Science.gov

Sample records for mold stachybotrys chartarum

  1. Indoor Mold, Toxigenic Fungi, and Stachybotrys chartarum: Infectious Disease Perspective

    PubMed Central

    Kuhn, D. M.; Ghannoum, M. A.

    2003-01-01

    Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors. PMID:12525430

  2. Facts about Stachybotrys chartarum and Other Molds

    MedlinePlus

    ... Program in Brief Related Issues Resources Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ... be removed. Â Top of Page Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ...

  3. ELISA MEASUREMENT OF STACHYLYSIN IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Problem- To develop a measurable indicator of human exposure to Stachybotys chartarum.

    Methods- Antibodies were produced against the hemolytic agent stachylysin obtained from the mold S. chartarum. These antibodies were used to develop two enzyme-linked immunosorbent ass...

  4. IS YOUR STACHYBOTRYS CHARTARUM A GENUINE S. CHARTARUM?

    EPA Science Inventory

    The fungus Stachybotrys chartarum is the type species of the genus Stachybotrys. Certain strains of the species are known to produce trichothecene mycotoxins,. It is a celluolytic saprophyte with worldwide distribution and frequently discovered in water-damaged buildings. Evid...

  5. ELISA MEASUREMENT OF STACHYLYSIN (TM) IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Antibodies were produced against the hemolytic agent stachylysin obtained from the mold Stachybotryis chartarum. These antibodies were used to develop two enzyme-linked immunosorbent assay (ELISA) methods for the analysis of stachylysin in human and rat sera and environmental sa...

  6. CHARACTERIZATION OF THE HEMOLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920
    Da as determ...

  7. GROWTH RESPONSE OF STACHYBOTRYS CHARTARUM TO MOISTURE VARIATION ON COMMON BUILDING MATERIALS

    EPA Science Inventory

    The mold Stachybotrys chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants and has been studied for toxin production and its occurrence in water damaged buildings. Growth of S. chartarum on building materials such as drywall has been frequentl...

  8. PARTIAL CHARACTERIZATION OF ALLERGENS IN EXTRACTS OF STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    PARTIAL CHARACTERIZATION OF ALLERGENS IN EXTRACTS OF Stachybotrys chartarum. M E Viana1, MJ Selgrade2, and M D Ward2. 1NCSU, Raleigh, NC, USA. 2NHEERL, ORD, US EPA, RTP, NC, USA.

    Exposure to Stachybotrys chartarum has been associated with the development of serious health ...

  9. Genome sequence of Stachybotrys chartarum Strain 51-11

    EPA Science Inventory

    Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina Hiseq 2000 and PacBio long read technology. Since Stachybotrys chartarum has been implicated in health impacts within water-damaged buildings, any information extracted from the geno...

  10. CHARACTERISTIC GROWTH REQUIREMENTS OF THE TOXIC MOLD STACHYBOTRYS CHARTARAM

    EPA Science Inventory

    The paper discusses the results of a study of the environmental factors leading to the growth of the mold Stachybotrys chartarum. S. chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants, and its toxin production and occurrence in water damaged...

  11. The relative allergenicity of Stachybotrys chartarum compared to house dust mite extracts in a mouse model

    EPA Science Inventory

    A report by the Institute of Medicine suggested that more research is needed to better understand mold effects on allergic disease, particularly asthma development. The authors compared the ability of the fungus Stachybotrys chartarum (SCE) and house dust mite (HDM) extracts to i...

  12. CHARACTERIZATION OF MICROBIAL VOLATILE ORGANIC COMPOUNDS (MVOC) EMITTED BY STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a filamentous fungi usually found in water-damaged buildings. Severe illnesses have been reported after indoor exposure to this mold. Toxicity has caused the production of secondary metabolites or mycotoxins, and the emission of by-products, specifically...

  13. Microbial volatile organic compound emissions from Stachybotrys chartarum growing on gypsum wallboard and ceiling tile

    PubMed Central

    2013-01-01

    Background Stachybotrys chartarum is a filamentous mold frequently identified among the mycobiota of water-damaged building materials. Growth of S. chartarum on suitable substrates and under favorable environmental conditions leads to the production of secondary metabolites such as mycotoxins and microbial volatile organic compounds (MVOCs). The aim of this study was to characterize MVOC emission profiles of seven toxigenic strains of S. chartarum, isolated from water-damaged buildings, in order to identify unique MVOCs generated during growth on gypsum wallboard and ceiling tile coupons. Inoculated coupons were incubated and monitored for emissions and growth using a closed glass environmental growth chamber maintained at a constant room temperature. Gas samples were collected from the headspace for three to four weeks using Tenax TA tubes. Results Most of the MVOCs identified were alcohols, ketones, ethers and esters. The data showed that anisole (methoxybenzene) was emitted from all of the S. chartarum strains tested on both types of substrates. Maximum anisole concentration was detected after seven days of incubation. Conclusions MVOCs are suitable markers for fungal identification because they easily diffuse through weak barriers like wallpaper, and could be used for early detection of mold growth in hidden cavities. This study identifies the production of anisole by seven toxigenic strains of Stachybotrys chartarum within a period of one week of growth on gypsum wallboard and ceiling tiles. These data could provide useful information for the future construction of a robust MVOC library for the early detection of this mold. PMID:24308451

  14. CHARACTERIZATION OF THE HEMOLYSIN, STACHYLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage/hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its monomeric form, has a molecular wieght of 11,920 daltons as determined by m...

  15. STACHYLYSIN MAY BE CAUSE OF HEMORRAHAGING IN STACHYBOTRYS CHARTARUM EXPOSURES

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns like nasal bleeding in adults and pulmonary hemosiderosis (PH) in infants. Stachylysin is a glycosylated protein, with the deglycosylated molecular mass of 21.5 kDa. Seven of eight ...

  16. EVALUATION OF STACHYBOTRYS CHARTARUM IN THE HOUSE OF AN INFANT WITH PULMONARY HEMORRHAGE: QUANTITATIVE ASSESSMENT BEFORE, DURING, AND AFTER REMEDIATION

    EPA Science Inventory

    Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...

  17. Occurrence of Stachybotrys chartarum chemotype S in dried culinary herbs.

    PubMed

    Biermaier, Barbara; Gottschalk, Christoph; Schwaiger, Karin; Gareis, Manfred

    2015-02-01

    Stachybotrys (S.) chartarum is an omnipresent cellulolytic mould which produces secondary metabolites, such as the highly toxic macrocyclic trichothecenes. While it is known to occur in animal feed like hay and straw as well as in water-damaged indoor environments, there is little knowledge about the occurrence of S. chartarum and its secondary metabolites in food. The objective of the present study was to examine selected dried culinary herbs for the presence of S. chartarum chemotype S, to assess the potential risk of a contamination of foods with macrocyclic trichothecenes. In total, 50 Stachybotrys isolates from different types of culinary herbs (n=100) such as marjoram (Origanum majorana Linné (L.)), oregano (Origanum vulgare L.), thyme (Thymus vulgaris L.), and savory (Satureja hortensis L.) were examined by MTT-cell culture test (effect-based bioassay), ELISA, and by liquid chromatography tandem mass spectrometry (LC-MS/MS). Selected toxic and non-toxic isolates (n=15) were genetically characterized by PCR and sequencing. Five isolates (10%) were highly toxic in the MTT-cell culture test, and the production of macrocyclic trichothecenes was proven by ELISA and LC-MS/MS. These five isolates were genetically confirmed as S. chartarum chemotype S. To the best of our knowledge, this is the first report about a contamination of dried culinary herbs with toxigenic S. chartarum. PMID:25346283

  18. Satratoxin G from the Black Mold Stachybotrys chartarum Evokes Olfactory Sensory Neuron Loss and Inflammation in the Murine Nose and Brain

    PubMed Central

    Islam, Zahidul; Harkema, Jack R.; Pestka, James J.

    2006-01-01

    Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the “black mold” suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose–response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 μg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 μg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 μg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-α, interleukin-6 (IL-6), and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings. PMID:16835065

  19. Detection of Airborne Stachybotrys chartarum Macrocyclic Trichothecene Mycotoxins in the Indoor Environment

    PubMed Central

    Brasel, T. L.; Martin, J. M.; Carriker, C. G.; Wilson, S. C.; Straus, D. C.

    2005-01-01

    The existence of airborne mycotoxins in mold-contaminated buildings has long been hypothesized to be a potential occupant health risk. However, little work has been done to demonstrate the presence of these compounds in such environments. The presence of airborne macrocyclic trichothecene mycotoxins in indoor environments with known Stachybotrys chartarum contamination was therefore investigated. In seven buildings, air was collected using a high-volume liquid impaction bioaerosol sampler (SpinCon PAS 450-10) under static or disturbed conditions. An additional building was sampled using an Andersen GPS-1 PUF sampler modified to separate and collect particulates smaller than conidia. Four control buildings (i.e., no detectable S. chartarum growth or history of water damage) and outdoor air were also tested. Samples were analyzed using a macrocyclic trichothecene-specific enzyme-linked immunosorbent assay (ELISA). ELISA specificity was tested using phosphate-buffered saline extracts of the fungal genera Aspergillus, Chaetomium, Cladosporium, Fusarium, Memnoniella, Penicillium, Rhizopus, and Trichoderma, five Stachybotrys strains, and the indoor air allergens Can f 1, Der p 1, and Fel d 1. For test buildings, the results showed that detectable toxin concentrations increased with the sampling time and short periods of air disturbance. Trichothecene values ranged from <10 to >1,300 pg/m3 of sampled air. The control environments demonstrated statistically significantly (P < 0.001) lower levels of airborne trichothecenes. ELISA specificity experiments demonstrated a high specificity for the trichothecene-producing strain of S. chartarum. Our data indicate that airborne macrocyclic trichothecenes can exist in Stachybotrys-contaminated buildings, and this should be taken into consideration in future indoor air quality investigations. PMID:16269780

  20. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  1. SOLVENT COMPARISON IN THE ISOLATION, SOLUBILIZATION, AND TOXICITY OF STACHYBOTRYS CHARTARUM SPORE TRICHOTHECENE MYCOTOXINS IN AN ESTABLISHED IN VITRO LUMINESCENCE PROTEIN TRANSLATION INHIBITION ASSAY

    EPA Science Inventory

    It is well known that non-viable mold contaminants such as macrocyclic trichothecene mycotoxins of Stachybotrys chartarum are highly toxinigenic to humans. However, there is no agreed upon method of recovering native mycotoxin. The purpose of this study was to provide quantitativ...

  2. GERMINATION, VIABILITY AND CLEARANCE OF STACHYBOTRYS CHARTARUM IN THE LUNGS OF INFANT RATS

    EPA Science Inventory

    The fungus Stachybotrys chartarum has been associated with many adverse health effects including the condition known as idiopathic pulmonary hemorrhage in infants. In order to gain some insight into possible mechanisms, viable conidia of S. chartarum were instilled into the lung...

  3. IDENTIFICATION OF SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenitic relati...

  4. MALDI-TOF mass spectrometry fingerprinting: A diagnostic tool to differentiate dematiaceous fungi Stachybotrys chartarum and Stachybotrys chlorohalonata.

    PubMed

    Gruenwald, Maike; Rabenstein, Andreas; Remesch, Markko; Kuever, Jan

    2015-08-01

    Stachybotrys chartarum and Stachybotrys chlorohalonata are two closely related species. Unambiguous identification of these two species is a challenging task if relying solely on morphological criteria and therefore smarter and less labor-intensive approaches are needed. Here we show that even such closely related species of fungi as S. chartarum and S. chlorohalonata are unequivocally discriminated by their highly reproducible MALDI-TOF-MS fingerprints (matrix assisted laser desorption/ionization time-of-flight mass spectrometry fingerprints). We examined 19 Stachybotrys and one Aspergillus isolate by MALDI-TOF-MS. All but one isolate produced melanin containing conidia on malt extract agar. Mass spectra were obtained in good quality from the analysis of hyaline and darkly pigmented conidia by circumventing the property of melanin which causes signal suppression. MALDI-TOF fingerprint analysis clearly discriminated not only the two morphologically similar species S. chartarum and S. chlorohalonata from each other but separated them precisely from Stachybotrys bisbyi and Aspergillus versicolor isolates. Furthermore, even S. chartarum chemotypes A and S could be differentiated into two distinct groups by their MALDI-TOF fingerprints. The chemotypes of S. chartarum isolates were identified by trichodiene synthase 5 (tri5) sequences prior to mass spectra analysis. Additionally, species identities of all isolates were verified by their 18S rRNA and tri5 gene sequences. PMID:26036596

  5. INITIAL CHARACTERIZATION OF MONOCLONAL ANTIBODIES AGAINST THE FUNGAL HEMOLYSIN STACHYLYSIN FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is known to produce the hemolysin stachylysin and its detection in human serum has been proposed as a biomarker for exposure to the fungus. In this study we report the initial characterization of monoclonal antibodies (mAbs) against stachylysin and the dev...

  6. IDENTIFICATION OF PUTATIVE SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachbotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relatio...

  7. [Cutaneous mold fungus granuloma from Ulocladium chartarum].

    PubMed

    Altmeyer, P; Schon, K

    1981-01-01

    Cutaneous granulomas due to the mold fungus Ulocladium chartarum (Preuss) are described in a 58 year old woman. This fungus is usually harmless for mammalian. It is thought that a consisting immunosuppression (Brill-Symmer's disease, therapy with corticosteroids) was a priming condition for the infection. The route of infection in this patient described is unknown. PMID:7194869

  8. QUANTITATIVE MEASUREMENT OF STACHYBOTRYS CHARTARUM CONIDIA USING REAL TIME DETECTION OF PCR PRODUCTS WITH THE TAQMAN TM FLUOROGENIC PROBE SYSTEM

    EPA Science Inventory

    The occurence of Stachybotrys chartarum in indoor environments has been associated with a number of human health concerns, including fatal pulmonary haemosiderosis in infants. Currently used culture-based and microscopic methods of fungal species identification are poorly suited ...

  9. DESTRUCTION OF ASPERGILLUS VERSICOLOR, PENICILLIUM CRYSOGENUM, STACHYBOTRYS CHARTARUM, AND CLADOSPORIUM CLADOSPORIDES SPORES USING CHEMICAL OXIDATION TREATMENT PROCESS

    EPA Science Inventory

    The survival of aqueous suspensions of Penicillium chrysogenum, Stachybotrys chartarum, Aspergillus versicolor, and Cladosporium cladosporioides spores was evaluated using various combinations of hydrogen peroxide and iron (II) as catalyst. Spores were suspended in water and trea...

  10. AN EXTRACT OF STACHYBOTRYS CHARTARUM CAUSES ALLERGIC RESPONSES IN A BALB/C MOUSE MODEL: I. BIOCHEMICAL AND PATHOLOGICAL RESPONSES

    EPA Science Inventory

    Environmental exposure to Stachybotrys chartarum has been associated with adverse health effects in humans. The goal of this study was to assess soluble components of this fungus for allergenic potential. Five isolates of S. chartarum were combined and extracted to form a crude...

  11. RESPIRATORY PHYSIOLOGICAL AND ALLERGIC-TYPE RESPONSES TO AN EXTRACT OF STACHYBOTRYS CHARTARUM IN BALB/C MICE

    EPA Science Inventory

    RESPIRATORY PHYSIOLOGICAL AND ALLERGIC-TYPE RESPONSES TO AN EXTRACT OF Stachybotrys chartarum IN BALB/C MICE. ME Viana1, N Haykal-Coates2, S H Gavett2, MJ Selgrade2, and M D W Ward2. 1APR/CVM, NCSU, Raleigh, NC, USA. 2NHEERL, ORD, US EPA, RTP, NC, USA.
    Rationale: assess the ab...

  12. QUANTIFICATION OF SIDEROPHORE AND HEMOLYSIN FROM STACHYBOTRYS CHARTARUM STRAINS, INCLUDING A STRAIN ISOLATED FROM THE LUNG OF A CHILD WITH PULMONARY HEMORRHAGE AND HEMOSIDEROSIS

    EPA Science Inventory

    A strain of Stachybotrys chartarum was recently isolated from the lung of a pulmonary hemorrhage and hemosiderosis (PH) patient in Texas (designated the Houston strain). This is the first time that S. chartarum has been isolated from the lung of a PH patient. In this study, the ...

  13. ASSESSMENT OF STACHYBOTRYS REGROWTH ON CONTAMINATED WALLBOARD AFTER TREATMENT WITH COMMON SURFACE CLEANERS/DISINFECTANTS

    EPA Science Inventory

    The paper describes results of experiments assessing the efficacy of treating mold-contaminated gypsum wallboard with cleaners and/or disinfectants. Although the accepted recommendations for handling Stachybotrys chartarum contaminated gypsum wallboard are removal and replacement...

  14. Recurrence of Stachybotrys chartarum during mycological and toxicological study of bioaerosols collected in a dairy cattle shed.

    PubMed

    Lanier, Caroline; André, Véronique; Séguin, Virginie; Heutte, Natacha; El Kaddoumi, Anne; Bouchart, Valérie; Picquet, Rachel; Garon, David

    2012-01-01

    Agricultural occupations associated with animal breeding and the processing of animal materials in confinement systems could potentially lead to bioaerosol exposures. Moulds and mycotoxins could be constituents of bioaerosols and should be studied because of their possible involvement in respiratory diseases and cancers. In order to characterize the fungal contamination of the indoor air in a dairy barn, bioaerosols were collected during 20 days in a cattle farm located in Normandy (France). Mycobiota, mycotoxins and the mutagenicity of bioaerosols were studied. The toxigenic ability of Aspergillus flavus group and Aspergillus fumigatus isolates was also evaluated in vitro. The prevalent airborne moulds were from the following potentially toxigenic species: Aspergillus flavus group, Aspergillus fumigatus, Penicillium chrysogenum, Stachybotrys chartarum, and the allergenic species Ulocladium chartarum, Cladosporium cladosporioides. In comparison with harvesting, grain handling or broiler breeding, the concentrations of viable moulds were lower in the cattle shed. Seasonal variations in levels of several species were also observed. This study revealed that aflatoxins were detected in bioaerosols and, for the first time, showed that farmers are possibly exposed to Stachybotrys chartarum during routine barn work. Moreover, the finding of mutagenicity from bioaerosols needs further investigations on bioaerosol composition. PMID:22462447

  15. STACHYBOTRYS CHARTARU Trichothecene Mycotoxins and Damp Building-Related Illness: New Insights into a Public Health Enigma

    EPA Science Inventory

    Damp building-related illnesses (DBRI) include a myriad of respiratory, immunologic, and neurologic symptoms that are sometimes etiologically linked to aberrant indoor growth of the toxic black mold, Stachybotrys chartarum. Although supportive evidence for such linkages is limite...

  16. Biological Responses of Raw 264.7 Macrophage Exposed to Two Strains of Stachybotrys chartarum Spores Grown on Four Different Wallboard Types

    EPA Science Inventory

    The focus of this research was to provide a better understanding of the health impacts caused by Stachybotrys chartarum (Houston and 51-11) spores grown on four gypsum products two of which were resistant to microbes. Raw 264.7 cells were exposed to whole spores and fragmented 51...

  17. Co-cultivation of Streptomyces californicus and Stachybotrys chartarum stimulates the production of cytostatic compound(s) with immunotoxic properties

    SciTech Connect

    Penttinen, Piia . E-mail: Piia.Penttinen@ktl.fi; Pelkonen, Jukka; Huttunen, Kati; Hirvonen, Maija-Riitta

    2006-12-15

    We have recently shown that the actinobacterium Streptomyces californicus and the fungus Stachybotrys chartarum originating from moisture damaged buildings possess both immunotoxic and immunostimulatory characteristics, which are synergistically potentiated by microbial interaction. In the search for the causative agent(s) behind the immunotoxicity, the cytostatic effects of the co-cultivated spores of S. californicus and S. chartarum were compared to those caused by widely used cytostatic agents produced by streptomycetes. The RAW264.7 macrophages were exposed to four doses of doxorubicin (DOX), actinomycin D (AMD), mitomycin C (MMC) or phleomycin (PHLEO) for 24 h. Kinetics of the spores of the co-cultivated and the separately cultivated microbes (1 x 10{sup 6} spores/ml) was compared to DOX (0.15 {mu}M). Apoptotic responses were analyzed by measuring DNA content and mitochondria membrane depolarization with flow cytometer, and by the fluorometric caspase-3 assay. The present data indicate that interactions during co-cultivation of S. californicus and S. chartarum stimulate the production of an unidentified cytostatic compound(s) capable of inducing mitochondria mediated apoptosis and cell cycle arrest at S-G{sub 2}/M. The spores of co-cultivated microbes caused a 4-fold collapse of mitochondrial membrane potential and an almost 6-fold caspase-3 activation and DNA fragmentation when compared to control. Similar responses were induced by DNA cleaving compounds, especially DOX and AMD, at the relatively low concentrations, but not the spores of the same microbes when they were grown separately. These data suggest that when growing in the same habitat, interactions between S. californicus and S. chartarum stimulates the production of an unknown cytostatic compound(s) which evoke immunotoxic effects similar to those by chemotherapeutic drugs.

  18. FACTORS RELATING TO THE RELEASE OF STACHYBOTRYS CHARTARUM SPORES FROM CONTAMINATED SOURCES

    EPA Science Inventory

    The paper describes preliminary results of a research project to determine the factors that control the release of S. chartarum spores from a contaminated source and test ways to reduce spore release and thus exposure. As anticipated, S. chartarum spore emissions from gypsum boar...

  19. Microbial Volatile Organic Compound Emissions from Stachybotrys chartarum growing on Gypsum Wallboard and Ceiling tile

    EPA Science Inventory

    This study compared seven toxigenic strains of S. chartarum found in water-damaged buildings to characterize the microbial volatile organic compound (MVOC) emissions profile while growing on gypsum wallboard (W) and ceiling tile (C) coupons. The inoculated coupons with their sub...

  20. Laboratory research on the efficacy of chlorine dioxide fumigation for the remediation of mold-contaminated buildings--conference paper

    EPA Science Inventory

    The purpose of this project was to determine the efficacy ofCl02 fumigation to inactivate viable mold, mycotoxins, and allergens on building materials. Alternaria alternata, Aspergillus versicolor, Aspergillus Jumigatus, Chaetomium globosum, and Stachybotrys chartarum were indivi...

  1. FR901459, a novel immunosuppressant isolated from Stachybotrys chartarum No. 19392. Taxonomy of the producing organism, fermentation, isolation, physico-chemical properties and biological activities.

    PubMed

    Sakamoto, K; Tsujii, E; Miyauchi, M; Nakanishi, T; Yamashita, M; Shigematsu, N; Tada, T; Izumi, S; Okuhara, M

    1993-12-01

    FR901459, a novel immunosuppressant, has been isolated from the fermentation broth of Stachybotrys chartarum No. 19392. The molecular formula of FR901459 was determined as C62H111N11O13. FR901459 was found to be a member of the cyclosporin family. However, it is structurally distinct from any other cyclosporins discovered so far, in that Leu is present at position 5 instead of Val. FR901459 was capable of prolonging the survival time of skin allografts in rats with one third the potency of cyclosporin A. PMID:8294235

  2. IMMUNOCYTOCHEMICAL LOCALIZATION OF STACHYLYSIN IN STACHYBOTRYS CHARTARUM SPORES AND SPORE-IMPACTED MOUSE AND RAT LUNG TISSUES

    EPA Science Inventory

    Stachylysin is a proteinaceous hemolytic agent that is producted by S. chartarum. Stachylysin was found, using immunohistochemistical and immunocytochemical methods, to be localized in S. chartarum spores/mycelia primarily in the inner wall suggesting that it is constitutively ...

