentrations of additives, such as thermoset elastomers, might not mix homogeneously within the short period of time during the plasticizing stage. In this study, various melt mixers inside the nozzle chamber, together forming a mixing nozzle, were developed. Three different materials were investigated, namely nitrile butadiene rubber (NBR), ethylene propylene-diene monomer (EPDM) and fluorocarbon (FKM). The use of these melt mixers resulted in better homogeneity and properties of the molded parts despite a curing time reduction of 10 s. This was due to the increase in mixing and shearing introduced a higher rate of crosslinking formation in the molded parts.

  7. Method for Molding Structural Parts Utilizing Modified Silicone Rubber

    NASA Technical Reports Server (NTRS)

    Weiser, Erik S. (Inventor); Baucom, Robert M. (Inventor); Snoha, John J. (Inventor)

    1998-01-01

    This invention improves upon a method for molding structural parts from preform material. Preform material to be used for the part is provided. A silicone rubber composition containing entrained air voids is prepared. The silicone rubber and preform material assembly is situated within a rigid mold cavity used to shape the preform material to die desired shape. The entire assembly is heated in a standard heating device so that the thermal expansion of the silicone rubber exerts the pressure necessary to force the preform material into contact with the mold container. The introduction of discrete air voids into the silicone rubber allows for accurately controlled pressure application on the preform material at the cure temperature.

  8. Mold filling and microhardness of 1% Fe titanium alloys.

    PubMed

    Sato, Hideki; Komatsu, Masashi; Miller, Barbara; Shimizu, Hiroshi; Fujii, Hideki; Okabe, Toru

    2004-06-01

    We examined the mold filling capacity and microhardness of two industrial 1% Fe titanium alloys: Super-TIX800 (Nippon Steel Corp.) (Fe: 0.910%, O: 0.370%, N: 0.005%) and Super-TIX800N (Nippon Steel Corp.) (Fe: 0.960%, O: 0.300%, N: 0.041%). Two wedge-shaped acrylic patterns (with 30 degrees or 15 degrees angles) were prepared. Each alloy was cast in a centrifugal casting machine. Mold filling was evaluated as the missing length between the tip of the casting and the theoretical tip. Vickers hardness of the edge of the castings was also determined. For both angles tested, there were no significant differences (p>0.05) in mold filling among these alloys and the control (CP Ti). The results of testing the microhardness near the cast surfaces indicated that the hardened reaction layers on these alloys were thinner at the edge compared to CP Ti.

  9. Injection Molding and its application to drug delivery.

    PubMed

    Zema, Lucia; Loreti, Giulia; Melocchi, Alice; Maroni, Alessandra; Gazzaniga, Andrea

    2012-05-10

    Injection Molding (IM) consists in the injection, under high pressure conditions, of heat-induced softened materials into a mold cavity where they are shaped. The advantages the technique may offer in the development of drug products concern both production costs (no need for water or other solvents, continuous manufacturing, scalability, patentability) and technological/biopharmaceutical characteristics of the molded items (versatility of the design and composition, possibility of obtaining solid molecular dispersions/solutions of the active ingredient). In this article, process steps and formulation aspects relevant to IM are discussed, with emphasis on the issues and advantages connected with the transfer of this technique from the plastics industry to the production of conventional and controlled-release dosage forms. Moreover, its pharmaceutical applications thus far proposed in the primary literature, intended as either alternative manufacturing strategies for existing products or innovative systems with improved design and performance characteristics, are critically reviewed.

  10. Use of the smart tongue to monitor mold growth and discriminate between four mold species grown in liquid media.

    PubMed

    Zhao, Guangying; Lin, Xiaona; Dou, Wenchao; Tian, Shiyi; Deng, Shaoping; Shi, Jinqin

    2011-04-01

    A novel voltammetric electronic tongue, smart tongue, was employed to monitor the growth of mold and to differentiate between four types of mold grown in liquid medium. Principal component analysis (PCA) was used to extract the relevant information obtained by the smart tongue. Reference growth curves were based on measurements of dry weight and pH. The growth detected by the smart tongue was basically consistent with that observed by the measurement of dry weight and pH. The optimal combinations of electrodes and frequencies for monitoring growth were as follows: for Aspergillus, both the Pt and Au electrodes at 1 Hz, 10 Hz and 100 Hz; for Penicillium, the Pt and W electrodes at 100 Hz; for Mucor, the Pt, Pd and W electrodes at the three frequency segments; for Rhizopus, the Pd, Ti and Ag electrodes at the three frequency segments. The Ag electrode at 10 Hz or 100 Hz frequency could differentiate well between the four types of mold for culturing 6 h in the liquid media. Therefore, the smart tongue has a promising future as a modern rapid analytical technology for the real time detection of the growth of mold and for the classification model of mold.

  11. Molecular orientation distributions during injection molding of liquid crystalline polymers: Ex situ investigation of partially filled moldings

    SciTech Connect

    Fang, Jun; Burghardt, Wesley R.; Bubeck, Robert A.

    2013-01-10

    The development of molecular orientation in thermotropic liquid crystalline polymers (TLCPs) during injection molding has been investigated using two-dimensional wide-angle X-ray scattering coordinated with numerical computations employing the Larson-Doi polydomain model. Orientation distributions were measured in 'short shot' moldings to characterize structural evolution prior to completion of mold filling, in both thin and thick rectangular plaques. Distinct orientation patterns are observed near the filling front. In particular, strong extension at the melt front results in nearly transverse molecular alignment. Far away from the flow front shear competes with extension to produce complex spatial distributions of orientation. The relative influence of shear is stronger in the thin plaque, producing orientation along the filling direction. Exploiting an analogy between the Larson-Doi model and a fiber orientation model, we test the ability of process simulation tools to predict TLCP orientation distributions during molding. Substantial discrepancies between model predictions and experimental measurements are found near the flow front in partially filled short shots, attributed to the limits of the Hele-Shaw approximation used in the computations. Much of the flow front effect is however 'washed out' by subsequent shear flow as mold filling progresses, leading to improved agreement between experiment and corresponding numerical predictions.

  12. Permanent Mold Casting of JIS-AC4C Aluminum Alloy Using a Low-Temperature Mold

    SciTech Connect

    Yamagata, Hiroshi; Nikawa, Makoto

    2011-01-17

    Permanent mold casting using mold temperatures below 200 deg. C was conducted to obtain a high-strength, thin-walled casting. Al-7.36 mass% Si -0.18 Cu- 0.27Mg-0.34Fe alloy JIS-AC4C was cast using a bottom pouring cast plan. The product had a rectangular tube shape (70 mm W x 68 mm D x 180 mm H) with wall thicknesses of 1, 3 and 5 mm. The effect of heat insulation at the melt path was compared when using a sand runner insert and when using a steel runner insert as well as a powder mold release agent. Fine microstructures were observed in the casting. The smaller the thickness, the higher the hardness with smaller secondary dendrite arm spacing (SDAS). However, the hardness and the SDAS were unaffected by the mold temperature. It was proposed that the avoidance of the formation of primary {alpha} dendrite at the melt path generates a higher strength casting with adequate mold filling.

  13. Psychological, neuropsychological, and electrocortical effects of mixed mold exposure.

    PubMed

    Crago, B Robert; Gray, Michael R; Nelson, Lonnie A; Davis, Marilyn; Arnold, Linda; Thrasher, Jack D

    2003-08-01

    The authors assessed the psychological, neuropsychological, and electrocortical effects of human exposure to mixed colonies of toxigenic molds. Patients (N = 182) with confirmed mold-exposure history completed clinical interviews, a symptom checklist (SCL-90-R), limited neuropsychological testing, quantitative electroencephalogram (QEEG) with neurometric analysis, and measures of mold exposure. Patients reported high levels of physical, cognitive, and emotional symptoms. Ratings on the SCL-90-R were "moderate" to "severe," with a factor reflecting situational depression accounting for most of the variance. Most of the patients were found to suffer from acute stress, adjustment disorder, or post-traumatic stress. Differential diagnosis confirmed an etiology of a combination of external stressors, along with organic metabolically based dysregulation of emotions and decreased cognitive functioning as a result of toxic or metabolic encephalopathy. Measures of toxic mold exposure predicted QEEG measures and neuropsychological test performance. QEEG results included narrowed frequency bands and increased power in the alpha and theta bands in the frontal areas of the cortex. These findings indicated a hypoactivation of the frontal cortex, possibly due to brainstem involvement and insufficient excitatory input from the reticular activating system. Neuropsychological testing revealed impairments similar to mild traumatic brain injury. In comparison with premorbid estimates of intelligence, findings of impaired functioning on multiple cognitive tasks predominated. A dose-response relationship between measures of mold exposure and abnormal neuropsychological test results and QEEG measures suggested that toxic mold causes significant problems in exposed individuals. Study limitations included lack of a comparison group, patient selection bias, and incomplete data sets that did not allow for comparisons among variables.

  14. Improved Probe for Evaluating Compaction of Mold Sand

    NASA Technical Reports Server (NTRS)

    Overfelt, Ruel A.; Bakhtiyarov, Sayavur I.

    2008-01-01

    A nominally stationary tubular probe denoted a telescopic probe has been developed as an improved alternative to a prior movable probe used to evaluate the local degree of compaction of mold sand. The probe is inserted vertically to a desired depth in a sand-filled molding flask and the back pressure at the given rate of flow of air is recorded as a measure of the degree of partial impermeability and, hence, of the degree of compaction of sand in the vicinity of the probe tip.

  15. FIBER ORIENTATION IN INJECTION MOLDED LONG CARBON FIBER THERMOPLASTIC COMPOSITES

    SciTech Connect

    Wang, Jin; Nguyen, Ba Nghiep; Mathur, Raj N.; Sharma, Bhisham; Sangid, Michael D.; Costa, Franco; Jin, Xiaoshi; Tucker III, Charles L.; Fifield, Leonard S.

    2015-03-23

    A set of edge-gated and center-gated plaques were injection molded with long carbon fiber-reinforced thermoplastic composites, and the fiber orientation was measured at different locations of the plaques. Autodesk Simulation Moldflow Insight (ASMI) software was used to simulate the injection molding of these plaques and to predict the fiber orientation, using the anisotropic rotary diffusion and the reduced strain closure models. The phenomenological parameters of the orientation models were carefully identified by fitting to the measured orientation data. The fiber orientation predictions show very good agreement with the experimental data.

