Sample records for mold stachybotrys chartarum

  1. Indoor mold, toxigenic fungi, and Stachybotrys chartarum: infectious disease perspective.

    PubMed

    Kuhn, D M; Ghannoum, M A

    2003-01-01

    Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors.

  2. Indoor Mold, Toxigenic Fungi, and Stachybotrys chartarum: Infectious Disease Perspective

    PubMed Central

    Kuhn, D. M.; Ghannoum, M. A.

    2003-01-01

    Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors. PMID:12525430

  3. Attributes of Stachybotrys chartarum and its association with human disease.

    PubMed

    Hossain, Mohammad Ashraf; Ahmed, Mohamed Sotohy; Ghannoum, Mahmoud Afif

    2004-02-01

    Mold contamination and toxicities are not limited to crops and animals; they are also a concern in human health. Molds occur in outdoor and indoor environments, and water-damaged buildings harbor and provide substrate for several mold species. Of these, Stachybotrys chartarum poses a particular threat to occupants. Patients with building-related symptoms and infant idiopathic pulmonary hemorrhage often have histories of living in moldy, water-damaged buildings. Although a causal connection is far from being unequivocally proven, S. chartarum has been associated with such clinical conditions. These illnesses could be attributed in part to mycotoxins released by S. chartarum. Recently, a hemolysin released by this mold was found to be hemolytic in vitro and in vivo. In addition, allergenic proteins have been characterized from S. chartarum. The exact mechanism of S. chartarum pathogenesis has not yet been defined. Moreover, a causality-effect relation is not yet established. This review summarizes available information on the pathogenic attributes of S. chartarum and calls for well-controlled objective studies.

  4. GROWTH RESPONSE OF STACHYBOTRYS CHARTARUM TO MOISTURE VARIATION ON COMMON BUILDING MATERIALS

    EPA Science Inventory

    The mold Stachybotrys chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants and has been studied for toxin production and its occurrence in water damaged buildings. Growth of S. chartarum on building materials such as drywall has been frequentl...

  5. CHARACTERISTIC GROWTH REQUIREMENTS OF THE TOXIC MOLD STACHYBOTRYS CHARTARAM

    EPA Science Inventory

    The paper discusses the results of a study of the environmental factors leading to the growth of the mold Stachybotrys chartarum. S. chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants, and its toxin production and occurrence in water damaged...

  6. CHARACTERIZATION OF MICROBIAL VOLATILE ORGANIC COMPOUNDS (MVOC) EMITTED BY STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a filamentous fungi usually found in water-damaged buildings. Severe illnesses have been reported after indoor exposure to this mold. Toxicity has caused the production of secondary metabolites or mycotoxins, and the emission of by-products, specifically...

  7. Genome sequence of Stachybotrys chartarum Strain 51-11

    EPA Science Inventory

    Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina Hiseq 2000 and PacBio long read technology. Since Stachybotrys chartarum has been implicated in health impacts within water-damaged buildings, any information extracted from the geno...

  8. Antibodies against Stachybotrys chartarum extract and its antigenic components, Stachyhemolysin and Stachyrase-A: a new clinical biomarker.

    PubMed

    Vojdani, Aristo

    2005-05-01

    IgG and IgE antibodies against Stachybotrys extract have been reported in allergic patients and residents of water-damaged buildings. Detection of these antibodies in blood was partially attributed to cross-reacting proteins from other fungi. There is a need for a specific method to detect antibodies against characteristic components of S. chartarum. We measured IgG and IgE antibodies against Stachybotrys hemolysin and proteinase-Stachyrase-A by ELISA and ELISA-inhibition techniques. Of 50 reference sera with IgE greater than 500 IU ml and positive against different mold extracts used in this study, significant elevation in IgG or IgE antibodies against S. chartarum extract was present in 25 and 21 specimens. Of these specimens 20 (80%) and 10 (40%) were positive for IgG anti-Stachybotrys hemolysin and anti-Stachyrase-A, while 8 out of 21 sera (38%) and 17 out of 21 (81%) specimens were positive for IgE anti-Stachybotrys hemolysin and anti-Stachyrase-A respectively. Inhibition studies using Stachybotrys hemolysin and Stachyrase-A at a concentration of 50 microg/ml prevented binding of anti-Stachybotrys to S. chartarum extract. Detection of IgG as well as IgE antibodies against Stachybotrys hemolysin and Stachyrase-A and inhibition of anti-Stachybotrys binding to Stachybotrys antigens indicate that Stachybotrys hemolysin and Stachyrase-A are two major antigenic components of S. chartarum extract, which can be used in antibody assays. Measurement of antibodies against these characteristic components of S. chartarum may be considered for demonstration of exposure and possibly allergy to the fungus.

  9. Biomechanics of conidial dispersal in the toxic mold Stachybotrys chartarum

    PubMed Central

    Tucker, Kathryn; Stolze, Jessica L.; Kennedy, Aaron H.; Money, Nicholas P.

    2007-01-01

    Conidial dispersal in Stachybotrys chartarum in response to low-velocity airflow was studied using a microflow apparatus. The maximum rate of spore release occurred during the first 5 min of airflow, followed by a dramatic reduction in dispersal that left more than 99% of the conidia attached to their conidiophores. Micromanipulation of undisturbed colonies showed that micronewton (μN) forces were needed to dislodge spore clusters from their supporting conidiophores. Calculations show that airspeeds that normally prevail in the indoor environment disturb colonies with forces that are 1,000-fold lower, in the nanonewton (nN) range. Low-velocity airflow does not, therefore, cause sufficient disturbance to disperse a large proportion of the conidia of S. chartarum. PMID:17267247

  10. Taxonomic history and current status of Stachybotrys chartarum and related species.

    PubMed

    Li, D-W; Yang, C S

    2005-01-01

    The fungus Stachybotrys chartarum is the type species of the genus Stachybotrys. It is a cellulolytic saprophyte with a worldwide distribution and is frequently recovered in water-damaged buildings. Three isolates of S. chartarum were studied morphologically from single-spore isolations. Significant differences were found with the sizes, lengths, width, and L/W ratio of conidia and phialides among the isolates. QPCR analysis on S. chartarum, S. yunnanensis, S. chlorohalonata, S. elegans, S. microspora, and S. nephrospora showed that the primers and probe for detecting S. chartarum used by commercial laboratories were not able to differentiate S. chartarum from S. chlorohalonata and S. yunnanensis. Results suggested that S. chartarum may not be well delineated even after S. chlorohalonata was recently segregated from the species complex. Further study on the taxonomic status of the epithet S. chartarum is necessary. Six species of Stachybotrys are present indoors. Differentiation of Stachybotrys chartarum from S. chlorohalonata, and S. yunnanensis can be challenging using either morphological or QPCR methods. Caution should be taken to identify S. chartarum and closely related species and to explain their health effects implication for indoor air quality investigations.

  11. PARTIAL CHARACTERIZATION OF ALLERGENS IN EXTRACTS OF STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    PARTIAL CHARACTERIZATION OF ALLERGENS IN EXTRACTS OF Stachybotrys chartarum. M E Viana1, MJ Selgrade2, and M D Ward2. 1NCSU, Raleigh, NC, USA. 2NHEERL, ORD, US EPA, RTP, NC, USA.

    Exposure to Stachybotrys chartarum has been associated with the development of serious health ...

  12. Microbial volatile organic compound emissions from Stachybotrys chartarum growing on gypsum wallboard and ceiling tile.

    PubMed

    Betancourt, Doris A; Krebs, Ken; Moore, Scott A; Martin, Shayna M

    2013-12-05

    Stachybotrys chartarum is a filamentous mold frequently identified among the mycobiota of water-damaged building materials. Growth of S. chartarum on suitable substrates and under favorable environmental conditions leads to the production of secondary metabolites such as mycotoxins and microbial volatile organic compounds (MVOCs). The aim of this study was to characterize MVOC emission profiles of seven toxigenic strains of S. chartarum, isolated from water-damaged buildings, in order to identify unique MVOCs generated during growth on gypsum wallboard and ceiling tile coupons. Inoculated coupons were incubated and monitored for emissions and growth using a closed glass environmental growth chamber maintained at a constant room temperature. Gas samples were collected from the headspace for three to four weeks using Tenax TA tubes. Most of the MVOCs identified were alcohols, ketones, ethers and esters. The data showed that anisole (methoxybenzene) was emitted from all of the S. chartarum strains tested on both types of substrates. Maximum anisole concentration was detected after seven days of incubation. MVOCs are suitable markers for fungal identification because they easily diffuse through weak barriers like wallpaper, and could be used for early detection of mold growth in hidden cavities. This study identifies the production of anisole by seven toxigenic strains of Stachybotrys chartarum within a period of one week of growth on gypsum wallboard and ceiling tiles. These data could provide useful information for the future construction of a robust MVOC library for the early detection of this mold.

  13. Microbial volatile organic compound emissions from Stachybotrys chartarum growing on gypsum wallboard and ceiling tile

    PubMed Central

    2013-01-01

    Background Stachybotrys chartarum is a filamentous mold frequently identified among the mycobiota of water-damaged building materials. Growth of S. chartarum on suitable substrates and under favorable environmental conditions leads to the production of secondary metabolites such as mycotoxins and microbial volatile organic compounds (MVOCs). The aim of this study was to characterize MVOC emission profiles of seven toxigenic strains of S. chartarum, isolated from water-damaged buildings, in order to identify unique MVOCs generated during growth on gypsum wallboard and ceiling tile coupons. Inoculated coupons were incubated and monitored for emissions and growth using a closed glass environmental growth chamber maintained at a constant room temperature. Gas samples were collected from the headspace for three to four weeks using Tenax TA tubes. Results Most of the MVOCs identified were alcohols, ketones, ethers and esters. The data showed that anisole (methoxybenzene) was emitted from all of the S. chartarum strains tested on both types of substrates. Maximum anisole concentration was detected after seven days of incubation. Conclusions MVOCs are suitable markers for fungal identification because they easily diffuse through weak barriers like wallpaper, and could be used for early detection of mold growth in hidden cavities. This study identifies the production of anisole by seven toxigenic strains of Stachybotrys chartarum within a period of one week of growth on gypsum wallboard and ceiling tiles. These data could provide useful information for the future construction of a robust MVOC library for the early detection of this mold. PMID:24308451

  14. The relative allergenicity of Stachybotrys chartarum compared to house dust mite extracts in a mouse model

    EPA Science Inventory

    A report by the Institute of Medicine suggested that more research is needed to better understand mold effects on allergic disease, particularly asthma development. The authors compared the ability of the fungus Stachybotrys chartarum (SCE) and house dust mite (HDM) extracts to i...

  15. Testing antimicrobial paint efficacy on gypsum wallboard contaminated with Stachybotrys chartarum.

    PubMed

    Menetrez, M Y; Foarde, K K; Webber, T D; Dean, T R; Betancourt, D A

    2008-02-01

    The goal of this research was to reduce occupant exposure to indoor mold through the efficacy testing of antimicrobial paints. An accepted method for handling Stachybotrys chartarum-contaminated gypsum wallboard (GWB) is removal and replacement. This practice is also recommended for water-damaged or mold-contaminated GWB but is not always followed completely. The efficacy of antimicrobial paints to eliminate or control mold regrowth on surfaces can be tested easily on nonporous surfaces. The testing of antimicrobial efficacy on porous surfaces found in the indoor environment, such as gypsum wallboard, can be more complicated and prone to incorrect conclusions regarding residual organisms. The mold S. chartarum has been studied for toxin production and its occurrence in water-damaged buildings. Research to control its growth using seven different antimicrobial paints and two commonly used paints on contaminated, common gypsum wallboard was performed in laboratory testing at high relative humidity. The results indicate differences in antimicrobial efficacy for the period of testing, and that proper cleaning and resurfacing of GWB with an antimicrobial paint can be an option in those unique circumstances when removal may not be possible.

  16. Genome Sequence of Stachybotrys chartarum Strain 51-11

    PubMed Central

    Kim, Jean; Levy, Josh

    2015-01-01

    The Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina HiSeq 2000 and PacBio technologies. Since S. chartarum has been implicated as having health impacts within water-damaged buildings, any information extracted from the genomic sequence data relating to toxins or the metabolism of the fungus might be useful. PMID:26430036

  17. Detection of airborne Stachybotrys chartarum macrocyclic trichothecene mycotoxins in the indoor environment.

    PubMed

    Brasel, T L; Martin, J M; Carriker, C G; Wilson, S C; Straus, D C

    2005-11-01

    The existence of airborne mycotoxins in mold-contaminated buildings has long been hypothesized to be a potential occupant health risk. However, little work has been done to demonstrate the presence of these compounds in such environments. The presence of airborne macrocyclic trichothecene mycotoxins in indoor environments with known Stachybotrys chartarum contamination was therefore investigated. In seven buildings, air was collected using a high-volume liquid impaction bioaerosol sampler (SpinCon PAS 450-10) under static or disturbed conditions. An additional building was sampled using an Andersen GPS-1 PUF sampler modified to separate and collect particulates smaller than conidia. Four control buildings (i.e., no detectable S. chartarum growth or history of water damage) and outdoor air were also tested. Samples were analyzed using a macrocyclic trichothecene-specific enzyme-linked immunosorbent assay (ELISA). ELISA specificity was tested using phosphate-buffered saline extracts of the fungal genera Aspergillus, Chaetomium, Cladosporium, Fusarium, Memnoniella, Penicillium, Rhizopus, and Trichoderma, five Stachybotrys strains, and the indoor air allergens Can f 1, Der p 1, and Fel d 1. For test buildings, the results showed that detectable toxin concentrations increased with the sampling time and short periods of air disturbance. Trichothecene values ranged from <10 to >1,300 pg/m3 of sampled air. The control environments demonstrated statistically significantly (P < 0.001) lower levels of airborne trichothecenes. ELISA specificity experiments demonstrated a high specificity for the trichothecene-producing strain of S. chartarum. Our data indicate that airborne macrocyclic trichothecenes can exist in Stachybotrys-contaminated buildings, and this should be taken into consideration in future indoor air quality investigations.

  18. Sanitation of wallboard colonized with Stachybotrys chartarum.

    PubMed

    Price, D L; Ahearn, D G

    1999-07-01

    Sections (8 cm2) of unused, nonsterile gypsum wallboard (dry wall) were inoculated with varying densities (10(4) to approximately 10(8)/ml) of conidia from 14- to 21-day cultures of Stachybotrys chartarum grown on cellulose agar. The sections were permitted to air dry and were placed into vessels with 86% or 92% RH and incubated at 22-25 degrees C for up to 12 weeks. The moisture content of the dryboard increased from near 10% to over 35%. Selected sections with confluent surface growth, mainly of S. chartarum, were obtained within 3 weeks. Sections were cleaned with a quaternary or quaternary and chlorine dioxide or a concentrated oxygen-saline solution and treated, in some cases, with a preservative system and returned to humidity vessels. Reemergence of S. chartarum from inoculated and treated surfaces occurred within 5 weeks only with sections treated with the quaternary alone. Other fungi, mostly species of Aspergillus, Chaetomium and Penicillium, slowly colonized (between 9-12 weeks) at least some areas of most treated surfaces and most uninoculated control surfaces. Stachybotrys chartarum was also found on several sections of uninoculated controls. Sections treated with a quaternary/acrylic and placed in a dynamic challenging chamber remained visually free of colonized fungi for over 90 days. These studies indicate that control samples of uninstalled wallboard, available from local distributors, can contain a baseline bioburden, including S. chartarum, that will colonize surfaces under high humidity conditions. Sanitation and preservation treatment of the wallboard can markedly delay regrowth of these fungi, particularly of S. chartarum.

  19. Genome Sequence of Stachybotrys chartarum Strain 51-11.

    PubMed

    Betancourt, Doris A; Dean, Timothy R; Kim, Jean; Levy, Josh

    2015-10-01

    The Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina HiSeq 2000 and PacBio technologies. Since S. chartarum has been implicated as having health impacts within water-damaged buildings, any information extracted from the genomic sequence data relating to toxins or the metabolism of the fungus might be useful. Copyright © 2015 Betancourt et al.

  20. EVALUATION OF STACHYBOTRYS CHARTARUM IN THE HOUSE OF AN INFANT WITH PULMONARY HEMORRHAGE: QUANTITATIVE ASSESSMENT BEFORE, DURING, AND AFTER REMEDIATION

    EPA Science Inventory

    Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...

  1. CHARACTERIZATION OF THE HEMOLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920
    Da as determ...

  2. Acute pulmonary hemorrhage during isoflurane anesthesia in two cats exposed to toxic black mold (Stachybotrys chartarum).

    PubMed

    Mader, Douglas R; Yike, Iwona; Distler, Anne M; Dearborn, Dorr G

    2007-09-01

    Acute pulmonary hemorrhage developed during isoflurane anesthesia in 2 Himalayan cats undergoing routine dental cleaning and prophylaxis. The cats were siblings and lived together. In both cats, results of pre-operative physical examinations and laboratory testing were unremarkable. Blood pressure and oxygen saturation were within reference ranges throughout the dental procedure. Approximately 15 to 20 minutes after administration of isoflurane was begun, frothy blood was noticed within the endotracheal tube. Blood was suctioned from the endotracheal tube, and the cats were allowed to recover from anesthesia. 1 cat initially responded to supportive care but developed a second episode of spontaneous pulmonary hemorrhage approximately 30 hours later and died. The other cat responded to supportive care and was discharged after 4 days, but its condition deteriorated, and the cat died 10 days later. Subsequently, it was discovered that the home was severely contaminated with mold as a result of storm damage that had occurred approximately 7 months previously. Retrospective analysis of banked serum from the cats revealed satratoxin G, a biomarker for Stachybotrys chartarum, commonly referred to as "toxic black mold." Findings highlight the potential risk of acute pulmonary hemorrhage in animals living in an environment contaminated with mold following flood damage.

  3. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  4. CHARACTERIZATION OF THE HEMOLYSIN, STACHYLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage/hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its monomeric form, has a molecular wieght of 11,920 daltons as determined by m...

  5. ELISA measurement of stachylysin in serum to quantify human exposures to the indoor mold Stachybotrys chartarum.

    PubMed

    Van Emon, Jeanette M; Reed, Allan W; Yike, Iwona; Vesper, Stephen J

    2003-06-01

    The goal of this research was to develop a measurable indicator of human exposure to Stachyborys chartarum. Antibodies were produced against the hemolytic agent stachylysin obtained from the mold S. chartarum. These antibodies were used to develop two enzyme-linked immunosorbent assay methods for the analysis of stachylysin in human and rat sera and environmental samples. Stachylysin was measured in rat pups that received nasal instillations of S. chartarum conidia but not in control rat serum. Stachylysin in the serum of five human adults exposed to S. chartarum in water-damaged environments was 371 ng/mL but none was detected in the control serum. Stachylysin was also quantified in spore, wallboard, mycelial, and dust samples. The measurement of stachylysin may be a useful indicator in assessing human exposure to S. chartarum and in determining the presence of this indoor mold.

  6. Occurrence of Stachybotrys chartarum chemotype S in dried culinary herbs.

    PubMed

    Biermaier, Barbara; Gottschalk, Christoph; Schwaiger, Karin; Gareis, Manfred

    2015-02-01

    Stachybotrys (S.) chartarum is an omnipresent cellulolytic mould which produces secondary metabolites, such as the highly toxic macrocyclic trichothecenes. While it is known to occur in animal feed like hay and straw as well as in water-damaged indoor environments, there is little knowledge about the occurrence of S. chartarum and its secondary metabolites in food. The objective of the present study was to examine selected dried culinary herbs for the presence of S. chartarum chemotype S, to assess the potential risk of a contamination of foods with macrocyclic trichothecenes. In total, 50 Stachybotrys isolates from different types of culinary herbs (n=100) such as marjoram (Origanum majorana Linné (L.)), oregano (Origanum vulgare L.), thyme (Thymus vulgaris L.), and savory (Satureja hortensis L.) were examined by MTT-cell culture test (effect-based bioassay), ELISA, and by liquid chromatography tandem mass spectrometry (LC-MS/MS). Selected toxic and non-toxic isolates (n=15) were genetically characterized by PCR and sequencing. Five isolates (10%) were highly toxic in the MTT-cell culture test, and the production of macrocyclic trichothecenes was proven by ELISA and LC-MS/MS. These five isolates were genetically confirmed as S. chartarum chemotype S. To the best of our knowledge, this is the first report about a contamination of dried culinary herbs with toxigenic S. chartarum.

  7. SOLVENT COMPARISON IN THE ISOLATION, SOLUBILIZATION, AND TOXICITY OF STACHYBOTRYS CHARTARUM SPORE TRICHOTHECENE MYCOTOXINS IN AN ESTABLISHED IN VITRO LUMINESCENCE PROTEIN TRANSLATION INHIBITION ASSAY

    EPA Science Inventory

    It is well known that non-viable mold contaminants such as macrocyclic trichothecene mycotoxins of Stachybotrys chartarum are highly toxinigenic to humans. However, there is no agreed upon method of recovering native mycotoxin. The purpose of this study was to provide quantitativ...

  8. GERMINATION, VIABILITY AND CLEARANCE OF STACHYBOTRYS CHARTARUM IN THE LUNGS OF INFANT RATS

    EPA Science Inventory

    The fungus Stachybotrys chartarum has been associated with many adverse health effects including the condition known as idiopathic pulmonary hemorrhage in infants. In order to gain some insight into possible mechanisms, viable conidia of S. chartarum were instilled into the lung...

  9. Testing antimicrobial cleaner efficacy on gypsum wallboard contaminated with Stachybotrys chartarum.

    PubMed

    Menetrez, Marc Y; Foarde, Karin K; Webber, Tricia D; Dean, Timothy R; Betancourt, Doris A

    2007-11-01

    Reducing occupant exposure to indoor mold is the goal of this research, through the efficacy testing of antimicrobial cleaners. Often mold contaminated building materials are not properly removed, but instead surface cleaners are applied in an attempt to alleviate the problem. The efficacy of antimicrobial cleaners to remove, eliminate or control mold growth on surfaces can easily be tested on non-porous surfaces. However, the testing of antimicrobial cleaner efficacy on porous surfaces, such as those found in the indoor environment such as gypsum board can be more complicated and prone to incorrect conclusions regarding residual organisms. The mold Stachybotrys chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants and has been studied for toxin production and its occurrence in water damaged buildings. Growth of S. chartarum on building materials such as gypsum wallboard has been frequently documented. Research to control S. chartarum growth using 13 separate antimicrobial cleaners on contaminated gypsum wallboard has been performed in laboratory testing. Popular brands of cleaning products were tested by following directions printed on the product packaging. A variety of gypsum wallboard surfaces were used to test these cleaning products at high relative humidity. The results indicate differences in antimicrobial efficacy for the six month period of testing. Results for the six types of GWB surfaces varied extensively. However, three cleaning products exhibited significantly better results than others. Lysol All-Purpose Cleaner-Orange Breeze (full strength) demonstrated results which ranked among the best in five of the six surfaces tested. Both Borax and Orange Glo Multipurpose Degreaser demonstrated results which ranked among the best in four of the six surfaces tested. The best antimicrobial cleaner to choose is often dependent on the type of surface to be cleaned of S. chartarum contamination. For Plain GWB, no paint, the

  10. ELISA MEASUREMENT OF STACHYLYSIN IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Problem- To develop a measurable indicator of human exposure to Stachybotys chartarum.

    Methods- Antibodies were produced against the hemolytic agent stachylysin obtained from the mold S. chartarum. These antibodies were used to develop two enzyme-linked immunosorbent ass...

  11. STACHYLYSIN MAY BE CAUSE OF HEMORRAHAGING IN STACHYBOTRYS CHARTARUM EXPOSURES

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns like nasal bleeding in adults and pulmonary hemosiderosis (PH) in infants. Stachylysin is a glycosylated protein, with the deglycosylated molecular mass of 21.5 kDa. Seven of eight ...

  12. Stachybotrys chartarum alters surfactant-related phospholipid synthesis and CTP:cholinephosphate cytidylyltransferase activity in isolated fetal rat type II cells.

    PubMed

    Hastings, C; Rand, T; Bergen, H T; Thliveris, J A; Shaw, A R; Lombaert, G A; Mantsch, H H; Giles, B L; Dakshinamurti, S; Scott, J E

    2005-03-01

    Stachybotry chartarum, a fungal contaminant of water-damaged buildings commonly grows on damp cellulose-containing materials. It produces a complex array of mycotoxins. Their mechanisms of action on the pulmonary system are not entirely clear. Previous studies suggest spore products may depress formation of disaturated phosphatidylcholine (DSPC), the major surface-active component of pulmonary surfactant (PS). If S. chartarum can indeed affect formation of this phospholipid, then mold exposure may be a significant issue for pulmonary function in both mature lung and developing fetal lung. To address this possibility, fetal rat type II cells, the principal source of DSPC, were used to assess effects of S. chartarum extract on formation of DSPC. Isolated fetal rat lung type II cells prelabeled with 3H-choline and incubated with spore extract showed decreased incorporation of 3H-choline into DSPC. The activity of CTP:cholinephosphate cytidylyltransferase (CPCT), the rate-limiting enzyme in phosphatidylcholine synthesis was reduced by approximately 50% by a 1:10 dilution of spore extract. Two different S. chartarum extracts (isolates from S. chartarum (Cleveland) and S. chartarum (Hawaiian)) were used to compare activity of CPCT in the presence of phosphatidylglycerol (PG), a known activator. PG produced an approximate two-fold increase in CPCT activity. The spore isolate from Hawaii did not alter enzyme activity. S. chartarum (Cleveland) eliminated the PG-induced activation of CPCT. These results support previous observations that mold products alter PS metabolism and may pose a risk in developing lung, inhibiting surfactant synthesis. Different isolates of the same species of fungus are not equivalent in terms of potential exposure risks.

  13. Sick building syndrome. III. Stachybotrys chartarum.

    PubMed

    Mahmoudi, M; Gershwin, M E

    2000-04-01

    Increasingly, physicians are being asked to evaluate patients with putative environmentally associated illnesses. These can include a variety of problems, including infectious illnesses (Legionnaire's disease), chemical exposure in the workplace, and sick building syndromes. The latter has been an issue particularly in asthma because of the association of mold and increased bronchial responsiveness. Recently, attention has been focused on the mold Stachybotrys in human disease. Stachybotrys was first identified more than 60 years ago following an epidemic of stomatitis, rhinitis, conjunctivitis, pancytopenia, neurologic disorders, and death in horses. Since then, Stachybotrys has been identified in several outbreaks of disease in animals. It has also attracted attention as a possible agent in idiopathic pulmonary hemorrhage in infants. Stachybotrys is a relatively uncommon fungus but has been isolated from a variety of sources, including contaminated grains, tobacco, indoor air, insulator foams, and water-damaged buildings with high humidity. This fungus is particularly important because it is one of a series of fungi that produces trichothecenes mycotoxins; these mycotoxins are biologically active and can produce a variety of physiological and pathologic changes in humans and animals, including modulation of inflammation and altered alveolar surfactant phospholipid concentrations. The presence of Stachybotrys in a building does not necessarily imply a cause-and-effect relationship with illness, but should alert physicians and healthcare professionals to do more vigorous environmental testing. Guidelines are presented herein for intervention measures in the maintenance of heating, ventilation, and air-conditioning systems.

  14. Detection of airborne Stachybotrys chartarum macrocyclic trichothecene mycotoxins on particulates smaller than conidia.

    PubMed

    Brasel, T L; Douglas, D R; Wilson, S C; Straus, D C

    2005-01-01

    Highly respirable particles (diameter, <1 microm) constitute the majority of particulate matter found in indoor air. It is hypothesized that these particles serve as carriers for toxic compounds, specifically the compounds produced by molds in water-damaged buildings. The presence of airborne Stachybotrys chartarum trichothecene mycotoxins on particles smaller than conidia (e.g., fungal fragments) was therefore investigated. Cellulose ceiling tiles with confluent Stachybotrys growth were placed in gas-drying containers through which filtered air was passed. Exiting particulates were collected by using a series of polycarbonate membrane filters with decreasing pore sizes. Scanning electron microscopy was employed to determine the presence of conidia on the filters. A competitive enzyme-linked immunosorbent assay (ELISA) specific for macrocyclic trichothecenes was used to analyze filter extracts. Cross-reactivity to various mycotoxins was examined to confirm the specificity. Statistically significant (P < 0.05) ELISA binding was observed primarily for macrocyclic trichothecenes at concentrations of 50 and 5 ng/ml and 500 pg/ml (58.4 to 83.5% inhibition). Of the remaining toxins tested, only verrucarol and diacetylverrucarol (nonmacrocyclic trichothecenes) demonstrated significant binding (18.2 and 51.7% inhibition, respectively) and then only at high concentrations. The results showed that extracts from conidium-free filters demonstrated statistically significant (P < 0.05) antibody binding that increased with sampling time (38.4 to 71.9% inhibition, representing a range of 0.5 to 4.0 ng/ml). High-performance liquid chromatography analysis suggested the presence of satratoxin H in conidium-free filter extracts. These data show that S. chartarum trichothecene mycotoxins can become airborne in association with intact conidia or smaller particles. These findings may have important implications for indoor air quality assessment.

  15. INITIAL CHARACTERIZATION OF MONOCLONAL ANTIBODIES AGAINST THE FUNGAL HEMOLYSIN STACHYLYSIN FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is known to produce the hemolysin stachylysin and its detection in human serum has been proposed as a biomarker for exposure to the fungus. In this study we report the initial characterization of monoclonal antibodies (mAbs) against stachylysin and the dev...

  16. Molecular and phenotypic descriptions of Stachybotrys chlorohalonata sp. nov. and two chemotypes of Stachybotrys chartarum found in water-damaged buildings.

    PubMed

    Andersen, Birgitte; Nielsen, Kristian F; Thrane, Ulf; Szaro, Tim; Taylor, John W; Jarvis, Bruce B

    2003-01-01

    Twenty-five Stachybotrys isolates from two previous studies have been examined and compared, using morphological, chemical and phylogenetic methods. The results show that S. chartarum sensu lato can be segregated into two chemotypes and one new species. The new species, S. chlorohalonata, differs morphologically from S. chartarum by having smooth conidia, being more restricted in growth and producing a green extracellular pigment on the medium CYA. S. chlorohalonata and S. chartarum also have different tri5, chs1 and tub1 gene fragment sequences. The two chemotypes of S. chartarum, chemotype S and chemotype A, have similar morphology but differ in production of metabolites. Chemotype S produces macrocyclic trichothecenes, satratoxins and roridins, while chemotype A produces atranones and dolabellanes. There is no difference between the two chemotypes in the tub1 gene fragment, but there is a one nucleotide difference in each of the tri5 and the chs1 gene fragments.

  17. ELISA MEASUREMENT OF STACHYLYSIN (TM) IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Antibodies were produced against the hemolytic agent stachylysin obtained from the mold Stachybotryis chartarum. These antibodies were used to develop two enzyme-linked immunosorbent assay (ELISA) methods for the analysis of stachylysin in human and rat sera and environmental sa...

  18. DESTRUCTION OF ASPERGILLUS VERSICOLOR, PENICILLIUM CRYSOGENUM, STACHYBOTRYS CHARTARUM, AND CLADOSPORIUM CLADOSPORIDES SPORES USING CHEMICAL OXIDATION TREATMENT PROCESS

    EPA Science Inventory

    The survival of aqueous suspensions of Penicillium chrysogenum, Stachybotrys chartarum, Aspergillus versicolor, and Cladosporium cladosporioides spores was evaluated using various combinations of hydrogen peroxide and iron (II) as catalyst. Spores were suspended in water and trea...

  19. ASSESSMENT OF STACHYBOTRYS REGROWTH ON CONTAMINATED WALLBOARD AFTER TREATMENT WITH COMMON SURFACE CLEANERS/DISINFECTANTS

    EPA Science Inventory

    The paper describes results of experiments assessing the efficacy of treating mold-contaminated gypsum wallboard with cleaners and/or disinfectants. Although the accepted recommendations for handling Stachybotrys chartarum contaminated gypsum wallboard are removal and replacement...

  20. Satratoxin G from the black mold Stachybotrys chartarum evokes olfactory sensory neuron loss and inflammation in the murine nose and brain.

    PubMed

    Islam, Zahidul; Harkema, Jack R; Pestka, James J

    2006-07-01

    Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the "black mold" suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose-response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 microg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 microg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 microg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-alpha, interleukin-6 (IL-6) , and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings.

  1. STACHYBOTRYS CHARTARU Trichothecene Mycotoxins and Damp Building-Related Illness: New Insights into a Public Health Enigma

    EPA Science Inventory

    Damp building-related illnesses (DBRI) include a myriad of respiratory, immunologic, and neurologic symptoms that are sometimes etiologically linked to aberrant indoor growth of the toxic black mold, Stachybotrys chartarum. Although supportive evidence for such linkages is limite...

  2. QUANTIFICATION OF SIDEROPHORE AND HEMOLYSIN FROM STACHYBOTRYS CHARTARUM STRAINS, INCLUDING A STRAIN ISOLATED FROM THE LUNG OF A CHILD WITH PULMONARY HEMORRHAGE AND HEMOSIDEROSIS

    EPA Science Inventory

    A strain of Stachybotrys chartarum was recently isolated from the lung of a pulmonary hemorrhage and hemosiderosis (PH) patient in Texas (designated the Houston strain). This is the first time that S. chartarum has been isolated from the lung of a PH patient. In this study, the ...

  3. RESPIRATORY PHYSIOLOGICAL AND ALLERGIC-TYPE RESPONSES TO AN EXTRACT OF STACHYBOTRYS CHARTARUM IN BALB/C MICE

    EPA Science Inventory

    RESPIRATORY PHYSIOLOGICAL AND ALLERGIC-TYPE RESPONSES TO AN EXTRACT OF Stachybotrys chartarum IN BALB/C MICE. ME Viana1, N Haykal-Coates2, S H Gavett2, MJ Selgrade2, and M D W Ward2. 1APR/CVM, NCSU, Raleigh, NC, USA. 2NHEERL, ORD, US EPA, RTP, NC, USA.
    Rationale: assess the ab...

  4. Evaluation of Stachybotrys chartarum in the house of an infant with pulmonary hemorrhage: quantitative assessment before, during, and after remediation.

    PubMed

    Vesper, S; Dearborn, D G; Yike, I; Allan, T; Sobolewski, J; Hinkley, S F; Jarvis, B B; Haugland, R A

    2000-03-01

    Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage cases in the Cleveland, Ohio, area. This study applied two new quantitative measurements to air samples from a home in which an infant developed PH. Quantitative polymerase chain reaction and a protein synthesis inhibition assay were used to determine the level of S. chartarum spores and their toxicity in air samples taken before, during, and after a remediation program was implemented to remove the fungus. Initial spore concentrations were between 0.1 and 9.3 spores/m3 of air, and the toxicity of air particulates was correspondingly low. However, the dust in the house contained between 0.4 and 2.1 x 10(3) spores/mg (as determined by hemocytometer counts). The remediation program removed all contaminated wallboard, paneling, and carpeting in the water-damaged areas of the home. In addition, a sodium hypochlorite solution was used to spray all surfaces during remediation. Although spore counts and toxicity were high during remediation, air samples taken postremediation showed no detectable levels of S. chartarum or related toxicity. Nine isolates of S. chartarum obtained from the home were analyzed for spore toxicity, hemolytic activity, and random amplified polymorphic DNA banding patterns. None of the isolates produced highly toxic spores (>90 microg T2 toxin equivalents per gram wet weight spores) after growth for 10 and 30 days on wet wallboard, but three isolates were hemolytic consistently. DNA banding patterns suggested that at least one of these isolates was related to isolates from homes of infants with previously investigated cases.

  5. QUANTITATIVE MEASUREMENT OF STACHYBOTRYS CHARTARUM CONIDIA USING REAL TIME DETECTION OF PCR PRODUCTS WITH THE TAQMAN TM FLUOROGENIC PROBE SYSTEM

    EPA Science Inventory

    The occurence of Stachybotrys chartarum in indoor environments has been associated with a number of human health concerns, including fatal pulmonary haemosiderosis in infants. Currently used culture-based and microscopic methods of fungal species identification are poorly suited ...

  6. Satratoxin-G from the black mold Stachybotrys chartarum induces rhinitis and apoptosis of olfactory sensory neurons in the nasal airways of rhesus monkeys.

    PubMed

    Carey, Stephan A; Plopper, Charles G; Hyde, Dallas M; Islam, Zahidul; Pestka, James J; Harkema, Jack R

    2012-08-01

    Satratoxin-G (SG) is a trichothecene mycotoxin of Stachybotrys chartarum, the black mold suggested to contribute etiologically to illnesses associated with water-damaged buildings. We have reported that intranasal exposure to SG evokes apoptosis of olfactory sensory neurons (OSNs) and acute inflammation in the nose and brain of laboratory mice. To further assess the potential human risk of nasal airway injury and neurotoxicity, we developed a model of SG exposure in monkeys, whose nasal airways more closely resemble those of humans. Adult, male rhesus macaques received a single intranasal instillation of 20 µg SG (high dose, n = 3), or 5 µg SG daily for four days (repeated low dose, n = 3) in one nasal passage, and saline vehicle in the contralateral nasal passage. Nasal tissues were examined using light and electron microscopy and morphometric analysis. SG induced acute rhinitis, atrophy of the olfactory epithelium (OE), and apoptosis of OSNs in both groups. High-dose and repeated low-dose SG elicited a 13% and 66% reduction in OSN volume density, and a 14-fold and 24-fold increase in apoptotic cells of the OE, respectively. This model provides new insight into the potential risk of nasal airway injury and neurotoxicity caused by exposure to water-damaged buildings.

  7. Quantification of Siderophore and Hemolysin from Stachybotrys chartarum Strains, Including a Strain Isolated from the Lung of a Child with Pulmonary Hemorrhage and Hemosiderosis

    PubMed Central

    Vesper, Stephen J.; Dearborn, Dorr G.; Elidemir, Okan; Haugland, Richard A.

    2000-01-01

    A strain of Stachybotrys chartarum was recently isolated from the lung of a pulmonary hemorrhage and hemosiderosis (PH) patient in Texas (designated the Houston strain). This is the first time that S. chartarum has been isolated from the lung of a PH patient. In this study, the Houston strain and 10 strains of S. chartarum isolated from case (n = 5) or control (n = 5) homes in Cleveland were analyzed for hemolytic activity, siderophore production, and relatedness as measured by random amplified polymorphic DNA analysis. PMID:10831457

  8. Effect of Plasterboard Composition on Stachybotrys chartarum Growth and Biological Activity of Spores

    PubMed Central

    Murtoniemi, Timo; Nevalainen, Aino; Hirvonen, Maija-Riitta

    2003-01-01

    The effects of plasterboard composition on the growth and sporulation of Stachybotrys chartarum as well as on the inflammatory potential of the spores were studied. S. chartarum was grown on 13 modified plasterboards under saturated humidity conditions. The biomass was estimated by measuring the ergosterol content of the S. chartarum culture while the spore-induced cytotoxicity and production of nitric oxide (NO), tumor necrosis factor alpha (TNF-α), and interleukin-6 in mouse macrophages was used to illustrate the bioactivity of spores. The ergosterol content of S. chartarum correlated with the number of spores collected from plasterboards. The growth and sporulation decreased compared to that of the reference board in those cases where (i) the liner was treated with biocide, (ii) starch was removed from the plasterboard, or (iii) desulfurization gypsum was used in the core. Spores collected from all the plasterboards were toxic to the macrophages. The biocide added to the core did not reduce the growth; in fact, the spores collected from that board evoked the highest cytotoxicity. The conventional additives used in the core had inhibitory effects on growth. Recycled plasterboards used in the core and the board lacking the starch triggered spore-induced TNF-α production in macrophages. In summary, this study shows that the growth of a strain of S. chartarum on plasterboard and the subsequent bioactivity of spores were affected by minor changes to the composition of the core or liners, but it could not be totally prevented without resorting to the use of biocides. However, incomplete prevention of microbial growth by biocides even increased the cytotoxic potential of the spores. PMID:12839740

  9. The role of fungal proteinases in pathophysiology of Stachybotrys chartarum.

    PubMed

    Yike, Iwona; Rand, Thomas; Dearborn, Dorr G

    2007-10-01

    The adverse health effects of Stachybotrys chartarum have often been linked to exposure to the trichothecene mycotoxins. Recent studies have shown that in addition to mycotoxins this fungus is capable of producing and secreting in vivo proteins such as hemolysins and proteinases. Spore extracts obtained from a high trichothecene producing isolate JS 58-17 exhibited a significantly lower proteolytic activity compared to the low trichothecene producer, JS 58-06. Growing isolates on rice or potato dextrose agar results in higher proteolytic activity of the spores compared to those grown on drywall. Proteinases in the spore extracts can hydrolyze gelatin and collagen I and IV. Analysis of zymograms shows the presence of several proteins with proteolytic activity in the spores of S. chartarum. Human tracheal epithelial cells exposed to spore extracts produced significantly higher levels of IL-6, IL-8, and TNF-alpha than control cells. This stimulation of cytokine production was completely abolished by Pefabloc, a serine protease inhibitor. Neutrophil numbers and proinflammatory cytokine (IL1-beta and TNF-alpha) concentrations were highly elevated in the lungs of 7 day old rat pups exposed intratracheally to 4 x 10(4) spores/gm body weight compared to control. No significant differences in those inflammatory indices in vivo were noted between the treatments with the high trichothecene producer, isolate JS 58-17 and JS 58-06, which does not produce macrocyclic trichothecenes. Immunohistochemistry revealed reduced collagen IV labeling in spore-induced lung granulomas in rat pups exposed to both isolates. These results suggest that proteinases from S. chartarum spores significantly contribute to lung inflammation and injury.

  10. EMISSION EXPOSURE MODEL FOR TRANSPORT OF TOXIC MOLD

    EPA Science Inventory

    The paper presents the results of a study of the release of Stachybotrys chartarum spores from contaminated gypsum wallboard and of tests on the effects of environmental conditions on the release of viable and non-viable spores and fragments. Biocontaminants such as mold spores a...

  11. Biological Responses of Raw 264.7 Macrophage Exposed to Two Strains of Stachybotrys chartarum Spores Grown on Four Different Wallboard Types

    EPA Science Inventory

    The focus of this research was to provide a better understanding of the health impacts caused by Stachybotrys chartarum (Houston and 51-11) spores grown on four gypsum products two of which were resistant to microbes. Raw 264.7 cells were exposed to whole spores and fragmented 51...

  12. Volatile metabolites produced by three strains of Stachybotrys chartarum cultivated on rice and gypsum board.

    PubMed

    Gao, Pengfei; Martin, Jennifer

    2002-06-01

    Stachybotrys chartarum (atra) is a toxigenic fungus frequently found in water-damaged buildings. Although microbial volatile organic compounds (MVOCs) produced by Aspergillus, Penicillium, and other fungi have been investigated extensively, little information exists on what MVOCs can be produced by S. chartarum. In this study, three strains of S. chartarum isolated from water-damaged residential homes in Cleveland, Ohio, were cultivated on rice and gypsum board. Air samples were collected after one, two, three, four, and six weeks of cultivation using Tenax TA tubes. Unique MVOCs were determined and other alcohols, ketones, and terpenes were also investigated using gas chromatography/mass spectrometry after thermal desorption from the sampling tube. Four unique MVOCs, 1-butanol, 3-methyl-1-butanol, 3-methyl-2-butanol, and thujopsene, were detected on rice cultures, and only one of them (1-butanol) was detected on gypsum board cultures. For a given strain, volatiles were considerably different with different cultivation media. Concentration profiles of the volatile compounds varied among compounds; however, each compound exhibited corresponding concentration trends between the strains. In comparison with our previous studies of five Aspergillus species on gypsum board under the same experimental conditions, fewer unique MVOCs were produced by S. chartarum, and they were quite different. It thus may be possible to use marker-unique MVOCs as a fingerprint to distinguish fungi in indoor environments once enough information becomes available. Our findings also indicate that volatiles produced by S. chartarum may represent a relatively small fraction of the total volatiles present in problem buildings where Aspergillus spp., Penicillium spp., and other fungi usually coexist.

  13. Analysis of pulmonary surfactant by Fourier-transform infrared spectroscopy following exposure to Stachybotrys chartarum (atra) spores.

    PubMed

    McCrae, K C; Rand, T; Shaw, R A; Mason, C; Oulton, M R; Hastings, C; Cherlet, T; Thliveris, J A; Mantsch, H H; MacDonald, J; Scott, J E

    2001-03-01

    Lung cells are among the first tissues of the body to be exposed to air-borne environmental contaminants. Consequently the function of these cells may be altered before other cells are affected. As gas exchange takes place in the lungs, changes in cellular function may have serious implications for the processes of oxygen uptake and carbon dioxide elimination. In order for these processes to occur, the lung must maintain a high degree of expandability. This latter function is accomplished in part by the pulmonary surfactant which is synthesized and released by alveolar type II cells. Earlier studies have shown that exposure to gas phase materials such as smoke or organic solvents can alter the composition and function of the surfactant. The present study examines the ability of highly toxigenic mold spores to alter surfactant composition. Stachybotrys chartarum spores suspended in saline were instilled into mouse trachea as described earlier. After 24 h, the lungs were lavaged and the different processing stages of surfactant isolated by repeated centrifugation. Intracellular surfactant was isolated from the homogenized lung tissue by centrifugation on a discontinuous sucrose gradient. Samples were extracted into chloroform-methanol, dried and analyzed by Fourier-Transform infrared spectroscopy (FTIR). Exposure to S. chartarum induced an overall reduction of phospholipid among the three surfactant subfractions. The intermediate and spent surfactant fractions in particular were reduced to about half of the values observed in the saline-treated group. The relative distribution of phospholipid was also altered by spore exposure. Within the intracellular surfactant pool, higher levels of phospholipid were detected after spore exposure. In addition, changes were observed in the nature of the phospholipids. In particular strong intramolecular hydrogen bonding, together with other changes, suggested that spore exposure was associated with absence of an acyl chain

  14. Laboratory research on the efficacy of chlorine dioxide fumigation for the remediation of mold-contaminated buildings--conference paper

    EPA Science Inventory

    The purpose of this project was to determine the efficacy ofCl02 fumigation to inactivate viable mold, mycotoxins, and allergens on building materials. Alternaria alternata, Aspergillus versicolor, Aspergillus Jumigatus, Chaetomium globosum, and Stachybotrys chartarum were indivi...

  15. Characterization of Stachybotrys from water-damaged buildings based on morphology, growth, and metabolite production.

    PubMed

    Andersen, Birgitte; Nielsen, Kristian F; Jarvis, Bruce B

    2002-01-01

    Stachybotrys was found to be associated with idiopathic pulmonary hemorrhage in infants in Cleveland, Ohio. Since that time, considerable effort has been put into finding the toxic components responsible for the disease. The name Stachybotrys chartarum has been applied to most of these isolates, but inconsistent toxicity results and taxonomic confusion prompted the present study. In this study, 122 Stachybotrys isolates, mainly from water-damaged buildings, were characterized and identified by combining three different approaches: morphology, colony characteristics, and metabolite production. Two different Stachybotrys taxa, S. chartarum and one undescribed species, were found in water-damaged buildings regardless of whether the buildings were in Denmark, Finland, or the USA. Furthermore, two chemotypes could be distinguished in S. chartarum. One chemotype produced atranones, whereas the other was a macrocyclic trichothecene-producer. The second undescribed taxon produced atranones and could be differentiated from S. chartarum by its growth characteristics and pigment production. Our results correlate with different inflammatory and toxicological properties reported for these same isolates and show that the three taxa/chemotypes should be treated separately. The co-occurrence of these three taxa/chemotypes in water-damaged buildings explains the inconsistent results in the literature concerning toxicity of Stachybotrys isolated from that environment.

  16. Hemolysis, Toxicity, and Randomly Amplified Polymorphic DNA Analysis of Stachybotrys chartarum Strains

    PubMed Central

    Vesper, Stephen J.; Dearborn, Dorr G.; Yike, Iwona; Sorenson, W. G.; Haugland, Richard A.

    1999-01-01

    Stachybotrys chartarum is an indoor air, toxigenic fungus that has been associated with a number of human and veterinary health problems. Most notable among these has been a cluster of idiopathic pulmonary hemorrhage cases that were observed in the Cleveland, Ohio, area. In this study, 16 strains of S. chartarum isolated from case (n = 8) or control (n = 8) homes in Cleveland and 12 non-Cleveland strains from diverse geographic locations were analyzed for hemolytic activity, conidial toxicity, and randomly amplified polymorphic DNA banding patterns. In tests for hemolytic activity, strains were grown at 23°C on wet wallboard pieces for an 8-week test period. Conidia from these wallboard pieces were subcultured on sheep’s blood agar once a week over this period and examined for growth and clearing of the medium at 37 or 23°C. Five of the Cleveland strains (all from case homes) showed hemolytic activity at 37°C throughout the 8-week test compared to 3 of the non-Cleveland strains. Five of the Cleveland strains, compared to two of the non-Cleveland strains, produced highly toxic conidia (>90 μg of T2 toxin equivalents per g [wet weight] of conidia) after 10 and 30 days of growth on wet wallboard. Only 3 of the 28 strains examined both were consistently hemolytic and produced highly toxic conidia. Each of these strains was isolated from a house in Cleveland where an infant had idiopathic pulmonary hemorrhage. PMID:10388719

  17. Hemolysis, toxicity, and randomly amplified polymorphic DNA analysis of Stachybotrys chartarum strains.

    PubMed

    Vesper, S J; Dearborn, D G; Yike, I; Sorenson, W G; Haugland, R A

    1999-07-01

    Stachybotrys chartarum is an indoor air, toxigenic fungus that has been associated with a number of human and veterinary health problems. Most notable among these has been a cluster of idiopathic pulmonary hemorrhage cases that were observed in the Cleveland, Ohio, area. In this study, 16 strains of S. chartarum isolated from case (n = 8) or control (n = 8) homes in Cleveland and 12 non-Cleveland strains from diverse geographic locations were analyzed for hemolytic activity, conidial toxicity, and randomly amplified polymorphic DNA banding patterns. In tests for hemolytic activity, strains were grown at 23 degrees C on wet wallboard pieces for an 8-week test period. Conidia from these wallboard pieces were subcultured on sheep's blood agar once a week over this period and examined for growth and clearing of the medium at 37 or 23 degrees C. Five of the Cleveland strains (all from case homes) showed hemolytic activity at 37 degrees C throughout the 8-week test compared to 3 of the non-Cleveland strains. Five of the Cleveland strains, compared to two of the non-Cleveland strains, produced highly toxic conidia (>90 microgram of T2 toxin equivalents per g [wet weight] of conidia) after 10 and 30 days of growth on wet wallboard. Only 3 of the 28 strains examined both were consistently hemolytic and produced highly toxic conidia. Each of these strains was isolated from a house in Cleveland where an infant had idiopathic pulmonary hemorrhage.

  18. Satratoxin G from the Black Mold Stachybotrys chartarum Evokes Olfactory Sensory Neuron Loss and Inflammation in the Murine Nose and Brain

    PubMed Central

    Islam, Zahidul; Harkema, Jack R.; Pestka, James J.

    2006-01-01

    Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the “black mold” suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose–response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 μg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 μg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 μg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-α, interleukin-6 (IL-6), and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings. PMID:16835065

  19. Health and immunology study following exposure to toxigenic fungi (Stachybotrys chartarum) in a water-damaged office environment.

    PubMed

    Johanning, E; Biagini, R; Hull, D; Morey, P; Jarvis, B; Landsbergis, P

    1996-01-01

    There is growing concern about adverse health effects of fungal bio-aerosols on occupants of water-damaged buildings. Accidental, occupational exposure in a nonagricultural setting has not been investigated using modern immunological laboratory tests. The objective of this study was to evaluate the health status of office workers after exposure to fungal bio-aerosols, especially Stachybotrys chartarum (atra) (S. chartarum) and its toxigenic metabolites (satratoxins), and to study laboratory parameters or biomarkers related to allergic or toxic human health effects. Exposure characterization and quantification were performed using microscopic, culture, and chemical techniques. The study population (n = 53) consisted of 39 female and 14 male employees (mean age 34.8 years) who had worked for a mean of 3.1 years at a problem office site; a control group comprised 21 persons (mean age 37.5 years) without contact with the problem office site. Health complaints were surveyed with a 187-item standardized questionnaire. A comprehensive test battery was used to study the red and white blood cell system, serum chemistry, immunology/antibodies, lymphocyte enumeration and function. Widespread fungal contamination of water-damaged, primarily cellulose material with S. chartarum was found. S. chartarum produced a macrocyclic trichothecene, satratoxin H, and spirocyclic lactones. Strong associations with exposure indicators and significant differences between employees (n = 53) and controls (n = 21) were found for lower respiratory system symptoms, dermatological symptoms, eye symptoms, constitutional symptoms, chronic fatigue symptoms and several enumeration and function laboratory tests, mainly of the white blood cell system. The proportion of mature T-lymphocyte cells (CD3%) was lower in employees than in controls, and regression analyses showed significantly lower CD3% among those reporting a history of upper respiratory infections. Specific S. chartarum antibody tests (Ig

  20. Production and characterization of IgM monoclonal antibodies against hyphal antigens of Stachybotrys species

    EPA Science Inventory

    Stachybotrys is a hydrophilic fungal genus that is well known for its ability to colonize water-damaged building materials in indoor environments. Personal exposure to Stachybotrys chartarum allergens, mycotoxins, cytolytic peptides, and other immunostimulatory macromolecules has...

  1. Differentiation of Toxic Molds via Headspace SPME-GC/MS and Canine Detection

    PubMed Central

    Griffith, Robert T.; Jayachandran, Krishnaswamy; Shetty, Kateel G.; Whitstine, William; Furton, Kenneth G.

    2007-01-01

    Indoor mold growth has recently become a concern in the legal world in regards to insurance litigation. Hazardous mold exposure to humans has been linked to many acute and chronic adverse health effects including death. As it grows, mold produces several types of primary and secondary metabolites, including microbial volatile organic compounds (MVOCs). Microbial volatile organic compound emission may be used as a preliminary indication of a mold infestation that is invisible to the unaided eye. The objective of the study is to identify the unique odor signatures of three species of molds, Aspergillus versicolor, Penicillium chrysogenum, and Stachybotrys chartarum by SPME-GC/MS analysis. Determining the compounds that are emitted by the selected species has made it possible to conduct validation studies of canine detection of these mold species through a series of field tests.

  2. Mold growth on gypsum wallboard--a summary of three techniques.

    PubMed

    Menetrez, M Y; Foarde, K K; Webber, T D; Dean, T R; Betancourt, D A

    2009-01-01

    Reducing occupant exposure to mold growing on damp gypsum wallboard and controlling mold contamination in the indoor environment was studied through 1) delineation of environmental conditions required to promote and avoid mold growth and 2) efficacy testing of antimicrobial products, specifically cleaners and paints, on gypsum wallboard (GWB) surfaces. The effects of moisture and relative humidity (RH) on mold growth and transport are important in avoiding and eliminating problems. These effects have been demonstrated on GWB and are discussed in this article for use as control guidance. The authors discuss the efficacy of antimicrobial cleaners and paints to remove, eliminate, or control mold growth on GWB. Research to control Stachybotrys chartarum growth using 13 separate antimicrobial cleaners and nine varieties of antimicrobial paint on contaminated GWB was performed in laboratory testing. GWB surfaces were subjected to high RH. GWB control measures are summarized and combined, and the antimicrobial product results are explained.