  3. TESTING ANTIMICROBIAL PAINT EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Often mold contaminated building materials are not properly removed, some surface cleaning is performed and paint is applied in an attempt to alleviate the problem. The efficacy of antimicrobial paints to eliminate or control mold regrowth on surfaces can easily be tested on non-...

  4. TESTING ANTIMICROBIAL CLEANER EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Reducing occupant exposure to indoor mold growth is the goal of this research, through the efficacy testing of antimicrobial cleaners. Often mold contaminated building materials are not properly removed, but instead surface cleaners are applied in an attempt to alleviate the prob...

  5. Interactions between Streptomyces californicus and Stachybotrys chartarum can induce apoptosis and cell cycle arrest in mouse RAW264.7 macrophages

    SciTech Connect

    Penttinen, Piia . E-mail: Piia.Penttinen@ktl.fi; Pelkonen, Jukka; Huttunen, Kati; Toivola, Mika; Hirvonen, Maija-Riitta

    2005-02-01

    Exposure to complex mixtures of bacteria and fungi in moisture-damaged buildings is a potential cause of inflammatory related symptoms among occupants. The present study assessed interactions between two characteristic moldy house microbes Streptomyces californicus and Stachybotrys chartarum. Differences in cytotoxic and inflammatory responses in mouse (RAW264.7) macrophages were studied after exposure to the spores of co-cultivated microbes, the mixture of separately cultivated spores, and the spores of either of these microbes cultivated alone. The RAW264.7 cells were exposed to six doses (1 x 10{sup 4} to 3 x 10{sup 6} spores/ml) for 24 h, and the time course of the induced responses was evaluated after 4, 8, 16, and 24 h of exposure (1 x 10{sup 6} spores/ml). The cytotoxic potential of the spores was characterized by the MTT test, DNA content analysis, and enzyme assay for caspase-3 activity. The production of cytokines (IL-1{beta}, IL-6, IL-10, TNF{alpha}, and MIP2) was measured immunochemically and nitric oxide by the Griess method. Co-cultivation increased the ability of the spores to cause apoptosis by more than 4-fold and the proportion of RAW264.7 cells at the G{sub 2}/M stage increased nearly 2-fold when compared to the response induced by the mixture of spores. In contrast, co-cultivation decreased significantly the ability of the spores to trigger the production of NO and IL-6 in RAW264.7 cells. In conclusion, these data suggest that co-culture of S. californicus and S. chartarum can result in microbial interactions that significantly potentiate the ability of the spores to cause apoptosis and cell cycle arrest in mammalian cells.

  6. DNA damage, redox changes, and associated stress-inducible signaling events underlying the apoptosis and cytotoxicity in murine alveolar macrophage cell line MH-S by methanol-extracted Stachybotrys chartarum toxins

    SciTech Connect

    Wang Huiyan; Yadav, Jagjit S. . E-mail: Jagjit.Yadav@uc.edu

    2006-08-01

    Spore-extracted toxins of the indoor mold Stachybotrys chartarum (SC) caused cytotoxicity (release of lactate dehydrogenase), inhibition of cell proliferation, and cell death in murine alveolar macrophage cell line MH-S in a dose- and time-dependent manner. Apoptotic cell death, confirmed based on morphological changes, DNA ladder formation, and caspase 3/7 activation, was detectable as early as at 3 h during treatment with a toxin concentration of 1 spore equivalent/macrophage and was preceded by DNA damage beginning at 15 min, as evidenced by DNA comet formation in single cell gel electrophoresis assay. The apoptotic dose of SC toxins did not induce detectable nitric oxide and pro-inflammatory cytokines (IL-1{beta}, IL-6, and TNF-{alpha}) but showed exacerbated cytotoxicity in presence of a non-apoptotic dose of the known pro-inflammatory agent LPS (10 ng/ml). Intracellular reduced glutathione (GSH) level showed a significant decrease beginning at 9 h of the toxin treatment whereas oxidized glutathione (GSSG) showed a corresponding significant increase, indicating a delayed onset of oxidative stress in the apoptosis process. The toxin-treated macrophages accumulated p53, an indicator of DNA damage response, and showed activation of the stress-inducible MAP kinases, JNK, and p38, in a time-dependent manner. Chemical blocking of either p38 or p53 inhibited in part the SC toxin-induced apoptosis whereas blocking of JNK did not show any such effect. This study constitutes the first report on induction of DNA damage and associated p53 activation by SC toxins, and demonstrates the involvement of p38- and p53-mediated signaling events in SC toxin-induced apoptosis of alveolar macrophages.

  7. EMISSION EXPOSURE MODEL FOR TRANSPORT OF TOXIC MOLD

    EPA Science Inventory

    The paper presents the results of a study of the release of Stachybotrys chartarum spores from contaminated gypsum wallboard and of tests on the effects of environmental conditions on the release of viable and non-viable spores and fragments. Biocontaminants such as mold spores a...

  8. Biological responses of Raw 264.7 macrophage exposed to two strains of Stachybotrys chartarum spores grown on four different wallboard types.

    PubMed

    Kim, J H; Harvey, L A; Evans, A L; Byfield, G E; Betancourt, D A; Dean, T R

    2016-06-01

    The many benefits of building "green" have motivated the use of sustainable products in the design and execution of the built environment. However, the use of these natural or recycled materials, some of which have been treated with antimicrobials, provides a growth opportunity for microorganisms with the potential to elicit adverse health effects especially in the presence of an antimicrobial. The focus of this research was to determine the effects of Stachybotrys chartarum (strains Houston and 51-11) grown under different conditions on a macrophage cell line (Raw 264.7) using endpoints, including cytotoxicity, and those associated with immunity specifically inflammation and MHC class II expression. The fungi were grown on four different gypsum products, and macrophages were exposed to whole spores of both strains and fragmented spores of strain 51-11. Whole spores of the Houston strain elicited no cytotoxicity with some level of inflammation, while exposure to whole spores of 51-11 caused variable responses depending on the wallboard type supporting the fungal growth. High concentrations of fragmented 51-11 spores primarily resulted in the apoptosis of macrophage with no inflammation. None of the fungal strains caused elevated levels of major histocompatibility complex (MHC) class II expression on the surface of Raw cells. Mycotoxin levels of 51-11 spores from all of the wallboard types measured  >250 ng/μL of T2 equivalent toxin based on activity. Collectively, the data demonstrated that all of the wallboard types supported growth of fungi with the ability to elicit harmful biological responses with the potential to negatively impact human health. PMID:27097835

  9. Production and characterization of IgM monoclonal antibodies against hyphal antigens of Stachybotrys species

    EPA Science Inventory

    Stachybotrys is a hydrophilic fungal genus that is well known for its ability to colonize water-damaged building materials in indoor environments. Personal exposure to Stachybotrys chartarum allergens, mycotoxins, cytolytic peptides, and other immunostimulatory macromolecules has...

  10. Production and Characterization of IgM Monoclonal Antibodies Against Hyphal Antigens of Stachybotrys Species

    PubMed Central

    Nayak, Ajay P.; Green, Brett J.; Janotka, Erika; Blachere, Francoise M.; Vesper, Stephen J.; Schmechel, Detlef

    2011-01-01

    Stachybotrys is a hydrophilic fungal genus that is well known for its ability to colonize water-damaged building materials in indoor environments. Personal exposure to Stachybotrys chartarum allergens, mycotoxins, cytolytic peptides, and other immunostimulatory macromolecules has been proposed to exacerbate respiratory morbidity. To date, advances in Stachybotrys detection have focused on the identification of unique biomarkers that can be detected in human serum; however, the availability of immunodiagnostic reagents to Stachybotrys species have been limited. In this study, we report the initial characterization of monoclonal antibodies (MAbs) against a semi-purified cytolytic S. chlorohalonata preparation (cScp) derived from hyphae. BALB/c mice were immunized with cScp and hybridomas were screened against the cScp using an antigen-mediated indirect ELISA. Eight immunoglobulin M MAbs were produced and four were specifically identified in the capture ELISA to react with the cScp. Cross-reactivity of the MAbs was tested against crude hyphal extracts derived from 15 Stachybotrys isolates representing nine Stachybotrys species as well as 39 other environmentally abundant fungi using a capture ELISA. MAb reactivity to spore and hyphal antigens was also tested by a capture ELISA and by fluorescent halogen immunoassay (fHIA). ELISA analysis demonstrated that all MAbs strongly reacted with extracts of S. chartarum but not with extracts of 39 other fungi. However, four MAbs showed cross-reactivity to the phylogenetically related genus Memnoniella. fHIA analysis confirmed that greatest MAb reactivity was ultrastructurally localized in hyphae and phialides. The results of this study further demonstrate the feasibility of specific MAb-based immunoassays for the detection of S. chartarum. PMID:21466283

  11. EVALUATION OF ANTIMICROBIAL EFFICACY FOR CONTROL OF STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Biological contaminants in buildings are known to act as sources of indoor air pollution, discomfort, asthma and pulmonary disease to building occupants, Sick buildings are evidence of extremely problematic indoor air quality (lAO) often resulting from unacceptable concentration...

  12. Environmental Mold and Mycotoxin Exposures Elicit Specific Cytokine and Chemokine Responses

    PubMed Central

    Rosenblum Lichtenstein, Jamie H.; Hsu, Yi-Hsiang; Gavin, Igor M.; Donaghey, Thomas C.; Molina, Ramon M.; Thompson, Khristy J.; Chi, Chih-Lin; Gillis, Bruce S.; Brain, Joseph D.

    2015-01-01

    Background Molds can cause respiratory symptoms and asthma. We sought to use isolated peripheral blood mononuclear cells (PBMCs) to understand changes in cytokine and chemokine levels in response to mold and mycotoxin exposures and to link these levels with respiratory symptoms in humans. We did this by utilizing an ex vivo assay approach to differentiate mold-exposed patients and unexposed controls. While circulating plasma chemokine and cytokine levels from these two groups might be similar, we hypothesized that by challenging their isolated white blood cells with mold or mold extracts, we would see a differential chemokine and cytokine release. Methods and Findings Peripheral blood mononuclear cells (PBMCs) were isolated from blood from 33 patients with a history of mold exposures and from 17 controls. Cultured PBMCs were incubated with the most prominent Stachybotrys chartarum mycotoxin, satratoxin G, or with aqueous mold extract, ionomycin, or media, each with or without PMA. Additional PBMCs were exposed to spores of Aspergillus niger, Cladosporium herbarum and Penicillium chrysogenum. After 18 hours, cytokines and chemokines released into the culture medium were measured by multiplex assay. Clinical histories, physical examinations and pulmonary function tests were also conducted. After ex vivo PBMC exposures to molds or mycotoxins, the chemokine and cytokine profiles from patients with a history of mold exposure were significantly different from those of unexposed controls. In contrast, biomarker profiles from cells exposed to media alone showed no difference between the patients and controls. Conclusions These findings demonstrate that chronic mold exposures induced changes in inflammatory and immune system responses to specific mold and mycotoxin challenges. These responses can differentiate mold-exposed patients from unexposed controls. This strategy may be a powerful approach to document immune system responsiveness to molds and other inflammation

  13. Stachybotrys mycotoxins: from culture extracts to dust samples.

    PubMed

    Došen, Ina; Andersen, Birgitte; Phippen, Christopher B W; Clausen, Geo; Nielsen, Kristian Fog

    2016-08-01

    The filamentous fungus Stachybotrys chartarum is known for its toxic metabolites and has been associated with serious health problems, including mycotoxicosis, among occupants of contaminated buildings. Here, we present results from a case study, where an ultra-high performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) method was developed for known and tentatively identified compounds characterized via UHPLC-quadruple time-of-flight (QTOF) screening of fungal culture extracts, wall scrapings and reference standards. The UHPLC-MS/MS method was able to identify 12 Stachybotrys metabolites, of which four could be quantified based on authentic standards and a further six estimated based on similarity to authentic standards. Samples collected from walls contaminated by S. chartarum in a water-damaged building showed that the two known chemotypes, S and A, coexisted. More importantly, a link between mycotoxin concentrations found on contaminated surfaces and in settled dust was made. One dust sample, collected from a water-damaged room, contained 10 pg/cm(2) macrocyclic trichothecenes (roridin E). For the first time, more than one spirocyclic drimane was detected in dust. Spirocyclic drimanes were detected in all 11 analysed dust samples and in total amounted to 600 pg/cm(2) in the water-damaged room and 340 pg/cm(2) in rooms adjacent to the water-damaged area. Their wide distribution in detectable amounts in dust suggested they could be good candidates for exposure biomarkers. Graphical abstract Stachybotrys growing on a gypsum board, and some of the compounds it produces. PMID:27255106

  14. Molds

    MedlinePlus

    ... touching mold or mold spores may cause allergic reactions or asthma attacks in sensitive people. Molds can cause fungal infections. In addition, mold exposure may irritate your eyes, skin, nose, ...

  15. Quantifying Mold Biomass on Gypsum Board: Comparison of Ergosterol and Beta-N-Acetylhexosaminidase as Mold Biomass Parameters

    PubMed Central

    Reeslev, M.; Miller, M.; Nielsen, K. F.

    2003-01-01

    Two mold species, Stachybotrys chartarum and Aspergillus versicolor, were inoculated onto agar overlaid with cellophane, allowing determination of a direct measurement of biomass density by weighing. Biomass density, ergosterol content, and beta-N-acetylhexosaminidase (3.2.1.52) activity were monitored from inoculation to stationary phase. Regression analysis showed a good linear correlation to biomass density for both ergosterol content and beta-N-acetylhexosaminidase activity. The same two mold species were inoculated onto wallpapered gypsum board, from which a direct biomass measurement was not possible. Growth was measured as an increase in ergosterol content and beta-N-acetylhexosaminidase activity. A good linear correlation was seen between ergosterol content and beta-N-acetylhexosaminidase activity. From the experiments performed on agar medium, conversion factors (CFs) for estimating biomass density from ergosterol content and beta-N-acetylhexosaminidase activity were determined. The CFs were used to estimate the biomass density of the molds grown on gypsum board. The biomass densities estimated from ergosterol content and beta-N-acetylhexosaminidase activity data gave similar results, showing significantly slower growth and lower stationary-phase biomass density on gypsum board than on agar. PMID:12839773

  16. Molds

    MedlinePlus

    Molds are fungi that can be found both outdoors and indoors. They grow best in warm, damp and humid conditions. If ... spots in your house, you will probably get mold. Molds can cause health problems. Inhaling or touching ...

  17. Health symptoms caused by molds in a courthouse.

    PubMed

    Lee, Tang G

    2003-07-01

    A majority of occupants of a newly renovated historic courthouse in Calgary, Alberta, Canada, reported multiple (3 or more) health-related symptoms, and several reported more than 10 persistent symptoms. Most required at least 1 day outside of the building to recover from their symptoms. Molds that produce mycotoxins, such as Stachybotrys chartarum and Emericella nidulans, were identified in the building, along with fungal organisms of the genera Aspergillus, Penicillium, Streptomyces, Cladosporium, Chaetomium, Rhizopus/Mucor, Alternaria, Ulocladium, and Basidiomycetes. Renovations to this historic had building failed to provide adequate thermal and vapor barriers, thus allowing moist indoor air to migrate into the building enclosure, causing condensation to develop. Mold grew on the condensation and was dispersed throughout the courthouse, including on furniture and files. The courthouse was closed and a new facility was modified with low-offgassing materials, better ventilation and air filtration, and strict building maintenance to accommodate those occupants of the older building who had developed multiple chemical sensitivities. PMID:15143857

  18. Adverse human health effects associated with molds in the indoor environment.

    PubMed

    Hardin, Bryan D; Kelman, Bruce J; Saxon, Andrew

    2003-05-01

    inhalation exposure to fungi, bacteria, and other organic matter, usually in industrial or agricultural settings. Molds growing indoors are believed by some to cause building-related symptoms. Despite a voluminous literature on the subject, the causal association remains weak and unproven, particularly with respect to causation by mycotoxins. One mold in particular, Stachybotrys chartarum, is blamed for a diverse array of maladies when it is found indoors. Despite its well-known ability to produce mycotoxins under appropriate growth conditions, years of intensive study have failed to establish exposure to S. chartarum in home, school, or office environments as a cause of adverse human health effects. Levels of exposure in the indoor environment, dose-response data in animals, and dose-rate considerations suggest that delivery by the inhalation route of a toxic dose of mycotoxins in the indoor environment is highly unlikely at best, even for the hypothetically most vulnerable subpopulations. Mold spores are present in all indoor environments and cannot be eliminated from them. Normal building materials and furnishings provide ample nutrition for many species of molds, but they can grow and amplify indoors only when there is an adequate supply of moisture. Where mold grows indoors there is an inappropriate source of water that must be corrected before remediation of the mold colonization can succeed. Mold growth in the home, school, or office environment should not be tolerated because mold physically destroys the building materials on which it grows, mold growth is unsightly and may produce offensive odors, and mold is likely to sensitize and produce allergic responses in allergic individuals. Except for persons with severely impaired immune systems, indoor mold is not a source of fungal infections. Current scientific evidence does not support the proposition that human health has been adversely affected by inhaled mycotoxins in home, school, or office environments. PMID

  19. Macrocyclic trichothecenes produced by Stachybotrys isolated from Egypt and eastern Europe.

    PubMed

    el-Maghraby, O M; Bean, G A; Jarvis, B B; Aboul-Nasr, M B

    1991-02-01

    Twenty seven isolates of Stachybotrys chartarum, S. albipes, S. kampalensis and S. microspora from Egypt and Eastern Europe were tested for production of macrocyclic trichothecenes. Twenty of the 27 isolates, grown on rice seeds, were toxic to brine shrimp larvae. Based on TLC and HPLC analyses, 5 macrocyclic trichothecenes (verrucarin J, roridin E, satratoxins F, G & H) as well as trichoverrols were identified. When grown in liquid culture on rice extract medium, only 3 isolates were toxic and produced verrucarin J, roridin E and satratoxins G & H. Extracts from mycelial mats were more toxic than culture filterates of two isolates grown on rice extract and both contained the same macrocyclic trichothecenes (285.5 mg/4 L), in addition to trichoverrols A & B (31 mg/4 L) found in mycelial mats only. When grown on 3% sucrose Czapek's medium supplemented with peptone and yeast extract (still cultures), all isolates were non-toxic to brine shrimp and no trichothecenes could be detected in the extracts. PMID:2034259

  20. Mold Allergy

    MedlinePlus

    ... navigation Home ▸ Conditions & Treatments ▸ Allergies ▸ Mold Allergy Share | Mold Allergy Overview Symptoms & Diagnosis Treatment & Management Mold Allergy Overview Molds are tiny fungi whose spores ...

  1. QUANTIFICATION OF STACHYBOTRYS CHARTARUM CONIDIA IN INDOOR DUST USING REAL TIME, FLUORESCENT PROBE-BASED DETECTION OF PCR PRODUCTS

    EPA Science Inventory

    Analyses of fungal spores or conidia in indoor dust samples can be useful for determining the contamination status of building interiors and in signaling instances where potentially harmful exposures of building occupants to these organisms may exist. A recently developed method ...

  2. Mold Allergy

    MedlinePlus

    ... the Allergist Health Professionals Partners Media Donate Allergies Mold Allergy What Is a Mold Allergy? If you have an allergy that occurs ... or basement. What Are the Symptoms of a Mold Allergy? The symptoms of mold allergy are very ...

  3. MOLDING APPARATUS

    DOEpatents

    Fleming, P.G.

    1963-10-01

    Molding apparatus capable of coating multiple elements each molding cycle is described. The apparatus comprises a centrally disposed reservoir penetrated by a plurality of circumferentially arranged and radially extending passageways. These passageways, in turn, communicate with passages in a separable annular member that retains selectively configured molds and mold seating arrangements. Each mold, which is readily removable from its respective seat, is adapted to retain an element therein in spaced relation to the interior of the mold by utilizing element positioning means within the mold seat and the mold so that coating material may flow about the entire outer surface of the element. (AEC)

  4. ELISA MEASUREMENT FOR STACHYLYSIN

    EPA Science Inventory

    The consumption of food commodities contaminated with the mold, Stachybotrys charatrum, has a long history of causing severe illness, and even death, in humans and animals. More recently, negative health effects have been linked to indoor inhalation exposures to S. chartarum. F...

  5. Photosensitization associated with exposure to Pithomyces chartarum in lambs.

    PubMed

    Hansen, D E; McCoy, R D; Hedstrom, O R; Snyder, S P; Ballerstedt, P B

    1994-05-15

    An epidemic of photosensitization was observed in a group of lambs on irrigated autumn pasture in western Oregon. Signs included crusting, necrosis, and sloughing of the skin over the nostrils, lips, and ears, and of the mucous membranes of the buccal regions. Microscopic examination of plant material from the pasture disclosed spores of Pithomyces chartarum. This fungus has been documented as a causal factor in photosensitization in sheep and cattle (facial eczema) in other parts of the world. An infective agent or other plant material that could have induced the clinical signs in the lambs was not evident. Weather and humidity conditions were ideal for fungal growth during the grazing period, and the fungus was detected in large numbers before and during the epidemic. Even though facial eczema has not been reported previously in northwestern United States, we feel the circumstances surrounding this epidemic warrant such a diagnosis. PMID:8050952

  6. The effect of spaceflight on growth of Ulocladium chartarum colonies on the international space station.

    PubMed

    Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

    2013-01-01

    The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions. PMID:23637980

  7. The Effect of Spaceflight on Growth of Ulocladium chartarum Colonies on the International Space Station

    PubMed Central

    Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

    2013-01-01

    The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions. PMID:23637980

  8. DETECTION OF STACHYBOTRYS CHARTARUM USING rRNA, tri5, AND Β-TUBULIN PRIMERS AND DETERMINING THEIR RELATIVE COPY NUMBER BY REAL TIME PCR

    EPA Science Inventory

    This research utilizes the quantitative polymerase chain reaction (qPCR) to determine ribosomal copy number of fungal organisms found in unhealthy indoor environments. Knowing specific copy numbers will allow for greater accuracy in quantification when utilizing current pQCR tec...

  9. MOLD POLLUTION

    EPA Science Inventory

    Mold pollution is the growth of molds in a building resulting in a negative impact on the use of that structure. The negative impacts generally fall into two categories: destruction of the structure itself and adverse health impacts on the building's occupants. It is estimated...