  16. Polymer microlens array integrated with imaging sensors by UV-molding technique

    NASA Astrophysics Data System (ADS)

    Lai, Jianjun; Zhao, Yue; Ke, Caijun; Yi, Xinjian; Zhang, TianXu

    2005-01-01

    Fabrication of Polymer microlens array based on UV-molding techniques is presented. UV-molding enables for the integration of polymer microlens array on top of arbitrary substrates like glass, silicon other polymeric films. In this technique, photoresist or glass mold is first fabricated by conventional photolithnic method and subsequently served as transparent replication tool. UV curable polymer resin is then coated on patterned or unpatterned substrates and a contact mask aligner is used to align substrates and replication mold tool and then make the mold immersed into the resin. Replication of polymer on substrates is achieved by UV photopolymerisation of the resin. Resin thickness and gap distance between mold and substrate are carefully controlled in order to obtain acceptable thickness of cured polymer base. The UV molding technique was used to molding of a polymer film carring microlens array on the surface of an experimental CCD imaging sensor chip in this paper to enhance its fill factor and sensitivity.

  17. Application of statistical methods for analyzing the relationship between casting distortion, mold filling, and interfacial heat transfer in sand molds

    SciTech Connect

    Y. A. Owusu

    1999-03-31

    This report presents a statistical method of evaluating geometric tolerances of casting products using point cloud data generated by coordinate measuring machine (CMM) process. The focus of this report is to present a statistical-based approach to evaluate the differences in dimensional and form variations or tolerances of casting products as affected by casting gating system, molding material, casting thickness, and casting orientation at the mold-metal interface. Form parameters such as flatness, parallelism, and other geometric profiles such as angularity, casting length, and height of casting products were obtained and analyzed from CMM point cloud data. In order to relate the dimensional and form errors to the factors under consideration such as flatness and parallelism, a factorial analysis of variance and statistical test means methods were performed to identify the factors that contributed to the casting distortion at the mold-metal interface.

  18. Injection molding of thermoplastic elastomers for microstructured substrates

    NASA Astrophysics Data System (ADS)

    Birkar, Smita

    Amorphous and semi-crystalline thermoplastic polymers have been widely investigated for injection molding of parts with microstructured surfaces. Microstructured surfaces injection molded from thermoplastic elastomers have emerging applications as superhydrobic surfaces and patterned adhesives, but there is a limited understanding of the factors affecting replication with these materials. This research was a continued investigation of block copolymer thermoplastic elastomers as well as the first in-depth examination of thermoplastic vulcanizates for injection molding microfeatures. The first focus of this research was the interactions between tooling aspect ratio and feature orientation (negative and positive tooling) and thermoplastic elastomer hard segment content on microfeature replication. Electroformed nickel tooling having positive and negative features with different geometries and aspect ratios of 0.02:1 to 2:1 were molded from three copolyester thermoplastic elastomers with similar chemistry and different hardness values. The tooling and part features were characterized for feature depth and height as well as feature definition using scanning electron microscopy and optical profilometry. Results were correlated with elastomer properties. In the second parts of this research, the effects of microfeature spacing on the replication of thermoplastic elastomer features was investigated using micropillars with two diameters (10 and 20 mum) and three spacing ratios (0.5:1, 1:1, and 2:1). The tooling and part features were characterized for feature depth and height as well as feature definition using scanning electron microscopy and optical profilometry. Feature spacing significantly affected the replication of micropillars using a thermoplastic elastomer. This replication was competition between cooling and pressurization of the melt. Wider spacing between smaller features allowed cooling in the tooling lands to dominate the feature filling. Higher pressures did

  19. Effect of Cross Sectional Geometry on PDMS Micro Peristaltic Pump Performance: Comparison of SU-8 Replica Molding vs. Micro Injection Molding

    PubMed Central

    Graf, Neil J.

    2013-01-01

    Two different fabrication methods were employed to fabricate micropumps with different cross-sectional channel geometries. The first was to fabricate rectangular cross-sectional microchannel geometries using the well known fabrication method of replica molding (REM).1 The second, and far less utilized fabrication technique, was to create microchannel molds using an in-house fabricated handheld micro injection molding apparatus. The injection mold apparatus was designed for use with elastomeric room temperature vulcanization (RTV) polymers, as opposed to most other injection molding machines, which are designed for use with thermoplastic polymers. The injection mold’s bottom plate was used as a microchannel molding template. The molding template was created by threading a small-diameter wire (150 μm or less) through the injection mold’s bottom plate, with subsequent adhesion and smoothing of a thin piece of aluminum foil over the wire-raised injection mold template. When molded against, the template produced a rounded/Gaussian-shaped PDMS microchannel. The design of the injection mold will be presented, along with a direct comparison for micropump performance metrics such as flow rate, valving characteristics, and maximum backpressures attainable for each of the respective micropump channel geometries. PMID:23917263

  20. The reflectivity, wettability and scratch durability of microsurface features molded in the injection molding process using a dynamic tool tempering system

    NASA Astrophysics Data System (ADS)

    Kuhn, Sascha; Burr, August; Kübler, Michael; Deckert, Matthias; Bleesen, Christoph

    2011-02-01

    In this paper the replication qualities of periodically and randomly arranged micro-features molded in the injection molding process and their effects on surface properties are studied. The features are molded in PC, PMMA and PP at different mold wall temperatures in order to point out the necessity and profitability of a variotherm mold wall temperature control system. A one-dimensional heat conduction model is proposed to predict the cycle times of the variotherm injection molding processes. With regard to these processes, the molding results are compared to the molded surface feature heights using an atomic force microscope. In addition, the effects of the molded surface features on macroscopic surfaces are characterized in terms of light reflection using a spectrometer and in terms of water wettability by measuring the static contact angle. Furthermore, due to the sensitivity of the surface features on the molded parts, their durability is compared in a scratch test with a diamond tip. This leads to successful implementation in applications in which the optical appearance, in terms of gloss and reflection, and the water repellence, in terms of drag flow and adhesion, are of importance.

  1. The effect of mold materials on the overlay accuracy of a roll-to-roll imprinting system using UV LED illumination within a transparent mold

    NASA Astrophysics Data System (ADS)

    Choi, Sungwoo; Kook, YunHo; Kim, ChulHo; Yoo, SoonSung; Park, Kwon-Shik; Kim, Seok-min; Kang, Shinill

    2016-06-01

    Although several studies on the roll-to-roll (R2R) imprinting process have reported achieving flexible electronics, improving the alignment accuracy in the overlay process of R2R imprinting is recognized as the biggest problem for the commercialization of this technology. For an overlay technique with high alignment accuracy, it is essential to develop a roll mold with high positional accuracy. In this study, a method for fabricating a roll mold with high positional accuracy is proposed by wrapping a thin glass substrate flexible mold around the transparent roll base, because it can provide higher mechanical strength and thermal stability than a conventional polymer substrate. To confirm the usability of the proposed process, the prepared roll mold was used to fabricate a test pattern of thin-film transistor backplane for a rollable display. The positional and overlay accuracy of the roll mold with the proposed thin glass substrate flexible mold were compared with the roll mold with a conventional polymer substrate flexible mold. Large-area transparent flexible molds with a size of 470  ×  370 mm were fabricated by an ultraviolet (UV) imprinting process on thin glass and polyethylene terephthalate substrates, and these flexible molds were wrapped around a roll base of 125 mm radius through a precision alignment process. After an anti-adhesion treatment and the wrapping process, the roll mold with the polymer substrate showed a ~180 μm positional error, whereas the thin glass substrate showed a ~30 μm positional error. After the overlay process using the R2R imprinting system with the alignment system, an average overlay error of ~3 μm was obtained when the thin glass flexible wrapped roll mold was used, whereas a ~22 μm overlay error was obtained when the polymer substrate flexible wrapped roll mold was used.

  2. Injection molding of iPP samples in controlled conditions and resulting morphology

    SciTech Connect

    Sessa, Nino De Santis, Felice Pantani, Roberto

    2015-12-17

    Injection molded parts are driven down in size and weight especially for electronic applications. In this work, an investigation was carried out on the process of injection molding of thin iPP samples and on the morphology of these parts. Melt flow in the mold cavity was analyzed and described with a mathematical model. Influence of mold temperature and injection pressure was analyzed. Samples orientation was studied using optical microscopy.

  3. Mold Species in Dust from the International Space Station Identified and Quantified by Mold Specific Quantitative PCR

    NASA Technical Reports Server (NTRS)

    Vesper, Stephen J.; Wong, Wing; Kuo, C. Mike; Pierson, Duane L.

    2008-01-01

    Dust was collected over a period of several weeks in 2007 from various HEPA filters in the U.S. Laboratory Module of the International Space Station (ISS). The dust was returned on the Space Shuttle Atlantis, mixed, sieved, and the DNA was extracted. Using a DNA-based method called mold specific quantitative PCR (MSQPCR), 39 molds were measured in the dust. Opportunistic pathogens Aspergillus flavus and A. niger and toxin producers Penicillium chrysogenum and P. brevicompactum were found at relatively high concentrations (compared to U.S. homes). No cells of the opportunistic pathogens A. fumigatus, A. terreus, Fusarium solani or Candida albicans were detected.

  4. Mold species in dust from the International Space Station identified and quantified by mold-specific quantitative PCR.

    PubMed

    Vesper, Stephen J; Wong, Wing; Kuo, C Mike; Pierson, Duane L

    2008-01-01

    Dust was collected over a period of several weeks in 2007 from HEPA filters in the U.S. Laboratory Module of the International Space Station (ISS). The dust was returned on the Space Shuttle Atlantis, mixed, sieved and the DNA was extracted. Using a DNA-based method called mold-specific quantitative PCR (MSQPCR), 39 molds were measured in the dust. Potential opportunistic pathogens Aspergillus flavus and Aspergillus niger and potential moderate toxin producers Penicillium chrysogenum and Penicillium brevicompactum were noteworthy. No cells of the potential opportunistic pathogens Aspergillus fumigatus, Aspergillus terreus, Fusarium solani or Candida albicans were detected.