  3. Stachybotrys: relevance to human disease.

    PubMed

    Terr, A I

    2001-12-01

    Recent public concern about the danger of environmental fungi has focused attention on one particular mold, Stachybotrys. The purpose of this review is to examine and critique the published literature on Stachybotrys for objective scientific and clinical evidence of disease caused by the presence of this fungal organism in the environment. Data were obtained from all published research and reviews of Stachybotrys indexed in MEDLINE since 1966. The publications used for this review were those that contained information about human health effects of this microorganism. The critique of these publications is the author's. Stachybotrys is a minor component of the indoor mycoflora, found on certain building material surfaces in water-damaged buildings, but airborne spores are present in very low concentrations. Published reports fail to establish inhalation of Stachybotrys spores as a cause of human disease even in water-damaged buildings. A possible exception may be mycotoxin-caused pulmonary hemorrhage/hemosiderosis in infants, although scientific evidence to date is suggestive but not conclusive. Based on old reports ingestion of food prepared from Stachybotrys-contaminated grains may cause a toxic gastroenteropathy. No convincing cases of human allergic disease or infection from this mold have been published. The current public concern for adverse health effects from inhalation of Stachybotrys spores in water-damaged buildings is not supported by published reports in the medical literature.

  4. FACTORS RELATING TO THE RELEASE OF STACHYBOTRYS CHARTARUM SPORES FROM CONTAMINATED SOURCES

    EPA Science Inventory

    The paper describes preliminary results of a research project to determine the factors that control the release of S. chartarum spores from a contaminated source and test ways to reduce spore release and thus exposure. As anticipated, S. chartarum spore emissions from gypsum boar...

  5. Solvent comparison in the isolation, solubilization, and toxicity of Stachybotrys chartarum spore trichothecene mycotoxins in an established in vitro luminescence protein translation inhibition assay.

    PubMed

    Black, J A; Foarde, K K; Menetrez, M Y

    2006-08-01

    It is well known that non-viable mold contaminants such as macrocyclic trichothecene mycotoxins of Stachybotrys chartarum are highly toxinigenic to humans. However, the method of recovering native mycotoxin has been without consensus. Inconsistencies occur in the methods of isolation, suspension, preparation, and quantitation of the mycotoxin from the spores. The purpose of this study was to provide quantitatively comparative data on three concurrent preparations of 10(6)S. chartarum spores. The experiments were designed to specifically evaluate a novel method of mycotoxin extraction, solubilization, and the subsequent inhibitory effect in an established in vitro luminescence protein translation assay from 30 day-old spores. The mycotoxin-containing spores swabbed from wallboard cultures were milled with and without glass beads in 100% methanol, 95% ethanol, or water. Milled spore lysates were cleared of cell debris by filter centrifugation followed by a second centrifugation through a 5000 MWCO filter to remove interfering proteins and RNases. Cleared lysate was concentrated by centrivap and suspended in either alcohol or water as described. The suspensions were used immediately in the in vitro luminescence protein translation assay with the trichothecene, T-2 toxin, as a control. Although, mycotoxin is reported to be alcohol soluble, the level of translation inhibition was not reliably satisfactory for either the methanol or ethanol preparations. In fact, the methanol and ethanol control reactions were not significantly different than the alcohol prepared spore samples. In addition, we observed that increasing amounts of either alcohol inhibited the reaction in a dose dependent manner. This suggests that although alcohol isolation of mycotoxin is desirable in terms of time and labor, the presence of alcohol in the luminescence protein translation reaction was not acceptable. Conversely, water extraction of mycotoxin demonstrated a dose dependent response, and

  6. Epidemics of mold poisoning past and present.

    PubMed

    Meggs, William J

    2009-01-01

    Molds are ubiquitous throughout the biosphere of planet earth and cause infectious, allergic, and toxic diseases. Toxic diseases arise from exposure to mycotoxins produced by molds. Throughout history, there have been a number of toxic epidemics associated with exposure to mycotoxins. Acute epidemics of ergotism are caused by consumption of grain infested by fungi of the genus Claviceps, which produce the bioactive amine ergotamine that mimics the neurotransmitters norepinephrine, serotonin, and dopamine. Acute aflatoxin outbreaks have occurred from ingestion of corn stored in damp conditions that potentiate growth of the molds of the species Aspergillus. Contemporary construction methods that use cellulose substrates such as fiber board and indoor moisture have caused an outbreak of contaminated buildings with Stachybotrys chartarum, with the extent of health effects still a subject of debate and ongoing research. This article reviews several of the more prominent epidemics and discusses the nature of the toxins. Two diseases that were leading causes of childhood mortality in England in the 1970s and vanished with changing dietary habits, putrid malignant fever, and slow nervous fever were most likely toxic mold epidemics.

  7. Quantifying Mold Biomass on Gypsum Board: Comparison of Ergosterol and Beta-N-Acetylhexosaminidase as Mold Biomass Parameters

    PubMed Central

    Reeslev, M.; Miller, M.; Nielsen, K. F.

    2003-01-01

    Two mold species, Stachybotrys chartarum and Aspergillus versicolor, were inoculated onto agar overlaid with cellophane, allowing determination of a direct measurement of biomass density by weighing. Biomass density, ergosterol content, and beta-N-acetylhexosaminidase (3.2.1.52) activity were monitored from inoculation to stationary phase. Regression analysis showed a good linear correlation to biomass density for both ergosterol content and beta-N-acetylhexosaminidase activity. The same two mold species were inoculated onto wallpapered gypsum board, from which a direct biomass measurement was not possible. Growth was measured as an increase in ergosterol content and beta-N-acetylhexosaminidase activity. A good linear correlation was seen between ergosterol content and beta-N-acetylhexosaminidase activity. From the experiments performed on agar medium, conversion factors (CFs) for estimating biomass density from ergosterol content and beta-N-acetylhexosaminidase activity were determined. The CFs were used to estimate the biomass density of the molds grown on gypsum board. The biomass densities estimated from ergosterol content and beta-N-acetylhexosaminidase activity data gave similar results, showing significantly slower growth and lower stationary-phase biomass density on gypsum board than on agar. PMID:12839773

  8. Stachybotrys: An unusual mold associated with water-damaged buildings.

    PubMed

    Jarvis, B; Hinkley, S; Nielsen, K

    2000-03-01

    Chemical analyses of extracts of cultures ofS. chartarum show that this fungus has two chemotypes: producers of the potent cytotoxic macrocyclic trichothecenes (e. g. satratoxins) and those that produce the diterpenoid atranones and the simple trichothecenes, trichodermol and trichodermin. All isolates ofS. chartarum produce the immunosuppressant spirocyclic drimanes.

  9. IMMUNOCYTOCHEMICAL LOCALIZATION OF STACHYLYSIN IN STACHYBOTRYS CHARTARUM SPORES AND SPORE-IMPACTED MOUSE AND RAT LUNG TISSUES

    EPA Science Inventory

    Stachylysin is a proteinaceous hemolytic agent that is producted by S. chartarum. Stachylysin was found, using immunohistochemistical and immunocytochemical methods, to be localized in S. chartarum spores/mycelia primarily in the inner wall suggesting that it is constitutively ...

  10. ELISA MEASUREMENT FOR STACHYLYSIN

    EPA Science Inventory

    The consumption of food commodities contaminated with the mold, Stachybotrys charatrum, has a long history of causing severe illness, and even death, in humans and animals. More recently, negative health effects have been linked to indoor inhalation exposures to S. chartarum. F...

  11. Chemistry and toxicology of molds isolated from water-damaged buildings.

    PubMed

    Jarvis, Bruce B

    2002-01-01

    There is increasing evidence of health risks associated with damp buildings and homes in which high levels of microbes are found. Although concerns have traditionally centered on microbial pathogens and allergenic effects, recent work has suggested that fungi pose the more serious risk. Evidence is accumulating that certain toxigenic molds are particularly a risk for human health through exposure, via inhalation, of fungal spores. Many of these fungi produce toxins (mycotoxins) some of which have been shown to cause animal and human intoxications, usually in an agricultural setting. The fungus, Stachybotrys chartarum (S. atra) is considered to be one of the more serious threats to people living and working in water-damaged buildings. This mold has a long history of being responsible for animal toxicoses, and in recent years, being associated with infant pulmonary hemosiderosis (bleeding in the lungs) of infants exposed to spores of this fungus in their homes. S. atra produces a variety of potent toxins and immunosuppressant agents, including a novel class of diterpenes (atranones) of unusual structure. More research is needed to determine the impact to health resulting from inhalation of toxigenic mold spores.

  12. Visualization of the structural changes in plywood and gypsum board during the growth of Chaetomium globosum and Stachybotrys chartarum.

    PubMed

    Lewinska, Anna M; Hoof, Jakob B; Peuhkuri, Ruut H; Rode, Carsten; Lilje, Osu; Foley, Matthew; Trimby, Patrick; Andersen, Birgitte

    2016-10-01

    Fungal growth in indoor environments is associated with many negative health effects. Many studies focus on brown- and white-rot fungi and their effect on wood, but there is none that reveals the influence of soft-rot fungi, such as Stachybotrys spp. and Chaetomium spp., on the structure of building materials such as plywood and gypsum wallboard. This study focuses on using micro-computed tomography (microCT) to investigate changes of the structure of plywood and gypsum wallboard during fungal degradation by S. chartarum and C. globosum. Changes in the materials as a result of dampness and fungal growth were determined by measuring porosity and pore shape via microCT. The results show that the composition of the building material influenced the level of penetration by fungi as shown by scanning electron microscopy (SEM). Plywood appeared to be the most affected, with the penetration of moisture and fungi throughout the whole thickness of the sample. Conversely, fungi grew only on the top cardboard in the gypsum wallboard and they did not have significant influence on the gypsum wallboard structure. The majority of the observed changes in gypsum wallboard occurred due to moisture. This paper suggests that the mycelium distribution within building materials and the structural changes, caused by dampness and fungal growth, depend on the type of the material. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Stachybotrys, a mycotoxin-producing fungus of increasing toxicologic importance.

    PubMed

    Fung, F; Clark, R; Williams, S

    1998-01-01

    Stachybotrys as a fungus has been implicated as a source of mycotoxins. While the toxicity of several well-known mycotoxins (aflatoxins) is well documented, recent studies on Stachybotrys have raised the question that mycotoxins produced by this fungus may be responsible for the health effects of occupants in water-damaged buildings. Published articles regarding Stachybotrys-related mycotoxins were reviewed with particular focus on human toxicity. A critical review of papers, reports, and studies on Stachybotrys mycotoxins revealed only descriptive reports of suspected animal and human poisoning secondary to consumption of mold-contaminated food products. No studies of good toxicologic and epidemiologic designs answer whether airborne mycotoxins produced by Stachybotrys could produce specific human toxicity. Current data on the toxicology of mycotoxins produced by Stachybotrys demonstrate that this group of mycotoxins is capable of producing immunosuppression and inflammatory insults to gastrointestinal and pulmonary systems. Case control study and case reports have suggested a possible association with environmental exposure to Stachybotrys mycotoxins, although a firm causal relationship has not been firmly established. Additional studies are needed to document that humans with sufficient exposure to these mycotoxins develop compatible clinical and pathologic pictures as demonstrated in animal models.

  14. Facts about Stachybotrys chartarum and Other Molds

    MedlinePlus

    ... buildings and homes? As part of routine building maintenance, buildings should be inspected for evidence of water ... Privacy FOIA No Fear Act OIG 1600 Clifton Road Atlanta , GA 30329-4027 USA 800-CDC-INFO ( ...

  15. Environmental Mold and Mycotoxin Exposures Elicit Specific Cytokine and Chemokine Responses

    PubMed Central

    Rosenblum Lichtenstein, Jamie H.; Hsu, Yi-Hsiang; Gavin, Igor M.; Donaghey, Thomas C.; Molina, Ramon M.; Thompson, Khristy J.; Chi, Chih-Lin; Gillis, Bruce S.; Brain, Joseph D.

    2015-01-01

    Background Molds can cause respiratory symptoms and asthma. We sought to use isolated peripheral blood mononuclear cells (PBMCs) to understand changes in cytokine and chemokine levels in response to mold and mycotoxin exposures and to link these levels with respiratory symptoms in humans. We did this by utilizing an ex vivo assay approach to differentiate mold-exposed patients and unexposed controls. While circulating plasma chemokine and cytokine levels from these two groups might be similar, we hypothesized that by challenging their isolated white blood cells with mold or mold extracts, we would see a differential chemokine and cytokine release. Methods and Findings Peripheral blood mononuclear cells (PBMCs) were isolated from blood from 33 patients with a history of mold exposures and from 17 controls. Cultured PBMCs were incubated with the most prominent Stachybotrys chartarum mycotoxin, satratoxin G, or with aqueous mold extract, ionomycin, or media, each with or without PMA. Additional PBMCs were exposed to spores of Aspergillus niger, Cladosporium herbarum and Penicillium chrysogenum. After 18 hours, cytokines and chemokines released into the culture medium were measured by multiplex assay. Clinical histories, physical examinations and pulmonary function tests were also conducted. After ex vivo PBMC exposures to molds or mycotoxins, the chemokine and cytokine profiles from patients with a history of mold exposure were significantly different from those of unexposed controls. In contrast, biomarker profiles from cells exposed to media alone showed no difference between the patients and controls. Conclusions These findings demonstrate that chronic mold exposures induced changes in inflammatory and immune system responses to specific mold and mycotoxin challenges. These responses can differentiate mold-exposed patients from unexposed controls. This strategy may be a powerful approach to document immune system responsiveness to molds and other inflammation

  16. Antibodies to molds and satratoxin in individuals exposed in water-damaged buildings.

    PubMed

    Vojdani, Aristo; Thrasher, Jack D; Madison, Roberta A; Gray, Michael R; Heuser, Gunnar; Campbell, Andrew W

    2003-07-01

    Immunoglobulin (Ig)A, IgM, and IgG antibodies against Penicillium notatum, Aspergillus niger, Stachybotrys chartarum, and satratoxin H were determined in the blood of 500 healthy blood donor controls, 500 random patients, and 500 patients with known exposure to molds. The patients were referred to the immunological testing laboratory for health reasons other than mold exposure, or for measurement of mold antibody levels. Levels of IgA, IgM, and IgG antibodies against molds were significantly greater in the patients (p < 0.001 for all measurements) than in the controls. However, in mold-exposed patients, levels of these antibodies against satratoxin differed significantly for IgG only (p < 0.001), but not for IgM or IgA. These differences in the levels of mold antibodies among the 3 groups were confirmed by calculation of z score and by Scheffé's significant difference tests. A general linear model was applied in the majority of cases, and 3 different subsets were formed, meaning that the healthy control groups were different from the random patients and from the mold-exposed patients. These findings indicated that mold exposure was more common in patients who were referred for immunological evaluation than it was in healthy blood donors. The detection of antibodies to molds and satratoxin H likely resulted from antigenic stimulation of the immune system and the reaction of serum with specially prepared mold antigens. These antigens, which had high protein content, were developed in this laboratory and used in the enzyme-linked immunosorbent assay (ELISA) procedure. The authors concluded that the antibodies studied are specific to mold antigens and mycotoxins, and therefore could be useful in epidemiological and other studies of humans exposed to molds and mycotoxins.

  17. Microbial Volatile Organic Compound Emissions from Stachybotrys chartarum growing on Gypsum Wallboard and Ceiling tile

    EPA Science Inventory

    This study compared seven toxigenic strains of S. chartarum found in water-damaged buildings to characterize the microbial volatile organic compound (MVOC) emissions profile while growing on gypsum wallboard (W) and ceiling tile (C) coupons. The inoculated coupons with their sub...

  18. Biological responses of Raw 264.7 macrophage exposed to two strains of Stachybotrys chartarum spores grown on four different wallboard types.

    PubMed

    Kim, J H; Harvey, L A; Evans, A L; Byfield, G E; Betancourt, D A; Dean, T R

    2016-06-01

    The many benefits of building "green" have motivated the use of sustainable products in the design and execution of the built environment. However, the use of these natural or recycled materials, some of which have been treated with antimicrobials, provides a growth opportunity for microorganisms with the potential to elicit adverse health effects especially in the presence of an antimicrobial. The focus of this research was to determine the effects of Stachybotrys chartarum (strains Houston and 51-11) grown under different conditions on a macrophage cell line (Raw 264.7) using endpoints, including cytotoxicity, and those associated with immunity specifically inflammation and MHC class II expression. The fungi were grown on four different gypsum products, and macrophages were exposed to whole spores of both strains and fragmented spores of strain 51-11. Whole spores of the Houston strain elicited no cytotoxicity with some level of inflammation, while exposure to whole spores of 51-11 caused variable responses depending on the wallboard type supporting the fungal growth. High concentrations of fragmented 51-11 spores primarily resulted in the apoptosis of macrophage with no inflammation. None of the fungal strains caused elevated levels of major histocompatibility complex (MHC) class II expression on the surface of Raw cells. Mycotoxin levels of 51-11 spores from all of the wallboard types measured  >250 ng/μL of T2 equivalent toxin based on activity. Collectively, the data demonstrated that all of the wallboard types supported growth of fungi with the ability to elicit harmful biological responses with the potential to negatively impact human health.

  19. Potential of the volatile-producing fungus Muscodor albus for control of building molds.

    PubMed

    Mercier, Julien; Jiménez, Jorge I

    2007-03-01

    The possibility of using the volatile-producing fungus Muscodor albus for biofumigation against building molds was investigated. Several species of Aspergillus and Penicillium as well as fungi belonging to nine other genera were inhibited or killed in vitro by volatiles produced by potato dextrose agar or rye grain cultures of M. albus. Trichoderma viride was the only fungus that was not inhibited by M. albus volatiles. To test biofumigation as a preventative treatment against fungal colonization of building material, dry pieces of gypsum drywall were fumigated with grain cultures of M. albus in closed boxes. After a simulated water damage and incubation under saturated humidity for 2 weeks, untreated drywall developed natural fungal populations of about 10(5)-10(6) cfu/cm2, while drywall fumigated with M. albus culture (20 g/11 L) had nondetectable fungal populations. To test for curative ability, moist pieces of drywall heavily colonized with Cladosporium cladosporioides, Aspergillus niger, or Stachybotrys chartarum were fumigated for 48 h with grain cultures of M. albus. Cladosporium cladosporioides was eliminated within 48 h, while A. niger and S. chartarum were usually more resistant. However, a longer curative fumigation of 96 h was effective in reducing A. niger or naturally occurring mold populations by about 5 log values. The production of volatile organic compounds from 20 g of rye grain culture in 11 L containers was monitored by solid-phase micro extraction and gas chromatography. Concentrations of isobutyric acid, the most abundant volatile, increased gradually in the headspace until it reached 25 microg/L (m/v) within 96 h. The second and third most abundant compounds, 2-methyl-1-butanol and isobutanol, peaked at about 10 and 5 microg/L (m/v), respectively, within the first 24 h and declined gradually afterwards.

  20. TESTING ANTIMICROBIAL CLEANER EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Reducing occupant exposure to indoor mold growth is the goal of this research, through the efficacy testing of antimicrobial cleaners. Often mold contaminated building materials are not properly removed, but instead surface cleaners are applied in an attempt to alleviate the prob...

  1. TESTING ANTIMICROBIAL PAINT EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Often mold contaminated building materials are not properly removed, some surface cleaning is performed and paint is applied in an attempt to alleviate the problem. The efficacy of antimicrobial paints to eliminate or control mold regrowth on surfaces can easily be tested on non-...

  2. Pre-contamination of new gypsum wallboard with potentially harmful fungal species.

    PubMed

    Andersen, B; Dosen, I; Lewinska, A M; Nielsen, K F

    2017-01-01

    Gypsum wallboard is a popular building material, but is also very frequently overgrown by Stachybotrys chartarum after severe and/or undetected water damage. The purpose of this study was to determine whether Stachybotrys and other fungi frequently isolated from wet gypsum wallboard are already present in the panels directly from the factory. Surface-disinfected gypsum disks were wetted with sterile water, sealed, and incubated for 70 days. The results showed that Neosartorya hiratsukae (≡ Aspergillus hiratsukae) was the most dominant fungus on the gypsum wallboard followed by Chaetomium globosum and Stachybotrys chartarum. Our results suggest that these three fungal species are already embedded in the materials, presumably in the paper/carton layer surrounding the gypsum core, before the panels reach the retailers/building site. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. A RAPID METHOD FOR THE EXTRACTION OF FUNGAL DNA FROM ENVIRONMENTAL SAMPLES: EVALUATION IN THE QUANTITATIVE ANALYSIS OF MEMNONIELLA ECHINATA CONIDIA USING REAL TIME DETECTION OF PCR PRODUCTS

    EPA Science Inventory

    New technologies are creating the potential for using nucleic acid sequence detection to perform routine microbiological analyses of environmental samples. Our laboratory has recently reported on the development of a method for the quantitative detection of Stachybotrys chartarum...

  4. Aerosolization of Particulate (1→3)-β-d-Glucan from Moldy Materials▿

    PubMed Central

    Seo, Sung-Chul; Reponen, Tiina; Levin, Linda; Borchelt, Tiffany; Grinshpun, Sergey A.

    2008-01-01

    Mold-damaged building materials may contain biologically active agents, such as (1→3)-β-d-glucan, allergens, and mycotoxins, which have been associated with adverse health effects. The release of these components from contaminated surfaces into the air is not well understood. The purpose of this study was to characterize the release of particulate (1→3)-β-d-glucan from the surface of artificially mold-contaminated materials. Aspergillus versicolor and Stachybotrys chartarum were grown on malt extract agar (MEA), white ceiling tiles, and a wall-papered gypsum board for 1 and 6 months. The (1→3)-β-d-glucan on the surfaces of moldy materials and in air samples collected from these materials was analyzed by the Limulus amebocyte lysate assay. The aerosolization ratio was defined as the amount of (1→3)-β-d-glucan in the air divided by the amount on the surface. The results showed that the aerosolization of particulate (1→3)-β-d-glucan was influenced mainly by the type of material and the fungal species. For A. versicolor, the aerosolization ratios of particulate (1→3)-β-d-glucan released from the three types of material were not significantly different. However, the ratios for S. chartarum released from ceiling tiles and gypsum board were significantly higher than the ratios for this organism released from MEA (P < 0.001) and were comparable to those for A. versicolor. These findings indicate that the use of MEA in aerosolization experiments is likely to underestimate the release of S. chartarum particles from building materials. These results provide important background information for design of future laboratory or animal experiments, as well as for interpretation of field measurement data. PMID:18065630

  5. MONITORING MYCOTOXIN PRODUCTION AT THE GENETIC LEVEL ON VARIOUS GROWTH SUBSTRATES USING QUANTITATIVE REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION?EXPERIMENT DESIGN

    EPA Science Inventory

    The paper describes a method of analyzing the production of mycotoxins at the genetic level by monitoring the intracellular levels of messenger RNA (mRNA). Initial work will focus on threshing out the mycotoxin gene clusters in Stachybotrys chartarum followed by analysis of toxin...

  6. Mold: "tsara'at," Leviticus, and the history of a confusion.

    PubMed

    Heller, Richard M; Heller, Toni W; Sasson, Jack M

    2003-01-01

    The noun tsara'at appears about two dozen times in the Hebrew Bible, almost exclusively in Leviticus, where it is used to describe a state of ritual defilement manifested as a scaly condition of the skin, a condition of cloth, leather, and the walls of houses. In the Septuagint, the Greek translation of the Hebrew Bible, negac tsara'at was translated as aphe lepras; in the Latin Vulgate, this became plega leprae. These words in Greek and Latin implied a condition that spread over the body, not a term of ritual impurity. Tsara'at has continued to be translated as "leprosy," even though this term is not appropriate, as there was no leprosy as we know it in the Middle East during the time period the Hebrew Bible was written. Others have suggested that the proper translation of tsara'at is "mold." The recent identification of a specific mold (Stachybotrys sp.) that contaminates buildings and causes respiratory distress, memory loss, and rash, and the fact that mold has been present for millennia, lend support to the translation of tsara'at as "mold."

  7. The Effect of Spaceflight on Growth of Ulocladium chartarum Colonies on the International Space Station

    PubMed Central

    Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

    2013-01-01

    The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions. PMID:23637980

  8. Identification of a novel fungus, Leptosphaerulina chartarum SJTU59 and characterization of its xylanolytic enzymes.

    PubMed

    Wu, Qiong; Li, Yaqian; Li, Yingying; Gao, Shigang; Wang, Meng; Zhang, Tailong; Chen, Jie

    2013-01-01

    Xylanolytic enzymes are widely used in processing industries, e.g., pulp and paper, food, livestock feeds, and textile. Furthermore, certain xylanotic enzymes have demonstrated the capability to improve the resistance and immunity of plants. Screening of high-yield microbial xylanolytic enzyme producers is significant for improving large-scale cost-effective xylanolytic enzyme production. This study provided new evidence of high-level xylanolytic enzyme production by a novel fungus, designated Leptosphaerulina chartarum SJTU59. Under laboratory conditions, L. chartarum SJTU59 produced xylanolytic enzymes of up to 17.566 U/mL (i.e., 878.307 U/g substrate). The enzyme solution was relatively stable over a wide range of pH (pH 3.0 to pH 9.0) and temperature (40°C to 65°C) while showing high resistance to the majority of metal ions tested. Composition analysis of the hydrolytic products of xylan showed sufficient degradation by xylanolytic enzymes from L. chartarum SJTU59, mainly the monosaccharide xylose, and a small amount of xylobiose were enzymatically produced; whereas in the presence of sufficient xylan substrates, mainly xylooligosaccharides, an emerging prebiotic used in food industry, were produced. In addition, the xylanolytic enzyme preparation from L. chartarum SJTU59 could initiate tissue necrosis and oxidative burst in tobacco leaves, which may be related to enhanced plant defense to adversity and disease. L. chartarum SJTU59 possessed a complex xylanolytic enzyme system, from which two novel endo-β-1,4-xylanases of the glycoside hydrolase (GH) family 10, one novel endo-β-1,4-xylanase of the GH family 11, and one novel β-xylosidase of the GH family 43 were obtained via rapid amplification of complementary DNA ends. Given the high yield and stable properties of xylanolytic enzymes produced by L. chartarum SJTU59, future studies will be conducted to characterize the properties of individual xylanolytic enzymes from L. chartarum SJTU59. xylanolytic

  9. Prototheca species and Pithomyces chartarum as Causative Agents of Rhinitis and/or Sinusitis in Horses.

    PubMed

    Schöniger, S; Roschanski, N; Rösler, U; Vidovic, A; Nowak, M; Dietz, O; Wittenbrink, M M; Schoon, H-A

    2016-01-01

    Pyogranulomatous rhinitis associated with an algal infection was diagnosed in a 25-year-old gelding and a 23-year-old mare had necrotizing sinusitis with intralesional algae and pigmented fungi. Algae were identified immunohistochemically in both cases as Prototheca spp. In the gelding, further characterization by polymerase chain reaction and sequencing revealed that the organism was Prototheca zopfii genotype 2. Fungi from the mare were identified as Pithomyces chartarum by molecular analysis. Prototheca species are achlorophyllous algae and P. chartarum represents a dematiaceous fungus; they are saprophytes and facultative pathogens. Prototheca spp. and P. chartarum should be considered as rare respiratory pathogens of horses. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Data points used to generate figures 2 through 6 in manuscript submission.

    EPA Pesticide Factsheets

    Excel files containing raw data used to generate figures throughout manuscript.This dataset is associated with the following publication:Dean , T., D. Betancourt , J. Kim, L. Harvey, A. Evans, and B. Grace. Biological Responses of Raw 264.7 Macrophage Exposed to Two Strains of Stachybotrys chartarum Spores Grown on Four Different Wallboard Types. INHALATION TOXICOLOGY. Taylor & Francis, Inc., Philadelphia, PA, USA, 28(7): 303-307, (2016).

  11. Hazard identification, dose-response and environmental characteristics of stachybotryotoxins and other health-related products from Stachybotrys.

    PubMed

    Lai, K M

    2006-03-01

    An extensive growth of Stachybotrys in water-damaged buildings is of great public health concern. It is inconclusive whether Stachybotrys is responsible for the reported health effects on the occupants in these contaminated environments. However, based on the veterinary, occupational and laboratory toxicity studies, it is reasonable to project that Stachybotrys can cause adverse health responses once the toxic level of the corresponding agents reached the target systems. In order to assess the risk to occupants in contaminated buildings, it is essential to outline and collect information for risk assessment. This review paper presents the current information in the format of hazard identification, dose-response and environmental characteristics and aims to discuss existing information with researchers and risk assessors and help to conduct risk characterization under different indoor conditions.

  12. Production of proinflammatory mediators by indoor air bacteria and fungal spores in mouse and human cell lines.

    PubMed

    Huttunen, Kati; Hyvärinen, Anne; Nevalainen, Aino; Komulainen, Hannu; Hirvonen, Maija-Riitta

    2003-01-01

    We compared the inflammatory and cytotoxic responses caused by household mold and bacteria in human and mouse cell lines. We studied the fungi Aspergillus versicolor, Penicillium spinulosum, and Stachybotrys chartarum and the bacteria Bacillus cereus, Pseudomonas fluorescens, and Streptomyces californicus for their cytotoxicity and ability to stimulate the production of inflammatory mediators in mouse RAW264.7 and human 28SC macrophage cell lines and in the human A549 lung epithelial cell line in 24-hr exposure to 10(5), 10(6), and 10(7) microbes/mL. We studied time dependency by terminating the exposure to 10(6) microbes/mL after 3, 6, 12, 24, and 48 hr. We analyzed production of the cytokines tumor necrosis factor-alpha and interleukins 6 and 1ss (TNF-alpha, IL-6, IL-1ss, respectively) and measured nitric oxide production using the Griess method, expression of inducible NO-synthase with Western Blot analysis, and cytotoxicity with the MTT-test. All bacteria strongly induced the production of TNF-alpha, IL-6 and, to a lesser extent, the formation of IL-1ss in mouse macrophages. Only the spores of Str. californicus induced the production of NO and IL-6 in both human and mouse cells. In contrast, exposure to fungal strains did not markedly increase the production of NO or any cytokine in the studied cell lines except for Sta. chartarum, which increased IL-6 production somewhat in human lung epithelial cells. These microbes were less cytotoxic to human cells than to mouse cells. On the basis of equivalent numbers of bacteria and spores of fungi added to cell cultures, the overall potency to stimulate the production of proinflammatory mediators decreased in the order Ps. fluorescens > Str. californicus > B. cereus > Sta. chartarum > A. versicolor > P. spinulosum. These data suggest that bacteria in water-damaged buildings should also be considered as causative agents of adverse inflammatory effects.

  13. Production of proinflammatory mediators by indoor air bacteria and fungal spores in mouse and human cell lines.

    PubMed Central

    Huttunen, Kati; Hyvärinen, Anne; Nevalainen, Aino; Komulainen, Hannu; Hirvonen, Maija-Riitta

    2003-01-01

    We compared the inflammatory and cytotoxic responses caused by household mold and bacteria in human and mouse cell lines. We studied the fungi Aspergillus versicolor, Penicillium spinulosum, and Stachybotrys chartarum and the bacteria Bacillus cereus, Pseudomonas fluorescens, and Streptomyces californicus for their cytotoxicity and ability to stimulate the production of inflammatory mediators in mouse RAW264.7 and human 28SC macrophage cell lines and in the human A549 lung epithelial cell line in 24-hr exposure to 10(5), 10(6), and 10(7) microbes/mL. We studied time dependency by terminating the exposure to 10(6) microbes/mL after 3, 6, 12, 24, and 48 hr. We analyzed production of the cytokines tumor necrosis factor-alpha and interleukins 6 and 1ss (TNF-alpha, IL-6, IL-1ss, respectively) and measured nitric oxide production using the Griess method, expression of inducible NO-synthase with Western Blot analysis, and cytotoxicity with the MTT-test. All bacteria strongly induced the production of TNF-alpha, IL-6 and, to a lesser extent, the formation of IL-1ss in mouse macrophages. Only the spores of Str. californicus induced the production of NO and IL-6 in both human and mouse cells. In contrast, exposure to fungal strains did not markedly increase the production of NO or any cytokine in the studied cell lines except for Sta. chartarum, which increased IL-6 production somewhat in human lung epithelial cells. These microbes were less cytotoxic to human cells than to mouse cells. On the basis of equivalent numbers of bacteria and spores of fungi added to cell cultures, the overall potency to stimulate the production of proinflammatory mediators decreased in the order Ps. fluorescens > Str. californicus > B. cereus > Sta. chartarum > A. versicolor > P. spinulosum. These data suggest that bacteria in water-damaged buildings should also be considered as causative agents of adverse inflammatory effects. PMID:12515684

  14. Culturability and toxicity of sick building syndrome-related fungi over time.

    PubMed

    Wilson, Stephen C; Carriker, Curtis G; Brasel, Trevor L; Karunasena, Enusha; Douglas, David R; Wu, Chunfa; Andriychuk, Larysa A; Fogle, Matthew R; Martin, Jared M; Straus, David C

    2004-08-01

    Two experiments were conducted regarding the culturability and toxicity of fungi located on building materials over time and the efficacy of seven laboratory techniques in recovering culturable fungi from sample swabs. In the first experiment, eight sections of drywall were inoculated with Stachybotrys chartarum and stored at 25 +/- 5 degrees Celsius and 20-60% relative humidity (RH) for up to two years. Another eight sections of ceiling tile were stored at 100% RH for 1 year. Six sections of ceiling tile and 15 swabs were also inoculated with Penicillium chrysogenum and S. chartarum respectively and stored under the same conditions for 8 months and 3.3 years. All materials were tested for culturability at the end of the storage period. S. chartarum-inoculated samples were also tested for toxicity. In the second experiment (replicated twice), S. chartarum and Chaetomium globosum were inoculated onto 84 swabs each. Storage was up to 266 days at 25 +/- 5 degrees Celsius and 20-60% RH. Seven techniques were compared regarding the recovery of culturable fungi from the swabs over different time points. Results for Experiment 1 showed that all samples were culturable after the storage period and that the S. chartarum-inoculated drywall samples were toxic. In Experiment 2, all techniques showed high rates of recovery. These data show that despite being without a water source, these organisms can be culturable and toxic after long periods of time under conditions similar to human-occupied dwellings and that a number of preparation techniques are suitable for the recovery of these fungi from inoculated swabs.

  15. Airborne Mold and Endotoxin Concentrations in New Orleans, Louisiana, after Flooding, October through November 2005

    PubMed Central

    Solomon, Gina M.; Hjelmroos-Koski, Mervi; Rotkin-Ellman, Miriam; Hammond, S. Katharine

    2006-01-01

    Background The hurricanes and flooding in New Orleans, Louisiana, in October and November 2005 resulted in damp conditions favorable to the dispersion of bioaerosols such as mold spores and endotoxin. Objective Our objective in this study was to assess potential human exposure to bioaerosols in New Orleans after the flooding of the city. Methods A team of investigators performed continuous airborne sampling for mold spores and endotoxin outdoors in flooded and nonflooded areas, and inside homes that had undergone various levels of remediation, for periods of 5–24 hr during the 2 months after the flooding. Results The estimated 24-hr mold concentrations ranged from 21,000 to 102,000 spores/m3 in outdoor air and from 11,000 to 645,000 spores/m3 in indoor air. The mean outdoor spore concentration in flooded areas was roughly double the concentration in nonflooded areas (66,167 vs. 33,179 spores/m3; p < 0.05). The highest concentrations were inside homes. The most common mold species were from the genera of Cladosporium and Aspergillus/Penicillium; Stachybotrys was detected in some indoor samples. The airborne endotoxin concentrations ranged from 0.6 to 8.3 EU (endo-toxin units)/m3 but did not vary with flooded status or between indoor and outdoor environments. Conclusions The high concentration of mold measured indoors and outdoors in the New Orleans area is likely to be a significant respiratory hazard that should be monitored over time. Workers and returning residents should use appropriate personal protective equipment and exposure mitigation techniques to prevent respiratory morbidity and long-term health effects. PMID:16966092

  16. Controlled study of mold growth and cleaning procedure on treated and untreated wet gypsum wallboard in an indoor environment.

    PubMed

    Krause, Michael; Geer, William; Swenson, Lonie; Fallah, Payam; Robbins, Coreen

    2006-08-01

    The basis for some common gypsum wallboard mold remediation practices was examined. The bottom inch of several gypsum wallboard panels was immersed in bottled drinking water; some panels were coated and others were untreated. The panels were examined and tested for a period of 8 weeks. This study investigated: (a) whether mold growth, detectable visually or with tape lift samples, occurs within 1 week on wet gypsum wallboard; (b) the types, timing, and extent of mold growth on wet gypsum wallboard; (c) whether mold growth is present on gypsum wallboard surfaces 6 inches from visible mold growth; (d) whether some commonly used surface treatments affect the timing of occurrence and rate of mold growth; and (e) if moldy but dried gypsum wallboard can be cleaned with simple methods and then sealed with common surface treatments so that residual mold particles are undetectable with typical surface sampling techniques. Mold growth was not detected visually or with tape lift samples after 1 week on any of the wallboard panels, regardless of treatment, well beyond the 24-48 hours often mentioned as the incubation period. Growth was detected at 2 weeks on untreated gypsum. Penicillium, Cladosporium, and Acremonium were early colonizers of untreated panels. Aspergillus, Epicoccum, Alternaria, and Ulocladium appeared later. Stachybotrys was not found. Mold growth was not detected more than 6 inches beyond the margin of visible mold growth, suggesting that recommendations to remove gypsum wallboard more than 1 foot beyond visible mold are excessive. The surface treatments resulted in delayed mold growth and reduced the area of mold growth compared with untreated gypsum wallboard. Results showed that simple cleaning of moldy gypsum wallboard was possible to the extent that mold particles beyond "normal trapping" were not found on tape lift samples. Thus, cleaning is an option in some situations where removal is not feasible or desirable. In cases where conditions are not

  17. EVALUATION OF ANTIMICROBIAL EFFICACY FOR CONTROL OF STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Biological contaminants in buildings are known to act as sources of indoor air pollution, discomfort, asthma and pulmonary disease to building occupants, Sick buildings are evidence of extremely problematic indoor air quality (lAO) often resulting from unacceptable concentration...

  18. RELATIVE POTENCY OF FUNGAL EXTRACTS IN INDUCING ALLERGIC ASTHMA-LIKE RESPONSES IN BALB/C MICE

    EPA Science Inventory

    Indoor mold has been associated with the development of allergic asthma. However, relative potency of molds in the induction of allergic asthma is not clear. In this study, we tested the relative potency of fungal extracts (Metarizium anisophilae [MACA], Stachybotrys ...

  19. Metabolite profiles of Stachybotrys isolates from water-damaged buildings and their induction of inflammatory mediators and cytotoxicity in macrophages.

    PubMed

    Nielsen, Kristian Fog; Huttunen, Kati; Hyvärinen, Anne; Andersen, Birgitte; Jarvis, Bruce B; Hirvonen, Maija-Riitta

    2002-01-01

    The metabolite profiles of 20 Stachybotrys spp. isolates from Finnish water-damaged buildings were compared with their biological activities. Effects of purified compounds on cytotoxicity and production of inflammatory mediators such as nitric oxide, IL-6 and TNFalpha in murine RAW264.7 macrophage cells were studied. The 11 isolates belonging to the satratoxin-producing chemotype were highly cytotoxic to the macrophages. The isolates inducing inflammatory mediators all belonged to the atranone-producing chemotype, but pure atranones B, and D did not elicit a response in the bioassay. Altogether, cytotoxicity of Stachybotrys sp. isolates appear to be related to satratoxin production whereas the specific component inducing inflammatory responses in atranone-producing isolates remains obscure.

  20. Mycotoxin production by indoor molds.

    PubMed

    Fog Nielsen, Kristian

    2003-07-01

    Fungal growth in buildings starts at a water activity (a(w)) near 0.8, but significant quantities of mycotoxins are not produced unless a(w) reaches 0.95. Stachybotrys generates particularly high quantities of many chemically distinct metabolites in water-damaged buildings. These metabolites are carried by spores, and can be detected in air samples at high spore concentrations. Very little attention has been paid to major metabolites of Stachybotrys called spirocyclic drimanes, and the precise structures of the most abundant of these compounds are unknown. Species of Aspergillus and Penicillium prevalent in the indoor environment produce relatively low concentrations of mycotoxins, with the exception of sterigmatocystins that can represent up to 1% of the biomass of A. versicolor at a(w)'s close to 1. The worst-case scenario for homeowners is produced by consecutive episodes of water damage that promote fungal growth and mycotoxin synthesis, followed by drier conditions that facilitate the liberation of spores and hyphal fragments.

  1. Identification of signatory secondary metabolites during mycoparasitism of Rhizoctonia solani by Stachybotrys elegans

    PubMed Central

    Chamoun, Rony; Aliferis, Konstantinos A.; Jabaji, Suha

    2015-01-01

    Stachybotrys elegans is able to parasitize the fungal plant pathogen Rhizoctonia solani AG-3 following a complex and intimate interaction, which, among others, includes the production of cell wall-degrading enzymes, intracellular colonization, and expression of pathogenic process encoding genes. However, information on the metabolome level is non-existent during mycoparasitism. Here, we performed a direct-infusion mass spectrometry (DIMS) metabolomics analysis using an LTQ Orbitrap analyzer in order to detect changes in the profiles of induced secondary metabolites of both partners during this mycoparasitic interaction 4 and 5 days following its establishment. The diketopiperazine(s) (DKPs) cyclo(S-Pro-S-Leu)/cyclo(S-Pro-S-Ile), ethyl 2-phenylacetate, and 3-nitro-4-hydroxybenzoic acid were detected as the primary response of Rhizoctonia 4 days following dual-culturing with Stachybotrys, whereas only the latter metabolite was up-regulated 1 day later. On the other hand, trichothecenes and atranones were mycoparasite-derived metabolites identified during mycoparasitism 4 and 5 days following dual-culturing. All the above secondary metabolites are known to exhibit bioactivity, including fungitoxicity, and represent key elements that determine the outcome of the interaction being studied. Results could be further exploited in programs for the evaluation of the bioactivity of these metabolites per se or their chemical analogs, and/or genetic engineering programs to obtain more efficient mycoparasite strains with improved efficacy and toxicological profiles. PMID:25972848

  2. Mold allergy: is it real and what do we do about it?

    PubMed

    Rudert, Amanda; Portnoy, Jay

    2017-08-01

    fungi produce substances that contain pathogen-associated molecular patterns (pamps) and damage-associated molecular patterns (damps) which bind to pattern recognition receptors, stimulating innate immune responses in humans. they also produce allergens that induce production of specific ige. Areas covered: In this review we cover both innate and adaptive immune responses to fungi. Some fungal products can activate both innate and adaptive responses and in doing so, cause an intense and complex health effects. Methods of testing for fungal allergy and evidence for clinical treatment including environmental control are also discussed. In addition, we describe controversial issues including the role of Stachybotrys and mycotoxins in adverse health effects. Expert commentary: Concerns about long-term exposure to fungi have led some patients, attorneys and fungus advocates to promote fears about a condition that has been termed toxic mold syndrome. This syndrome is associated with vague symptoms and is believed to be due to exposure to mycotoxins, though this connection has not been proven. Ultimately, more precise methods are needed to measure both fungal exposure and the resulting health effects. Once that such methods become available, much of the speculation will be replaced by knowledge.

  3. Fungal DNA in hotel rooms in Europe and Asia--associations with latitude, precipitation, building data, room characteristics and hotel ranking.

    PubMed

    Norbäck, Dan; Cai, Gui-Hong

    2011-10-01

    There is little information on the indoor environment in hotels. Analysis of fungal DNA by quantitative PCR (qPCR) is a new method which can detect general and specific sequences. Dust was collected through swab sampling of door frames in 69 hotel rooms in 20 countries in Europe and Asia (2007-2009). Five sequences were detected by qPCR: total fungal DNA, Aspergillus and Penicillium DNA (Asp/Pen DNA), Aspergillus versicolor (A. versicolor DNA), Stachybotrys chartarum (S. chartarum DNA) and Streptomyces spp. (Streptomyces DNA). Associations were analysed by multiple linear regression. Total fungal DNA (GM = 1.08 × 10(8) cell equivalents m(-2); GSD = 6.36) and Asp/Pen DNA (GM = 1.79 × 10(7) cell equivalents m(-2); GSD = 10.12) were detected in all rooms. A. versicolor DNA, S. chartarum DNA and Streptomyces DNA were detected in 84%, 28% and 47% of the samples. In total, 20% of the rooms had observed dampness/mould, and 30% had odour. Low latitude (range 1.5-64.2 degrees) was a predictor of Asp/Pen DNA. Seaside location, lack of mechanical ventilation, and dampness or mould were other predictors of total fungal DNA and Asp/Pen DNA. Hotel ranking (Trip Advisor) or self-rated quality of the interior of the hotel room was a predictor of total fungal DNA, A. versicolor DNA and Streptomyces DNA. Odour was a predictor of S. chartarum DNA. In conclusion, fungal DNA in swab samples from hotel rooms was related to latitude, seaside location, ventilation, visible dampness and indoor mould growth. Hotels in tropical areas may have 10-100 times higher levels of common moulds such as Aspergillus and Penicillium species, as compared to a temperate climate zone.

  4. Identification of mycotoxins produced by species of Fusarium and Stachybotrys obtained from Eastern Europe.

    PubMed Central

    Szathmary, C I; Mirocha, C J; Palyusik, M; Pathre, S V

    1976-01-01

    Isolates of Fusarium and Stachybotrys spp. and crude extracts from these fungi were obtained from Hungary and the U.S.S.R. and used for the evaluation of the mycotoxins they produced. The cultures were grown on millet and oats and extracted in Budapest, Hungary (Veterinary Medical Research Institute) and chemically analyzed at the University of Minnesota using thin-layer chromatography (TLC), gas-liquid chromatography (GLC), gas chromatograph-mass spectrometry (GC-MS), and the rat skin bioassay. Zearalenone was found in most of the Fusarium cultures, T-2 toxin, neosolaniol, T-2 tetraol, and HT-2 toxin were found in extracts of Fusarium poae and F. sporotrichioies. A special effort was made to isolate the steroid-like toxins reported in the early Russian literature as sporofusarin and poaefusarin. None of the extracts from the Fusarium species yielded poaefusarin or sporofusarin when analyzed by our chemical methods or by those of L.E. Olifson, S.M. Kenina, and V.L. Kartashova, 1972. We therefore accounted for the toxicity of the Fusarium extracts as due to the 12,13,epoxytrichothecenes. One culture of Stachybotrys alternans yielded a macrocyclic ester of 12,13-epoxytrichothecene which, upon hydrolysis, yielded verrucarol; a steroid-like molecule (SB-3) was also isolated. The former had skin-irritant activity but SB-3 did not; the latter exhibited cardiac activity on the heart of the cockroach. PMID:988785

  5. Curbing indoor mold growth with mold inhibitors

    Treesearch

    Carol A. Clausen; Vina W. Yang

    2004-01-01

    Environmentally acceptable mold inhibitors are needed to curb the growth of mold fungi in woodframe housing when moisture management measures fail. Excess indoor moisture can lead to rapid mold establishment which, in turn, can have deleterious affects on indoor air quality. Compounds with known mold inhibitory properties and low mammalian toxicity, such as food...

  6. Resin film infusion mold tooling and molding method

    NASA Technical Reports Server (NTRS)

    Burgess, Roger (Inventor); Grossheim, Brian (Inventor); Mouradian, Karbis (Inventor); Thrash, Patrick J. (Inventor)

    1999-01-01

    A mold apparatus and method for resin film infusion molding including an outer mold tool having a facing sheet adapted to support a resin film and preform assembly. The facing sheet includes attachment features extending therefrom. An inner mold tool is positioned on the facing sheet to enclose the resin film and preform assembly for resin film infusion molding. The inner mold tool includes a plurality of mandrels positioned for engagement with the resin film and preform assembly. Each mandrel includes a slot formed therein. A plurality of locating bars cooperate with the slots and with the attachment features for locating the mandrels longitudinally on the outer mold tool.

  7. Mold Allergy

    MedlinePlus

    ... Home ▸ Conditions & Treatments ▸ Allergies ▸ Mold Allergy Share | Mold Allergy Overview Symptoms & Diagnosis Treatment & Management Mold Allergy Overview Molds are tiny fungi whose spores float ...

  8. Novel Isochroman Dimers from Stachybotrys sp. PH30583: Fermentation, Isolation, Structural Elucidation and Biological Activities.

    PubMed

    Li, Wei; Yang, Ya-Bin; Yang, Xue-Qiong; Xie, Hui-Ding; Shao, Zhi-Hui; Zhou, Hao; Miao, Cui-Ping; Zhao, Li-Xing; Ding, Zhong-Tao

    2017-05-01

    The rare anishidiol and five new isochromans, including three novel dimers with unprecedented skeletons, were isolated from Stachybotrys sp. PH30583. Their structures were determined by spectral analyses. The bioactivities of these compounds were also investigated. The dimers ( 6 - 10 ) inhibited acetylcholinesterase at 50 µM, but the monomers did not. To investigate the biogenesis of the novel dimers, a time-course investigation of metabolite production was undertaken. Georg Thieme Verlag KG Stuttgart · New York.

  9. Molds

    MedlinePlus

    Molds are fungi that can be found both outdoors and indoors. They grow best in warm, damp and humid conditions. If ... spots in your house, you will probably get mold. Molds can cause health problems. Inhaling or touching ...

  10. Mold Flux Crystallization and Mold Thermal Behavior

    NASA Astrophysics Data System (ADS)

    Peterson, Elizabeth Irene

    Mold flux plays a small but critical role in the continuous casting of steel. The carbon-coated powder is added at the top of the water-cooled copper mold, over time it melts and infiltrates the gap between the copper mold and the solidifying steel strand. Mold powders serve five primary functions: (1) chemical insulation, (2) thermal insulation, (3) lubrication between the steel strand and mold, (4) absorption of inclusions, and (5) promotion of even heat flux. All five functions are critical to slab casting, but surface defect prevention is primarily controlled through even heat flux. Glassy fluxes have high heat transfer and result in a thicker steel shell. Steels with large volumetric shrinkage on cooling must have a crystalline flux to reduce the radiative heat transfer and avoid the formation of cracks in the shell. Crystallinity plays a critical role in steel shell formation, therefore it is important to study the thermal conditions that promote each phase and its morphology. Laboratory tests were performed to generate continuous cooling transformation (CCT) and time-temperature-transformation (TTT) diagrams. Continuous cooling transformation tests were performed in an instrumented eight cell step chill mold. Results showed that cuspidine was the only phase formed in conventional fluxes and all observed structures were dendritic. An isothermal tin bath quench method was also developed to isothermally age glassy samples. Isothermal tests yielded different microstructures and different phases than those observed by continuous cooling. Comparison of aged tests with industrial flux films indicates similar faceted structures along the mold wall, suggesting that mold flux first solidifies as a glass along the mold wall, but the elevated temperature devitrifies the glassy structure forming crystals that cannot form by continuous cooling.

  11. The relation between growth of four microbes on six different plasterboards and biological activity of spores.

    PubMed

    Murtoniemi, T; Hirvonen, M-R; Nevalainen, A; Suutari, M

    2003-03-01

    Microbial growth on water-damaged building materials is commonly associated with adverse health effects in the occupants. We examined the growth of Stachybotrys chartarum, Aspergillus versicolor, Penicillium spinulosum, and Streptomyces californicus, isolated from water-damaged buildings, on six different brands of plasterboards. The microbial growth was compared with the biological activity of the spores, that is the potential to induce cytotoxicity and proinflammatory mediators in RAW264.7 macrophages. These results showed that the microbial growth on plasterboard depended on both the microbial strain and the brand of plasterboard used. The biological activity of spores appeared to be regulated by different growth conditions on plasterboards so that good microbial growth was associated with a low bioactivity of the spores, whereas the spores collected from plasterboard supporting only weak growth usually were biologically active. Cytotoxicity of either S. chartarum or A. versicolor did not correlate with any particular growth conditions or induced inflammatory responses. Instead, there were positive correlations between cytotoxicity and levels of induced proinflammatory cytokines for P. spinulosum and S. californicus. These data suggest that both the microbial growth on plasterboard and the resulting bioactivity of spores vary and might be affected by changing the growth conditions provided by the plasterboards.

  12. 53. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    53. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL MOLDS IN THE MORAVIAN POTTERY AND TILE WORKS COLLECTION, AND ARE USED TO PRESS TILES. THE FACTORY KEEPS TEN PRODUCTION MOLDS FOR EACH IMAGE. THE ORIGINAL MOLDS ARE NOT USED IN PRODUCTION. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  13. The influence of lime and nitrogen fertilisers on spore counts of Pithomyces chartarum in pasture.

    PubMed

    Cuttance, E L; Laven, R A; Mason, W A; Stevenson, M

    2016-11-01

    To determine whether the application of lime or nitrogen to pasture affected the spore counts of Pithomyces chartarum. The lime application studies were undertaken on a spring-calving, pasture-based, commercial dairy farm near Te Awamutu, New Zealand. On 6 November 2012, five randomly selected paddocks were split into three equal sections. In two of the sections, lime was applied at either 1.5 or 2.5 t/ha, and the central section was left as an untreated control. Each section was sampled for spore counting weekly from 16 January to 15 May 2013. Starting in January 2013, five other randomly selected paddocks were monitored for spore counts. On 20 March 2013 the average spore counts in three paddocks were >100,000 spores/g of pasture. These paddocks were then divided into three equal sections and lime was applied as described above. Spore counting in each section continued weekly until 15 May 2013. The nitrogen application study was carried out on three commercial dairy farms near Te Awamutu, New Zealand. Two randomly selected paddocks on each farm were divided into three equal sections and, on 20 December 2012, nitrogen in the form of urea was applied at either 50 or 80 kg urea/ha to two of the sections; the central section remained as an untreated control. Each section was sampled for spore counting weekly from 16 January to 15 May 2013. Following pre-summer lime application, treatment at 1.5 or 2.5 t/ha did not affect spore counts over time compared with the control section (p>0.26). Similarly following autumn lime application, treatment at 1.5 or 2.5 t/ha did not affect spore counts over time compared with the control section (p>0.11). Following nitrogen application median spore counts remained <20,000 spores/g pasture throughout the trial period and there was no effect of treatment on spore counts over time (p>0.49). This study found that application of lime before the risk period for facial eczema, in November, application of lime after a spore count

  14. Microfungi in cultivated fields in Eskişehir provience (Turkey).

    PubMed

    Demirel, Rasime; Ilhan, Semra; Asan, Ahmet; Kinaci, Engin; Oner, Setenay

    2005-01-01

    The soil microfungi flora was investigated in four locations of Eskişehir (Turkey). 56 soil samples were seasonaly collected from 14 stations in the areas of Karacahöyük, Bahçecik, OGU I, and OGU II. A total of 110 species belonging to 32 genera were encountered including Absidia, Acremonium, Alternaria, Aspergillus, Beauveria, Botryoderma, Chaetomium, Chrysosporium, Cladosporium, Eupenicillium, Eurotium, Fusarium, Geotrichum, Gliocladium, Gonytrichum, Metarrhizium, Mucor, Myrothecium, Paecilomyces, Penicillium, Phoma, Plectosphaerella, Rhizoctania, Rhizopus, Scopulariopsis, Septonema, Stachybotrys, Trichocladium, Trichoderma, Ulocladium, Verticillium, and Wardomyces. Twenty five species were more frequent (all locations) while twenty seven species were rare (only one sample). Mainly, Acremonium kiliense, Aspergillus ochraceus, A. terricola var. americanus, A. versicolor, Cladosporium cladosporioides, Fusarium oxysporum, F. solani, Gliocladium roseum, Penicillium chrysogenum, P. corylophum, P. expansum, P. griseofulvum, P. implicatum, P. restrictum, and Stachybotrys chartarum were the most common and abundant microfungi in all locations. Five species Aspergillus subsessilis, A. terreus var. africanus, Eupenicillium egyptiacum, Paecilomyces ramosus, and Penicillium novae-zeelandiae are likely to be newly recorded for Turkey. The microfungi number in Eskişehir soils was between 25,000-234,000 CFU/g (mean value at 126,375 CFU/g). Copyright (c) 2005 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. High Cost/High Risk Components to Chalcogenide Molded Lens Model: Molding Preforms and Mold Technology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bernacki, Bruce E.