  10. Mold Charlatans.

    ERIC Educational Resources Information Center

    Woody, Daniel

    2002-01-01

    Offers a primer on toxic mold and its removal, warning against ignorant or unethical mold remediation companies and offering five considerations (checking references, considering the big picture, sampling more than the air, considering release, and considering the source) when hiring such services. (EV)

  11. Characterization of an extracellular laccase of Leptosphaerulina chartarum.

    PubMed

    Sajben-Nagy, Enikő; Manczinger, László; Škrbić, Biljana; Živančev, Jelena; Antić, Igor; Krisch, Judit; Vágvölgyi, Csaba

    2014-09-01

    Laccase-producing fungi were isolated from air, using selective media with a chromogenic substrate to indicate enzyme activity. The best laccase producer strain proved to be a Leptosphaerulina chartarum isolate. Laccase production was investigated in the presence of various inducers in different cultivation conditions. The extracellular laccase was purified for further investigations. SDS-PAGE showed that this laccase is a monomeric protein of 38 kDa molecular weight. The enzyme is active in the pH-range of 3.5-6, with an optimum at pH 3.8. It is active in the 10-60 °C temperature range, with an optimum at 40 °C. After 20 min incubation at temperatures above 70 °C the enzyme lost its activity. Degradation of seven aniline and phenol compounds (2,4-dichlorophenol; 2-methyl-4-chlorophenol; 3-chloroaniline; 4-chloroaniline; 2,6-dimethylaniline; 3,4-dichloroaniline and 3-chloro-4-methylaniline) was investigated, with or without guaiacol (2-methoxyphenol) as mediator molecule. Addition of a mediator to the system significantly increased the degradation levels. These results confirmed that the isolated laccase is able to convert these harmful xenobiotics at in vitro conditions. PMID:24845167

  12. Cutaneous infection caused by Ulocladium chartarum in a heart transplant recipient: case report and review.

    PubMed

    Durán, María Teresa; Del Pozo, Jesús; Yebra, María Teresa; Crespo, María Generosa; Paniagua, María Jesús; Cabezón, María Angeles; Guarro, Josep

    2003-01-01

    A cutaneous mycoses caused by Ulocladium chartarum in a heart transplant recipient is reported. The infection cleared after complete surgical excision and 6 months of oral itraconazole therapy. In vitro activity of amphotericin B, fluconazole, itraconazole, voriconazole, ravuconazole and terbinafine against the clinical isolate is shown. PMID:12816160

  13. Trichothecene mycotoxins in aerosolized conidia of Stachybotrys atra.

    PubMed Central

    Sorenson, W G; Frazer, D G; Jarvis, B B; Simpson, J; Robinson, V A

    1987-01-01

    Stachybotrys atra is the etiologic agent of stachybotryotoxicosis, and this fungus and its trichothecene mycotoxins were recently implicated in an outbreak of unexplained illness in homes. S. atra was grown on sterile rice, autoclaved, dried, and then aerosolized by acoustic vibration. The distribution of particles (mass and number) was monitored on an aerodynamic particle sizer interfaced with a computer. Dust was collected on preweighed glass-fiber filters and extracted with 90% aqueous methanol. Extracts were tested for the ability to inhibit protein synthesis in rat alveolar macrophages, the ability to inhibit the proliferation of mouse thymocytes, and the presence of specific trichothecene mycotoxins. Virtually all of the particles were less than 15 micron in aerodynamic diameter, and the mass median diameter was 5 micron. Thus, most of the particles were respirable. Microscopic analysis of the generated dust revealed that ca. 85% of the dust particles were conidia of S. atra, another 6% were hyphal fragments, and the remainder of the particles were unidentifiable. Thus, greater than 90% of the particles were of fungal origin. The extracts strongly inhibited protein synthesis and thymocyte proliferation. Purified satratoxin H was also highly toxic in the same systems. Each of the individual filters contained satratoxin H (average, 9.5 ng/mg of dust). Satratoxin G and trichoverrols A and B were found in lesser amounts in some, but not all, of the filters. The limit of analysis is ca. 50 ng. These results establish that the conidia of S. atra contain trichothecene mycotoxins. In view of the potent toxicity of the trichothecenes, the inhalation of aerosols containing high concentrations of these conidia could be a potential hazard to health. PMID:3496850

  14. Allergies, asthma, and molds

    MedlinePlus

    Allergic rhinitis - mold ... make allergies or asthma worse are called triggers. Mold is a common trigger. When your asthma or allergies become worse due to mold, you are said to have a mold allergy. ...

  15. INGOT MOLD

    DOEpatents

    Mangold, A.J. Jr.; MaHaffey, J.W.; Reese, S.L.

    1958-04-29

    An improved ingot-mold assembly is described, consisting of a body having a cavity and a recess extending through to the bottom of the body from the cavity, and the bottom of the cavity having an internal shoulder extending downward and a plug having an external shoulder. The plug extends above the shoulders and below the bottom of the body.

  16. Bacteria, molds, and toxins in water-damaged building materials.

    PubMed Central

    Andersson, M A; Nikulin, M; Köljalg, U; Andersson, M C; Rainey, F; Reijula, K; Hintikka, E L; Salkinoja-Salonen, M

    1997-01-01

    Microbial toxins and eukaryotic cell toxicity from indoor building materials heavily colonized by fungi and bacteria were analyzed. The dominant colonizers at water-damaged sites of the building were Stachybotrys chartarum (10(3) to 10(5) visible conidia cm-2), Penicillium and Aspergillus species (10(4) CFU mg-1), gram-negative bacteria (10(4) CFU mg-1), and mycobacteria (10(3) CFU mg-1). The mycobacterial isolates were most similar to M. komossense, with 98% similarity of the complete 16S rDNA sequence. Limulus assay of water extracts prepared from a water-damaged gypsum liner revealed high contents of gram-negative endotoxin (17 ng mg-1 of E. coli lipopolysaccharide equivalents) and beta-D-glucan (210 ng mg-1 of curdlan equivalents). High-performance liquid chromatography analysis of the methanol extracts showed that the water-damaged gypsum liner also contained satratoxin (17 ng mg-1). This methanol-extracted substance was 200 times more toxic to rabbit skin and fetus feline lung cells than extract of gypsum liner sampled from a non-water-damaged site. The same extract contained toxin(s) that paralyzed the motility of boar spermatozoa at extremely low concentrations; the 50% effective concentration was 0.3 microgram of dry solids per ml. This toxicity was not explainable by the amount of bacterial endotoxin, beta-D-glucan, or satratoxin present in the same extract. The novel in vitro toxicity test that utilized boar spermatozoa as described in this article is convenient to perform and reproducible and was a useful tool for detecting toxins of microbial origin toward eukaryotic cells not detectable in building materials by the other methods. PMID:9023919

  17. Improved compression molding process

    NASA Technical Reports Server (NTRS)

    Heier, W. C.

    1967-01-01

    Modified compression molding process produces plastic molding compounds that are strong, homogeneous, free of residual stresses, and have improved ablative characteristics. The conventional method is modified by applying a vacuum to the mold during the molding cycle, using a volatile sink, and exercising precise control of the mold closure limits.

  18. [Photosensitization in cattle grazing on pastures of Brahciaria decumbens Stapf infested with Pithomyces chartarum (Berk. & Curt.) M.B. Ellis].

    PubMed

    Andrade, S O; da Silva Lopes, H O; de Almeida Barros, M; Leite, G G; Dias, S M; Saueressig, M; Nobre, D; Temperini, J A

    1978-01-01

    Aspects of photosensitization in bovines grazing on pastures of Brachiaria decumbens Stapf infested with Pithomyces chartarum (Berk. & Curt.) M.B. Ellis infested all pastures 45(2):117-136, 1978. This paper reports experimental studies on photosensitization in bovines grazing on different pastures of Brachiaria decumbens Stapf in the "Cerrados" region (Planaltina, DF). Climatic conditions, zinc content and occurence of fungi on pastures were investigated. Pithomyces chartarum (Berk. & Curt.) M.B. Ellis infested all pastures examined. Photosensitization was observed in one animal maintained on a pasture of B. decumbens formed with seeds from Australia. Clinical and necropsy data were similar to those related in literature for sporidesmin-intoxicated animals. An isolate of P. chartarum and samples of bovine bile were assayed for sporidesmin presence. PMID:573108

  19. Thermoset matched die molding

    NASA Astrophysics Data System (ADS)

    Young, P. R.

    Reinforced molding compounds, mat molding, preform molding, cold press molding, and various other molding processes are discussed. Particular attention is given to the bulk molding compound (BMC) and the sheet molding compound (SMC) (both of which are reinforced molding compounds) as there is an increasing use of these compounds. SMC can employ a wider range of fiber lengths and fiber content than BMC, while preserving strength. The dimensional stability of BMC and SMC is unexcelled, and their corrosion resistance is generally excellent. Both compounds are composed of resins (10-2500 poises), reinforcements (BMC-glass, asbestos, sisal; SMC-soluble binder chopped strand mat), and fillers from four chemical groups (silica and silicates, carbonates, sulfates, and oxides). Molding press designs are included.

  20. Identification of signatory secondary metabolites during mycoparasitism of Rhizoctonia solani by Stachybotrys elegans

    PubMed Central

    Chamoun, Rony; Aliferis, Konstantinos A.; Jabaji, Suha

    2015-01-01

    Stachybotrys elegans is able to parasitize the fungal plant pathogen Rhizoctonia solani AG-3 following a complex and intimate interaction, which, among others, includes the production of cell wall-degrading enzymes, intracellular colonization, and expression of pathogenic process encoding genes. However, information on the metabolome level is non-existent during mycoparasitism. Here, we performed a direct-infusion mass spectrometry (DIMS) metabolomics analysis using an LTQ Orbitrap analyzer in order to detect changes in the profiles of induced secondary metabolites of both partners during this mycoparasitic interaction 4 and 5 days following its establishment. The diketopiperazine(s) (DKPs) cyclo(S-Pro-S-Leu)/cyclo(S-Pro-S-Ile), ethyl 2-phenylacetate, and 3-nitro-4-hydroxybenzoic acid were detected as the primary response of Rhizoctonia 4 days following dual-culturing with Stachybotrys, whereas only the latter metabolite was up-regulated 1 day later. On the other hand, trichothecenes and atranones were mycoparasite-derived metabolites identified during mycoparasitism 4 and 5 days following dual-culturing. All the above secondary metabolites are known to exhibit bioactivity, including fungitoxicity, and represent key elements that determine the outcome of the interaction being studied. Results could be further exploited in programs for the evaluation of the bioactivity of these metabolites per se or their chemical analogs, and/or genetic engineering programs to obtain more efficient mycoparasite strains with improved efficacy and toxicological profiles. PMID:25972848

  1. Identification of mycotoxins produced by species of Fusarium and Stachybotrys obtained from Eastern Europe.

    PubMed Central

    Szathmary, C I; Mirocha, C J; Palyusik, M; Pathre, S V

    1976-01-01

    Isolates of Fusarium and Stachybotrys spp. and crude extracts from these fungi were obtained from Hungary and the U.S.S.R. and used for the evaluation of the mycotoxins they produced. The cultures were grown on millet and oats and extracted in Budapest, Hungary (Veterinary Medical Research Institute) and chemically analyzed at the University of Minnesota using thin-layer chromatography (TLC), gas-liquid chromatography (GLC), gas chromatograph-mass spectrometry (GC-MS), and the rat skin bioassay. Zearalenone was found in most of the Fusarium cultures, T-2 toxin, neosolaniol, T-2 tetraol, and HT-2 toxin were found in extracts of Fusarium poae and F. sporotrichioies. A special effort was made to isolate the steroid-like toxins reported in the early Russian literature as sporofusarin and poaefusarin. None of the extracts from the Fusarium species yielded poaefusarin or sporofusarin when analyzed by our chemical methods or by those of L.E. Olifson, S.M. Kenina, and V.L. Kartashova, 1972. We therefore accounted for the toxicity of the Fusarium extracts as due to the 12,13,epoxytrichothecenes. One culture of Stachybotrys alternans yielded a macrocyclic ester of 12,13-epoxytrichothecene which, upon hydrolysis, yielded verrucarol; a steroid-like molecule (SB-3) was also isolated. The former had skin-irritant activity but SB-3 did not; the latter exhibited cardiac activity on the heart of the cockroach. PMID:988785

  2. Molds in the Environment

    MedlinePlus

    ... Program in Brief Related Issues Resources Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ... ng Việt [PDF - 273 KB] Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ...

  3. Pyrotechnic filled molding powder

    DOEpatents

    Hartzel, Lawrence W.; Kettling, George E.

    1978-01-01

    The disclosure relates to thermosetting molding compounds and more particularly to a pyrotechnic filled thermosetting compound comprising a blend of unfilled diallyl phthalate molding powder and a pyrotechnic mixture.

  4. QUANTIFYING INDOOR MOLDS

    EPA Science Inventory

    There is growing awareness that indoor molds/fungi may be connected to such conditions as asthma, allergies, hemorrhaging, chronic rhinosinusitis, memory loss, and a symptom complex called sick-building-syndrome. In addition, molds cause frequently fatal nosocomical infections. ...

  5. Allergies, asthma, and molds

    MedlinePlus

    ... in damp places. Outdoors, mold lives in the soil, on compost, and on plants that are damp. Keeping your house and yard drier will help control mold growth. Central heating and air-conditioning systems can help control mold. Change furnace and ...

  6. Molds for cable dielectrics

    DOEpatents

    Roose, L.D.

    1996-12-10

    Molds for use in making end moldings for high-voltage cables are described wherein the dielectric insulator of a cable is heated and molded to conform to a desired shape. As a consequence, high quality substantially bubble-free cable connectors suitable for mating to premanufactured fittings are made. 5 figs.

  7. Molds for cable dielectrics

    DOEpatents

    Roose, Lars D.

    1996-01-01

    Molds for use in making end moldings for high-voltage cables are described wherein the dielectric insulator of a cable is heated and molded to conform to a desired shape. As a consequence, high quality substantially bubble-free cable connectors suitable for mating to premanufactured fittings are made.

  8. Mold and Children's Health.

    ERIC Educational Resources Information Center

    Tuscano, Antoinette

    1998-01-01

    Mold can seriously affect the health of children with asthma or allergies. Indoor air problems related to mold can be difficult to identify, but when several students who spend time in the same classroom area show allergic symptoms, it is important to consider mold and air quality. Failure to respond promptly can have serious consequences. (SM)

  9. Mold-Resistant Construction.

    ERIC Educational Resources Information Center

    Huckabee, Christopher

    2003-01-01

    Asserts that one of the surest ways to prevent indoor air quality and mold issues is to use preventive construction materials, discussing typical resistance to dealing with mold problems (usually budget-related) and describing mold-resistant construction, which uses concrete masonry, brick, and stone and is intended to withstand inevitable…

  10. Bleach Neutralizes Mold Allergens

    ERIC Educational Resources Information Center

    Science Teacher, 2005

    2005-01-01

    Researchers at National Jewish Medical and Research Center have demonstrated that dilute bleach not only kills common household mold, but may also neutralize the mold allergens that cause most mold-related health complaints. The study, published in the Journal of Allergy and Clinical Immunology, is the first to test the effect on allergic…

  11. Microfungal contamination of damp buildings--examples of risk constructions and risk materials.

    PubMed Central

    Gravesen, S; Nielsen, P A; Iversen, R; Nielsen, K F

    1999-01-01

    To elucidate problems with microfungal infestation in indoor environments, a multidisciplinary collaborative pilot study, supported by a grant from the Danish Ministry of Housing and Urban Affairs, was performed on 72 mold-infected building materials from 23 buildings. Water leakage through roofs, rising damp, and defective plumbing installations were the main reasons for water damage with subsequent infestation of molds. From a score system assessing the bioavailability of the building materials, products most vulnerable to mold attacks were water damaged, aged organic materials containing cellulose, such as wooden materials, jute, wallpaper, and cardboard. The microfungal genera most frequently encountered were Penicillium (68%), Aspergillus (56%), Chaetomium (22%), Ulocladium, (21%), Stachybotrys (19%) and Cladosporium (15%). Penicillium chrysogenum, Aspergillus versicolor, and Stachybotrys chartarum were the most frequently occurring species. Under field conditions, several trichothecenes were detected in each of three commonly used building materials, heavily contaminated with S. chartarum. Under experimental conditions, four out of five isolates of S. chartarum produced satratoxin H and G when growing on new and old, very humid gypsum boards. A. versicolor produced the carcinogenic mycotoxin sterigmatocystin and 5-methoxysterigmatocystin under the same conditions. PMID:10347000

  12. Microfungal contamination of damp buildings--examples of risk constructions and risk materials.

    PubMed

    Gravesen, S; Nielsen, P A; Iversen, R; Nielsen, K F

    1999-06-01

    To elucidate problems with microfungal infestation in indoor environments, a multidisciplinary collaborative pilot study, supported by a grant from the Danish Ministry of Housing and Urban Affairs, was performed on 72 mold-infected building materials from 23 buildings. Water leakage through roofs, rising damp, and defective plumbing installations were the main reasons for water damage with subsequent infestation of molds. From a score system assessing the bioavailability of the building materials, products most vulnerable to mold attacks were water damaged, aged organic materials containing cellulose, such as wooden materials, jute, wallpaper, and cardboard. The microfungal genera most frequently encountered were Penicillium (68%), Aspergillus (56%), Chaetomium (22%), Ulocladium, (21%), Stachybotrys (19%) and Cladosporium (15%). Penicillium chrysogenum, Aspergillus versicolor, and Stachybotrys chartarum were the most frequently occurring species. Under field conditions, several trichothecenes were detected in each of three commonly used building materials, heavily contaminated with S. chartarum. Under experimental conditions, four out of five isolates of S. chartarum produced satratoxin H and G when growing on new and old, very humid gypsum boards. A. versicolor produced the carcinogenic mycotoxin sterigmatocystin and 5-methoxysterigmatocystin under the same conditions. PMID:10347000

  13. The Lactone form of stachybotrydial: a new inhibitor of dihydrofolate reductase from stachybotrys sp. FN298.

    PubMed

    Kwon, Yun-Ju; Sohn, Mi-Jin; Kim, Hyun-Ju; Kim, Won-Gon

    2014-01-01

    Dihydrofolate reductase (DHFR) has been confirmed to be a novel target for antibacterial drug development. In this study, we determined that a fungal metabolite from Stachybotrys sp. FN298 can inhibit the DHFR of Staphylococcus aureus. Its structure was identified as a lactone form of stachybotrydial using mass spectrometry and nuclear magnetic resonance analysis. This compound inhibited S. aureus DHFR with a half-maximal inhibitory concentration of 41 µM. It also prevented the growth of S. aureus and methicillin-resistant S. aureus (MRSA) with a minimum inhibitory concentration of 32 µg·mL(-1). To our knowledge, this is the first description of a DHFR inhibitor of microbial origin. The inhibitory function of the lactone form of stachybotrydial highlights its potential for development into a new broad-spectrum antibacterial agent and as an agent against MRSA. PMID:25087962

  14. Laboratory experiments on membrane filter sampling of airborne mycotoxins produced by Stachybotrys atra corda

    NASA Astrophysics Data System (ADS)

    Pasanen, A.-L.; Nikulin, M.; Tuomainen, M.; Berg, S.; Parikka, P.; Hintikka, E.-L.

    A membrane filter method for sampling of airborne stachybotrystoxins was studied in the laboratory. Toxigenic strains of Stachybotrys atra on wallpaper, grain, hay and straw were used as toxin sources in the experiments. Air samples were collected on cellulose nitrate and polycarbonate membrane filters at air flow rates of 10-20 ℓ min -1. After the filter sampling, the air was passed through methanol. The results showed that stachybotrystoxins (trichothecenes) were concentrated in airborne fungal propagules, and thus can be collected on filters. Polycarbonate filters with a pore size of 0.2 μm collected the highest percentage of toxic samples. The laboratory experiments indicated that polycarbonate filter sampling for the collection of airborne mycotoxins is a promising method for extension to field measurements.

  15. 53. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    53. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL MOLDS IN THE MORAVIAN POTTERY AND TILE WORKS COLLECTION, AND ARE USED TO PRESS TILES. THE FACTORY KEEPS TEN PRODUCTION MOLDS FOR EACH IMAGE. THE ORIGINAL MOLDS ARE NOT USED IN PRODUCTION. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  16. Comparative sampling molds evaluation

    SciTech Connect

    Pierrard, L.; Jarry, P.; Charbonnier, J.; Rigaut, C.

    1996-10-01

    The metallurgical industry needs to cast alloys with narrow tolerances in their chemical composition in order to reduce variability of their use properties. Therefore appropriate sampling practices and analytical methods are required. Both accuracy and precision of the analytical results are limited by the non-homogeneity of as-cast disk or cylinder samples, which results from macrosegregation phenomenon. This paper presents a comparison between six commonly used molds: four molds recommended by ASTM standards (center-pour molds type B and vacuum mold), mushroom shaped and cylinder molds. Two complementary approaches are exhibited for the different molds designs: (1) solidification modeling in order to predict macrosegregation localization using the Simulor software; (2) experimental characterization. Radial and axial segregation profiles are determined by Analytical Scanning Electron Microscopy in addition to analytical precision evaluation by spark optical emission and X-Ray fluorescence spectrometries for a given machining depth.

  17. Stachbotrys Root Rot

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Stachybotrys root rot is caused by Stachybotrys chartarum, a cellulytic saprophytic hyphomycete fungus. The pathogen produces mycotoxins including a host of immunosupressant compounds for human and is one of the causes of the "sick building syndrome." Although S. chartarum is rarely known as a plan...

  18. Molded Magnetic Article

    NASA Technical Reports Server (NTRS)

    Bryant, Robert G. (Inventor); Namkung, Min (Inventor); Wincheski, Russell A. (Inventor); Fulton, James P. (Inventor); Fox, Robert L. (Inventor)

    2000-01-01

    A molded magnetic article and fabrication method are provided. Particles of ferromagnetic material embedded in a polymer binder are molded under heat and pressure into a geometric shape. Each particle is an oblate spheroid having a radius-to-thickness aspect ratio approximately in the range of 15-30. Each oblate spheroid has flattened poles that are substantially in perpendicular alignment to a direction of the molding pressure throughout the geometric shape.

  19. Guide to Molds at School.

    ERIC Educational Resources Information Center

    Healthy Schools Network, Inc., Albany, NY.

    Asserting that molds growing in schools can be harmful to children's health and learning, this guide offers information about the issue. It provides an overview of the basics, then addresses testing, types of molds, molds and health, monitoring schools for mold, mold prevention and clean-up tips for schools, and what parents should do if they…

  20. BRITISH MOLDING MACHINE, PBQ AUTOMATIC COPE AND DRAG MOLDING MACHINE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    BRITISH MOLDING MACHINE, PBQ AUTOMATIC COPE AND DRAG MOLDING MACHINE MAKES BOTH MOLD HALVES INDIVIDUALLY WHICH ARE LATER ROTATED, ASSEMBLED, AND LOWERED TO POURING CONVEYORS BY ASSISTING MACHINES. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  1. Phenolic Molding Compounds

    NASA Astrophysics Data System (ADS)

    Koizumi, Koji; Charles, Ted; de Keyser, Hendrik

    Phenolic Molding Compounds continue to exhibit well balanced properties such as heat resistance, chemical resistance, dimensional stability, and creep resistance. They are widely applied in electrical, appliance, small engine, commutator, and automotive applications. As the focus of the automotive industry is weight reduction for greater fuel efficiency, phenolic molding compounds become appealing alternatives to metals. Current market volumes and trends, formulation components and its impact on properties, and a review of common manufacturing methods are presented. Molding processes as well as unique advanced techniques such as high temperature molding, live sprue, and injection/compression technique provide additional benefits in improving the performance characterisitics of phenolic molding compounds. Of special interest are descriptions of some of the latest innovations in automotive components, such as the phenolic intake manifold and valve block for dual clutch transmissions. The chapter also characterizes the most recent developments in new materials, including long glass phenolic molding compounds and carbon fiber reinforced phenolic molding compounds exhibiting a 10-20-fold increase in Charpy impact strength when compared to short fiber filled materials. The role of fatigue testing and fatigue fracture behavior presents some insight into long-term reliability and durability of glass-filled phenolic molding compounds. A section on new technology outlines the important factors to consider in modeling phenolic parts by finite element analysis and flow simulation.

  2. Rapid mold replication

    SciTech Connect

    Heestand, G.M.; Beeler, R.G. Jr.; Brown, D.L.