  5. 75 FR 55340 - Recovery Fact Sheet 9580.100, Mold Remediation

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-10

    ... SECURITY Federal Emergency Management Agency Recovery Fact Sheet 9580.100, Mold Remediation AGENCY: Federal... Emergency Management Agency (FEMA) is accepting comments on Recovery Fact Sheet RP9580.100, Mold Remediation... The Recovery Fact Sheet RP9580.100, Mold Remediation, identifies the expenses related to...

  6. CROSS REACTIVITY IN ALLERGIC ASTHMA-LIKE RESPONSES BETWEEN MOLD AND HOUSE DUST MITE IN MICE

    EPA Science Inventory

    Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases including allergic asthma. Some mold allergens have been implicated as the causal agent for allergic asthma. Western blot analysis demonstrated IgE-binding cross-reactivity among m...

  7. 49 CFR 176.907 - Polymeric Beads and Plastic Molding Compounds.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 2 2014-10-01 2014-10-01 false Polymeric Beads and Plastic Molding Compounds. 176.907 Section 176.907 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS..., and Plastic Molding Compounds § 176.907 Polymeric Beads and Plastic Molding Compounds. (a)...

  8. 49 CFR 176.907 - Polymeric Beads and Plastic Molding Compounds.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 2 2013-10-01 2013-10-01 false Polymeric Beads and Plastic Molding Compounds. 176.907 Section 176.907 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS..., and Plastic Molding Compounds § 176.907 Polymeric Beads and Plastic Molding Compounds. (a)...

  9. 40 CFR Appendix - Alternative Organic HAP Emissions Limits for Open Molding, Centrifugal Casting, and SMC...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Limits for Open Molding, Centrifugal Casting, and SMC Manufacturing Operations Where the Standards Are..., Table 5 Alternative Organic HAP Emissions Limits for Open Molding, Centrifugal Casting, and SMC... casting—CR/HS 3,4 A vent system that moves heated air through the mold 27 lb/ton. 8. Centrifugal...

  10. 40 CFR Appendix - Alternative Organic HAP Emissions Limits for Open Molding, Centrifugal Casting, and SMC...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Limits for Open Molding, Centrifugal Casting, and SMC Manufacturing Operations Where the Standards Are..., Table 5 Alternative Organic HAP Emissions Limits for Open Molding, Centrifugal Casting, and SMC... casting—CR/HS 3,4 A vent system that moves heated air through the mold 27 lb/ton. 8. Centrifugal...

  11. 40 CFR Appendix - Alternative Organic HAP Emissions Limits for Open Molding, Centrifugal Casting, and SMC...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Limits for Open Molding, Centrifugal Casting, and SMC Manufacturing Operations Where the Standards Are..., Subpt. WWWW, Table 5 Alternative Organic HAP Emissions Limits for Open Molding, Centrifugal Casting, and... casting—CR/HS 3,4 A vent system that moves heated air through the mold 27 lb/ton. 8. Centrifugal...

  12. 40 CFR Appendix - Alternative Organic HAP Emissions Limits for Open Molding, Centrifugal Casting, and SMC...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Limits for Open Molding, Centrifugal Casting, and SMC Manufacturing Operations Where the Standards Are..., Subpt. WWWW, Table 5 Alternative Organic HAP Emissions Limits for Open Molding, Centrifugal Casting, and... casting—CR/HS 3,4 A vent system that moves heated air through the mold 27 lb/ton. 8. Centrifugal...

  13. Differential allergy induction by molds found in water-damaged homes**

    EPA Science Inventory

    Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases including allergic lung diseases. The Institute of Medicine reports (NAS, 2004) and World Health Organization guidelines (WHO, 2009) concluded that the role of molds in asthma indu...

  14. Effective Control of Molds Using a Combination of Nanoparticles.

    PubMed

    Auyeung, Ariana; Casillas-Santana, Miguel Ángel; Martínez-Castañón, Gabriel Alejandro; Slavin, Yael N; Zhao, Wayne; Asnis, Jason; Häfeli, Urs O; Bach, Horacio

    2017-01-01

    Molds are filamentous fungi able to grow on a variety of surfaces, including constructed surfaces, food, rotten organic matter, and humid places. Mold growth is characterized by having an unpleasant odor in enclosed or non-ventilated places and a non-aesthetic appearance. They represent a health concern because of their ability to produce and release mycotoxins, compounds that are toxic to animals and humans. The aim of this study was to evaluate commercial nanoparticles (NPs) that can be used as an additive in coatings and paints to effectively control the growth of harmful molds. Four different NPs were screened for their antifungal activities against the mycotoxin producing mold strains Aspergillus flavus and A. fumigatus. The minimal inhibitory concentrations of the NPs were determined in broth media, whereas an agar diffusion test was used to assess the antimold activity on acrylic- and water-based paints. The cytotoxic activity and the inflammatory response of the NPs were also evaluated using the established human derived macrophage cell line THP-1. Results showed that a combination of mix metallic- and ZnO-NPs (50:10 μg/mL) effectively inhibited the fungal growth when exposed to fluorescent light. Neither cytotoxic effect nor inflammatory responses were recorded, suggesting that this combination can be safely used in humid or non-ventilated environments without any health concerns.

  15. Effective Control of Molds Using a Combination of Nanoparticles

    PubMed Central

    Martínez-Castañón, Gabriel Alejandro; Slavin, Yael N.; Zhao, Wayne; Asnis, Jason; Häfeli, Urs O.

    2017-01-01

    Molds are filamentous fungi able to grow on a variety of surfaces, including constructed surfaces, food, rotten organic matter, and humid places. Mold growth is characterized by having an unpleasant odor in enclosed or non-ventilated places and a non-aesthetic appearance. They represent a health concern because of their ability to produce and release mycotoxins, compounds that are toxic to animals and humans. The aim of this study was to evaluate commercial nanoparticles (NPs) that can be used as an additive in coatings and paints to effectively control the growth of harmful molds. Four different NPs were screened for their antifungal activities against the mycotoxin producing mold strains Aspergillus flavus and A. fumigatus. The minimal inhibitory concentrations of the NPs were determined in broth media, whereas an agar diffusion test was used to assess the antimold activity on acrylic- and water-based paints. The cytotoxic activity and the inflammatory response of the NPs were also evaluated using the established human derived macrophage cell line THP-1. Results showed that a combination of mix metallic- and ZnO-NPs (50:10 μg/mL) effectively inhibited the fungal growth when exposed to fluorescent light. Neither cytotoxic effect nor inflammatory responses were recorded, suggesting that this combination can be safely used in humid or non-ventilated environments without any health concerns. PMID:28122038

  16. Resin transfer molding for advanced composite primary aircraft structures

    NASA Technical Reports Server (NTRS)

    Markus, Alan; Palmer, Ray

    1991-01-01

    Resin Transfer Molding (RTM) has been identified by Douglas Aircraft Company (DAC) and industry to be one of the promising processes being developed today which can break the cost barrier of implementing composite primary structures into a commercial aircraft production environment. The RTM process developments and scale-up plans Douglas Aircrart will be conducting under the NASA ACT contract are discussed.

  17. 14. Detail view of molding at first floor level on ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. Detail view of molding at first floor level on SE corner of mill. - Hacienda Azurarera Santa Elena, Sugar Mill Ruins, 1.44 miles North of PR Route 2 Bridge Over Rio De La Plata, Toa Baja, Toa Baja Municipio, PR

  18. 12. Detail view of molding at second floor level on ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. Detail view of molding at second floor level on SE corner of mill. - Hacienda Azurarera Santa Elena, Sugar Mill Ruins, 1.44 miles North of PR Route 2 Bridge Over Rio De La Plata, Toa Baja, Toa Baja Municipio, PR

  19. 12. VIEW OF DEPLETED URANIUM INGOT AND MOLDS. DEPLETED URANIUM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. VIEW OF DEPLETED URANIUM INGOT AND MOLDS. DEPLETED URANIUM CASTING OPERATIONS CEASED IN 1988. (11/14/57) - Rocky Flats Plant, Non-Nuclear Production Facility, South of Cottonwood Avenue, west of Seventh Avenue & east of Building 460, Golden, Jefferson County, CO

  20. Air sampling of mold spores by slit impactors: yield comparison.

    PubMed

    Pityn, Peter J; Anderson, James

    2013-01-01

    The performance of simple slit impactors for air sampling of mold contamination was compared under field conditions. Samples were collected side-by-side, outdoors in quadruplicates with Burkhard (ambient sampler) and Allergenco MK3 spore traps and with two identical Allergenco slit cassettes operated at diverse flow rates of 5 and 15 L/min, respectively. The number and types of mold spores in each sample were quantified by microscopy. Results showed all four single-stage slit impactors produced similar spore yields. Moreover, paired slit cassettes produced similar outcomes despite a three-fold difference in their sampling rate. No measurable difference in the amount or mix of mold spores per m(3)of air was detected. The implications for assessment of human exposures and interpretation of indoor/outdoor fungal burden are discussed. These findings demonstrate that slit cassettes capture most small spores, effectively and without bias, when operated at a range of flow rates including the lower flow rates used for personal sampling. Our findings indicate sampling data for mold spores correlate for different single stage impactor collection methodologies and that data quality is not deteriorated by operating conditions deviating from manufacturers' norms allowing such sampling results to be used for scientific, legal, investigative, or property insurance purposes. The same conclusion may not be applied to other particle sampling instruments and mulit-stage impactors used for ambient particulate sampling, which represent an entirely different scenario. This knowledge may help facilitate comparison between scientific studies where methodological differences exist.

  1. New sources of grain mold resistance among accessions from Sudan

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fifty-nine sorghum accessions from Sudan were evaluated in replicated plots at Isabela, Puerto Rico, for resistance against Fusarium thapsinum, one of the causal agents of grain mold. The environmental conditions during this study, especially at and after physiological maturity were optimal for gra...