    2012-10-05

    This brief report contains a critique of two key components of FiveFocal's cost model for glass compression molding of chalcogenide lenses for infrared applications. Molding preforms and mold technology have the greatest influence on the ultimate cost of the product and help determine the volumes needed to select glass molding over conventional single-point diamond turning or grinding and polishing. This brief report highlights key areas of both technologies with recommendations for further study.

  16. 92. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    92. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL MOLDS IN THE MORAVIAN POTTERY AND TILE WORKS COLLECTION, AND ARE USED TO PRESS TILES. THE FACTORY KEEPS TEN PRODUCTION MOLDS FOR EACH IMAGE. THE ORIGINAL MOLDS ARE NOT USED IN PRODUCTION. SAME VIEW AS PA-107-53. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  17. MOLD-SPECIFIC QUANTITATIVE PCR: THE EMERGING STANDARD IN MOLD ANALYSIS

    EPA Science Inventory

    Molds can cause health problems like infections and allergies, destroy crops, and contaminate our food or pharmaceuticals. We can't avoid molds. Molds are essential players in the biological processes on earth, but we can now identify and quantify the molds that will be most pr...

  18. Mold and Health

    EPA Pesticide Factsheets

    Molds have the potential to cause health problems. Molds produce allergens (substances that can cause allergic reactions) and irritants. Inhaling or touching mold or mold spores may cause allergic reactions in sensitive individuals.

  19. Mycotoxins from mould infested building materials.

    PubMed

    Nielsen, K F

    2000-03-01

    Only limited documentation of non-allergenic, especially toxic reactions after inhalation of microfungal spores in water damaged buildings exists. Recently attention has been drawn to the mycotoxins as causal compounds, as some the dominating genera found in buildings are well known mycotoxin producers.Penicillium chrysogenum and A. ustus do not seem to produce any known mycotoxins when growing on building materials, whereasP. brevicompactum produces mycophenolic acid, someP. polonicum produces verrucosidin and verrucofortine,A. versicolor produces sterigmatocystins,A. niger produces nigragillin, orlandin, naphtho-γ-pyrones and tetracyclic compounds, someA. ochraceus produces ochratoxin A,Alternaria spp. produce alternariol and alternariol monomethyl ether,Chaetomium globosum produce chaetoglobosins, and finally 30-40% ofStachybotrys chartarum isolates from buildings produce macrocyclic trichothecenes and a number of other biologically active compounds.

  20. Rapid control of mold temperature during injection molding process

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liparoti, Sara; Titomanlio, Giuseppe; Hunag, Tsang Min

    2015-05-22

    The control of mold surface temperature is an important factor that determines surface morphology and its dimension in thickness direction. It can also affect the frozen molecular orientation and the mold surface replicability in injection molded products. In this work, thin thermally active films were used to quickly control the mold surface temperature. In particular, an active high electrical conductivity carbon black loaded polyimide composites sandwiched between two insulating thin polymeric layers was used to condition the mold surface. By controlling the heating time, it was possible to control precisely the temporal variation of the mold temperature surface during themore » entire cycle. The surface heating rate was about 40°C/s and upon contact with the polymer the surface temperature decreased back to 40°C within about 5 s; the overall cycle time increased only slightly. The effect on cross section sample morphology of samples of iPP were analyzed and discussed on the basis of the recorded temperature evolution.« less

  1. Challenges in mold manufacturing for high precision molded diffractive optical elements

    NASA Astrophysics Data System (ADS)

    Pongs, Guido; Bresseler, Bernd; Schweizer, Klaus; Bergs, Thomas

    2016-09-01

    Isothermal precision glass molding of imaging optics is the key technology for mass production of precise optical elements. Especially for numerous consumer applications (e.g. digital cameras, smart phones, …), high precision glass molding is applied for the manufacturing of aspherical lenses. The usage of diffractive optical elements (DOEs) can help to further reduce the number of lenses in the optical systems which will lead to a reduced weight of hand-held optical devices. But today the application of molded glass DOEs is limited due to the technological challenges in structuring the mold surfaces. Depending on the application submicrometer structures are required on the mold surface. Furthermore these structures have to be replicated very precisely to the glass lens surface. Especially the micro structuring of hard and brittle mold materials such as Tungsten Carbide is very difficult and not established. Thus a multitude of innovative approaches using diffractive optical elements cannot be realized. Aixtooling has investigated in different mold materials and different suitable machining technologies for the micro- and sub-micrometer structuring of mold surfaces. The focus of the work lays on ultra-precision grinding to generate the diffractive pattern on the mold surfaces. This paper presents the latest achievements in diffractive structuring of Tungsten Carbide mold surfaces by ultra-precision grinding.

  2. Allergies, asthma, and molds

    MedlinePlus

    Reactive airway - mold; Bronchial asthma - mold; Triggers - mold; Allergic rhinitis - pollen ... Things that make allergies or asthma worse are called triggers. Mold is a common trigger. When your asthma or allergies become worse due to mold, you are ...

  3. ATP Mediates Neuroprotective and Neuroproliferative Effects in Mouse Olfactory Epithelium following Exposure to Satratoxin G In Vitro and In Vivo

    PubMed Central

    Jia, Cuihong; Sangsiri, Sutheera; Belock, Bethany; Iqbal, Tania R.; Pestka, James J.; Hegg, Colleen C.

    2011-01-01

    Intranasal aspiration of satratoxin G (SG), a mycotoxin produced by the black mold Stachybotrys chartarum, selectively induces apoptosis in olfactory sensory neurons (OSNs) in mouse olfactory epithelium (OE) through unknown mechanisms. Here, we show a dose-dependent induction of apoptosis 24 h post-SG exposure in vitro as measured by increased activated caspases in the OP6 olfactory placodal cell line and increased propidium iodide staining in primary OE cell cultures. Intranasal aspiration of SG increased TUNEL (Terminal dUTP Nick End Labeling) staining in the neuronal layer of the OE and significantly increased the latency to find a buried food pellet, confirming that SG selectively induces neuronal apoptosis and demonstrating that SG impairs the sense of smell. Next, we investigated whether ATP can prevent SG-induced OE toxicity. ATP did not decrease apoptosis under physiological conditions but significantly reduced SG-induced OSN apoptosis in vivo and in vitro. Furthermore, purinergic receptor inhibition significantly increased apoptosis in OE primary cell culture and in vivo. These data indicate that ATP is neuroprotective against SG-induced OE toxicity. The number of cells that incorporated 5′-bromodeoxyuridine, a measure of proliferation, was significantly increased 3 and 6 days post-SG aspiration. Treatment with purinergic receptor antagonists significantly reduced SG-induced cell proliferation, whereas post-treatment with ATP significantly potentiated SG-induced cell proliferation. These data indicate that ATP is released and promotes cell proliferation via activation of purinergic receptors in SG-induced OE injury. Thus, the purinergic system is a therapeutic target to alleviate or restore the loss of OSNs. PMID:21865290

  4. Improved compression molding process

    NASA Technical Reports Server (NTRS)

    Heier, W. C.

    1967-01-01

    Modified compression molding process produces plastic molding compounds that are strong, homogeneous, free of residual stresses, and have improved ablative characteristics. The conventional method is modified by applying a vacuum to the mold during the molding cycle, using a volatile sink, and exercising precise control of the mold closure limits.

  5. Study on In-mold Punching during PPS/GF Injection Molding

    NASA Astrophysics Data System (ADS)

    Inuzuka, Takayuki; Fujita, Akihiro; Nakai, Asami; Hamada, Hiroyuki

    The influence of the punching condition on strength and the amount of shear droop was investigated to optimize the processing condition for punching in the mold during glass fiber reinforced polyphenylenesulfide (PPS/GF) injection molding. For in-mold punching part during cooling process, the tensile strength was constant because the pressure loss by the punch did not occur. The amount of the shear droop decreased in line with the increase in delay time because the rigidity of injection molded part in the mold increased when the resin was cooled. Moreover, when the resin temperature lowered more than the glass transition temperature, the amount of the shear droop was constant because the rigidity became constant. It is necessary to begin punching when the resin temperature lowers more than the glass transition temperature after holding pressure process is completed, to secure high strength and to assume 0.05 mm or less, at which level the shear droop cannot be visually recognized. The shortest delay time for PPS/GF is 8 sec. The delay time to minimize the amount of the shear droop can be guessed by analyzing the temperature change of the resin in the mold by injection molding CAE.

  6. Hydrogen silsesquioxane mold coatings for improved replication of nanopatterns by injection molding

    NASA Astrophysics Data System (ADS)

    Hobæk, Thor Christian; Matschuk, Maria; Kafka, Jan; Pranov, Henrik J.; Larsen, Niels B.

    2015-03-01

    We demonstrate the replication of nanosized pillars in polymer (cyclic olefin copolymer) by injection molding using nanostructured thermally cured hydrogen silsesquioxane (HSQ) ceramic coatings on stainless steel mold inserts with mold nanostructures produced by a simple embossing process. At isothermal mold conditions, the average pillar height increases by up to 100% and a more uniform height distribution is observed compared to a traditional metal mold insert. Thermal heat transfer simulations predict that the HSQ film retards the cooling of the polymer melt during the initial stages of replication, thus allowing more time to fill the nanoscale cavities compared to standard metal molds. A monolayer of a fluorinated silane (heptadecafluorotrichlorosilane) deposited on the mold surface reduces the mold/polymer interfacial energy to support demolding of the polymer replica. The mechanical stability of thermally cured HSQ makes it a promising material for nanopattern replication on an industrial scale without the need for slow and energy intensive variotherm processes.

  7. Mold Testing or Sampling

    EPA Pesticide Factsheets

    In most cases, if visible mold growth is present, sampling is unnecessary. Since no EPA or other federal limits have been set for mold or mold spores, sampling cannot be used to check a building's compliance with federal mold standards.

  8. Occurrence of itraconazole-tolerant micromycetes in the soil and food products.

    PubMed

    Piecková, E; Jesenská, Z

    1999-01-01

    Unexpected pathogens from the environment represent considerable risk for humans with impaired health. We examined the occurrence of itraconazole tolerant micromycetes in soil and in maize products. Five concentrations of itraconazole (2.5-12.5 micrograms/mL) selected according to known treatment schedules for human patients were incorporated into Sabouraud agar with chloramphenicol and Rose Bengal and diluted samples were inoculated onto the agar surface. After 7-d growth at 22 degrees C colonies of Alternaria sp., Aspergillus clavatus, A. glaucus group, A. flavus, A. fumigatus, A. niger group, A. ochraceus group, A. ochraceus, Chaetomium sp., Cladosporium cladosporioides, Cylindrocarpon sp., Doratomyces sp., Fusarium sp., F. moniliforme, F. oxysporum, F. solani, F. subglutinans, Marianaea elegans, Mortierella sp., Mucor sp., Myrothecium sp., Penicillium sp., Rhizopus sp., Scopulariopsis brevicaulis, Sepedonium sp., Stachybotrys chartarum, Stemphylium sp., Torula humicola and Trichoderma viride were isolated.

  9. Manufacturing plastic injection optical molds

    NASA Astrophysics Data System (ADS)

    Bourque, David

    2008-08-01

    ABCO Tool & Die, Inc. is a mold manufacturer specializing in the manufacturing of plastic injection molds for molded optical parts. The purpose of this presentation is to explain the concepts and procedures required to build a mold that produces precision optical parts. Optical molds can produce a variety of molded parts ranging from safety eyewear to sophisticated military lens parts, which must meet precise optical specifications. The manufacturing of these molds begins with the design engineering of precision optical components. The mold design and the related optical inserts are determined based upon the specific optical criteria and optical surface geometry. The mold manufacturing techniques will be based upon the optical surface geometry requirements and specific details. Manufacturing processes used will be specific to prescribed geometrical surface requirements of the molded part. The combined efforts result in a robust optical mold which can produce molded parts that meet the most precise optical specifications.

  10. Phenolic Molding Compounds

    NASA Astrophysics Data System (ADS)

    Koizumi, Koji; Charles, Ted; de Keyser, Hendrik

    Phenolic Molding Compounds continue to exhibit well balanced properties such as heat resistance, chemical resistance, dimensional stability, and creep resistance. They are widely applied in electrical, appliance, small engine, commutator, and automotive applications. As the focus of the automotive industry is weight reduction for greater fuel efficiency, phenolic molding compounds become appealing alternatives to metals. Current market volumes and trends, formulation components and its impact on properties, and a review of common manufacturing methods are presented. Molding processes as well as unique advanced techniques such as high temperature molding, live sprue, and injection/compression technique provide additional benefits in improving the performance characterisitics of phenolic molding compounds. Of special interest are descriptions of some of the latest innovations in automotive components, such as the phenolic intake manifold and valve block for dual clutch transmissions. The chapter also characterizes the most recent developments in new materials, including long glass phenolic molding compounds and carbon fiber reinforced phenolic molding compounds exhibiting a 10-20-fold increase in Charpy impact strength when compared to short fiber filled materials. The role of fatigue testing and fatigue fracture behavior presents some insight into long-term reliability and durability of glass-filled phenolic molding compounds. A section on new technology outlines the important factors to consider in modeling phenolic parts by finite element analysis and flow simulation.

  11. Transferability of glass lens molding

    NASA Astrophysics Data System (ADS)

    Katsuki, Masahide

    2006-02-01

    Sphere lenses have been used for long time. But it is well known that sphere lenses theoretically have spherical aberration, coma and so on. And, aspheric lenses attract attention recently. Plastic lenses are molded easily with injection machines, and are relatively low cost. They are suitable for mass production. On the other hand, glass lenses have several excellent features such as high refractive index, heat resistance and so on. Many aspheric glass lenses came to be used for the latest digital camera and mobile phone camera module. It is very difficult to produce aspheric glass lenses by conventional process of curve generating and polishing. For the solution of this problem, Glass Molding Machine was developed and is spreading through the market. High precision mold is necessary to mold glass lenses with Glass Molding Machine. The mold core is ground or turned by high precision NC aspheric generator. To obtain higher transferability of the mold core, the function of the molding machine and the conditions of molding are very important. But because of high molding temperature, there are factors of thermal expansion and contraction of the mold and glass material. And it is hard to avoid the factors. In this session, I introduce following items. [1] Technology of glass molding and the machine is introduced. [2] The transferability of glass molding is analyzed with some data of glass lenses molded. [3] Compensation of molding shape error is discussed with examples.

  12. Mold-Resistant Construction.

    ERIC Educational Resources Information Center

    Huckabee, Christopher

    2003-01-01

    Asserts that one of the surest ways to prevent indoor air quality and mold issues is to use preventive construction materials, discussing typical resistance to dealing with mold problems (usually budget-related) and describing mold-resistant construction, which uses concrete masonry, brick, and stone and is intended to withstand inevitable…

  13. Chemorheology of in-mold coating for compression molded SMC applications

    NASA Astrophysics Data System (ADS)

    Ko, Seunghyun; Straus, Elliott J.; Castro, Jose M.

    2015-05-01

    In-mold coating (IMC) is applied to compression molded sheet molding compound (SMC) exterior automotive or truck body panels as an environmentally friendly alternative to make the surface conductive for subsequent electrostatic painting operations. The coating is a thermosetting liquid that when injected onto the surface of the part cures and bonds to provide a smooth conductive surface. In order to optimize the IMC process, it is essential to predict the time available for flow, that is the time before the thermosetting reaction starts (inhibition time) as well as the time when the coating has enough structural integrity so that the mold can be opened without damaging the part surface (cure time). To predict both the inhibition time and the cure time, it is critical to study the chemorheology of IMC. In this paper, we study the chemorheology for a typical commercial IMC system, and show its relevance to both the flow and cure time for the IMC stage during SMC compression molding.

  14. Implications of diamond-turned versus diamond-ground mold fabrication techniques on precision-molded optics

    NASA Astrophysics Data System (ADS)

    Mertus, Lou; Symmons, Alan

    2012-10-01

    In recent years, the trend within the molded optics community has been an overall advancement in the capability to diamond grind molds using a variety of grinding techniques. Improvements in grinding equipment, materials and tooling have enabled higher quality ceramic and carbide molds and thereby lenses. Diamond turned molds from ductile metals are still used prevalently throughout the molding industry. Each technology presents a unique set of advantages and disadvantages whether used for precision injection molding of plastic optics or precision glass molding. This paper reviews the manufacturing techniques for each approach and applicable molding process. The advantages and disadvantages of each are compared and analyzed. The subtle differences that exist in optics molded from each technique and the impact they have on the performance in various applications is reviewed. Differences stemming from tooling material properties, material-specific minor defects, as well as cutting and grinding process-induced artifacts are described in detail as well as their influence on the roughness, waviness, and form errors present on the molded surface. A comparison with results between similar surfaces for both diamond grinding and diamond turning is presented.

  15. Silicon micro-mold

    DOEpatents

    Morales, Alfredo M [Livermore, CA

    2006-10-24

    The present invention describes a method for rapidly fabricating a robust 3-dimensional silicon-mold for use in preparing complex metal micro-components. The process begins by depositing a conductive metal layer onto one surface of a silicon wafer. A thin photoresist and a standard lithographic mask are then used to transfer a trace image pattern onto the opposite surface of the wafer by exposing and developing the resist. The exposed portion of the silicon substrate is anisotropically etched through the wafer thickness down to conductive metal layer to provide an etched pattern consisting of a series of rectilinear channels and recesses in the silicon which serve as the silicon micro-mold. Microcomponents are prepared with this mold by first filling the mold channels and recesses with a metal deposit, typically by electroplating, and then removing the silicon micro-mold by chemical etching.

  16. Mold Charlatans.

    ERIC Educational Resources Information Center

    Woody, Daniel

    2002-01-01

    Offers a primer on toxic mold and its removal, warning against ignorant or unethical mold remediation companies and offering five considerations (checking references, considering the big picture, sampling more than the air, considering release, and considering the source) when hiring such services. (EV)

  17. MOLD POLLUTION

    EPA Science Inventory

    Mold pollution is the growth of molds in a building resulting in a negative impact on the use of that structure. The negative impacts generally fall into two categories: destruction of the structure itself and adverse health impacts on the building's occupants. It is estimated...

  18. Molds in the Environment

    MedlinePlus

    ... visit this page: About CDC.gov . Mold Cleanup & Remediation Homeowner’s and Renter’s Guide to Mold Cleanup After ... Home or Building with Mold Damage Prevention and Remediation Strategies for the Control and Removal of Fungal ...

  19. Design of Revolute Joints for In-Mold Assembly Using Insert Molding.

    PubMed

    Ananthanarayanan, Arvind; Ehrlich, Leicester; Desai, Jaydev P; Gupta, Satyandra K

    2011-12-01

    Creating highly articulated miniature structures requires assembling a large number of small parts. This is a very challenging task and increases cost of mechanical assemblies. Insert molding presents the possibility of creating a highly articulated structure in a single molding step. This can be accomplished by placing multiple metallic bearings in the mold and injecting plastic on top of them. In theory, this idea can generate a multi degree of freedom structures in just one processing step without requiring any post molding assembly operations. However, the polymer material has a tendency to shrink on top of the metal bearings and hence jam the joints. Hence, until now insert molding has not been used to create articulated structures. This paper presents a theoretical model for estimating the extent of joint jamming that occurs due to the shrinkage of the polymer on top of the metal bearings. The level of joint jamming is seen as the effective torque needed to overcome the friction in the revolute joints formed by insert molding. We then use this model to select the optimum design parameters which can be used to fabricate functional, highly articulating assemblies while meeting manufacturing constraints. Our analysis shows that the strength of weld-lines formed during the in-mold assembly process play a significant role in determining the minimum joint dimensions necessary for fabricating functional revolute joints. We have used the models and methods described in this paper to successfully fabricate the structure for a minimally invasive medical robot prototype with potential applications in neurosurgery. To the best of our knowledge, this is the first demonstration of building an articulated structure with multiple degrees of freedom using insert molding.

  20. Molded Magnetic Article

    NASA Technical Reports Server (NTRS)

    Bryant, Robert G. (Inventor); Namkung, Min (Inventor); Wincheski, Russell A. (Inventor); Fulton, James P. (Inventor); Fox, Robert L. (Inventor)

    2000-01-01

    A molded magnetic article and fabrication method are provided. Particles of ferromagnetic material embedded in a polymer binder are molded under heat and pressure into a geometric shape. Each particle is an oblate spheroid having a radius-to-thickness aspect ratio approximately in the range of 15-30. Each oblate spheroid has flattened poles that are substantially in perpendicular alignment to a direction of the molding pressure throughout the geometric shape.

  1. Interactive Mold House Tour

    EPA Pesticide Factsheets

    Get a quick glimpse of some of the most important ways to protect your home from mold by this interactive tour of the Mold House. Room-by-room, you'll learn about common mold issues and how to address them.

  2. Kinetics of Satratoxin G Tissue Distribution and Excretion Following Intranasal Exposure in the Mouse

    PubMed Central

    Amuzie, Chidozie J.; Islam, Zahidul; Kim, Jae Kyung; Seo, Ji-Hyun; Pestka, James J.

    2010-01-01

    Intranasal exposure of mice to satratoxin G (SG), a macrocyclic trichothecene produced by the indoor air mold Stachybotrys chartarum, selectively induces apoptosis in olfactory sensory neurons (OSNs) of the nose and brain. The purpose of this study was to measure the kinetics of distribution and clearance of SG in the mouse. Following intranasal instillation of female C57B16 mice with SG (500 μg/kg bw), the toxin was detectable from 5 to 60 min in blood and plasma, with the highest concentrations, 30 and 19 ng/ml, respectively, being observed at 5 min. SG clearance from plasma was rapid and followed single-compartment kinetics (t1/2 = 20 min) and differed markedly from that of other tissues. SG concentrations were maximal at 15–30 min in nasal turbinates (480 ng/g), kidney (280 ng/g), lung (250 ng/g), spleen (200 ng/g), liver (140 ng/g), thymus (90 ng/g), heart (70 ng/g), olfactory bulb (14 ng/g), and brain (3 ng/g). The half-lives of SG in the nasal turbinate and thymus were 7.6 and 10.1 h, respectively, whereas in other organs, these ranged from 2.3 to 4.4 h. SG was detectable in feces and urine, but cumulative excretion over 5 days via these routes accounted for less than 0.3% of the total dose administered. Taken together, SG was rapidly taken up from the nose, distributed to tissues involved in respiratory, immune, and neuronal function, and subsequently cleared. However, a significant amount of the toxin was retained in the nasal turbinate, which might contribute to SG’s capacity to evoke OSN death. PMID:20466779

  3. Grinding technoloy of aspheric molds for glass-molding; Technical Digest

    NASA Astrophysics Data System (ADS)

    Kojima, Yoichi

    2005-05-01

    We introduce the method of precisely grinding of axis-symmetric aspherical glass-molding dies by using a diamond wheel. Those show how to select vertical-grinding or slant-grinding, how to grind molds with high accuracy and actual grinding results.

  4. Molds for cable dielectrics

    DOEpatents

    Roose, L.D.

    1996-12-10

    Molds for use in making end moldings for high-voltage cables are described wherein the dielectric insulator of a cable is heated and molded to conform to a desired shape. As a consequence, high quality substantially bubble-free cable connectors suitable for mating to premanufactured fittings are made. 5 figs.

  5. Bleach Neutralizes Mold Allergens

    ERIC Educational Resources Information Center

    Science Teacher, 2005

    2005-01-01

    Researchers at National Jewish Medical and Research Center have demonstrated that dilute bleach not only kills common household mold, but may also neutralize the mold allergens that cause most mold-related health complaints. The study, published in the Journal of Allergy and Clinical Immunology, is the first to test the effect on allergic…

  6. Effecting aging time of epoxy molding compound to molding process for integrated circuit packaging

    NASA Astrophysics Data System (ADS)

    Tachapitunsuk, Jirayu; Ugsornrat, Kessararat; Srisuwitthanon, Warayoot; Thonglor, Panakamon

    2017-09-01

    This research studied about effecting aging time of epoxy molding compound (EMC) that effect to reliability performance of integrated circuit (IC) package in molding process. Molding process is so important of IC packaging process for protecting IC chip (or die) from temperature and humidity environment using encapsulated EMC. For general molding process, EMC are stored in the frozen at 5°C and left at room temperature at 25 °C for aging time on self before molding of die onto lead frame is 24 hours. The aging time effect to reliability performance of IC package due to different temperature and humidity inside the package. In experiment, aging time of EMC were varied from 0 to 24 hours for molding process of SOIC-8L packages. For analysis, these packages were tested by x-ray and scanning acoustic microscope to analyze properties of EMC with an aging time and also analyzed delamination, internal void, and wire sweep inside the packages with different aging time. The results revealed that different aging time of EMC effect to properties and reliability performance of molding process.

  7. Staged mold for encapsulating hazardous wastes

    DOEpatents

    Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

    1990-01-01

    A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

  8. Staged mold for encapsulating hazardous wastes

    DOEpatents

    Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

    1988-01-01

    A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

  9. QUANTIFYING INDOOR MOLDS

    EPA Science Inventory

    There is growing awareness that indoor molds/fungi may be connected to such conditions as asthma, allergies, hemorrhaging, chronic rhinosinusitis, memory loss, and a symptom complex called sick-building-syndrome. In addition, molds cause frequently fatal nosocomical infections. ...

  10. Thermophilic molds: Biology and applications.

    PubMed

    Singh, Bijender; Poças-Fonseca, Marcio J; Johri, B N; Satyanarayana, Tulasi

    2016-11-01

    Thermophilic molds thrive in a variety of natural habitats including soils, composts, wood chip piles, nesting materials of birds and other animals, municipal refuse and others, and ubiquitous in their distribution. These molds grow in simple media containing carbon and nitrogen sources and mineral salts. Polyamines are synthesized in these molds and the composition of lipids varies considerably, predominantly containing palmitic, oleic and linoleic acids with low levels of lauric, palmiotoleic and stearic acids. Thermophilic molds are capable of efficiently degrading organic materials by secreting thermostable enzymes, which are useful in the bioremediation of industrial wastes and effluents that are rich in oil, heavy metals, anti-nutritional factors such as phytic acid and polysaccharides. Thermophilic molds synthesize several antimicrobial substances and biotechnologically useful miscellaneous enzymes. The analysis of genomes of thermophilic molds reveals high G:C contents, shorter introns and intergenic regions with lesser repetitive sequences, and further confirms their ability to degrade agro-residues efficiently. Genetic engineering has aided in ameliorating the characteristics of the enzymes of thermophilic molds. This review is aimed at focusing on the biology of thermophilic molds with emphasis on recent developments in the analysis of genomes, genetic engineering and potential applications.

  11. MOLD SPECIFIC QUANTITATIVE PCR: THE EMERGING STANDARD IN MOLD ANALYSIS

    EPA Science Inventory

    Today I will talk about the use of quantitative or Real time PCR for the standardized identification and quantification of molds. There are probably at least 100,000 species of molds or fungi. But there are actually about 100 typically found indoors. Some pose a threat to human...

  12. Mold Allergy: Proper Humidifier Care

    MedlinePlus

    ... Training Home Conditions Allergy Allergy Overview Allergy Allergens Mold Allergy Proper Humidifier Care Proper Humidifier Care Make ... neglected humidifier can be a major source of mold and mold spores. Learn how to keep a ...

  13. Allergy and "toxic mold syndrome".

    PubMed

    Edmondson, David A; Nordness, Mark E; Zacharisen, Michael C; Kurup, Viswanath P; Fink, Jordan N

    2005-02-01

    "Toxic mold syndrome" is a controversial diagnosis associated with exposure to mold-contaminated environments. Molds are known to induce asthma and allergic rhinitis through IgE-mediated mechanisms, to cause hypersensitivity pneumonitis through other immune mechanisms, and to cause life-threatening primary and secondary infections in immunocompromised patients. Mold metabolites may be irritants and may be involved in "sick building syndrome." Patients with environmental mold exposure have presented with atypical constitutional and systemic symptoms, associating those symptoms with the contaminated environment. To characterize the clinical features and possible etiology of symptoms in patients with chief complaints related to mold exposure. Review of patients presenting to an allergy and asthma center with the chief complaint of toxic mold exposure. Symptoms were recorded, and physical examinations, skin prick/puncture tests, and intracutaneous tests were performed. A total of 65 individuals aged 1 1/2 to 52 years were studied. Symptoms included rhinitis (62%), cough (52%), headache (34%), respiratory symptoms (34%), central nervous system symptoms (25%), and fatigue (23%). Physical examination revealed pale nasal mucosa, pharyngeal "cobblestoning," and rhinorrhea. Fifty-three percent (33/62) of the patients had skin reactions to molds. Mold-exposed patients can present with a variety of IgE- and non-IgE-mediated symptoms. Mycotoxins, irritation by spores, or metabolites may be culprits in non-IgE presentations; environmental assays have not been perfected. Symptoms attributable to the toxic effects of molds and not attributable to IgE or other immune mechanisms need further evaluation as to pathogenesis. Allergic, rather than toxic, responses seemed to be the major cause of symptoms in the studied group.

  14. Molding process for imidazopyrrolone polymers

    NASA Technical Reports Server (NTRS)

    Johnson, C. L. (Inventor)

    1973-01-01

    A process is described for producing shaped articles of imidazopyrrolone polymers comprising molding imidazopyrrolone polymer molding power under pressure and at a temperature greater than 475 C. Moderate pressures may be employed. Preferably, prior to molding, a preform is prepared by isostatic compression. The preform may be molded at a relatively low initial pressure and temperature; as the temperature is increased to a value greater than 475 C., the pressure is also increased.

  15. Creating mold-free buildings: a key to avoiding health effects of indoor molds.

    PubMed

    Small, Bruce M

    2003-08-01

    In view of the high costs of building diagnostics and repair subsequent to water damage--as well as the large medical diagnostic and healthcare costs associated with mold growth in buildings--commitment to a philosophy of proactive preventive maintenance for home, apartment, school, and commercial buildings could result in considerable cost savings and avoidance of major health problems among building occupants. The author identifies common causes of mold growth in buildings and summarizes key building design and construction principles essential for preventing mold contamination indoors. Physicians and healthcare workers must be made aware of conditions within buildings that can give rise to mold growth, and of resulting health problems. Timely advice provided to patients already sensitized by exposure to molds could save these individuals, and their families, from further exposures as a result of inadequate building maintenance or an inappropriate choice of replacement housing.

  16. Traditional Mold Analysis Compared to a DNA-based Method of Mold Analysis with Applications in Asthmatics' Homes

    EPA Science Inventory

    Traditional environmental mold analysis is based-on microscopic observations and counting of mold structures collected from the air on a sticky surface or culturing of molds on growth media for identification and quantification. A DNA-based method of mold analysis called mol...

  17. Mycoflora and mycotoxin-producing fungi of air-dust particles from Egypt.

    PubMed

    Abdel-Hafez, S I; Shoreit, A A; Abdel-Hafez, A I; el Maghraby, O M

    1986-01-01

    Using the dilution-plate method, 27 genera and 64 species were collected from 20 air-dust samples on glucose - (24 genera and 57 species) and cellulose - (21 genera and 45 species) Czapek's agar at 28 degrees C. There are basic similarities between the mycoflora of air-dust on the two media and the most prevalent species were Aspergillus niger, A. flavus, A. ochraceus, A. terreus, A. versicolor, Penicillium chrysogenum, P. funiculosum, Alternaria alternata, Cladosporium herbarum, Fusarium oxysporum, Rhizopus stolonifer and Trichoderma viride. Chaetomium globosum, Stachybotrys chartarum, Humicola grisea and Arthrobotrys oligospora were common only on cellulose agar plates. Extracts of mycelium from 25 isolates were tested with brine schrimp (Artemia salina); of these 23 displayed varying degrees of toxicity. Thin layer chromatographic analysis of 12 isolates of Aspergillus flavus revealed that 4 strains were producing detectable aflatoxin. Zearalenone production was noted for 3 out of 5 strains of Fusarium oxysporum and 2 out of 5 strains of F. solani.

  18. Computer-aided injection molding system

    NASA Astrophysics Data System (ADS)

    Wang, K. K.; Shen, S. F.; Cohen, C.; Hieber, C. A.; Isayev, A. I.

    1982-10-01

    Achievements are reported in cavity-filling simulation, modeling viscoelastic effects, measuring and predicting frozen-in birefringence in molded parts, measuring residual stresses and associated mechanical properties of molded parts, and developing an interactive mold-assembly design program and an automatic NC maching data generation and verification program. The Cornell Injection Molding Program (CIMP) consortium is discussed as are computer user manuals that have been published by the consortium. Major tasks which should be addressed in future efforts are listed, including: (1) predict and experimentally determine the post-fillin behavior of thermoplastics; (2) simulate and experimentally investigate the injection molding of thermosets and filled materials; and (3) further investigate residual stresses, orientation and mechanical properties.

  19. Effects of mold geometry on fiber orientation of powder injection molded metal matrix composites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahmad, Faiz, E-mail: faizahmad@petronas.com.my; Aslam, Muhammad, E-mail: klaira73@gmail.com; Altaf, Khurram, E-mail: khurram.altaf@petronas.com.my

    2015-07-22

    Fiber orientations in metal matrix composites have significant effect on improving tensile properties. Control of fiber orientations in metal injection molded metal composites is a difficult task. In this study, two mold cavities of dimensions 6x6x90 mm and 10x20x180 mm were used for comparison of fiber orientation in injection molded metal composites test parts. In both mold cavities, convergent and divergent flows were developed by modifying the sprue dimensions. Scanning electron microscope (SEM) was used to examine the fiber orientations within the test samples. The results showed highly aligned fiber in injection molded test bars developed from the convergent melt flow. Randommore » orientation of fibers was noted in the composites test bars produced from divergent melt flow.« less

  20. Toxigenic molds in water-damaged buildings: dechlorogriseofulvins from Memnoniella echinata.

    PubMed

    Jarvis, B B; Zhou, Y; Jiang, J; Wang, S; Sorenson, W G; Hintikka, E L; Nikulin, M; Parikka, P; Etzel, R A; Dearborn, D G

    1996-06-01

    An investigation of a cluster of cases of pulmonary hemosiderosis in infants in Cleveland, OH, led to the isolation of many isolates of Stachybotrys atra and two isolates of a related toxigenic fungus, Memnoniella echinata. M. echinata produces two cytotoxic trichothecene mycotoxins, trichodermol (1a) and trichodermin (1b), as well as several griseofulvins. Dechlorogriseofulvin (2a) and epidechlorogriseofulvin (2b) were the major compounds isolated. This is the first report of a fungus outside the Penicillium genus producing griseofulvins.

  1. Failure strengths of denture teeth fabricated on injection molded or compression molded denture base resins.

    PubMed

    Robison, Nathan E; Tantbirojn, Daranee; Versluis, Antheunis; Cagna, David R

    2016-08-01

    Denture tooth fracture or debonding remains a common problem in removable prosthodontics. The purpose of this in vitro study was to explore factors determining failure strengths for combinations of different denture tooth designs (shape, materials) and injection or compression molded denture base resins. Three central incisor denture tooth designs were tested: nanohybrid composite (NHC; Ivoclar Phonares II), interpenetrating network (IPN; Dentsply Portrait), and microfiller reinforced polyacrylic (MRP; VITA Physiodens). Denture teeth of each type were processed on an injection molded resin (IvoBase HI; Ivoclar Vivadent AG) or a compression molded resin (Lucitone 199; Dentsply Intl) (n=11 or 12). The denture teeth were loaded at 45 degrees on the incisal edge. The failure load was recorded and analyzed with 2-way ANOVA (α=.05), and the fracture mode was categorized from observed fracture surfaces as cohesive, adhesive, or mixed failure. The following failure loads (mean ±SD) were recorded: NHC/injection molded 280 ±52 N; IPN/injection molded 331 ±41 N; MRP/injection molded 247 ±23 N; NHC/compression molded 204 ±31 N; IPN/compression molded 184 ±17 N; MRP/compression molded 201 ±16 N. Injection molded resin yielded significantly higher failure strength for all denture teeth (P<.001), among which IPN had the highest strength. Failure was predominantly cohesive in the teeth, with the exception of mixed mode for the IPN/compression group. When good bonding was achieved, the strength of the structure (denture tooth/base resin combination) was determined by the strength of the denture teeth, which may be affected by the processing technique. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  2. Pyrotechnic filled molding powder

    DOEpatents

    Hartzel, Lawrence W.; Kettling, George E.

    1978-01-01

    The disclosure relates to thermosetting molding compounds and more particularly to a pyrotechnic filled thermosetting compound comprising a blend of unfilled diallyl phthalate molding powder and a pyrotechnic mixture.

  3. ILLUSTRATED HANDBOOK OF SOME COMMON MOLDS.

    ERIC Educational Resources Information Center

    CHANDLER, MARION N.

    THIS DOCUMENT IS A PICTURE GUIDE FOR THE IDENTIFICATION OF TEN COMMON MOLDS. IT IS DESIGNED FOR USE WITH THE ELEMENTARY SCIENCE STUDY UNIT "MICROGARDENING" AND IS SUGGESTED FOR UPPER ELEMENTARY GRADES. INCLUDED FOR EACH MOLD ARE COLOR PHOTOGRAPHS AND PHOTOMICROGRAPHS OF THE INTACT MOLD MASS AND OF THE MOLD'S SPORE PRODUCING STRUCTURES.…

  4. 21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 2 2012-04-01 2012-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION..., sheep's milk blue-mold, and blue-mold cheese from sheep's milk. (a) Description. (1) Roquefort cheese...

  5. 21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 2 2014-04-01 2014-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION..., sheep's milk blue-mold, and blue-mold cheese from sheep's milk. (a) Description. (1) Roquefort cheese...

  6. 21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 2 2013-04-01 2013-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION..., sheep's milk blue-mold, and blue-mold cheese from sheep's milk. (a) Description. (1) Roquefort cheese...

  7. Mathematical modeling of the process of filling a mold during injection molding of ceramic products

    NASA Astrophysics Data System (ADS)

    Kulkov, S. N.; Korobenkov, M. V.; Bragin, N. A.

    2015-10-01

    Using the software package Fluent it have been predicted of the filling of a mold in injection molding of ceramic products is of great importance, because the strength of the final product is directly related to the presence of voids in the molding, making possible early prediction of inaccuracies in the mold prior to manufacturing. The calculations were performed in the formulation of mathematical modeling of hydrodynamic turbulent process of filling a predetermined volume of a viscous liquid. The model used to determine the filling forms evaluated the influence of density and viscosity of the feedstock, and the injection pressure on the mold filling process to predict the formation of voids in the area caused by the shape defect geometry.

  8. Floods and Mold Growth

    EPA Pesticide Factsheets

    Mold growth may be a problem after flooding. Excess moisture in the home is cause for concern about indoor air quality primarily because it provides breeding conditions for pests, molds and other microorganisms.

  9. Environmental Sustainability and Mold Hygiene in Buildings

    PubMed Central

    Ng, Tsz Wai; Lai, Ka Man

    2018-01-01

    Environmental sustainability is one of the key issues in building management. In Hong Kong, one of the initiatives is to reduce the operation hours of air-conditioning in buildings to cut down energy consumption. In this study, we reported a mold contamination case in a newly refurbished laboratory, in which the air-conditioner was switched from 24- to 18-h mode after refurbishment. In order to prevent mold recurrence, the air-conditioner was switched back to 24-h mode in the laboratory. During the mold investigation, visible mold patches in the laboratory were searched and then cultured, counted and identified. Building and environmental conditions were recorded, and used to deduce different causes of mold contamination. Eight contaminated sites including a wall, a bench, some metal and plastic surfaces and seven types of molds including two Cladosporium spp., two Aspergillus spp., one Rhizopus sp., one Trichoderma sp., and one Tritirachium sp. were identified. Cladosporium spp. were the most abundant and frequently found molds in the laboratory. The contaminated areas could have one to five different species on them. Based on the mold and environmental conditions, several scenarios causing the mold contamination were deduced, and different mold control measures were discussed to compare them with the current solution of using 24-h air-conditioning to control mold growth. This study highlights the importance of mold hygiene in sustainable building management. PMID:29617339

  10. Environmental Sustainability and Mold Hygiene in Buildings.

    PubMed

    Wu, Haoxiang; Ng, Tsz Wai; Wong, Jonathan Wc; Lai, Ka Man

    2018-04-04

    Environmental sustainability is one of the key issues in building management. In Hong Kong, one of the initiatives is to reduce the operation hours of air-conditioning in buildings to cut down energy consumption. In this study, we reported a mold contamination case in a newly refurbished laboratory, in which the air-conditioner was switched from 24- to 18-h mode after refurbishment. In order to prevent mold recurrence, the air-conditioner was switched back to 24-h mode in the laboratory. During the mold investigation, visible mold patches in the laboratory were searched and then cultured, counted and identified. Building and environmental conditions were recorded, and used to deduce different causes of mold contamination. Eight contaminated sites including a wall, a bench, some metal and plastic surfaces and seven types of molds including two Cladosporium spp., two Aspergillus spp., one Rhizopus sp., one Trichoderma sp., and one Tritirachium sp. were identified. Cladosporium spp. were the most abundant and frequently found molds in the laboratory. The contaminated areas could have one to five different species on them. Based on the mold and environmental conditions, several scenarios causing the mold contamination were deduced, and different mold control measures were discussed to compare them with the current solution of using 24-h air-conditioning to control mold growth. This study highlights the importance of mold hygiene in sustainable building management.

  11. Predicting shrinkage and warpage in injection molding: Towards automatized mold design

    NASA Astrophysics Data System (ADS)

    Zwicke, Florian; Behr, Marek; Elgeti, Stefanie

    2017-10-01

    It is an inevitable part of any plastics molding process that the material undergoes some shrinkage during solidification. Mainly due to unavoidable inhomogeneities in the cooling process, the overall shrinkage cannot be assumed as homogeneous in all volumetric directions. The direct consequence is warpage. The accurate prediction of such shrinkage and warpage effects has been the subject of a considerable amount of research, but it is important to note that this behavior depends greatly on the type of material that is used as well as the process details. Without limiting ourselves to any specific properties of certain materials or process designs, we aim to develop a method for the automatized design of a mold cavity that will produce correctly shaped moldings after solidification. Essentially, this can be stated as a shape optimization problem, where the cavity shape is optimized to fulfill some objective function that measures defects in the molding shape. In order to be able to develop and evaluate such a method, we first require simulation methods for the diffierent steps involved in the injection molding process that can represent the phenomena responsible for shrinkage and warpage ina sufficiently accurate manner. As a starting point, we consider the solidification of purely amorphous materials. In this case, the material slowly transitions from fluid-like to solid-like behavior as it cools down. This behavior is modeled using adjusted viscoelastic material models. Once the material has passed a certain temperature threshold during cooling, any viscous effects are neglected and the behavior is assumed to be fully elastic. Non-linear elastic laws are used to predict shrinkage and warpage that occur after this point. We will present the current state of these simulation methods and show some first approaches towards optimizing the mold cavity shape based on these methods.

  12. Method for molding ceramic powders

    DOEpatents

    Janney, Mark A.

    1990-01-01

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, whereafter the product may be sintered.

  13. Method for molding ceramic powders

    DOEpatents

    Janney, M.A.

    1990-01-16

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, where after the product may be sintered.

  14. Precision injection molding of freeform optics

    NASA Astrophysics Data System (ADS)

    Fang, Fengzhou; Zhang, Nan; Zhang, Xiaodong

    2016-08-01

    Precision injection molding is the most efficient mass production technology for manufacturing plastic optics. Applications of plastic optics in field of imaging, illumination, and concentration demonstrate a variety of complex surface forms, developing from conventional plano and spherical surfaces to aspheric and freeform surfaces. It requires high optical quality with high form accuracy and lower residual stresses, which challenges both optical tool inserts machining and precision injection molding process. The present paper reviews recent progress in mold tool machining and precision injection molding, with more emphasis on precision injection molding. The challenges and future development trend are also discussed.

  15. Exploring the problem of mold growth and the efficacy of various mold inhibitor methods during moisture sorption isotherm measurements.

    PubMed

    Yu, X; Martin, S E; Schmidt, S J

    2008-03-01

    Mold growth is a common problem during the equilibration of food materials at high relative humidity values using the standard saturated salt slurry method. Exposing samples to toluene vapor and mixing samples with mold inhibitor chemicals are suggested methods for preventing mold growth while obtaining isotherms. However, no published research was found that examined the effect of mold growth on isotherm performance or the efficacy of various mold inhibitor methods, including their possible effect on the physicochemical properties of food materials. Therefore, the objectives of this study were to (1) explore the effect of mold growth on isotherm performance in a range of food materials, (2) investigate the effectiveness of 4 mold inhibitor methods, irradiation, 2 chemical inhibitors (potassium sorbate and sodium acetate), and toluene vapor, on mold growth on dent corn starch inoculated with A. niger, and (3) examine the effect of mold inhibitor methods on the physicochemical properties of dent corn starch, including isotherm performance, pasting properties, gelatinization temperature, and enthalpy. Mold growth was found to affect starch isotherm performance by contributing to weight changes during sample equilibration. Among the 4 mold inhibitor methods tested, irradiation and toluene vapor were found to be the most effective for inhibiting growth of A. niger on dent cornstarch. However, both methods exhibited a significant impact on the starches' physiochemical properties, suggesting the need to probe the efficacy of other mold inhibitor methods and explore the use of new rapid isotherm instruments, which hamper mold growth by significantly decreasing measurement time.

  16. Reversal of Refractory Ulcerative Colitis and Severe Chronic Fatigue Syndrome Symptoms Arising from Immune Disturbance in an HLADR/DQ Genetically Susceptible Individual with Multiple Biotoxin Exposures

    PubMed Central

    Gunn, Shelly R.; Gibson Gunn, G.; Mueller, Francis W.

    2016-01-01

    Patient: Male, 25 Final Diagnosis: Ulcerative colitis and chronic fatigue syndrome Symptoms: Colitis • profound fatigue • multi-joint pain • cognitive impairment • corneal keratitis Medication: — Clinical Procedure: VIP replacement therapy Specialty: Family Medicine Objective: Unusual clinical course Background: Patients with multisymptom chronic conditions, such as refractory ulcerative colitis (RUC) and chronic fatigue syndrome (CFS), present diagnostic and management challenges for clinicians, as well as the opportunity to recognize and treat emerging disease entities. In the current case we report reversal of co-existing RUC and CFS symptoms arising from biotoxin exposures in a genetically susceptible individual. Case Report: A 25-year-old previously healthy male with new-onset refractory ulcerative colitis (RUC) and chronic fatigue syndrome (CFS) tested negative for autoimmune disease biomarkers. However, urine mycotoxin panel testing was positive for trichothecene group and air filter testing from the patient’s water-damaged rental house identified the toxic mold Stachybotrys chartarum. HLA-DR/DQ testing revealed a multisusceptible haplotype for development of chronic inflammation, and serum chronic inflammatory response syndrome (CIRS) biomarker testing was positive for highly elevated TGF-beta and a clinically undetectable level of vasoactive intestinal peptide (VIP). Following elimination of biotoxin exposures, VIP replacement therapy, dental extractions, and implementation of a mind body intervention-relaxation response (MBI-RR) program, the patient’s symptoms resolved. He is off medications, back to work, and resuming normal exercise. Conclusions: This constellation of RUC and CFS symptoms in an HLA-DR/DQ genetically susceptible individual with biotoxin exposures is consistent with the recently described CIRS disease pathophysiology. Chronic immune disturbance (turbatio immuno) can be identified with clinically available CIRS biomarkers and

  17. REFRACTORY COATING FOR GRAPHITE MOLDS

    DOEpatents

    Stoddard, S.D.

    1958-06-24

    Refractory coating for graphite molds used in the casting of uranium is described. The coating is an alumino-silicate refractory composition which may be used as a mold surface in solid form or as a coating applied to the graphite mold. The composition consists of a mixture of ball clay, kaolin, alumina cement, alumina, water, sodium silicate, and sodium carbonate.

  18. Investigation of Heat Transfer at the Mold/Metal Interface in Permanent Mold Casting of Light Alloys

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Robert D. Pehlke; John T. Berry

    2005-12-16

    Accurate modeling of the metal casting process prior to creating a mold design demands reliable knowledge of the interfacial heat transfer coefficient at the mold metal interface as a function of both time and location. The phenomena concerned with the gap forming between the mold and the solidifying metal are complex but need to be understood before any modeling is attempted. The presence of mold coatings further complicates the situation. A commercial casting was chosen and studied in a gravity permanent mold casting process. The metal/mold interfacial heat transfer coefficient (IHTC) was the focus of the research. A simple, directmore » method has been used to evaluate the IHTC. Both the simulation and experiments have shown that a reasonably good estimate of the heat transfer coefficient could be made in the case studied. It has been found that there is a good agreement between experiments and simulations in the temperature profiles during the solidification process, given that the primary mechanism of heat transfer across the gap in permanent mold casting of light alloys is by conduction across the gap. The procedure utilized to determine the interfacial heat transfer coefficient can be applied to other casting processes. A recently completed project involving The University of Michigan and Mississippi State University, together with several industrial partners, which was supported by the USDOE through the Cast Metals Coalition, examined a number of cases of thermal contact. In an investigation which gave special consideration to the techniques of measurement, several mold coatings were employed and results presented as a function of time. Realistic conditions of coating thickness and type together with an appropriate combination of mold preheat and metal pouring temperature were strictly maintained throughout the investigation. Temperature sensors, in particular thermocouples, play an important part in validating the predictions of solidification models

  19. Localized mold heating with the aid of selective induction for injection molding of high aspect ratio micro-features

    NASA Astrophysics Data System (ADS)

    Park, Keun; Lee, Sang-Ik

    2010-03-01

    High-frequency induction is an efficient, non-contact means of heating the surface of an injection mold through electromagnetic induction. Because the procedure allows for the rapid heating and cooling of mold surfaces, it has been recently applied to the injection molding of thin-walled parts or micro/nano-structures. The present study proposes a localized heating method involving the selective use of mold materials to enhance the heating efficiency of high-frequency induction heating. For localized induction heating, a composite injection mold of ferromagnetic material and paramagnetic material is used. The feasibility of the proposed heating method is investigated through numerical analyses in terms of its heating efficiency for localized mold surfaces and in terms of the structural safety of the composite mold. The moldability of high aspect ratio micro-features is then experimentally compared under a variety of induction heating conditions.

  20. Particle Image Velocimetry During Injection Molding

    NASA Astrophysics Data System (ADS)

    Bress, Thomas; Dowling, David

    2012-11-01

    Injection molding involves the unsteady non-isothermal flow of a non-Newtonian polymer melt. An optical-access mold has been used to perform particle image velocimetry (PIV) on molten polystyrene during injection molding. Velocimetry data of the mold-filling flow will be presented. Statistical assessments of the velocimetry data and scaled residuals of the continuity equation suggest that PIV can be conducted in molten plastics with an uncertainty of +/-2 percent. Simulations are often used to model polymer flow during injection molding to design molds and select processing parameters but it is difficult to determine the accuracy of these simulations due to a lack of in-mold velocimetry and melt-front progression data. Moldflow was used to simulate the filling of the optical-access mold, and these simulated results are compared to the appropriately-averaged time-varying velocity field measurements. Simulated results for melt-front progression are also compared with the experimentally observed flow fronts. The ratio of the experimentally measured average velocity magnitudes to the simulation magnitudes was found on average to be 0.99 with a standard deviation of 0.25, and the difference in velocity orientations was found to be 0.9 degree with a standard deviation of 3.2 degrees. formerly at the University of Michigan.

  1. Dynamic Feed Control For Injection Molding

    DOEpatents

    Kazmer, David O.

    1996-09-17

    The invention provides methods and apparatus in which mold material flows through a gate into a mold cavity that defines the shape of a desired part. An adjustable valve is provided that is operable to change dynamically the effective size of the gate to control the flow of mold material through the gate. The valve is adjustable while the mold material is flowing through the gate into the mold cavity. A sensor is provided for sensing a process condition while the part is being molded. During molding, the valve is adjusted based at least in part on information from the sensor. In the preferred embodiment, the adjustable valve is controlled by a digital computer, which includes circuitry for acquiring data from the sensor, processing circuitry for computing a desired position of the valve based on the data from the sensor and a control data file containing target process conditions, and control circuitry for generating signals to control a valve driver to adjust the position of the valve. More complex embodiments include a plurality of gates, sensors, and controllable valves. Each valve is individually controllable so that process conditions corresponding to each gate can be adjusted independently. This allows for great flexibility in the control of injection molding to produce complex, high-quality parts.

  2. A method for detecting fungal contaminants in wall cavities.

    PubMed

    Spurgeon, Joe C

    2003-01-01

    This article describes a practical method for detecting the presence of both fungal spores and culturable fungi in wall cavities. Culturable fungi were collected in 25 mm cassettes containing 0.8 microm mixed cellulose ester filters using aggressive sampling conditions. Both culturable fungi and fungal spores were collected in modified slotted-disk cassettes. The sample volume was 4 L. The filters were examined microscopically and dilution plated onto multiple culture media. Collecting airborne samples in filter cassettes was an effective method for assessing wall cavities for fungal contaminants, especially because this method allowed the sample to be analyzed by both microscopy and culture media. Assessment criteria were developed that allowed the sample results to be used to classify wall cavities as either uncontaminated or contaminated. As a criterion, wall cavities with concentrations of culturable fungi below the limit of detection (LOD) were classified as uncontaminated, whereas those cavities with detectable concentrations of culturable fungi were classified as contaminated. A total of 150 wall cavities was sampled as part of a field project. The concentrations of culturable fungi were below the LOD in 34% of the samples, whereas Aspergillus and/or Penicillium were the only fungal genera detected in 69% of the samples in which culturable fungi were detected. Spore counting resulted in the detection of Stachybotrys-like spores in 25% of the samples that were analyzed, whereas Stachybotrys chartarum colonies were only detected on 2% of malt extract agar plates and on 6% of corn meal agar plates.

  3. Rapid and low-cost prototyping of medical devices using 3D printed molds for liquid injection molding.

    PubMed

    Chung, Philip; Heller, J Alex; Etemadi, Mozziyar; Ottoson, Paige E; Liu, Jonathan A; Rand, Larry; Roy, Shuvo

    2014-06-27

    Biologically inert elastomers such as silicone are favorable materials for medical device fabrication, but forming and curing these elastomers using traditional liquid injection molding processes can be an expensive process due to tooling and equipment costs. As a result, it has traditionally been impractical to use liquid injection molding for low-cost, rapid prototyping applications. We have devised a method for rapid and low-cost production of liquid elastomer injection molded devices that utilizes fused deposition modeling 3D printers for mold design and a modified desiccator as an injection system. Low costs and rapid turnaround time in this technique lower the barrier to iteratively designing and prototyping complex elastomer devices. Furthermore, CAD models developed in this process can be later adapted for metal mold tooling design, enabling an easy transition to a traditional injection molding process. We have used this technique to manufacture intravaginal probes involving complex geometries, as well as overmolding over metal parts, using tools commonly available within an academic research laboratory. However, this technique can be easily adapted to create liquid injection molded devices for many other applications.

  4. Bag molding processes

    NASA Astrophysics Data System (ADS)

    Slobodzinsky, A.

    Features, materials, and techniques of vacuum, pressure, and autoclave FRP bag molding processes are described. The bags are used in sealed environments, inflated to flexibly force a curing FRP laminate to conform to a stiff mold form which defines the shape of the finished product. Densification is achieved as the bag presses out the voids and excess resin from the laminate, and consolidation occurs as the plies and adherends are bonded by the bag pressure. Curing techniques nominally involved room temperature or high temperature, and investigations of alternative techniques, such as induction, dielectric, microwave, xenon flash, UV, electron beam, and gamma radiation heating are proceeding. Polysulfone is the most common thermoplastic. Details are given of mold preparations, peel plies or release films and fabrics, bagging techniques, and reusable venting blankets and silicone rubber bags.

  5. Effect of cross sectional geometry on PDMS micro peristaltic pump performance: comparison of SU-8 replica molding vs. micro injection molding.