    1995-06-01

    The desire to reduce tooling costs have driven manufacturers to investigate new manufacturing methods and materials. In the plastics injection molding industry replicating molds to meet production needs is time consuming (up to 6 months) and costly in terms of lost business. We have recently completed a feasibility study demonstrating the capability of high rate Electron Beam Physical Vapor Deposition (EBPVD) in producing mold inserts in days, not months. In the current practice a graphite mandrel, in the shape of the insert`s negative image, was exposed to a jet of metal vapor atoms emanating from an electron beam heated source of an aluminum-bronze alloy. The condensation rate of the metal atoms on the mandrel was sufficient to allow the deposit to grow at over 30 {mu}m/min or 1.2 mils per minute. The vaporization process continued for approximately 14 hours after which the mandrel and deposit were removed from the EBPVD vacuum chamber. The mandrel and condensate were easily separated resulting in a fully dense aluminum-bronze mold insert about 2.5 cm or one inch thick. This mold was subsequently cleaned and drilled for water cooling passages and mounted on a fixture for operation in an actual injection molding machine. Results of the mold`s operation were extremely successful showing great promise for this technique. This paper describes the EBPVD feasibility demonstration in more detail and discusses future development work needed to bring this technique into practice.

  3. Silicon micro-mold

    DOEpatents

    Morales, Alfredo M.

    2006-10-24

    The present invention describes a method for rapidly fabricating a robust 3-dimensional silicon-mold for use in preparing complex metal micro-components. The process begins by depositing a conductive metal layer onto one surface of a silicon wafer. A thin photoresist and a standard lithographic mask are then used to transfer a trace image pattern onto the opposite surface of the wafer by exposing and developing the resist. The exposed portion of the silicon substrate is anisotropically etched through the wafer thickness down to conductive metal layer to provide an etched pattern consisting of a series of rectilinear channels and recesses in the silicon which serve as the silicon micro-mold. Microcomponents are prepared with this mold by first filling the mold channels and recesses with a metal deposit, typically by electroplating, and then removing the silicon micro-mold by chemical etching.

  4. Silicone plesiotherapy molds

    SciTech Connect

    Karolis, C.; Reay-Young, P.S.; Walsh, W.; Velautham, G.

    1983-04-01

    Plesiotherapy, the treatment of superficial lesions by radioactive molds has largely been replaced by teletherapy techniques involving high energy photon and electron beams. There are, however, situations for which a short distance type treatment, in one form or another, is superior to any other presently available. Traditionally, molds have taken the form of rigid devices incorporating clamps to attach them to the patient. This ensures a reproducible geometry about a localized region since the molds are applied on a daily basis. To make such devices requires considerable skill and patience. This article describes an alternative method that eliminates the use of cumbersome devices in many situations. Silicone molds made from a plaster cast model have been found suitable for the treatment of surface lesions and especially for lesions in the oral and nasal cavities. With the use of radioactive gold seeds the molds may be left in place for a few days without fear of them moving.

  5. Glass molding process with mold lubrication

    DOEpatents

    Davey, Richard G.

    1978-06-27

    Improvements are provided in glass forming processes of the type wherein hot metal blank molds are employed by using the complementary action of a solid film lubricant layer, of graphite dispersed in a cured thermoset organopolysiloxane, along with an overspray of a lubricating oil.

  6. Resin film infusion mold tooling and molding method

    NASA Technical Reports Server (NTRS)

    Burgess, Roger (Inventor); Grossheim, Brian (Inventor); Mouradian, Karbis (Inventor); Thrash, Patrick J. (Inventor)

    1999-01-01

    A mold apparatus and method for resin film infusion molding including an outer mold tool having a facing sheet adapted to support a resin film and preform assembly. The facing sheet includes attachment features extending therefrom. An inner mold tool is positioned on the facing sheet to enclose the resin film and preform assembly for resin film infusion molding. The inner mold tool includes a plurality of mandrels positioned for engagement with the resin film and preform assembly. Each mandrel includes a slot formed therein. A plurality of locating bars cooperate with the slots and with the attachment features for locating the mandrels longitudinally on the outer mold tool.

  7. 92. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    92. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL MOLDS IN THE MORAVIAN POTTERY AND TILE WORKS COLLECTION, AND ARE USED TO PRESS TILES. THE FACTORY KEEPS TEN PRODUCTION MOLDS FOR EACH IMAGE. THE ORIGINAL MOLDS ARE NOT USED IN PRODUCTION. SAME VIEW AS PA-107-53. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  8. SMTP (Stachybotrys microspora triprenyl phenol) enhances clot clearance in a pulmonary embolism model in rats

    PubMed Central

    2012-01-01

    Background Stachybotrys microspora triprenyl phenols (SMTPs) are a novel family of small molecules that enhance both activation and fibrin-binding of plasminogen. While their effects on fibrinolysis have been characterized in vitro, little is known about their activity in vivo with respect to plasminogen activation and blood clot clearance. Results To select a potent SMTP congener for the evaluation of its action in vitro and in vivo, we tested several SMTP congeners with distinct structural properties for their effects on plasminogen activation. As a result, SMTP-7 (orniplabin) was found to have distinguished activity. Several lines of biochemical evidence supported the idea that SMTP-7 acted as a plasminogen modulator. SMTP-7 elevated plasma level of plasmin-α2-antiplasmin complex, an index of plasmin formation in vivo, 1.5-fold in mice after the intravenous injections at doses of 5 and 10 mg kg-1. In a rat pulmonary embolism model, SMTP-7 (5 mg kg-1) enhanced the rate of clot clearance ~3-fold in the absence of exogenous plasminogen activator. Clot clearance was enhanced further by 5 mg kg-1 of SMTP-7 in combination with single-chain urokinase-type plasminogen activator. Conclusions Our results show that SMTP-7 is a superior plasminogen modulator among the SMTP family compounds and suggest that the agent enhances plasmin generation in vivo, leading to clearance of thrombi in a model of pulmonary embolism. PMID:22230042

  9. Mold After a Disaster

    MedlinePlus

    ... Health Matters What's New Preparation & Planning Disasters & Severe Weather Earthquakes Extreme Heat Floods Hurricanes Landslides Tornadoes Tsunamis ... Disaster Mold Removal After a Disaster Disasters & Severe Weather Earthquakes Extreme Heat Floods Hurricanes Landslides Tornadoes Tsunamis ...

  10. Breaking the Mold.

    ERIC Educational Resources Information Center

    Huckabee, Christopher

    2003-01-01

    Using the example of a Texas elementary school, describes how to eliminate mold and mildew from school facilities, including discovering the problem, responding quickly, reconstructing the area, and crisis planning and prevention. (EV)

  11. Newborn head molding

    MedlinePlus

    ... molding. In: Graham JM, Sanchez-Lara PA, eds. Smiths' Recognizable Patterns of Human Deformation . 4th ed. Philadelphia, PA: Elsevier; 2016:chap 35. Smith J. Initial evaluation. In: Gleason CA, Devaskar SU, ...

  12. MOLDS FOR CASTING PLUTONIUM

    DOEpatents

    Anderson, J.W.; Miley, F.; Pritchard, W.C.

    1962-02-27

    A coated mold for casting plutonium comprises a mold base portion of a material which remains solid and stable at temperatures as high as the pouring temperature of the metal to be cast and having a thin coating of the order of 0.005 inch thick on the interior thereof. The coating is composed of finely divided calcium fluoride having a particle size of about 149 microns. (AEC)

  13. TENDING THE MOLD, DURING THE TRANSFER FROM TUNDISH TO MOLD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    TENDING THE MOLD, DURING THE TRANSFER FROM TUNDISH TO MOLD TO CONTAINMENT CHAMBER IS CONTINUOUS CASTING OPERATOR, CALVIN ANDERS. - U.S. Steel, Fairfield Works, Continuous Caster, Fairfield, Jefferson County, AL

  14. Pressure molding of powdered materials improved by rubber mold insert

    NASA Technical Reports Server (NTRS)

    1964-01-01

    Pressure molding tungsten microspheres is accomplished by applying hydraulic pressure to a silicone rubber mold insert with several barrel shaped chambers which is placed in a steel die cavity. This technique eliminates castings containing shear fractures.

  15. FILLING MOLDS MADE ON THE BRITISH MOLDING MACHINE, AUTOMATIC COPE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    FILLING MOLDS MADE ON THE BRITISH MOLDING MACHINE, AUTOMATIC COPE AND DRAG (BMM) FROM MOBILE LADLE. EMPTY BULL LADLE IN FOREGROUND. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  16. Bag molding processes

    NASA Astrophysics Data System (ADS)

    Slobodzinsky, A.

    Features, materials, and techniques of vacuum, pressure, and autoclave FRP bag molding processes are described. The bags are used in sealed environments, inflated to flexibly force a curing FRP laminate to conform to a stiff mold form which defines the shape of the finished product. Densification is achieved as the bag presses out the voids and excess resin from the laminate, and consolidation occurs as the plies and adherends are bonded by the bag pressure. Curing techniques nominally involved room temperature or high temperature, and investigations of alternative techniques, such as induction, dielectric, microwave, xenon flash, UV, electron beam, and gamma radiation heating are proceeding. Polysulfone is the most common thermoplastic. Details are given of mold preparations, peel plies or release films and fabrics, bagging techniques, and reusable venting blankets and silicone rubber bags.

  17. End moldings for cable dielectrics

    DOEpatents

    Roose, Lars D.

    2000-01-01

    End moldings for high-voltage cables are described wherein the dielectric insulator of the cable is heated and molded to conform to a desired shape. As a consequence, high quality substantially bubble-free cable connectors suitable for mating to premanufactured fittings are made. Disclosed is a method for making the cable connectors either in the field or in a factory, molds suitable for use with the method, and the molded cable connectors, themselves.

  18. Molding process for imidazopyrrolone polymers

    NASA Technical Reports Server (NTRS)

    Johnson, C. L. (Inventor)

    1973-01-01

    A process is described for producing shaped articles of imidazopyrrolone polymers comprising molding imidazopyrrolone polymer molding power under pressure and at a temperature greater than 475 C. Moderate pressures may be employed. Preferably, prior to molding, a preform is prepared by isostatic compression. The preform may be molded at a relatively low initial pressure and temperature; as the temperature is increased to a value greater than 475 C., the pressure is also increased.

  19. REFRACTORY COATING FOR GRAPHITE MOLDS

    DOEpatents

    Stoddard, S.D.

    1958-06-24

    Refractory coating for graphite molds used in the casting of uranium is described. The coating is an alumino-silicate refractory composition which may be used as a mold surface in solid form or as a coating applied to the graphite mold. The composition consists of a mixture of ball clay, kaolin, alumina cement, alumina, water, sodium silicate, and sodium carbonate.

  20. MOLDED SEALING ELEMENT

    DOEpatents

    Bradford, B.W.; Skinner, W.J.

    1959-03-24

    Molded sealing elements suitable for use under conditions involving exposure to uranium hexafluoride vapor are described. Such sealing elements are made by subjecting graphitic carbons to a preliminary treatment with uranium hexafluoride vapor, and then incorporating polytetrafluorethylene in them. The resulting composition has good wear resistant and frictional properties and is resistant to disintegration by uranium hexafluoride over long periods of exposure.

  1. White Mold of Chickpea

    Technology Transfer Automated Retrieval System (TEKTRAN)

    White mold of chickpea can occur at either seedling stage or at flowering and pod filling stages. At seedling stage, the disease occurs at the base of the stem causing symptoms like collar rot. Often white mycelial growth around the stem on soil surface is visible. Affected plants wilt and die. ...

  2. Process and mold for molding foamed plastic articles

    SciTech Connect

    Baumrucker, E.J.

    1984-10-30

    A method for forming foamed plastic articles which includes the steps of closing a mold; prepressurizing the mold cavity with gas to prevent premature diffusion of blowing gas from the material injected into the cavity; injecting a short shot of molten synthetic resin material containing a blowing agent into the cavity; venting a portion of the prepressurization gas during the injection step; and venting the remaining prepressurization gas from the mold cavity to a vacuum chamber means to allow expansion of the injected foamable resin material within the mold cavity, the vacuum drawing the resin material throughout the mold cavity. In addition, the vacuum chamber is coupled to the mold cavity through plural spaced passageways so that the vacuum is drawn at various locations throughout the cavity to thereby enhance the complete filling of the cavity with the injected material as it expands. The mold is vented following the injection step automatically at the expiration of a predetermined time following the closing of a nozzle of the injection apparatus. A mold for carrying out the process includes improved gas flow means for delivering gas to and venting gas from the mold cavity. The mold also includes improved sealing means for sealing the mold to maintain it in a pressurized state as desired.

  3. Nonpost mold cure compound

    NASA Astrophysics Data System (ADS)

    Hirata, Akihiro

    1997-08-01

    The recent low price trend of electronic products has made IC manufacturing efficiency a top priority in the semiconductor industry. Post mold cure (PMC) process, which generally involves heating the packages in the oven at 175 C for 4 to 8 hours, takes up much longer time than most other assembly processes. If this PMC process can be reduced or eliminated, semiconductor makers will be rewarded with a much higher cost merit. We define the purpose of Non-PMC as 'to get high reliability with suitable physical and electrical properties without PMC'. We compared carious properties of molding compound before and after PMC. We found that curing reaction has almost complete through DSC and C-NMR measurement, but several properties have not stabilized yet, and that not all properties after PMC were better than before PMC. We developed new grade of molding compound considering these facts. And we found that main factors to accomplish non-PMC compound are curability and flowability, and more, increasing of fundamental properties. To accomplish non-PMC, at first, molding compound need to have very high curability. Generally speaking, too high curability causes low flowability, and causes incomplete filing, wire sweep, pad shift, and weak adhesion to inner parts of IC packages. To prevent these failures, various compound properties were studied, and we achieved in adding good flowability to very high curable molding compound. Finally, anti-popcorn property was improved by adding low moisture, high adhesion, high Tg, and high flexural strengths at high temperature. Through this study, we developed new compound grade for various package, especially large QFP using standard ECN resin.

  4. High Cost/High Risk Components to Chalcogenide Molded Lens Model: Molding Preforms and Mold Technology

    SciTech Connect

    Bernacki, Bruce E.

    2012-10-05

    This brief report contains a critique of two key components of FiveFocal's cost model for glass compression molding of chalcogenide lenses for infrared applications. Molding preforms and mold technology have the greatest influence on the ultimate cost of the product and help determine the volumes needed to select glass molding over conventional single-point diamond turning or grinding and polishing. This brief report highlights key areas of both technologies with recommendations for further study.

  5. World Allergy Organization Study on Aerobiology for Creating First Pollen and Mold Calendar With Clinical Significance in Islamabad, Pakistan; A Project of World Allergy Organization and Pakistan Allergy, Asthma & Clinical Immunology Centre of Islamabad

    PubMed Central

    2012-01-01

    Pollen and mold allergies are highly problematic in Islamabad. This study was conducted to investigate the type and concentration of airborne pollens/molds causing allergic diseases in susceptible individuals. A volumetric spore trap (Burkard) was placed at the height of 11 m and ran continuously for 3 years. Once a week, the collecting drum was prepared by affixing Melinex tape with a double sided adhesive that was coated with a thin layer of silicone grease. Every Sunday at 9:00 AM the drum was replaced by another drum and the pollen/mold spores were removed and permanently mounted on slides. Using a microscope, the trapped particles were identified and recorded as counts per cubic meter of air per hour. From these data, the pollen and mold calendars were constructed and expressed as counts per cubic meter of air per day. Skin prick tests were performed on more than 1000 patients attending the Pakistan Allergy, Asthma & Clinical Immunology Centre of Islamabad. The results indicated that there were 2 main pollen plants that contributed to seasonal allergies. These were Broussonetia papyrifera and Cannabis sativa during the March/April season and the July/September season, respectively. Although mold spores were continuously detected throughout the year, the most prominent mold was undetected mold and unconfirmed mold species similar to Stachybotrys species, which was high from July to September/October. Two additional molds contributing to allergic reactions were Pithomyces species and Cladosporium species, which were active during January and April, with the latter also being detected between October and November. These results may prove beneficial to both patients and physicians in planning a therapeutic protocol for avoidance and amelioration. PMID:23283209

  6. Fabrication of Molded Magnetic Article

    NASA Technical Reports Server (NTRS)

    Bryant, Robert G. (Inventor); Namkung, Min (Inventor); Wincheski, Russell A. (Inventor); Fox, Robert L. (Inventor)

    2001-01-01

    A molded magnetic article and fabrication method are provided. Particles of ferromagnetic material embedded in a polymer binder are molded under heat and pressure into a geometric shape. Each particle is an oblate spheroid having a radius-to-thickness aspect ratio approximately in the range of 15-30. Each oblate spheroid has flattened poles that are substantially in perpendicular alignment to a direction of the molding pressure throughout the geometric shape.

  7. Low-pressure injection molding

    SciTech Connect

    Mangels, J.A. )

    1994-05-01

    Ceramic injection molding experienced a revival in the 1970s and 1980s with the application of ceramics for gas turbine components. Concurrently, techniques were being developed for the injection molding of powdered metal compositions into complex shaped articles. The impetus for the development of injection molding as a ceramic fabrication process lay in the potential to produce complex-shaped components to near-net shape. In the ceramic injection molding process, ceramic powders are processed to obtain the desired particle size, distribution and morphology and blended to obtain a homogeneous distribution. These powders are then mixed with the organic binders, generally in a heated, highshear mixer at temperatures above the melting point of the organic binders. The injection molding mix is pelletized, cooled and fed into an injection molding machine. The molding mix is reheated to a fluid state and injected under high pressure (7--70 MPa) into a die cavity. The molded part is removed from the tooling after the molding mix has solidified in the die. The organic binders are then removed from the component at temperatures up to 400 C, generally by some combination of wicking and thermal decomposition. Finally, the component is sintered to obtain its final ceramic properties, using conventional ceramic processes.

  8. Method for molding ceramic powders

    DOEpatents

    Janney, M.A.

    1990-01-16

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, where after the product may be sintered.

  9. Method for molding ceramic powders

    DOEpatents

    Janney, Mark A.

    1990-01-01

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, whereafter the product may be sintered.

  10. 8. VIEW OF A MOLD FOR PRECISION CASTING. THE MOLD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. VIEW OF A MOLD FOR PRECISION CASTING. THE MOLD WAS USED IN FOUNDRY OPERATIONS THAT CAST PLUTONIUM EITHER AS INGOTS SUITABLE FOR ROLLING AND FURTHER WROUGHT PROCESSING OR INTO SHAPES AMENABLE TO DIRECT MACHINING OPERATIONS. (5/6/59) - Rocky Flats Plant, Plutonium Fabrication, Central section of Plant, Golden, Jefferson County, CO

  11. MOLD SPECIFIC QUANTITATIVE PCR: THE EMERGING STANDARD IN MOLD ANALYSIS

    EPA Science Inventory

    Today I will talk about the use of quantitative or Real time PCR for the standardized identification and quantification of molds. There are probably at least 100,000 species of molds or fungi. But there are actually about 100 typically found indoors. Some pose a threat to human...

  12. Mold Materials For Permanent Molding of Aluminum Alloys

    SciTech Connect

    John F Wallace; David Schwam; Wen Hong dxs11@po.cwru.edu

    2001-09-14

    A test that involves immersion of the potential mod materials for permanent molds has been developed that provides a thermal cycle that is similar to the experienced during casting of aluminum in permanent molds. This test has been employed to determine the relative thermal fatigue resistance of several different types of mold materials. Four commercial mold coatings have been evaluated for their insulating ability, wear resistance and roughness. The results indicate that composition and structure of the mold materials have considerable effect on their thermal fatigue cracking behavior. Irons with a gray iron structure are the most prone to thermal fatigue cracking followed by compacted graphite irons with the least thermal fatigue cracking of the cast irons experienced by ductile iron. The composition of these various irons affects their behavior.

  13. Processing studies in sheet molding compound compression molding

    NASA Astrophysics Data System (ADS)

    Abrams, Lisa Marie

    Due to its high strength to weight ratio, corrosion resistance, and low cost. Sheet Molding Compound (SMC) production offers great potential for growth in the automotive and trucking industry. Much attention is now being given to improving the economy of SMC compression molding by reducing the cycle time required to produce acceptable parts in steady production. One of the fastest growing applications of Sheet Molding Compound (SMC) compression molding panels is the manufacture of truck body panels. Due to their large size, the molding forces developed are substantial and have a major influence in the molding cycle. The relevant process models for SMC flow are reviewed and a procedure is developed that can be used to obtain the closing force and calculate the needed material parameters. Experiments were done using commercially made SMC varying quantities of glass, filler, and thickener to verify the validity of this model and the compression force was predicted for commercially made automotive hoods. It was found that glass and filler had a significant impact on the material parameters. When the amount of glass was increased, both material parameters m/deltan and eta increased. Similar trends were seen when increasing the amount of filler. For the thickener used in this research (magnesium oxide), it was found that it had minimal effect on the material parameters. Molding conditions and initial SMC charge configurations were also varied to see their effects on molding force and material parameters. Initial charge dimensions and volume as well as mold closing speed showed no effect on material parameters, while molding temperature showed a minimal effect. Material parameters were calculated for each SMC composition. These parameters were used to predict the compression force for the Corvette hood and Fiero hood. These predictions were compared with actual Corvette and Fiero hoods manufactured in industry. They predicted the commercially made parts quite well.

  14. Twistable mold for helicopter blades

    NASA Technical Reports Server (NTRS)

    Carter, E. S.; Kiely, E. F.

    1972-01-01

    Design is described of mold for fabrication of blades composed of sets of aerodynamic shells having same airfoil section characteristics but different distributions. Mold consists of opposing stacks of thin templates held together by long bolts. When bolts are loosened, templates can be set at different positions with respect to each other and then locked in place.

  15. Thermophilic molds: Biology and applications.

    PubMed

    Singh, Bijender; Poças-Fonseca, Marcio J; Johri, B N; Satyanarayana, Tulasi

    2016-11-01

    Thermophilic molds thrive in a variety of natural habitats including soils, composts, wood chip piles, nesting materials of birds and other animals, municipal refuse and others, and ubiquitous in their distribution. These molds grow in simple media containing carbon and nitrogen sources and mineral salts. Polyamines are synthesized in these molds and the composition of lipids varies considerably, predominantly containing palmitic, oleic and linoleic acids with low levels of lauric, palmiotoleic and stearic acids. Thermophilic molds are capable of efficiently degrading organic materials by secreting thermostable enzymes, which are useful in the bioremediation of industrial wastes and effluents that are rich in oil, heavy metals, anti-nutritional factors such as phytic acid and polysaccharides. Thermophilic molds synthesize several antimicrobial substances and biotechnologically useful miscellaneous enzymes. The analysis of genomes of thermophilic molds reveals high G:C contents, shorter introns and intergenic regions with lesser repetitive sequences, and further confirms their ability to degrade agro-residues efficiently. Genetic engineering has aided in ameliorating the characteristics of the enzymes of thermophilic molds. This review is aimed at focusing on the biology of thermophilic molds with emphasis on recent developments in the analysis of genomes, genetic engineering and potential applications. PMID:26777293

  16. STANDARDIZED MOLD IDENTIFICATION AND ENUMERATION

    EPA Science Inventory

    There are probably at least 100,000 species of molds or fungi. But there are actually about 100 typically found indoors. Some pose a threat to humans and animals and others don't. We need to know what molds are present indoors and their concentrations. The older methods of cult...

  17. INDOOR MOLDS AND ALLERGIC POTENTIAL

    EPA Science Inventory

    Rationale: Damp/moldy environments have been associated with asthma exacerbation, but mold¿s role in allergic asthma induction is less clear. Recently, 5 molds were statistically associated with water-damaged asthmatic homes in the Cleveland area. The asthma exacerbation...