  2. UVC Sheds New Light on School Mold Problems.

    ERIC Educational Resources Information Center

    Freeman, James

    2002-01-01

    Describes how the LaPorte Independent School District in Texas turned to ultraviolent light devices installed within the HVAC system to combat mold and fungus after conventional approaches failed. Describes the additional benefits of energy savings from the system. (EV)

  3. Molding of the regenerate in mandibular distraction: clinical experience.

    PubMed

    McCarthy, Joseph G; Hopper, Richard A; Hollier, Larry H; Peltomaki, Timo; Katzen, Timothy; Grayson, Barry H

    2003-10-01

    Initial clinical experience with distraction osteogenesis has demonstrated the risk of developing postdistraction malocclusion that requires secondary orthodontic correction. In addition, optimal mandibular form is not always achieved. Both animal studies and preliminary clinical investigations have suggested that the regenerate can be successfully "molded" during active mandibular distraction. The authors have applied this concept clinically to obtain a more desirable occlusal relationship in a group of mandibular distraction patients. Eleven patients are described in whom angulation of the distraction device or intermaxillary/interdental elastics were employed to mold the regenerate. Two representative case studies are provided to illustrate the principles. When using elastic traction to close an anterior open bite, care must be taken that extrusion of individual teeth is minimized by distributing the force over the entire dental arch, especially the basilar portions of the jaws. The authors demonstrate that molding of the regenerate can be successfully accomplished not only during device activation but also early in the consolidation period. The outer limit of the time window in which molding is effective remains to be defined.

  4. VIEW POURING PLATFORM SHOWING MOLD POURING JACKETS AND WEIGHTS AND, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW POURING PLATFORM SHOWING MOLD POURING JACKETS AND WEIGHTS AND, IN THE FOREGROUND, SAND RETURN FROM THE SHAKEOUT ACTUATING A SIMPLE LEVER SYSTEM THAT ADDED FRESH WATER TO THE SAND IN PREPARATION FOR ITS REUSE. - Southern Ductile Casting Company, Centerville Foundry, 101 Airport Road, Centreville, Bibb County, AL

  5. Mold with improved core for metal casting operation

    DOEpatents

    Gritzner, Verne B.; Hackett, Donald W.

    1977-01-01

    The present invention is directed to a mold containing an improved core for use in casting hollow, metallic articles. The core is formed of, or covered with, a layer of cellular material which possesses sufficient strength to maintain its structural integrity during casting, but will crush to alleviate the internal stresses that build up if the normal contraction during solidification and cooling is restricted.

  6. INTERIOR DETAIL, EAST CHAMBER OVER THE SALOON. THE ARCHITRAVE MOLDING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR DETAIL, EAST CHAMBER OVER THE SALOON. THE ARCHITRAVE MOLDING AROUND THE WINDOW AND AROUND THE CLOSET AT REAR—ONCE AN EXTERIOR WINDOW OPENING—LIKELY DATE FROM THE HOUSE’S EARLIEST STATE - The Woodlands, 4000 Woodlands Avenue, Philadelphia, Philadelphia County, PA

  7. Injection-molded replication of binary optic structures

    NASA Astrophysics Data System (ADS)

    Nisper, Jon K.

    1995-12-01

    Application of molded plastics to precision optical systems has required significant advances in both the design and fabrication of these optical components. Tighter fabrication tolerances and improved transmitted wavefront quality are being achieved with each passing year. Recently, interest has focused on the particular challenge of injection molded diffractive optic structures. Binary optics are generated using VLSI techniques of microlithography and dry etching to produce a diffractive structure with submicron accuracy. The cost incurred in wafer scale fabrication of individual elements is quite high. By precise mastering, detailed mold design and careful process control, binary optics can be successfully replicated in plastic materials allowing significantly lower costs. This paper will address three specific applications of mass produced diffractive structures. A hybrid refractive/diffractive lens has been designed and produced in acrylic; a set of complex diffractive fanout gratings has been produced in acrylic, polycarbonate, polymethylpentene, and cyclic olefin copolymer; and a diode laser collimator/corrector has recently been successfully molded in polycarbonate. Detailed results highlighting the fidelity of the replicated surface will be included.

  8. Vacuum isostatic micro molding of diffractive structures into PTFE materials

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd E.; Ohar, Orest

    2007-09-01

    Polytetrafluoroethylene (PTFE) is an ideal material for use in industrial, automotive and consumer electronics. Specifically, PTFE has outstanding physical properties; such as chemical inertness and resistance to chemical corrosion, even when exposed to a strong acid, alkali and oxidants. Its properties provide for superior electrical insulation and thermal stability, which is not affected by wide ranges in temperature and frequency. Its non-absorption of moisture makes it a perfect material for consideration in micro optical, retro-reflector or diffuser type devices used in handheld displays, flat panel displays as well as automotive, industrial and home lighting. This paper presents an overview of a unique fabrication method that incorporates a variety of elements to establish a processing technique that can form micro diffractive, holographic and reflective structures into PTFE materials. By means of modifying an existing known molding process, this new technique incorporates the addition of a vacuum to assist in the reliable molding and densification of the PTFE as well the use of a micro-structured electroformed shim to form small microstructures into the surface of the PTFE material. The combination of the vacuum and the electroformed shim within the molding process noticeably increases the precision, reproducibility and resolution of micro-structures that can be realized. The paper will describe the molding hardware involved, process parameters and the resulting structures formed. Optical function testing and metrology of the micro-structure geometry formed on each sample will be compared to the original design mandrel geometry [1].

  9. Optimizing biomass blends for manufacturing molded packaging materials using mycelium

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polystyrene is one of the most widely used plastics and is commonly produced in three forms: 1) Extruded polystyrene – disposable utensils, CD/DVD cases, yogurt containers, smoke alarm housing, etc.; 2) Expanded polystyrene foam – molded packaging materials and packaging "peanuts"; 3) Extruded polys...

  10. Precision glass molding: Toward an optimal fabrication of optical lenses

    NASA Astrophysics Data System (ADS)

    Zhang, Liangchi; Liu, Weidong

    2016-12-01

    It is costly and time consuming to use machining processes, such as grinding, polishing and lapping, to produce optical glass lenses with complex features. Precision glass molding (PGM) has thus been developed to realize an efficient manufacture of such optical components in a single step. However, PGM faces various technical challenges. For example, a PGM process must be carried out within the super-cooled region of optical glass above its glass transition temperature, in which the material has an unstable non-equilibrium structure. Within a narrow window of allowable temperature variation, the glass viscosity can change from 105 to 1012 Pas due to the kinetic fragility of the super-cooled liquid. This makes a PGM process sensitive to its molding temperature. In addition, because of the structural relaxation in this temperature window, the atomic structure that governs the material properties is strongly dependent on time and thermal history. Such complexity often leads to residual stresses and shape distortion in a lens molded, causing unexpected changes in density and refractive index. This review will discuss some of the central issues in PGM processes and provide a method based on a manufacturing chain consideration from mold material selection, property and deformation characterization of optical glass to process optimization. The realization of such optimization is a necessary step for the Industry 4.0 of PGM.

  11. PUBLIC HEALTH AND ECONOMIC IMPACT OF DAMPNESS AND MOLD

    EPA Science Inventory

    There is a rapidly growing body of scientific literature examining the relationship between dampness and mold in buildings and associated health effects. Reviews by expert groups in Europe (Bornehag et al. 2001; Bornehag et al. 2004) and the United States (IOM, 2004) conclude th...

  12. Modified Silicone-Rubber Tooling For Molding Composite Parts

    NASA Technical Reports Server (NTRS)

    Baucom, Robert M.; Snoha, John J.; Weiser, Erik S.

    1995-01-01

    Reduced-thermal-expansion, reduced-bulk-modulus silicone rubber for use in mold tooling made by incorporating silica powder into silicone rubber. Pressure exerted by thermal expansion reduced even further by allowing air bubbles to remain in silicone rubber instead of deaerating it. Bubbles reduce bulk modulus of material.

  13. Detecting Mold in School Buildings: An Exercise in Biodiversity

    ERIC Educational Resources Information Center

    Farone, Anthony L.

    2005-01-01

    A project was designed to introduce students to fungi in which students surveyed their school buildings for different types of mold. The students were able to make connections between structure and function of the fungal components and learn how these different components enhance survival in the environment.

  14. Thermal modeling of wafer-based precision glass molding process

    NASA Astrophysics Data System (ADS)

    Hu, Yang; Shen, Lianguan; Zhou, Jian; Li, Mujun

    2016-10-01

    Wafer based precision glass optics manufacturing has been an innovative approach for combining high accuracy with mass production. However, due to the small ratio of thickness and diameter of the glass wafer, deformation and residual stress would be induced for the nonuniform temperature distribution in the glass wafer after molding. Therefore, thermal modelling of the heating system in the wafer based precision glass molding (PGM) process is of great importance in optimizing the heating system and the technique of the process. The current paper deals with a transient thermal modelling of a self-developed heating system for wafer based PGM process. First, in order to investigate the effect of radiation from the surface and interior of the glass wafer, the thermal modeling is simulated with a discrete ordinates radiation model in the CFD software FLUENT. Temperature distribution of the glass wafer obtained from the simulations is then used to evaluate the performance of heating system and investigate some importance parameters in the model, such as interior and surface radiation in glass wafer, thermal contact conductance between glass wafer and molds, thickness to diameter ratio of glass wafer. Finally, structure modification in the molding chamber is raised to decrease the temperature gradient in the glass wafer and the effect is significant.

  15. Seating tool for preparing molded-plug terminations on FCC

    NASA Technical Reports Server (NTRS)

    Chambers, C. M.; Corum, C. C.

    1971-01-01

    Hand-operated tool positions and seats window piece and conductor spacer onto conductors of two stripped cables during process of terminating cables with molded plug. Tool accommodates cables up to 3 in. wide and is used in conjunction with folding tools.

  16. Populations of some molds in water-damaged homes may ...

    EPA Pesticide Factsheets

    Starting in the 1940s, gypsum drywall began replacing plaster and lathe in the U.S. home construction industry. Our goal was to evaluate whether some mold populations differ in water- damaged homes primarily constructed with gypsum drywall compared to plaster. The dust samples from the 2006 Department of Housing and Urban Development's (HUD) American Health Homes Survey (AHHS) were the subject of this analysis. The concentrations of the 36 Environmental Relative Moldiness Index (ERMI) molds were compared in homes of different ages. The homes (n = 301) were built between 1878 and 2005. Homes with ERMI values > 5 (n = 126) were defined as water-damaged. Homes with ERMI values > 5 were divided in the years 1976 to 1977 into two groups, i.e., older (n = 61) and newer (n = 65). Newer water-damaged homes had significantly (p = 0.002) higher mean ERMI values than older water-damaged homes, 11.18 and 8.86, respectively. The Group 1 molds Aspergillus flavus, Ammophilus fumigatus, Aspergillus ochraceus, Cladosporium sphaerospermum and Trichoderma viride were found in significantly higher concentrations in newer compared to older high-ERMI homes. Some mold populations in water-damaged homes may have changed after the introduction of gypsum drywall. This research provides insight into the asthma epidemic in the US.