    PubMed

    Graf, Neil J; Bowser, Michael T

    2013-10-07

    Two different fabrication methods were employed to fabricate micropumps with different cross-sectional channel geometries. The first was to fabricate rectangular cross-sectional microchannel geometries using the well known fabrication method of replica molding (REM). The second, and far less utilized fabrication technique, was to create microchannel molds using an in-house fabricated handheld micro injection molding apparatus. The injection mold apparatus was designed for use with elastomeric room temperature vulcanization (RTV) polymers, as opposed to most other injection molding machines, which are designed for use with thermoplastic polymers. The injection mold's bottom plate was used as a microchannel molding template. The molding template was created by threading a small-diameter wire (150 μm or less) through the injection mold's bottom plate, with subsequent adhesion and smoothing of a thin piece of aluminum foil over the wire-raised injection mold template. When molded against, the template produced a rounded/Gaussian-shaped PDMS microchannel. The design of the injection mold will be presented, along with a direct comparison for micropump performance metrics such as flow rate, valving characteristics, and maximum backpressures attainable for each of the respective micropump channel geometries.

  6. Presurgical nasoalveolar molding for cleft lip and palate: the application of digitally designed molds.

    PubMed

    Shen, Congcong; Yao, Caroline A; Magee, William; Chai, Gang; Zhang, Yan

    2015-06-01

    The authors present a novel nasoalveolar molding protocol by prefabricating sets of nasoalveolar molding appliances using three-dimensional technology. Prospectively, 17 infants with unilateral complete cleft lip and palate underwent the authors' protocol before primary cheiloplasty. An initial nasoalveolar molding appliance was created based on the patient's first and only in-person maxillary cast, produced from a traditional intraoral dental impression. Thereafter, each patient's molding course was simulated using computer software that aimed to narrow the alveolar gap by 1 mm each week by rotating the greater alveolar segment. A maxillary cast of each predicted molding stage was created using three-dimensional printing. Subsequent appliances were constructed in advance, based on the series of computer-generated casts. Each patient had a total three clinic visits spaced 1 month apart. Anthropometric measurements and bony segment volumes were recorded before and after treatment. Alveolar cleft widths narrowed significantly (p < 0.01), soft-tissue volume of each segment expanded (p < 0.01), and the arc of the alveolus became more contiguous across the cleft (p < 0.01). One patient required a new appliance at the second visit because of bleeding and discomfort. Eleven patients had mucosal irritation and two experienced minor mucosal ulceration. Three-dimensional technology can precisely represent anatomic structures in pediatric clefts. Results from the authors' algorithm are equivalent to those of traditional nasoalveolar molding therapies; however, the number of required clinic visits and appliance adjustments decreased. As three-dimensional technology costs decrease, multidisciplinary teams may design customized nasoalveolar molding treatment with improved efficiency and less burden to medical staff, patients, and families. Therapeutic, IV.

  7. Modeling and Simulation of Compression Molding Process for Sheet Molding Compound (SMC) of Chopped Carbon Fiber Composites

    DOE PAGES

    Li, Yang; Chen, Zhangxing; Xu, Hongyi; ...

    2017-01-02

    Compression molded SMC composed of chopped carbon fiber and resin polymer which balances the mechanical performance and manufacturing cost presents a promising solution for vehicle lightweight strategy. However, the performance of the SMC molded parts highly depends on the compression molding process and local microstructure, which greatly increases the cost for the part level performance testing and elongates the design cycle. ICME (Integrated Computational Material Engineering) approaches are thus necessary tools to reduce the number of experiments required during part design and speed up the deployment of the SMC materials. As the fundamental stage of the ICME workflow, commercial softwaremore » packages for SMC compression molding exist yet remain not fully validated especially for chopped fiber systems. In this study, SMC plaques are prepared through compression molding process. The corresponding simulation models are built in Autodesk Moldflow with the same part geometry and processing conditions as in the molding tests. The output variables of the compression molding simulations, including press force history and fiber orientation of the part, are compared with experimental data. Influence of the processing conditions to the fiber orientation of the SMC plaque is also discussed. It is found that generally Autodesk Moldflow can achieve a good simulation of the compression molding process for chopped carbon fiber SMC, yet quantitative discrepancies still remain between predicted variables and experimental results.« less

  8. Modeling and Simulation of Compression Molding Process for Sheet Molding Compound (SMC) of Chopped Carbon Fiber Composites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Yang; Chen, Zhangxing; Xu, Hongyi

    Compression molded SMC composed of chopped carbon fiber and resin polymer which balances the mechanical performance and manufacturing cost presents a promising solution for vehicle lightweight strategy. However, the performance of the SMC molded parts highly depends on the compression molding process and local microstructure, which greatly increases the cost for the part level performance testing and elongates the design cycle. ICME (Integrated Computational Material Engineering) approaches are thus necessary tools to reduce the number of experiments required during part design and speed up the deployment of the SMC materials. As the fundamental stage of the ICME workflow, commercial softwaremore » packages for SMC compression molding exist yet remain not fully validated especially for chopped fiber systems. In this study, SMC plaques are prepared through compression molding process. The corresponding simulation models are built in Autodesk Moldflow with the same part geometry and processing conditions as in the molding tests. The output variables of the compression molding simulations, including press force history and fiber orientation of the part, are compared with experimental data. Influence of the processing conditions to the fiber orientation of the SMC plaque is also discussed. It is found that generally Autodesk Moldflow can achieve a good simulation of the compression molding process for chopped carbon fiber SMC, yet quantitative discrepancies still remain between predicted variables and experimental results.« less

  9. Rapid and Low-cost Prototyping of Medical Devices Using 3D Printed Molds for Liquid Injection Molding

    PubMed Central

    Chung, Philip; Heller, J. Alex; Etemadi, Mozziyar; Ottoson, Paige E.; Liu, Jonathan A.; Rand, Larry; Roy, Shuvo

    2014-01-01

    Biologically inert elastomers such as silicone are favorable materials for medical device fabrication, but forming and curing these elastomers using traditional liquid injection molding processes can be an expensive process due to tooling and equipment costs. As a result, it has traditionally been impractical to use liquid injection molding for low-cost, rapid prototyping applications. We have devised a method for rapid and low-cost production of liquid elastomer injection molded devices that utilizes fused deposition modeling 3D printers for mold design and a modified desiccator as an injection system. Low costs and rapid turnaround time in this technique lower the barrier to iteratively designing and prototyping complex elastomer devices. Furthermore, CAD models developed in this process can be later adapted for metal mold tooling design, enabling an easy transition to a traditional injection molding process. We have used this technique to manufacture intravaginal probes involving complex geometries, as well as overmolding over metal parts, using tools commonly available within an academic research laboratory. However, this technique can be easily adapted to create liquid injection molded devices for many other applications. PMID:24998993

  10. HIGH TEMPERATURE REFRACTORY COATING FOR GRAPHITE MOLDS

    DOEpatents

    Stoddard, S.D.

    1958-10-21

    An improved foundry mold coating for use with graphite molds used in the casting of uranium is presented. The refractory mold coating serves to keep the molten uranium from contact with graphite of the mold and thus prevents carbon pickup by the molten metal. The refractory coating is made by dry mixing certain specific amounts of aluminum oxide, bentonite, Tennessee ball clay, and a soluble silicate salt. Water is then added to the mixture and the suspension thus formed is applied by spraying onto the mold.

  11. Microbial specialists in below-grade foundation walls in Scandinavia.

    PubMed

    Nunez, M; Hammer, H

    2014-10-01

    Below-grade foundation walls are often exposed to excessive moisture by water infiltration, condensation, leakage, or lack of ventilation. Microbial growth in these structures depends largely on environmental factors, elapsed time, and the type of building materials and construction setup. The ecological preferences of Actinomycetes (Actinobacteria) and the molds Ascotricha chartarum, Myxotrichum chartarum (Ascomycota), Geomyces pannorum, and Monocillium sp. (Hyphomycetes) have been addressed based on analyses of 1764 samples collected in below-grade spaces during the period of 2001-2012. Our results show a significant correlation between these taxa and moist foundation walls as ecological niches. Substrate preference was the strongest predictor of taxa distribution within the wall, but the taxa's physiological needs, together with gradients of abiotic factors within the wall structure, also played a role. Our study describes for the first time how the wall environment affects microbial growth. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. High resolution PFPE-based molding High resolution PFPE-based molding High resolution PFPE-based molding techniques for nanofabrication of high pattern density sub-20 nm features: A fundamental materials approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Williams, Stuart S; Samulski, Edward; Lopez, Renee

    2010-01-01

    ABSTRACT. Described herein is the development and investigation of PFPE-based elastomers for high resolution replica molding applications. The modulus of the elastomeric materials was increased through synthetic and additive approaches while maintaining relatively low surface energies (<25 mN/m). Using practically relevant large area master templates, we show that the resolution of the molds is strongly dependant upon the elastomeric mold modulus. A composite mold approach was used to form flexible molds out of stiff, high modulus materials that allow for replication of sub-20 nm post structures. Sub-100 nm line grating master templates, formed using e-beam lithography, were used to determinemore » the experimental stability of the molding materials. It was observed that as the feature spacing decreased, high modulus composite molds were able to effectively replicate the nano-grating structures without cracking or tear-out defects that typically occur with high modulus elastomers.« less

  13. Snow Mold Investigations in Eastern Washington

    Treesearch

    T. H. Filer; A. G. Law

    1961-01-01

    "Snow mold of turf" in the Pacific Northwest must include both Fusarium Patch caused by Calonectria graminicola (Berk and Br.) (conidial stage Fusarium nivale (Fr. ) CES.), and Gray snow mold caused by Typhula itoana Imai, which occur together to give a disease complex. Snow mold of turf is the most...

  14. Indoor Molds and Respiratory Hypersensitivity: A Comparison of Selected Molds and House Dust Mite Induced Responses in a Mouse Model**

    EPA Science Inventory

    Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases. Damp/moldy environments have been associated with asthma exacerbation, but mold's role in allergic asthma induction is less clear. The molds selected for these studies are commonl...

  15. Rotationally Molded Liquid Crystalline Polymers

    NASA Technical Reports Server (NTRS)

    Rogers, Martin; Stevenson, Paige; Scribben, Eric; Baird, Donald; Hulcher, Bruce

    2002-01-01

    Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers advantages of low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semi-rigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers.

  16. Transfer molding of PMR-15 polyimide resin

    NASA Technical Reports Server (NTRS)

    Reardon, J. P.; Moyer, D. W.; Nowak, B. E.

    1985-01-01

    Transfer molding is an economically viable method of producing small shapes of PMR-15 polyimide. It is shown that with regard to flexural, compressive, and tribological properties transfer-molded PMR-15 polyimide is essentially equivalent to PMR-15 polyimide produced by the more common method of compression molding. Minor variations in anisotropy are predictable effects of molding design and secondary finishing operations.

  17. Digital Twin concept for smart injection molding

    NASA Astrophysics Data System (ADS)

    Liau, Y.; Lee, H.; Ryu, K.

    2018-03-01

    Injection molding industry has evolved over decades and became the most common method to manufacture plastic parts. Monitoring and improvement in the injection molding industry are usually performed separately in each stage, i.e. mold design, mold making and injection molding process. However, in order to make a breakthrough and survive in the industrial revolution, all the stages in injection molding need to be linked and communicated with each other. Any changes in one stage will cause a certain effect in other stage because there is a correlation between each other. Hence, the simulation should not only based on the input of historical data, but it also needs to include the current condition of equipment and prediction of future events in other stages to make the responsive decision. This can be achieved by implementing the concept of Digital Twin that models the entire process as a virtual model and enables bidirectional control with the physical process. This paper presented types of data and technology required to build the Digital Twin for the injection molding industry. The concept includes Digital Twin of each stage and integration of these Digital Twin model as a thoroughgoing model of the injection molding industry.

  18. Permanent Mold Casting of JIS-AC4C Aluminum Alloy Using a Low-Temperature Mold

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yamagata, Hiroshi; Nikawa, Makoto

    2011-01-17

    Permanent mold casting using mold temperatures below 200 deg. C was conducted to obtain a high-strength, thin-walled casting. Al-7.36 mass% Si -0.18 Cu- 0.27Mg-0.34Fe alloy JIS-AC4C was cast using a bottom pouring cast plan. The product had a rectangular tube shape (70 mm W x 68 mm D x 180 mm H) with wall thicknesses of 1, 3 and 5 mm. The effect of heat insulation at the melt path was compared when using a sand runner insert and when using a steel runner insert as well as a powder mold release agent. Fine microstructures were observed in the casting.more » The smaller the thickness, the higher the hardness with smaller secondary dendrite arm spacing (SDAS). However, the hardness and the SDAS were unaffected by the mold temperature. It was proposed that the avoidance of the formation of primary {alpha} dendrite at the melt path generates a higher strength casting with adequate mold filling.« less

  19. Mold inhibition on unseasoned southern pine

    Treesearch

    Carol A. Clausen; Vina W. Yang

    2003-01-01

    Concerns about indoor air quality due to mold growth have increased dramatically in the United States. In the absence of moisture management, fungicides need to be developed for indoor use to control mold establishment. An ideal fungicide for prevention of indoor mold growth on wood-based materials needs to specifically prevent spore germination and provide long-term...

  20. Medical diagnostics for indoor mold exposure.

    PubMed

    Hurraß, Julia; Heinzow, Birger; Aurbach, Ute; Bergmann, Karl-Christian; Bufe, Albrecht; Buzina, Walter; Cornely, Oliver A; Engelhart, Steffen; Fischer, Guido; Gabrio, Thomas; Heinz, Werner; Herr, Caroline E W; Kleine-Tebbe, Jörg; Klimek, Ludger; Köberle, Martin; Lichtnecker, Herbert; Lob-Corzilius, Thomas; Merget, Rolf; Mülleneisen, Norbert; Nowak, Dennis; Rabe, Uta; Raulf, Monika; Seidl, Hans Peter; Steiß, Jens-Oliver; Szewszyk, Regine; Thomas, Peter; Valtanen, Kerttu; Wiesmüller, Gerhard A

    2017-04-01

    In April 2016, the German Society of Hygiene, Environmental Medicine and Preventative Medicine (Gesellschaft für Hygiene, Umweltmedizin und Präventivmedizin (GHUP)) together with other scientific medical societies, German and Austrian medical societies, physician unions and experts has provided an AWMF (Association of the Scientific Medical Societies) guideline 'Medical diagnostics for indoor mold exposure'. This guideline shall help physicians to advise and treat patients exposed indoors to mold. Indoor mold growth is a potential health risk, even without a quantitative and/or causal association between the occurrence of individual mold species and health effects. Apart from the allergic bronchopulmonary aspergillosis (ABPA) and the mycoses caused by mold, there is only sufficient evidence for the following associations between moisture/mold damages and different health effects: Allergic respiratory diseases, asthma (manifestation, progression, exacerbation), allergic rhinitis, exogenous allergic alveolitis and respiratory tract infections/bronchitis. In comparison to other environmental allergens, the sensitizing potential of molds is estimated to be low. Recent studies show a prevalence of sensitization of 3-10% in the total population of Europe. The evidence for associations to mucous membrane irritation and atopic eczema (manifestation, progression, exacerbation) is classified as limited or suspected. Inadequate or insufficient evidence for an association is given for COPD, acute idiopathic pulmonary hemorrhage in children, rheumatism/arthritis, sarcoidosis, and cancer. The risk of infections from indoor molds is low for healthy individuals. Only molds that are capable to form toxins can cause intoxications. The environmental and growth conditions and especially the substrate determine whether toxin formation occurs, but indoor air concentrations are always very low. In the case of indoor moisture/mold damages, everyone can be affected by odor effects and

  1. A Mold by Any Other Name: One Librarian's Battle Against a Mold Bloom.

    ERIC Educational Resources Information Center

    Smith, Laura Katz

    1997-01-01

    Describes how library staff at Virginia Polytechnic Institute and State University cleaned up materials after a mold bloom in the rare book room. Includes advice for controlling mold: set up a hygrothermograph, clean dust from books, set up fans, do a "skin" test at regular intervals, keep windows closed, have dehumidifiers available.…

  2. The reflectivity, wettability and scratch durability of microsurface features molded in the injection molding process using a dynamic tool tempering system

    NASA Astrophysics Data System (ADS)

    Kuhn, Sascha; Burr, August; Kübler, Michael; Deckert, Matthias; Bleesen, Christoph

    2011-02-01

    In this paper the replication qualities of periodically and randomly arranged micro-features molded in the injection molding process and their effects on surface properties are studied. The features are molded in PC, PMMA and PP at different mold wall temperatures in order to point out the necessity and profitability of a variotherm mold wall temperature control system. A one-dimensional heat conduction model is proposed to predict the cycle times of the variotherm injection molding processes. With regard to these processes, the molding results are compared to the molded surface feature heights using an atomic force microscope. In addition, the effects of the molded surface features on macroscopic surfaces are characterized in terms of light reflection using a spectrometer and in terms of water wettability by measuring the static contact angle. Furthermore, due to the sensitivity of the surface features on the molded parts, their durability is compared in a scratch test with a diamond tip. This leads to successful implementation in applications in which the optical appearance, in terms of gloss and reflection, and the water repellence, in terms of drag flow and adhesion, are of importance.

  3. Effect of Cross Sectional Geometry on PDMS Micro Peristaltic Pump Performance: Comparison of SU-8 Replica Molding vs. Micro Injection Molding

    PubMed Central

    Graf, Neil J.

    2013-01-01

    Two different fabrication methods were employed to fabricate micropumps with different cross-sectional channel geometries. The first was to fabricate rectangular cross-sectional microchannel geometries using the well known fabrication method of replica molding (REM).1 The second, and far less utilized fabrication technique, was to create microchannel molds using an in-house fabricated handheld micro injection molding apparatus. The injection mold apparatus was designed for use with elastomeric room temperature vulcanization (RTV) polymers, as opposed to most other injection molding machines, which are designed for use with thermoplastic polymers. The injection mold’s bottom plate was used as a microchannel molding template. The molding template was created by threading a small-diameter wire (150 μm or less) through the injection mold’s bottom plate, with subsequent adhesion and smoothing of a thin piece of aluminum foil over the wire-raised injection mold template. When molded against, the template produced a rounded/Gaussian-shaped PDMS microchannel. The design of the injection mold will be presented, along with a direct comparison for micropump performance metrics such as flow rate, valving characteristics, and maximum backpressures attainable for each of the respective micropump channel geometries. PMID:23917263

  4. Evacuated displacement compression molding

    NASA Technical Reports Server (NTRS)

    Heier, W. C. (Inventor)

    1973-01-01

    A process for molding long, thin-wall tubular bodies from thermosetting plastic molding compounds is described. The tubular bodies produced may have body lengths several times the diameters. The application of the process for manufacturing rocket engine cases and nozzles is discussed. The advantages of the system over other methods of circular tube manufacture are analyzed.

  5. Mold and Indoor Air Quality in Schools

    MedlinePlus

    ... Centers Mold Contact Us Share Mold and Indoor Air Quality in Schools Mold and Moisture in Schools Webinar ... premier resource on this issue is the Indoor Air Quality Tools for Schools kit. Our schools-related resources ...

  6. Mold and Human Health: a Reality Check.

    PubMed

    Borchers, Andrea T; Chang, Christopher; Eric Gershwin, M

    2017-06-01

    There are possibly millions of mold species on earth. The vast majority of these mold spores live in harmony with humans, rarely causing disease. The rare species that does cause disease does so by triggering allergies or asthma, or may be involved in hypersensitivity diseases such as allergic bronchopulmonary aspergillosis or allergic fungal sinusitis. Other hypersensitivity diseases include those related to occupational or domiciliary exposures to certain mold species, as in the case of Pigeon Breeder's disease, Farmer's lung, or humidifier fever. The final proven category of fungal diseases is through infection, as in the case of onchomycosis or coccidiomycosis. These diseases can be treated using anti-fungal agents. Molds and fungi can also be particularly important in infections that occur in immunocompromised patients. Systemic candidiasis does not occur unless the individual is immunodeficient. Previous reports of "toxic mold syndrome" or "toxic black mold" have been shown to be no more than media hype and mass hysteria, partly stemming from the misinterpreted concept of the "sick building syndrome." There is no scientific evidence that exposure to visible black mold in apartments and buildings can lead to the vague and subjective symptoms of memory loss, inability to focus, fatigue, and headaches that were reported by people who erroneously believed that they were suffering from "mycotoxicosis." Similarly, a causal relationship between cases of infant pulmonary hemorrhage and exposure to "black mold" has never been proven. Finally, there is no evidence of a link between autoimmune disease and mold exposure.

  7. Interface conditions of two-shot molded parts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kisslinger, Thomas, E-mail: thomas.kisslinger@pccl.at; Bruckmoser, Katharina, E-mail: katharina.bruckmoser@unileoben.ac.at; Resch, Katharina, E-mail: katharina.resch@unileoben.ac.at

    2014-05-15

    The focus of this work is on interfaces of two-shot molded parts. It is well known that e.g. material combination, process parameters and contact area structures show significant effects on the bond strength of multi-component injection molded parts. To get information about the bond strength at various process parameter settings and material combinations a test mold with core back technology was used to produce two-component injection molded tensile test specimens. At the core back process the different materials are injected consecutively, so each component runs through the whole injection molding cycle (two-shot process). Due to this consecutive injection molding processes,more » a cold interface is generated. This is defined as overmolding of a second melt to a solidified polymer preform. Strong interest lies in the way the interface conditions change during the adhesion formation between the individual components. Hence the interface conditions were investigated by computed tomography and Raman spectroscopy. By analyzing these conditions the understanding of the adhesion development during the multi-component injection molding was improved.« less

  8. Rotationally Molded Liquid Crystalline Polymers

    NASA Technical Reports Server (NTRS)

    Rogers, Martin; Scribben, Eric; Baird, Donald; Hulcher, Bruce

    2002-01-01

    Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semirigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers. This paper will also highlight the interactions between academia and small businesses in developing new products and processes.

  9. Pressurized Shell Molds For Metal-Matrix Composites

    NASA Technical Reports Server (NTRS)

    Kashalikar, Uday K.; Lusignea, Richard N.; Cornie, James

    1993-01-01

    Balanced-pressure molds used to make parts in complex shapes from fiber-reinforced metal-matrix composite materials. In single step, molding process makes parts in nearly final shapes; only minor finishing needed. Because molding pressure same on inside and outside, mold does not have to be especially strong and can be made of cheap, nonstructural material like glass or graphite. Fibers do not have to be cut to conform to molds. Method produces parts with high content of continuous fibers. Parts stiff but light in weight, and coefficients of thermal expansion adjusted. Parts resistant to mechanical and thermal fatigue superior to similar parts made by prior fabrication methods.

  10. Injection molding ceramics to high green densities

    NASA Technical Reports Server (NTRS)

    Mangels, J. A.; Williams, R. M.

    1983-01-01

    The injection molding behavior of a concentrated suspension of Si powder in wax was studied. It was found that the injection molding behavior was a function of the processing techniques used to generate the powder. Dry ball-milled powders had the best molding behavior, while air classified and impact-milled powders demonstrated poorer injection moldability. The relative viscosity of these molding batches was studied as a function of powder properties: distribution shape, surface area, packing density, and particle morphology. The experimental behavior, in all cases, followed existing theories. The relative viscosity of an injection molding composition composed of dry ball-milled powders could be expressed using Farris' relation.

  11. Toxic mold: phantom risk vs science.

    PubMed

    Chapman, Jean A; Terr, Abba I; Jacobs, Robert L; Charlesworth, Ernest N; Bardana, Emil J

    2003-09-01

    To review the available literature on the subject of fungi (molds) and their potential impact on health and to segregate information that has scientific validity from information that is yet unproved and controversial. This review represents a synthesis of the available literature in this area with the authors' collective experience with many patients presenting with complaints of mold-related illness. Pertinent scientific investigation on toxic mold issues and previously published reviews on this and related subjects that met the educational objectives were critically reviewed. Indoor mold growth is variable, and its discovery in a building does not necessarily mean occupants have been exposed. Human response to fungal antigens may induce IgE or IgG antibodies that connote prior exposure but not necessarily a symptomatic state. Mold-related disease has been discussed in the framework of noncontroversial and controversial disorders. When mold-related symptoms occur, they are likely the result of transient irritation, allergy, or infection. Building-related illness due to mycotoxicosis has never been proved in the medical literature. Prompt remediation of water-damaged material and infrastructure repair should be the primary response to fungal contamination in buildings.

  12. Castable plastic mold with electroplatable base

    DOEpatents

    Domeier, Linda A.; Morales, Alfredo M.; Gonzales, Marcela G.; Keifer, Patrick M.

    2004-01-20

    A sacrificial plastic mold having an electroplatable backing is provided as are methods of making such a mold via the infusion of a castable liquid formulation through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale master mold. Upon casting and demolding, the porous metal substrate is embedded within the cast formulation and projects a plastic structure with features determined by the mold tool. The plastic structure provides a sacrificial plastic mold mechanically bonded to the porous metal substrate, which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved, leaving the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

  13. INDOOR MOLDS AND ALLERGIC POTENTIAL

    EPA Science Inventory

    Rationale: Damp/moldy environments have been associated with asthma exacerbation, but mold¿s role in allergic asthma induction is less clear. Recently, 5 molds were statistically associated with water-damaged asthmatic homes in the Cleveland area. The asthma exacerbation...

  14. Study of parameters in precision optical glass molding

    NASA Astrophysics Data System (ADS)

    Ni, Ying; Wang, Qin-hua; Yu, Jing-chi

    2010-10-01

    Precision glass compression molding is an attractive approach to manufacture small precision optics in large volume over traditional manufacturing techniques because of its advantages such as lower cost, faster time to market and being environment friendly. In order to study the relationship between the surface figures of molded lenses and molding process parameters such as temperature, pressure, heating rate, cooling rate and so on, we present some glass compression molding experiments using same low Tg (transition temperature) glass material to produce two different kinds of aspheric lenses by different molding process parameters. Based on results from the experiments, we know the major factors influencing surface figure of molded lenses and the changing range of these parameters. From the knowledge we could easily catch proper molding parameters which are suitable for aspheric lenses with diameter from 10mm to 30mm.

  15. Rotational molding of pultruded profiles reinforced polyethylene

    NASA Astrophysics Data System (ADS)

    Greco, Antonio; Maffezzoli, Alfonso; Romano, Giorgio

    2014-05-01

    The aim of this paper is the production of fiber reinforced LLDPE components by rotational molding. To this purpose, a process upgrade was developed, for the incorporation of pultruded tapes in the rotational molding cycle. Pultruded tapes, made of 50% by weight of glass fibers dispersed in a high density polyethylene(HDPE) matrix, were glued on the internal surface of a cubic mold, and rotational molding process was run using the same processing conditions used for conventional LLDPE processing. During processing, melting of LLDPE powders and of HDPE allowed to incorporate the tapes inside rotational molded LLDPE. The glass fiber reinforced prototypes were characterized in terms of mechanical properties. Plate bending tests were performed on the square faces extracted from the rotational molded product. The rotational molding products were also subjected to internal hydrostatic pressure tests up to 10 bar. In any case, no failure of the cubic samples was observed. In both cases, it was found that addition of a single pultruded strips, which corresponds to addition of about 0.6% by weight of glass fibers, involved an increase of the stiffness of the faces by about 25%.

  16. Method for encapsulating hazardous wastes using a staged mold

    DOEpatents

    Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

    1989-01-01

    A staged mold and method for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

  17. Antifungal properties of silver nanoparticles against indoor mould growth.

    PubMed

    Ogar, Anna; Tylko, Grzegorz; Turnau, Katarzyna

    2015-07-15

    The presence of moulds in indoor environments causes serious diseases and acute or chronic toxicological syndromes. In order to inhibit or prevent the growth of microorganisms on building materials, the disruption of their vital processes or the reduction of reproduction is required. The development of novel techniques that impair the growth of microorganisms on building materials is usually based on silver nanoparticles (AgNPs). It makes them an alternative to other biocides. AgNPs have proven antibacterial activity and became promising in relation to fungi. The aim of the study was to assess growth and morphology of mycelia of typical indoor fungal species: Penicillium brevicompactum, Aspergillus fumigatus, Cladosporium cladosporoides, Chaetomium globosum and Stachybotrys chartarum as well as Mortierella alpina, cultured on agar media. The antifungal activity of AgNPs was also tested in relation to C. globosum and S. chartarum grown on the surface of gypsum drywall. It was found that the presence of AgNPs in concentrations of 30-200mg/l significantly decreased the growth of fungi. However, in the case of M. alpina, AgNPs stimulated its growth. Moreover, strong changes in moulds morphology and colour were observed after administration of AgNPs. Parameters of conidiophores/sporangiophores varied depending on mould region and changed significantly after treatment with AgNPs. The experiments have shown antifungal properties of AgNPs against common indoor mould species. Their application to building materials could effectively protect indoor environments from mould development. However, consideration must be given to the fact that the growth of some fungal strains might be stimulated by AgNPs. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Direct micropatterning of polymer materials by ice mold

    NASA Astrophysics Data System (ADS)

    Yu, Xinhong; Xing, Rubo; Luan, Shifang; Wang, Zhe; Han, Yanchun

    2006-10-01

    Micropatterning of functional polymer materials by micromolding in capillaries (MIMIC) with ice mold is reported in this paper. Ice mold was selected due to its thaw or sublimation. Thus, the mold can be easily removed. Furthermore, the polymer solution did not react with, swell, or adhere to the ice mold, so the method is suitable for many kinds of materials (such as P3HT, PMMA Alq 3/PVK, PEDOT: PSS, PS, P2VP, etc.). Freestanding polymer microstructures, binary polymer pattern, and microchannels have been fabricated by the use of ice mold freely.

  19. Influence of mold surface temperature on polymer part warpage in rapid heat cycle molding

    NASA Astrophysics Data System (ADS)

    Berger, G. R.; Pacher, G. A.; Pichler, A.; Friesenbichler, W.; Gruber, D. P.

    2014-05-01

    Dynamic mold surface temperature control was examined for its influence on the warpage. A test mold, featuring two different rapid heat cycle molding (RHCM) technologies was used to manufacture complex plate-shaped parts having different ribs, varying thin-wall regions, and both, circular and rectangular cut-outs. The mold's nozzle side is equipped with the areal heating and cooling technology BFMOLD®, where the heating/cooling channels are replaced by a ball-filled slot near the cavity surface flooded through with hot and cold water sequentially. Two local electrical ceramic heating elements are installed into the mold's ejection side. Based on a 23 full-factorial design of experiments (DoE) plan, varying nozzle temperature (Tnozzle), rapid heat cycle molding temperature (TRHCM) and holding pressure (pn), specimens of POM were manufactured systematically. Five specimens were examined per DoE run. The resulting warpage was measured at 6 surface line scans per part using the non-contact confocal topography system FRT MicroProf®. Two warpage parameters were calculated, the curvature of a 2nd order approximation a, and the vertical deflection at the profile center d. Both, the influence strength and the acting direction of the process parameters and their interactions on a and d were calculated by statistical analysis. Linear mathematical process models were determined for a and d to predict the warpage as a function of the process parameter settings. Finally, an optimum process setting was predicted, based on the process models and Microsoft Excel GRG solver. Clear and significant influences of TRHCM, pn, Tnozzle, and the interaction of TRHCM and pn were determined. While TRHCM was dominant close to the gate, pn became more effective as the flow length increased.

  20. MOLDS FOR CASTING PLUTONIUM

    DOEpatents

    Anderson, J.W.; Miley, F.; Pritchard, W.C.

    1962-02-27

    A coated mold for casting plutonium comprises a mold base portion of a material which remains solid and stable at temperatures as high as the pouring temperature of the metal to be cast and having a thin coating of the order of 0.005 inch thick on the interior thereof. The coating is composed of finely divided calcium fluoride having a particle size of about 149 microns. (AEC)

  1. Indoor visible mold and mold odor are associated with new-onset childhood wheeze in a dose-dependent manner.

    PubMed

    Shorter, Caroline; Crane, Julian; Pierse, Nevil; Barnes, Phillipa; Kang, Janice; Wickens, Kristin; Douwes, Jeroen; Stanley, Thorsten; Täubel, Martin; Hyvärinen, Anne; Howden-Chapman, Philippa

    2018-01-01

    Evidence is accumulating that indoor dampness and mold are associated with the development of asthma. The underlying mechanisms remain unknown. New Zealand has high rates of both asthma and indoor mold and is ideally placed to investigate this. We conducted an incident case-control study involving 150 children with new-onset wheeze, aged between 1 and 7 years, each matched to two control children with no history of wheezing. Each participant's home was assessed for moisture damage, condensation, and mold growth by researchers, an independent building assessor and parents. Repeated measures of temperature and humidity were made, and electrostatic dust cloths were used to collect airborne microbes. Cloths were analyzed using qPCR. Children were skin prick tested for aeroallergens to establish atopy. Strong positive associations were found between observations of visible mold and new-onset wheezing in children (adjusted odds ratios ranged between 1.30 and 3.56; P ≤ .05). Visible mold and mold odor were consistently associated with new-onset wheezing in a dose-dependent manner. Measurements of qPCR microbial levels, temperature, and humidity were not associated with new-onset wheezing. The association between mold and new-onset wheeze was not modified by atopic status, suggesting a non-allergic association. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Porous media heat transfer for injection molding

    DOEpatents

    Beer, Neil Reginald

    2016-05-31

    The cooling of injection molded plastic is targeted. Coolant flows into a porous medium disposed within an injection molding component via a porous medium inlet. The porous medium is thermally coupled to a mold cavity configured to receive injected liquid plastic. The porous medium beneficially allows for an increased rate of heat transfer from the injected liquid plastic to the coolant and provides additional structural support over a hollow cooling well. When the temperature of the injected liquid plastic falls below a solidifying temperature threshold, the molded component is ejected and collected.

  3. 40 CFR Table 3 to Subpart Wwww of... - Organic HAP Emissions Limits for Existing Open Molding Sources, New Open Molding Sources Emitting...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Existing Open Molding Sources, New Open Molding Sources Emitting Less Than 100 TPY of HAP, and New and... CATEGORIES National Emissions Standards for Hazardous Air Pollutants: Reinforced Plastic Composites... Existing Open Molding Sources, New Open Molding Sources Emitting Less Than 100 TPY of HAP, and New and...

  4. Microcellular nanocomposite injection molding process

    Treesearch

    Mingjun Yuan; Lih-Sheng Turng; Rick Spindler; Daniel Caulfield; Chris Hunt

    2003-01-01

    This study aims to explore the processing benefits and property improvements of combining nanocomposites with microcellular injection molding. The molded parts produced based on the Design of Experiments (DOE) matrices were subjected to tensile testing, impact testing, and Scanning Electron Microscope (SEM), Transmission Electron Microscope (TEM), Dynamic Mechanical...

  5. Matched metal die compression molded structural random fiber sheet molding compound flywheel

    DOEpatents

    Kulkarni, Satish V.; Christensen, Richard M.; Toland, Richard H.

    1985-01-01

    A flywheel (10) is described that is useful for energy storage in a hybrid vehicle automotive power system or in some stationary applications. The flywheel (10) has a body of essentially planar isotropic high strength structural random fiber sheet molding compound (SMC-R). The flywheel (10) may be economically produced by a matched metal die compression molding process. The flywheel (10) makes energy intensive efficient use of a fiber/resin composite while having a shape designed by theory assuming planar isotropy.

  6. HOW to Recognize and Control Sooty Molds

    Treesearch

    Kenneth J. Jr. Kessler

    1992-01-01

    Sooty molds are dark fungi that grow on honeydew excreted by sucking insects or on exudates from leaves of certain plants. Typically, sooty mold growths are composed of fungal complexes made up of ascomycetes and fungi imperfecti. Some of the common genera of fungi found in sooty mold complexes are Cladosporium, Aureobasidium, Antennariella, Limacinula, Scorias, and...

  7. Grinding aspheric and freeform micro-optical molds

    NASA Astrophysics Data System (ADS)

    Tohme, Yazid E.

    2007-02-01

    Fueled by the need for better performing optics, glass optics are now replacing plastic optics in many industrial and consumer electronic devices. One of these devices is the mobile phone camera. The optical sub-assembly in a mobile phone includes several micro lenses that are spherical and/or aspherical in shape and require form tolerances in the submicron range. These micro glass lenses are mass produced by a replication process known as glass press molding. The process entails the compression of a glass gob between two precise optical quality molds at an elevated temperature, usually near the transition temperature of the glass material. The elevated forces and temperatures required in the glass molding process limits the materials of the molds to very tough materials such as tungsten carbide or silicon carbide. These materials can withstand large pressing forces at high temperatures without any significant deformation. These materials offer great mechanical properties for glass press molding but they are also a challenge to machine to submicron accuracy. The work in this paper discusses a deterministic micro grinding manufacturing process referred to as wheel normal grinding, which is utilized to produce these optical quality molds. Wheel normal grinding is more accurate and more deterministic than most other grinding techniques and can produce molds to the form and finish tolerances required for optical molding. This method relies on the ability to recognize and compensate for grinding wheel wear and machine repeatable errors. Results will be presented to illustrate the accuracy of this micro grinding technique.

  8. Use of acrylic sheet molds for elastomeric products

    NASA Technical Reports Server (NTRS)

    Heisman, R. M.; Koerner, A. E.; Messineo, S. M.

    1970-01-01

    Molds constructed of acrylic sheet are more easily machined than metal, are transparent to ensure complete filling during injection, and have smooth surfaces free of contamination. Technique eliminates flashing on molded parts and mold release agents.

  9. Indoor Molds and Respiratory Hypersensitivity: A Comparison of Selected Molds and House Dust Mite Induced Responses in a Mouse Model

    EPA Science Inventory

    Introduction/Study Goal Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases including allergic lung diseases. The Institute of Medicine reports and WHO gUidelines concluded that the role of molds in asthma induction is not clear bu...

  10. The Mold that Almost Ate the Principal

    ERIC Educational Resources Information Center

    Barry, Wayne; Bishop, Chuck; Byars, Jennifer

    2006-01-01

    New-building mold was a bane for many home construction companies and new homeowners during the 1990s. It was not unusual to read or watch the news and see the tragedy played out in one's local community. Untold, however, is the story of the toll new-building mold can take on school systems and their principals, especially as these mold problems…

  11. Slimeware: engineering devices with slime mold.

    PubMed

    Adamatzky, Andrew

    2013-01-01

    The plasmodium of the acellular slime mold Physarum polycephalum is a gigantic single cell visible to the unaided eye. The cell shows a rich spectrum of behavioral patterns in response to environmental conditions. In a series of simple experiments we demonstrate how to make computing, sensing, and actuating devices from the slime mold. We show how to program living slime mold machines by configurations of repelling and attracting gradients and demonstrate the workability of the living machines on tasks of computational geometry, logic, and arithmetic.

  12. Commercial and Residential Water Damage: The Mold Connection.

    ERIC Educational Resources Information Center

    Williams, Del

    2002-01-01

    Describes the problem of toxic mold in residential and commercial property resulting from excess moisture. Includes common sources of unwanted moisture, design and construction flaws, determining the presence of mold, and advice for identifying and hiring reputable mold remediators. (PKP)

  13. Mold Allergy

    MedlinePlus

    ... the AAAAI Foundation Donate Utility navigation Español Journals Pollen Counts Annual Meeting Member Login / My Membership Search ... email alert to keep tabs on mold and pollen counts in your area. • Keep away from uncut ...

  14. Volume-change indicator for molding plastic

    NASA Technical Reports Server (NTRS)

    Heler, W. C.

    1979-01-01

    Monitor consisting of two concentric disks measures change in volume of charge during compression/displacement molding. Device enables operator to decide whether process pressure and temperature are set properly or whether sufficient material has been placed in mold.

  15. Silicon micro-mold and method for fabrication

    DOEpatents

    Morales, Alfredo M.

    2005-01-11

    The present invention describes a method for rapidly fabricating a robust 3-dimensional silicon micro-mold for use in preparing complex metal micro-components. The process begins by depositing a conductive metal layer onto one surface of a silicon wafer. A thin photoresist and a standard lithographic mask are then used to transfer a trace image pattern onto the opposite surface of the wafer by exposing and developing the resist. The exposed portion of the silicon substrate is anisotropically etched through the wafer thickness down to conductive metal layer to provide an etched pattern consisting of a series of rectilinear channels and recesses in the silicon which serve as the silicon micro-mold. Microcomponents are prepared with this mold by first filling the mold channels and recesses with a metal deposit, typically by electroplating, and then removing the silicon micro-mold by chemical etching.

  16. Replication of the nano-scale mold fabricated with focused ion beam

    NASA Astrophysics Data System (ADS)

    Gao, J. X.; Chan-Park, M. B.; Xie, D. Z.; Ngoi, Bryan K. A.

    2004-12-01

    Silicon mold fabricated with Focused Ion Beam lithography (FIB) was used to make silicone elastomer molds. The silicon mold is composed of lattice of holes which the diameter and depth are about 200 nm and 60 nm, respectively. The silicone elastomer material was then used to replicate slavery mold. Our study show the replication process with the elastomer mold had been performed successfully and the diameter of humps on the elastomer mold is near to that of holes on the master mold. But the height of humps in the elastomer mold is only 42 nm and it is different from the depth of holes in the master mold.

  17. From micro- to nano-scale molding of metals : size effect during molding of single crystal Al with rectangular strip punches.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, K.; Meng, W. J.; Mei, F.

    2011-02-01

    A single crystal Al specimen was molded at room temperature with long, rectangular, strip diamond punches. Quantitative molding response curves were obtained at a series of punch widths, ranging from 5 {micro}m to 550 nm. A significant size effect was observed, manifesting itself in terms of significantly increasing characteristic molding pressure as the punch width decreases to 1.5 {micro}m and below. A detailed comparison of the present strip punch molding results was made with Berkovich pyramidal indentation on the same single crystal Al specimen. The comparison reveals distinctly different dependence of the characteristic pressure on corresponding characteristic length. The presentmore » results show the feasibility of micro-/nano-scale compression molding as a micro-/nano-fabrication technique, and offer an experimental test case for size-dependent plasticity theories.« less

  18. Sacrificial plastic mold with electroplatable base

    DOEpatents

    Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.

    2002-01-01

    A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

  19. Sacrificial Plastic Mold With Electroplatable Base

    DOEpatents

    Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.

    2005-08-16

    A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

  20. Study of injection molded microcellular polyamide-6 nanocomposites

    Treesearch

    Mingjun Yuan; Lih-Sheng Turng; Shaoqin Gong; Daniel Caulfield; Chris Hunt; Rick Spindler

    2004-01-01

    This study aims to explore the processing benefits and property improvements of combining nanocomposites with microcellular injection molding. The microcellular nanocomposite processing was performed on an injection-molding machine equipped with a commercially available supercritical fluid (SCF) system. The molded samples produced based on the Design of Experiments (...

  1. Rapid localized heating of graphene coating on a silicon mold by induction for precision molding of polymer optics.

    PubMed

    Zhang, Lin; Zhou, Wenchen; Yi, Allen Y

    2017-04-01

    In compression molding of polymer optical components with micro/nanoscale surface features, rapid heating of the mold surface is critical for the implementation of this technology for large-scale applications. In this Letter, a novel method of a localized rapid heating process is reported. This process is based on induction heating of a thin conductive coating deposited on a silicon mold. Since the graphene coating is very thin (∼45  nm), a high heating rate of 10∼20°C/s can be achieved by employing a 1200 W 30 kHz electrical power unit. Under this condition, the graphene-coated surface and the polymer substrate can be heated above the polymer's glass transition temperature within 30 s and subsequently cooled down to room temperature within several tens of seconds after molding, resulting in an overall thermal cycle of about 3 min or shorter. The feasibility of this process was validated by fabrication of optical gratings, micropillar matrices, and microlens arrays on polymethylmethacrylate (PMMA) substrates with very high precision. The uniformity and surface geometries of the replicated optical elements are evaluated using an optical profilometer, a diffraction test setup, and a Shack-Hartmann wavefront sensor built with a molded PMMA microlens array. Compared with the conventional bulk heating molding process, this novel rapid localized induction heating process could improve replication efficiency with better geometrical fidelity.

  2. Factors influencing microinjection molding replication quality

    NASA Astrophysics Data System (ADS)

    Vera, Julie; Brulez, Anne-Catherine; Contraires, Elise; Larochette, Mathieu; Trannoy-Orban, Nathalie; Pignon, Maxime; Mauclair, Cyril; Valette, Stéphane; Benayoun, Stéphane

    2018-01-01

    In recent years, there has been increased interest in producing and providing high-precision plastic parts that can be manufactured by microinjection molding: gears, pumps, optical grating elements, and so on. For all of these applications, the replication quality is essential. This study has two goals: (1) fabrication of high-precision parts using the conventional injection molding machine; (2) identification of robust parameters that ensure production quality. Thus, different technological solutions have been used: cavity vacuuming and the use of a mold coated with DLC or CrN deposits. AFM and SEM analyses were carried out to characterize the replication profile. The replication quality was studied in terms of the process parameters, coated and uncoated molds and crystallinity of the polymer. Specific studies were processed to quantify the replicability of injection molded parts (ABS, PC and PP). Analysis of the Taguchi experimental designs permits prioritization of the impact of each parameter on the replication quality. A discussion taking into account these new parameters and the thermal and spreading properties on the coatings is proposed. It appeared that, in general, increasing the mold temperature improves the molten polymer fill in submicron features except for the steel insert (for which the presence of a vacuum is the most important factor). Moreover, the DLC coating was the best coating to increase the quality of the replication. This result could be explained by the lower thermal diffusivity of this coating. We noted that the viscosity of the polymers is not a primordial factor of the replication quality.

  3. Taxonomic re-evaluation of black koji molds.

    PubMed

    Hong, Seung-Beom; Yamada, Osamu; Samson, Robert A

    2014-01-01

    Black koji molds including its albino mutant, the white koji mold, have been widely used for making the distilled spirit shochu in Northeast Asia because they produce citric acid which prevents undesirable contamination from bacteria. Since Inui reported Aspergillus luchuensis from black koji in Okinawa in 1901, many fungal names associated with black koji molds were reported. However, some species are similar and differentiation between species is difficult. Fungal taxonomists tried to arrange a taxonomic system for black koji molds, but the results were not clear. Recently, multi-locus sequence typing has been successfully used to taxonomy of black Aspergillus. According to β-tubulin and calmodulin gene sequences, black koji molds can be subdivided in three species, A. luchuensis, Aspergillus niger, and Aspergillus tubingensis. Aspergillus awamori, Aspergillus kawachii, Aspergillus inuii, Aspergillus nakazawai, and Aspergillus coreanus are synonyms of A. luchuensis, Aspergillus batatae, Aspergillus aureus (or Aspergillus foetidus), Aspergillus miyakoensis, and Aspergillus usamii (including A. usamii mut. shirousamii) are synonyms of A. niger and Aspergillus saitoi and A. saitoi var. kagoshimaensis are synonyms of A. tubingensis. A. luchuensis mut. kawachii was suggested particular names for A. kawachii because of their industrial importance. The history and modern taxonomy of black koji molds is further discussed.

  4. EXPOSURE OF CHILDREN TO INDOOR MOLDS

    EPA Science Inventory

    Children now spend more than 90% of their time indoors. Thus, any exposure to indoor pollutants may be critical to their health. Molds are one of the most important pollutants children are exposed to indoors. Molds produce hundreds of allergens and toxins. These products ha...

  5. A hybrid optimization approach in non-isothermal glass molding

    NASA Astrophysics Data System (ADS)

    Vu, Anh-Tuan; Kreilkamp, Holger; Krishnamoorthi, Bharathwaj Janaki; Dambon, Olaf; Klocke, Fritz

    2016-10-01

    Intensively growing demands on complex yet low-cost precision glass optics from the today's photonic market motivate the development of an efficient and economically viable manufacturing technology for complex shaped optics. Against the state-of-the-art replication-based methods, Non-isothermal Glass Molding turns out to be a promising innovative technology for cost-efficient manufacturing because of increased mold lifetime, less energy consumption and high throughput from a fast process chain. However, the selection of parameters for the molding process usually requires a huge effort to satisfy precious requirements of the molded optics and to avoid negative effects on the expensive tool molds. Therefore, to reduce experimental work at the beginning, a coupling CFD/FEM numerical modeling was developed to study the molding process. This research focuses on the development of a hybrid optimization approach in Non-isothermal glass molding. To this end, an optimal configuration with two optimization stages for multiple quality characteristics of the glass optics is addressed. The hybrid Back-Propagation Neural Network (BPNN)-Genetic Algorithm (GA) is first carried out to realize the optimal process parameters and the stability of the process. The second stage continues with the optimization of glass preform using those optimal parameters to guarantee the accuracy of the molded optics. Experiments are performed to evaluate the effectiveness and feasibility of the model for the process development in Non-isothermal glass molding.

  6. Predicting and preventing mold spoilage of food products.

    PubMed

    Dagnas, Stéphane; Membré, Jeanne-Marie

    2013-03-01

    This article is a review of how to quantify mold spoilage and consequently shelf life of a food product. Mold spoilage results from having a product contaminated with fungal spores that germinate and form a visible mycelium before the end of the shelf life. The spoilage can be then expressed as the combination of the probability of having a product contaminated and the probability of mold growth (germination and proliferation) up to a visible mycelium before the end of the shelf life. For products packed before being distributed to the retailers, the probability of having a product contaminated is a function of factors strictly linked to the factory design, process, and environment. The in-factory fungal contamination of a product might be controlled by good manufacturing hygiene practices and reduced by particular processing practices such as an adequate air-renewal system. To determine the probability of mold growth, both germination and mycelium proliferation can be mathematically described by primary models. When mold contamination on the product is scarce, the spores are spread on the product and more than a few spores are unlikely to be found at the same spot. In such a case, models applicable for a single spore should be used. Secondary models can be used to describe the effect of intrinsic and extrinsic factors on either the germination or proliferation of molds. Several polynomial models and gamma-type models quantifying the effect of water activity and temperature on mold growth are available. To a lesser extent, the effect of pH, ethanol, heat treatment, addition of preservatives, and modified atmospheres on mold growth also have been quantified. However, mold species variability has not yet been properly addressed, and only a few secondary models have been validated for food products. Once the probability of having mold spoilage is calculated for various shelf lives and product formulations, the model can be implemented as part of a risk management

  7. Investigations on injection molded, glass-fiber reinforced polyamide 6 integral foams using breathing mold technology

    NASA Astrophysics Data System (ADS)

    Roch, A.; Kehret, L.; Huber, T.; Henning, F.; Elsner, P.

    2015-05-01

    Investigations on PA6-GF50 integral foams have been carried out using different material systems: longfiber- and shortfiber-reinforced PA6 as well as unreinforced PA6 as a reference material. Both chemical and physical blowing agents were applied. Breathing mold technology (decompression of the mold) was selected for the foaming process. The integral foam design, which can be conceived as a sandwich structure, helps to save material in the neutral axis area and maintains a distance between load-bearing, unfoamed skin layers. For all test series an initial mold gap of 2.5 mm was chosen and the same amount of material was injected. In order to realize different density reductions, the mold opening stroke was varied. The experiments showed that, at a constant mass per unit area, integral polyamide 6 foams have a significantly higher bending stiffness than compact components, due to their higher area moment of inertia after foaming. At a constant surface weight the bending stiffness in these experiments could be increased by up to 600 %. Both shortfiber- and longfiber-reinforced polyamide 6 showed an increase in energy absorption during foaming.

  8. Brightness field distributions of microlens arrays using micro molding.

    PubMed

    Cheng, Hsin-Chung; Huang, Chiung-Fang; Lin, Yi; Shen, Yung-Kang

    2010-12-20

    This study describes the brightness field distributions of microlens arrays fabricated by micro injection molding (μIM) and micro injection-compression molding (μICM). The process for fabricating microlens arrays used room-temperature imprint lithography, photoresist reflow, electroforming, μIM, μICM, and optical properties measurement. Analytical results indicate that the brightness field distribution of the molded microlens arrays generated by μICM is better than those made using μIM. Our results further demonstrate that mold temperature is the most important processing parameter for brightness field distribution of molded microlens arrays made by μIM or μICM.

  9. Molecular orientation distributions during injection molding of liquid crystalline polymers: Ex situ investigation of partially filled moldings

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fang, Jun; Burghardt, Wesley R.; Bubeck, Robert A.

    The development of molecular orientation in thermotropic liquid crystalline polymers (TLCPs) during injection molding has been investigated using two-dimensional wide-angle X-ray scattering coordinated with numerical computations employing the Larson-Doi polydomain model. Orientation distributions were measured in 'short shot' moldings to characterize structural evolution prior to completion of mold filling, in both thin and thick rectangular plaques. Distinct orientation patterns are observed near the filling front. In particular, strong extension at the melt front results in nearly transverse molecular alignment. Far away from the flow front shear competes with extension to produce complex spatial distributions of orientation. The relative influence ofmore » shear is stronger in the thin plaque, producing orientation along the filling direction. Exploiting an analogy between the Larson-Doi model and a fiber orientation model, we test the ability of process simulation tools to predict TLCP orientation distributions during molding. Substantial discrepancies between model predictions and experimental measurements are found near the flow front in partially filled short shots, attributed to the limits of the Hele-Shaw approximation used in the computations. Much of the flow front effect is however 'washed out' by subsequent shear flow as mold filling progresses, leading to improved agreement between experiment and corresponding numerical predictions.« less

  10. Proactive approaches for mold-free interior environments.

    PubMed

    Warsco, Katherine; Lindsey, Patricia F

    2003-08-01

    Interior design education and practice can contribute to the prevention of mold growth in indoor environments. The authors provide an overview of current thinking within the interior design educational and professional communities regarding proactive approaches to achieving mold-free building interiors, including identification of current best practices for the prevention of mold problems in buildings. They also discuss the development of certification programs. A review of recent literature points to the need for interior designers to be educated to specify the use of ecologically sound materials that support the health of building occupants. The authors present trade-offs between best practices for designing mold-free indoor environments (including considerations of cost, maintenance, and operation) and occupant comfort, health, and well-being.

  11. Mathematical modeling of the in-mold coating process for injection-molded thermoplastic parts

    NASA Astrophysics Data System (ADS)

    Chen, Xu

    In-Mold Coating (IMC) has been successfully used for many years for exterior body panels made from compression molded Sheet Molding Compound (SMC). The coating material is a single component reactive fluid, designed to improve the surface quality of SMC moldings in terms of functional and cosmetic properties. When injected onto a cured SMC part, IMC cures and bonds to provide a pain-like surface. Because of its distinct advantages, IMC is being considered for application to injection molded thermoplastic parts. For a successful in mold coating operation, there are two key issues related to the flow of the coating. First, the injection nozzle should be located such that the thermoplastic substrate is totally covered and the potential for air trapping is minimized. The selected location should be cosmetically acceptable since it most likely will leave a mark on the coated surface. The nozzle location also needs to be accessible for easy of maintenance. Secondly, the hydraulic force generated by the coating injection pressure should not exceed the available clamping tonnage. If the clamping force is exceeded, coating leakage will occur. In this study, mathematical models for IMC flow on the compressible thermoplastic substrate have been developed. Finite Difference Method (FDM) is first used to solve the 1 dimensional (1D) IMC flow problem. In order to investigate the application of Control Volume based Finite Element Method (CV/FEM) to more complicated two dimensional IMC flow, that method is first evaluated by solving the 1D IMC flow problem. An analytical solution, which can be obtained when a linear relationship between the coating thickness and coating injection pressure is assumed, is used to verify the numerical results. The mathematical models for the 2 dimensional (2D) IMC flow are based on the generalized Hele-Shaw approximation. It has been found experimentally that the power law viscosity model adequately predicts the rheological behavior of the coating

  12. Route 20, Autobahn 7, and Slime Mold: Approximating the Longest Roads in USA and Germany With Slime Mold on 3-D Terrains.