  18. A RAPID METHOD FOR THE EXTRACTION OF FUNGAL DNA FROM ENVIRONMENTAL SAMPLES: EVALUATION IN THE QUANTITATIVE ANALYSIS OF MEMNONIELLA ECHINATA CONIDIA USING REAL TIME DETECTION OF PCR PRODUCTS

    EPA Science Inventory

    New technologies are creating the potential for using nucleic acid sequence detection to perform routine microbiological analyses of environmental samples. Our laboratory has recently reported on the development of a method for the quantitative detection of Stachybotrys chartarum...

  19. INJECTION-MOLDING APPARATUS

    DOEpatents

    Lobell, G.M.

    1958-02-11

    This patent is drawn to an injection molding apparatus for producing a tube closed at one end wherein the normally unsupported end of the core located in the cavity during the injection of the molten material to fill the space between the core and cavity wall, which supporting means is automatically removed from operation during the forming of the closed end of the tube. This support means is a plug extending through the end of the core into a recess in the bottom of the cavity where the closed end of the tube is to be formed. The plug is spring pressed into said recess and is forced out of the recess by a slidable bushing at the top of the cavity which is moved against the force of the spring by the molten material when it fills the uppormost open end portion of the cavity, thereby permitting the closed end of the tube to be formed.

  20. Current status of mold immunotherapy.

    PubMed

    Dhillon, M

    1991-05-01

    There is evidence to suggest that molds can cause IgE-mediated upper respiratory tract disorders and immunotherapy is efficacious in a select group. The environmental sampling studies show a remarkably small numbers of molds accounting for a majority of the mold load in various diverse locations. These are Cladosporium, Basidiospores, Aspergillus, and Alternaria-Penicillin families. Basidiospores have been underreported in the older studies because of difficulties in their identification. Whether the absolute mold level is the most important factor leading to IgE formation and induction of upper respiratory tract symptoms is uncertain. Certainly, the majority of the studies are based on the assumption that the absolute level of mold in the environment is the most important factor leading to the development of symptoms, but this is not based on strong evidence. A major problem in the majority of the studies is a lack of standardization of extracts which may lead to false negatives on skin testing and thus produce variable data in population evaluations comparing the prevalence of mold to its ability to induce IgE production and symptoms. The best current trials to document the efficacy of mold immunotherapy have been with the standardized Cladosporium extract. Unfortunately, these results cannot be extrapolated to the commercially available mold extracts available in the United States either for immunotherapy or for skin testing. These extracts are highly variable in their potency, prone to high false negative rates, and at best serve as poor skin testing reagents and possibly even worse immunotherapy reagents. Adequately standardized mold reagents are urgently needed to determine whether the Cladosporium data can be extrapolated to them in any meaningful way. PMID:2035901

  1. Ceramic injection molding material analysis, modeling and injection molding simulation

    NASA Astrophysics Data System (ADS)

    Drummer, D.; Messingschlager, S.

    2014-05-01

    In comparison to unfilled polymers, a ceramic feedstocks has a very high viscosity, a very high heat conductivity and a different pvT-behavior. So far standard simulation tools for plastic injection molding are capable of simulating unfilled or fiber filled compounds with their typical low viscosity and heat conductivity etc. but not for very high ceramic powder filled polymers. This article shows an approach of preparing and adding ceramic feedstocks to standard injection molding tools. Two different feedstocks are used.

  2. Transfer molding of PMR-15 polyimide resin

    NASA Technical Reports Server (NTRS)

    Reardon, J. P.; Moyer, D. W.; Nowak, B. E.

    1985-01-01

    Transfer molding is an economically viable method of producing small shapes of PMR-15 polyimide. It is shown that with regard to flexural, compressive, and tribological properties transfer-molded PMR-15 polyimide is essentially equivalent to PMR-15 polyimide produced by the more common method of compression molding. Minor variations in anisotropy are predictable effects of molding design and secondary finishing operations.

  3. ILLUSTRATED HANDBOOK OF SOME COMMON MOLDS.

    ERIC Educational Resources Information Center

    CHANDLER, MARION N.

    THIS DOCUMENT IS A PICTURE GUIDE FOR THE IDENTIFICATION OF TEN COMMON MOLDS. IT IS DESIGNED FOR USE WITH THE ELEMENTARY SCIENCE STUDY UNIT "MICROGARDENING" AND IS SUGGESTED FOR UPPER ELEMENTARY GRADES. INCLUDED FOR EACH MOLD ARE COLOR PHOTOGRAPHS AND PHOTOMICROGRAPHS OF THE INTACT MOLD MASS AND OF THE MOLD'S SPORE PRODUCING STRUCTURES. ALSO…

  4. Rapid control of mold temperature during injection molding process

    NASA Astrophysics Data System (ADS)

    Liparoti, Sara; Hunag, Tsang Min; Sorrentino, Andrea; Titomanlio, Giuseppe; Cakmak, Mukerrem

    2015-05-01

    The control of mold surface temperature is an important factor that determines surface morphology and its dimension in thickness direction. It can also affect the frozen molecular orientation and the mold surface replicability in injection molded products. In this work, thin thermally active films were used to quickly control the mold surface temperature. In particular, an active high electrical conductivity carbon black loaded polyimide composites sandwiched between two insulating thin polymeric layers was used to condition the mold surface. By controlling the heating time, it was possible to control precisely the temporal variation of the mold temperature surface during the entire cycle. The surface heating rate was about 40°C/s and upon contact with the polymer the surface temperature decreased back to 40°C within about 5 s; the overall cycle time increased only slightly. The effect on cross section sample morphology of samples of iPP were analyzed and discussed on the basis of the recorded temperature evolution.

  5. Rapid control of mold temperature during injection molding process

    SciTech Connect

    Liparoti, Sara; Titomanlio, Giuseppe; Hunag, Tsang Min; Cakmak, Mukerrem; Sorrentino, Andrea

    2015-05-22

    The control of mold surface temperature is an important factor that determines surface morphology and its dimension in thickness direction. It can also affect the frozen molecular orientation and the mold surface replicability in injection molded products. In this work, thin thermally active films were used to quickly control the mold surface temperature. In particular, an active high electrical conductivity carbon black loaded polyimide composites sandwiched between two insulating thin polymeric layers was used to condition the mold surface. By controlling the heating time, it was possible to control precisely the temporal variation of the mold temperature surface during the entire cycle. The surface heating rate was about 40°C/s and upon contact with the polymer the surface temperature decreased back to 40°C within about 5 s; the overall cycle time increased only slightly. The effect on cross section sample morphology of samples of iPP were analyzed and discussed on the basis of the recorded temperature evolution.

  6. Purification and characterization of an extracellular exochitinase, beta-N-acetylhexosaminidase, from the fungal mycoparasite Stachybotrys elegans.

    PubMed

    Taylor, Greg; Jabaji-Hare, Suha; Charest, Pierre M; Khan, Wajahatullah

    2002-04-01

    The mycoparasite Stachybotrys elegans produces two exo- and one endo-acting chitinases when grown on chitin. We purified to homogeneity one of the exo-acting chitinases, beta-N-acetylhexosaminidase and partially characterized its physical and biochemical properties. The native enzyme has a molecular mass of 120 kDa when determined by gel filtration and 68 kDa by sodium dodecyl sulfate - polyacrylamide gel electrophoresis indicating that the native protein probably occurs as a dimer in solution. The purified beta-N-acetylhexosaminidase is most active at pH 5.0 and 40 degrees C and hydrolyzes the p-nitrophenyl-N-acetyl-beta-D-glucosaminide with apparent Km of 84.6 microM. Polyclonal antibodies raised against the 68-kDa beta-N-acetylhexosaminidase (NAG-68) indicated that the antibody is highly specific and recognizes the protein in crude filtrate preparation. This suggests that the protein is a not a proteolytic product of another protein. Western blot analysis showed that the activity of NAG-68 was induced when S. elegans was grown on purified cell wall fragments of its host, Rhizoctonia solani, as well as during antagonistic interaction of the mycoparasite and host when both were grown on synthetic medium with or without supplemental carbon source. PMID:12030703

  7. White mold of Jerusalem artichoke

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Jerusalem artichoke (Helianthus tuberosus) is a Native American food plant closely related to the common sunflower (Helianthus annuus). Tubers of Jerusalem artichoke are increasingly available in retail grocery outlets. White mold (Sclerotinia stem rot), caused by the fungus, Sclerotinia sclerotioru...

  8. Molded polymer solar water heater

    DOEpatents

    Bourne, Richard C.; Lee, Brian E.

    2004-11-09

    A solar water heater has a rotationally-molded water box and a glazing subassembly disposed over the water box that enhances solar gain and provides an insulating air space between the outside environment and the water box. When used with a pressurized water system, an internal heat exchanger is integrally molded within the water box. Mounting and connection hardware is included to provide a rapid and secure method of installation.

  9. Rotationally Molded Liquid Crystalline Polymers

    NASA Technical Reports Server (NTRS)

    Rogers, Martin; Stevenson, Paige; Scribben, Eric; Baird, Donald; Hulcher, Bruce

    2002-01-01

    Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers advantages of low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semi-rigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers.

  10. Rotationally Molded Liquid Crystalline Polymers

    NASA Technical Reports Server (NTRS)

    Rogers, Martin; Scribben, Eric; Baird, Donald; Hulcher, Bruce

    2002-01-01

    Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semirigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers. This paper will also highlight the interactions between academia and small businesses in developing new products and processes.

  11. Aerodynamic characteristics and respiratory deposition of fungal fragments

    NASA Astrophysics Data System (ADS)

    Cho, Seung-Hyun; Seo, Sung-Chul; Schmechel, Detlef; Grinshpun, Sergey A.; Reponen, Tiina

    The purpose of this study was to investigate the aerodynamic characteristics of fungal fragments and to estimate their respiratory deposition. Fragments and spores of three different fungal species ( Aspergillus versicolor, Penicillium melinii, and Stachybotrys chartarum) were aerosolized by the fungal spore source strength tester (FSSST). An electrical low-pressure impactor (ELPI) measured the size distribution in real-time and collected the aerosolized fungal particles simultaneously onto 12 impactor stages in the size range of 0.3-10 μm utilizing water-soluble ZEF-X10 coating of the impaction stages to prevent spore bounce. For S. chartarum, the average concentration of released fungal fragments was 380 particles cm -3, which was about 514 times higher than that of spores. A. versicolor was found to release comparable amount of spores and fragments. Microscopic analysis confirmed that S. chartarum and A. versicolor did not show any significant spore bounce, whereas the size distribution of P. melinii fragments was masked by spore bounce. Respiratory deposition was calculated using a computer-based model, LUDEP 2.07, for an adult male and a 3-month-old infant utilizing the database on the concentration and size distribution of S. chartarum and A. versicolor aerosols measured by the ELPI. Total deposition fractions for fragments and spores were 27-46% and 84-95%, respectively, showing slightly higher values in an infant than in an adult. For S. chartarum, fragments demonstrated 230-250 fold higher respiratory deposition than spores, while the number of deposited fragments and spores of A. versicolor were comparable. It was revealed that the deposition ratio (the number of deposited fragments divided by that of deposited spores) in the lower airways for an infant was 4-5 times higher than that for an adult. As fungal fragments have been shown to contain mycotoxins and antigens, further exposure assessment should include the measurement of fungal fragments for

  12. Experimental study of glass molding process and transcription characteristics of mold surface in molding of aspheric glass lenses

    NASA Astrophysics Data System (ADS)

    Cha, Du Hwan; Park, Heung Su; Hwang, Yeon; Kim, Jeong-Ho; Kim, Hye-Jeong

    2011-03-01

    The effects of the process parameters in the molding of aspheric glass lenses for camera phone modules have been investigated experimentally and the surface topographies of the mold and the molded lens were compared to ascertain the transcription characteristics. The molding conditions were optimized with respect to the form error (PV) (the response variable) of the molded lens. The experimental conditions were obtained by employing a factorial design method. From the analysis of variance (ANOVA) and P-value (significance level), the slow cooling rate was found to affect the response variable most significantly. For the form topography, the lens molded under the optimum molding condition showed a transcription ratio of 93.4% against the mold.

  13. Flow behavior in liquid molding

    NASA Technical Reports Server (NTRS)

    Hunston, D.; Phelan, F.; Parnas, R.

    1992-01-01

    The liquid molding (LM) process for manufacturing polymer composites with structural properties has the potential to significantly lower fabrication costs and increase production rates. LM includes both resin transfer molding and structural reaction injection molding. To achieve this potential, however, the underlying science base must be improved to facilitate effective process optimization and implementation of on-line process control. The National Institute of Standards and Technology (NIST) has a major program in LM that includes materials characterization, process simulation models, on-line process monitoring and control, and the fabrication of test specimens. The results of this program are applied to real parts through cooperative projects with industry. The key feature in the effort is a comprehensive and integrated approach to the processing science aspects of LM. This paper briefly outlines the NIST program and uses several examples to illustrate the work.

  14. Staged mold for encapsulating hazardous wastes

    DOEpatents

    Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

    1988-01-01

    A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

  15. Staged mold for encapsulating hazardous wastes

    DOEpatents

    Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

    1990-01-01

    A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

  16. Contamination Barrier For Contour-Molding Material

    NASA Technical Reports Server (NTRS)

    Adams, James F.

    1988-01-01

    Release agent prevents molding compound from adhering to or contaminating surface. Cleaning agent, Turco 4215 NCLT, forms barrier preventing silicone molding compound from sticking to surface and leaving contaminating residue. Also see MFS-29243.

  17. MOLD-SPECIFIC QUANTITATIVE PCR: THE EMERGING STANDARD IN MOLD ANALYSIS

    EPA Science Inventory

    Molds can cause health problems like infections and allergies, destroy crops, and contaminate our food or pharmaceuticals. We can't avoid molds. Molds are essential players in the biological processes on earth, but we can now identify and quantify the molds that will be most pr...

  18. Blow molding of melt processible rubber

    SciTech Connect

    Abell, W.R.; Stuart, R.E.; Myrick, R.E.

    1991-07-01

    This article discusses the advantages of making hollow rubber parts by blow molding thermoplastic elastomers (TPEs) versus conventional rubber processing. It describes the various types of blow molding processes and it provides some insight into the rheological properties of melt processible rubber (MPR) and how MPR should be molded by each of these processes. A number of blow molded applications for MPR are also discussed.

  19. Making Internal Molds Of Long, Curved Tubes

    NASA Technical Reports Server (NTRS)

    Burley, Richard K.

    1989-01-01

    Mold material carried to internal weld joint and removed after impression taken. Remotely operated device makes impression mold of interior surface of tube at weld joint. Mold provides indication of extent of mismatch between members at joint. Maneuvered to weld inspected through curved tube 3 in. in diameter by 50 in. long. Readily adapted to making molds to measure depth of corrosion in boiler tubes or other pipes.

  20. The Mold that Almost Ate the Principal

    ERIC Educational Resources Information Center

    Barry, Wayne; Bishop, Chuck; Byars, Jennifer

    2006-01-01

    New-building mold was a bane for many home construction companies and new homeowners during the 1990s. It was not unusual to read or watch the news and see the tragedy played out in one's local community. Untold, however, is the story of the toll new-building mold can take on school systems and their principals, especially as these mold problems…

  1. Planning an Injection Mold Design Training Program.

    ERIC Educational Resources Information Center

    Allyn, Edward P.

    With the increased use of plastics worldwide the shortage of trained personnel in moldmaking and design for plastic injection molds is becoming critical. Local schools and community colleges should provide courses in mold design and mold making, since most workers presently learn while working under experienced designers on the job. Following this…

  2. Injection Molding of Plastics from Agricultural Materials

    SciTech Connect

    Bhattacharya, M.; Ruan, R.

    2001-02-22

    The objective of this research was to conduct a systematic study to relate injection molding parameters to properties of blends of starch and synthetic polymer. From this study, we wished to develop a thorough understanding of the injection molding process and gain significant insight into designing molds and aiding in developing products cheaply and efficiently.

  3. Attack of the Killer Mold Spores.

    ERIC Educational Resources Information Center

    Moore, Mary

    1999-01-01

    Describes experiences at the Arkansas State University at Jonesboro library when mold was discovered in a large portion of the monograph collection. Discusses causes of mold formation, equipment needed, news media coverage, staff involvement in the cleanup, and possible health hazards from mold. (LRW)

  4. Gray Mold or Botrytis Blight

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gray mold, caused by Botrytis cinerea can cause an intermittent decay of leaves or seed production organs of beet. The disease is not usually economically important on sugar beet, but can be severe enough to need control on swiss chard. This chapter describes the disease and pathogen and mentions ...

  5. ALLERGIC POTENTIAL OF INDOOR MOLDS

    EPA Science Inventory

    Many fungi have been associated with allergic lung disease, but few are well studied and even fewer allergens of fungal origin are well characterized. Exposure to damp moldy environments has been associated with the exacerbation of asthma, but the role of molds in the induction o...

  6. ANIMAL MODELS OF MOLD ALLERGY

    EPA Science Inventory

    The concept of molds as causative agents for allergy/asthma is not new. In fact many fungal genera have been associated with allergic lung disease, but only a few fungi are well studied and even fewer fungal allergens well characterized. The complexity and variety of fungal pro...

  7. Molded Concrete Center Mine Wall

    NASA Technical Reports Server (NTRS)

    Lewis, E. V.

    1987-01-01

    Proposed semiautomatic system forms concrete-foam wall along middle of coal-mine passage. Wall helps support roof and divides passage into two conduits needed for ventilation of coal face. Mobile mold and concrete-foam generator form sections of wall in place.

  8. Is Mold the New Asbestos?

    ERIC Educational Resources Information Center

    Colgan, Craig

    2003-01-01

    Mold and indoor air quality (IAQ) are matters of major concern to architects and their educational clients. The Environmental Protection Agency's Indoor Air Quality Tools for Schools program offers help to districts seeking to tackle IAQ issues. Strengthening community relations is one way to be ready in case of a bad environmental or IAQ report.…

  9. Injection molding ceramics to high green densities

    NASA Technical Reports Server (NTRS)

    Mangels, J. A.; Williams, R. M.

    1983-01-01

    The injection molding behavior of a concentrated suspension of Si powder in wax was studied. It was found that the injection molding behavior was a function of the processing techniques used to generate the powder. Dry ball-milled powders had the best molding behavior, while air classified and impact-milled powders demonstrated poorer injection moldability. The relative viscosity of these molding batches was studied as a function of powder properties: distribution shape, surface area, packing density, and particle morphology. The experimental behavior, in all cases, followed existing theories. The relative viscosity of an injection molding composition composed of dry ball-milled powders could be expressed using Farris' relation.

  10. HIGH TEMPERATURE REFRACTORY COATING FOR GRAPHITE MOLDS

    DOEpatents

    Stoddard, S.D.

    1958-10-21

    An improved foundry mold coating for use with graphite molds used in the casting of uranium is presented. The refractory mold coating serves to keep the molten uranium from contact with graphite of the mold and thus prevents carbon pickup by the molten metal. The refractory coating is made by dry mixing certain specific amounts of aluminum oxide, bentonite, Tennessee ball clay, and a soluble silicate salt. Water is then added to the mixture and the suspension thus formed is applied by spraying onto the mold.

  11. Advanced manufacturing methods for chalcogenide molded optics

    NASA Astrophysics Data System (ADS)

    Cogburn, Gabriel

    2011-06-01

    As Chalcogenide glass and Precision Molded Optics (PMO) have developed and matured to a point of being accepted as replacements for Germanium Single Point Diamond Turned (SPDT) optics; technological research is being dedicated to developing infrared PMO that can be used in a broader application base. These include laser arrays, large aperture molded chalcogenide optics, and molded in mount infrared optics. This paper presents applications for infrared laser arrays and the corresponding optics that must be closely mechanically mounted to avoid clipping the beams. Different molding and mounting techniques will be discussed to solve this issue which include; dicing chalcogenide optic lenses, molded in mount chalcogenide optics and stepped optic shape molding for mounting purposes. Accompanying the research and discussion of these techniques will be experiments and molded chalcogenide glass lenses showing the results and application for each lens type.

  12. Influence of mold length and mold heat transfer on horizontal continuous casting of nonferrous alloy rods

    NASA Astrophysics Data System (ADS)

    Verwijs, J. P.; Weckman, D. C.

    1988-04-01

    The influence of mold length and mold heat transfer on the conventional hot-top D.C. continuous casting process was studied through numerical simulations and experiments with horizontally cast 20 mm diameter lead and zinc rods. The minimum casting speed was found to be a nonlinear function of the mold length. For short molds, an inverse relationship between mold length and minimum casting speed was observed. However, the minimum casting speed for zinc cast from molds longer than 12 mm was constant at 2.5 mm/s. For lead cast in molds longer than 12 mm, the minimum observed casting speed was constant at 4.0 mm/s. The observed nonlinear relationship between minimum casting speed and mold length was predicted using a numerical model of the process. For this, an analytical expression for the mold boundary conditions was derived which included the influence of gas gap formation between the rod and the mold due to thermoelastic deformations of both the rod and the mold. Correlation between observed and predicted behavior was demonstrated for both the lead and zinc rods. Maximum casting speed was observed to increase with increased mold length; however, this speed was found to be critically dependent on process attributes such as mold and pinch wheel alignment and mold lubrication.

  13. Precision compression molding of chalcogenide glass optical elements

    NASA Astrophysics Data System (ADS)

    Qi, Chaowei; Ma, Tao; Chen, Fan

    2013-12-01

    Precision glass molding process (GMP) is a promising process to manufacture small precision optical elements in large volume. In this paper, we report on the fabrication of a molded chalcogenide glass lens as an optical element. A set of mold was designed and manufactured with silicon carbide material for the molding test. The structure of the mold set was semi-closed and detachable which can make the molded lens easy releasing with non-invasion. The surfaces of the mold cores are coated with thin protecting DLC film to relieve adhesion problem and increase the working life. Experiments were also performed using a precision glass molding machine Toshiba GMP-311V to determine the molding parameters i.e. molding temperature, pressure and cooling rate. The glass lens breakage during precision molding process was analyzed according to the glass property and the molding parameters. By modifying the mold design and optimization the processing parameters, ultimately achieve the desired molded lens.

  14. High Temperature Transfer Molding Resins

    NASA Technical Reports Server (NTRS)

    Connell, John W. (Inventor); Smith, Joseph G., Jr. (Inventor); Hergenrother, Paul M. (Inventor)

    2000-01-01

    High temperature resins containing phenylethynyl groups that are processable by transfer molding have been prepared. These phenylethynyl containing oligomers were prepared from aromatic diamines containing phenylethynyl groups and various ratios of phthalic anhydride and 4-phenylethynlphthalic anhydride in glacial acetic acid to form a mixture of imide compounds in one step. This synthetic approach is advantageous since the products are a mixture of compounds and consequently exhibit a relatively low melting temperature. In addition, these materials exhibit low melt viscosities which are stable for several hours at 210-275 C, and since the thermal reaction of the phenylethynyl group does not occur to any appreciable extent at temperatures below 300 C, these materials have a broad processing window. Upon thermal cure at approximately 300-350 C, the phenylethynyl groups react to provide a crosslinked resin system. These new materials exhibit excellent properties and are potentially useful as adhesives, coatings, films, moldings and composite matrices.

  15. Compression molding of aerogel microspheres

    DOEpatents

    Pekala, R.W.; Hrubesh, L.W.