  17. Advanced Polymer Composite Molding Through Intelligent Process Analysis and Control

    DTIC Science & Technology

    2004-11-30

    In this project. process analysis of Resin Transfer Molding (RTM) was carried out and adaptive process control models were developed. In addition, a...aforementioned work in three separate sections: (1) process analysis and adaptive control modeling, (2) manufacturing of non-invasive sensor, end (3) list of publications resulting from this project.

  18. Natural formation of styrene by cinnamon mold flora.

    PubMed

    Lafeuille, J-L; Buniak, M-L; Vioujas, M-C; Lefevre, S

    2009-08-01

    Tests on 106 dried pure cinnamon samples of diverse origins showed that some samples were naturally contaminated with high levels of styrene, up to 524 microg/g. Styrene taint can be associated with high water activity levels and thus with microorganism growth. The mold flora of a Korintji cinnamon sample in which styrene had been found at a 50 microg/g concentration was analyzed and 5 species of mold were isolated. An investigation into the ability of the 5 species of mold to produce styrene showed that 3 of them--namely, Penicillium citrinum, Penicillium oxalicum, Aspergillus niger--produced styrene in vitro in buffered peptone water at 25 degrees C within 5 d in the presence of several natural cinnamon volatile constituents containing the styrene structure. The conversion of these compounds into styrene by these 3 cinnamon fungal species has never been previously reported. A standardized inoculation with the 3 mold species was carried out on 10 g cinnamon samples of various origins followed by a 10-d incubation and highlighting styrene production except for Sri Lanka origin.

  19. Molded elastomer provides compact ferrite-core holder, simplifies assembly

    NASA Technical Reports Server (NTRS)

    Hayden, R. R.

    1964-01-01

    A ferrite-core holder, fabricated by casting an elastomer in a simple mold, simplifies the assembly of modular matrix units for computers. Use of the device permits the core leads to be multiply threaded and soldered to terminals, without requiring intermediate terminals.

  20. 54. PRODUCTION MOLD STORAGE, SECOND FLOOR, EAST WING. THE WALLS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    54. PRODUCTION MOLD STORAGE, SECOND FLOOR, EAST WING. THE WALLS OF THIS ROOM WERE ORIGINALLY LINED WITH STEAM PIPES CONNECTED TO THE BOILER WHICH WERE USED TO DRY THE TILES BEFORE FIRING. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  1. 93. PRODUCTION MOLDS STORAGE, SECOND FLOOR, EAST WING. THE WALL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    93. PRODUCTION MOLDS STORAGE, SECOND FLOOR, EAST WING. THE WALL OF THIS ROOM WERE ORIGINALLY LINED WITH STEAM PIPES CONNECTED TO THE BOILER WHICH WERE USED TO DRY THE TILES BEFORE FIRING. SAME VIEW AS PA-107-54. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  2. Innovative molding technologies for the fabrication of components for microsystems

    NASA Astrophysics Data System (ADS)

    Piotter, Volker; Benzler, Tobias; Hanemann, Thomas; Woellmer, Heinz; Ruprecht, Robert; Hausselt, Juergen H.

    1999-03-01

    Economic success of microsystems technology requires a wide range of materials as well as the related manufacturing processes. A suitable technology for medium/large scale production is micro injection molding which actually allows the manufacturing of plastic microstructures with 20 microns minimum thickness, structural details of approximately 0.2 microns or maximum aspect ratios of more than 20. These microstructures are, for example, applied as components in micro optics, micro fluidics or minimally invasive surgery. This is demonstrated by microparts that are currently available or will be available soon. For higher economic efficiency and cost reduction, fully electrical injection modeling machines of higher accuracy have been applied. Also, micro insert injection molding reduces mounting costs. Manufacturing of metal or ceramic microparts by powder injection modeling allows large-scale production of complex shaped microstructures with a wide range of materials. Typical examples are sintered structured like stepped LIGA- gear wheels with minimal dimensions of 50 microns in different metal and ceramic materials. Micro Precision Casting originating from conventional investment casting is a suitable process for small/medium-scale production. Examples are microturbine housings made of precious metal alloys. An approach similar to rapid prototyping applies photocurable reactive resins. Photoinduced molding of low viscous resins under ambient conditions leads to significantly reduced cycle times. Additionally, rapid testing of new composite materials can be performed easily. Microcomponents molded from polymers and different composites like dyes with nonlinear optical properties and nanosized ceramic powders will be presented.

  3. Recommended Best Practices for Mold Investigations in Minnesota Schools.

    ERIC Educational Resources Information Center

    Minnesota State Dept. of Health, St. Paul.

    The Minnesota Department of Health developed this guidance at the request of the Minnesota Department of Children, Families and Learning. The goal of the document is to assist school district staff of Minnesota public schools in responding to problems related to indoor mold. Its focus is on practical, cost-effective methods to identify indoor mold…

  4. Screening Tools to Estimate Mold Burdens in Homes

    EPA Science Inventory

    Objective: The objective of this study was to develop screening tools that could be used to estimate the mold burden in a home which would indicate whether more detailed testing might be useful. Methods: Previously, in the American Healthy Home Survey, a DNA-based method of an...

  5. Incipient flocculation molding: A new ceramic-forming technique

    NASA Astrophysics Data System (ADS)

    Arrasmith, Steven Reade

    Incipient Flocculation Molding (IFM) was conceived as a new near-net-shape forming technique for ceramic components. It was hypothesized that the development of a temperature-dependent deflocculant would result in a forming technique that is flexible, efficient, and capable of producing a superior microstructure with improved mechanical properties from highly reactive, submicron ceramic powders. IFM utilizes a concentrated, nonaqueous, sterically stabilized ceramic powder and/or colloidal suspension which is injected into a non-porous mold. The suspension is then flocculated by destabilizing the suspension by lowering the temperature. Flocculation is both rapid and reversible. Cooling to -20°C produces a green body with sufficient strength for removal from the mold. The solvent is removed from the green body by evaporation. The dried green body is subsequently sintered to form a dense ceramic monolith. This is the first ceramic forming method based upon the manipulation of a sterically-stabilized suspension. To demonstrate IFM, the process of grafting polyethylene glycol (PEG), with molecular weights from 600 to 8000, to alumina powders was investigated. The maximum grafted amounts were achieved by the technique of dispersing the alumina powders in molten polymer at 195°C. The ungrafted PEG was then removed by repeated centrifuging and redispersion in fresh distilled water. The rheological behavior of suspensions of the PEG-grafted powders in water, 2-propanol and 2-butanol were characterized. All of the aqueous suspensions were shear thinning. The PEG 4600-grafted alumina powder aqueous suspensions were the most fluid. Sample rods and bars were molded from 52 vol% PEG-grafted alumina suspensions in 2-butanol. The best results were obtained with a preheated aluminum mold lubricated with a fluorinated oil mold-release. The samples were dried, sintered, and their microstructure and density were compared with sintered samples dry pressed from the same alumina powder

  6. Materials processing research opportunities in powder injection molding

    SciTech Connect

    German, R.M.

    1995-12-31

    Materials processing is an active area with many research opportunities for advanced instrumentation, control, and modeling. Among new materials processing routes, powder injection molding (PIM) has rapidly grown from a curiosity to a viable production technique over just a few years. This manufacturing technique is applicable to all materials, and is the preferred fabrication route for many complex-shaped, high-performance components for surgical tools, computer hardware, automotive systems, consumer products, and turbine components. This presentation introduces the use of a computer controlled injection molding machine to shape powders (metal, carbide, composite, and ceramic) in a high productivity setting. After molding the organic is extracted and the powder structure is sintered to full density. Much research is needed in process modeling, control, inspection, and optimization. This presentation summarizes the basic technology and several important factors relevant to manufacturing. An important development is in minimization of molding defects via closed-loop feedback control using pressure, temperature, and optical sensors. Recent progress has occurred using in situ guided waves for ultrasonic inspection of the molded part. Neural networks are being generated to allow assessment of processing changes as required from the integrated robot, visual imaging, pressure, and ultrasonic sensors. Similar, but less refined efforts are occurring in die compaction technology. As another example, computer simulation of heat transfer is needed during sintering to understand sources of component warpage during densification. A furnace equipped with visual imaging and residual gas analysis is being used to assist in verification of such computer simulations. These tools are still in the research stage, so future integration into the manufacturing environment will bring new challenges.

  7. Measurement Of Thermal Contact Resistance Between The Mold And The Polymer For The Stretch-blow Molding Process

    NASA Astrophysics Data System (ADS)

    Bordival, M.; Schmidt, F. M.; Le Maoult, Y.; Coment, E.

    2007-04-01

    In the stretch-blow molding process, the heat transfer between the polymer and the mold is of prime interest. Although the time of contact is very short (typically around 0.5 s), the heat transfer affects the mechanical properties of the bottle, and the quality of final parts. In order to model heat transfers at the interface, a classical approach — generally adopted in numerical softwares — is to impose the heat flux density boundary condition thanks to a parameter called Thermal Contact Resistance (TCR). This paper focuses on describing the experimental method developed in order to measure evolution of this thermal parameter (TCR) versus time, as well as results obtained on the CROMeP blowing machine. In this study, a mold has been instrumented with two different sensors. The first probe allows to estimate the heat flux density and temperature at the mold surface temperature, using a linear inverse heat condution problem (Function Specification Method). The second device is used to measure the surface temperature of the PET during the blowing. This measurement is non intrusive, and can be applied within an industrial environment during the blowing step. In addition, air pressure inside the preform is also measured during the blowing. This work is part of the European project "APT_PACK" (Advanced knowledge of Polymer deformation for Tomorrow's PACKaging).