    PubMed

    Adamatzky, Andrew I

    2014-01-01

    A cellular slime mould Physarum polycephalum is a monstrously large single cell visible by an unaided eye. The slime mold explores space in parallel, is guided by gradients of chemoattractants, and propagates toward sources of nutrients along nearly shortest paths. The slime mold is a living prototype of amorphous biological computers and robotic devices capable of solving a range of tasks of graph optimization and computational geometry. When presented with a distribution of nutrients, the slime mold spans the sources of nutrients with a network of protoplasmic tubes. This protoplasmic network matches a network of major transport routes of a country when configuration of major urban areas is represented by nutrients. A transport route connecting two cities should ideally be a shortest path, and this is usually the case in computer simulations and laboratory experiments with flat substrates. What searching strategies does the slime mold adopt when exploring 3-D terrains? How are optimal and transport routes approximated by protoplasmic tubes? Do the routes built by the slime mold on 3-D terrain match real-world transport routes? To answer these questions, we conducted pioneer laboratory experiments with Nylon terrains of USA and Germany. We used the slime mold to approximate route 20, the longest road in USA, and autobahn 7, the longest national motorway in Europe. We found that slime mold builds longer transport routes on 3-D terrains, compared to flat substrates yet sufficiently approximates man-made transport routes studied. We demonstrate that nutrients placed in destination sites affect performance of slime mold, and show how the mold navigates around elevations. In cellular automaton models of the slime mold, we have shown variability of the protoplasmic routes might depends on physiological states of the slime mold. Results presented will contribute toward development of novel algorithms for sensorial fusion, information processing, and decision making, and

  13. NUTRITION OF CELLULAR SLIME MOLDS I.

    PubMed Central

    Hohl, Hans-Rudolf; Raper, Kenneth B.

    1963-01-01

    Hohl, Hans-Rudolf (University of Wisconsin, Madison) and Kenneth B. Raper. Nutrition of cullular slime molds. I. Growth on living and dead bacteria. J. Bacteriol. 85:191–198. 1963.—Methods for growing selected species of cellular slime molds in liquid culture on living and dead bacteria are described. Species investigated included Polysphondylium pallidum, P. violaceum, Dictyostelium discoideum, and D. purpureum. Maximal growth of myxamoebae occurred in suspensions of 1010 living bacteria (Escherichia coli B/r)/ml in Sörensen's phosphate buffer (pH 6.0), reaching a density of 107 to 2 × 107 cells/ml in 48 hr. The generation time for the different slime molds ranged from 2.4 hr for P. violaceum to 2.9 hr for D. discoideum (strain V-12). Good growth of P. pallidum occurred between pH 3.6 and 7.8. The slime molds grew less well on dead (autoclaved) than on living bacteria and, except for P. pallidum, the amount and rate of growth decreased markedly as the time of autoclaving was increased from 2.5 to 80 min. Bacteria killed with propylene oxide supported growth equal to those autoclaved for a few minutes. The myxamoebae were very sensitive to the osmotic pressure of the culture medium, especially in the presence of living bacteria, and addition of as little as 0.01 m NaCl caused a measurable decrease in slime mold growth. The culture techniques employed afford useful methods for investigating the nutritional requirements of the cellular slime molds, and the experiments described provide the bases for subsequent studies relating to the axenic cultivation of these singular microorganisms. Images PMID:13961228

  14. Molded polymer solar water heater

    DOEpatents

    Bourne, Richard C.; Lee, Brian E.

    2004-11-09

    A solar water heater has a rotationally-molded water box and a glazing subassembly disposed over the water box that enhances solar gain and provides an insulating air space between the outside environment and the water box. When used with a pressurized water system, an internal heat exchanger is integrally molded within the water box. Mounting and connection hardware is included to provide a rapid and secure method of installation.

  15. Matched metal die compression molded structural random fiber sheet molding compound flywheel. [Patent application

    DOEpatents

    Kulkarni, S.V.; Christensen, R.M.; Toland, R.H.

    1980-09-24

    A flywheel is described that is useful for energy storage in a hybrid vehicle automotive power system or in some stationary applications. The flywheel has a body of essentially planar isotropic high strength structural random fiber sheet molding compound (SMC-R). The flywheel may be economically produced by a matched metal die compression molding process. The flywheel makes energy intensive efficient use of a fiber/resin composite while having a shape designed by theory assuming planar isotropy.

  16. Indoor molds and lung function in healthy adults.

    PubMed

    Hernberg, Samu; Sripaiboonkij, Penpatra; Quansah, Reginald; Jaakkola, Jouni J K; Jaakkola, Maritta S

    2014-05-01

    Indoor mold exposure is common worldwide and constitutes an important health problem. There are very few studies assessing the relation between mold exposure and lung function levels among non-asthmatic adults. Our objective was to assess the relations between dampness and mold exposures at home and at work and lung function. In particular, we elaborated the importance of different exposure indicators. In a population-based study, 269 non-asthmatic adults from South Finland answered a questionnaire on indoor dampness and mold exposures at home or at work and other factors potentially influencing lung function, and performed spirometry. Multiple linear regression model was applied to study the relations between exposures and spirometric lung function levels. In linear regression adjusting for confounding, FEV1 level was reduced on average 200 ml related to mold odor at home (effect estimate -0.20, 95% CI -0.60 to 0.21) and FVC level was reduced on average 460 ml (-0.46, -0.95 to 0.03) respectively. Exposure to mold odor at home or at work or both was related to reduced FEV1 (-0.15, -0.42 to 0.12) and FVC (-0.22, -0.55 to 0.11) levels. Women had on average 510 ml reduced FEV1 levels (-0.51, -1.0 to 0.03) and 820 ml reduced FVC levels (-0.82, -1.4 to -0.20) related to mold odor exposure at home. Mold odor exposure was related to lower lung function levels among non-asthmatic adults, especially among women. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Preparation and properties of an internal mold release for rigid urethane foam

    NASA Astrophysics Data System (ADS)

    Paker, B. G.

    1980-08-01

    Most mold release agents used in the molding of rigid polyurethane foam are applied to the internal surfaces of the mold. These materials form a thin layer between the surface of the mold and the foam, allowing for easy release of the molded parts. This type of mold release must be applied prior to each molding operation; and, after repeated use, cleaning of the mold is required. Small amounts of this mold release are transferred to the molded part, resulting in a part with poor surface bondability characteristics. An internal release agent, which can be mixed in a urethane foam resin was investigated. The internal mold release provided good releasability and resulted in urethane foam that has excellent surface bondability. No compatibility problems are expected from the use of this type of release agent.

  18. Applying simulation to optimize plastic molded optical parts

    NASA Astrophysics Data System (ADS)

    Jaworski, Matthew; Bakharev, Alexander; Costa, Franco; Friedl, Chris

    2012-10-01

    Optical injection molded parts are used in many different industries including electronics, consumer, medical and automotive due to their cost and performance advantages compared to alternative materials such as glass. The injection molding process, however, induces elastic (residual stress) and viscoelastic (flow orientation stress) deformation into the molded article which alters the material's refractive index to be anisotropic in different directions. Being able to predict and correct optical performance issues associated with birefringence early in the design phase is a huge competitive advantage. This paper reviews how to apply simulation analysis of the entire molding process to optimize manufacturability and part performance.

  19. Mold exposure and health effects following hurricanes Katrina and Rita.

    PubMed

    Barbeau, Deborah N; Grimsley, L Faye; White, LuAnn E; El-Dahr, Jane M; Lichtveld, Maureen

    2010-01-01

    The extensive flooding in the aftermath of Hurricanes Katrina and Rita created conditions ideal for indoor mold growth, raising concerns about the possible adverse health effects associated with indoor mold exposure. Studies evaluating the levels of indoor and outdoor molds in the months following the hurricanes found high levels of mold growth. Homes with greater flood damage, especially those with >3 feet of indoor flooding, demonstrated higher levels of mold growth compared with homes with little or no flooding. Water intrusion due to roof damage was also associated with mold growth. However, no increase in the occurrence of adverse health outcomes has been observed in published reports to date. This article considers reasons why studies of mold exposure after the hurricane do not show a greater health impact.

  20. Testing single point incremental forming molds for thermoforming operations

    NASA Astrophysics Data System (ADS)

    Afonso, Daniel; de Sousa, Ricardo Alves; Torcato, Ricardo

    2016-10-01

    Low pressure polymer processing processes as thermoforming or rotational molding use much simpler molds then high pressure processes like injection. However, despite the low forces involved with the process, molds manufacturing for this operations is still a very material, energy and time consuming operation. The goal of the research is to develop and validate a method for manufacturing plastically formed sheets metal molds by single point incremental forming (SPIF) operation for thermoforming operation. Stewart platform based SPIF machines allow the forming of thick metal sheets, granting the required structural stiffness for the mold surface, and keeping the short lead time manufacture and low thermal inertia.

  1. Micro-optical fabrication by ultraprecision diamond machining and precision molding

    NASA Astrophysics Data System (ADS)

    Li, Hui; Li, Likai; Naples, Neil J.; Roblee, Jeffrey W.; Yi, Allen Y.

    2017-06-01

    Ultraprecision diamond machining and high volume molding for affordable high precision high performance optical elements are becoming a viable process in optical industry for low cost high quality microoptical component manufacturing. In this process, first high precision microoptical molds are fabricated using ultraprecision single point diamond machining followed by high volume production methods such as compression or injection molding. In the last two decades, there have been steady improvements in ultraprecision machine design and performance, particularly with the introduction of both slow tool and fast tool servo. Today optical molds, including freeform surfaces and microlens arrays, are routinely diamond machined to final finish without post machining polishing. For consumers, compression molding or injection molding provide efficient and high quality optics at extremely low cost. In this paper, first ultraprecision machine design and machining processes such as slow tool and fast too servo are described then both compression molding and injection molding of polymer optics are discussed. To implement precision optical manufacturing by molding, numerical modeling can be included in the future as a critical part of the manufacturing process to ensure high product quality.

  2. Nasoalveolar molding in cleft care: is it efficacious?

    PubMed

    Abbott, Megan M; Meara, John G

    2012-09-01

    In the era of evidence-based medicine, new treatment protocols and interventions should be routinely evaluated for their efficacy by reviewing the available evidence. In the cleft literature, nasoalveolar molding has garnered attention over the last decade as a new option for improving nasal form and symmetry before primary surgical repair. Systematic review of the evidence is, however, currently lacking. This review evaluates whether nasoalveolar molding can improve nasal symmetry and form toward the norm, as well as whether nasoalveolar molding demonstrates advantages over other protocols in achieving this goal. A literature search of five databases plus relevant reference lists retrieved 98 articles regarding nasoalveolar molding, 21 of which reported objective outcome measures of nasal symmetry and form, and six of which were able to be given evidence level ratings, all in the unilateral cleft population. Statistical analysis was not possible given the range of techniques and outcomes. Studies of bilateral cleft were not given evidence level ratings, given the inability to separate the effects of nasoalveolar molding from other primary nasal interventions in studies that would have otherwise been rated. In unilateral cleft lip-cleft palate, there was some evidence that nasoalveolar molding may improve nasal outcomes, though comparison with other techniques was limited. Despite a relative paucity of high-level evidence, nasoalveolar molding appears to be a promising technique that deserves further study.

  3. Flow behavior in liquid molding

    NASA Technical Reports Server (NTRS)

    Hunston, D.; Phelan, F.; Parnas, R.

    1992-01-01

    The liquid molding (LM) process for manufacturing polymer composites with structural properties has the potential to significantly lower fabrication costs and increase production rates. LM includes both resin transfer molding and structural reaction injection molding. To achieve this potential, however, the underlying science base must be improved to facilitate effective process optimization and implementation of on-line process control. The National Institute of Standards and Technology (NIST) has a major program in LM that includes materials characterization, process simulation models, on-line process monitoring and control, and the fabrication of test specimens. The results of this program are applied to real parts through cooperative projects with industry. The key feature in the effort is a comprehensive and integrated approach to the processing science aspects of LM. This paper briefly outlines the NIST program and uses several examples to illustrate the work.

  4. Epoxy-resin patterns speed shell-molding of aluminum parts

    NASA Technical Reports Server (NTRS)

    1965-01-01

    Half patterns cast from commercial epoxy resin containing aluminum powder are used for shell-molding of aluminum parts. The half patterns are cast in plastic molds of the original wooden pattern. Ten serviceable sand resin molds are made from each epoxy pattern.

  5. The Effect of Epoxy Molding Compound Floor Life to Reliability Performance and mold ability for QFN Package

    NASA Astrophysics Data System (ADS)

    Peanpunga, Udom; Ugsornrat, Kessararat; Thorlor, Panakamol; Sumithpibul, Chalermsak

    2017-09-01

    This research studied about an epoxy molding compound (EMC) floor life to reliability performance of integrated circuit (IC) package. Molding is the process for protecting the die of IC package form mechanical and chemical reaction from external environment by shaping EMC. From normal manufacturing process, the EMC is stored in the frozen at 5oC and left at around room temperature for aging time or floor life before molding process. The EMC floor life effect to its properties and reliability performance of IC package. Therefore, this work interested in varied the floor life of EMC before molding process to analyze properties of EMC such as spiral flow length, gelation time, and viscosity. In experiment, the floor life of EMC was varied to check the effect of its property to reliability performance. The EMC floor life were varied from 0 hours to 60 hours with a step of 12 hours and observed wire sweep, incomplete EMC, and delamination inside the packages for 3x3, 5x5 and 8x8 mm2 of QFN packages. The evaluation showed about clearly effect of EMC floor life to IC packaging reliability. EMC floor life is not any concern for EMC property, moldabilty, and reliability from 0 hours to 48 hours for molding process of 3x3,5x5 and 8x8 mm2 QFN packaging manufacturing

  6. A programmable nanoreplica molding for the fabrication of nanophotonic devices.

    PubMed

    Liu, Longju; Zhang, Jingxiang; Badshah, Mohsin Ali; Dong, Liang; Li, Jingjing; Kim, Seok-min; Lu, Meng

    2016-03-01

    The ability to fabricate periodic structures with sub-wavelength features has a great potential for impact on integrated optics, optical sensors, and photovoltaic devices. Here, we report a programmable nanoreplica molding process to fabricate a variety of sub-micrometer periodic patterns using a single mold. The process utilizes a stretchable mold to produce the desired periodic structure in a photopolymer on glass or plastic substrates. During the replica molding process, a uniaxial force is applied to the mold and results in changes of the periodic structure, which resides on the surface of the mold. Direction and magnitude of the force determine the array geometry, including the lattice constant and arrangement. By stretching the mold, 2D arrays with square, rectangular, and triangular lattice structures can be fabricated. As one example, we present a plasmonic crystal device with surface plasmon resonances determined by the force applied during molding. In addition, photonic crystal slabs with different array patterns are fabricated and characterized. This unique process offers the capability of generating various periodic nanostructures rapidly and inexpensively.

  7. A programmable nanoreplica molding for the fabrication of nanophotonic devices

    PubMed Central

    Liu, Longju; Zhang, Jingxiang; Badshah, Mohsin Ali; Dong, Liang; Li, Jingjing; Kim, Seok-min; Lu, Meng

    2016-01-01

    The ability to fabricate periodic structures with sub-wavelength features has a great potential for impact on integrated optics, optical sensors, and photovoltaic devices. Here, we report a programmable nanoreplica molding process to fabricate a variety of sub-micrometer periodic patterns using a single mold. The process utilizes a stretchable mold to produce the desired periodic structure in a photopolymer on glass or plastic substrates. During the replica molding process, a uniaxial force is applied to the mold and results in changes of the periodic structure, which resides on the surface of the mold. Direction and magnitude of the force determine the array geometry, including the lattice constant and arrangement. By stretching the mold, 2D arrays with square, rectangular, and triangular lattice structures can be fabricated. As one example, we present a plasmonic crystal device with surface plasmon resonances determined by the force applied during molding. In addition, photonic crystal slabs with different array patterns are fabricated and characterized. This unique process offers the capability of generating various periodic nanostructures rapidly and inexpensively. PMID:26925828

  8. 21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE...

  9. 21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 2 2011-04-01 2011-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE...

  10. Additive Manufacturing of Wind Turbine Molds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Post, Brian; Richardson, Bradley; Lloyd, Peter

    The objective of this project was to explore the utility of Big Area Additive Manufacturing (BAAM) for low cost manufacturing of wind turbine molds. Engineers at Oak Ridge National Laboratory (ORNL) and TPI Composites (TPI) collaborated to design and manufacture a printed mold that can be used for resin infusion of wind turbine components. Specific focus was on required material properties (operating temperatures and pressures, coefficient of thermal expansion (CTE), thermal conductivity), surface finish (accuracy and coatings) and system integration (integrated vacuum ports, and heating element). The project began with a simple proof of principle components, targeting surface coatings andmore » material properties for printing a small section (approximately 4’ x 4’ x 2’) of a mold. Next, the second phase scaled up and integrated with the objective of capturing all of the necessary components (integrated heating to accelerate cure time, and vacuum, sealing) for resin infusion on a mold of significant size (8’ x 20’ x 6’).« less

  11. Neuropsychological exploration of alleged mold neurotoxicity.

    PubMed

    Reinhard, Matthew J; Satz, Paul; Scaglione, Cris A; D'Elia, Louis F; Rassovsky, Yuri; Arita, Anthony A; Hinkin, Charles H; Thrasher, Delaney; Ordog, Gary

    2007-05-01

    Cognitive and emotional correlates of toxic mold exposure and potential dose-response effects for both outcomes were investigated. Self-reported length of exposure, time since last exposure, and serum immunoglobulin (IgG) levels were assessed. Despite CNS complaints often seen with mold exposed individuals, overall results did not uncover concomitant cognitive deficits suggested in previous studies or a significant reduction in intellectual functioning. Fewer subjects were excluded as result of failing effort/motivation assessment than expected. Correlations of IgG and cognitive function are discussed. A dose-effect for self-reported length of exposure and cognitive outcome was not seen. The sample's overall Minnesota Multiphasic Personality Inventory II (MMPI-2) profile indicated elevations on scales 1, 2, 3, 7 and 8. MMPI-2 clinical scales 1 and 3 were significantly correlated with length of exposure. The MMPI-2 may be sensitive to increasing physical and emotional sequelae as length of exposure increases. A potential subgroup of cognitively impaired outliers within mold exposure litigants is explored. Limitations of self-reported and objective measurements for mold exposure and exploratory statistical methodology are discussed.

  12. Evacuated, displacement compression mold. [of tubular bodies from thermosetting plastics

    NASA Technical Reports Server (NTRS)

    Heier, W. C. (Inventor)

    1974-01-01

    A process of molding long thin-wall tubular bodies from thermosetting plastic molding compounds is described wherein the tubular body lengths may be several times the diameters. The process is accomplished by loading a predetermined quantity of molding compound into a female mold cavity closed at one end by a force mandrel. After closing the other end of the female mold with a balance mandrel, the loaded cavity is evacuated by applying a vacuum of from one-to-five mm pressure for a period of fifteen-to-thirty minutes. The mold temperature is raised to the minimum temperature at which the resin constituent of the compound will soften or plasticize and a pressure of 2500 psi is applied.

  13. Breaking the Mold.

    ERIC Educational Resources Information Center

    Huckabee, Christopher

    2003-01-01

    Using the example of a Texas elementary school, describes how to eliminate mold and mildew from school facilities, including discovering the problem, responding quickly, reconstructing the area, and crisis planning and prevention. (EV)

  14. Genomic characterization of recurrent mold infections in thoracic transplant recipients.

    PubMed

    Messina, Julia A; Wolfe, Cameron R; Hemmersbach-Miller, Marion; Milano, Carmelo; Todd, Jamie L; Reynolds, John; Alexander, Barbara D; Schell, Wiley A; Cuomo, Christina A; Perfect, John R

    2018-05-31

    Invasive mold disease in thoracic organ transplant recipients is a well-recognized complication, but the long-term persistence of molds within the human body and evasion of host defenses has not been well-described. We present 2 cases of invasive mold disease (Verruconis gallopava and Aspergillus fumigatus) in thoracic transplant recipients who had the same mold cultured years prior to the invasive disease presentation. The paired isolates from the index and recurrent infections in both patients were compared using whole-genome sequencing to determine if the same strain of mold caused both the index and recurrent infections. In Case 1, the isolates were found to be of the same strain indicating that the initial colonizing isolate identified pre-transplant eventually caused invasive mold disease post-transplant while in Case 2, the 2 isolates were not of the same strain. These results demonstrate the distinct possibility of molds both persisting within the human body for years prior to invasive mold disease or the long-term risk of recurrent, persistent infection with more than one strain. Further studies of long-term molecular epidemiology of IMD and risk factors for mold persistence in transplant recipients are encouraged. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. [Biological monitoring in the molding of plastics and rubbers].

    PubMed

    Fustinoni, S; Campo, L; Cirla, A M; Cirla, P E; Cutugno, V; Lionetti, C; Martinotti, I; Mossini, E; Foà, V

    2007-01-01

    This survey was carried out in the molding of plastics and rubbers, in the "Professional Cancer Prevention Project" sponsored by the Lombardy region with the objective of developing and implementing protocols for evaluating exposure to carcinogens through the biological monitoring. The realities of molding the thermoplastic polymer ABS, rubber, and thermosetting plastics containing formaldehyde were examined. The carcinogenic substances identified in these processes were: 1,3-butadiene, acrylonitrile and styrene in molding ABS, polycyclic aromatic hydrocarbons (PAH) in molding rubber, and formaldehyde in molding the thermosetting plastics. Only for some of these substances biological indicators are available. The limited exposure to airborne chemicals in molding ABS and the intrinsic characteristics of biological indicators available for 1-3 butadiene have determined the non applicability of biological monitoring to this situation. The absence of a biological indicator of exposure to formaldehyde has made this situation not investigable. Exposure in the rubber molding was studied in 19 subjects applying the determination not metabolized PAH in urine. The levels of these indicators were similar to those measured in other groups of subjects without occupational exposure to PAH, confirming a low airborne contamination in this workplace.

  16. Static Mixer for Heat Transfer Enhancement for Mold Cooling Application

    NASA Astrophysics Data System (ADS)

    Becerra, Rodolfo; Barbosa, Raul; Lee, Kye-Hwan; Park, Younggil

    Injection molding is the process by which a material is melted in a barrel and then it is injected through a nozzle in the mold cavity. When it cools down, the material solidifies into the shape of the cavity. Typical injection mold has cooling channels to maintain constant mold temperature during injection molding process. Even and constant temperature throughout the mold are very critical for a part quality and productivity. Conformal cooling improves the quality and productivity of injection molding process through the implementation of cooling channels that ``conform'' to the shape of the molded part. Recent years, the use of conformal cooling increases with advance of 3D printing technology such as Selective Laser Melting (SLM). Although it maximizes cooling, material and dimension limitations make SLM methods highly expensive. An alternative is the addition of static mixers in the molds with integrated cooling channels. A static mixer is a motionless mixing device that enhances heat transfer by producing improved flow mixing in the pipeline. In this study, the performance of the cooling channels will be evaluated with and without static mixers, by measuring temperature, pressure drop, and flow rate. The following question is addressed: Can a static mixer effectively enhance heat transfer for mold cooling application processes? This will provide insight on the development of design methods and guidelines that can be used to increase cooling efficiency at a lower cost.

  17. Treating "cauliflower ear" with silicone mold.

    PubMed

    Gross, C G

    1978-01-01

    Acute hematoma of the ear (cauliflower ear) can be satisfactorily treated with aspiration and the use of the silicone mold to prevent reaccumulation of the blood or serum in the ear. Advantages of the silicone mold over other dressings appears to be ease of application, patient acceptance, and prevention of reoccurrence of reaccumulation of the hematoma.

  18. Mold Image Library

    MedlinePlus

    ... condensation because there is a hole in the insulation and it is cold outdoors. Photo courtesy of ... Inside of wall from above, moldy gypsum board, insulation Photo courtesy of Terry Brennan Looking for mold ...

  19. Simulation of cracking cores when molding piston components

    NASA Astrophysics Data System (ADS)

    Petrenko, Alena; Soukup, Josef

    2014-08-01

    The article deals with pistons casting made from aluminum alloy. Pistons are casting at steel mold with steel core. The casting is provided by gravity casting machine. The each machine is equipped by two metal molds, which are preheated above temperature 160 °C before use. The steel core is also preheated by flame. The metal molds and cores are heated up within the casting process. The temperature of the metal mold raise up to 200 °C and temperature of core is higher. The surface of the core is treated by nitration. The mold and core are cooled down by water during casting process. The core is overheated and its top part is finally cracked despite its intensive water-cooling. The life time cycle of the core is decreased to approximately 5 to 15 thousands casting, which is only 15 % of life time cycle of core for production of other pistons. The article presents the temperature analysis of the core.

  20. Direct molding of pavement tiles made of ground tire rubber

    NASA Astrophysics Data System (ADS)

    Quadrini, Fabrizio; Gagliardi, Donatella; Tedde, Giovanni Matteo; Santo, Loredana; Musacchi, Ettore

    2016-10-01

    Large rubber products can be molded by using only ground tire rubber (GTR) without any additive or binder due to a new technology called "direct molding". Rubber granules and powders from tire recycling are compression molded at elevated temperatures and pressures. The feasibility of this process was clearly shown in laboratory but the step to the industrial scale was missing. Thanks to an European Project (SMART "Sustainable Molding of Articles from Recycled Tires") this step has been made and some results are reported in this study. The press used for compression molding is described. Some tests were made to measure the energy consumption so as to evaluate costs for production in comparison with conventional technologies for GTR molding (by using binders). Results show that 1 m2 tiles can be easily molded with several thicknesses in a reasonable low time. Energy consumption is higher than conventional technologies but it is lower than the cost for binders.

  1. Fundamentals of rapid injection molding for microfluidic cell-based assays.

    PubMed

    Lee, Ulri N; Su, Xiaojing; Guckenberger, David J; Dostie, Ashley M; Zhang, Tianzi; Berthier, Erwin; Theberge, Ashleigh B

    2018-01-30

    Microscale cell-based assays have demonstrated unique capabilities in reproducing important cellular behaviors for diagnostics and basic biological research. As these assays move beyond the prototyping stage and into biological and clinical research environments, there is a need to produce microscale culture platforms more rapidly, cost-effectively, and reproducibly. 'Rapid' injection molding is poised to meet this need as it enables some of the benefits of traditional high volume injection molding at a fraction of the cost. However, rapid injection molding has limitations due to the material and methods used for mold fabrication. Here, we characterize advantages and limitations of rapid injection molding for microfluidic device fabrication through measurement of key features for cell culture applications including channel geometry, feature consistency, floor thickness, and surface polishing. We demonstrate phase contrast and fluorescence imaging of cells grown in rapid injection molded devices and provide design recommendations to successfully utilize rapid injection molding methods for microscale cell-based assay development in academic laboratory settings.

  2. Indoor mold spore exposure: characteristics of 127 homes in southern California with endogenous mold problems.

    PubMed

    Gallup, J; Kozak, P; Cummins, L; Gillman, S

    1987-01-01

    We are constantly being exposed to molds in our environment. Indoor mold problems occur after prolonged or chronic water damage to a variety of organic materials such as unfinished wood, jutebacked carpeting, wallpaper, books, cardboard, leather, cork, paper, wallboard, and wicker baskets. Mechanisms for spore dispersal (such as air currents or foot traffic on carpets) must also be present. The presence of these organic materials and dispersal mechanisms leads to significant increases in indoor spore levels.

  3. 56. ORIGINAL MOLDS. THE MORAVIAN POTTERY AND TILE WORKS HAS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    56. ORIGINAL MOLDS. THE MORAVIAN POTTERY AND TILE WORKS HAS APPROXIMATELY 6,000 PLASTER MOLDS OF VARIOUS TYPES, INCLUDING THE DEEP CAVITY MOLDS IN THE CENTER OF THE PHOTOGRAPH. THESE MOLDS PRODUCED ALLEGORICAL FIGURES TO BE INSTALLED AROUND THE CORNICES OF PUBLIC SCHOOLS. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  4. 21ST CENTURY MOLD ANALYSIS IN FOOD

    EPA Science Inventory

    Traditionally, the indoor air community has relied on mold analysis performed by either microscopic observations or the culturing of molds on various media to assess indoor air quality. These techniques were developed in the 19th century and are very laborious and time consumin...

  5. Mold contamination of automobile air conditioner systems.

    PubMed

    Kumar, P; Lopez, M; Fan, W; Cambre, K; Elston, R C

    1990-02-01

    Eight cars belonging to patients who were found to have exacerbation of allergic rhinitis and bronchial asthma after turning on the air conditioner in their cars were examined. Mold concentrations inside the passenger compartment with the a/c turned off and at different climate control settings were lower than concentrations in the outside air. After turning on the air conditioner to "Max", cultures obtained at various intervals revealed that mold concentrations decreased significantly with time. Furthermore, placement of a filter at the portal of entry of outside air significantly reduced the mold concentration in the passenger compartment.

  6. Rapid manufacturing of metallic Molds for parts in Automobile

    NASA Astrophysics Data System (ADS)

    Zhang, Renji; Xu, Da; Liu, Yuan; Yan, Xudong; Yan, Yongnian

    1998-03-01

    The recent research of RPM (Rapid Prototyping Manufacturing) in our lab has been focused on the rapid creation of alloyed cast iron (ACI) molds. There are a lot of machinery parts in an automobile, so a lot of mettallic molds are needed in automobile industry. A new mold manufacturing technology has been proposed. A new large scale RP machine has been set up in our lab now. Then rapid prototypes could be manufactured by means of laminated object manufacturing (LOM) technology. The molds for parts in automobile have been produced by ceramic shell precision casting. An example is a drawing mold for cover parts in automobile. Sufficient precision and surface roughness have been obtained. Itis proved that this is a vew kind of technology. Work supported by the Mational Science Foundation of China.

  7. Development of In-Mold Assembly Methods for Producing Mesoscale Revolute Joints

    DTIC Science & Technology

    2009-01-01

    tolerances available for manufacturing the molds are relatively low. Any inaccuracy in mold First stage part (ABS) Second stage part ( LDPE ) Pins...case, the viscosity of LDPE is also a function of temperature. For each of these cases, they have considered the filling of a thin mold cavity. From...predicting the weld-line strengths of crystalline polymers such as LDPE . 63 3 Issues in In-Mold Assembly at the Mesoscale 3.1 Motivation In-mold

  8. Study of the Effect of Mold Corner Shape on the Initial Solidification Behavior of Molten Steel Using Mold Simulator

    NASA Astrophysics Data System (ADS)

    Lyu, Peisheng; Wang, Wanlin; Long, Xukai; Zhang, Kaixuan; Gao, Erzhuo; Qin, Rongshan

    2018-02-01

    The chamfered mold with a typical corner shape (angle between the chamfered face and hot face is 45 deg) was applied to the mold simulator study in this paper, and the results were compared with the previous results from a well-developed right-angle mold simulator system. The results suggested that the designed chamfered structure would increase the thermal resistance and weaken the two-dimensional heat transfer around the mold corner, causing the homogeneity of the mold surface temperatures and heat fluxes. In addition, the chamfered structure can decrease the fluctuation of the steel level and the liquid slag flow around the meniscus at mold corner. The cooling intensities at different longitudinal sections of shell are close to each other due to the similar time-average solidification factors, which are 2.392 mm/s1/2 (section A-A: chamfered center), 2.372 mm/s1/2 (section B-B: 135 deg corner), and 2.380 mm/s1/2 (section D-D: face), respectively. For the same oscillation mark (OM), the heights of OM roots at different positions (profile L1 (face), profile L2 (135 deg corner), and profile L3 (chamfered center)) are very close to each other. The average value of height difference (HD) between two OMs roots for L1 and L2 is 0.22 mm, and for L2 and L3 is 0.38 mm. Finally, with the help of metallographic examination, the shapes of different hooks were also discussed.

  9. Three-dimensional numerical simulation for plastic injection-compression molding

    NASA Astrophysics Data System (ADS)

    Zhang, Yun; Yu, Wenjie; Liang, Junjie; Lang, Jianlin; Li, Dequn

    2018-03-01

    Compared with conventional injection molding, injection-compression molding can mold optical parts with higher precision and lower flow residual stress. However, the melt flow process in a closed cavity becomes more complex because of the moving cavity boundary during compression and the nonlinear problems caused by non-Newtonian polymer melt. In this study, a 3D simulation method was developed for injection-compression molding. In this method, arbitrary Lagrangian- Eulerian was introduced to model the moving-boundary flow problem in the compression stage. The non-Newtonian characteristics and compressibility of the polymer melt were considered. The melt flow and pressure distribution in the cavity were investigated by using the proposed simulation method and compared with those of injection molding. Results reveal that the fountain flow effect becomes significant when the cavity thickness increases during compression. The back flow also plays an important role in the flow pattern and redistribution of cavity pressure. The discrepancy in pressures at different points along the flow path is complicated rather than monotonically decreased in injection molding.

  10. Critical tests for determination of microbiological quality and biological activity in commercial vermicompost samples of different origins.

    PubMed

    Grantina-Ievina, Lelde; Andersone, Una; Berkolde-Pīre, Dace; Nikolajeva, Vizma; Ievinsh, Gederts

    2013-12-01

    The aim of the present paper was to show that differences in biological activity among commercially produced vermicompost samples can be found by using a relatively simple test system consisting of microorganism tests on six microbiological media and soilless seedling growth tests with four vegetable crop species. Significant differences in biological properties among analyzed samples were evident both at the level of microbial load as well as plant growth-affecting activity. These differences were mostly manufacturer- and feedstock-associated, but also resulted from storage conditions of vermicompost samples. A mature vermicompost sample that was produced from sewage sludge still contained considerable number of Escherichia coli. Samples from all producers contained several potentially pathogenic fungal species such as Aspergillus fumigatus, Pseudallescheria boidii, Pseudallescheria fimeti, Pseudallescheria minutispora, Scedosporium apiospermum, Scedosporium prolificans, Scopulariopsis brevicaulis, Stachybotrys chartarum, Geotrichum spp., Aphanoascus terreus, and Doratomyces columnaris. In addition, samples from all producers contained plant growth-promoting fungi from the genera Trichoderma and Mortierella. The described system can be useful both for functional studies aiming at understanding of factors affecting quality characteristics of vermicompost preparations and for routine testing of microbiological quality and biological activity of organic waste-derived composts and vermicomposts.

  11. 47 CFR 76.805 - Access to molding.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Access to molding. 76.805 Section 76.805 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES MULTICHANNEL VIDEO AND CABLE TELEVISION SERVICE Cable Inside Wiring § 76.805 Access to molding. (a) An MVPD shall be permitted...

  12. Precision lens molding of asphero diffractive surfaces in chalcogenide materials

    NASA Astrophysics Data System (ADS)

    Nelson, J.; Scordato, M.; Schwertz, K.; Bagwell, J.

    2015-10-01

    Finished lens molding, and the similar process of precision lens molding, have long been practiced for high volume, accurate replication of optical surfaces on oxide glass. The physics surrounding these processes are well understood, and the processes are capable of producing high quality optics with great fidelity. However, several limitations exist due to properties inherent with oxide glasses. Tooling materials that can withstand the severe environmental conditions of oxide glass molding cannot easily be machined to produce complex geometries such as diffractive surfaces, lens arrays, and off axis features. Current machining technologies coupled with a limited selection of tool materials greatly limits the type of structures that can be molded into the finished optic. Tooling for chalcogenide glasses are not bound by these restrictions since the molding temperatures required are much lower than for oxide glasses. Innovations in tooling materials and manufacturing techniques have enabled the production of complex geometries to optical quality specifications and have demonstrated the viability of creating tools for molding diffractive surfaces, off axis features, datums, and arrays. Applications for optics having these features are found in automotive, defense, security, medical, and industrial domains. This paper will discuss results achieved in the study of various molding techniques for the formation of positive diffractive features on a concave spherical surface molded from As2Se3 chalcogenide glass. Examples and results of molding with tools having CTE match with the glass and non CTE match will be reviewed. The formation of stress within the glass during molding will be discussed, and methods of stress management will also be demonstrated and discussed. Results of process development methods and production of good diffractive surfaces will be shown.

  13. Ultrasound - Aided ejection in micro injection molding

    NASA Astrophysics Data System (ADS)

    Masato, D.; Sorgato, M.; Lucchetta, G.

    2018-05-01

    In this work, an ultrasound-aided ejection system was designed and tested for different polymers (PS, COC and POM) and mold topographies. The proposed solution aims at reducing the ejection friction by decreasing the adhesion component of the frictional force, which is controlled by the contact area developed during the filling stage of the injection molding process. The experimental results indicate a positive effect of ultrasound vibration on the friction force values, with a maximum reduction of 16. Moreover, it is demonstrated that the ultrasound effect is strictly related to both polymer selection and mold roughness. The combined effect on the ejection force of mold surface roughness, melt viscosity during filling and polymer elastic modulus at ejection was modeled to the experimental data, in order to demonstrate that the effect of ultrasound vibration on the ejection friction reduction is due to the heating of the contact interface and the consequent reduction of the polymer elastic modulus.

  14. Method and composition for molding low-density desiccant syntactic-foam articles

    DOEpatents

    Not Available

    1981-12-07

    These and other objects of the invention are achieved by a process for molding to size a desiccant syntactic foam article having a density of 0.2 to 0.9 g/cc and a moisture capacity of 1 to 12% by weight, comprising the steps of: charging a mold with a powdery mixture of an activated desiccant, microspheres and a thermosetting resin, the amount of the desiccant being sufficient to provide the required moisture capacity, and the amounts of the microspheres and resin being such that the microspheres/desiccant volume fraction exceeds the packing factor by an amount sufficient to substantially avoid shrinkage without causing excessively high molding pressures; covering the mold and heating the covered mold to a temperature and for an amount of time sufficient to melt the resin; and tightly closing the mold and heating the closed mold to a temperature and for an amount of time sufficient to cure the resin, and removing the resultant desiccant syntactic foam article from the mold. In a composition of matter aspect, the present invention provides desiccant syntactic foam articles, and a composition of matter for use in molding the same.

  15. Injection molded polymer optics in the 21st Century

    NASA Astrophysics Data System (ADS)

    Beich, William S.

    2005-08-01

    Precision polymer optics, manufactured by injection molding techniques, has been a key enabling technology for several decades now. The technology, which can be thought of as a subset of the wider field of precision optics manufacturing, was pioneered in the United States by companies such as Eastman Kodak, US Precision Lens, and Polaroid. In addition to suppliers in the U.S. there are several companies worldwide that design and manufacture precision polymer optics, for example Philips High Tech Plastics in Europe and Fujinon in Japan. Designers who are considering using polymer optics need a fundamental understanding of exactly how the optics are created. This paper will survey the technology and processes that are employed in the successful implementation of a polymer optic solution from a manufacturer's perspective. Special emphasis will be paid to the unique relationship between the molds and the optics that they produce. We will discuss the key elements of production: molding resins, molds and molding equipment, and metrology. Finally we will offer a case study to illustrate just how the optics designer carries a design concept through to production. The underlying theme throughout the discussion of polymer optics is the need for the design team to work closely with an experienced polymer optics manufacturer with a solid track record of success in molded optics. As will be seen shortly, the complex interaction between thermoplastics, molds, and molding machines dictates the need for working closely with a supplier who has the critical knowledge needed to manage all aspects of the program.

  16. Flexible Nonstick Replica Mold for Transfer Printing of Ag Ink.

    PubMed

    Lee, Bong Kuk; Yu, Han Young; Kim, Yarkyeon; Yoon, Yong Sun; Jang, Won Ik; Do, Lee-Mi; Park, Ji-Ho; Park, Jaehoon

    2016-03-01

    We report the fabrication of flexible replica molds for transfer printing of Ag ink on a rigid glass substrate. As mold precursors, acrylic mixtures were prepared from silsesquioxane-based materials, silicone acrylate, poly(propylene glycol) diacrylate, 3,3,4,4,5,5,6,6,7,7,8,8, 9,9,10,10,10-heptadecafluorodecyl methacrylate, and photoinitiator. By using these materials, the replica molds were fabricated from a silicon master onto a flexible substrate by means of UV-assisted molding process at room temperature. The wettability of Ag ink decreased with increase in the water contact angle of replica molds. On the other hand, the transfer rate of Ag ink onto adhesive-modified substrates increased with increase in the water contact angle of replica molds. Transferred patterns were found to be thermally stable on the photocurable adhesive layer, whereas Ag-ink patterns transferred on non-photocurable adhesives were distorted by thermal treatment. We believe that these characteristics of replica molds and adhesives offer a new strategy for the development of the transfer printing of solution-based ink materials.

  17. A would-be nervous system made from a slime mold.

    PubMed

    Adamatzky, Andrew

    2015-01-01

    The slime mold Physarum polycephalum is a huge single cell that has proved to be a fruitful material for designing novel computing architectures. The slime mold is capable of sensing tactile, chemical, and optical stimuli and converting them to characteristic patterns of its electrical potential oscillations. The electrical responses to stimuli may propagate along protoplasmic tubes for distances exceeding tens of centimeters, as impulses in neural pathways do. A slime mold makes decisions about its propagation direction based on information fusion from thousands of spatially extended protoplasmic loci, similarly to a neuron collecting information from its dendritic tree. The analogy is distant yet inspiring. We speculate on whether alternative-would-be-nervous systems can be developed and practically implemented from the slime mold. We uncover analogies between the slime mold and neurons, and demonstrate that the slime mold can play the roles of primitive mechanoreceptors, photoreceptors, and chemoreceptors; we also show how the Physarum neural pathways develop. The results constituted the first step towards experimental laboratory studies of nervous system implementation in slime molds.

  18. TRUFLO GONDOLA, USED WITH THE HUNTER 10 MOLDING MACHINE, OPERATES ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    TRUFLO GONDOLA, USED WITH THE HUNTER 10 MOLDING MACHINE, OPERATES THE SAME AS THE TWO LARGER TRUFLOS USED IN CONJUNCTION WITH THE TWO HUNTER 20S. EACH GONDOLA IS CONNECTED TO THE NEXT AND RIDES ON A SINGLE TRACK RAIL FROM MOLDING MACHINES THROUGH POURING AREAS CARRYING A MOLD AROUND TWICE BEFORE THE MOLD IS PUSHED OFF ONTO A VIBRATING SHAKEOUT CONVEYOR. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  19. Production application of injection-molded diffractive elements

    NASA Astrophysics Data System (ADS)

    Clark, Peter P.; Chao, Yvonne Y.; Hines, Kevin P.

    1995-12-01

    We demonstrate that transmission kinoforms for visible light applications can be injection molded in acrylic in production volumes. A camera is described that employs molded Fresnel lenses to change the convergence of a projection ranging system. Kinoform surfaces are used in the projection system to achromatize the Fresnel lenses.

  20. Classification of buildings mold threat using electronic nose

    NASA Astrophysics Data System (ADS)

    Łagód, Grzegorz; Suchorab, Zbigniew; Guz, Łukasz; Sobczuk, Henryk

    2017-07-01

    Mold is considered to be one of the most important features of Sick Building Syndrome and is an important problem in current building industry. In many cases it is caused by the rising moisture of building envelopes surface and exaggerated humidity of indoor air. Concerning historical buildings it is mostly caused by outdated raising techniques among that is absence of horizontal isolation against moisture and hygroscopic materials applied for construction. Recent buildings also suffer problem of mold risk which is caused in many cases by hermetization leading to improper performance of gravitational ventilation systems that make suitable conditions for mold development. Basing on our research there is proposed a method of buildings mold threat classification using electronic nose, based on a gas sensors array which consists of MOS sensors (metal oxide semiconductor). Used device is frequently applied for air quality assessment in environmental engineering branches. Presented results show the interpretation of e-nose readouts of indoor air sampled in rooms threatened with mold development in comparison with clean reference rooms and synthetic air. Obtained multivariate data were processed, visualized and classified using a PCA (Principal Component Analysis) and ANN (Artificial Neural Network) methods. Described investigation confirmed that electronic nose - gas sensors array supported with data processing enables to classify air samples taken from different rooms affected with mold.

  1. Selection of antifungal protein-producing molds from dry-cured meat products.

    PubMed

    Acosta, Raquel; Rodríguez-Martín, Andrea; Martín, Alberto; Núñez, Félix; Asensio, Miguel A

    2009-09-30

    To control unwanted molds in dry-cured meats it is necessary to allow the fungal development essential for the desired characteristics of the final product. Molds producing antifungal proteins could be useful to prevent hazards due to the growth of mycotoxigenic molds. The objective has been to select Penicillium spp. that produce antifungal proteins against toxigenic molds. To obtain strains adapted to these products, molds were isolated from dry-cured ham. A first screening with 281 isolates by the radial inhibition assay revealed that 166 were active against some of the toxigenic P. echinulatum, P. commune, and Aspergillusniger used as reference molds. The activity of different extracts from cultured medium was evaluated by a microspectroscopic assay. Molds producing active chloroform extracts were eliminated from further consideration. A total of 16 Penicillium isolates were screened for antifungal activity from both cell-free media and the aqueous residues obtained after chloroform extraction. The cell-free media of 10 isolates that produced a strong inhibition of the three reference molds were fractionated by FPLC on a cationic column. For protein purification, the fractions of the three molds that showed high inhibitory activity were further chromatographed on a gel filtration column, and the subfractions containing the highest absorbance peaks were assayed against the most sensitive reference molds. One subfraction each from strains AS51D and RP42C from Penicilliumchrysogenum confirmed the inhibitory activity against the reference molds. SDS-PAGE revealed a single band from each subfraction, with estimated molecular masses of 37kDa for AS51D and 9kDa for RP42C. Although further characterisation is required, both these proteins and the producing strains can be of interest to control unwanted molds on foods.

  2. Differential allergy induction by molds found in water-damaged homes**

    EPA Science Inventory

    Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases including allergic lung diseases. The Institute of Medicine reports (NAS, 2004) and World Health Organization guidelines (WHO, 2009) concluded that the role of molds in asthma indu...

  3. Integrally cored ceramic investment casting mold fabricated by ceramic stereolithography

    NASA Astrophysics Data System (ADS)

    Bae, Chang-Jun

    Superalloy airfoils are produced by investment casting (IC), which uses ceramic cores and wax patterns with ceramic shell molds. Hollow cored superalloy airfoils in a gas turbine engine are an example of complex IC parts. The complex internal hollow cavities of the airfoil are designed to conduct cooling air through one or more passageways. These complex internal passageways have been fabricated by a lost wax process requiring several processing steps; core preparation, injection molding for wax pattern, and dipping process for ceramic shell molds. Several steps generate problems such as high cost and decreased accuracy of the ceramic mold. For example, costly tooling and production delay are required to produce mold dies for complex cores and wax patterns used in injection molding, resulting in a big obstacle for prototypes and smaller production runs. Rather than using separate cores, patterns, and shell molds, it would be advantageous to directly produce a mold that has the casting cavity and the ceramic core by one process. Ceramic stereolithography (CerSLA) can be used to directly fabricate the integrally cored ceramic casting mold (ICCM). CerSLA builds ceramic green objects from CAD files from many thin liquid layers of powder in monomer, which are solidified by polymerization with a UV laser, thereby "writing" the design for each slice. This dissertation addresses the integrally cored casting ceramic mold (ICCM), the ceramic core with a ceramic mold shell in a single patternless construction, fabricated by ceramic stereolithography (CerSLA). CerSLA is considered as an alternative method to replace lost wax processes, for small production runs or designs too complex for conventional cores and patterns. The main topic is the development of methods to successfully fabricate an ICCM by CerSLA from refractory silica, as well as related issues. The related issues are the segregation of coarse fused silica powders in a layer, the degree of segregation parameter to

  4. Mold Remediation in Schools and Commercial Buildings.

    ERIC Educational Resources Information Center

    Environmental Protection Agency, Washington, DC. Office of Radiation and Indoor Air.

    This document describes how to investigate and evaluate moisture and mold problems in educational facilities, and presents the key steps for implementing a remediation plan. A checklist is provided for conducting mold remediation efforts along with a resource list of helpful organizations and governmental agencies. Appendices contain a glossary,…

  5. Feasibility of using Big Area Additive Manufacturing to Directly Manufacture Boat Molds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Post, Brian K.; Chesser, Phillip C.; Lind, Randall F.

    The goal of this project was to explore the feasibility of using Big Area Additive Manufacturing (BAAM) to directly manufacture a boat mold without the need for coatings. All prior tooling projects with BAAM required the use to thick coatings to overcome the surface finish limitations of the BAAM process. While the BAAM process significantly lowers the cost of building the mold, the high cost element rapidly became the coatings (cost of the material, labor on coating, and finishing). As an example, the time and cost to manufacture the molds for the Wind Turbine project with TPI Composites Inc. andmore » the molds for the submarine project with Carderock Naval Warfare Systems was a fraction of the time and cost of the coatings. For this project, a catamaran boat hull mold was designed, manufactured, and assembled with an additional 0.15” thickness of material on all mold surfaces. After printing, the mold was immediately machined and assembled. Alliance MG, LLC (AMG), the industry partner of this project, experimented with mold release agents on the carbon-fiber reinforced acrylonitrile butadiene styrene (CF ABS) to verify that the material can be directly used as a mold (rather than needing a coating). In addition, for large molds (such as the wind turbine mold with TPI Composites Inc.), the mold only provided the target surface. A steel subframe had to be manufactured to provide structural integrity. If successful, this will significantly reduce the time and cost necessary for manufacturing large resin infusion molds using the BAAM process.« less

  6. QUANTIFYING INDOOR MOLDS

    EPA Science Inventory

    The US EPA has patented a mold ID technology (#6,387,652) licensed by 15 companies in the US and EU. This technology is based upon DNA sequences. In conjunction with HUD, this technology will be used in a National Survey of Homes.

  7. Prompt remediation of water intrusion corrects the resultant mold contamination in a home.

    PubMed

    Rockwell, William

    2005-01-01

    More patients are turning to their allergists with symptoms compatible with allergic rhinitis, allergic sinusitis, and/or bronchial asthma after exposure to mold-contaminated indoor environments. These patients often seek guidance from their allergists in the remediation of the contaminated home or office. The aim of this study was to determine baseline mold spore counts for noncontaminated homes and report a successful mold remediation in one mold-contaminated home. Indoor air quality was tested using volumetric spore counts in 50 homes where homeowners reported no mold-related health problems and in one mold-contaminated home that was remediated. The health of the occupant of the mold-contaminated home also was assessed. Indoor volumetric mold spore counts ranged from 300 to 1200 spores/m3 in the baseline homes. For the successful remediation, the mold counts started at 300 spores/m3, increased to 2800 spores/m3 at the height of the mold contamination, and then fell to 800 spores/m3 after remediation. The occupant's allergic symptoms ceased on complete remediation of the home. Indoor volumetric mold counts taken with the Allergenco MK-3 can reveal a potential indoor mold contamination, with counts above 1000 spores/m3 suggesting indoor mold contamination. Once the presence of indoor mold growth is found, a prompt and thorough remediation can bring mold levels back to near-baseline level and minimize negative health effects for occupants.

  8. INGOT MOLD

    DOEpatents

    Mangold, A.J. Jr.; MaHaffey, J.W.; Reese, S.L.

    1958-04-29

    An improved ingot-mold assembly is described, consisting of a body having a cavity and a recess extending through to the bottom of the body from the cavity, and the bottom of the cavity having an internal shoulder extending downward and a plug having an external shoulder. The plug extends above the shoulders and below the bottom of the body.

  9. THE DURABILITY OF LARGE-SCALE ADDITIVE MANUFACTURING COMPOSITE MOLDS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Post, Brian K; Love, Lonnie J; Duty, Chad

    2016-01-01

    Oak Ridge National Laboratory s Big Area Additive Manufacturing (BAAM) technology permits the rapid production of thermoplastic composite molds using a carbon fiber filled Acrylonitrile-Butadiene-Styrene (ABS) thermoplastic. Demonstration tools (i.e. 0.965 m X 0.559 m X 0.152 m) for composite part fabrication have been printed, coated, and finished with a traditional tooling gel. We present validation results demonstrating the stability of thermoplastic printed molds for room temperature Vacuum Assisted Resin Transfer Molding (VARTM) processes. Arkema s Elium thermoplastic resin was investigated with a variety of reinforcement materials. Experimental results include dimensional characterization of the tool surface using laser scanning techniquemore » following demolding of 10 parts. Thermoplastic composite molds offer rapid production compared to traditionally built thermoset molds in that near-net deposition allows direct digital production of the net geometry at production rate of 45 kg/hr.« less

  10. Additive Manufacturing of Molds for Fabrication of Insulated Concrete Block

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Love, Lonnie J.; Lloyd, Peter D.

    ORNL worked with concrete block manufacturer, NRG Insulated Block, to demonstrate additive manufacturing of a multi-component block mold for its line of insulated blocks. Solid models of the mold parts were constructed from existing two-dimensional drawings and the parts were fabricated on a Stratasys Fortus 900 using ULTEM 9085. Block mold parts were delivered to NRG and installed on one of their fabrication lines. While form and fit were acceptable, the molds failed to function during NRG’s testing.

  11. Introducing the slime mold graph repository

    NASA Astrophysics Data System (ADS)

    Dirnberger, M.; Mehlhorn, K.; Mehlhorn, T.

    2017-07-01

    We introduce the slime mold graph repository or SMGR, a novel data collection promoting the visibility, accessibility and reuse of experimental data revolving around network-forming slime molds. By making data readily available to researchers across multiple disciplines, the SMGR promotes novel research as well as the reproduction of original results. While SMGR data may take various forms, we stress the importance of graph representations of slime mold networks due to their ease of handling and their large potential for reuse. Data added to the SMGR stands to gain impact beyond initial publications or even beyond its domain of origin. We initiate the SMGR with the comprehensive Kist Europe data set focusing on the slime mold Physarum polycephalum, which we obtained in the course of our original research. It contains sequences of images documenting growth and network formation of the organism under constant conditions. Suitable image sequences depicting the typical P. polycephalum network structures are used to compute sequences of graphs faithfully capturing them. Given such sequences, node identities are computed, tracking the development of nodes over time. Based on this information we demonstrate two out of many possible ways to begin exploring the data. The entire data set is well-documented, self-contained and ready for inspection at http://smgr.mpi-inf.mpg.de.

  12. 75 FR 55340 - Recovery Fact Sheet 9580.100, Mold Remediation

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-10

    ...] Recovery Fact Sheet 9580.100, Mold Remediation AGENCY: Federal Emergency Management Agency, DHS. ACTION... accepting comments on Recovery Fact Sheet RP9580.100, Mold Remediation. DATES: Comments must be received by... 20472-3100. II. Background The Recovery Fact Sheet RP9580.100, Mold Remediation, identifies the expenses...

  13. Controlling Radiative Heat Transfer Across the Mold Flux Layer by the Scattering Effect of the Borosilicate Mold Flux System with Metallic Iron

    NASA Astrophysics Data System (ADS)

    Yoon, Dae-Woo; Cho, Jung-Wook; Kim, Seon-Hyo

    2017-08-01

    The present study proposes a countermeasure for regulating total heat flux through the mold flux layer by designed mold flux with additive metallic iron particles. The heat flux through the B2O3-CaO-SiO2-Na2O-CaF2-Fe system was investigated using the infrared emitter technique to evaluate total flux density across the mold flux film. Both scanning electron microscope (SEM) and X-ray diffraction analysis were employed in order to identify the morphological and compositional changes of the crystalline phase, according to increasing iron contents in the mold flux. It was confirmed that the crystalline layer of studied mold fluxes does not have a meaningful effect on the total heat flux density due to the similar structure and fraction of the crystalline phase. The extinction coefficient was measured for glassy mold fluxes using an ultraviolet/visible and a Fourier transformation-infrared ray spectrometer in the range of 0.5 to 5 μm. For analyzing the scattering behavior of iron particles on the extinction coefficient, the number density and diameter of particles were observed by an automated SEM (auto-SEM). With these data, Mie scattering theory is adopted to define the scattering behavior of dispersed iron droplets in glassy matrix. It was found that the theoretical scattering coefficient demonstrated about 1623 to 3295 m-1, which is in accordance with the experimental results. In doing so, this study successfully achieves the strong scattering behavior that would contribute greatly to the optimization of overall heat flux through the mold flux film during the casting process.

  14. Chemotaxis in the Plasmodial Slime Mold, Physarum polycephalum.

    ERIC Educational Resources Information Center

    Bozzone, Donna M.; Martin, Denise A.