    1998-03-24

    An aerogel composite material produced by compression molding of aerogel microspheres (powders) mixed together with a small percentage of polymer binder to form monolithic shapes in a cost-effective manner is disclosed. The aerogel composites are formed by mixing aerogel microspheres with a polymer binder, placing the mixture in a mold and heating under pressure, which results in a composite with a density of 50--800 kg/m{sup 3} (0.05--0.80 g/cc). The thermal conductivity of the thus formed aerogel composite is below that of air, but higher than the thermal conductivity of monolithic aerogels. The resulting aerogel composites are attractive for applications such as thermal insulation since fabrication thereof does not require large and expensive processing equipment. In addition to thermal insulation, the aerogel composites may be utilized for filtration, ICF target, double layer capacitors, and capacitive deionization. 4 figs.

  16. Compression molding of aerogel microspheres

    DOEpatents

    Pekala, Richard W.; Hrubesh, Lawrence W.

    1998-03-24

    An aerogel composite material produced by compression molding of aerogel microspheres (powders) mixed together with a small percentage of polymer binder to form monolithic shapes in a cost-effective manner. The aerogel composites are formed by mixing aerogel microspheres with a polymer binder, placing the mixture in a mold and heating under pressure, which results in a composite with a density of 50-800 kg/m.sup.3 (0.05-0.80 g/cc). The thermal conductivity of the thus formed aerogel composite is below that of air, but higher than the thermal conductivity of monolithic aerogels. The resulting aerogel composites are attractive for applications such as thermal insulation since fabrication thereof does not require large and expensive processing equipment. In addition to thermal insulation, the aerogel composites may be utilized for filtration, ICF target, double layer capacitors, and capacitive deionization.

  17. Onychomycosis due to opportunistic molds*

    PubMed Central

    Martínez-Herrera, Erick Obed; Arroyo-Camarena, Stefanie; Tejada-García, Diana Luz; Porras-López, Carlos Francisco; Arenas, Roberto

    2015-01-01

    BACKGROUND: Onychomycosis are caused by dermatophytes and Candida, but rarely by non- dermatophyte molds. These opportunistic agents are filamentous fungi found as soil and plant pathogens. OBJECTIVES: To determine the frequency of opportunistic molds in onychomycosis. METHODS: A retrospective analysis of 4,220 cases with onychomycosis, diagnosed in a 39-month period at the Institute of Dermatology and Skin surgery "Prof. Dr. Fernando A. Cordero C." in Guatemala City, and confirmed with a positive KOH test and culture. RESULTS: 32 cases (0.76%) of onychomycosis caused by opportunistic molds were confirmed. The most affected age group ranged from 41 to 65 years (15 patients, 46.9%) and females were more commonly affected (21 cases, 65.6%) than males. Lateral and distal subungual onychomycosis (OSD-L) was detected in 20 cases (62.5%). The microscopic examination with KOH showed filaments in 19 cases (59.4%), dermatophytoma in 9 cases (28.1%), spores in 2 cases (6.25%), and filaments and spores in 2 cases (6.25%). Etiologic agents: Aspergillus sp., 11 cases (34.4%); Scopulariopsis brevicaulis, 8 cases (25.0%); Cladosporium sp., 3 cases (9.4%); Acremonium sp., 2 cases (6.25%); Paecilomyces sp., 2 cases (6.25%); Tritirachium oryzae, 2 cases (6.25%); Fusarium sp., Phialophora sp., Rhizopus sp. and Alternaria alternate, 1 case (3.1%) each. CONCLUSIONS: We found onychomycosis by opportunistic molds in 0.76% of the cases and DLSO was present in 62.5%. The most frequent isolated etiological agents were: Aspergillus sp. and Scopulariopsis brevicaulis. PMID:26131862

  18. Recombinant expression of a GH12 β-glucanase carrying its own signal peptide from Stachybotrys atra in yeast and filamentous fungi.

    PubMed

    Picart, Pere; Orejas, Margarita; Pastor, F I Javier

    2016-08-01

    The β-glucanase Cel12A gene from Stachybotrys atra has been cloned and heterologously expressed in Aspergillus nidulans and Saccharomyces cerevisiae. The recombinant strains constructed, contained the exonic sequence of cel12A including its own signal peptide coding sequence. SDS-PAGE and zymography revealed that recombinant Cel12A has a molecular mass of 24 kDa which agrees with that deduced from its amino acid sequence, indicating that it is expressed in the non-glycosylated active form. Recombinant A. nidulans showed about eightfold greater activity yield than S. cerevisiae recombinant strain, namely 0.71 and 0.09 β-glucanase Units/ml of culture, respectively. In both host strains most of the activity was secreted to the extracellular media, evidencing the functionality of Cel12A signal peptide in yeast and fungi. This novel signal peptide might facilitate the expression and efficient secretion of other recombinant proteins difficult to secrete. PMID:27339304

  19. Success in chess mediated by mental molds.

    PubMed

    Hernández Hernández, Pedro; Rodríguez Mateo, Heriberto

    2006-11-01

    Research has revealed the impact of cognitive-affective strategies (Molds of the Mind) on subjective well-being, interpersonal relationships, or school achievement. However, it seems odd that such strategies could influence the success of chess players, because this game is usually considered to be influenced mainly by technical and cognitive skills. To examine the influence of cognitive-affective molds, 53 chess players, ages from 9 to 16 years old, enrolled in sport competitions, were assigned to two groups, high and low success. They responded to the MOLDES, designed to evaluate individuals' molds. The results show that the "Mental Molds" of the most successful players are more realistic, positive and regulators of the emotions, while the molds of the less successful players are more evasive, magical, defensive and inoperative. PMID:17296106

  20. Gating of Permanent Molds for ALuminum Casting

    SciTech Connect

    David Schwam; John F. Wallace; Tom Engle; Qingming Chang

    2004-03-30

    This report summarizes a two-year project, DE-FC07-01ID13983 that concerns the gating of aluminum castings in permanent molds. The main goal of the project is to improve the quality of aluminum castings produced in permanent molds. The approach taken was determine how the vertical type gating systems used for permanent mold castings can be designed to fill the mold cavity with a minimum of damage to the quality of the resulting casting. It is evident that somewhat different systems are preferred for different shapes and sizes of aluminum castings. The main problems caused by improper gating are entrained aluminum oxide films and entrapped gas. The project highlights the characteristic features of gating systems used in permanent mold aluminum foundries and recommends gating procedures designed to avoid common defects. The study also provides direct evidence on the filling pattern and heat flow behavior in permanent mold castings.

  1. Amorphous materials molded IR lens progress report

    NASA Astrophysics Data System (ADS)

    Hilton, A. R., Sr.; McCord, James; Timm, Ronald; Le Blanc, R. A.

    2008-04-01

    Amorphous Materials began in 2000 a joint program with Lockheed Martin in Orlando to develop molding technology required to produce infrared lenses from chalcogenide glasses. Preliminary results were reported at this SPIE meeting by Amy Graham1 in 2003. The program ended in 2004. Since that time, AMI has concentrated on improving results from two low softening glasses, Amtir 4&5. Both glasses have been fully characterized and antireflection coatings have been developed for each. Lenses have been molded from both glasses, from Amtir 6 and from C1 Core glass. A Zygo unit is used to evaluate the results of each molded lens as a guide to improving the molding process. Expansion into a larger building has provided room for five production molding units. Molded lens sizes have ranged from 8 mm to 136 mm in diameter. Recent results will be presented

  2. Hydrogen silsesquioxane mold coatings for improved replication of nanopatterns by injection molding

    NASA Astrophysics Data System (ADS)

    Hobæk, Thor Christian; Matschuk, Maria; Kafka, Jan; Pranov, Henrik J.; Larsen, Niels B.

    2015-03-01

    We demonstrate the replication of nanosized pillars in polymer (cyclic olefin copolymer) by injection molding using nanostructured thermally cured hydrogen silsesquioxane (HSQ) ceramic coatings on stainless steel mold inserts with mold nanostructures produced by a simple embossing process. At isothermal mold conditions, the average pillar height increases by up to 100% and a more uniform height distribution is observed compared to a traditional metal mold insert. Thermal heat transfer simulations predict that the HSQ film retards the cooling of the polymer melt during the initial stages of replication, thus allowing more time to fill the nanoscale cavities compared to standard metal molds. A monolayer of a fluorinated silane (heptadecafluorotrichlorosilane) deposited on the mold surface reduces the mold/polymer interfacial energy to support demolding of the polymer replica. The mechanical stability of thermally cured HSQ makes it a promising material for nanopattern replication on an industrial scale without the need for slow and energy intensive variotherm processes.

  3. Mold For Casting Radius-Inspection Specimens

    NASA Technical Reports Server (NTRS)

    Ball, Robert N.

    1988-01-01

    Thin replicas viewed on comparator without sectioning. New mold machined from piece of transparent poly(methyl methacrylate). Fits around base of post. Two slots machined into inner surface form channels for casting inspection sections. Bottom of mold fits flush against surface around bottom of post. When surface slanted, mold automatically aligns in proper orientation. Time required to inspect elliptical radii located at bottoms of series of small posts reduced from 18 hours to 3 hours.

  4. Mold in My School: What Do I Do?

    ERIC Educational Resources Information Center

    National Clearinghouse for Educational Facilities, Washington, DC.

    This publication provides information on the most important indoor mold-related health concerns and discusses how school districts can keep school facilities mold-free and avoid these problems. The document addresses when to be concerned, how molds cause health problems, symptoms caused by mold allergies, indoor molds that form toxins, who is most…

  5. Mold Cavity Roughness vs. Flow of Polymer

    NASA Astrophysics Data System (ADS)

    Stanek, Michal; Manas, Miroslav; Manas, David

    2009-07-01

    Injection molding represents such a way of polymer processing that requires injection of polymer melt into the mold cavity with very high injection rate. The fluidity of polymers is affected by many parameters (mold design, melt temperature, injection rate and pressure). The main objective of this paper is the study of influence of surface roughness of mold cavity of the polymer melts flow. Evaluation of set of data obtained by experiments where the testing conditions were widely changed shows that quality of cavity surface affects on the length of flow.

  6. Porous media heat transfer for injection molding

    DOEpatents

    Beer, Neil Reginald

    2016-05-31

    The cooling of injection molded plastic is targeted. Coolant flows into a porous medium disposed within an injection molding component via a porous medium inlet. The porous medium is thermally coupled to a mold cavity configured to receive injected liquid plastic. The porous medium beneficially allows for an increased rate of heat transfer from the injected liquid plastic to the coolant and provides additional structural support over a hollow cooling well. When the temperature of the injected liquid plastic falls below a solidifying temperature threshold, the molded component is ejected and collected.

  7. Mold Infections of the Central Nervous System

    PubMed Central

    McCarthy, Matthew; Rosengart, Axel; Schuetz, Audrey N.; Kontoyiannis, Dimitrios P.; Walsh, Thomas J.

    2016-01-01

    The recent outbreak of exserohilum rostratum meningitis linked to epidural injections of methylprednisolone acetate has brought renewed attention to mold infections of the central nervous system (CNS).1 Although uncommon, these infections are often devastating and difficult to treat. This focused review of the epidemiologic aspects, clinical characteristics, and treatment of mold infections of the CNS covers a group of common pathogens: aspergillus, fusarium, and scedosporium species, molds in the order Mucorales, and dematiaceous molds. Infections caused by these pathogen groups have distinctive epidemiologic profiles, clinical manifestations, microbiologic characteristics, and therapeutic implications, all of which clinicians should understand. PMID:25006721

  8. Indoor mold and Children's health

    PubMed

    Etzel; Rylander

    1999-06-01

    Reactive airways disease in children is increasing in many countries around the world. The clinical diagnosis of asthma or reactive airways disease includes a variable airflow and an increased sensitivity in the airways. This condition can develop after an augmented reaction to a specific agent (allergen) and may cause a life-threatening situation within a very short period of exposure. It can also develop after a long-term exposure to irritating agents that cause an inflammation in the airways in the absence of an allergen. (paragraph) Several environmental agents have been shown to be associated with the increased incidence of childhood asthma. They include allergens, cat dander, outdoor as well as indoor air pollution, cooking fumes, and infections. There is, however, increasing evidence that mold growth indoors in damp buildings is an important risk factor. About 30 investigations from various countries around the world have demonstrated a close relationship between living in damp homes or homes with mold growth, and the extent of adverse respiratory symptoms in children. Some studies show a relation between dampness/mold and objective measures of lung function. Apart from airways symptoms, some studies demonstrate the presence of general symptoms that include fatigue and headache and symptoms from the central nervous system. At excessive exposures, an increased risk for hemorraghic pneumonia and death among infants has been reported. (paragraph) The described effects may have important consequences for children in the early years of life. A child's immune system is developing from birth to adolescence and requires a natural, physiologic stimulation with antigens as well as inflammatory agents. Any disturbances of this normal maturing process will increase the risk for abnormal reactions to inhaled antigens and inflammagenic agents in the environment. (paragraph) The knowledge about health risks due to mold exposure is not widespread and health authorities in

  9. Use of acrylic sheet molds for elastomeric products

    NASA Technical Reports Server (NTRS)

    Heisman, R. M.; Koerner, A. E.; Messineo, S. M.

    1970-01-01

    Molds constructed of acrylic sheet are more easily machined than metal, are transparent to ensure complete filling during injection, and have smooth surfaces free of contamination. Technique eliminates flashing on molded parts and mold release agents.

  10. Plastic molds reduce cost of encapsulating electric cable connectors

    NASA Technical Reports Server (NTRS)

    Knott, D.

    1964-01-01

    Resin casting of the aluminum master pattern forms a plastic mold for encapsulating a cable connector. An elastomer is injected into the mold and cured. The mold is disassembled leaving an elastomeric encapsulation around the connector.

  11. Molding procedure for casting a variety of alloys

    NASA Technical Reports Server (NTRS)

    Fontes, M. J.; Kourtides, D.; Leibfritz, E. R.

    1970-01-01

    General procedure and molding sand composition for preparing molds usable for casting variety of alloys are developed. Molds are prepared from mixture of sand, sodium silicate binder, and organic liquid ester. Castings of radiographic quality are produced from various alloys.

  12. 1. INTERIOR VIEW OF MOLDING ROOM, NO. 2 WORKS, SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. INTERIOR VIEW OF MOLDING ROOM, NO. 2 WORKS, SHOWING BUCKET LINE FEEDING MOLDING MACHINES - Harbison-Walker Refractories Company, Molding Room, West end of Shirley Street, Mount Union, Huntingdon County, PA

  13. Commercial and Residential Water Damage: The Mold Connection.

    ERIC Educational Resources Information Center

    Williams, Del

    2002-01-01

    Describes the problem of toxic mold in residential and commercial property resulting from excess moisture. Includes common sources of unwanted moisture, design and construction flaws, determining the presence of mold, and advice for identifying and hiring reputable mold remediators. (PKP)

  14. Mold

    MedlinePlus

    ... Clin Immunol 130(1):267–270. 12 Chulada PC, Kennedy S, Mvula MM, Jaffee K, Wildfire J, Thornton ... 120(11): 1592–1599. 13 Grimsley LF, Chulada PC, Kennedy S, White L, Wildfire J, Cohn RD, Mitchell ...

  15. Process for Making Ceramic Mold

    NASA Technical Reports Server (NTRS)

    Buck, Gregory M. (Inventor); Vasquez, Peter (Inventor)

    2001-01-01

    An improved process for slip casting molds that can be more economically automated and that also exhibits greater dimensional stability is disclosed. The process involves subjecting an investment pattern, preferably made from wax, to successive cycles of wet-dipping in a slurry of colloidal, silica-based binder and dry powder-coating, or stuccoing with plaster of Paris or calcium sulfate mixtures to produce a multi-layer shell over the pattern. The invention as claimed entails applying a primary and a secondary coating to the investment pattern. At least two wet-dipping on in a primary slurry and dry-stuccoing cycles provide the primary coating, and an additional two wet-dippings and dry-stuccoing cycles provide the secondary, or back-up, coating. The primary and secondary coatings produce a multi-layered shell pattern. The multi-layered shell pattern is placed in a furnace first to cure and harden, and then to vaporize the investment pattern, leaving a detailed, high precision shell mold.

  16. Mold Remediation in Schools and Commercial Buildings.

    ERIC Educational Resources Information Center

    Environmental Protection Agency, Washington, DC. Office of Radiation and Indoor Air.

    This document describes how to investigate and evaluate moisture and mold problems in educational facilities, and presents the key steps for implementing a remediation plan. A checklist is provided for conducting mold remediation efforts along with a resource list of helpful organizations and governmental agencies. Appendices contain a glossary,…

  17. Particle Image Velocimetry During Injection Molding

    NASA Astrophysics Data System (ADS)

    Bress, Thomas; Dowling, David

    2012-11-01

    Injection molding involves the unsteady non-isothermal flow of a non-Newtonian polymer melt. An optical-access mold has been used to perform particle image velocimetry (PIV) on molten polystyrene during injection molding. Velocimetry data of the mold-filling flow will be presented. Statistical assessments of the velocimetry data and scaled residuals of the continuity equation suggest that PIV can be conducted in molten plastics with an uncertainty of +/-2 percent. Simulations are often used to model polymer flow during injection molding to design molds and select processing parameters but it is difficult to determine the accuracy of these simulations due to a lack of in-mold velocimetry and melt-front progression data. Moldflow was used to simulate the filling of the optical-access mold, and these simulated results are compared to the appropriately-averaged time-varying velocity field measurements. Simulated results for melt-front progression are also compared with the experimentally observed flow fronts. The ratio of the experimentally measured average velocity magnitudes to the simulation magnitudes was found on average to be 0.99 with a standard deviation of 0.25, and the difference in velocity orientations was found to be 0.9 degree with a standard deviation of 3.2 degrees. formerly at the University of Michigan.

  18. EXPOSURE OF CHILDREN TO INDOOR MOLDS

    EPA Science Inventory

    Children now spend more than 90% of their time indoors. Thus, any exposure to indoor pollutants may be critical to their health. Molds are one of the most important pollutants children are exposed to indoors. Molds produce hundreds of allergens and toxins. These products ha...

  19. Dynamic Feed Control For Injection Molding

    DOEpatents

    Kazmer, David O.

    1996-09-17

    The invention provides methods and apparatus in which mold material flows through a gate into a mold cavity that defines the shape of a desired part. An adjustable valve is provided that is operable to change dynamically the effective size of the gate to control the flow of mold material through the gate. The valve is adjustable while the mold material is flowing through the gate into the mold cavity. A sensor is provided for sensing a process condition while the part is being molded. During molding, the valve is adjusted based at least in part on information from the sensor. In the preferred embodiment, the adjustable valve is controlled by a digital computer, which includes circuitry for acquiring data from the sensor, processing circuitry for computing a desired position of the valve based on the data from the sensor and a control data file containing target process conditions, and control circuitry for generating signals to control a valve driver to adjust the position of the valve. More complex embodiments include a plurality of gates, sensors, and controllable valves. Each valve is individually controllable so that process conditions corresponding to each gate can be adjusted independently. This allows for great flexibility in the control of injection molding to produce complex, high-quality parts.

  20. 21ST CENTURY MOLD ANALYSIS IN FOOD

    EPA Science Inventory

    Traditionally, the indoor air community has relied on mold analysis performed by either microscopic observations or the culturing of molds on various media to assess indoor air quality. These techniques were developed in the 19th century and are very laborious and time consumin...

  1. Strong, easy-to-mold, spiral buttress thread

    NASA Technical Reports Server (NTRS)

    Heier, W. C.

    1971-01-01

    Buttress thread with steep taper connects two molded plastic cylinders without changing wall thickness or sacrificing longitudinal strength at the juncture. Technique lends itself to conventional molding methods.

  2. IC chip stress during plastic package molding

    SciTech Connect

    Palmer, D.W.; Benson, D.A.; Peterson, D.W.; Sweet, J.N.

    1998-02-01

    Approximately 95% of the world`s integrated chips are packaged using a hot, high pressure transfer molding process. The stress created by the flow of silica powder loaded epoxy can displace the fine bonding wires and can even distort the metalization patterns under the protective chip passivation layer. In this study the authors developed a technique to measure the mechanical stress over the surface of an integrated circuit during the molding process. A CMOS test chip with 25 diffused resistor stress sensors was applied to a commercial lead frame. Both compression and shear stresses were measured at all 25 locations on the surface of the chip every 50 milliseconds during molding. These measurements have a fine time and stress resolution which should allow comparison with computer simulation of the molding process, thus allowing optimization of both the manufacturing process and mold geometry.

  3. Castable plastic mold with electroplatable base

    DOEpatents

    Domeier, Linda A.; Morales, Alfredo M.; Gonzales, Marcela G.; Keifer, Patrick M.

    2004-01-20

    A sacrificial plastic mold having an electroplatable backing is provided as are methods of making such a mold via the infusion of a castable liquid formulation through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale master mold. Upon casting and demolding, the porous metal substrate is embedded within the cast formulation and projects a plastic structure with features determined by the mold tool. The plastic structure provides a sacrificial plastic mold mechanically bonded to the porous metal substrate, which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved, leaving the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

  4. Mold Simulator Study of the Initial Solidification of Molten Steel in Continuous Casting Mold: Part II. Effects of Mold Oscillation and Mold Level Fluctuation

    NASA Astrophysics Data System (ADS)

    Zhang, Haihui; Wang, Wanlin

    2016-04-01

    The surface quality of the continuous casting strands is closely related to the initial solidification of liquid steel in the vicinity of the mold meniscus, and thus the clear understanding of the behavior of molten steel initial solidification would be of great importance for the control of the quality of final slab. With the development of the mold simulator techniques, the complex interrelationship between the solidified shell surface profile, heat flux, shell thickness, mold level fluctuation, and the infiltrated slag film was well illustrated in our previous study. As the second part, this article investigated the effect of the mold oscillation frequency, stroke, and mold level fluctuation on the initial solidification of the molten steel through the conduction of five different experiments. Results suggested that in the case of the stable mold level, the oscillation marks (OMs) exhibit equally spaced horizon depressions on the shell surface, where the heat flux at the meniscus area raises rapidly during negative strip time (NST) period and the presence of each OMs on the shell surface is corresponding to a peak value of the heat flux variation rate. Otherwise, the shell surface is poorly defined by the existence of wave-type defects, such as ripples or deep depressions, and the heat flux variation is irregular during NST period. The rising of the mold level leads to the longer-pitch and deeper OMs formation; conversely, the falling of mold level introduces shorter-pitch and shallower OMs. With the increase of the mold oscillation frequency, the average value of the low-frequency heat flux at the meniscus increases; however, it decreases when the mold oscillation stroke increases. Additionally, the variation amplitude of the high-frequency temperature and the high-frequency heat flux decreases with the increase of the oscillation frequency and the reduction of the oscillation stroke.

  5. 40 CFR Table 3 to Subpart Wwww of... - Organic HAP Emissions Limits for Existing Open Molding Sources, New Open Molding Sources Emitting...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... mold is vented during spinning and cureb. resin application with the mold closed, and the mold is not vented during spinning and cure c. resin application with the mold open, and the mold is vented during spinning and cure d. resin application with the mold open, and the mold is not vented during spinning...

  6. 40 CFR Table 3 to Subpart Wwww of... - Organic HAP Emissions Limits for Existing Open Molding Sources, New Open Molding Sources Emitting...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... closed, and the mold is vented during spinning and cureb. resin application with the mold closed, and the mold is not vented during spinning and cure c. resin application with the mold open, and the mold is vented during spinning and cure d. resin application with the mold open, and the mold is not...

  7. 40 CFR Table 3 to Subpart Wwww of... - Organic HAP Emissions Limits for Existing Open Molding Sources, New Open Molding Sources Emitting...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... closed, and the mold is vented during spinning and cureb. resin application with the mold closed, and the mold is not vented during spinning and cure c. resin application with the mold open, and the mold is vented during spinning and cure d. resin application with the mold open, and the mold is not...