  8. Investigation of micro-injection molding based on longitudinal ultrasonic vibration core.

    PubMed

    Qiu, Zhongjun; Yang, Xue; Zheng, Hui; Gao, Shan; Fang, Fengzhou

    2015-10-01

    An ultrasound-assisted micro-injection molding method is proposed to improve the rheological behavior of the polymer melt radically, and a micro-injection molding system based on a longitudinal ultrasonic vibration core is developed and employed in the micro-injection molding process of Fresnel lenses. The verification experiments show that the filling mold area of the polymer melt is increased by 6.08% to 19.12%, and the symmetric deviation of the Fresnel lens is improved 15.62% on average. This method improved the filling performance and replication quality of the polymer melt in the injection molding process effectively.

  9. The effect of process parameters on the thermal conditions during moving mold ESR

    SciTech Connect

    Heilman, J.E.; Damkroger, B.K.

    1994-09-01

    Several experimental melts were conducted using a moving mold electroslag remelting furnace. The conditions of electrode immersion depth, slag cap thickness, and melt current were varied. Mold wall temperatures and slag pool temperatures were measured and the heat flux through the mold wall was calculated. The relationships between varying ESR melt parameters and the resultant thermal conditions were examined. The thermal profile of the mold, the heat transfer to the mold coolant total and fractional, and the formation of a slag skin were studied.

  10. Effects of Process Parameters on Replication Accuracy of Microinjection Molded Cyclic Olefins Copolymers Parts

    NASA Astrophysics Data System (ADS)

    Lin, Hsuan-Liang; Chen, Chun-Sheng; Lee, Ruey-Tsung; Chen, Shia-Chung; Chien, Rean-Der; Jeng, Ming-Chang; Hwang, Jiun-Ren

    2013-04-01

    In this study, the effects of various processing parameters of microinjection molding on the replication accuracy of the micro featured fluidic platform used for DNA/RNA tests are investigated. LIGA-like processes were utilized to prepare a silicon-based SU-8 photoresist, followed by electroforming to make a Ni-Co-based stamp. A cyclic olefin copolymer (COC) was used as the injection molding material. The molding parameters associated with the replication accuracy of micro channel parts were investigated. It was found that for microinjection molded devices, the replication accuracies of the imprint width and depth increase with increasing of mold temperature, melt temperature, injection velocity, and packing pressure.

  11. Precision molding of advanced glass optics: innovative production technology for lens arrays and free form optics

    NASA Astrophysics Data System (ADS)

    Pongs, Guido; Bresseler, Bernd; Bergs, Thomas; Menke, Gert

    2012-10-01

    Today isothermal precision molding of imaging glass optics has become a widely applied and integrated production technology in the optical industry. Especially in consumer electronics (e.g. digital cameras, mobile phones, Blu-ray) a lot of optical systems contain rotationally symmetrical aspherical lenses produced by precision glass molding. But due to higher demands on complexity and miniaturization of optical elements the established process chain for precision glass molding is not sufficient enough. Wafer based molding processes for glass optics manufacturing become more and more interesting for mobile phone applications. Also cylindrical lens arrays can be used in high power laser systems. The usage of unsymmetrical free-form optics allows an increase of efficiency in optical laser systems. Aixtooling is working on different aspects in the fields of mold manufacturing technologies and molding processes for extremely high complex optical components. In terms of array molding technologies, Aixtooling has developed a manufacturing technology for the ultra-precision machining of carbide molds together with European partners. The development covers the machining of multi lens arrays as well as cylindrical lens arrays. The biggest challenge is the molding of complex free-form optics having no symmetrical axis. A comprehensive CAD/CAM data management along the entire process chain is essential to reach high accuracies on the molded lenses. Within a national funded project Aixtooling is working on a consistent data handling procedure in the process chain for precision molding of free-form optics.

  12. Increasing the life of molds for casting copper and its alloys

    NASA Astrophysics Data System (ADS)

    Smirnov, A. N.; Spiridonov, D. V.

    2010-12-01

    The work of the molds intended for casting copper and copper alloys in semicontinuous casters for producing flat billets is considered. It is shown that, to increase the resistance of mold plates, the inner space of the mold should have a taper shape toward the casting direction and take into account the shrinkage of the linear dimensions of the ingot during its motion in the mold. The taper shape increases the intensity and uniformity of heat removal due to close contact between the ingot and the mold inner surface. Testing of new design molds under industrial conditions demonstrates that their resistance increases by a factor of 4.0-4.5. The taper effect of the mold plates is much more pronounced in their narrow faces.

  13. [Mold growth on strawberries and cherries during storage at 25 degrees C].

    PubMed

    Aikawa, Katsuhiro; Asai, Yoshio; Takahashi, Takanori

    2008-04-01

    Mold species that grew on the surface of retailed strawberries (10 packs, 211 strawberries) and cherries (18 packs, 441 cherries) during storage at 25 degrees C were isolated and identified to evaluate the state of mold growth. Mold growth was observed on 208 (98.6%) of the 211 strawberries and 193 (43.8%) of the 441 cherries. The mold species most frequently isolated from strawberries was Botrytis cinerea, being observed in 81.0% of the strawberries examined, followed by Cladosporium and Alternaria alternata. The mold most frequently isolated from cherries was Alternaria (28.7%), followed by Penicillium, Botrytis, and Cladosporium. The frequency of cherries on which mold growth was observed varied among packs. Mold tended to grow more often in the areas of the fruits in contact with adjacent fruits.

  14. Titanium casting: the surface reaction layer of castings obtained using ultra-low-temperature molds.

    PubMed

    Kikuchi, H; Onouchi, M; Hsu, H C; Kurotani, T; Nishiyama, M

    2001-03-01

    To examine whether the surface reaction layer of titanium castings can be reduced by lowering the mold temperature during casting, we cast titanium at three mold temperatures, including an ultra-low temperature produced by cooling the mold with liquid nitrogen, then measured the tensile strength and elongation of the castings. The titanium was cast using a centrifugal casting machine, and the molds were incinerated according to the manufacturers' instructions. Castings were then made with the molds at 200 degrees C, 600 degrees C, and an ultra-low temperature (-196 degrees C). The castability of titanium cast in the mold at the ultra-low temperature was good. The Vickers hardness near the surface layer of castings decreased as the mold temperature decreased.

  15. Fiber Reinforcement in Injection Molded Nylon 6/6 Spur Gears

    NASA Astrophysics Data System (ADS)

    Senthilvelan, S.; Gnanamoorthy, R.

    2006-07-01

    Injection molded polymer composite gears are being used in many power and or motion transmission applications. In order to widen the utilization of reinforced polymers for precision motion transmission and noise less applications, the accuracy of molded gears should be increased. Since the injection molded gear accuracy is significantly influenced by the material shrinkage behaviour, there is a need to understand the influence of fiber orientation and gate location on part shrinkage behaviour and hence the gear accuracy. Unreinforced and 20% short glass fiber reinforced Nylon 6/6 spur gears were injection molded in the laboratory and computer aided simulations of gear manufacturing was also carried out. Results of the mold flow simulation of gear manufacturing were correlated with the actual fiber orientation and measured major geometrical parameters of the molded gears. Actual orientation of the fibers near the tooth profile, weld line region and injection points of molded gears were observed using optical microscope and correlated with predicted fiber orientation.

  16. Modeling and flow analysis of pure nylon polymer for injection molding process

    NASA Astrophysics Data System (ADS)

    Nuruzzaman, D. M.; Kusaseh, N.; Basri, S.; Oumer, A. N.; Hamedon, Z.

    2016-02-01

    In the production of complex plastic parts, injection molding is one of the most popular industrial processes. This paper addresses the modeling and analysis of the flow process of the nylon (polyamide) polymer for injection molding process. To determine the best molding conditions, a series of simulations are carried out using Autodesk Moldflow Insight software and the processing parameters are adjusted. This mold filling commercial software simulates the cavity filling pattern along with temperature and pressure distributions in the mold cavity. In the modeling, during the plastics flow inside the mold cavity, different flow parameters such as fill time, pressure, temperature, shear rate and warp at different locations in the cavity are analyzed. Overall, this Moldflow is able to perform a relatively sophisticated analysis of the flow process of pure nylon. Thus the prediction of the filling of a mold cavity is very important and it becomes useful before a nylon plastic part to be manufactured.

  17. Respiratory symptoms associated with the use of azodicarbonamide foaming agent in a plastics injection molding facility.

    PubMed

    Whitehead, L W; Robins, T G; Fine, L J; Hansen, D J

    1987-01-01

    Respiratory health variables were studied cross-sectionally in 227 employees of a plastics molding facility where numerous complaints had been apparently associated with the use of azodicarbonamide foaming agent in injection molding. Pre- and postshift respiratory status measures and azodicarbonamide concentrations were also obtained for 17 employees. Cross-sectional pulmonary function differences by injection molding status were not observed. Modest decrements in pulmonary function measures were observed between start and end of shift but with no dose-effect relationship. A strong association was observed for injection molding workers for eye/nose/throat irritation, cough, and wheezing. Additionally, wheezing, chest tightness, and symptoms of chronic bronchitis were strongly associated with work in injection molding during periods in which azodicarbonamide was in use. These results suggest respiratory symptom causation by some combination of azodicarbonamide itself, reaction products of azodicarbonamide formed during injection molding, or other unidentified agents uniquely associated with the process of injection molding with azodicarbonamide foaming agent.

  18. Composite materials molding simulation for purpose of automotive industry

    NASA Astrophysics Data System (ADS)

    Grabowski, Ł.; Baier, A.; Majzner, M.; Sobek, M.