    1998-01-01

    Describes a biology unit designed so that students pose their own questions and perform experiments to answer these questions. Plasmodial slime mold is employed as the focus of the study with background information about the mold provided. (DDR)

  15. Crack-resistant siloxane molding compounds. [Patent application

    DOEpatents

    McFarland, J.W.; Swearngin, C.B.

    1980-11-03

    The crack resistance of phenyl silicone molding resins containing siliceous fillers is improved by incorporating therein about 0.5 to 5.5% by weight of ..beta..-eucryptite, a lithium aluminum silicate having a negative thermal expansion coefficient. These molding resins are particularly suitable for encapsulating electronic devices such as diodes, coils, resistors, and the like.

  16. Method and mold for casting thin metal objects

    DOEpatents

    Pehrson, Brandon P; Moore, Alan F

    2014-04-29

    Provided herein are various embodiments of systems for casting thin metal plates and sheets. Typical embodiments include layers of mold cavities that are oriented vertically for casting the metal plates. In some embodiments, the mold cavities include a beveled edge such that the plates that are cast have a beveled edge. In some embodiments, the mold cavities are filled with a molten metal through an open horizontal edge of the cavity. In some embodiments, the mold cavities are filled through one or more vertical feed orifices. Further disclosed are methods for forming a thin cast metal plate or sheet where the thickness of the cast part is in a range from 0.005 inches to 0.2 inches, and the surface area of the cast part is in a range from 16 square inches to 144 square inches.

  17. Progress in Titanium Metal Powder Injection Molding.

    PubMed

    German, Randall M

    2013-08-20

    Metal powder injection molding is a shaping technology that has achieved solid scientific underpinnings. It is from this science base that recent progress has occurred in titanium powder injection molding. Much of the progress awaited development of the required particles with specific characteristics of particle size, particle shape, and purity. The production of titanium components by injection molding is stabilized by a good understanding of how each process variable impacts density and impurity level. As summarized here, recent research has isolated the four critical success factors in titanium metal powder injection molding (Ti-MIM) that must be simultaneously satisfied-density, purity, alloying, and microstructure. The critical role of density and impurities, and the inability to remove impurities with sintering, compels attention to starting Ti-MIM with high quality alloy powders. This article addresses the four critical success factors to rationalize Ti-MIM processing conditions to the requirements for demanding applications in aerospace and medical fields. Based on extensive research, a baseline process is identified and reported here with attention to linking mechanical properties to the four critical success factors.

  18. Progress in Titanium Metal Powder Injection Molding

    PubMed Central

    German, Randall M.

    2013-01-01

    Metal powder injection molding is a shaping technology that has achieved solid scientific underpinnings. It is from this science base that recent progress has occurred in titanium powder injection molding. Much of the progress awaited development of the required particles with specific characteristics of particle size, particle shape, and purity. The production of titanium components by injection molding is stabilized by a good understanding of how each process variable impacts density and impurity level. As summarized here, recent research has isolated the four critical success factors in titanium metal powder injection molding (Ti-MIM) that must be simultaneously satisfied—density, purity, alloying, and microstructure. The critical role of density and impurities, and the inability to remove impurities with sintering, compels attention to starting Ti-MIM with high quality alloy powders. This article addresses the four critical success factors to rationalize Ti-MIM processing conditions to the requirements for demanding applications in aerospace and medical fields. Based on extensive research, a baseline process is identified and reported here with attention to linking mechanical properties to the four critical success factors. PMID:28811458

  19. Index change of chalcogenide materials from precision glass molding processes

    NASA Astrophysics Data System (ADS)

    Deegan, J.; Walsh, K.; Lindberg, G.; Benson, R.; Gibson, D.; Bayya, S.; Sanghera, J.; Stover, E.

    2015-05-01

    With the increase in demand for infrared optics for thermal applications and the use of glass molding of chalcogenide materials to support these higher volume optical designs, an investigation of changes to the optical properties of these materials is required. Typical precision glass molding requires specific thermal conditions for proper lens molding of any type of optical glass. With these conditions a change (reduction) of optical index occurs after molding of all oxide glass types and it is presumed that a similar behavior will happen with chalcogenide based materials. We will discuss the effects of a typical molding thermal cycle for use with commercially and newly developed chalcogenide materials and show results of index variation from nominally established material data.

  20. Onychomycosis due to opportunistic molds*

    PubMed Central

    Martínez-Herrera, Erick Obed; Arroyo-Camarena, Stefanie; Tejada-García, Diana Luz; Porras-López, Carlos Francisco; Arenas, Roberto

    2015-01-01

    BACKGROUND: Onychomycosis are caused by dermatophytes and Candida, but rarely by non- dermatophyte molds. These opportunistic agents are filamentous fungi found as soil and plant pathogens. OBJECTIVES: To determine the frequency of opportunistic molds in onychomycosis. METHODS: A retrospective analysis of 4,220 cases with onychomycosis, diagnosed in a 39-month period at the Institute of Dermatology and Skin surgery "Prof. Dr. Fernando A. Cordero C." in Guatemala City, and confirmed with a positive KOH test and culture. RESULTS: 32 cases (0.76%) of onychomycosis caused by opportunistic molds were confirmed. The most affected age group ranged from 41 to 65 years (15 patients, 46.9%) and females were more commonly affected (21 cases, 65.6%) than males. Lateral and distal subungual onychomycosis (OSD-L) was detected in 20 cases (62.5%). The microscopic examination with KOH showed filaments in 19 cases (59.4%), dermatophytoma in 9 cases (28.1%), spores in 2 cases (6.25%), and filaments and spores in 2 cases (6.25%). Etiologic agents: Aspergillus sp., 11 cases (34.4%); Scopulariopsis brevicaulis, 8 cases (25.0%); Cladosporium sp., 3 cases (9.4%); Acremonium sp., 2 cases (6.25%); Paecilomyces sp., 2 cases (6.25%); Tritirachium oryzae, 2 cases (6.25%); Fusarium sp., Phialophora sp., Rhizopus sp. and Alternaria alternate, 1 case (3.1%) each. CONCLUSIONS: We found onychomycosis by opportunistic molds in 0.76% of the cases and DLSO was present in 62.5%. The most frequent isolated etiological agents were: Aspergillus sp. and Scopulariopsis brevicaulis. PMID:26131862

  1. Low Cost Injection Mold Creation via Hybrid Additive and Conventional Manufacturing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dehoff, Ryan R.; Watkins, Thomas R.; List, III, Frederick Alyious

    2015-12-01

    The purpose of the proposed project between Cummins and ORNL is to significantly reduce the cost of the tooling (machining and materials) required to create injection molds to make plastic components. Presently, the high cost of this tooling forces the design decision to make cast aluminum parts because Cummins typical production volumes are too low to allow injection molded plastic parts to be cost effective with the amortized cost of the injection molding tooling. In addition to reducing the weight of components, polymer injection molding allows the opportunity for the alternative cooling methods, via nitrogen gas. Nitrogen gas cooling offersmore » an environmentally and economically attractive cooling option, if the mold can be manufactured economically. In this project, a current injection molding design was optimized for cooling using nitrogen gas. The various components of the injection mold tooling were fabricated using the Renishaw powder bed laser additive manufacturing technology. Subsequent machining was performed on the as deposited components to form a working assembly. The injection mold is scheduled to be tested in a projection setting at a commercial vendor selected by Cummins.« less

  2. Diagnosis of mold allergy by RAST and skin prick testing.

    PubMed

    Nordvall, S L; Agrell, B; Malling, H J; Dreborg, S

    1990-11-01

    Sera from 33 patients with mold allergy proven by bronchial provocation were analyzed for specific IgE against six mold species comparing an improved Phadebas RAST with four other techniques. The new method was more sensitive and gave significantly higher IgE antibody concentrations for all tested molds except Cladosporium herbarum.

  3. Investigation of micro-injection molding based on longitudinal ultrasonic vibration core.

    PubMed

    Qiu, Zhongjun; Yang, Xue; Zheng, Hui; Gao, Shan; Fang, Fengzhou

    2015-10-01

    An ultrasound-assisted micro-injection molding method is proposed to improve the rheological behavior of the polymer melt radically, and a micro-injection molding system based on a longitudinal ultrasonic vibration core is developed and employed in the micro-injection molding process of Fresnel lenses. The verification experiments show that the filling mold area of the polymer melt is increased by 6.08% to 19.12%, and the symmetric deviation of the Fresnel lens is improved 15.62% on average. This method improved the filling performance and replication quality of the polymer melt in the injection molding process effectively.

  4. Design and Checking Analysis of Injection Mold for a Plastic Cup

    NASA Astrophysics Data System (ADS)

    Li, Xuebing

    2018-03-01

    A special injection mold was designed for the structural characteristics of a plastic cup part. The mold was simulated by Moldflow software and verified by calculating the stripping force, the pulling force and the clamping force of the mold so that to determine the appropriate injection parameters. It has been proved that the injection mold is effective and practical in the actual producing and can meet the quality requirements during the course of using it, which solved some problems for injection molding of this kind of parts and can provide some reference for the production of other products in the same industry.

  5. Residual stresses in injection molded shape memory polymer parts

    NASA Astrophysics Data System (ADS)

    Katmer, Sukran; Esen, Huseyin; Karatas, Cetin

    2016-03-01

    Shape memory polymers (SMPs) are materials which have shape memory effect (SME). SME is a property which has the ability to change shape when induced by a stimulator such as temperature, moisture, pH, electric current, magnetic field, light, etc. A process, known as programming, is applied to SMP parts in order to alter them from their permanent shape to their temporary shape. In this study we investigated effects of injection molding and programming processes on residual stresses in molded thermoplastic polyurethane shape memory polymer, experimentally. The residual stresses were measured by layer removal method. The study shows that injection molding and programming process conditions have significantly influence on residual stresses in molded shape memory polyurethane parts.

  6. Effect of Binder and Mold parameters on Collapsibility and Surface Finish of Gray Cast Iron No-bake Sand Molds

    NASA Astrophysics Data System (ADS)

    Srinivasulu Reddy, K.; Venkata Reddy, Vajrala; Mandava, Ravi Kumar

    2017-08-01

    Chemically bonded no-bake molds and cores have good mechanical properties and produce dimensionally accurate castings compared to green sand molds. Poor collapsibility property of CO2 hardened sodium silicate bonded sand mold and phenolic urethane no-bake (PUN) binder system, made the reclamation of the sands more important. In the present work fine silica sand is mixed with phenolic urethane no-bake binder and the sand sets in a very short time within few minutes. In this paper it is focused on optimizing the process parameters of PUN binder based sand castings for better collapsibility and surface finish of gray cast iron using Taguchi design. The findings were successfully verified through experiments.

  7. Molding apparatus. [for thermosetting plastic compositions

    NASA Technical Reports Server (NTRS)

    Heier, W. C. (Inventor)

    1974-01-01

    Apparatus for compression molding of thermosetting plastics compositions including interfitting hollow male and female components is reported. The components are adapted to be compressed to form a rocket nozzle in a cavity. A thermal jacket is provided exteriorly adjacent to the female component for circulating a thermal transfer fluid to effect curing of a thermosetting plastics material being molded. Each of the male and female components is provided with suitable inlets and outlets for circulating a thermal transfer fluid.

  8. Ultrasonically-assisted Polymer Molding: An Evaluation

    NASA Astrophysics Data System (ADS)

    Moles, Matthew; Roy, Anish; Silberschmidt, Vadim

    Energy reduction in extrusion and injection molding processes can be achieved by the introduction of ultrasonic energy. Polymer flow can be enhanced on application of ultrasonic vibration, which can reduce the thermal and pressure input requirements to produce the same molding; higher productivity may also be achieved. In this paper, a design of an ultrasound-assisted injection mold machine is explored. An extrusion-die design was augmented with a commercial 1.5 kW ultrasonic transducer and sonotrode designed to resonate close to 20 kHz with up to 100 μm vibration amplitude. The design was evaluated with modal and thermal analysis using finite-element analysis software. The use of numerical techniques, including computational fluid dynamics, fluid-structure interaction and coupled Lagrangian-Eulerian method, to predict the effect of ultrasound on polymer flow was considered. A sonotrode design utilizing ceramic to enhance thermal isolation was also explored.

  9. Neonatal Ear Molding: Timing and Technique.

    PubMed

    Anstadt, Erin Elizabeth; Johns, Dana Nicole; Kwok, Alvin Chi-Ming; Siddiqi, Faizi; Gociman, Barbu

    2016-03-01

    The incidence of auricular deformities is believed to be ∼11.5 per 10,000 births, excluding children with microtia. Although not life-threatening, auricular deformities can cause undue distress for patients and their families. Although surgical procedures have traditionally been used to reconstruct congenital auricular deformities, ear molding has been gaining acceptance as an efficacious, noninvasive alternative for the treatment of newborns with ear deformations. We present the successful correction of bilateral Stahl's ear deformity in a newborn through a straightforward, nonsurgical method implemented on the first day of life. The aim of this report is to make pediatric practitioners aware of an effective and simple molding technique appropriate for correction of congenital auricular anomalies. In addition, it stresses the importance of very early initiation of ear cartilage molding for achieving the desired outcome. Copyright © 2016 by the American Academy of Pediatrics.

  10. METHOD FOR EVALUATING MOLD GROWTH ON CEILING TILE

    EPA Science Inventory

    A method to extract mold spores from porous ceiling tiles was developed using a masticator blender. Ceiling tiles were inoculated and analyzed using four species of mold. Statistical analysis comparing results obtained by masticator extraction and the swab method was performed. T...

  11. Laser-Etched Designs for Molding Hydrogel-Based Engineered Tissues

    PubMed Central

    Munarin, Fabiola; Kaiser, Nicholas J.; Kim, Tae Yun; Choi, Bum-Rak

    2017-01-01

    Rapid prototyping and fabrication of elastomeric molds for sterile culture of engineered tissues allow for the development of tissue geometries that can be tailored to different in vitro applications and customized as implantable scaffolds for regenerative medicine. Commercially available molds offer minimal capabilities for adaptation to unique conditions or applications versus those for which they are specifically designed. Here we describe a replica molding method for the design and fabrication of poly(dimethylsiloxane) (PDMS) molds from laser-etched acrylic negative masters with ∼0.2 mm resolution. Examples of the variety of mold shapes, sizes, and patterns obtained from laser-etched designs are provided. We use the patterned PDMS molds for producing and culturing engineered cardiac tissues with cardiomyocytes derived from human-induced pluripotent stem cells. We demonstrate that tight control over tissue morphology and anisotropy results in modulation of cell alignment and tissue-level conduction properties, including the appearance and elimination of reentrant arrhythmias, or circular electrical activation patterns. Techniques for handling engineered cardiac tissues during implantation in vivo in a rat model of myocardial infarction have been developed and are presented herein to facilitate development and adoption of surgical techniques for use with hydrogel-based engineered tissues. In summary, the method presented herein for engineered tissue mold generation is straightforward and low cost, enabling rapid design iteration and adaptation to a variety of applications in tissue engineering. Furthermore, the burden of equipment and expertise is low, allowing the technique to be accessible to all. PMID:28457187

  12. Manufacture of mold of polymeric composite water pipe reinforced charcoal

    NASA Astrophysics Data System (ADS)

    Zulfikar; Misdawati; Idris, M.; Nasution, F. K.; Harahap, U. N.; Simanjuntak, R. K.; Jufrizal; Pranoto, S.

    2018-03-01

    In general, household wastewater pipelines currently use thermoplastic pipes of Polyvinyl Chloride (PVC). This material is known to be not high heat resistant, contains hazardous chemicals (toxins), relatively inhospitable, and relatively more expensive. Therefore, researchers make innovations utilizing natural materials in the form of wood charcoal as the basic material of making the water pipe. Making this pipe requires a simple mold design that can be worked in the scale of household and intermediate industries. This research aims to produce water pipe mold with simple design, easy to do, and making time relatively short. Some considerations for molding materials are weight of mold, ease of raw material, strong, sturdy, and able to cast. Pipe molds are grouped into 4 (four) main parts, including: outer diameter pipe molding, pipe inside diameter, pipe holder, and pipe alignment control. Some materials have been tested as raw materials for outer diameter of pipes, such as wood, iron / steel, cement, and thermoset. The best results are obtained on thermoset material, where the process of disassembling is easier and the resulting mold weight is relatively lighter. For the inside diameter of the pipe is used stainless steel, because in addition to be resistant to chemical processes that occur, in this part of the mold must hold the press load due to shrinkage of raw materials of the pipe during the process of hardening (polymerization). Therefore, it needs high pressure resistant material and does not blend with the raw material of the pipe. The base of the mold is made of stainless steel material because it must be resistant to corrosion due to chemical processes. As for the adjustment of the pipe is made of ST 37 carbon steel, because its function is only as a regulator of the alignment of the pipe structure.

  13. MOLD GROWTH ON GYPSUM WALLBOARD--A RESEARCH SUMMARY

    EPA Science Inventory

    Reducing occupant exposure to mold growing on damp gypsum wallboard is a research objective of the U.S. Environmental Protection Agency. Often mold contaminated building materials are not properly removed but instead surface cleaners are used and then paint is applied in an attem...

  14. High rate fabrication of compression molded components

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matsen, Marc R.; Negley, Mark A.; Dykstra, William C.

    2016-04-19

    A method for fabricating a thermoplastic composite component comprises inductively heating a thermoplastic pre-form with a first induction coil by inducing current to flow in susceptor wires disposed throughout the pre-form, inductively heating smart susceptors in a molding tool to a leveling temperature with a second induction coil by applying a high-strength magnetic field having a magnetic flux that passes through surfaces of the smart susceptors, shaping the magnetic flux that passes through surfaces of the smart susceptors to flow substantially parallel to a molding surface of the smart susceptors, placing the heated pre-form between the heated smart susceptors; andmore » applying molding pressure to the pre-form to form the composite component.« less

  15. Fabrication of sinterable silicon nitride by injection molding

    NASA Technical Reports Server (NTRS)

    Quackenbush, C. L.; French, K.; Neil, J. T.

    1982-01-01

    Transformation of structural ceramics from the laboratory to production requires development of near net shape fabrication techniques which minimize finish grinding. One potential technique for producing large quantities of complex-shaped parts at a low cost, and microstructure of sintered silicon nitride fabricated by injection molding is discussed and compared to data generated from isostatically dry-pressed material. Binder selection methodology, compounding of ceramic and binder components, injection molding techniques, and problems in binder removal are discussed. Strength, oxidation resistance, and microstructure of sintered silicon nitride fabricated by injection molding is discussed and compared to data generated from isostatically dry-pressed material.

  16. Material flow data for numerical simulation of powder injection molding

    NASA Astrophysics Data System (ADS)

    Duretek, I.; Holzer, C.

    2017-01-01

    The powder injection molding (PIM) process is a cost efficient and important net-shape manufacturing process that is not completely understood. For the application of simulation programs for the powder injection molding process, apart from suitable physical models, exact material data and in particular knowledge of the flow behavior are essential in order to get precise numerical results. The flow processes of highly filled polymers are complex. Occurring effects are very hard to separate, like shear flow with yield stress, wall slip, elastic effects, etc. Furthermore, the occurrence of phase separation due to the multi-phase composition of compounds is quite probable. In this work, the flow behavior of a 316L stainless steel feedstock for powder injection molding was investigated. Additionally, the influence of pre-shearing on the flow behavior of PIM-feedstocks under practical conditions was examined and evaluated by a special PIM injection molding machine rheometer. In order to have a better understanding of key factors of PIM during the injection step, 3D non-isothermal numerical simulations were conducted with a commercial injection molding simulation software using experimental feedstock properties. The simulation results were compared with the experimental results. The mold filling studies amply illustrate the effect of mold temperature on the filling behavior during the mold filling stage. Moreover, the rheological measurements showed that at low shear rates no zero shear viscosity was observed, but instead the viscosity further increased strongly. This flow behavior could be described with the Cross-WLF approach with Herschel-Bulkley extension very well.

  17. Soft lithography of ceramic microparts using wettability-tunable poly(dimethylsiloxane) (PDMS) molds

    NASA Astrophysics Data System (ADS)

    Su, Bo; Zhang, Aijun; Meng, Junhu; Zhang, Zhaozhu

    2016-07-01

    Green alumina microparts were fabricated from a high solid content aqueous suspension by microtransfer molding using air plasma-treated poly(dimethylsiloxane) (PDMS) molds. The wettability of the air plasma-treated PDMS molds spontaneously changed between the hydrophilic and hydrophobic states during the process. Initial hydrophilicity of the air plasma-treated PDMS molds significantly improved the flowability of the concentrated suspension. Subsequent hydrophobic recovery of the air plasma-treated PDMS molds enabled a perfect demolding of the green microparts. Consequently, defect-free microchannel parts of 60 μm and a micromixer with an area of several square centimeters were successfully fabricated. In soft lithography, tuning the wetting behavior of PDMS molds has a great effect on the quality of ceramic microparts. Using wettability-tunable PDMS molds has great potential in producing complex-shaped and large-area ceramic microparts and micropatterns.

  18. Manufacturing Science of Improved Molded Optics

    DTIC Science & Technology

    2013-12-05

    Forrer, “Interaction of N-FK5 and L- BAL35 optical glass with various carbide and other precision glass mold tooling”, SPIE Optifab 2013 Conference...Richardson, S. Mourad, M. Huber, A. Kunz, M. Forrer. Interaction of N-FK5 and L-BAL35 optical glass with various carbide and other precision glass mold...stoichiometric compounds. As an example, if silicon and oxygen are present in a material, then it was assumed that they are present in the form of

  19. Injection Molding Parameters Calculations by Using Visual Basic (VB) Programming

    NASA Astrophysics Data System (ADS)

    Tony, B. Jain A. R.; Karthikeyen, S.; Alex, B. Jeslin A. R.; Hasan, Z. Jahid Ali

    2018-03-01

    Now a day’s manufacturing industry plays a vital role in production sectors. To fabricate a component lot of design calculation has to be done. There is a chance of human errors occurs during design calculations. The aim of this project is to create a special module using visual basic (VB) programming to calculate injection molding parameters to avoid human errors. To create an injection mold for a spur gear component the following parameters have to be calculated such as Cooling Capacity, Cooling Channel Diameter, and Cooling Channel Length, Runner Length and Runner Diameter, Gate Diameter and Gate Pressure. To calculate the above injection molding parameters a separate module has been created using Visual Basic (VB) Programming to reduce the human errors. The outcome of the module dimensions is the injection molding components such as mold cavity and core design, ejector plate design.

  20. ASTHMATIC HUMAN SERUM IGE-REACTIVITY WITH MOLD EXTRACTS

    EPA Science Inventory

    Although molds have demonstrated the ability to induce allergic asthma-like responses in mouse models, their role in human disease is unclear. This study was undertaken to provide insight into the prevalence of human IgE-reactivity and identify the target mold protein(s). The st...

  1. Failure Analysis in Platelet Molded Composite Systems

    NASA Astrophysics Data System (ADS)

    Kravchenko, Sergii G.

    Long-fiber discontinuous composite systems in the form of chopped prepreg tapes provide an advanced, structural grade, molding compound allowing for fabrication of complex three-dimensional components. Understanding of process-structure-property relationship is essential for application of prerpeg platelet molded components, especially because of their possible irregular disordered heterogeneous morphology. Herein, a structure-property relationship was analyzed in the composite systems of many platelets. Regular and irregular morphologies were considered. Platelet-based systems with more ordered morphology possess superior mechanical performance. While regular morphologies allow for a careful inspection of failure mechanisms derived from the morphological characteristics, irregular morphologies are representative of the composite architectures resulting from uncontrolled deposition and molding with chopped prerpegs. Progressive failure analysis (PFA) was used to study the damaged deformation up to ultimate failure in a platelet-based composite system. Computational damage mechanics approaches were utilized to conduct the PFA. The developed computational models granted understanding of how the composite structure details, meaning the platelet geometry and system morphology (geometrical arrangement and orientation distribution of platelets), define the effective mechanical properties of a platelet-molded composite system, its stiffness, strength and variability in properties.

  2. Mold After a Disaster

    MedlinePlus

    ... U.S. Environmental Protection Agency (EPA) guide titled Mold Remediation in Schools and Commercial Buildings . Also available is ... Resources NIOSH Interim Recommendations for the Cleaning and Remediation of Flood-Contaminated HVAC Systems: A Guide for ...

  3. Mold: Cleanup and Remediation

    MedlinePlus

    ... National Center for Environmental Health (NCEH) Cleanup and Remediation Recommend on Facebook Tweet Share Compartir On This ... CDC and EPA on mold cleanup, removal and remediation. Cleanup information for you and your family Homeowner’s ...

  4. Precision glass molding of high-resolution diffractive optical elements

    NASA Astrophysics Data System (ADS)

    Prater, Karin; Dukwen, Julia; Scharf, Toralf; Herzig, Hans P.; Plöger, Sven; Hermerschmidt, Andreas

    2016-04-01

    The demand of high resolution diffractive optical elements (DOE) is growing. Smaller critical dimensions allow higher deflection angles and can fulfill more demanding requirements, which can only be met by using electron-beam lithography. Replication techniques are more economical, since the high cost of the master can be distributed among a larger number of replicas. The lack of a suitable mold material for precision glass molding has so far prevented an industrial use. Glassy Carbon (GC) offers a high mechanical strength and high thermal strength. No anti-adhesion coatings are required in molding processes. This is clearly an advantage for high resolution, high aspect ratio microstructures, where a coating with a thickness between 10 nm and 200 nm would cause a noticeable rounding of the features. Electron-beam lithography was used to fabricate GC molds with highest precision and feature sizes from 250 nm to 2 μm. The master stamps were used for precision glass molding of a low Tg glass L-BAL42 from OHARA. The profile of the replicated glass is compared to the mold with the help of SEM images. This allows discussion of the max. aspect-ratio and min. feature size. To characterize optical performances, beamsplitting elements are fabricated and their characteristics were investigated, which are in excellent agreement to theory.

  5. Triple Plate Mold Final Report: Optimization of the Mold Design and Casting Parameters for a Thin U-10mo Fuel Casting

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aikin, Jr., Robert M.

    This work describes the experiments and modeling that have been performed to improve and try to optimize the simultaneous casting of three plates of U-10wt%Mo in a single coil vacuum induction melting (VIM) furnace. The plates of interest are 280 mm wide by 203 mm tall by 5 mm thick (11" x 8" x 0.2"). The initial mold design and processing parameters were supplied by Y-12. The mold and casting cavity were instrumented with a number of thermocouples, and the casting performed to determine the thermal history of the mold and casting. The resulting cast plates were radiographed and numerousmore » defects identified. Metallography was performed to help identify the nature of the radiographically observed defects. This information was then used to validate a mold filling and solidification model of that casting. Based on the initial casting, good casting design practice, and process simulation of several design alternatives, a revised design was developed with the goal of minimizing casting defects such as porosity. The redesigned mold had a larger hot-top and had its long axis along the horizontal direction. These changes were to try to develop a strong thermal gradient conducive to good feeding and minimization of micro- and macroporosity in the cast plates. An instrumented casting was then performed with the revised mold design and a linear distributor. This design yielded cast plates with significantly less radiographically identified defects. Unfortunately, there was significant variation in plate weight and metal content in their hot-tops. Fluid flow simulations were then performed on this mold/distributor design. This helped identify the issue with this linear distributor design. Additional simulations were then performed on candidate distributor redesigns and a preferred distributor annular design was identified. This improved annular design was used to produce a third instrumented casting with favorable results. These refined designs and their radiographic

  6. An Impedance-Based Mold Sensor with on-Chip Optical Reference

    PubMed Central

    Papireddy Vinayaka, Poornachandra; van den Driesche, Sander; Blank, Roland; Tahir, Muhammad Waseem; Frodl, Mathias; Lang, Walter; Vellekoop, Michael J.

    2016-01-01

    A new miniaturized sensor system with an internal optical reference for the detection of mold growth is presented. The sensor chip comprises a reaction chamber provided with a culture medium that promotes the growth of mold species from mold spores. The mold detection is performed by measuring impedance changes with integrated electrodes fabricated inside the reaction chamber. The impedance change in the culture medium is caused by shifts in the pH (i.e., from 5.5 to 8) as the mold grows. In order to determine the absolute pH value without the need for calibration, a methyl red indicator dye has been added to the culture medium. It changes the color of the medium as the pH passes specific values. This colorimetric principle now acts as a reference measurement. It also allows the sensitivity of the impedance sensor to be established in terms of impedance change per pH unit. Major mold species that are involved in the contamination of food, paper and indoor environments, like Fusarium oxysporum, Fusarium incarnatum, Eurotium amstelodami, Aspergillus penicillioides and Aspergillus restrictus, have been successfully analyzed on-chip. PMID:27690039

  7. Addressing environmental health Implications of mold exposure after major flooding.

    PubMed

    Metts, Tricia A

    2008-03-01

    Extensive water damage resulting from major flooding is often associated with mold growth if materials are not quickly and thoroughly dried. Exposure to fungal contamination can lead to several infectious and noninfectious health effects impacting the respiratory system, skin, and eyes. Adverse health effects can be categorized as infections, allergic or hypersensitivity reactions, or toxic-irritant reactions. Workers and building occupants can minimize their exposure to mold by avoiding areas with excessive mold growth, using personal protective equipment, and implementing environmental controls. Occupational health professionals should encourage workers to seek health care if they experience any symptoms that may be linked to mold exposure.

  8. Cross Section of Legislative Approaches to Reducing Indoor Dampness and Mold

    PubMed Central

    Boese, Gerald W.

    2017-01-01

    Exposure to indoor dampness and mold is associated with numerous adverse respiratory conditions, including asthma. While no quantitative health-based threshold currently exists for mold, the conditions that support excessive dampness and mold are known and preventable; experts agree that controlling these conditions could lead to substantial savings in health care costs and improvement in public health. This article reviews a sample of state and local policies to limit potentially harmful exposures. Adoption of laws to strengthen building codes, specify dampness and mold in habitability laws, regulate mold contractors, and other legislative approaches are discussed, as are key factors supporting successful implementation. Communicating these lessons learned could accelerate the process for other jurisdictions considering similar approaches. Information about effectiveness of legislation as prevention is lacking; thus, evaluation could yield important information to inform the development of model state or local laws that significantly address mold as a public health concern. PMID:27977504

  9. Modeling and flow analysis of pure nylon polymer for injection molding process

    NASA Astrophysics Data System (ADS)

    Nuruzzaman, D. M.; Kusaseh, N.; Basri, S.; Oumer, A. N.; Hamedon, Z.

    2016-02-01

    In the production of complex plastic parts, injection molding is one of the most popular industrial processes. This paper addresses the modeling and analysis of the flow process of the nylon (polyamide) polymer for injection molding process. To determine the best molding conditions, a series of simulations are carried out using Autodesk Moldflow Insight software and the processing parameters are adjusted. This mold filling commercial software simulates the cavity filling pattern along with temperature and pressure distributions in the mold cavity. In the modeling, during the plastics flow inside the mold cavity, different flow parameters such as fill time, pressure, temperature, shear rate and warp at different locations in the cavity are analyzed. Overall, this Moldflow is able to perform a relatively sophisticated analysis of the flow process of pure nylon. Thus the prediction of the filling of a mold cavity is very important and it becomes useful before a nylon plastic part to be manufactured.

  10. Numerical prediction of flow induced fibers orientation in injection molded polymer composites

    NASA Astrophysics Data System (ADS)

    Oumer, A. N.; Hamidi, N. M.; Mat Sahat, I.

    2015-12-01

    Since the filling stage of injection molding process has important effect on the determination of the orientation state of the fibers, accurate analysis of the flow field for the mold filling stage becomes a necessity. The aim of the paper is to characterize the flow induced orientation state of short fibers in injection molding cavities. A dog-bone shaped model is considered for the simulation and experiment. The numerical model for determination of the fibers orientation during mold-filling stage of injection molding process was solved using Computational Fluid Dynamics (CFD) software called MoldFlow. Both the simulation and experimental results showed that two different regions (or three layers of orientation structures) across the thickness of the specimen could be found: a shell region which is near to the mold cavity wall, and a core region at the middle of the cross section. The simulation results support the experimental observations that for thin plates the probability of fiber alignment to the flow direction near the mold cavity walls is high but low at the core region. It is apparent that the results of this study could assist in decisions regarding short fiber reinforced polymer composites.

  11. 40 CFR Table 3 to Subpart Wwww of... - Organic HAP Emissions Limits for Existing Open Molding Sources, New Open Molding Sources Emitting...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... cure 25 lb/ton.4 NA—this is considered to be a closed molding operation. 25 lb/ton.4 Use the... vented during spinning and cure 20 lb/ton.4 NA—this is considered to be a closed molding operation. 20 lb...

  12. Investigation of the adhesion interface obtained through two-component injection molding

    NASA Astrophysics Data System (ADS)

    Fetecau, Catalin; Stan, Felicia; Dobrea, Daniel

    2011-01-01

    In this paper we study the interface strength obtained through two-component (2C) injection molding of LDPE-HDPE polymers. First, numerical simulation of the over-molding process is carried out using Moldflow technology. Second, butt-joint specimens were produced by over-molding under different process condition, and tested. Two injection sequences were considered, injection of LDPE on HDPE polymer, and HDLE on LDPE, respectively. To investigate the effects of the mold surface roughness on the polymers adhesion at interface, different inserts with different roughness are employed.

  13. Analysis of form deviation in non-isothermal glass molding

    NASA Astrophysics Data System (ADS)

    Kreilkamp, H.; Grunwald, T.; Dambon, O.; Klocke, F.

    2018-02-01

    Especially in the market of sensors, LED lighting and medical technologies, there is a growing demand for precise yet low-cost glass optics. This demand poses a major challenge for glass manufacturers who are confronted with the challenge arising from the trend towards ever-higher levels of precision combined with immense pressure on market prices. Since current manufacturing technologies especially grinding and polishing as well as Precision Glass Molding (PGM) are not able to achieve the desired production costs, glass manufacturers are looking for alternative technologies. Non-isothermal Glass Molding (NGM) has been shown to have a big potential for low-cost mass manufacturing of complex glass optics. However, the biggest drawback of this technology at the moment is the limited accuracy of the manufactured glass optics. This research is addressing the specific challenges of non-isothermal glass molding with respect to form deviation of molded glass optics. Based on empirical models, the influencing factors on form deviation in particular form accuracy, waviness and surface roughness will be discussed. A comparison with traditional isothermal glass molding processes (PGM) will point out the specific challenges of non-isothermal process conditions. Furthermore, the underlying physical principle leading to the formation of form deviations will be analyzed in detail with the help of numerical simulation. In this way, this research contributes to a better understanding of form deviations in non-isothermal glass molding and is an important step towards new applications demanding precise yet low-cost glass optics.

  14. MOLD SPECIFIC QUANTITATIVE PCR FOR RAPID IDENTIFICATION AND ENUMERATION

    EPA Science Inventory

    There is growing awareness that indoor molds/fungi may be connected to such conditions as asthma, allergies, hemorrhaging, chronic rhinosinusitis, memory loss, and a symptom complex called sick-building-syndrome. In addition, molds cause frequently fatal nosocomical infections. ...

  15. An in-mold packaging process for plastic fluidic devices.

    PubMed

    Yoo, Y E; Lee, K H; Je, T J; Choi, D S; Kim, S K

    2011-01-01

    Micro or nanofluidic devices have many channel shapes to deliver chemical solutions, body fluids or any fluids. The channels in these devices should be covered to prevent the fluids from overflowing or leaking. A typical method to fabricate an enclosed channel is to bond or weld a cover plate to a channel plate. This solid-to-solid bonding process, however, takes a considerable amount of time for mass production. In this study, a new process for molding a cover layer that can enclose open micro or nanochannels without solid-to-solid bonding is proposed and its feasibility is estimated. First, based on the design of a model microchannel, a brass microchannel master core was machined and a plastic microchannel platform was injection-molded. Using this molded platform, a series of experiments was performed for four process or mold design parameters. Some feasible conditions were successfully found to enclosed channels without filling the microchannels for the injection molding of a cover layer over the plastic microchannel platform. In addition, the bond strength and seal performance were estimated in a comparison with those done by conventional bonding or welding processes.

  16. Fabrication of injection molded sintered alpha SiC turbine components

    NASA Technical Reports Server (NTRS)

    Storm, R. S.; Ohnsorg, R. W.; Frechette, F. J.

    1981-01-01

    Fabrication of a sintered alpha silicon carbide turbine blade by injection molding is described. An extensive process variation matrix was carried out to define the optimum fabrication conditions. Variation of molding parameters had a significant impact on yield. Turbine blades were produced in a reasonable yield which met a rigid quality and dimensional specification. Application of injection molding technology to more complex components such as integral rotors is also described.

  17. Frequency and amplitude dependences of molding accuracy in ultrasonic nanoimprint technology

    NASA Astrophysics Data System (ADS)

    Mekaru, Harutaka; Takahashi, Masaharu

    2009-12-01

    We use neither a heater nor ultraviolet lights, and are researching and developing an ultrasonic nanoimprint as a new nano-patterning technology. In our ultrasonic nanoimprint technology, ultrasonic vibration is not used as a heat generator instead of the heater. A mold is connected with an ultrasonic generator, and mold patterns are pushed down and pulled up at a high speed into a thermoplastic. Frictional heat is generated by ultrasonic vibration between mold patterns and thermoplastic patterns formed by an initial contact force. However, because frictional heat occurs locally, the whole mold is not heated. Therefore, a molding material can be comprehensively processed at room temperature. A magnetostriction actuator was built into our ultrasonic nanoimprint system as an ultrasonic generator, and the frequency and amplitude can be changed between dc-10 kHz and 0-4 µm, respectively. First, the ultrasonic nanoimprint was experimented by using this system on polyethylene terephthalate (PET, Tg = 69 °C), whose the glass transition temperature (Tg) is comparatively low in engineering plastics, and it was ascertained that the most suitable elastic material for this technique was an ethyl urethane rubber. In addition, we used a changeable frequency of the magnetostriction actuator, and nano-patterns in an electroformed-Ni mold were transferred to a 0.5 mm thick sheet of PET, polymethylmethacrylate (PMMA) and polycarbonate (PC), which are typical engineering plastics, under variable molding conditions. The frequency and amplitude dependence of ultrasonic vibration to the molding accuracy were investigated by measuring depth and width of imprinted patterns. As a result, regardless of the molding material, the imprinted depth was changed drastically when the frequency exceeded 5 kHz. On the other hand, when the amplitude of ultrasonic vibration grew, the imprinted depth gradually deepened. Influence of the frequency and amplitude of ultrasonic vibration was not observed

  18. Mold Heating and Cooling Pump Package Operator Interface Controls Upgrade

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Josh A. Salmond

    2009-08-07

    The modernization of the Mold Heating and Cooling Pump Package Operator Interface (MHC PP OI) consisted of upgrading the antiquated single board computer with a proprietary operating system to off-the-shelf hardware and off-the-shelf software with customizable software options. The pump package is the machine interface between a central heating and cooling system that pumps heat transfer fluid through an injection or compression mold base on a local plastic molding machine. The operator interface provides the intelligent means of controlling this pumping process. Strict temperature control of a mold allows the production of high quality parts with tight tolerances and lowmore » residual stresses. The products fabricated are used on multiple programs.« less

  19. Parylene C coating for high-performance replica molding.

    PubMed

    Heyries, Kevin A; Hansen, Carl L

    2011-12-07

    This paper presents an improvement to the soft lithography fabrication process that uses chemical vapor deposition of poly(chloro-p-xylylene) (parylene C) to protect microfabricated masters and to improve the release of polymer devices following replica molding. Chemical vapor deposition creates nanometre thick conformal coatings of parylene C on silicon wafers having arrays of 30 μm high SU8 pillars with densities ranging from 278 to 10,040 features per mm(2) and aspect ratios (height : width) from 1 : 1 to 6 : 1. A single coating of parylene C was sufficient to permanently promote poly(dimethyl)siloxane (PDMS) mold release and to protect masters for an indefinite number of molding cycles. We also show that the improved release properties of parylene treated masters allow for fabrication with hard polymers, such as poly(urethane), that would otherwise not be compatible with SU8 on silicon masters. Parylene C provides a robust and high performance mold release coating for soft lithography microfabrication that extends the life of microfabricated masters and improves the achievable density and aspect ratio of replicated features.

  20. Injection molding of iPP samples in controlled conditions and resulting morphology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sessa, Nino, E-mail: ninosessa.ns@gmail.com; De Santis, Felice, E-mail: fedesantis@unisa.it; Pantani, Roberto, E-mail: rpantani@unisa.it

    2015-12-17

    Injection molded parts are driven down in size and weight especially for electronic applications. In this work, an investigation was carried out on the process of injection molding of thin iPP samples and on the morphology of these parts. Melt flow in the mold cavity was analyzed and described with a mathematical model. Influence of mold temperature and injection pressure was analyzed. Samples orientation was studied using optical microscopy.

  1. Treatment Principles for the Management of Mold Infections

    PubMed Central

    Kontoyiannis, Dimitrios P.; Lewis, Russell E.

    2015-01-01

    Survival rates among immunocompromised patients with invasive mold infections have markedly improved over the last decade with earlier diagnosis and new antifungal treatment options. Yet, increasing antifungal resistance, breakthrough infections with intrinsically resistant fungi, and potentially life-threatening adverse effects and drug interactions are becoming more problematic, especially with prolonged therapy. Evidence-based recommendations for treating invasive aspergillosis and mucormycosis provide excellent guidance on the initial workup and treatment of these molds, but they cannot address all of the key management issues. Herein, we discuss 10 general treatment principles in the management of invasive mold disease in immunocompromised patients and discuss how these principles can be integrated to develop an effective, individualized treatment plan. PMID:25377139

  2. Chalcogenide molded freeform optics for mid-infrared lasers

    NASA Astrophysics Data System (ADS)

    Chenard, Francois; Alvarez, Oseas; Yi, Allen

    2017-05-01

    High-precision chalcogenide molded micro-lenses were produced to collimate mid-infrared Quantum Cascade Lasers (QCLs). Molded cylindrical micro-lens prototypes with aspheric contour (acylindrical), high numerical aperture (NA 0.8) and small focal length (f<2 mm) were fabricated to collimate the QCL fast-axis beam. Another innovative freeform micro-lens has an input acylindrical surface to collimate the fast axis and an orthogonal output acylindrical surface to collimate the slow axis. The thickness of the freeform lens is such that the output fast- and slow-axis beams are circular. This paper presents results on the chalcogenide molded freeform micro-lens designed to collimate and circularize QCL at 4.6 microns.

  3. 3D Molding of Veneers by Mechanical and Pneumatic Methods

    PubMed Central

    Gaff, Milan; Gašparík, Miroslav

    2017-01-01

    This paper deals with the influence of selected methods (mechanical and pneumatic) as well as various factors (wood species, moisture content, veneer shape, punch diameter, laminating foil thickness, holding method, plasticizing) on 3D molding of veneers. 3D molding was evaluated on the basis of maximum deflection of birch and beech veneers. Cracks and warping edges were also evaluated in selected groups of mechanical molding. Mechanical methods tested veneers with various treatments (steaming, water and ammonia plasticizing and lamination). The pneumatic method was based on veneer shaping using air pressure. The results indicate that birch veneers are more suitable for 3D molding. The differences between the mechanical and pneumatic methods were not considerable. The most suitable method for mechanical 3D molding was the veneer lamination by polyethylene foils with thicknesses of 80 and 125 μm, inasmuch as these achieved better results than veneer plasticized by steam. The occurrence of cracks was more frequent in beech veneers, whereas, edge warping occurred at similar rates for both wood species and depends rather on holding method during 3D molding. Use of the ammonia solution is more suitable and there occurs no marked increase in moisture as happens when soaking in water. PMID:28772684

  4. Saliva secretory IgA antibodies against molds and mycotoxins in patients exposed to toxigenic fungi.

    PubMed

    Vojdani, Aristo; Kashanian, Albert; Vojdani, Elroy; Campbell, Andrew W

    2003-11-01

    Upper respiratory exposure to different environmental antigens results first in the activation of mucosal immunity and production of IgA antibodies in different secretions including saliva. Despite this there is no study, which addresses secretory antibodies against molds and mycotoxins. The purpose of this study was to evaluate mold-specific salivary IgA in individuals exposed to molds and mycotoxins in a water-damaged building environment. Saliva IgA antibody levels against seven different molds and two mycotoxins were studied in 40 patients exposed to molds and in 40 control subjects. Mold-exposed patients showed significantly higher levels of salivary IgA antibodies against one or more mold species. A majority of patients with high IgA antibodies against molds exhibited elevation in salivary IgA against mycotoxins, as well. These IgA antibodies against molds and mycotoxins are specific, since using molds and mycotoxins in immune absorption could reduce antibody levels, significantly. Detection of high counts of molds in water-damaged buildings, strongly suggests the existence of a reservoir of mold spores in the environment. This viable microbial activity with specific mold and mycotoxin IgA in saliva may assist in the diagnosis of mold exposure. Whether mold and mycotoxin specific IgA antibodies detected in saliva are indicative of the role of IgA antibodies in the late phase of type-1 hypersensitivity reaction or in type-2 and type-3 delayed sensitivities is a matter that warrants further investigation.

  5. Higher Potassium Concentration in Shoots Reduces Gray Mold in Sweet Basil.

    PubMed

    Yermiyahu, Uri; Israeli, Lior; David, Dalia Rav; Faingold, Inna; Elad, Yigal

    2015-08-01

    Nutritional elements can affect plant susceptibility to plant pathogens, including Botrytis cinerea. We tested the effect of potassium (K) fertilization on gray mold in sweet basil grown in pots, containers, and soil. Increased K in the irrigation water and in the sweet basil tissue resulted in an exponential decrease in gray mold severity. Potassium supplied to plants by foliar application resulted in a significant decrease in gray mold in plants grown with a low rate of K fertigation. Lower K fertigation resulted in a significant increase in B. cinerea infection under semi-commercial conditions. Gray mold severity in harvested shoots was significantly negatively correlated with K concentration in the irrigation solution, revealing resistance to B. cinerea infection as a result of high K concentration in sweet basil tissue. Gray mold was reduced following K foliar application of the plants. In general, there was no synergy between the fertigation and foliar spray treatments. Proper K fertilization can replace some of the required chemical fungicide treatments and it may be integrated into gray mold management for improved disease suppression.

  6. Microcellular injection molding process for producing lightweight thermoplastic polyurethane with customizable properties

    NASA Astrophysics Data System (ADS)

    Ellingham, Thomas; Kharbas, Hrishikesh; Manitiu, Mihai; Scholz, Guenter; Turng, Lih-Sheng

    2018-03-01

    A three-stage molding process involving microcellular injection molding with core retraction and an "out-of-mold" expansion was developed to manufacture thermoplastic polyurethane into lightweight foams of varying local densities, microstructures, and mechanical properties in the same microcellular injection molded part. Two stages of cavity expansion through sequential core retractions and a third expansion in a separate mold at an elevated temperature were carried out. The densities varied from 0.25 to 0.42 g/cm3 (77% to 62% weight reduction). The mechanical properties varied as well. Cyclic compressive strengths and hysteresis loss ratios, together with the microstructures, were characterized and reported.

  7. Removing function model and experiments on ultrasonic polishing molding die

    NASA Astrophysics Data System (ADS)

    Huang, Qitai; Ni, Ying; Yu, Jingchi

    2010-10-01

    Low temperature glass molding technology is the main method on volume-producing high precision middle and small diameter optical cells in the future. While the accuracy of the molding die will effect the cell precision, so the high precision molding die development is one of the most important part of the low temperature glass molding technology. The molding die is manufactured from high rigid and crisp metal alloy, with the ultrasonic vibration character of high vibration frequency and concentrative energy distribution; abrasive particles will impact the rigid metal alloy surface with very high speed that will remove the material from the work piece. Ultrasonic can make the rigid metal alloy molding die controllable polishing and reduce the roughness and surface error. Different from other ultrasonic fabrication method, untouched ultrasonic polishing is applied on polish the molding die, that means the tool does not touch the work piece in the process of polishing. The abrasive particles vibrate around the balance position with high speed and frequency under the drive of ultrasonic vibration in the liquid medium and impact the workspace surface, the energy of abrasive particles come from ultrasonic vibration, while not from the direct hammer blow of the tool. So a nummular vibrator simple harmonic vibrates on an infinity plane surface is considered as a model of ultrasonic polishing working condition. According to Huygens theory the sound field distribution on a plane surface is analyzed and calculated, the tool removing function is also deduced from this distribution. Then the simple point ultrasonic polishing experiment is proceeded to certificate the theory validity.

  8. Understanding the impact of molds on indoor air quality and possible links to health effects Indoor Molds - More than Just a Musty Smell

    EPA Science Inventory

    Molds are multi-celled, colony forming, eukaryotic microorganisms lacking chlorophyll belonging to the Kingdom Fungi. Furthermore, molds are ubiquitous in both indoor and outdoor environments. There are more than 200 different types of fungi to which people are routinely exposed ...

  9. SPECIFIC MOLDS ASSOCIATED WITH ASTHMA IN WATER-DAMAGED HOMES

    EPA Science Inventory

    Objective: We sought to determine if specific molds were found in significantly higher concentrations in the water-damaged homes of asthmatic children compared to homes with no visible water damage. Methods: The mold concentrations in the dust in asthmatic children's bedrooms i...

  10. Psychological, neuropsychological, and electrocortical effects of mixed mold exposure.

    PubMed

    Crago, B Robert; Gray, Michael R; Nelson, Lonnie A; Davis, Marilyn; Arnold, Linda; Thrasher, Jack D

    2003-08-01

    The authors assessed the psychological, neuropsychological, and electrocortical effects of human exposure to mixed colonies of toxigenic molds. Patients (N = 182) with confirmed mold-exposure history completed clinical interviews, a symptom checklist (SCL-90-R), limited neuropsychological testing, quantitative electroencephalogram (QEEG) with neurometric analysis, and measures of mold exposure. Patients reported high levels of physical, cognitive, and emotional symptoms. Ratings on the SCL-90-R were "moderate" to "severe," with a factor reflecting situational depression accounting for most of the variance. Most of the patients were found to suffer from acute stress, adjustment disorder, or post-traumatic stress. Differential diagnosis confirmed an etiology of a combination of external stressors, along with organic metabolically based dysregulation of emotions and decreased cognitive functioning as a result of toxic or metabolic encephalopathy. Measures of toxic mold exposure predicted QEEG measures and neuropsychological test performance. QEEG results included narrowed frequency bands and increased power in the alpha and theta bands in the frontal areas of the cortex. These findings indicated a hypoactivation of the frontal cortex, possibly due to brainstem involvement and insufficient excitatory input from the reticular activating system. Neuropsychological testing revealed impairments similar to mild traumatic brain injury. In comparison with premorbid estimates of intelligence, findings of impaired functioning on multiple cognitive tasks predominated. A dose-response relationship between measures of mold exposure and abnormal neuropsychological test results and QEEG measures suggested that toxic mold causes significant problems in exposed individuals. Study limitations included lack of a comparison group, patient selection bias, and incomplete data sets that did not allow for comparisons among variables.

  11. EPA Scientists Develop Research Methods for Studying Mold Fact Sheet

    EPA Pesticide Factsheets

    In 2002, U.S. Environmental Protection Agency researchers developed a DNA-based Mold Specific Quantitative Polymerase Chain Reaction method (MSQPCR) for identifying and quantifying over 100 common molds and fungi.

  12. MOLDED SEALING ELEMENT

    DOEpatents

    Bradford, B.W.; Skinner, W.J.

    1959-03-24

    Molded sealing elements suitable for use under conditions involving exposure to uranium hexafluoride vapor are described. Such sealing elements are made by subjecting graphitic carbons to a preliminary treatment with uranium hexafluoride vapor, and then incorporating polytetrafluorethylene in them. The resulting composition has good wear resistant and frictional properties and is resistant to disintegration by uranium hexafluoride over long periods of exposure.

  13. Method for molding ceramic powders using a water-based gel casting

    DOEpatents

    Janney, Mark A.; Omatete, Ogbemi O.

    1991-07-02

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant, and a monomer solution. The monomer solution includes at least one monofunctional monomer and at least one difunctional monomer, a free-radical initiator, and a aqueous solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product any be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, whereafter the product may be sintered.

  14. An Investigation of the Mold-Flux Performance for the Casting of Cr12MoV Steel Using a Mold Simulator Technique

    NASA Astrophysics Data System (ADS)

    Zhou, Lejun; Wang, Wanlin; Xu, Chao; Zhang, Chen

    2017-08-01

    Mold flux plays important roles in the process of continuous casting. In this article, the performance of mold flux for the casting of Cr12MoV steel was investigated by using a mold simulator. The results showed that the slag film formed in the gap between the initial shell and mold hot surface is thin and discontinuous during the casting process with the Flux BM, due to the absorption of chromic oxide inclusions into the liquid slag, while the slag film formed in the case of the optimized Flux NEW casting process is uniform. The main precipitated crystals in Flux BM slag film are cuspidine (Ca4Si2O7F2) and Cr3O4, but only Ca4Si2O7F2 precipitated in the Flux NEW case. Besides, both the responding temperature and heat flux in the case of Flux BM are relatively higher and fluctuate in a larger amplitude. The surface of the shell obtained in the case of the Flux BM experiment is quite uneven, and many severe depressions, cracks, and entrapped slags are observed in the surface due to the lack of lubrication. However, the obtained shell surface in the case of the Flux NEW shows good surface quality due to the addition of B2O3 and the adjustment of basicity, which can compensate for the negative effects of the mold-flux properties caused by the absorption of chromic oxide during the casting process.

  15. Understanding the impact of molds on indoor air quality and ...

    EPA Pesticide Factsheets

    Molds are multi-celled, colony forming, eukaryotic microorganisms lacking chlorophyll belonging to the Kingdom Fungi. Furthermore, molds are ubiquitous in both indoor and outdoor environments. There are more than 200 different types of fungi to which people are routinely exposed (NAS. 2000). The growth of molds in homes, schools, offices, and other public buildings has been implicated as the cause of a wide variety of adverse health effects. Headlines resulting from moldy, water-damaged homes, particularly

  16. Deformable silicone grating fabricated with a photo-imprinted polymer mold

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yamada, Itsunari, E-mail: yamada.i@e.usp.ac.jp; Nishii, Junji; Saito, Mitsunori

    A tunable transmission grating was fabricated by molding a silicone elastomer (polydimethylsiloxane). Its optical characteristics were then evaluated during compression. For fabrication, a glass plate with a photoimprinted polymer grating film was used as a mold. Both the grating period and diffraction transmittance of the molded elastomer were functions of the compressive stress. The grating period changed from 3.02 to 2.86 μm during compressing the elastomer in the direction perpendicular to the grooves.

  17. Treatment principles for the management of mold infections.

    PubMed

    Kontoyiannis, Dimitrios P; Lewis, Russell E

    2014-11-06

    Survival rates among immunocompromised patients with invasive mold infections have markedly improved over the last decade with earlier diagnosis and new antifungal treatment options. Yet, increasing antifungal resistance, breakthrough infections with intrinsically resistant fungi, and potentially life-threatening adverse effects and drug interactions are becoming more problematic, especially with prolonged therapy. Evidence-based recommendations for treating invasive aspergillosis and mucormycosis provide excellent guidance on the initial workup and treatment of these molds, but they cannot address all of the key management issues. Herein, we discuss 10 general treatment principles in the management of invasive mold disease in immunocompromised patients and discuss how these principles can be integrated to develop an effective, individualized treatment plan. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

  18. Decontamination formulation with additive for enhanced mold remediation

    DOEpatents

    Tucker, Mark D [Albuquerque, NM; Irvine, Kevin [Huntsville, AL; Berger, Paul [Rome, NY; Comstock, Robert [Bel Air, MD

    2010-02-16

    Decontamination formulations with an additive for enhancing mold remediation. The formulations include a solubilizing agent (e.g., a cationic surfactant), a reactive compound (e.g., hydrogen peroxide), a carbonate or bicarbonate salt, a water-soluble bleaching activator (e.g., propylene glycol diacetate or glycerol diacetate), a mold remediation enhancer containing Fe or Mn, and water. The concentration of Fe.sup.2+ or Mn.sup.2+ ions in the aqueous mixture is in the range of about 0.0001% to about 0.001%. The enhanced formulations can be delivered, for example, as a foam, spray, liquid, fog, mist, or aerosol for neutralization of chemical compounds, and for killing certain biological compounds or agents and mold spores, on contaminated surfaces and materials.