  8. 40 CFR Table 3 to Subpart Wwww of... - Organic HAP Emissions Limits for Existing Open Molding Sources, New Open Molding Sources Emitting...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... mold is vented during spinning and cureb. resin application with the mold closed, and the mold is not vented during spinning and cure c. resin application with the mold open, and the mold is vented during spinning and cure d. resin application with the mold open, and the mold is not vented during spinning...

  9. Characterization of fiberglass-filled diallyl phthalate plastic molding resins and molded parts

    SciTech Connect

    Whitaker, R.B.; Glaub, J.E.; Bonekowski, N.R.; Gillham, P.D.

    1980-12-01

    Characterization of diallyl phthalate (DAP) molding resins was undertaken by differential scanning calorimetry (DSC) and by combined size exclusion chromatography (SEC)/low angle laser light scattering (LALLS) in order to better predict moldability and storage life limits. Completeness of cure of molded parts, before and after any post-curing, was also determined by thermal analysis. Molecular weights and molecular weight distributions of the DAP molding resins by SEC/LALLS indicated that the better molding resins have lower M/sub w//M/sub n/ ratios. Association effects were observed, which could not be overcome by solvent modification alone. Determination of DAP molding resin heats of reaction by DSC indicated a linear relation between ..delta..H/sub R/ and weight percent filler for the good molding resins. DSC analyses of molded DAP parts showed that 95% cure was achieved in some as-molded parts, with a post-cure temperature of 165/sup 0/C being required to complete the cure to 100%. Thickness of the parts was a factor, with the thicker parts being 100% cured as molded. The glass transition temperature (T/sub g/) of the molded parts increased as cure was completed, to approx. 160 to 165/sup 0/C maximum. These results are consistent with a model of thermoset resin curing behavior which states that 100% cure can be achieved only if a post-curing operation is conducted above the T/sub g infinity/ (T/sub g/ at complete cure) of the polymer.

  10. Study on heat flux from resin to mold in injection molding process

    SciTech Connect

    Nishiwaki, Nobuhiko; Hori, Sankei

    1999-07-01

    Recently, an injection molding of thermoplastic is widely used in many industries, because this manufacturing method is very suitable for mass production. For injection molding processes, a number of software packages for simulating an injection molding process have been developed. It is assumed in these software packages that the heat transfer coefficient between the resin and the mold surface is constant at the filling or cooling stages. In general, when melted resin flows into the mold, heat is generated in the flowing resin because of the high viscosity at the filling stage. Moreover at the cooling stage, a separation of the molded part from the mold surface generally occurs because of shrinkage of the molded material. Therefore, the heat transfer coefficient has not been accurately obtained yet at these stages. In this paper, the temperature near the surface of the mold cavity has been experimentally measured, so the heat flux that flows from the resin to the mold has been able to be analytically estimated by an inverse conduction method. On the other hand, the separating behavior of the resin from the mold surface has been measured using an ultrasonic transducer attached to the outer surface of the stationary mold. The heat flux that flows from the resin to the mold has been analytically estimated. The apparent heat transfer coefficient can be obtained from the heat flux and the representative temperature difference, which is measured by an ultrasonic technique. It was discovered that the heat flux and the apparent heat transfer coefficient are hardly influenced by the separation.

  11. Residual stresses in injection molded products

    NASA Astrophysics Data System (ADS)

    Jansen, K. M. B.

    2015-12-01

    During the molding process residual stresses are formed due to thermal contraction during cooling as well as the local pressure history during solidification. In this paper a simple analytical model is reviewed which relates residual stresses, product shrinkage as well as warpage to the temperature and pressure histories during molding. Precise excimer laser layer removal measurements were performed to verify the predicted residual stress distributions. In addition, detailed shrinkage and warpage measurements on a large series of polymers and for different molding conditions were performed and are shown to compare well with the model predictions.

  12. Slimeware: engineering devices with slime mold.

    PubMed

    Adamatzky, Andrew

    2013-01-01

    The plasmodium of the acellular slime mold Physarum polycephalum is a gigantic single cell visible to the unaided eye. The cell shows a rich spectrum of behavioral patterns in response to environmental conditions. In a series of simple experiments we demonstrate how to make computing, sensing, and actuating devices from the slime mold. We show how to program living slime mold machines by configurations of repelling and attracting gradients and demonstrate the workability of the living machines on tasks of computational geometry, logic, and arithmetic. PMID:23834592

  13. Mucormycosis, Pseudallescheriasis, and Other Uncommon Mold Infections

    PubMed Central

    Quan, Clifford; Spellberg, Brad

    2010-01-01

    Serious infections due to non-Aspergillus molds are being encountered with increasing frequency. Factors likely responsible for the rise of these infections include aging populations in countries with advanced medical technologies, the resultant increase in incidence of many cancers, increasingly intensive myeloablative therapies for these cancers, increasingly intensive care for critically ill patients, and increases in the frequency of solid organ and hematopoietic stem cell transplantation. Although diagnostic and therapeutic modalities have improved, mortality rates for invasive mold infections remain high. In this review, we summarize current knowledge about non-Aspergillus mold infections of the chest, with a focus on risk factors, clinical features, diagnosis, and treatment. PMID:20463250

  14. RUN OUTS OCCUR WHEN IRON HAS UNSEATED MOLDING SAND AND ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    RUN OUTS OCCUR WHEN IRON HAS UNSEATED MOLDING SAND AND RUN OUT OF THE MOLD UNDER POURING JACKETS AND SPILLS ONTO THE MOLDING PLATFORM. WORKERS GENERALLY WAIT SEVERAL MINUTES FOR THE IRON TO SOLIDIFY AND, WHILE IT IS STILL RED-HOT, REMOVE IT FROM THE PLATFORM AND SCRAP THE MOLD. - Southern Ductile Casting Company, Centerville Foundry, 101 Airport Road, Centreville, Bibb County, AL

  15. INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER, R. L. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER, R. L. BRANDY MOLDING A RAIL CASTING (LAWLER NO. 1337, A 16' x 35' MOLD WITH A 5' COPE AND A 4' DRAG). DRAG IS FILLED WITH SAND. - Lawler Machine & Foundry Company, Molding Area, 760 North Forty-fourth Street, Birmingham, Jefferson County, AL

  16. Cloning, molecular characterization, and mRNA expression of the thermostable family 3 β-glucosidase from the rare fungus Stachybotrys microspora.

    PubMed

    Abdeljalil, Salma; Trigui-Lahiani, Héla; Lazzez, Houcine; Gargouri, Ali

    2013-07-01

    The filamentous fungus Stachybotrys microspora possess a rich β-glucosidase system composed of five β-glucosidases. Three of them were already purified to homogeneity and characterized. In order to isolate the β-glucosidase genes from S. microspora and study their regulation, a PCR strategy using consensus primers was used as a first step. This approach enabled the isolation of three different fragments of family 3 β-glucosidase gene. A representative genomic library was constructed and probed with one amplified fragment gene belonging to family 3 of β-glucosidase. After two rounds of hybridization, seven clones were obtained and the analysis of DNA plasmids leads to the isolation of one clone (CF3) with the largest insert of 7 kb. The regulatory region shows multiple TC-rich elements characteristic of constitutive promoter, explaining the expression of this gene under glucose condition, as shown by zymogram and RT-PCR analysis. The tertiary structure of the deduced amino acid sequence of Smbgl3 was predicted and has shown three conserved domains: an (α/β)8 triose phosphate isomerase (TIM) barrel, (α/β)5 sandwich, and fibronectin type III domain involved in protein thermostability. Zymogram analysis highlighted such thermostable character of this novel β-glucosidase. PMID:23242634

  17. Sacrificial Plastic Mold With Electroplatable Base

    DOEpatents

    Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.

    2005-08-16

    A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

  18. Sacrificial plastic mold with electroplatable base

    DOEpatents

    Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.

    2002-01-01

    A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

  19. Custom molded thermal MRg-FUS phantom

    NASA Astrophysics Data System (ADS)

    Eames, Matthew D. C.; Snell, John W.; Hananel, Arik; Kassell, Neal F.

    2012-11-01

    This article describes a method for creating custom-molded thermal phantoms for use with MR-guided focused ultrasound systems. The method is defined here for intracranial applications, though it may be modified for other anatomical targets.

  20. Antimicrobial Treatments of Indoor Mold and Bacteria

    EPA Science Inventory

    Biological contaminants especially mold in buildings are known to act as sources of indoor air pollution, discomfort, asthma and pulmonary disease to building occupants. Sick buildings are evidence of extremely problematic indoor air quality (IAQ), often resulting from unacceptab...

  1. Organic materials for ceramic molding processes

    NASA Technical Reports Server (NTRS)

    Saito, K.

    1984-01-01

    Ceramic molding processes are examined. Binders, wetting agents, lubricants, plasticizers, surface active agents, dispersants, etc., for pressing, rubber pressing, sip casting, injection casting, taping, extrusion, etc., are described, together with forming machines.

  2. Indoor Molds and Respiratory Hypersensitivity: A Comparison of Selected Molds and House Dust Mite Induced Responses in a Mouse Model**

    EPA Science Inventory

    Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases. Damp/moldy environments have been associated with asthma exacerbation, but mold's role in allergic asthma induction is less clear. The molds selected for these studies are commonl...

  3. Traditional Mold Analysis Compared to a DNA-based Method of Mold Analysis with Applications in Asthmatics' Homes

    EPA Science Inventory

    Traditional environmental mold analysis is based-on microscopic observations and counting of mold structures collected from the air on a sticky surface or culturing of molds on growth media for identification and quantification. A DNA-based method of mold analysis called mol...

  4. The biocontaminants and complexity of damp indoor spaces: more than what meets the eyes.

    PubMed

    Thrasher, Jack D; Crawley, Sandra

    2009-01-01

    Nine types of biocontaminants in damp indoor environments from microbial growth are discussed: (1) indicator molds; (2) Gram negative and positive bacteria; (3) microbial particulates; (4) mycotoxins; (5) volatile organic compounds, both microbial (MVOCs) and non-microbial (VOCs); (6) proteins; (7) galactomannans; (8) 1-3-beta-D-glucans (glucans) and (9) lipopolysaccharides (LPS--endotoxins). When mold species exceed those outdoors contamination is deduced. Gram negative bacterial endotoxins, LPS in indoor environments, synergize with mycotoxins. The gram positive Bacillus species, Actinomycetes (Streptomyces, Nocardia and Mycobacterium), produce exotoxins. The Actinomycetes are associated with hypersensitivity pneumonitis, lung and invasive infections. Mycobacterial mycobacterium infections not from M. tuberculosis are increasing in immunocompetent individuals. In animal models, LPS enhance the toxicity of roridin A, satratoxins G and aflatoxin B1 to damage the olfactory epithelium, tract and bulbs (roridin A, satratoxin G) and liver (aflatoxin B1). Aflatoxin B1 and probably trichothecenes are transported along the olfactory tract to the temporal lobe. Co-cultured Streptomyces californicus and Stachybotrys chartarum produce a cytotoxin similar to doxorubicin and actinomycin D (chemotherapeutic agents). Trichothecenes, aflatoxins, gliotoxin and other mycotoxins are found in dust, bulk samples, air and ventilation systems of infested buildings. Macrocyclic trichothecenes are present in airborne particles <2 microm. Trichothecenes and stachylysin are present in the sera of individuals exposed to S. chartarum in contaminated indoor environments. Haemolysins are produced by S. chartarum, Memnoniella echinata and several species of Aspergillus and Penicillium. Galactomannans, glucans and LPS are upper and lower respiratory tract irritants. Gliotoxin, an immunosuppressive mycotoxin, was identified in the lung secretions and sera of cancer patients with aspergillosis

  5. Mold contamination and air handling units.

    PubMed

    Wilson, Stephen C; Palmatier, Robert N; Andriychuk, Larysa A; Martin, Jared M; Jumper, Cynthia A; Holder, Homer W; Straus, David C

    2007-07-01

    An investigation was conducted on selected locations in air handling units (AHUs) to (a) identify common mold species found on these locations, (b) determine whether some locations (and subsets) featured mold growth sites more frequently than others, (c) ascertain whether the operating condition of AHUs is related to mold contamination, and (d) provide a basis for a microbial sampling protocol for AHUs. A total of 566 tape lifts and 570 swab samples were collected from the blower wheel fan blades, insulation, cooling coil fins, and ductwork from 25 AHUs. All AHU conditions were numerically rated using a heating, ventilation and air-conditioning (HVAC) survey. Results showed that Cladosporium sp. fungi were commonly recovered in terms of growth sites and deposited spores, and they were found mainly in the blower wheel fan blades, the ductwork, and the cooling coil fins. Subsections of the fan blades, insulation, and cooling coil fins showed no preferred area for mold growth sites. Other organisms such as Penicillium sp., Aspergillus sp., and Paecilomyces sp. were recovered from the cooling coil fins and insulation. Because of the widespread prevalence of Cladosporium sp., there was no relationship between mold growth and operating condition. However, the presence of different species of molds in locations other than the blower wheel blades may indicate that the AHU condition is not optimal. A suggested microbial sampling protocol including interpretations of sample results is presented. PMID:17487721

  6. Integrated mold/surface-micromachining process

    SciTech Connect

    Barron, C.C.; Fleming, J.G.; Montague, S.; Sniegowski, J.J.; Hetherington, D.L.

    1996-03-01

    We detail a new monolithically integrated silicon mold/surface-micromachining process which makes possible the fabrication of stiff, high-aspect-ratio micromachined structures integrated with finely detailed, compliant structures. An important example, which we use here as our process demonstration vehicle, is that of an accelerometer with a large proof mass and compliant suspension. The proof mass is formed by etching a mold into the silicon substrate, lining the mold with oxide, filling it with mechanical polysilicon, and then planarizing back to the level of the substrate. The resulting molded structure is recessed into the substrate, forming a planar surface ideal for subsequent processing. We then add surface-micromachined springs and sense contacts. The principal advantage of this new monolithically integrated mold/surface-micromachining process is that it decouples the design of the different sections of the device: In the case of a sensitive accelerometer, it allows us to optimize independently the proof mass, which needs to be as large, stiff, and heavy as possible, and the suspension, which needs to be as delicate and compliant as possible. The fact that the high-aspect-ratio section of the device is embedded in the substrate enables the monolithic integration of high-aspect-ratio parts with surface-micromachined mechanical parts, and, in the future, also electronics. We anticipate that such an integrated mold/surface micromachining/electronics process will offer versatile high-aspect-ratio micromachined structures that can be batch-fabricated and monolithically integrated into complex microelectromechanical systems.

  7. Gating of Permanent Molds for Aluminum Casting

    SciTech Connect

    David Schwam; John F. Wallace; Tom Engle; Qingming Chang

    2004-01-01

    This report summarizes a two-year project, DE-FC07-011D13983 that concerns the gating of aluminum castings in permanent molds. The main goal of the project is to improve the quality of aluminum castings produced in permanent molds. The approach taken was to determine how the vertical type gating systems used for permanent mold castings can be designed to fill the mold cavity with a minimum of damage to the quality of the resulting casting. It is evident that somewhat different systems are preferred for different shapes and sizes of aluminum castings. The main problems caused by improper gating are entrained aluminum oxide films and entrapped gas. The project highlights the characteristic features of gating systems used in permanent mold aluminum foundries and recommends gating procedures designed to avoid common defects. The study also provides direct evidence on the filling pattern and heat flow behavior in permanent mold castings. Equipment and procedure for real time X-Ray radiography of molten aluminum flow into permanent molds have been developed. Other studies have been conducted using water flow and behavior of liquid aluminum in sand mold using real time photography. This investigation utilizes graphite molds transparent to X-Rays making it possible to observe the flow pattern through a number of vertically oriented grating systems. These have included systems that are choked at the base of a rounded vertical sprue and vertical gating systems with a variety of different ingates into the bottom of a mold cavity. These systems have also been changed to include gating systems with vertical and horizontal gate configurations. Several conclusions can be derived from this study. A sprue-well, as designed in these experiments, does not eliminate the vena contracta. Because of the swirling at the sprue-base, the circulating metal begins to push the entering metal stream toward the open runner mitigating the intended effect of the sprue-well. Improved designs of

  8. Rapid control of mold temperature during injection molding process: Effect of packing pressure

    NASA Astrophysics Data System (ADS)

    Liparoti, Sara; Sorrentino, Andrea; Titomanlio, Giuseppe

    2015-12-01

    A thorough analysis of the effect of operative conditions of injection molding process on the morphology distribution inside the obtained molded is performed, with particular reference to semi- crystalline polymers. In particular, fully characterized injection molding tests are presented using an isotactic polypropylene, previously carefully characterized as far as most of properties of interest. The effects of mold temperature and packing conditions are analyzed. The mold temperature was controlled by a thin heating device, composed by polyimide as insulating layer and polyimide loaded carbon black as electrical conductive layer, that is able to increase temperature on mold surface in few seconds (70°C/s) by joule effect and cool down soon after. The shear layer thickness in the molded is reduced in the samples produced at high mold temperatures, that means high electrical power and long heating time, and this reduction is more significant at lower packing pressures, indeed, at 360bar as packing pressure and 20s as heating time the shear layer disappear. The resulting morphology was analyzed by optical microscope.

  9. Development of sheet molding compound solar collectors with molded-in silvered glass reflective surfaces

    SciTech Connect

    Champion, R. L.; Allred, R. E.

    1980-12-01

    The reflecting concentrator of a parabolic trough solar collector system comprises approximately 40% of initial system cost. The parabolic concentrator structure is also the most influential component in determining overall system efficiency. Parabolic test moldings have been fabricated from a general purpose sheet molding compound with flat chemically strengthened glass, flat annealed glass, and thermally formed glass. The test panel configuration was a 1.22 m x 0.61 m, 45/sup 0/ rim angle (0.762 m focal length) parabola. Attempts to mold with annealed sheet glass (1 mm thick) and thermally formed glass (1.25 mm thick) were unsuccessful; only the chemically strengthened glass (1.25 mm thick) was strong enough to survive molding pressures. Because of the mismatch in thermal expansion between glass and sheet molding compound, the as-molded panels contained a sizeable residual stress. The results are given of dimensional changes taking place in the panels under accelerated thermal cycling and outdoor aging conditions; these results are compared to an analytical model of the laminate. In addition, the sheet molding compound has been examined for thermomechanical properties and flow behavior in the rib sections. Results indicated that lowering the thermal expansion coefficient of the sheet molding compound through material modifications would produce a more stable structure.

  10. Mathematical modeling of the process of filling a mold during injection molding of ceramic products

    NASA Astrophysics Data System (ADS)

    Kulkov, S. N.; Korobenkov, M. V.; Bragin, N. A.

    2015-10-01

    Using the software package Fluent it have been predicted of the filling of a mold in injection molding of ceramic products is of great importance, because the strength of the final product is directly related to the presence of voids in the molding, making possible early prediction of inaccuracies in the mold prior to manufacturing. The calculations were performed in the formulation of mathematical modeling of hydrodynamic turbulent process of filling a predetermined volume of a viscous liquid. The model used to determine the filling forms evaluated the influence of density and viscosity of the feedstock, and the injection pressure on the mold filling process to predict the formation of voids in the area caused by the shape defect geometry.

  11. Effects of mold geometry on fiber orientation of powder injection molded metal matrix composites

    SciTech Connect

    Ahmad, Faiz Aslam, Muhammad Altaf, Khurram Shirazi, Irfan

    2015-07-22

    Fiber orientations in metal matrix composites have significant effect on improving tensile properties. Control of fiber orientations in metal injection molded metal composites is a difficult task. In this study, two mold cavities of dimensions 6x6x90 mm and 10x20x180 mm were used for comparison of fiber orientation in injection molded metal composites test parts. In both mold cavities, convergent and divergent flows were developed by modifying the sprue dimensions. Scanning electron microscope (SEM) was used to examine the fiber orientations within the test samples. The results showed highly aligned fiber in injection molded test bars developed from the convergent melt flow. Random orientation of fibers was noted in the composites test bars produced from divergent melt flow.

  12. Development of sheet molding compound solar collectors with molded-in silvered glass reflective surfaces

    SciTech Connect

    Champion, R. L.; Allred, R. E.

    1980-01-01

    An approach to the fabrication of a line-focusng parabolic trough reflector structure which offers the potential of high performance while utilizing mass production type technology with potential for low cost is discussed. The concept is one of a molded structure of fiber reinforced plastic with an integrally molded silvered glass reflective surface. Sheet molding compound (SMC), a mixture of glass fibers and inorganic fillers in polyester resin, has been selected for evaluation as representative of reinforced plastic molding materials. The purpose of the work was to establish the feasibility of molding glass mirrors into SMC structural trough panels. If the effort proved successful, the next stage of development would be demonstration of the structure in a trough collector which incorporates individual SMC reflector panels. The trough has a 2 x 6 m aperture with six individual SMC panels mounted on a torque tube as the main support structure. Results are described. (WHK)

  13. Creating mold-free buildings: a key to avoiding health effects of indoor molds.

    PubMed

    Small, Bruce M

    2003-08-01

    In view of the high costs of building diagnostics and repair subsequent to water damage--as well as the large medical diagnostic and healthcare costs associated with mold growth in buildings--commitment to a philosophy of proactive preventive maintenance for home, apartment, school, and commercial buildings could result in considerable cost savings and avoidance of major health problems among building occupants. The author identifies common causes of mold growth in buildings and summarizes key building design and construction principles essential for preventing mold contamination indoors. Physicians and healthcare workers must be made aware of conditions within buildings that can give rise to mold growth, and of resulting health problems. Timely advice provided to patients already sensitized by exposure to molds could save these individuals, and their families, from further exposures as a result of inadequate building maintenance or an inappropriate choice of replacement housing. PMID:15259432

  14. Injection molding simulation with variothermal mold temperature control of highly filled polyphenylene sulfide

    NASA Astrophysics Data System (ADS)

    Birkholz, A.; Tschiersky, M.; Wortberg, J.

    2015-05-01

    For the installation of a fuel cell stack to convert chemical energy into electricity it is common to apply bipolar plates to separate and distribute reaction gases and cooling agents. For reducing manufacturing costs of bipolar plates a fully automated injection molding process is examined. The high performance thermoplastic matrix material, polyphenylene sulfide (PPS), defies against the chemical setting and the operation temperature up to 200 °C. To adjust also high electrical and thermal conductivity, PPS is highly filled with various carbon fillers up to an amount of 65 percentage by volume. In the first step two different structural plates (one-sided) with three different gate heights and molds are designed according to the characteristics of a bipolar plate. To cope with the approach that this plate should be producible on standard injection molding machines with variothermal mold temperature control, injection molding simulation is used. Additionally, the simulation should allow to formulate a quality prediction model, which is transferrable to bipolar plates. Obviously, the basis for a precise simulation output is an accurate description of the material properties and behavior of the highly filled compound. This, the design of the structural plate and mold and the optimization via simulation is presented, as well. The influence of the injection molding process parameters, e.g. injection time, cycle times, packing pressure, mold temperature, and melt temperature on the form filling have been simulated to determine optimal process conditions. With the aid of the simulation and the variothermal mold temperature control it was possible to reduce the required melt temperature below the decomposition temperature of PPS. Thereby, hazardous decomposition products as hydrogen sulfide are obviated. Thus, the health of the processor, the longevity of the injection molding machine as well as the material and product properties can be protected.

  15. Powder Injection Molding of Titanium Components

    SciTech Connect

    Simmons, Kevin L.; Nyberg, Eric A.; Weil, K. Scott; Miller, Megan R.