    2016-08-01

    Composite materials loom large increasingly important role in the overall industry. Composite material have a special role in the ever-evolving automotive industry. Every year the composite materials are used in a growing number of elements included in the cars construction. Development requires the search for ever new applications of composite materials in areas where previously were used only metal materials. Requirements for modern solutions, such as reducing the weight of vehicles, the required strength and vibration damping characteristics go hand in hand with the properties of modern composite materials. The designers faced the challenge of the use of modern composite materials in the construction of bodies of power steering systems in vehicles. The initial choice of method for producing composite bodies was the method of molding injection of composite material. Molding injection of polymeric materials is a widely known and used for many years, but the molding injection of composite materials is a relatively new issue, innovative, it is not very common and is characterized by different conditions, parameters and properties in relation to the classical method. Therefore, for the purpose of selecting the appropriate composite material for injection for the body of power steering system computer analysis using Siemens NX 10.0 environment, including Moldex 3d and EasyFill Advanced tool to simulate the injection of materials from the group of possible solutions were carried out. Analyses were carried out on a model of a modernized wheel case of power steering system. During analysis, input parameters, such as temperature, pressure injectors, temperature charts have been analysed. An important part of the analysis was to analyse the propagation of material inside the mold during injection, so that allowed to determine the shape formability and the existence of possible imperfections of shapes and locations air traps. A very important parameter received from

  19. Mold prevention strategies and possible health effects in the aftermath of hurricanes and major floods.

    PubMed

    Brandt, Mary; Brown, Clive; Burkhart, Joe; Burton, Nancy; Cox-Ganser, Jean; Damon, Scott; Falk, Henry; Fridkin, Scott; Garbe, Paul; McGeehin, Mike; Morgan, Juliette; Page, Elena; Rao, Carol; Redd, Stephen; Sinks, Tom; Trout, Douglas; Wallingford, Kenneth; Warnock, David; Weissman, David

    2006-06-09

    Extensive water damage after major hurricanes and floods increases the likelihood of mold contamination in buildings. This report provides information on how to limit exposure to mold and how to identify and prevent mold-related health effects. Where uncertainties in scientific knowledge exist, practical applications designed to be protective of a person's health are presented. Evidence is included about assessing exposure, clean-up and prevention, personal protective equipment, health effects, and public health strategies and recommendations. The recommendations assume that, in the aftermath of major hurricanes or floods, buildings wet for <48 hours will generally support visible and extensive mold growth and should be remediated, and excessive exposure to mold-contaminated materials can cause adverse health effects in susceptible persons regardless of the type of mold or the extent of contamination. For the majority of persons, undisturbed mold is not a substantial health hazard. Mold is a greater hazard for persons with conditions such as impaired host defenses or mold allergies. To prevent exposure that could result in adverse health effects from disturbed mold, persons should 1) avoid areas where mold contamination is obvious; 2) use environmental controls; 3) use personal protective equipment; and 4) keep hands, skin, and clothing clean and free from mold-contaminated dust. Clinical evaluation of suspected mold-related illness should follow conventional clinical guidelines. In addition, in the aftermath of extensive flooding, health-care providers should be watchful for unusual mold-related diseases. The development of a public health surveillance strategy among persons repopulating areas after extensive flooding is recommended to assess potential health effects and the effectiveness of prevention efforts. Such a surveillance program will help CDC and state and local public health officials refine the guidelines for exposure avoidance, personal protection

  20. Influence of mold and substrate material combinations on nanoimprint lithography process: MD simulation approach

    NASA Astrophysics Data System (ADS)

    Yang, Seunghwa; Yu, Suyoung; Cho, Maenghyo

    2014-05-01

    A molecular dynamics (MD) study was performed to examine the effect of mold-substrate material composition on the pattern transferring and defects of the resist polymer in a thermal Nano Imprint Lithography (NIL) process. As candidate materials, single crystalline nickel (Ni), silicon (Si) and silica (SiO2, α-quartz) for the rigid mold substrate, and amorphous poly-(methylmethacrylate) (PMMA) thin film for the resist were considered for common applications in NIL processes. Three different material compositions of Si mold-Ni substrate, Ni mold-Si substrate, and quartz mold-Ni substrate were considered. In accordance with a real NIL process, a sequence of indentation-relaxation-release processes was quasi-statically simulated using isothermal ensemble simulation on tri-layer molecular structures consisting of a mold, resist, and substrate. To correlate the deformed shape and delamination of PMMA resist from the substrate in indentation and release processes, non-bond interaction energy between a rigid mold and resist was calculated for each combination of mold and substrate materials. The Si mold-Ni substrate combination shows successful pattern transfer to the resist polymer even without an anti-sticking layer as a result of the desirable balance of surface free energy for mold and substrate materials. However, Ni mold-Si substrate combination shows a critical delamination of the resist in the release process due to strong van der Waals adhesion between the resist and Ni mold. Similarly, the quartz mold-Ni substrate combination shows the same delamination in pattern transfer, but the adhesion of the resist to the quartz mold is attributed to electrostatic interaction. In order to provide guidelines for material selection in imprint-like processes where surface adsorption and wetting characteristics are critical design parameters, a simple PMMA-rigid plate model is proposed, with which consistent surface interaction characteristics in the full model NIL process

  1. Route 20, Autobahn 7, and Slime Mold: Approximating the Longest Roads in USA and Germany With Slime Mold on 3-D Terrains.

    PubMed

    Adamatzky, Andrew I

    2014-01-01

    A cellular slime mould Physarum polycephalum is a monstrously large single cell visible by an unaided eye. The slime mold explores space in parallel, is guided by gradients of chemoattractants, and propagates toward sources of nutrients along nearly shortest paths. The slime mold is a living prototype of amorphous biological computers and robotic devices capable of solving a range of tasks of graph optimization and computational geometry. When presented with a distribution of nutrients, the slime mold spans the sources of nutrients with a network of protoplasmic tubes. This protoplasmic network matches a network of major transport routes of a country when configuration of major urban areas is represented by nutrients. A transport route connecting two cities should ideally be a shortest path, and this is usually the case in computer simulations and laboratory experiments with flat substrates. What searching strategies does the slime mold adopt when exploring 3-D terrains? How are optimal and transport routes approximated by protoplasmic tubes? Do the routes built by the slime mold on 3-D terrain match real-world transport routes? To answer these questions, we conducted pioneer laboratory experiments with Nylon terrains of USA and Germany. We used the slime mold to approximate route 20, the longest road in USA, and autobahn 7, the longest national motorway in Europe. We found that slime mold builds longer transport routes on 3-D terrains, compared to flat substrates yet sufficiently approximates man-made transport routes studied. We demonstrate that nutrients placed in destination sites affect performance of slime mold, and show how the mold navigates around elevations. In cellular automaton models of the slime mold, we have shown variability of the protoplasmic routes might depends on physiological states of the slime mold. Results presented will contribute toward development of novel algorithms for sensorial fusion, information processing, and decision making, and

  2. Microstructures of poly (ethylene glycol) by molding and dewetting

    NASA Astrophysics Data System (ADS)

    Suh, Kahp Y.; Langer, Robert

    2003-08-01

    We report on the fabrication of microstructures of poly (ethylene glycol) (PEG) using a soft molding technique. When a patterned poly (dimethylsiloxane) stamp is placed on a wet PEG film, the polymer in contact with the stamp spontaneously moves into the void space as a result of capillary action. Three types of microstructures are observed with the substrate surface completely exposed: a negative replica of the stamp, a two-dimensional projection of the simple cubic structure, and a two-dimensional projection of the diamond structure. A molding process is responsible for the first type and a dewetting process for the final two. A phase diagram is constructed based on the effects of molecular weight and concentration, which shows that mobility and confinement play a crucial role in determining the particular type of microstructure obtained. The PEG microstructure could be used as a lithographic resist in fabricating electronic devices and a resistant layer for preventing nonspecific adsorption of proteins or cells.

  3. Grain Refinement of Permanent Mold Cast Copper Base Alloys

    SciTech Connect

    M.Sadayappan; J.P.Thomson; M.Elboujdaini; G.Ping Gu; M. Sahoo

    2005-04-01

    Grain refinement is a well established process for many cast and wrought alloys. The mechanical properties of various alloys could be enhanced by reducing the grain size. Refinement is also known to improve casting characteristics such as fluidity and hot tearing. Grain refinement of copper-base alloys is not widely used, especially in sand casting process. However, in permanent mold casting of copper alloys it is now common to use grain refinement to counteract the problem of severe hot tearing which also improves the pressure tightness of plumbing components. The mechanism of grain refinement in copper-base alloys is not well understood. The issues to be studied include the effect of minor alloy additions on the microstructure, their interaction with the grain refiner, effect of cooling rate, and loss of grain refinement (fading). In this investigation, efforts were made to explore and understand grain refinement of copper alloys, especially in permanent mold casting conditions.

  4. Polyimide molding powder, coating, adhesive, and matrix resin

    NASA Technical Reports Server (NTRS)

    St.clair, Terry L. (Inventor); Progar, Donald J. (Inventor)

    1992-01-01

    The invention is a polyimide prepared from 3,4'-oxydianiline (3,4'-ODA) and 4,4'-oxydiphthalic anhydride (ODPA), in 2-methoxyethyl ether (diglyme). The polymer was prepared in ultra high molecular weight and in a controlled molecular weight form which has a 2.5 percent offset in stoichiometry (excess diamine) with a 5.0 percent level of phthalic anhydride as an endcap. This controlled molecular weight form allows for greatly improved processing of the polymer for moldings, adhesive bonding, and composite fabrication. The higher molecular weight version affords tougher films and coatings. The overall polymer structure groups in the dianhydride, the diamine, and a metal linkage in the diamine affords adequate flow properties for making this polymer useful as a molding powder, adhesive, and matrix resin.