  19. An investigation into the injection molding of PMR-15 polyimide

    NASA Technical Reports Server (NTRS)

    Colaluca, M. A.

    1984-01-01

    The chemorheological behavior of the PRM-15 molding compounds were characterized, the range of suitable processing parameters for injection molding in a reciprocating screw injection molding machine was determined, and the effects of the injection molding processing parameters on the mechanical properties of molded PMR-15 parts were studied. The apparatus and procedures for measuring viscosity and for determining the physical response of the material during heating are described. Results show that capillary rheometry can be effectively used with thermosets if the equipment is designed to overcome some of the inherent problems of these materials. A uniform temperature was provided in the barrel by using a circulating hot oil system. Standard capillary rheometry methods can provide the dependence of thermoset apparent viscosity on shear rate, temperature, and time. Process conditions resulting in complete imidization should be carefully defined. Specification of controlled oven temperature is inadequate and can result in incomplete imidization. For completely imidized PMR-15 heat at 15 C/min melt flow without gas evolution occurs in the temperature range of 325 C to 400 C.

  20. [Effects of different excipients on properties of Tongsaimai mixture and pellet molding].

    PubMed

    Wang, Jin; Lv, Zhiyang; Wu, Xiaoyan; Di, Liuqing; Dong, Yu; Cai, Baochang

    2011-01-01

    To study preliminarily on the relationship between properties of the mixture composed of Tongsaimai extract and different excipients and pellet molding. The multivariate regression analysis was used to investigate the correlation of different mixture and pellet molding by measuring the cohesion, liquid-plastic limit of mixture, and the powder properties of pellets. The weighted coefficients of the powder properties were determined by analytic hierarchy process combined with criteria importance through intercriteria correlation. The results showed that liquid-plastic limit seemed to be a major factor, which had positive correlation with pellet molding, while cohesion had negative correlation with pellet molding in the measured range. The physical properties of the mixture has marked influence on pellet molding.

  1. Effects of process parameters in plastic, metal, and ceramic injection molding processes

    NASA Astrophysics Data System (ADS)

    Lee, Shi W.; Ahn, Seokyoung; Whang, Chul Jin; Park, Seong Jin; Atre, Sundar V.; Kim, Jookwon; German, Randall M.

    2011-09-01

    Plastic injection molding has been widely used in the past and is a dominant forming approach today. As the customer demands require materials with better engineering properties that were not feasible with polymers, powder injection molding with metal and ceramic powders has received considerable attention in recent decades. To better understand the differences in the plastic injection molding, metal injection molding, and ceramic injection molding, the effects of the core process parameters on the process performances has been studied using the state-of-the-art computer-aided engineering (CAE) design tool, PIMSolver® The design of experiments has been conducted using the Taguchi method to obtain the relative contributions of various process parameters onto the successful operations.

  2. Applications of polyamide/cellulose fiber/wollastonite composites for microcellular injection molding

    Treesearch

    Herman Winata; Lih-Sheng Turng; Daniel F. Caulfield; Tom Kuster; Rick Spindler; Rod Jacobson

    2003-01-01

    In this study, a cellulose-fiber-reinforced Polyamide-6 (PA-6) composite, a hybrid composite (PA-6/cellulose/Wollastonite), and the neat PA-6 resin were injection molded into ASTM test–bar samples with conventional and microcellular injection molding. The impact and tensile strengths of molded samples were measured and the Scanning Electron Microscopy (SEM) images were...

  3. Using Direct Metal Deposition to Fabricate Mold Plates for an Injection Mold Machine Allowing for the Evaluation of Cost Effective Near-Sourcing Opportunities in Larger, High Volume Consumer Products

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duty, Chad E; Groh, Bill

    2014-10-31

    ORNL collaborated with Radio Systems Corporation to investigate additive manufacturing (AM) of mold plates for plastic injection molding by direct metal deposition. The team s modelling effort identified a 100% improvement in heat transfer through use of conformal cooling lines that could be built into the mold using a revolutionary design enabled by additive manufacturing. Using the newly installed laser deposition system at the ORNL Manufacturing Demonstration Facility (MDF) a stainless steel mold core was printed.

  4. THE CHALLENGE OF MOLDS FOR THE U.S. ARMY

    EPA Science Inventory

    The US Army and all armies have been interested in molds since there were armies. The most obvious interest was human infections by molds like trench foot. Then there were losses of military animals and contamination of their fodder, most notably the Soviet loss of thousands o...

  5. Powder Injection Molding of Ceramic Engine Components for Transportation

    NASA Astrophysics Data System (ADS)

    Lenz, Juergen; Enneti, Ravi K.; Onbattuvelli, Valmikanathan; Kate, Kunal; Martin, Renee; Atre, Sundar

    2012-03-01

    Silicon nitride has been the favored material for manufacturing high-efficiency engine components for transportation due to its high temperature stability, good wear resistance, excellent corrosion resistance, thermal shock resistance, and low density. The use of silicon nitride in engine components greatly depends on the ability to fabricate near net-shape components economically. The absence of a material database for design and simulation has further restricted the engineering community in developing parts from silicon nitride. In this paper, the design and manufacturability of silicon nitride engine rotors for unmanned aerial vehicles by the injection molding process are discussed. The feedstock material property data obtained from experiments were used to simulate the flow of the material during injection molding. The areas susceptible to the formation of defects during the injection molding process of the engine component were identified from the simulations. A test sample was successfully injection molded using the feedstock and sintered to 99% density without formation of significant observable defects.

  6. QUANTIFICATION OF STACHYBOTRYS CHARTARUM CONIDIA IN INDOOR DUST USING REAL TIME, FLUORESCENT PROBE-BASED DETECTION OF PCR PRODUCTS

    EPA Science Inventory

    Analyses of fungal spores or conidia in indoor dust samples can be useful for determining the contamination status of building interiors and in signaling instances where potentially harmful exposures of building occupants to these organisms may exist. A recently developed method ...

  7. Dimensional Precision Research of Wax Molding Rapid Prototyping based on Droplet Injection

    NASA Astrophysics Data System (ADS)

    Mingji, Huang; Geng, Wu; yan, Shan

    2017-11-01

    The traditional casting process is complex, the mold is essential products, mold quality directly affect the quality of the product. With the method of rapid prototyping 3D printing to produce mold prototype. The utility wax model has the advantages of high speed, low cost and complex structure. Using the orthogonal experiment as the main method, analysis each factors of size precision. The purpose is to obtain the optimal process parameters, to improve the dimensional accuracy of production based on droplet injection molding.

  8. Selection of UV Resins for Nanostructured Molds for Thermal-NIL.

    PubMed

    Jia, Zheng; Choi, Junseo; Park, Sunggook

    2018-06-18

    Nanoimprint molds made of soft polymeric materials have advantages of low demolding force and low fabrication cost over Si or metal-based hard molds. However, such advantages are often sacrificed by their reduced replication fidelity associated with the low mechanical strength. In this paper, we studied replication fidelity of different UV-resin molds copied from a Si master mold via UV nanoimprint lithography (NIL) and their thermal imprinting performance into a thermoplastic polymer. Four different UV resins were studied: two were high surface energy UV resins based on tripropyleneglycol diacrylate (TPGDA resin) and polypropyleneglycol diacrylate (PPGDA resin), and the other two were commercially available, low surface energy poly-urethane acrylate (PUA resin) and fluorine-containing (MD 700) UV resins. The replication fidelity among the four UV-resins during UV nanoimprint lithograph from a Si master with sharp nanostructures was in the increasing order of (poorest) PUA resin < MD 700 < PPGDA resin < TPGDA resin (best). The results show that the high surface energy and small monomer size are keys to achieving good UV resin filling into sharp nanostructures over the viscosity of the resin solution. When the four UV-resin molds were used for thermal-NIL into a thermoplastic polymer, the replication fidelity was in the increasing order of (poorest) MD 700 < TPGDA resin < PUA resin (best), which follows the same order of their Young's moduli. Our results indicate that the selection of an appropriate UV resin for NIL molds requires consideration of the replication fidelities in the mold fabrication and the subsequent thermal-NIL into thermoplastic polymers. © 2018 IOP Publishing Ltd.

  9. CAE for Injection Molding — Past, Present and the Future

    NASA Astrophysics Data System (ADS)

    Wang, Kuo K.

    2004-06-01

    It is well known that injection molding is the most effective process for mass-producing discrete plastic parts of complex shape to the highest precision at the lowest cost. However, due to the complex property of polymeric materials undergoing a transient non-isothermal process, it is equally well recognized that the quality of final products is often difficult to be assured. This is particularly true when a new mold or material is encountered. As a result, injection molding has often been viewed as an art than a science. During the past few decades, numerical simulation of injection molding process based on analytic models has become feasible for practical use as computers became faster and cheaper continually. A research effort was initiated at the Cornell Injection Molding Program (CIMP) in 1974 under a grant from the National Science Foundation. Over a quarter of the century, CIMP has established some scientific bases ranging from materials characterization, flow analysis, to prediction of part quality. Use of such CAE tools has become common place today in industry. Present effort has been primarily aimed at refinements of many aspects of the process. Computational efficiency and user-interface have been main thrusts by commercial software developers. Extension to 3-dimensional flow analysis for certain parts has drawn some attention. Research activities are continuing on molding of fiber-filled materials and reactive polymers. Expanded molding processes such as gas-assisted, co-injection, micro-molding and many others are continually being investigated. In the future, improvements in simulation accuracy and efficiency will continue. This will include in-depth studies on materials characterization. Intelligent on-line process control may draw more attention in order to achieve higher degree of automation. As Internet technology continues to evolve, Web-based CAE tools for design, production, remote process monitoring and control can come to path. The CAE

  10. Pressure redistribution by molded inserts in diabetic footwear: a pilot study.

    PubMed

    Lord, M; Hosein, R

    1994-08-01

    A small-scale trial is described to demonstrate and evaluate the redistribution of plantar pressure resulting from the use of custom-molded inserts in the orthopedic shoes of diabetic patients at risk of plantar ulceration. A pressure-measuring insole based on force-sensitive resistor technology enabled the load distribution to be compared using molded inserts and flat inserts fitted into the same shoes. An analysis of the 12 peaks of pressure that could be identified under a discrete metatarsal head of six subjects in the trial showed that the pressure was significantly reduced with the use of molded inserts (flat inserts: 305 +/- 79 kPa; molded inserts: 216 +/- 70 kPa; n = 6 p < 0.005). Technical limitations of the equipment and the difficult choice of match of flat insert to molded for comparison suggest that further studies are required for a definitive result.

  11. Using Cellular Slime Molds in the High School Laboratory

    ERIC Educational Resources Information Center

    Haskins, P. B.

    1977-01-01

    Described is the life cycle of the cellular slime molds Acrasiales. Experiments that can be used to explore the aggregation, migration, and culmination activities of the organism are suggested. Laboratory procedures for culturing these slime molds and listings of biological supply houses and literature references are also given. (MA)

  12. Process influences and correction possibilities for high precision injection molded freeform optics

    NASA Astrophysics Data System (ADS)

    Dick, Lars; Risse, Stefan; Tünnermann, Andreas

    2016-08-01

    Modern injection molding processes offer a cost-efficient method for manufacturing high precision plastic optics for high volume applications. Besides form deviation of molded freeform optics, internal material stress is a relevant influencing factor for the functionality of a freeform optics in an optical system. This paper illustrates dominant influence parameters of an injection molding process relating to form deviation and internal material stress based on a freeform demonstrator geometry. Furthermore, a deterministic and efficient way for 3D mold correcting of systematic, asymmetrical shrinkage errors is shown to reach micrometer range shape accuracy at diameters up to 40 mm. In a second case, a stress-optimized parameter combination using unusual molding conditions was 3D corrected to reach high precision and low stress freeform polymer optics.

  13. Adaptive temporal refinement in injection molding

    NASA Astrophysics Data System (ADS)

    Karyofylli, Violeta; Schmitz, Mauritius; Hopmann, Christian; Behr, Marek

    2018-05-01

    Mold filling is an injection molding stage of great significance, because many defects of the plastic components (e.g. weld lines, burrs or insufficient filling) can occur during this process step. Therefore, it plays an important role in determining the quality of the produced parts. Our goal is the temporal refinement in the vicinity of the evolving melt front, in the context of 4D simplex-type space-time grids [1, 2]. This novel discretization method has an inherent flexibility to employ completely unstructured meshes with varying levels of resolution both in spatial dimensions and in the time dimension, thus allowing the use of local time-stepping during the simulations. This can lead to a higher simulation precision, while preserving calculation efficiency. A 3D benchmark case, which concerns the filling of a plate-shaped geometry, is used for verifying our numerical approach [3]. The simulation results obtained with the fully unstructured space-time discretization are compared to those obtained with the standard space-time method and to Moldflow simulation results. This example also serves for providing reliable timing measurements and the efficiency aspects of the filling simulation of complex 3D molds while applying adaptive temporal refinement.

  14. Incipient flocculation molding: A new ceramic-forming technique

    NASA Astrophysics Data System (ADS)

    Arrasmith, Steven Reade

    Incipient Flocculation Molding (IFM) was conceived as a new near-net-shape forming technique for ceramic components. It was hypothesized that the development of a temperature-dependent deflocculant would result in a forming technique that is flexible, efficient, and capable of producing a superior microstructure with improved mechanical properties from highly reactive, submicron ceramic powders. IFM utilizes a concentrated, nonaqueous, sterically stabilized ceramic powder and/or colloidal suspension which is injected into a non-porous mold. The suspension is then flocculated by destabilizing the suspension by lowering the temperature. Flocculation is both rapid and reversible. Cooling to -20°C produces a green body with sufficient strength for removal from the mold. The solvent is removed from the green body by evaporation. The dried green body is subsequently sintered to form a dense ceramic monolith. This is the first ceramic forming method based upon the manipulation of a sterically-stabilized suspension. To demonstrate IFM, the process of grafting polyethylene glycol (PEG), with molecular weights from 600 to 8000, to alumina powders was investigated. The maximum grafted amounts were achieved by the technique of dispersing the alumina powders in molten polymer at 195°C. The ungrafted PEG was then removed by repeated centrifuging and redispersion in fresh distilled water. The rheological behavior of suspensions of the PEG-grafted powders in water, 2-propanol and 2-butanol were characterized. All of the aqueous suspensions were shear thinning. The PEG 4600-grafted alumina powder aqueous suspensions were the most fluid. Sample rods and bars were molded from 52 vol% PEG-grafted alumina suspensions in 2-butanol. The best results were obtained with a preheated aluminum mold lubricated with a fluorinated oil mold-release. The samples were dried, sintered, and their microstructure and density were compared with sintered samples dry pressed from the same alumina powder

  15. Physarum attraction: Why slime mold behaves as cats do?

    PubMed

    Adamatzky, Andrew; Costello, Ben De Lacy

    2012-05-01

    We discuss potential chemical substances responsible for attracting acellular slime mold Physarun polycephalum to valerian root. The contributes toward fundamental research into pheromones and chemo-attracts of primitive organisms such as slime molds. The results show that significant information could be gained about the action of compounds on higher organisms.

  16. Multicomponent micropatterned sol-gel materials by capillary molding

    NASA Astrophysics Data System (ADS)

    Lochhead, Michael J.; Yager, Paul

    1997-10-01

    A physically and chemically benign method for patterning multiple sol-gel materials onto a single substrate is described. Structures are demonstrated for potential micro- optical chemical sensor, biosensor, and waveguiding applications. Fabrication is based on the micro molding in capillaries (MIMIC) approach. A novel mold design allows several sols to be cast simultaneously. Closely spaced, organically modified silica ridges containing fluorescent dyes are demonstrated. Ridges have cross sectional dimensions from one to 50 micrometers and are centimeters in length. Processing issues, particularly those related to mold filling, are discussed in detail. Because sol-gel MIMIC avoids the harsh physical and chemical environments normally associated with patterning, the approach allows full exploitation of sol- gel processing advantages, such as the ability to entrap sensitive organic dopant molecules in the sol-gel matrix.

  17. A rapid colorimetric assay for mold spore germination using XTT tetrazolium salt

    Treesearch

    Carol A. Clausen; Vina W. Yang

    2011-01-01

    Current laboratory test methods to measure efficacy of new mold inhibitors are time consuming, some require specialized test equipment and ratings are subjective. Rapid, simple quantitative assays to measure the efficacy of mold inhibitors are needed. A quantitative, colorimetric microassay was developed using XTT tetrazolium salt to metabolically assess mold spore...

  18. Severe Sequelae to Mold-Related Illness as Demonstrated in Two Finnish Cohorts

    PubMed Central

    Tuuminen, Tamara; Rinne, Kyösti Sakari

    2017-01-01

    The presence of toxic indoor molds with accompanying bacterial growth is clearly detrimental to human health. The pathophysiological and toxicological effects of toxins and structural components of molds and bacteria have been clarified in experiments conducted in tissue culture and animals, and there is convincing epidemiologic evidence; nonetheless their implications for human health are either ignored or denied, at least in Finland. In this communication, we describe two cohorts suffering severe sequelae to mold-related illness. One cohort is a nine-member family with pets that moved into a new house, which soon proved to be infested with pathogenic molds. The other cohort consists of 30 teachers and 50 students from a mold-infested school building. The first cohort experienced a plethora of mucosal irritation, neurological, skin, allergic, and other symptoms, with all family members ultimately developing a multiple chemical syndrome. In the second cohort, we detected a greatly elevated prevalence of autoimmune conditions and malignancies. We claim that mold-related illness exists in multiple facets; if not simply a transient mucosal irritation or even an increased risk of asthma onset or its exacerbation. We propose a scheme to explain the natural course of the mold-related illness. We recommend that future studies should combine data from, e.g., cancer, autoimmune, and endocrine disorder registers and neurological and mental health or neuropsychological registers with mold-exposed individuals being monitored for prolonged follow-up times. PMID:28421079

  19. Severe Sequelae to Mold-Related Illness as Demonstrated in Two Finnish Cohorts.

    PubMed

    Tuuminen, Tamara; Rinne, Kyösti Sakari

    2017-01-01

    The presence of toxic indoor molds with accompanying bacterial growth is clearly detrimental to human health. The pathophysiological and toxicological effects of toxins and structural components of molds and bacteria have been clarified in experiments conducted in tissue culture and animals, and there is convincing epidemiologic evidence; nonetheless their implications for human health are either ignored or denied, at least in Finland. In this communication, we describe two cohorts suffering severe sequelae to mold-related illness. One cohort is a nine-member family with pets that moved into a new house, which soon proved to be infested with pathogenic molds. The other cohort consists of 30 teachers and 50 students from a mold-infested school building. The first cohort experienced a plethora of mucosal irritation, neurological, skin, allergic, and other symptoms, with all family members ultimately developing a multiple chemical syndrome. In the second cohort, we detected a greatly elevated prevalence of autoimmune conditions and malignancies. We claim that mold-related illness exists in multiple facets; if not simply a transient mucosal irritation or even an increased risk of asthma onset or its exacerbation. We propose a scheme to explain the natural course of the mold-related illness. We recommend that future studies should combine data from, e.g., cancer, autoimmune, and endocrine disorder registers and neurological and mental health or neuropsychological registers with mold-exposed individuals being monitored for prolonged follow-up times.

  20. Inhalational mold toxicity: fact or fiction? A clinical review of 50 cases.

    PubMed

    Khalili, Barzin; Montanaro, Marc T; Bardana, Emil J

    2005-09-01

    Three well-accepted mechanisms of mold-induced disease exist: allergy, infection, and oral toxicosis. Epidemiologic studies suggest a fourth category described as a transient aeroirritation effect. Toxic mold syndrome or inhalational toxicity continues to cause public concern despite a lack of scientific evidence that supports its existence. To conduct a retrospective review of 50 cases of purported mold-induced toxic effects and identify unrecognized conditions that could explain presenting symptoms; to characterize a subgroup with a symptom complex suggestive of an aeroirritation-mediated mechanism and compare this group to other diagnostic categories, such as sick building syndrome and idiopathic chemical intolerance; and to discuss the evolution of toxic mold syndrome from a clinical perspective. Eighty-two consecutive medical evaluations were analyzed of which 50 met inclusion criteria. These cases were critically reviewed and underwent data extraction of 23 variables, including demographic data, patient symptoms, laboratory, imaging, and pulmonary function test results, and an evaluation of medical diagnoses supported by medical record review, examination, and/or test results. Upper respiratory tract, lower respiratory tract, systemic, and neurocognitive symptoms were reported in 80%, 94%, 74%, and 84% of patients, respectively. Thirty patients had evidence of non-mold-related conditions that explained their presenting complaints. Two patients had evidence of allergy to mold allergens, whereas 1 patient exhibited mold-induced psychosis best described as toxic agoraphobia. Seventeen patients displayed a symptom complex that could be postulated to be caused by a transient mold-induced aeroirritation. The clinical presentation of patients with perceived mold-induced toxic effects is characterized by a disparate constellation of symptoms. Close scrutiny revealed a number of preexisting diagnoses that could plausibly explain presenting symptoms. The pathogenesis

  1. Method and composition for molding low density desiccant syntactic foam articles

    DOEpatents

    Lula, James W.; Schicker, James R.

    1984-01-01

    A method and a composition are provided for molding low density desiccant syntactic foam articles. A low density molded desiccant article may be made as a syntactic foam by blending a thermosetting resin, microspheres and molecular sieve desiccant powder, molding and curing. Such articles have densities of 0.2-0.9 g/cc, moisture capacities of 1-12% by weight, and can serve as light weight structural supports.

  2. ENVIRONMENTALLY-BENIGN POLYTETRAFLUOROETHYLENE (PTFE) COATINGS FOR MOLD RELEASE - PHASE II

    EPA Science Inventory

    GVD proposes to develop high performance, volatile organic compound (VOC)-free and perfluorooctanoic acid (PFOA)-free, non-stick mold release coatings based on its novel polytetrafluoroethylene (PTFE) fluoropolymer technology. Most commercial mold release agents make use of...

  3. A Model for Fiber Length Attrition in Injection-Molded Long-Fiber Composites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    TuckerIII, Charles L.; Phelps, Jay H; El-Rahman, Ahmed Abd

    2013-01-01

    Long-fiber thermoplastic (LFT) composites consist of an engineering thermoplastic matrix with glass or carbon reinforcing fibers that are initially 10 to 13 mm long. When an LFT is injection molded, flow during mold filling orients the fibers and degrades the fiber length. Fiber orientation models for injection molding are well developed, and special orientation models for LFTs have been developed. Here we present a detailed quantitative model for fiber length attrition in a flowing fiber suspension. The model tracks a discrete fiber length distribution (FLD) at each spatial node. Key equations are a conservation equation for total fiber length, andmore » a breakage rate equation. The breakage rate is based on buckling of fibers due to hydrodynamic forces, when the fibers are in unfavorable orientations. The FLD model is combined with a mold filling simulation to predict spatial and temporal variations in fiber length distribution in a mold cavity during filling. The predictions compare well to experiments on a glassfiber/ PP LFT molding. Fiber length distributions predicted by the model are easily incorporated into micromechanics models to predict the stress-strain behavior of molded LFT materials. Author to whom correspondence should be addressed; electronic mail: ctucker@illinois.edu 1« less

  4. Coping With Cleft: A Conceptual Framework of Caregiver Responses to Nasoalveolar Molding.

    PubMed

    Sischo, Lacey; Broder, Hillary L; Phillips, Ceib

    2015-11-01

    To present a conceptual framework of caregiver coping and adaptation to early cleft care using nasoalveolar molding. In-depth interviews were conducted at three time points with caregivers of infants with cleft lip or cleft lip and palate whose children had nasoalveolar molding to treat their cleft. Qualitative data were analyzed using modified grounded theory. Most caregivers expressed initial apprehension and anxiety about the responsibilities of care associated with nasoalveolar molding (e.g., changing and positioning tapes, cleaning the appliance). In subsequent interviews, caregivers often reported positive feelings related to their active participation in their child's treatment for cleft. These positive feelings were associated with increased self-esteem and feelings of empowerment for the caregivers. Although caregivers also identified burdens associated with nasoalveolar molding (e.g., stress related to lip taping, concerns about the appliance causing sores in their child's mouth, travel to weekly appointments), they tended to minimize the impact of these issues in comparison with the perceived benefits of nasoalveolar molding. Despite the increased burden of care, many caregivers of infants with cleft used nasoalveolar molding as a problem-focused coping strategy to deal with their child's cleft. Completing nasoalveolar molding was often associated with positive factors such as increased empowerment, self-esteem, and bonding with their infant.

  5. Physarum attraction: Why slime mold behaves as cats do?

    PubMed Central

    Adamatzky, Andrew; Costello, Ben De Lacy

    2012-01-01

    We discuss potential chemical substances responsible for attracting acellular slime mold Physarun polycephalum to valerian root. The contributes toward fundamental research into pheromones and chemo-attracts of primitive organisms such as slime molds. The results show that significant information could be gained about the action of compounds on higher organisms. PMID:22896798

  6. Is Mold Toxicity Really a Problem for Our Patients? Part 2-Nonrespiratory Conditions.

    PubMed

    Pizzorno, Joseph; Shippy, Ann

    2016-06-01

    In my last editorial, I addressed the respiratory effects of mold exposure. The surprising research shows that as many as 50% of residential and work environments have water damage1 and that mold toxicity should be considered in all patients with any chronic respiratory condition. This is especially true in adult-onset asthma, two-thirds of which appears to be caused by toxins released from water-damaged buildings. The carcinogenic effects of food-borne mold contamination are also well documented. Less clear is the role of indoor mold exposure in water-damaged buildings and its relationship to nonrespiratory conditions. As we look at the research on mold toxicity and toxins in general, we propose that the medical community (by all its names) has focused too much on the "yellow canaries" and missed the big picture that toxins have now become a primary driver of disease in the general population, not only among those most susceptible. The mold toxicity conundrum illustrates this issue quite well. As summarized in this editorial, there clearly is a portion of the population, the size of which is currently unknown, who experience neurological and/or immunological damage from mold toxicity. In addition, a substantial portion of the population experiences chronic respiratory problems from mold exposure. This does not mean we should stop paying attention to our more affected patients. Rather, we need to realize that almost everyone is being affected by toxins to some degree: molds, metals, solvents, persistent organic pollutants, etc.

  7. Mold Species in Dust from the International Space Station Identified and Quantified by Mold Specific Quantitative PCR

    NASA Technical Reports Server (NTRS)

    Vesper, Stephen J.; Wong, Wing; Kuo, C. Mike; Pierson, Duane L.

    2008-01-01

    Dust was collected over a period of several weeks in 2007 from various HEPA filters in the U.S. Laboratory Module of the International Space Station (ISS). The dust was returned on the Space Shuttle Atlantis, mixed, sieved, and the DNA was extracted. Using a DNA-based method called mold specific quantitative PCR (MSQPCR), 39 molds were measured in the dust. Opportunistic pathogens Aspergillus flavus and A. niger and toxin producers Penicillium chrysogenum and P. brevicompactum were found at relatively high concentrations (compared to U.S. homes). No cells of the opportunistic pathogens A. fumigatus, A. terreus, Fusarium solani or Candida albicans were detected.

  8. Method for Selective Cleaning of Mold Release from Composite Honeycomb Surfaces

    NASA Technical Reports Server (NTRS)

    Pugel, Diane

    2011-01-01

    Honeycomb structures are commonly employed as load- and force-bearing structures as they are structurally strong and lightweight. Manufacturing processes for heat-molded composite honeycomb structures commence with the placement of pre-impregnated composite layups over metal mandrels. To prevent permanent bonding between the composite layup and the metal mandrels, an agent, known as a mold release agent, is used. Mold release agents allow the molded composite material to be removed from mandrels after a heat-forming process. Without a specific removal process, mold release agents may continue to adhere to the surface of the composite material, thereby affecting the bonding of other materials that may come into contact with the composite surface in later stages of processing A constituent common to commercially available household cleaning agents is employed for the removal of mold release agents common to the manufacturing of heat-formed composite materials. The reliability of the solvent has been proven by the longevity and reliability of commercial household cleaners. At the time of this reporting, no one has attempted using constituent for this purpose. The material to be cleaned is immersed in the solution, vertically removed so that the solution is allowed to drain along cell walls and into a solvent bath, and then placed on a compressed airflow table for drying.

  9. Mold prevention strategies and possible health effects in the aftermath of hurricanes and major floods.

    PubMed

    Brandt, Mary; Brown, Clive; Burkhart, Joe; Burton, Nancy; Cox-Ganser, Jean; Damon, Scott; Falk, Henry; Fridkin, Scott; Garbe, Paul; McGeehin, Mike; Morgan, Juliette; Page, Elena; Rao, Carol; Redd, Stephen; Sinks, Tom; Trout, Douglas; Wallingford, Kenneth; Warnock, David; Weissman, David

    2006-06-09

    Extensive water damage after major hurricanes and floods increases the likelihood of mold contamination in buildings. This report provides information on how to limit exposure to mold and how to identify and prevent mold-related health effects. Where uncertainties in scientific knowledge exist, practical applications designed to be protective of a person's health are presented. Evidence is included about assessing exposure, clean-up and prevention, personal protective equipment, health effects, and public health strategies and recommendations. The recommendations assume that, in the aftermath of major hurricanes or floods, buildings wet for <48 hours will generally support visible and extensive mold growth and should be remediated, and excessive exposure to mold-contaminated materials can cause adverse health effects in susceptible persons regardless of the type of mold or the extent of contamination. For the majority of persons, undisturbed mold is not a substantial health hazard. Mold is a greater hazard for persons with conditions such as impaired host defenses or mold allergies. To prevent exposure that could result in adverse health effects from disturbed mold, persons should 1) avoid areas where mold contamination is obvious; 2) use environmental controls; 3) use personal protective equipment; and 4) keep hands, skin, and clothing clean and free from mold-contaminated dust. Clinical evaluation of suspected mold-related illness should follow conventional clinical guidelines. In addition, in the aftermath of extensive flooding, health-care providers should be watchful for unusual mold-related diseases. The development of a public health surveillance strategy among persons repopulating areas after extensive flooding is recommended to assess potential health effects and the effectiveness of prevention efforts. Such a surveillance program will help CDC and state and local public health officials refine the guidelines for exposure avoidance, personal protection

  10. Infant origins of childhood asthma associated with specific molds.

    PubMed

    Reponen, Tiina; Lockey, James; Bernstein, David I; Vesper, Stephen J; Levin, Linda; Khurana Hershey, Gurjit K; Zheng, Shu; Ryan, Patrick; Grinshpun, Sergey A; Villareal, Manuel; Lemasters, Grace

    2012-09-01

    The specific cause or causes of asthma development must be identified to prevent this disease. Our hypothesis was that specific mold exposures are associated with childhood asthma development. Infants were identified from birth certificates. Dust samples were collected from 289 homes when the infants were 8 months of age. Samples were analyzed for concentrations of 36 molds that comprise the Environmental Relative Moldiness Index (ERMI) and endotoxin, house dust mite, cat, dog, and cockroach allergens. Children were evaluated at age 7 years for asthma based on reported symptoms and objective measures of lung function. Host, environmental exposure, and home characteristics evaluated included a history of parental asthma, race, sex, upper and lower respiratory tract symptoms, season of birth, family income, cigarette smoke exposure, air conditioning, use of a dehumidifier, presence of carpeting, age of home, and visible mold at age 1 year and child's positive skin prick test response to aeroallergens and molds at age 7 years. Asthma was diagnosed in 24% of the children at age 7 years. A statistically significant increase in asthma risk at age 7 years was associated with high ERMI values in the child's home in infancy (adjusted relative risk for a 10-unit increase in ERMI value, 1.8; 95% CI, 1.5-2.2). The summation of levels of 3 mold species, Aspergillus ochraceus, Aspergillus unguis, and Penicillium variabile, was significantly associated with asthma (adjusted relative risk, 2.2; 95% CI, 1.8-2.7). In this birth cohort study exposure during infancy to 3 mold species common to water-damaged buildings was associated with childhood asthma at age 7 years. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  11. The Allergenic Potential of Molds Found in Water-Damaged Homes*

    EPA Science Inventory

    Damp/moldy environments have been associated with asthma exacerbation, but mold's role in allergic asthma induction is less clear. Recently, certain molds categorized as Group 1 were associated with asthmatics' water-damaged homes in Cleveland, while others were found more univer...

  12. Applications of thin carbon coatings and films in injection molding

    NASA Astrophysics Data System (ADS)

    Cabrera, Eusebio Duarte

    In this research, the technical feasibility of two novel applications of thin carbon coatings is demonstrated. The first application consists of using thin carbon coatings on molds for molding ultra-thin plastic parts (<0.5 mm thickness) with lower pressures by promoting wall slip. The second application consists of a new approach to provide electromagnetic interference (EMI) shielding for plastic parts using in mold coated nanoparticle thin films or nanopapers to create a conductive top layer. During this research, the technical feasibility of a new approach was proven which provides injection molding of ultra-thin parts at lower pressures, without the need of fast heating/fast cooling or other expensive mold modification. An in-house developed procedure by other members of our group, was employed for coating the mold surface using chemical vapor deposition (CVD) resulting in a graphene coating with carbide bonding to the mold surface. The coating resulted in a significant decrease of surface friction and consequently easiness of flow when compared to their uncoated counterparts. Thermoplastic polymers and their composites are a very attractive alternative but are hindered by the non-conductive nature of polymers. There are two general approaches used to date to achieve EMI shielding for plastic products. One is to spray a conductive metal coating onto the plastic surface forming a layer that must maintain its shielding effectiveness (SE), and its adhesion to the plastic throughout the expected life of the product. However, metal coatings add undesirable weight and tend to corrode over time. Furthermore, scratching the coating may create shielding failure; therefore, a protective topcoat may be required. The other approach is to use polymer composites filled with conductive fillers such as carbon black (CB), carbon nanofiber (CNF), and carbon nanotube (CNT). While conductive fillers may increase the electrical conductivity of polymer composites, the loading of

  13. Azole-based antimycotic agents inhibit mold on unseasoned pine

    Treesearch

    Carol. A. Clausen; Vina W. Yang

    2005-01-01

    Inhibiting the growth of mold fungi on cellulose-based building materials may be achievable through the use of azole-based antimycotics. Azoles were variably effective against mold fungi that are frequently found on wood and wood products. Unseasoned southern yellow pine specimens that were dip-treated with varying concentrations of eight azoles were evaluated for...

  14. Method for Molding Structural Parts Utilizing Modified Silicone Rubber

    NASA Technical Reports Server (NTRS)

    Weiser, Erik S. (Inventor); Baucom, Robert M. (Inventor); Snoha, John J. (Inventor)

    1998-01-01

    This invention improves upon a method for molding structural parts from preform material. Preform material to be used for the part is provided. A silicone rubber composition containing entrained air voids is prepared. The silicone rubber and preform material assembly is situated within a rigid mold cavity used to shape the preform material to die desired shape. The entire assembly is heated in a standard heating device so that the thermal expansion of the silicone rubber exerts the pressure necessary to force the preform material into contact with the mold container. The introduction of discrete air voids into the silicone rubber allows for accurately controlled pressure application on the preform material at the cure temperature.

  15. Effect of Reclamation on the Skin Layer of Ductile Iron Cast in Furan Molds

    NASA Astrophysics Data System (ADS)

    Dańko, R.; Holtzer, M.; Górny, M.; Żymankowska-Kumon, S.

    2013-11-01

    The paper presents the results of investigations of the influence of the quality of molding sand with furan resin hardened by paratoluenesulfonic acid, on the formation of microstructure and surface quality of ductile iron castings. Within the studies different molding sands were used: molding sand prepared with fresh sand and molding sands prepared with reclaimed sands of a different purification degree, determined by the ignition loss value. Various concentrations of sulfur and nitrogen in the sand molds as a function of the ignition loss were shown in the paper. A series of experimental melts of ductile iron in molds made of molding sand characterized by different levels of surface-active elements (e.g., sulfur) and different gas evolution rates were performed. It was shown that there exists a significant effect of the quality of the sand on the formation of the graphite degeneration layer.

  16. Mold Cleanup in Your Home

    EPA Pesticide Factsheets

    If you found mold in your household, you will want to clean it up. Some considerations on how you will clean it up depend on the size of the area, the contaminated materials, and any additional health concerns.

  17. Method for molding ceramic powders using a water-based gel casting process

    DOEpatents

    Jenny, Mark A.; Omalete, Ogbemi O.

    1992-09-08

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant, and a monomer solution. The monomer solution includes at least one monofunctional monomer and at least one difunctional monomer, a free-radical initiator, and a aqueous solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, whereafter the product may be sintered.

  18. Improved molding process ensures plastic parts of higher tensile strength

    NASA Technical Reports Server (NTRS)

    Heier, W. C.

    1968-01-01

    Single molding process ensures that plastic parts /of a given mechanical design/ produced from a conventional thermosetting molding compound will have a maximum tensile strength. The process can also be used for other thermosetting compounds to produce parts with improved physical properties.

  19. IGE IN ASTHMATIC HUMAN SERA IS REACTIVE AGAINST MOLD EXTRACTS

    EPA Science Inventory

    Molds have been associated with various health effects including asthma, but their role in induction of asthma is unclear. However, the presence of mold-specific IgE indicates their capacity to induce allergic responses and possibly exacerbate asthma symptoms. This study was und...

  20. 34. THESE INGOT MOLDS OF STEEL 32' X 83' ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    34. THESE INGOT MOLDS OF STEEL - 32' X 83' IN SIZE - ARE READY TO BE TAKEN TO THE STRIPPER, WHERE THE MOLDS WILL BE REMOVED. INGOTS WILL NEXT BE PLACED INTO A 'SOAKING PIT,' WHERE THEY ARE HEATED TO A UNIFORM TEMPERATURE PRIOR TO ROLLING. - Corrigan, McKinney Steel Company, 3100 East Forty-fifth Street, Cleveland, Cuyahoga County, OH

  1. Evaluation of Additive Manufacturing for Composite Part Molds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duty, Chad E.; Springfield, Robert M.

    2015-02-01

    The ORNL Manufacturing Demonstration Facility (MDF) collaborated with Tru-Design to test the quality and durability of molds used for making fiber reinforced composites using additive manufacturing. The partners developed surface treatment techniques including epoxy coatings and machining to improve the quality of the surface finish. Test samples made using the printed and surface finished molds demonstrated life spans suitable for one-of-a-kind and low-volume applications, meeting the project objective.

  2. Compression molding of aerogel microspheres

    DOEpatents

    Pekala, Richard W.; Hrubesh, Lawrence W.

    1998-03-24

    An aerogel composite material produced by compression molding of aerogel microspheres (powders) mixed together with a small percentage of polymer binder to form monolithic shapes in a cost-effective manner. The aerogel composites are formed by mixing aerogel microspheres with a polymer binder, placing the mixture in a mold and heating under pressure, which results in a composite with a density of 50-800 kg/m.sup.3 (0.05-0.80 g/cc). The thermal conductivity of the thus formed aerogel composite is below that of air, but higher than the thermal conductivity of monolithic aerogels. The resulting aerogel composites are attractive for applications such as thermal insulation since fabrication thereof does not require large and expensive processing equipment. In addition to thermal insulation, the aerogel composites may be utilized for filtration, ICF target, double layer capacitors, and capacitive deionization.

  3. Compression molded energy storage flywheels

    NASA Astrophysics Data System (ADS)

    Burdick, P. A.

    Materials choices, manufacturing processes, and benefits of flywheels as an effective energy storage device are discussed. Tests at the LL Laboratories have indicated that compressing molding of plies of structural sheet molding compound (SMC) filled with randomly oriented fibers produces a laminated disk with transversely isotropic properties. Good performance has been realized with a carbon/epoxy system, which displays satisfactory stiffness and strength in flywheel applications. A core profile has been selected, consisting of a uniform 1 in cross sectional thickness and a 21 in diam. Test configurations using three different resin paste formulations were compared after being mounted elastomerically on aluminum hubs. Further development was found necessary on accurate balancing and hub bonding. It was concluded that the SMC flywheels display the low-cost, sufficient energy densities, suitable dynamic stability characteristics, and acceptably benign failure modes for automotive applications.

  4. Molded composite pyrogen igniter for rocket motors. [solid propellant ignition

    NASA Technical Reports Server (NTRS)

    Heier, W. C.; Lucy, M. H. (Inventor)

    1978-01-01

    A lightweight pyrogen igniter assembly including an elongated molded plastic tube adapted to contain a pyrogen charge was designed for insertion into a rocket motor casing for ignition of the rocket motor charge. A molded plastic closure cap provided for the elongated tube includes an ignition charge for igniting the pyrogen charge and an electrically actuated ignition squib for igniting the ignition charge. The ignition charge is contained within a portion of the closure cap, and it is retained therein by a noncorrosive ignition pellet retainer or screen which is adapted to rest on a shoulder of the elongated tube when the closure cap and tube are assembled together. A circumferentially disposed metal ring is provided along the external circumference of the closure cap and is molded or captured within the plastic cap in the molding process to provide, along with O-ring seals, a leakproof rotary joint.

  5. Microlens fabrication by replica molding of frozen laser-printed droplets

    NASA Astrophysics Data System (ADS)

    Surdo, Salvatore; Diaspro, Alberto; Duocastella, Martí

    2017-10-01

    In this work, we synergistically combine laser-induced forward transfer (LIFT) and replica molding for the fabrication of microlenses with control of their geometry and size independent of the material or substrate used. Our approach is based on a multistep process in which liquid microdroplets of an aqueous solution are first printed on a substrate by LIFT. Following a freezing step, the microdroplets are used as a master to fabricate a polydimethylsiloxane (PDMS) mold. A subsequent replica molding step enables the creation of microlenses and microlens arrays on arbitrary selected substrates and by using different curable polymers. Thus, our method combines the rapid fabrication capabilities of LIFT and the perfectively smooth surface quality of the generated microdroplets, with the advantages of replica molding in terms of parallelization and materials flexibility. We demonstrate our strategy by generating microlenses of different photocurable polymers and by characterizing their optical and morphological properties.

  6. Coping With Cleft: A Conceptual Framework of Caregiver Responses to Nasoalveolar Molding

    PubMed Central

    Sischo, Lacey; Broder, Hillary L.; Phillips, Ceib

    2014-01-01

    Objective To present a conceptual framework of caregiver coping and adaptation to early cleft care using nasoalveolar molding. Design In-depth interviews were conducted at three time points with caregivers of infants with cleft lip or cleft lip and palate whose children had nasoalveolar molding to treat their cleft. Qualitative data were analyzed using modified grounded theory. Results Most caregivers expressed initial apprehension and anxiety about the responsibilities of care associated with nasoalveolar molding (e.g., changing and positioning tapes, cleaning the appliance). In subsequent interviews, caregivers often reported positive feelings related to their active participation in their child’s treatment for cleft. These positive feelings were associated with increased self-esteem and feelings of empowerment for the caregivers. Although caregivers also identified burdens associated with nasoalveolar molding (e.g., stress related to lip taping, concerns about the appliance causing sores in their child’s mouth, travel to weekly appointments), they tended to minimize the impact of these issues in comparison with the perceived benefits of nasoalveolar molding. Conclusions Despite the increased burden of care, many caregivers of infants with cleft used nasoalveolar molding as a problem-focused coping strategy to deal with their child’s cleft. Completing nasoalveolar molding was often associated with positive factors such as increased empowerment, self-esteem, and bonding with their infant. PMID:25225840

  7. Differential Allergy Induction by Molds Found in Water-Damaged Homes

    EPA Science Inventory

    Abstract: We compared the allergy induction potential of high concentration molds found in water-damaged homes and molds found more universally to house dust mite (HDM) in our mouse allergy/asthma model. Female BALB/c mice received 1 or 4 exposures by intratracheal aspiration of ...

  8. Application of atmospheric-pressure argon plasma jet for bread mold decontamination

    NASA Astrophysics Data System (ADS)

    Thonglor, P.; Amnuaycheewa, P.

    2017-09-01

    Atmospheric-pressure argon plasma (APAP) is a promising non-thermal technology for microbial control and prevention minimally affecting quality of foods. Effect of APAP jet on the growth of bread molds, including two Aspergillus sp., Rhizopus stolonifer, and Penicillium roqueforti, isolated from white bread were investigated. The molds were isolated, verified, cultured to fully grown on potato dextrose agar (PDA), and subsequently treated with APAP jet using plasma generating power at 24 W for 5, 10, and 20 min, respectively. The inhibition of mold growth was investigated by comparing fungal dry weights and the effect on fungal cell structure was observed using compound light microscope. The results indicated that the 20-min treatment time is most effective in retarding the growth of the three bread molds. However, this level of generating power did not lead to destruction of the cellular structures for all the four fungi. Plasma generating power and treatment time are significant parameters determining the success of bread mold decontamination and further investigation on real bread matrix is needed.

  9. Diversity and Significance of Mold Species in Norwegian Drinking Water▿

    PubMed Central

    Hageskal, Gunhild; Knutsen, Ann Kristin; Gaustad, Peter; de Hoog, G. Sybren; Skaar, Ida

    2006-01-01

    In order to determine the occurrence, distribution, and significance of mold species in groundwater- and surface water-derived drinking water in Norway, molds isolated from 273 water samples were identified. Samples of raw water, treated water, and water from private homes and hospital installations were analyzed by incubation of 100-ml membrane-filtered samples on dichloran-18% glycerol agar. The total count (number of CFU per 100 ml) of fungal species and the species diversity within each sample were determined. The identification of mold species was based on morphological and molecular methods. In total, 94 mold species belonging to 30 genera were identified. The mycobiota was dominated by species of Penicillium, Trichoderma, and Aspergillus, with some of them occurring throughout the drinking water system. Several of the same species as isolated from water may have the potential to cause allergic reactions or disease in humans. Other species are common contaminants of food and beverages, and some may cause unwanted changes in the taste or smell of water. The present results indicate that the mycobiota of water should be considered when the microbiological safety and quality of drinking water are assessed. In fact, molds in drinking water should possibly be included in the Norwegian water supply and drinking water regulations. PMID:17028226

  10. Molded Concrete Center Mine Wall

    NASA Technical Reports Server (NTRS)

    Lewis, E. V.

    1987-01-01

    Proposed semiautomatic system forms concrete-foam wall along middle of coal-mine passage. Wall helps support roof and divides passage into two conduits needed for ventilation of coal face. Mobile mold and concrete-foam generator form sections of wall in place.

  11. White mold of Jerusalem artichoke

    USDA-ARS?s Scientific Manuscript database

    Jerusalem artichoke (Helianthus tuberosus) is a Native American food plant closely related to the common sunflower (Helianthus annuus). Tubers of Jerusalem artichoke are increasingly available in retail grocery outlets. White mold (Sclerotinia stem rot), caused by the fungus, Sclerotinia sclerotioru...

  12. Fabrication of spherical microlens array by combining lapping on silicon wafer and rapid surface molding

    NASA Astrophysics Data System (ADS)

    Liu, Xiaohua; Zhou, Tianfeng; Zhang, Lin; Zhou, Wenchen; Yu, Jianfeng; Lee, L. James; Yi, Allen Y.

    2018-07-01

    Silicon is a promising mold material for compression molding because of its properties of hardness and abrasion resistance. Silicon wafers with carbide-bonded graphene coating and micro-patterns were evaluated as molds for the fabrication of microlens arrays. This study presents an efficient but flexible manufacturing method for microlens arrays that combines a lapping method and a rapid molding procedure. Unlike conventional processes for microstructures on silicon wafers, such as diamond machining and photolithography, this research demonstrates a unique approach by employing precision steel balls and diamond slurries to create microlenses with accurate geometry. The feasibility of this method was demonstrated by the fabrication of several microlens arrays with different aperture sizes and pitches on silicon molds. The geometrical accuracy and surface roughness of the microlens arrays were measured using an optical profiler. The measurement results indicated good agreement with the optical profile of the design. The silicon molds were then used to copy the microstructures onto polymer substrates. The uniformity and quality of the samples molded through rapid surface molding were also assessed and statistically quantified. To further evaluate the optical functionality of the molded microlens arrays, the focal lengths of the microlens arrays were measured using a simple optical setup. The measurements showed that the microlens arrays molded in this research were compatible with conventional manufacturing methods. This research demonstrated an alternative low-cost and efficient method for microstructure fabrication on silicon wafers, together with the follow-up optical molding processes.

  13. Electron-Beam Vapor Deposition of Mold Inserts Final Report CRADA No. TSB-777-94

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shepp, T.; Feeley, T.

    Lawrence Livermore National Laboratory and H.G.G. Laser Fare, Inc. studied the application of electron-beam vapor deposition technology to the production of mold inserts for use in an injection molding machine by Laser Fare. Laser Fare provided LLNL with the requirements of the mold inserts as well as sample inserts. LLNL replicated the mold insert(s) to Laser Fare for testing by Laser Fare.

  14. Looking east inside of the ingot mold stripper building for ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Looking east inside of the ingot mold stripper building for the 44" slab mill at a row of ingots. A row of ingot molds are pictured east on the left. - U.S. Steel Edgar Thomson Works, 44" Slab Mill, Along Monongahela River, Braddock, Allegheny County, PA

  15. Demonstration of pharmaceutical tablet coating process by injection molding technology.

    PubMed

    Puri, Vibha; Brancazio, David; Harinath, Eranda; Martinez, Alexander R; Desai, Parind M; Jensen, Keith D; Chun, Jung-Hoon; Braatz, Richard D; Myerson, Allan S; Trout, Bernhardt L

    2018-01-15

    We demonstrate the coating of tablets using an injection molding (IM) process that has advantage of being solvent free and can provide precision coat features. The selected core tablets comprising 10% w/w griseofulvin were prepared by an integrated hot melt extrusion-injection molding (HME-IM) process. Coating trials were conducted on a vertical injection mold machine. Polyethylene glycol and polyethylene oxide based hot melt extruded coat compositions were used. Tablet coating process feasibility was successfully demonstrated using different coating mold designs (with both overlapping and non-overlapping coatings at the weld) and coat thicknesses of 150 and 300 μm. The resultant coated tablets had acceptable appearance, seal at the weld, and immediate drug release profile (with an acceptable lag time). Since IM is a continuous process, this study opens opportunities to develop HME-IM continuous processes for transforming powder to coated tablets. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Modeling injection molding of net-shape active ceramic components.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baer, Tomas; Cote, Raymond O.; Grillet, Anne Mary

    2006-11-01

    To reduce costs and hazardous wastes associated with the production of lead-based active ceramic components, an injection molding process is being investigated to replace the current machining process. Here, lead zirconate titanate (PZT) ceramic particles are suspended in a thermoplastic resin and are injected into a mold and allowed to cool. The part is then bisque fired and sintered to complete the densification process. To help design this new process we use a finite element model to describe the injection molding of the ceramic paste. Flow solutions are obtained using a coupled, finite-element based, Newton-Raphson numerical method based on themore » GOMA/ARIA suite of Sandia flow solvers. The evolution of the free surface is solved with an advanced level set algorithm. This approach incorporates novel methods for representing surface tension and wetting forces that affect the evolution of the free surface. Thermal, rheological, and wetting properties of the PZT paste are measured for use as input to the model. The viscosity of the PZT is highly dependent both on temperature and shear rate. One challenge in modeling the injection process is coming up with appropriate constitutive equations that capture relevant phenomenology without being too computationally complex. For this reason we model the material as a Carreau fluid and a WLF temperature dependence. Two-dimensional (2D) modeling is performed to explore the effects of the shear in isothermal conditions. Results indicate that very low viscosity regions exist near walls and that these results look similar in terms of meniscus shape and fill times to a simple Newtonian constitutive equation at the shear-thinned viscosity for the paste. These results allow us to pick a representative viscosity to use in fully three-dimensional (3D) simulation, which because of numerical complexities are restricted to using a Newtonian constitutive equation. Further 2D modeling at nonisothermal conditions shows that the

  17. Design and thermal analysis of a mold used in the injection of elastomers

    NASA Astrophysics Data System (ADS)

    Fekiri, Nasser; Canto, Cécile; Madec, Yannick; Mousseau, Pierre; Plot, Christophe; Sarda, Alain

    2017-10-01

    In the process of injection molding of elastomers, improving the energy efficiency of the tools is a current challenge for industry in terms of energy consumption, productivity and product quality. In the rubber industry, 20% of the energy consumed by capital goods comes from heating processes; more than 50% of heat losses are linked to insufficient control and thermal insulation of Molds. The design of the tooling evolves in particular towards the reduction of the heated mass and the thermal insulation of the molds. In this paper, we present a complex tool composed, on one hand, of a multi-cavity mold designed by reducing the heated mass and equipped with independent control zones placed closest to each molding cavity and, on the other hand, of a regulated channel block (RCB) which makes it possible to limit the waste of rubber during the injection. The originality of this tool lies in thermally isolating the regulated channel block from the mold and the cavities between them in order to better control the temperature field in the material which is transformed. We present the design and the instrumentation of the experimental set-up. Experimental measurements allow us to understand the thermal of the tool and to show the thermal heterogeneities on the surface of the mold and in the various cavities. Tests of injection molding of the rubber and a thermal balance on the energy consumption of the tool are carried out.

  18. Compression molding of aerogel microspheres

    DOEpatents

    Pekala, R.W.; Hrubesh, L.W.

    1998-03-24

    An aerogel composite material produced by compression molding of aerogel microspheres (powders) mixed together with a small percentage of polymer binder to form monolithic shapes in a cost-effective manner is disclosed. The aerogel composites are formed by mixing aerogel microspheres with a polymer binder, placing the mixture in a mold and heating under pressure, which results in a composite with a density of 50--800 kg/m{sup 3} (0.05--0.80 g/cc). The thermal conductivity of the thus formed aerogel composite is below that of air, but higher than the thermal conductivity of monolithic aerogels. The resulting aerogel composites are attractive for applications such as thermal insulation since fabrication thereof does not require large and expensive processing equipment. In addition to thermal insulation, the aerogel composites may be utilized for filtration, ICF target, double layer capacitors, and capacitive deionization. 4 figs.

  19. Nonisothermal glass molding for the cost-efficient production of precision freeform optics

    NASA Astrophysics Data System (ADS)

    Vu, Anh-Tuan; Kreilkamp, Holger; Dambon, Olaf; Klocke, Fritz

    2016-07-01

    Glass molding has become a key replication-based technology to satisfy intensively growing demands of complex precision optics in the today's photonic market. However, the state-of-the-art replicative technologies are still limited, mainly due to their insufficiency to meet the requirements of mass production. This paper introduces a newly developed nonisothermal glass molding in which a complex-shaped optic is produced in a very short process cycle. The innovative molding technology promises a cost-efficient production because of increased mold lifetime, less energy consumption, and high throughput from a fast process chain. At the early stage of the process development, the research focuses on an integration of finite element simulation into the process chain to reduce time and labor-intensive cost. By virtue of numerical modeling, defects including chill ripples and glass sticking in the nonisothermal molding process can be predicted and the consequent effects are avoided. In addition, the influences of process parameters and glass preforms on the surface quality, form accuracy, and residual stress are discussed. A series of experiments was carried out to validate the simulation results. The successful modeling, therefore, provides a systematic strategy for glass preform design, mold compensation, and optimization of the process parameters. In conclusion, the integration of simulation into the entire nonisothermal glass molding process chain will significantly increase the manufacturing efficiency as well as reduce the time-to-market for the mass production of complex precision yet low-cost glass optics.

  20. Mold contamination in schools with either high or low prevelance of asthma.

    PubMed

    Vesper, Stephen; Prill, Rich; Wymer, Larry; Adkins, Lauren; Williams, Ronald; Fulk, Florence

    2015-02-01

    Mold exposures have been linked to the development and exacerbation of asthma. The purpose of this study was to determine whether the Environmental Relative Moldiness Index (ERMI) metric, developed to quantify mold exposures in homes, might be applied to evaluating the mold contamination in schools. Settled dust samples (n = 10) were collected on each level of a water-damaged school in Springfield, Massachusetts and two samples per level in five Idaho schools. Each dust sample was analyzed for the 36 molds that make up the ERMI. The concentration of 2.5-μm particulate matter (PM2.5 ) was measured in each school at two locations during the spring of 2013. The average ERMI value in the Springfield school, 15.51, was significantly greater (p < 0.001) than the average ERMI value, -2.87, in the Idaho schools. Ten of the twenty-six Group 1 molds, which are associated with water-damaged environments, were in significantly greater concentrations in the Springfield school. The populations of Group 2 molds, which are common indoors even without water damage, were essentially the same in Springfield and Idaho schools. The average PM2.5 concentration in the Springfield and Idaho schools was 11.6 and 3.4 μg/m(3) , respectively. The ERMI scale might be useful in comparing the relative mold contamination in schools. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. The Design of 3D-Printed Lattice-Reinforced Thickness-Varying Shell Molds for Castings.

    PubMed

    Shangguan, Haolong; Kang, Jinwu; Yi, Jihao; Zhang, Xiaochuan; Wang, Xiang; Wang, Haibin; Huang, Tao

    2018-03-30

    3D printing technologies have been used gradually for the fabrication of sand molds and cores for castings, even though these molds and cores are dense structures. In this paper, a generation method for lattice-reinforced thickness-varying shell molds is proposed and presented. The first step is the discretization of the STL (Stereo Lithography) model of a casting into finite difference meshes. After this, a shell is formed by surrounding the casting with varying thickness, which is roughly proportional to the surface temperature distribution of the casting that is acquired by virtually cooling it in the environment. A regular lattice is subsequently constructed to support the shell. The outside surface of the shell and lattice in the cubic mesh format is then converted to STL format to serve as the external surface of the new shell mold. The internal surface of the new mold is the casting's surface with the normals of all of the triangles in STL format reversed. Experimental verification was performed on an Al alloy wheel hub casting. Its lattice-reinforced thickness-varying shell mold was generated by the proposed method and fabricated by the binder jetting 3D printing. The poured wheel hub casting was sound and of good surface smoothness. The cooling rate of the wheel hub casting was greatly increased due to the shell mold structure. This lattice-reinforced thickness-varying shell mold generation method is of great significance for mold design for castings to achieve cooling control.

  2. Atmospheric transport of mold spores in clouds of desert dust

    USGS Publications Warehouse

    Shinn, E.A.; Griffin, Dale W.; Seba, D.B.

    2003-01-01

    Fungal spores can be transported globally in clouds of desert dust. Many species of fungi (commonly known as molds) and bacteria--including some that are human pathogens--have characteristics suited to long-range atmospheric transport. Dust from the African desert can affect air quality in Africa, Europe, the Middle East, and the Americas. Asian desert dust can affect air quality in Asia, the Arctic, North America, and Europe. Atmospheric exposure to mold-carrying desert dust may affect human health directly through allergic induction of respiratory stress. In addition, mold spores within these dust clouds may seed downwind ecosystems in both outdoor and indoor environments.

  3. Correlation between strength properties in standard test specimens and molded phenolic parts

    NASA Technical Reports Server (NTRS)

    Turner, P S; Thomason, R H

    1946-01-01

    This report describes an investigation of the tensile, flexural, and impact properties of 10 selected types of phenolic molding materials. The materials were studied to see in what ways and to what extent their properties satisfy some assumptions on which the theory of strength of materials is based: namely, (a) isotropy, (b) linear stress-strain relationship for small strains, and (c) homogeneity. The effect of changing the dimensions of tensile and flexural specimens and the span-depth ratio in flexural tests were studied. The strengths of molded boxes and flexural specimens cut from the boxes were compared with results of tests on standard test specimens molded from the respective materials. The nonuniformity of a material, which is indicated by the coefficient of variation, affects the results of tests made with specimens of different sizes and tests with different methods of loading. The strength values were found to depend on the relationship between size and shape of the molded specimen and size and shape of the fillers. The most significant variations observed within a diversified group of materials were found to depend on the orientation of fibrous fillers. Of secondary importance was the dependence of the variability of test results on the pieces of filler incorporated into the molding powder as well as on the size of the piece. Static breaking strength tests on boxes molded from six representative phenolic materials correlated well with falling-ball impact tests on specimens cut from molded flat sheets. Good correlation was obtained with Izod impact tests on standard test specimens prepared from the molding materials. The static breaking strengths of the boxes do not correlate with the results of tensile or flexural tests on standard specimens.

  4. Antibodies against molds and mycotoxins following exposure to toxigenic fungi in a water-damaged building.

    PubMed

    Vojdani, Aristo; Campbell, Andrew W; Kashanian, Albert; Vojdani, Elroy

    2003-06-01

    Exposure to molds in water-damaged buildings can cause allergy, asthma, hypersensitivity pneumonitis, mucus membrane irritation, and toxicity--alone or in combination. Despite this, significant emphasis has been placed only on Type I allergy and asthma, but not on the other 3 types of allergies. In this study, we sought to evaluate simultaneous measurements of immunoglobulin (Ig) G, IgM, IgA, and IgE antibodies against the most common molds, and their mycotoxins, cultured from water-damaged buildings. Antibodies against 7 different molds and 2 mycotoxins were determined by enzyme-linked immunosorbent assay (ELISA) in the blood of 40 controls and 40 mold-exposed patients. The IgG antibody levels against all 7 of the molds used, as well as the 2 mycotoxins, were significantly greater in patients than in controls. The IgM antibody levels were significantly different in patients for only 6 of 9 determinations. Regarding IgA determinations, antibodies were elevated significantly against all antigens tested, except Epicoccum. However, the differences in IgE levels in controls and mold-exposed patients were significant only for Aspergillus and satratoxin. These differences implied that, overall, the healthy control group was different from the mold-exposed patients for IgG, IgM, and IgA antibodies, but not for the IgE anti-mold antibody. Most patients with high levels of antibodies against various mold antigens also exhibited elevated antibodies against purified mycotoxins, indicating that the patients had been exposed to mold spores and mycotoxins. Detection of high levels (colony-forming units per cubic meter) of molds--which, in this study, strongly suggested that there existed a reservoir of spores in the building at the time of sampling--along with a significant elevation in IgG, IgM, or IgA antibodies against molds and mycotoxins, could be used in future epidemiologic investigations of fungal exposure. In addition to IgE, measurements of IgG, IgM, and IgA antibodies

  5. Injection Molding and its application to drug delivery.

    PubMed

    Zema, Lucia; Loreti, Giulia; Melocchi, Alice; Maroni, Alessandra; Gazzaniga, Andrea

    2012-05-10

    Injection Molding (IM) consists in the injection, under high pressure conditions, of heat-induced softened materials into a mold cavity where they are shaped. The advantages the technique may offer in the development of drug products concern both production costs (no need for water or other solvents, continuous manufacturing, scalability, patentability) and technological/biopharmaceutical characteristics of the molded items (versatility of the design and composition, possibility of obtaining solid molecular dispersions/solutions of the active ingredient). In this article, process steps and formulation aspects relevant to IM are discussed, with emphasis on the issues and advantages connected with the transfer of this technique from the plastics industry to the production of conventional and controlled-release dosage forms. Moreover, its pharmaceutical applications thus far proposed in the primary literature, intended as either alternative manufacturing strategies for existing products or innovative systems with improved design and performance characteristics, are critically reviewed. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Method of reusably sealing a silicone rubber vacuum bag to a mold for composite manufacture

    NASA Technical Reports Server (NTRS)

    Steinbach, John (Inventor)

    1989-01-01

    A silicone rubber vacuum bag for use in composite article manufacture is reusably sealed to a mold, without mechanical clamping means. The mold-mating portion of the bag is primed with a silicone rubber adhesive, which is cured thereto, and a layer of semiadhesive sealer is applied between the primed mold-mating portion of the bag and the mold.

  7. Foam injection molding of poly(lactic acid) with physical blowing agents

    NASA Astrophysics Data System (ADS)

    Pantani, R.; Sorrentino, A.; Volpe, V.; Titomanlio, G.

    2014-05-01

    Foam injection molding uses environmental friendly blowing agents under high pressure and temperature to produce parts having a cellular core and a compact solid skin (the so-called "structural foam"). The addition of a supercritical gas reduces the part weight and at the same time improves some physical properties of the material through the promotion of a faster crystallization; it also leads to the reduction of both the viscosity and the glass transition temperature of the polymer melt, which therefore can be injection molded adopting lower temperatures and pressures. These aspects are of extreme interest for biodegradable polymers, which often present a very narrow processing window, with the suitable processing temperatures close to the degradation conditions. In this work, foam injection molding was carried out by an instrumented molding machine, able to measure the pressure evolution in different positions along the flow-path. The material adopted was a biodegradable polymer, namely the Poly(lactic acid), PLA. The effect of a physical blowing agent (PBA) on the viscosity was measured. The density reduction and the morphology of parts obtained by different molding conditions was assessed.

  8. Fabricating microfluidic valve master molds in SU-8 photoresist

    NASA Astrophysics Data System (ADS)

    Dy, Aaron J.; Cosmanescu, Alin; Sluka, James; Glazier, James A.; Stupack, Dwayne; Amarie, Dragos

    2014-05-01

    Multilayer soft lithography has become a powerful tool in analytical chemistry, biochemistry, material and life sciences, and medical research. Complex fluidic micro-circuits require reliable components that integrate easily into microchips. We introduce two novel approaches to master mold fabrication for constructing in-line micro-valves using SU-8. Our fabrication techniques enable robust and versatile integration of many lab-on-a-chip functions including filters, mixers, pumps, stream focusing and cell-culture chambers, with in-line valves. SU-8 created more robust valve master molds than the conventional positive photoresists used in multilayer soft lithography, but maintained the advantages of biocompatibility and rapid prototyping. As an example, we used valve master molds made of SU-8 to fabricate PDMS chips capable of precisely controlling beads or cells in solution.

  9. Surface quality of unsaturated polyester resin processed via continuous multi-shot rotational molding

    NASA Astrophysics Data System (ADS)

    Ogila, K. O.; Yang, W.; Shao, M.; Tan, J.

    2017-05-01

    Unsaturated Polyester Resin is a versatile and cost efficient thermosetting plastic whose application in rotational molding is currently limited by its relatively high initial viscosity and heat of reaction. These material characteristics result in uneven material distribution, poor surface finish and imperfections in the moldings especially when large wall thicknesses are required. The current work attempts to remedy these shortcomings through the development of a continuous multi-shot system which adds predetermined loads of unsaturated polyester resin into a rotating mold at various intervals. As part of this system, a laboratory-scale uniaxial rotational molding machine was used to produce Unsaturated Polyester Resin moldings in single and double shots. Optimal processing conditions were determined through visual studies, three dimensional microscopic studies, thickness distribution analysis and Fourier Transform Infrared spectroscopy. Volume filling fractions of 0.049-0.065, second shot volumes of 0.5-0.75 from the first shot, rotational speeds of 15-20 rpm and temperatures of 30-50 °C resulted in moldings of suitable quality on both the inner and outer surfaces.

  10. Long-Term Stability of Mold Compounds and the Influence on Semiconductor Device Reliability

    NASA Astrophysics Data System (ADS)

    Mahler, Joachim; Mengel, Manfred

    2012-07-01

    Lifetimes of semiconductor devices are specified according to the products and their applications to ensure safe operation, for instance as part of an automobile product. The long-term stability of the device is strongly dependent on the chip encapsulation and its adhesion to the chip and substrate. Molded silicon strips that act as a model system for molded chips inside semiconductor devices were investigated. Four commercially available mold compounds were applied on silicon strips and stored over 5 years at room temperature (RT), and changes in the thermomechanical behavior were analyzed. After storage, all molded strips exhibited warpage reduction in the range of 11% to 14% at RT with respect to the initial warpage. The temperatures for the stress-free state also changed during storage and were located between 228°C and 235°C for each mold. Additional stress applied to the stored modules, by temperature cycling as well as high-temperature storage, increased the warpage of the molded silicon samples. For further interpretation of measured results, finite-element method calculations were performed.

  11. Organic materials for ceramic molding processes

    NASA Technical Reports Server (NTRS)

    Saito, K.

    1984-01-01

    Ceramic molding processes are examined. Binders, wetting agents, lubricants, plasticizers, surface active agents, dispersants, etc., for pressing, rubber pressing, sip casting, injection casting, taping, extrusion, etc., are described, together with forming machines.

  12. Two species of myxomycetes causing slime mold of sweet potato.

    PubMed

    Kim, Wan Gyu; Lee, Sang Yeob; Cho, Weon Dae

    2007-06-01

    Specimens collected from sweet potato plants with slime mold symptoms in fields in Daejeon, Korea were examined. Two species of Myxomycetes, Fuligo septica and Stemonitis herbatica were identified based on their morphological characteristics. This is the first report that the two species of Myxomycetes cause slime mold of sweet potato in Korea.

  13. Applications of nanocomposites and woodfiber plastics for microcellular injection molding

    Treesearch

    Lih-Sheng Turng; Mingjun Yuan; Hrishikesh Kharbas; Herman Winata; Daniel F. Caulfield

    2003-01-01

    The paper reviews the processing advantages and challenges of microcellular injection molding and presents recent research results on applications of nanocomposites and woodfiber-plastic composites as well as new process develop for the microcellular injection molding process. In particular, two types of polyamide (PA-6) neat resins and their filled counterparts, such...

  14. Inhibitory effect of essential oils on decay fungi and mold growth on wood

    Treesearch

    Vina W. Yang; Carol A. Clausen

    2007-01-01

    Structural damage and potential health risks caused by wood decay and mold fungi in residential structures have been a major concern for homeowners, building contractors and insurance companies alike. The combined damage from decay fungi and mold claims exceeds several billion US dollars annually. Protection against decay and mold growth on wood is a critical economic...

  15. METHODS TO CLASSIFY ENVIRONMENTAL SAMPLES BASED ON MOLD ANALYSES BY QPCR

    EPA Science Inventory

    Quantitative PCR (QPCR) analysis of molds in indoor environmental samples produces highly accurate speciation and enumeration data. In a number of studies, eighty of the most common or potentially problematic indoor molds were identified and quantified in dust samples from homes...

  16. ANIMAL MODELS OF MOLD ALLERGY

    EPA Science Inventory

    The concept of molds as causative agents for allergy/asthma is not new. In fact many fungal genera have been associated with allergic lung disease, but only a few fungi are well studied and even fewer fungal allergens well characterized. The complexity and variety of fungal pro...

  17. ALLERGIC POTENTIAL OF INDOOR MOLDS

    EPA Science Inventory

    Many fungi have been associated with allergic lung disease, but few are well studied and even fewer allergens of fungal origin are well characterized. Exposure to damp moldy environments has been associated with the exacerbation of asthma, but the role of molds in the induction o...

  18. Structural and compositional analysis of a casting mold sherd from ancient China.

    PubMed

    Zong, Yunbing; Yao, Shengkun; Lang, Jianfeng; Chen, Xuexiang; Fan, Jiadong; Sun, Zhibin; Duan, Xiulan; Li, Nannan; Fang, Hui; Zhou, Guangzhao; Xiao, Tiqiao; Li, Aiguo; Jiang, Huaidong

    2017-01-01

    Casting had symbolic significance and was strictly controlled in the Shang dynasty of ancient China. Vessel casting was mainly distributed around the Shang capital, Yin Ruins, which indicates a rigorous centralization of authority. Thus, for a casting mold to be excavated far from the capital region is rare. In addition to some bronze vessel molds excavated at the Buyao Village site, another key discovery of a bronze vessel mold occurred at Daxinzhuang. The Daxinzhuang site was a core area in the east of Shang state and is an important site to study the eastward expansion of the Shang. Here, combining synchrotron X-rays and other physicochemical analysis methods, nondestructive three-dimensional structure imaging and different elemental analyses were conducted on this mold sherd. Through high penetration X-ray tomography, we obtained insights on the internal structure and discovered some pores. We infer that the generation of pores inside the casting mold sherd was used to enhance air permeability during casting. Furthermore, we suppose that the decorative patterns on the surface were carved and not pasted onto it. Considering the previous compositional studies of bronze vessels, the copper and iron elements were analyzed by different methods. Unexpectedly, a larger amount of iron than of copper was detected on the surface. According to the data analysis and archaeological context, the source of iron on the casting mold sherd could be attributed to local soil contamination. A refined compositional analysis confirms that this casting mold was fabricated locally and used for bronze casting.

  19. Structural and compositional analysis of a casting mold sherd from ancient China

    PubMed Central

    Zong, Yunbing; Yao, Shengkun; Lang, Jianfeng; Chen, Xuexiang; Fan, Jiadong; Sun, Zhibin; Duan, Xiulan; Li, Nannan; Fang, Hui; Zhou, Guangzhao; Xiao, Tiqiao; Li, Aiguo; Jiang, Huaidong

    2017-01-01

    Casting had symbolic significance and was strictly controlled in the Shang dynasty of ancient China. Vessel casting was mainly distributed around the Shang capital, Yin Ruins, which indicates a rigorous centralization of authority. Thus, for a casting mold to be excavated far from the capital region is rare. In addition to some bronze vessel molds excavated at the Buyao Village site, another key discovery of a bronze vessel mold occurred at Daxinzhuang. The Daxinzhuang site was a core area in the east of Shang state and is an important site to study the eastward expansion of the Shang. Here, combining synchrotron X-rays and other physicochemical analysis methods, nondestructive three-dimensional structure imaging and different elemental analyses were conducted on this mold sherd. Through high penetration X-ray tomography, we obtained insights on the internal structure and discovered some pores. We infer that the generation of pores inside the casting mold sherd was used to enhance air permeability during casting. Furthermore, we suppose that the decorative patterns on the surface were carved and not pasted onto it. Considering the previous compositional studies of bronze vessels, the copper and iron elements were analyzed by different methods. Unexpectedly, a larger amount of iron than of copper was detected on the surface. According to the data analysis and archaeological context, the source of iron on the casting mold sherd could be attributed to local soil contamination. A refined compositional analysis confirms that this casting mold was fabricated locally and used for bronze casting. PMID:28296963

  20. Prevalence of Residential Dampness and Mold Exposure in a University Student Population

    PubMed Central

    Lanthier-Veilleux, Mathieu; Généreux, Mélissa; Baron, Geneviève

    2016-01-01

    The impact of residential dampness or mold on respiratory health is well established but few studies have focused on university students. This study aims to: (a) describe the prevalence of exposure to residential dampness or mold in university students according to socio-geographic factors and (b) identify associated housing characteristics. A web survey was conducted in 2014 among the 26,676 students registered at the Université de Sherbrooke (QC, Canada). Residential dampness and mold being closely intertwined, they were considered as a single exposure and assessed using a validated questionnaire. Exposure was compared according to socio-geographic and housing characteristics using chi-square tests and logistic regressions. Among the 2097 participants included in the study (response rate: 8.1%), over 80% were tenants. Residential exposure to dampness or mold was frequent (36.0%, 95% CI: 33.9–38.1). Marked differences for this exposure were noted according to home ownership (39.7% vs. 25.5% among tenants and owners respectively; OR = 1.92%, 95% CI: 1.54–2.38). Campus affiliation, household composition and the number of residents per building were associated with exposure to dampness or mold (p < 0.01), while sex and age were not. Exposure was also associated with older buildings, and buildings in need of renovations and lacking proper ventilation (p < 0.001). This study highlights the potential risk of university students suffering from mold-related health effects given their frequent exposure to this agent. Further research is needed to fully evaluate the mold-related health impact in this at risk group. PMID:26861364

  1. Is Mold Toxicity Really a Problem for Our Patients? Part 2—Nonrespiratory Conditions

    PubMed Central

    Pizzorno, Joseph; Shippy, Ann

    2016-01-01

    In my last editorial, I addressed the respiratory effects of mold exposure. The surprising research shows that as many as 50% of residential and work environments have water damage1 and that mold toxicity should be considered in all patients with any chronic respiratory condition. This is especially true in adult-onset asthma, two-thirds of which appears to be caused by toxins released from water-damaged buildings. The carcinogenic effects of food-borne mold contamination are also well documented. Less clear is the role of indoor mold exposure in water-damaged buildings and its relationship to nonrespiratory conditions. As we look at the research on mold toxicity and toxins in general, we propose that the medical community (by all its names) has focused too much on the “yellow canaries” and missed the big picture that toxins have now become a primary driver of disease in the general population, not only among those most susceptible. The mold toxicity conundrum illustrates this issue quite well. As summarized in this editorial, there clearly is a portion of the population, the size of which is currently unknown, who experience neurological and/or immunological damage from mold toxicity. In addition, a substantial portion of the population experiences chronic respiratory problems from mold exposure. This does not mean we should stop paying attention to our more affected patients. Rather, we need to realize that almost everyone is being affected by toxins to some degree: molds, metals, solvents, persistent organic pollutants, etc. PMID:27547160

  2. The Design of 3D-Printed Lattice-Reinforced Thickness-Varying Shell Molds for Castings

    PubMed Central

    Shangguan, Haolong; Kang, Jinwu; Yi, Jihao; Zhang, Xiaochuan; Wang, Xiang; Wang, Haibin; Huang, Tao

    2018-01-01

    3D printing technologies have been used gradually for the fabrication of sand molds and cores for castings, even though these molds and cores are dense structures. In this paper, a generation method for lattice-reinforced thickness-varying shell molds is proposed and presented. The first step is the discretization of the STL (Stereo Lithography) model of a casting into finite difference meshes. After this, a shell is formed by surrounding the casting with varying thickness, which is roughly proportional to the surface temperature distribution of the casting that is acquired by virtually cooling it in the environment. A regular lattice is subsequently constructed to support the shell. The outside surface of the shell and lattice in the cubic mesh format is then converted to STL format to serve as the external surface of the new shell mold. The internal surface of the new mold is the casting’s surface with the normals of all of the triangles in STL format reversed. Experimental verification was performed on an Al alloy wheel hub casting. Its lattice-reinforced thickness-varying shell mold was generated by the proposed method and fabricated by the binder jetting 3D printing. The poured wheel hub casting was sound and of good surface smoothness. The cooling rate of the wheel hub casting was greatly increased due to the shell mold structure. This lattice-reinforced thickness-varying shell mold generation method is of great significance for mold design for castings to achieve cooling control. PMID:29601543

  3. High Temperature Transfer Molding Resins

    NASA Technical Reports Server (NTRS)

    Connell, John W. (Inventor); Smith, Joseph G., Jr. (Inventor); Hergenrother, Paul M. (Inventor)

    2000-01-01

    High temperature resins containing phenylethynyl groups that are processable by transfer molding have been prepared. These phenylethynyl containing oligomers were prepared from aromatic diamines containing phenylethynyl groups and various ratios of phthalic anhydride and 4-phenylethynlphthalic anhydride in glacial acetic acid to form a mixture of imide compounds in one step. This synthetic approach is advantageous since the products are a mixture of compounds and consequently exhibit a relatively low melting temperature. In addition, these materials exhibit low melt viscosities which are stable for several hours at 210-275 C, and since the thermal reaction of the phenylethynyl group does not occur to any appreciable extent at temperatures below 300 C, these materials have a broad processing window. Upon thermal cure at approximately 300-350 C, the phenylethynyl groups react to provide a crosslinked resin system. These new materials exhibit excellent properties and are potentially useful as adhesives, coatings, films, moldings and composite matrices.

  4. Process for Making Ceramic Mold

    NASA Technical Reports Server (NTRS)

    Buck, Gregory M. (Inventor); Vasquez, Peter (Inventor)

    2001-01-01

    An improved process for slip casting molds that can be more economically automated and that also exhibits greater dimensional stability is disclosed. The process involves subjecting an investment pattern, preferably made from wax, to successive cycles of wet-dipping in a slurry of colloidal, silica-based binder and dry powder-coating, or stuccoing with plaster of Paris or calcium sulfate mixtures to produce a multi-layer shell over the pattern. The invention as claimed entails applying a primary and a secondary coating to the investment pattern. At least two wet-dipping on in a primary slurry and dry-stuccoing cycles provide the primary coating, and an additional two wet-dippings and dry-stuccoing cycles provide the secondary, or back-up, coating. The primary and secondary coatings produce a multi-layered shell pattern. The multi-layered shell pattern is placed in a furnace first to cure and harden, and then to vaporize the investment pattern, leaving a detailed, high precision shell mold.

  5. Occurrence of Fuligo gyrosa Causing Slime Mold of Oriental Melon.

    PubMed

    Kim, Wan Gyu; Choi, Hyo Won; Hong, Sung Kee; Lee, Young Kee; Lee, Su Heon

    2009-09-01

    Recently, a severe slime mold infestation affected oriental melon plants in fields in Chilgok county, Gyeongbuk province, Korea. Specimens were collected from the fields and examined for identification. A species of Myxomycetes, Fuligo gyrosa, was identified based on its morphological characteristics. This is the first report that F. gyrosa causes slime mold of oriental melon.

  6. Two Species of Myxomycetes Causing Slime Mold of Sweet Potato

    PubMed Central

    Lee, Sang Yeob; Cho, Weon Dae

    2007-01-01

    Specimens collected from sweet potato plants with slime mold symptoms in fields in Daejeon, Korea were examined. Two species of Myxomycetes, Fuligo septica and Stemonitis herbatica were identified based on their morphological characteristics. This is the first report that the two species of Myxomycetes cause slime mold of sweet potato in Korea. PMID:24015079

  7. DAMAGE MODELING OF INJECTION-MOLDED SHORT- AND LONG-FIBER THERMOPLASTICS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nguyen, Ba Nghiep; Kunc, Vlastimil; Bapanapalli, Satish K.

    2009-10-30

    This article applies the recent anisotropic rotary diffusion – reduced strain closure (ARD-RSC) model for predicting fiber orientation and a new damage model for injection-molded long-fiber thermoplastics (LFTs) to analyze progressive damage leading to total failure of injection-molded long-glass-fiber/polypropylene (PP) specimens. The ARD-RSC model was implemented in a research version of the Autodesk Moldflow Plastics Insight (MPI) processing code, and it has been used to simulate injection-molding of a long-glass-fiber/PP plaque. The damage model combines micromechanical modeling with a continuum damage mechanics description to predict the nonlinear behavior due to plasticity coupled with damage in LFTs. This model has beenmore » implemented in the ABAQUS finite element code via user-subroutines and has been used in the damage analyses of tensile specimens removed from the injection-molded long-glass-fiber/PP plaques. Experimental characterization and mechanical testing were performed to provide input data to support and validate both process modeling and damage analyses. The predictions are in agreement with the experimental results.« less

  8. Effects of process parameters on the molding quality of the micro-needle array

    NASA Astrophysics Data System (ADS)

    Qiu, Z. J.; Ma, Z.; Gao, S.

    2016-07-01

    Micro-needle array, which is used in medical applications, is a kind of typical injection molded products with microstructures. Due to its tiny micro-features size and high aspect ratios, it is more likely to produce short shots defects, leading to poor molding quality. The injection molding process of the micro-needle array was studied in this paper to find the effects of the process parameters on the molding quality of the micro-needle array and to provide theoretical guidance for practical production of high-quality products. With the shrinkage ratio and warpage of micro needles as the evaluation indices of the molding quality, the orthogonal experiment was conducted and the analysis of variance was carried out. According to the results, the contribution rates were calculated to determine the influence of various process parameters on molding quality. The single parameter method was used to analyse the main process parameter. It was found that the contribution rate of the holding pressure on shrinkage ratio and warpage reached 83.55% and 94.71% respectively, far higher than that of the other parameters. The study revealed that the holding pressure is the main factor which affects the molding quality of micro-needle array so that it should be focused on in order to obtain plastic parts with high quality in the practical production.

  9. Precision molding of advanced glass optics: innovative production technology for lens arrays and free form optics

    NASA Astrophysics Data System (ADS)

    Pongs, Guido; Bresseler, Bernd; Bergs, Thomas; Menke, Gert

    2012-10-01

    Today isothermal precision molding of imaging glass optics has become a widely applied and integrated production technology in the optical industry. Especially in consumer electronics (e.g. digital cameras, mobile phones, Blu-ray) a lot of optical systems contain rotationally symmetrical aspherical lenses produced by precision glass molding. But due to higher demands on complexity and miniaturization of optical elements the established process chain for precision glass molding is not sufficient enough. Wafer based molding processes for glass optics manufacturing become more and more interesting for mobile phone applications. Also cylindrical lens arrays can be used in high power laser systems. The usage of unsymmetrical free-form optics allows an increase of efficiency in optical laser systems. Aixtooling is working on different aspects in the fields of mold manufacturing technologies and molding processes for extremely high complex optical components. In terms of array molding technologies, Aixtooling has developed a manufacturing technology for the ultra-precision machining of carbide molds together with European partners. The development covers the machining of multi lens arrays as well as cylindrical lens arrays. The biggest challenge is the molding of complex free-form optics having no symmetrical axis. A comprehensive CAD/CAM data management along the entire process chain is essential to reach high accuracies on the molded lenses. Within a national funded project Aixtooling is working on a consistent data handling procedure in the process chain for precision molding of free-form optics.

  10. Effect of mold diameter on the depth of cure of a resin-based composite material.

    PubMed

    Erickson, Robert L; Barkmeier, Wayne W

    2017-02-01

    The purpose of this study was to examine the effect of mold diameter on depth of cure of a resin-based composite material for varying amounts of irradiation. A resin-based composite was light-cured for 10-80 s in stainless-steel molds of either 6 mm or 4 mm in diameter and then dark-stored for 24 h. Specimens were then scraped back and the length of the cured specimens was measured to provide depth of cure (D SB ). Radiant exposure to each of the mold diameters was determined by measuring the power. The D SB values using the 4-mm molds were lower than those of the 6-mm molds. The average difference between the two groups for each irradiation time was 0.45 ± 0.02 mm. A fixed depth of cure required about 39% more irradiation time for the 4-mm mold than for the 6-mm mold but 75% more radiant exposure. The difference in cure depth for a fixed radiant exposure was 0.79 mm. A better comparison of depth of cure is obtained by using identical radiant exposures for different mold diameters. It is believed that greater loss of light by absorption at the stainless-steel cylinder walls for the 4-mm-diameter cylinders accounts for the lower depth of cure when compared with the 6-mm molds. © 2017 Eur J Oral Sci.

  11. Developing quartz wafer mold manufacturing process for patterned media

    NASA Astrophysics Data System (ADS)

    Chiba, Tsuyoshi; Fukuda, Masaharu; Ishikawa, Mikio; Itoh, Kimio; Kurihara, Masaaki; Hoga, Morihisa

    2009-04-01

    Recently, patterned media have gained attention as a possible candidate for use in the next generation of hard disk drives (HDD). Feature sizes on media are predicted to be 20-25 nm half pitch (hp) for discrete-track media in 2010. One method of fabricating such a fine pattern is by using a nanoimprint. The imprint mold for the patterned media is created from a 150-millimeter, rounded, quartz wafer. The purpose of the process introduced here was to construct a quartz wafer mold and to fabricate line and space (LS) patterns at 24 nmhp for DTM. Additionally, we attempted to achieve a dense hole (HOLE) pattern at 12.5 nmhp for BPM for use in 2012. The manufacturing process of molds for patterned media is almost the same as that for semiconductors, with the exception of the dry-etching process. A 150-millimeter quartz wafer was etched on a special tray made from carving a 6025 substrate, by using the photo-mask tool. We also optimized the quartz etching conditions. As a result, 24 nmhp LS and HOLE patterns were manufactured on the quartz wafer. In conclusion, the quartz wafer mold manufacturing process was established. It is suggested that the etching condition should be further optimized to achieve a higher resolution of HOLE patterns.

  12. Populations of some molds in water-damaged homes may ...

    EPA Pesticide Factsheets

    Starting in the 1940s, gypsum drywall began replacing plaster and lathe in the U.S. home construction industry. Our goal was to evaluate whether some mold populations differ in water- damaged homes primarily constructed with gypsum drywall compared to plaster. The dust samples from the 2006 Department of Housing and Urban Development's (HUD) American Health Homes Survey (AHHS) were the subject of this analysis. The concentrations of the 36 Environmental Relative Moldiness Index (ERMI) molds were compared in homes of different ages. The homes (n = 301) were built between 1878 and 2005. Homes with ERMI values > 5 (n = 126) were defined as water-damaged. Homes with ERMI values > 5 were divided in the years 1976 to 1977 into two groups, i.e., older (n = 61) and newer (n = 65). Newer water-damaged homes had significantly (p = 0.002) higher mean ERMI values than older water-damaged homes, 11.18 and 8.86, respectively. The Group 1 molds Aspergillus flavus, Ammophilus fumigatus, Aspergillus ochraceus, Cladosporium sphaerospermum and Trichoderma viride were found in significantly higher concentrations in newer compared to older high-ERMI homes. Some mold populations in water-damaged homes may have changed after the introduction of gypsum drywall. This research provides insight into the asthma epidemic in the US.

  13. Occurrence of Fuligo gyrosa Causing Slime Mold of Oriental Melon

    PubMed Central

    Choi, Hyo Won; Hong, Sung Kee; Lee, Young Kee; Lee, Su Heon

    2009-01-01

    Recently, a severe slime mold infestation affected oriental melon plants in fields in Chilgok county, Gyeongbuk province, Korea. Specimens were collected from the fields and examined for identification. A species of Myxomycetes, Fuligo gyrosa, was identified based on its morphological characteristics. This is the first report that F. gyrosa causes slime mold of oriental melon. PMID:23983540

  14. 42. PRESSING A SLAB OF CLAY ONTO A MOSAIC MOLD. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    42. PRESSING A SLAB OF CLAY ONTO A MOSAIC MOLD. THE MOLD, WHICH HAS A RAISED DESIGN, LEAVES AND OUTLINE IN THE SLAB, THE PIECES THUS DEFINED, ARE THEN CUT APART TO BE FIRED SEPARATELY AND REASSEMBLED. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  15. New methods and materials for molding and casting ice formations

    NASA Technical Reports Server (NTRS)

    Reehorst, Andrew L.; Richter, G. Paul

    1987-01-01

    This study was designed to find improved materials and techniques for molding and casting natural or simulated ice shapes that could replace the wax and plaster method. By utilizing modern molding and casting materials and techniques, a new methodology was developed that provides excellent reproduction, low-temperature capability, and reasonable turnaround time. The resulting casts are accurate and tough.

  16. 18. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON GREY IRON UNIT NO. 1 MOLD CONVEYOR WITH MOLTEN IRON FROM MOBILE LADLES AS THEY STAND ON WHAT USED TO BE A PLATFORM MOVING AT THE SAME RATE OF SPEED AS THE CONVEYOR. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  17. Development of processes and techniques for molding thermally stable, fire-retardant, low-smoke-emitting polymeric materials

    NASA Technical Reports Server (NTRS)

    Silverman, B.

    1979-01-01

    All available newly developed nonmetallic thermally stable polymers were examined for the development of processes and techniques by compression molding, injection molding, or thermoforming cabin interior parts. Efforts were directed toward developing molding techniques of new polymers to economically produce usable nonmetallic molded parts. Data on the flame resistant characteristics of the materials were generated from pilot plant batches. Preliminary information on the molding characteristics of the various thermoplastic materials was obtained by producing actual parts.

  18. The newborn butterfly project: a shortened treatment protocol for ear molding.

    PubMed

    Doft, Melissa A; Goodkind, Alison B; Diamond, Shawn; DiPace, Jennifer I; Kacker, Ashutosh; LaBruna, Anthony N

    2015-03-01

    Secondary to circulating maternal estrogens, a baby's ear cartilage is unusually plastic during the first few weeks of life, providing an opportunity to correct ear deformities by molding. If molding is initiated during the first days of life with a more rigid molding system than previously described in the literature, the authors hypothesized that treatment time would be reduced and the correction rate would increase. An interdisciplinary team identified and assessed all infants born with ear deformities at New York-Presbyterian Hospital/Weill Cornell Medical Center. The authors conducted a prospective, institutional review board-approved study on the first consecutive 100 infants identified. Parents were surveyed initially, immediately after treatment, and at 6 and 12 months. One hundred fifty-eight ears in 96 patients underwent ear molding using the EarWell Infant Ear Correction System. Eighty-two percent of the children had the device placed in the newborn nursery and 95 percent had it placed before 2 weeks of life. Average treatment time was 14 days, and 96 percent of the deformities were corrected. Complications were limited to mild pressure ulcerations. Ninety-nine percent of parents stated that they would have the procedure repeated. The molding period can be reduced from 6 to 8 weeks to 2 weeks by initiating molding during the first weeks of life and using a more secure and rigid device. Through an interdisciplinary approach, the authors were able to identify patients and to correct the deformity earlier and faster than has been previously published, eliminating the need for surgical correction in many children. Therapeutic, IV.

  19. Characterization of curing behavior of UV-curable LSR for LED embedded injection mold

    NASA Astrophysics Data System (ADS)

    Tae, Joon-Sung; Yim, Kyung-Gyu; Rhee, Byung-Ohk; Kwak, Jae B.

    2016-11-01

    For many applications, liquid silicone rubber (LSR) injection molding is widely used for their great design flexibility and high productivity. In particular, a sealing part for a mobile device such as smartphone and watch has been produced by injection molding. While thermally curable LSR causes deformation problem due to a high mold temperature, UV-curable LSR can be molded at room temperature, which has advantages for over-molding with inserts of temperature-sensitive materials. Ultraviolet light-emitting diodes (UV LEDs) have advantages such as a longer service life, a lower heat dissipation, and smaller size to equip into the mold than conventional halogen or mercury UV lamps. In this work, rheological behavior of UV-curable LSR during curing process was analyzed by UV LEDs available in the market. UV-LEDs of various wave lengths and intensities were tested. The steady shear test was applied to find the starting time of curing and the SAOS was applied to find the ending time of curing to estimate processing time. In addition, the hardness change with irradiation energy was compared with the rheological data to confirm the reliability of the rheological test.

  20. Processing study of injection molding of silicon nitride for engine applications

    NASA Technical Reports Server (NTRS)

    Rorabaugh, M. E.; Yeh, H. C.

    1985-01-01

    The high hardness of silicon nitride, which is currently under consideration as a structural material for such hot engine components as turbine blades, renders machining of the material prohibitively costly; the near net shape forming technique of injection molding is accordingly favored as a means for component fabrication. Attention is presently given to the relationships between injection molding processing parameters and the resulting microstructural and mechanical properties of the resulting engine parts. An experimental program has been conducted under NASA sponsorship which tests the quality of injection molded bars of silicon nitride at various stages of processing.

  1. Custom molded thermal MRg-FUS phantom

    NASA Astrophysics Data System (ADS)

    Eames, Matthew D. C.; Snell, John W.; Hananel, Arik; Kassell, Neal F.

    2012-11-01

    This article describes a method for creating custom-molded thermal phantoms for use with MR-guided focused ultrasound systems. The method is defined here for intracranial applications, though it may be modified for other anatomical targets.

  2. Development of a PCR protocol to detect aflatoxigenic molds in food products.

    PubMed

    Luque, M Isabel; Rodríguez, Alicia; Andrade, María J; Martín, Alberto; Córdoba, Juan J

    2012-01-01

    Aflatoxins are secondary metabolites produced mainly by Aspergillus species growing in foodstuffs. Because aflatoxins have important health effects, the detection of early contamination of foods by aflatoxigenic molds should be useful. In the present work, a reliable conventional PCR method for detecting aflatoxigenic molds of various species was developed. Fifty-six aflatoxigenic and nonaflatoxigenic strains commonly reported in foodstuffs were tested. Aflatoxin production was first confirmed by micellar electrokinetic capillary electrophoresis or/and high-pressure liquid chromatography-mass spectrometry. Based on the conserved regions of the O-methyltransferase gene (omt-1) involved in the aflatoxin biosynthetic pathway, six primer pairs were designed. With only the designed primer pair AFF1-AFR3, the expected PCR product (381 bp) was obtained in all of the tested aflatoxigenic strains of various species and genera. Amplification products were not obtained with this primer pair for any of the nonaflatoxigenic reference molds. However, an amplicon of 453 bp was obtained for all aflatoxigenic and nonaflatoxigenic mold reference strains with a PCR protocol based on the constitutive fungal β-tubulin gene, which was used as a positive fungal control. The PCR protocol based on omt-1 detected as little as 15 pg of DNA from aflatoxigenic molds and 10(2) to 10(3) CFU/g in contaminated food samples. This PCR protocol should be used as a routine technique to detect aflatoxigenic molds in foods.

  3. Analysis of Deformation and Equivalent Stress during Biomass Material Compression Molding

    NASA Astrophysics Data System (ADS)

    Xu, Guiying; Wei, Hetao; Zhang, Zhien; Yu, Shaohui; Wang, Congzhe; Huang, Guowen

    2018-02-01

    Ansys is adopted to analyze mold deformation and stress field distribution rule during the process of compressing biomass under pressure of 20Mpa. By means of unit selection, material property setting, mesh partition, contact pair establishment, load and constraint applying, and solver setting, the stress and strain of overall mold are analyzed. Deformation and equivalent Stress of compression structure, base, mold, and compression bar were analyzed. We can have conclusions: The distribution of stress forced on compressor is not completely uniform, where the stress at base is slightly decreased; the stress and strain of compression bar is the largest, and stress concentration my occur at top of compression bar, which goes against compression bar service life; the overall deformation of main mold is smaller; although there is slight difference between upper and lower part, the overall variation is not obvious, but the stress difference between upper and lower part of main mold is extremely large so that reaches to 10 times; the stress and strain in base decrease in circular shape, but there is still stress concentration in ledge, which goes against service life; contact stress does not distribute uniformly, there is increasing or decreasing trend in adjacent parts, which is very large in some parts. in constructing both.

  4. Lost Mold Rapid Infiltration Forming of Mesoscale Ceramics: Part 1, Fabrication

    PubMed Central

    Antolino, Nicholas E.; Hayes, Gregory; Kirkpatrick, Rebecca; Muhlstein, Christopher L.; Frecker, Mary I.; Mockensturm, Eric M.; Adair, James H.

    2009-01-01

    Free-standing mesoscale (340 μm × 30 μm × 20 μm) bend bars with an aspect ratio over 15:1 and an edge resolution as fine as a single grain diameter (∼400 nm) have been fabricated in large numbers on refractory ceramic substrates by combining a novel powder processing approach with photoresist molds and an innovative lost-mold thermal process. The colloid and interfacial chemistry of the nanoscale zirconia particulates has been modeled and used to prepare highly concentrated suspensions. Engineering solutions to challenges in mold fabrication and casting have yielded free-standing, crack-free parts. Molds are fabricated using high-aspect-ratio photoresist on ceramic substrates. Green parts are formed using a rapid infiltration method that exploits the shear thinning behavior of the highly concentrated ceramic suspension in combination with gelcasting. The mold is thermally decomposed and the parts are sintered in place on the ceramic substrate. Chemically aided attrition milling disperses and concentrates the as-received 3Y-TZP powder to produce a dense, fine-grained sintered microstructure. Initial three-point bend strength data are comparable to that of conventional zirconia; however, geometric irregularities (e.g., trapezoidal cross sections) are present in this first generation and are discussed with respect to the distribution of bend strength. PMID:19809595

  5. Viscoelastic properties of chalcogenide glasses and the simulation of their molding processes

    NASA Astrophysics Data System (ADS)

    Liu, Weiguo; Shen, Ping; Jin, Na

    In order to simulate the precision molding process, the viscoelastic properties of chalcogenide glasses under high temperatures were investigated. Thermomechanical analysis were performed to measure and analysis the thermomechanical properties of chalcogenide glasses. The creep responses of the glasses at different temperatures were obtained. Finite element analysis was applied for the simulation of the molding processes. The simulation results were in consistence with previously reported experiment results. Stress concentration and evolution during the molding processes was also described with the simulation results.

  6. Nonsteroidal Anti-inflammatory Drugs (NSAIDS) Inhibit the Growth and Reproduction of Chaetomium globosum and Other Fungi Associated with Water-Damaged Buildings.

    PubMed

    Dalmont, Kelsey; Biles, Charles L; Konsure, Heather; Dahal, Sujita; Rowsey, Tyler; Broge, Matthew; Poudyal, Shubhra; Gurung, Tara; Shrestha, Sabina; Biles, Caleb L; Cluck, Terry; Howard, Alisha

    2017-12-01

    Indoor mold due to water damage causes serious human respiratory disorders, and the remediation to homes, schools, and businesses is a major expense. Prevention of mold infestation of building materials would reduce health problems and building remediation costs. Nonsteroidal anti-inflammatory drugs (NSAIDs) inhibit yeasts and a limited number of filamentous fungi. The purpose of this research was to determine the possible inhibitory activity of nonsteroidal anti-inflammatory drugs (NSAIDs) on germination, fungal growth, and reproduction of Chaetomium globosum and other important filamentous fungi that occur in water-damaged buildings. Several NSAIDs were found to inhibit C. globosum germination, growth, and reproduction. The most effective NSAIDs inhibiting C. globosum were ibuprofen, diflunisal, and diclofenac. Fusarium oxysporum, Fusarium solani, Aspergillus niger, and Stachybotrys atra were also tested on the various media with similar results obtained. However, F. oxysporum and A. niger exhibited a higher level of resistance to aspirin and NaSAL when compared to the C. globosum isolates. The inhibition exhibited by NSAIDs was variable depending on growth media and stage of fungal development. These compounds have a great potential of inhibiting fungal growth on building materials such as gypsum board. Formulations of sprays or building materials with NSAID-like chemical treatments may hold promise in reducing mold in homes and buildings.

  7. 49 CFR 173.221 - Polymeric beads, expandable and Plastic molding compound.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 2 2011-10-01 2011-10-01 false Polymeric beads, expandable and Plastic molding... Than Class 1 and Class 7 § 173.221 Polymeric beads, expandable and Plastic molding compound. (a) Non-bulk shipments of Polymeric beads (or granules), expandable, evolving flammable vapor and Plastic...

  8. 49 CFR 173.221 - Polymeric beads, expandable and Plastic molding compound.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Polymeric beads, expandable and Plastic molding... Than Class 1 and Class 7 § 173.221 Polymeric beads, expandable and Plastic molding compound. (a) Non-bulk shipments of Polymeric beads (or granules), expandable, evolving flammable vapor and Plastic...

  9. 49 CFR 173.221 - Polymeric beads, expandable and Plastic molding compound.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 2 2012-10-01 2012-10-01 false Polymeric beads, expandable and Plastic molding... Than Class 1 and Class 7 § 173.221 Polymeric beads, expandable and Plastic molding compound. (a) Non-bulk shipments of Polymeric beads (or granules), expandable, evolving flammable vapor and Plastic...

  10. 49 CFR 173.221 - Polymeric beads, expandable and Plastic molding compound.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 2 2014-10-01 2014-10-01 false Polymeric beads, expandable and Plastic molding... Than Class 1 and Class 7 § 173.221 Polymeric beads, expandable and Plastic molding compound. (a) Non-bulk shipments of Polymeric beads (or granules), expandable evolving flammable vapor and Plastic...

  11. 49 CFR 173.221 - Polymeric beads, expandable and Plastic molding compound.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 2 2013-10-01 2013-10-01 false Polymeric beads, expandable and Plastic molding... Than Class 1 and Class 7 § 173.221 Polymeric beads, expandable and Plastic molding compound. (a) Non-bulk shipments of Polymeric beads (or granules), expandable evolving flammable vapor and Plastic...

  12. QUANTITATIVE PCR ANALYSIS OF HOUSE DUST CAN REVEAL ABNORMAL MOLD CONDITIONS

    EPA Science Inventory

    Indoor mold populations were measured in the dust of homes in Cleveland and Cincinnati, OH, by quantitative PCR (QPCR) and, in Cincinnati, also by culturing. QPCR assays for 82 species (or groups of species) were used to identify and quantify indoor mold populations in moldy home...

  13. Atomic layer deposition as pore diameter adjustment tool for nanoporous aluminum oxide injection molding masks.

    PubMed

    Miikkulainen, Ville; Rasilainen, Tiina; Puukilainen, Esa; Suvanto, Mika; Pakkanen, Tapani A

    2008-05-06

    The wetting properties of polypropylene (PP) surfaces were modified by adjusting the dimensions of the surface nanostructure. The nanostructures were generated by injection molding with nanoporous anodized aluminum oxide (AAO) as the mold insert. Atomic layer deposition (ALD) of molybdenum nitride film was used to control the pore diameters of the AAO inserts. The original 50-nm pore diameter of AAO was adjusted by depositing films of thickness 5, 10, and 15 nm on AAO. Bis(tert-butylimido)-bis(dimethylamido)molybdenum and ammonia were used as precursors in deposition. The resulting pore diameters in the nitride-coated AAO inserts were 40, 30, and 20 nm, respectively. Injection molding of PP was conducted with the coated inserts, as well as with the non-coated insert. Besides the pore diameter, the injection mold temperature was varied with temperatures of 50, 70, and 90 degrees C tested. Water contact angles of PP casts were measured and compared with theoretical contact angles calculated from Wenzel and Cassie-Baxter theories. The highest contact angle, 140 degrees , was observed for PP molded with the AAO mold insert with 30-nm pore diameter. The Cassie-Baxter theory showed better fit than the Wenzel theory to the experimental values. With the optimal AAO mask, the nanofeatures in the molded PP pieces were 100 nm high. In explanation of this finding, it is suggested that some sticking and stretching of the nanofeatures occurs during the molding. Increase in the mold temperature increased the contact angle.

  14. Performance Characteristics of Borate Fatty Acid Formulations as Mold Inhibitors

    Treesearch

    Robert D. Coleman; Vina Yang; Carol A. Clausen

    2013-01-01

    The combination of boric acid (BA) or disodium octaborate tetrahydrate (DOT) and a fatty acid (FA) such as heptanoic, octanoic, and nonanoic acids (C7–C9) is an effective treatment solution for protecting wood structures against mold. BA or DOT alone have substantial potency against insects and decay fungi, but have negligible or no mold inhibitor activity. However,...

  15. Influence of melt mixer on injection molding of thermoset elastomers

    NASA Astrophysics Data System (ADS)

    Rochman, Arif; Zahra, Keith

    2016-10-01

    One of the drawbacks in injection molding is that the plasticizing screw is short such that polymers having high concentrations of additives, such as thermoset elastomers, might not mix homogeneously within the short period of time during the plasticizing stage. In this study, various melt mixers inside the nozzle chamber, together forming a mixing nozzle, were developed. Three different materials were investigated, namely nitrile butadiene rubber (NBR), ethylene propylene-diene monomer (EPDM) and fluorocarbon (FKM). The use of these melt mixers resulted in better homogeneity and properties of the molded parts despite a curing time reduction of 10 s. This was due to the increase in mixing and shearing introduced a higher rate of crosslinking formation in the molded parts.

  16. EFFECT OF TETRACYCLINES ON THE INTRACELLULAR AMINO ACIDS OF MOLDS

    PubMed Central

    Freeman, Bob A.; Circo, Richard

    1963-01-01

    Freeman, Bob A. (University of Chicago, Chicago, Ill.) and Richard Circo. Effect of tetracyclines on the intracellular amino acids of molds. J. Bacteriol. 86:38–44. 1963.—The tetracycline antibiotics were shown to alter the amino acid metabolism of molds whose growth is not markedly affected. Eight molds were grown in the presence of these antiobiotics; four exhibited a general reduction in the concentration of the intracellular amino acids, except for glutamic acid and alanine. In most of these four cultures, the tetracyclines also caused the complete disappearance of arginine, lysine, proline, phenylalanine, and tyrosine from the intracellular amino acid pool. The significance of these observations and the usefulness of the method in the study of the mechanisms of antibiotic action are discussed. PMID:14051820

  17. Molding of strength testing samples using modern PDCPD material for purpose of automotive industry

    NASA Astrophysics Data System (ADS)

    Grabowski, L.; Baier, A.; Sobek, M.

    2017-08-01

    The casting of metal materials is widely known but the molding of composite polymer materials is not well-known method still. The initial choice of method for producing composite bodies was the method of casting of PDCPD material. For purpose of performing casting of polymer composite material, a special mold was made. Firstly, the 3D printed, using PLA material, mold was used. After several attempts of casting PDCPD many problems were encountered. The second step was to use mold milled from a firm and dense isocyanate foam. After several attempts research shown that this solution is more resistant to high-temperature peak, but this material is too fragile to use it several times. This solution also prevents mold from using external heating, which can be necessary for performing correct molding process. The last process was to use the aluminum mold, which is dedicated to PDCPD polymer composite, because of low adhesiveness. This solution leads to perform correct PDCPD polymer composite material injection. After performing casting operation every PDCPD testing samples were tested. These results were compared together. The result of performed work was to archive correct properties of injection of composite material. Research and results were described in detail in this paper.

  18. 40 CFR 63.5728 - What standards must I meet for closed molding resin operations?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... operation does not meet the definition of closed molding, then you must comply with the limit for open... molding operation must comply with the limit for open molding resin and gel coat operations specified in § 63.5698. Examples of these operations include gel coat or skin coat layers that are applied before...

  19. An unusual case of anaphylaxis. Mold in pancake mix.

    PubMed

    Bennett, A T; Collins, K A

    2001-09-01

    Anaphylactic reactions involve contact with an antigen that evokes an immune reaction that is harmful. This type of reaction is a rapidly developing immunologic reaction termed a type I hypersensitivity reaction. The antigen complexes with an IgE antibody that is bound to mast cells and basophils in a previously sensitized individual. Upon re-exposure, vasoactive and spasmogenic substances are released that act on vessels and smooth muscle. The reaction can be local or systemic and may be fatal. The authors report the death of a 19-year-old white male who had a history of "multiple allergies," including pets, molds, and penicillin. One morning, he and his friends made pancakes with a packaged mix that had been opened and in the cabinet for approximately 2 years. The friends stopped eating the pancakes because they said that they tasted like "rubbing alcohol." The decedent continued to eat the pancakes and suddenly became short of breath. He was taken to a nearby clinic, where he became unresponsive and died. At autopsy, laryngeal edema and hyperinflated lungs with mucous plugging were identified. Microscopically, edema and numerous degranulating mast cells were identified in the larynx. The smaller airways contained mucus, and findings of chronic asthma were noted. Serum tryptase was elevated at 14.0 ng/ml. The pancake mix was analyzed and found to contain a total mold count of 700/g of mix as follows: Penicillium, Fusarium, Mucor, and Aspergillus. Witness statements indicate that the decedent ate two pancakes; thus he consumed an approximate mold count of 21,000. The decedent had a history of allergies to molds and penicillin, and thus was allergic to the molds in the pancake mix. The authors present this unusual case of anaphylaxis and a review of the literature.

  20. An apparatus for in situ x-ray scattering measurements during polymer injection molding.

    PubMed

    Rendon, Stanley; Fang, Jun; Burghardt, Wesley R; Bubeck, Robert A

    2009-04-01

    We report a novel instrument for synchrotron-based in situ x-ray scattering measurements during injection molding processing. It allows direct, real-time monitoring of molecular-scale structural evolution in polymer materials undergoing a complex processing operation. The instrument is based on a laboratory-scale injection molding machine, and employs customized mold tools designed to allow x-ray access during mold filling and subsequent solidification, while providing sufficient robustness to withstand high injection pressures. The use of high energy, high flux synchrotron radiation, and a fast detector allows sufficiently rapid data acquisition to resolve time-dependent orientation dynamics in this transient process. Simultaneous monitoring of temperature and pressure signals allows transient scattering data to be referenced to various stages of the injection molding cycle. Representative data on a commercial liquid crystalline polymer, Vectra(R) B950, are presented to demonstrate the features of this apparatus; however, it may find application in a wide range of polymeric materials such as nanocomposites, semicrystalline polymers and fiber-reinforced thermoplastics.