  5. SIDE VIEW OF PREPARATION FOR PULLING CONTINUOUSLYCAST "CAKES" FROM MOLDS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    SIDE VIEW OF PREPARATION FOR PULLING CONTINUOUSLY-CAST "CAKES" FROM MOLDS AT #03 STATION. WHEN THE CAKES HAVE COOLED SUFFICIENTLY, THE CASTER STATION IS MOVED ASIDE TO EXPOSE THE QUENCH TANK AND MOLDS. EACH CAKE OF THE THREE CAKES WEIGHS UP TO APPROXIMATELY 20,000 LBS THE DIMENSIONS OF BRASS CAKES RANGE UP TO 27 1\\2" WIDE X 6 3\\4" THICK X 25' LONG, CORRESPONDING MAXIMUMS FOR COPPER CAKES ARE 37 1\\2" X 5" X 24'. #01 STATION, DATING FROM THE EARLY 1960'S CASTS ONLY A SINGLE BAR (RATHER THAN THREE SIMULTANEOUSLY), THAT IS APPROXIMATELY HALF THE LENGTH OF CAKES FROM THE OTHER STATIONS (150' V. 300") AND WEIGHS UP TO 12,500 LBS. - American Brass Foundry, 70 Sayre Street, Buffalo, Erie County, NY

  6. SIDE VIEW OF PREPARATION FOR PULLING CONTINUOUSLYCAST "CAKES" FROM MOLDS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    SIDE VIEW OF PREPARATION FOR PULLING CONTINUOUSLY-CAST "CAKES" FROM MOLDS AT #03 STATION. WHEN THE CAKES HAVE COOLED SUFFICIENTLY, THE CASTER STATION IS MOVED ASIDE TO EXPOSE THE QUENCH TANK AND MOLDS. EACH CAKE OF THE THREE CAKES WEIGHS UP TO APPROXIMATELY 20,000. THE DIMENSIONS OF BRASS CAKES RANGE UP TO 27 1\\2" WIDE X 6 3\\4" THICK X 25' LONG, CORRESPONDING MAXIMUMS FOR COPPER CAKES ARE 37 1\\2" X 5" X 24'. #01 STATION, DATING FROM THE EARLY 1960'S CASTS ONLY A SINGLE BAR (RATHER THAN THREE SIMULTANEOUSLY), THAT IS APPROXIMATELY HALF THE LENGTH OF CAKES FROM THE OTHER STATIONS (150' V. 300") AND WEIGHS UP TO 12,500 LBS. - American Brass Foundry, 70 Sayre Street, Buffalo, Erie County, NY

  7. FPGA-Based Multiprocessor System for Injection Molding Control

    PubMed Central

    Muñoz-Barron, Benigno; Morales-Velazquez, Luis; Romero-Troncoso, Rene J.; Rodriguez-Donate, Carlos; Trejo-Hernandez, Miguel; Benitez-Rangel, Juan P.; Osornio-Rios, Roque A.

    2012-01-01

    The plastic industry is a very important manufacturing sector and injection molding is a widely used forming method in that industry. The contribution of this work is the development of a strategy to retrofit control of an injection molding machine based on an embedded system microprocessors sensor network on a field programmable gate array (FPGA) device. Six types of embedded processors are included in the system: a smart-sensor processor, a micro fuzzy logic controller, a programmable logic controller, a system manager, an IO processor and a communication processor. Temperature, pressure and position are controlled by the proposed system and experimentation results show its feasibility and robustness. As validation of the present work, a particular sample was successfully injected. PMID:23202036

  8. FPGA-based multiprocessor system for injection molding control.

    PubMed

    Muñoz-Barron, Benigno; Morales-Velazquez, Luis; Romero-Troncoso, Rene J; Rodriguez-Donate, Carlos; Trejo-Hernandez, Miguel; Benitez-Rangel, Juan P; Osornio-Rios, Roque A

    2012-10-18

    The plastic industry is a very important manufacturing sector and injection molding is a widely used forming method in that industry. The contribution of this work is the development of a strategy to retrofit control of an injection molding machine based on an embedded system microprocessors sensor network on a field programmable gate array (FPGA) device. Six types of embedded processors are included in the system: a smart-sensor processor, a micro fuzzy logic controller, a programmable logic controller, a system manager, an IO processor and a communication processor. Temperature, pressure and position are controlled by the proposed system and experimentation results show its feasibility and robustness. As validation of the present work, a particular sample was successfully injected.

  9. Extending the Performance of Net Shape Molded Fiber Reinforced Polymer Composite Valves for Use in Internal Combustion Engines

    DTIC Science & Technology

    2007-06-01

    vacuum bagged part (SCRIMP) or vacuum assisted resin transfer ( VARTM ) in a mold, Advantages of RTM include: "* Ability to mold complex shapes "* High...Published Reduction RPM Revolutions per minute RTM Resin Transfer Molding SCRIMP Seemann Composites Resin Infusion Molding Process SiC Silicon Carbide St...temperature vi V Shear Force VARTM Vacuum Assisted Resin Transfer Molding WOT Wide Open Throttle Symbols: a = thermal diffusivity (m2/s) f

  10. Development of processes and techniques for molding thermally stable, fire-retardant, low-smoke-emitting polymeric materials

    NASA Technical Reports Server (NTRS)

    Silverman, B.

    1979-01-01

    All available newly developed nonmetallic thermally stable polymers were examined for the development of processes and techniques by compression molding, injection molding, or thermoforming cabin interior parts. Efforts were directed toward developing molding techniques of new polymers to economically produce usable nonmetallic molded parts. Data on the flame resistant characteristics of the materials were generated from pilot plant batches. Preliminary information on the molding characteristics of the various thermoplastic materials was obtained by producing actual parts.

  11. Simulation of the Vacuum Assisted Resin Transfer Molding Process

    DTIC Science & Technology

    2004-07-01

    Manufacturing INTRODUCTION Vacuum Assisted Resin Transfer Molding ( VARTM ) is a variant of the traditional RTM process in which one of the solid tool faces...is replaced by a flexible vacuum bag. VARTM offers numerous cost advantages over traditional RTM , such as lower tooling cost and shorter start-up time... VARTM ) process. Flow of resin through the distribution medium and preform were modeled as flow through porous media. The finite element/control volume

  12. Modeling and Simulation of Mold Filling with LIMS

    DTIC Science & Technology

    2007-11-02

    University of Delaware All rights reservedSimacek ONR Workshop - 4 RTM and VARTM Processes RTM VARTM 2 July 2003© 2003 University of Delaware All...Tools? Ø Can We See Into the Mold? F In RTM Manufacturing NO! F In VARTM or Laboratory A little Ø Can We Measure What is Happening? F Yes, but at High...Pressure Transducers Flow meter Inlet 2 July 2003© 2003 University of Delaware All rights reservedSimacek ONR Workshop - 22 VARTM Specific

  13. Engineering Design Handbook Rotational Molding of Plastic Powders

    DTIC Science & Technology

    1975-04-15

    characteristics such as discoloration. Also, tumbling of very fine powders within a mold will build up high static charges that aid in agglomerating the powders...strongly affected by fines concentration. Further, fines aid powder flow during mixing and tumbling apparently by lubricating the larger particles and...different type. Powders that have been ground but not polished or tumbled for some time against an abrasive surface usually have tails on the order of 10

  14. Transforming Wind Turbine Blade Mold Manufacturing with 3D Printing

    SciTech Connect

    Zayas, Jose; Johnson, Mark

    2016-06-28

    Innovation in the design and manufacturing of wind power generation components continues to be critical to achieving our national renewable energy goals. As a result of this challenge, the U.S. Department of Energy's Wind Program and Advanced Manufacturing Office are partnering with public and private organizations to apply additive manufacturing, commonly known as 3D printing, to the production of wind turbine blade molds.

  15. Simultaneous mold infections in an orthotopic heart transplant recipient.

    PubMed

    Clauss, H; Samuel, R

    2008-10-01

    Simultaneous mold infections in heart transplant recipients have not been previously reported. Here we describe early onset post-transplant pulmonary aspergillosis and cutaneous zygomycosis in a 46-year-old heart transplant recipient who was also treated with basiliximab. Along with surgical debridement, medical treatment of his cutaneous abdominal wall zygomycosis at the former left ventricular assist device driveline site with liposomal amphotericin B and voriconazole also led to cure of his pulmonary aspergillosis.

  16. DUMPING COOLED MOLDS FROM THE SHAKE OUT RAILS ONTO A ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    DUMPING COOLED MOLDS FROM THE SHAKE OUT RAILS ONTO A VIBRATING CONVEYOR WHICH TRANSPORTS CASTINGS AND SAND TO A SEPARATION SCREEN WHICH SIFTS SAND ONTO BELT CONVEYORS BELOW THAT CARRY IT PAST SWITCH-ACTIVATED WATER INJECTORS TO SIMILAR SWITCH-ACTIVATED FRESH SAND ADDERS BEFORE TRANSPORTING IT TO THE SAND STORAGE BIN WHILE CASTINGS ARE EITHER MANUALLY OR SMALL CRANE LIFTED TO DEGATING AREAS. - Southern Ductile Casting Company, Centerville Foundry, 101 Airport Road, Centreville, Bibb County, AL

  17. Spray forming process for producing molds, dies and related tooling

    DOEpatents

    McHugh, Kevin M.; Key, James F.

    1998-01-01

    A method for spray forming manufacturing of near-net-shape molds, dies and related toolings, wherein liquid material such as molten metal, metallic alloys, or polymers are atomized into fine droplets by a high temperature, high velocity gas and deposited onto a pattern. Quenching of the atomized droplets provides a heat sink, thereby allowing undercooled and partially solidified droplets to be formed in-flight. Composites can be formed by combining the atomized droplets with solid particles such as whiskers or fibers.

  18. Transforming Wind Turbine Blade Mold Manufacturing with 3D Printing

    ScienceCinema

    Zayas, Jose; Johnson, Mark

    2016-08-17

    Innovation in the design and manufacturing of wind power generation components continues to be critical to achieving our national renewable energy goals. As a result of this challenge, the U.S. Department of Energy's Wind Program and Advanced Manufacturing Office are partnering with public and private organizations to apply additive manufacturing, commonly known as 3D printing, to the production of wind turbine blade molds.

  19. Indoor moisture and mold-related health problems.

    PubMed

    Johanning, Eckardt

    2004-05-01

    Moisture, microbial and in particular mold related indoor exposure and health problems in homes, offices, and public buildings (Kindergartens, schools, library, and hospitals) have been gaining recognition as one of the most common indoor environmental health issues. Proper recognition of microbial related health problems and the differential diagnosis of sick building syndrome (SBS) or building related illness (BRI) are important for early and effective exposure intervention, treatment, referral and prevention of more serious illness.

  20. Understanding the impact of molds on indoor air quality and possible links to health effects Indoor Molds - More than Just a Musty Smell

    EPA Science Inventory

    Molds are multi-celled, colony forming, eukaryotic microorganisms lacking chlorophyll belonging to the Kingdom Fungi. Furthermore, molds are ubiquitous in both indoor and outdoor environments. There are more than 200 different types of fungi to which people are routinely exposed ...