    2005-01-01

    Powder injection molding (PIM) is a well-established, cost-effective method of fabricating small-to-moderate size metal components. Derived from plastic injection molding and employing a mixture of metal powder and plastic binder, the process has been used with great success in manufacturing a wide variety of metal products, including those made from stainless steel, nickel-based superalloys, and copper alloys. Less progress has been achieved with titanium and other refractory metal alloys because of problems with alloy impurities that are directly attributable to the injection molding process. Specifically, carbon, oxygen, and nitrogen are left behind during binder removal and become incorporated into the chemistry and microstructure of the material during densification. Even at low concentration, these impurities can cause severe degradation in the mechanical properties of titanium and its alloys. We have developed a unique blend of PIM constituents where only a small volume fraction of binder (~5 – 10 vol%) is required for injection molding; the remainder of the mixture consists of the metal powder and binder solvent. Because of the nature of decomposition in the binder system and the relatively small amount used, the binder is eliminated almost completely from the pre-sintered component during the initial stage of a two-step heat treatment process. Results will be presented on the first phase of this research, in which the binder, injection molding, de-binding and sintering schedule were developed. Additional data on the mechanical and physical properties of the material produced will be discussed.

  16. Nanostructuring steel for injection molding tools

    NASA Astrophysics Data System (ADS)

    Al-Azawi, A.; Smistrup, K.; Kristensen, A.

    2014-05-01

    The production of nanostructured plastic items by injection molding with ridges down to 400 nm in width, which is the smallest line width replicated from nanostructured steel shims, is presented. Here we detail a micro-fabrication method where electron beam lithography, nano-imprint lithography and ion beam etching are combined to nanostructure the planar surface of a steel wafer. Injection molded plastic parts with enhanced surface properties, like anti-reflective, superhydrophobic and structural colors can be achieved by micro- and nanostructuring the surface of the steel molds. We investigate the minimum line width that can be realized by our fabrication method and the influence of etching angle on the structure profile during the ion beam etching process. Trenches down to 400 nm in width have been successfully fabricated into a 316 type electro-polished steel wafer. Afterward a plastic replica has been produced by injection molding with good structure transfer fidelity. Thus we have demonstrated that by utilizing well-established fabrication techniques, nanostructured steel shims that are used in injection molding, a technique that allows low cost mass fabrication of plastic items, are produced.

  17. Polymeric N-halamine latex emulsions for use in antimicrobial paints.

    PubMed

    Cao, Zhengbing; Sun, Yuyu

    2009-02-01

    A new N-halamine monomer, N-chloro-2,2,6,6-tetramethyl-4-piperidinyl methacrylate (Cl-TMPM), was synthesized and used to prepare water-based polymeric N-halamines by emulsion polymerization. The chemical structures of the samples were characterized with Fourier transform IR, (13)C NMR, UV/vis, and differential scanning calorimetry analyses. Upon the addition of a small amount of the polymeric N-halamine latex emulsions into commercial water-based latex paints as antimicrobial additives, the new paints provided potent antimicrobial activities against Staphylococcus aureus (S. aureus; Gram-positive bacteria), methicillin-resistant S. aureus (MRSA; drug-resistant Gram-positive bacteria), vancomycin-resistant enterococcus (VRE; drug-resistant Gram-positive bacteria), Escherichia coli (E. coli; Gram-negative bacteria), Candida tropicalis (C. tropicalis; fungi), MS2 virus (15597-B; virus), and Stachybotrys chartarum spore (S. chartarum; mold), and they successfully prevented biofilm formation and development. The antimicrobial functions of the new paints were long-lasting for more than 1 year under normal in-use conditions, easily monitorable by a simple potassium iodine/starch test, and readily rechargeable if the functions were accidentally lost as a result of challenging conditions such as heavy soil, flooding, etc. PMID:20353242

  18. High rate fabrication of compression molded components

    DOEpatents

    Matsen, Marc R.; Negley, Mark A.; Dykstra, William C.; Smith, Glen L.; Miller, Robert J.

    2016-04-19

    A method for fabricating a thermoplastic composite component comprises inductively heating a thermoplastic pre-form with a first induction coil by inducing current to flow in susceptor wires disposed throughout the pre-form, inductively heating smart susceptors in a molding tool to a leveling temperature with a second induction coil by applying a high-strength magnetic field having a magnetic flux that passes through surfaces of the smart susceptors, shaping the magnetic flux that passes through surfaces of the smart susceptors to flow substantially parallel to a molding surface of the smart susceptors, placing the heated pre-form between the heated smart susceptors; and applying molding pressure to the pre-form to form the composite component.

  19. The research of UV curing injection molding

    NASA Astrophysics Data System (ADS)

    Xie, Pengcheng; Chang, Le; Song, Le; Cai, Tianze; Ding, Yumei; Yang, Weimin

    2015-05-01

    The micro-injection molding technology and the UV (ultraviolet) curing technique are combined to bring about a new plastic forming method, UV curing injection molding. The mean weight of micro-product is an important process characteristic for UV curing injection molding as well as the surface quality of micro-features is another important process characteristic for this new plastic forming method. This research investigates three effects of processing factors on the mass-change rate of micro-product and the surface quality of micro-features. In every particular, the following two factors are considered: UV material system temperature and the packing pressure. The study revealed that as usual, the micro-products gain weight with the imported increasing UV material system temperature and the improved packing pressure. Meanwhile, the increasing packing pressure also improves the surface quality, yet, warming the UV system temperature up has no effect on the quality of the product.

  20. Method for encapsulating hazardous wastes using a staged mold

    DOEpatents

    Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

    1989-01-01

    A staged mold and method for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

  1. Numerical recipes for mold filling simulation

    SciTech Connect

    Kothe, D.; Juric, D.; Lam, K.; Lally, B.

    1998-07-01

    Has the ability to simulate the filling of a mold progressed to a point where an appropriate numerical recipe achieves the desired results? If results are defined to be topological robustness, computational efficiency, quantitative accuracy, and predictability, all within a computational domain that faithfully represents complex three-dimensional foundry molds, then the answer unfortunately remains no. Significant interfacial flow algorithm developments have occurred over the last decade, however, that could bring this answer closer to maybe. These developments have been both evolutionary and revolutionary, will continue to transpire for the near future. Might they become useful numerical recipes for mold filling simulations? Quite possibly. Recent progress in algorithms for interface kinematics and dynamics, linear solution methods, computer science issues such as parallelization and object-oriented programming, high resolution Navier-Stokes (NS) solution methods, and unstructured mesh techniques, must all be pursued as possible paths toward higher fidelity mold filling simulations. A detailed exposition of these algorithmic developments is beyond the scope of this paper, hence the authors choose to focus here exclusively on algorithms for interface kinematics. These interface tracking algorithms are designed to model the movement of interfaces relative to a reference frame such as a fixed mesh. Current interface tracking algorithm choices are numerous, so is any one best suited for mold filling simulation? Although a clear winner is not (yet) apparent, pros and cons are given in the following brief, critical review. Highlighted are those outstanding interface tracking algorithm issues the authors feel can hamper the reliable modeling of today`s foundry mold filling processes.

  2. Relationship Between Casting Distortion, Mold Filling, and Interfacial Heat Transfer in Sand Molds

    SciTech Connect

    J. K. Parker; K. A. Woodbury; T. S. Piwonka; Y. Owusu

    1999-09-30

    This project sought to determine the relationship between casting dimensions and interfacial heat transfer in aluminum alloy sand castings. The program had four parts; measurement of interfacial heat transfer coefficients in resin bonded and green sand molds, the measurement of gap formation in these molds, the analysis of castings made in varying gatings, orientations and thicknesses, and the measurement of residual stresses in castings in the as-cast and gate removed condition. New values for interfacial heat transfer coefficients were measured, a novel method for gap formation was developed, and the variation of casting dimensions with casting method, gating, and casting orientation in the mold was documented.

  3. MOLD MACHINE, BRASS FOUNDRY, USED TO COMPRESS CONDITIONED SAND IN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MOLD MACHINE, BRASS FOUNDRY, USED TO COMPRESS CONDITIONED SAND IN FLASKS OVER PATTERNS TO CREATE MOLD CAVITIES WHICH ARE LATER FILLED WITH MOLTEN BRONZE. - Stockham Pipe & Fittings Company, Brass Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  4. HUNTER 20 MATCHPLATE MOLDING MACHINE 'SQUEEZING' BOTH HALVES OF A ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    HUNTER 20 MATCHPLATE MOLDING MACHINE 'SQUEEZING' BOTH HALVES OF A MOLD SURROUNDING A MATCHPLATE PATTERN, DENNIS GRAY OPERATOR. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  5. Looking east inside of the ingot mold stripeer building at ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Looking east inside of the ingot mold stripeer building at a mold being stripped from an ingot. - U.S. Steel Edgar Thomson Works, 44" Slab Mill, Along Monongahela River, Braddock, Allegheny County, PA

  6. INTERIOR VIEW WITH CORE SET IN MOLD HALF IN BOX ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR VIEW WITH CORE SET IN MOLD HALF IN BOX FLOOR AREA. AWAITING OTHER MOLD HALF TO BE PLACED ON TOP. - Stockham Pipe & Fittings Company, Ductile Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  7. Chemotaxis in the Plasmodial Slime Mold, Physarum polycephalum.

    ERIC Educational Resources Information Center

    Bozzone, Donna M.; Martin, Denise A.

    1998-01-01

    Describes a biology unit designed so that students pose their own questions and perform experiments to answer these questions. Plasmodial slime mold is employed as the focus of the study with background information about the mold provided. (DDR)

  8. 19. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    19. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON GREY IRON UNIT NO. 1 MOLD CONVEYOR. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  9. 20. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON GREY IRON UNIT NO. 1 MOLD CONVEYOR. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  10. MOLD SPECIFIC QUANTITATIVE PCR FOR RAPID IDENTIFICATION AND ENUMERATION

    EPA Science Inventory

    There is growing awareness that indoor molds/fungi may be connected to such conditions as asthma, allergies, hemorrhaging, chronic rhinosinusitis, memory loss, and a symptom complex called sick-building-syndrome. In addition, molds cause frequently fatal nosocomical infections. ...

  11. A method for producing large, accurate, economical female molds

    SciTech Connect

    Guenter, A.; Guenter, B.

    1996-11-01

    A process in which lightweight, highly accurate, economical molds can be produced for prototype and low production runs of large parts for use in composites molding has been developed. This has been achieved by developing existing milling technology, using new materials and innovative material applications to CNC mill large female molds directly. Any step that can be eliminated in the mold building process translates into savings in tooling costs through reduced labor and material requirements.

  12. 56. ORIGINAL MOLDS. THE MORAVIAN POTTERY AND TILE WORKS HAS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    56. ORIGINAL MOLDS. THE MORAVIAN POTTERY AND TILE WORKS HAS APPROXIMATELY 6,000 PLASTER MOLDS OF VARIOUS TYPES, INCLUDING THE DEEP CAVITY MOLDS IN THE CENTER OF THE PHOTOGRAPH. THESE MOLDS PRODUCED ALLEGORICAL FIGURES TO BE INSTALLED AROUND THE CORNICES OF PUBLIC SCHOOLS. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  13. TRUFLO GONDOLA, USED WITH THE HUNTER 10 MOLDING MACHINE, OPERATES ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    TRUFLO GONDOLA, USED WITH THE HUNTER 10 MOLDING MACHINE, OPERATES THE SAME AS THE TWO LARGER TRUFLOS USED IN CONJUNCTION WITH THE TWO HUNTER 20S. EACH GONDOLA IS CONNECTED TO THE NEXT AND RIDES ON A SINGLE TRACK RAIL FROM MOLDING MACHINES THROUGH POURING AREAS CARRYING A MOLD AROUND TWICE BEFORE THE MOLD IS PUSHED OFF ONTO A VIBRATING SHAKEOUT CONVEYOR. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  14. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Middle ear mold. 874.3430 Section 874.3430 Food... DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  15. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Middle ear mold. 874.3430 Section 874.3430 Food... DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  16. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Middle ear mold. 874.3430 Section 874.3430 Food... DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  17. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Middle ear mold. 874.3430 Section 874.3430 Food... DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  18. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Middle ear mold. 874.3430 Section 874.3430 Food... DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  19. 1928 MALLEABLE FOUNDRY MOLD CONVEYOR #1 SHOWING CONVEYOR AND TRACK ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1928 MALLEABLE FOUNDRY MOLD CONVEYOR #1 SHOWING CONVEYOR AND TRACK ARRANGEMENTS WITH OVERHEAD POURING WEIGHTS THAT REST ON A MOLD'S TOP SURFACE TO ENSURE THAT IRON DOES NOT FLOW OUT OF THE MOLD WHEN IT IS BEING POURED THROUGH THE OPENING IN THE WEIGHT. - Stockham Pipe & Fittings Company, Malleable Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  20. HUNTER 20 MATCHPLATE MOLDING MACHINE, OPERATING THE SAME AS THE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    HUNTER 20 MATCHPLATE MOLDING MACHINE, OPERATING THE SAME AS THE HUNTER 10 AND OTHER HUNTER 20 COMPRESSES BOTH MOLD HALVES OVER A DOUBLE-SIDED MATCH PLATE PATTERN. DENNIS GRAY TESTS A MOLD'S HARDNESS TO ENSURE SAND MIXTURE AND MACHINE COMPRESSIBILITY ARE CORRECT. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  1. Improved mold release for filled-silicone compounds

    NASA Technical Reports Server (NTRS)

    Accountius, O. E.

    1973-01-01

    Ceramic and filled-plastic materials used for fabrication of tiles are relatively brittle and easily break as they are being removed from molds. Dusting mold surfaces with commercially available glass microspheres provides mold release superior to existing spray releases. Glass-microsphere dusting also permits removal of uncured tile which has very little strength.

  2. 17. INTERIOR VIEW WITH GREY UNIT NO. 1 MOLD CONVEYOR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. INTERIOR VIEW WITH GREY UNIT NO. 1 MOLD CONVEYOR SHOWING CHAIN HELD WEIGHTS THAT TRAVEL AT THE SAME SPEED AS THE CONVEYOR AND REST ON COMPLETED MOLDS TO HOLD THE SAND SEAMS TOGETHER AS MOLTED IRON IS POURED INTO THE MOLD CAVITY. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  3. 14. INTERIOR VIEW WITH JOHNNY TAYLOR REMOVING A MOLD HALF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. INTERIOR VIEW WITH JOHNNY TAYLOR REMOVING A MOLD HALF FROM THE PATTERN ON THE MOLDING MACHINE, REVEALING THE CAVITY THAT WILL BE FILLED WITH MOLTEN IRON AFTER IT IS ASSEMBLED WITH THE OTHER MOLD HALF INSIDE GREY IRON UNIT NO. 1. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  4. Bell X-5 Model and Molds

    NASA Technical Reports Server (NTRS)

    1953-01-01

    A Langley model maker examines the molds used to form a model of the Bell X-5, a variable sweep craft that first flew in June of 1951. Photograph published in Winds of Change, 75th Anniversary NASA publication (page 64), by James Schultz.

  5. Flexible Interior-Impression-Molding Tray

    NASA Technical Reports Server (NTRS)

    Anders, Jeffrey E.

    1991-01-01

    Device used inside combustion chamber of complicated shape for nondestructive evaluation of qualities of welds, including such features as offset, warping, misalignment of parts, and dropthrough. Includes flexible polypropylene tray trimmed to fit desired interior surface contour. Two neodymium boron magnets and inflatable bladder attached to tray. Tray and putty inserted in cavity to make mold of interior surface.

  6. Streaming instability of aggregating slime mold amoebae

    NASA Astrophysics Data System (ADS)

    Levine, Herbert; Reynolds, William

    1991-05-01

    We propose a new model of aggregation in the cellular slime mold D. Discoideum. Our approach couples the excitable signaling system to amoeba chemotaxis; the resultant system of equations is tractable to analytical and numerical approaches. Using our model, we derive the existence of a streaming instability for the concentric target aggregation pattern.

  7. Mold Die Making. 439-322/324.

    ERIC Educational Resources Information Center

    Yunke, P.; And Others

    Each unit in this curriculum guide on mold die making contains an introduction, objectives, materials required, lessons, space for notes, figures, and diagrams. There are 10 units in this guide: (1) introduction to Electrical Discharge Machining (EDM); (2) EDM principles; (3) the single pulse; (4) EDM safety; (5) electrode material; (6) electrode…

  8. Molding Compound For Inspection Of Internal Contours

    NASA Technical Reports Server (NTRS)

    Adams, Jim; Ricklefs, Steve

    1988-01-01

    Material clean, sets rapidly, and easy to use. Silicone elastomer, Citrocon or equivalent, commonly used in dentistry, in combination with mold-release agent (Also see MFS-29240), speeds and facilitates making of impressions of interior surfaces so surface contours examined. Elastomer easily moved around in cavity until required location found.

  9. Contamination of PDMS microchannels by lithographic molds.

    PubMed

    Bubendorfer, Andrea J; Ingham, Bridget; Kennedy, John V; Arnold, W Mike

    2013-11-21

    By use of synchrotron X-ray fluorescence and Rutherford backscattering spectrometry, we show the SU-8 soft lithographic process contaminates PDMS. Residues of the antimony containing photoinitiator are transferred from the master mold to the surface of PDMS, uncontrollably intensifying the surface potential, leading to electroosmotic flow variability in PDMS microfluidic devices. PMID:24080639

  10. Cultural Molding: A Modular Approach. Cultural Anthropology.

    ERIC Educational Resources Information Center

    Kassebaum, Peter

    Designed for use as supplementary instructional material in a cultural anthropology course, this learning module introduces the student to cultural molding, the idea that most human behavior can be traced to enculturation and exposure rather than to a socio-biological explanation of human behavior. Following a brief description of socialization,…

  11. A REVOLUTION IN MOLD IDENTIFICATION AND ENUMERATION

    EPA Science Inventory

    More than 100 assay were developed to identify and quantify indoor molds using quantitiative PCR (QPCR) assays. This technology incorporates fluorigenic 5' nuclease (TaqMan�) chemistry directed at the nuclear ribosomal RNA operon internal transcribed spacer regions (ITS1 or ITS2...

  12. Illinois Occupational Skill Standards: Plastics Molding Cluster.

    ERIC Educational Resources Information Center

    Illinois Occupational Skill Standards and Credentialing Council, Carbondale.

    This document, which is intended to serve as a guide for work force preparation program providers, details the Illinois occupational skill standards for programs preparing students for employment in jobs in the plastics molding industry. Agency partners involved in this project include: the Illinois State Board of Education, Illinois Community…

  13. Experimental Determination of Heat Transfer Within the Metal/Mold Gap in a DC Casting Mold: Part II. Effect of Casting Metal, Mold Material, and Other Casting Parameters

    NASA Astrophysics Data System (ADS)

    Prasad, Arvind; Bainbridge, Ian F.

    2013-07-01

    Extensive experimental studies were conducted to quantify the effect of different parameters that can affect the heat transfer from the metal to the mold during the steady-state phase of DC casting. In the first part previously published, the experimental technique was established and results were reported for the effect of gas type (atmosphere within the mold) and the gap between the metal and the mold. The results showed the significant effect of gas thermal conductivity and the metal-mold gap on the mold wall heat transfer coefficient. In this second publication on heat transfer in the mold wall region of a DC casting mold, the results from the effect of casting temperature, gas flow rate, casting alloy, mold material, and the mold insert material on the mold wall heat transfer coefficient are described. The experiments reported in the current paper show that these additional factors tested do not affect the heat flux through the mold wall to the same extent as the gap size or the gas type. The heat transfer coefficient changes by less than 5 pct when casting temperature is changed by ±25 K, less than 15 pct when the gas flow rate within the metal-mold gap flows at up to 3 LPM, and approximately 30 pct when the mold material is changed from stainless steel to AA601 to copper. Similar results were obtained when different insert materials were used. These results are explained with the help of an electrical analogy of heat transfer and are consistent with the heat transfer theory.

  14. Multilevel micro-structuring of glassy carbon molds for precision glass molding

    NASA Astrophysics Data System (ADS)

    Prater, Karin; Dukwen, Julia; Scharf, Toralf; Herzig, Hans Peter; Plöger, Sven; Hermerschmidt, Andreas

    2015-09-01

    Replication techniques for diffractive optical elements (DOEs) in soft materials such as plastic injection molding are state of the art. For precision glass molding in glasses with high transition temperatures, molds with extreme thermal resistivity, low chemical reactivity and high mechanical strength are needed. Glassy Carbon can be operated up to 2000°C making it possible to mold almost all glasses including Fused Silica with a transition temperatures above 1060°C. For the structuring of Glassy Carbon wafers photolithography and a RIE process is used. We have developed a process using Si as a hard mask material. If the flow rates of the etching gases O2 and SF6 are chosen properly, high selectivity of GC to Si 19:1 can be achieved, which provides excellent conditions to realize high resolution elements with feature size down to 1 micron and fulfills requirements for optical applications. We fabricated several multilevel GC molds with 8 levels of structuring. Two different optical functionalities were implemented: 6x6 array beamsplitter and 1x4 linear beamsplitter. The molds were applied for precision glass molding of a low Tg glass L-BAL 42 (from Ohara) with a transition temperature of 565°C. Their optical performance was measured. A more detailed analysis of the impact of mold fabrication defects on optical performance is done. Rigorous coupled wave analysis simulations are performed, where we included fabrication constrains such as duty cycle, edge depth errors, wall verticality and misalignment errors. We will compare the results with the design specifications and discuss the influence of fabrication errors introduced during the different process steps.

  15. Matched metal die compression molded structural random fiber sheet molding compound flywheel

    DOEpatents

    Kulkarni, Satish V.; Christensen, Richard M.; Toland, Richard H.

    1985-01-01

    A flywheel (10) is described that is useful for energy storage in a hybrid vehicle automotive power system or in some stationary applications. The flywheel (10) has a body of essentially planar isotropic high strength structural random fiber sheet molding compound (SMC-R). The flywheel (10) may be economically produced by a matched metal die compression molding process. The flywheel (10) makes energy intensive efficient use of a fiber/resin composite while having a shape designed by theory assuming planar isotropy.

  16. Matched metal die compression molded structural random fiber sheet molding compound flywheel. [Patent application

    DOEpatents

    Kulkarni, S.V.; Christensen, R.M.; Toland, R.H.

    1980-09-24

    A flywheel is described that is useful for energy storage in a hybrid vehicle automotive power system or in some stationary applications. The flywheel has a body of essentially planar isotropic high strength structural random fiber sheet molding compound (SMC-R). The flywheel may be economically produced by a matched metal die compression molding process. The flywheel makes energy intensive efficient use of a fiber/resin composite while having a shape designed by theory assuming planar isotropy.

  17. Indoor Molds and Respiratory Hypersensitivity: A Comparison of Selected Molds and House Dust Mite Induced Responses in a Mouse Model

    EPA Science Inventory

    Introduction/Study Goal Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases including allergic lung diseases. The Institute of Medicine reports and WHO gUidelines concluded that the role of molds in asthma induction is not clear bu...

  18. Production of proinflammatory mediators by indoor air bacteria and fungal spores in mouse and human cell lines.

    PubMed Central

    Huttunen, Kati; Hyvärinen, Anne; Nevalainen, Aino; Komulainen, Hannu; Hirvonen, Maija-Riitta

    2003-01-01

    We compared the inflammatory and cytotoxic responses caused by household mold and bacteria in human and mouse cell lines. We studied the fungi Aspergillus versicolor, Penicillium spinulosum, and Stachybotrys chartarum and the bacteria Bacillus cereus, Pseudomonas fluorescens, and Streptomyces californicus for their cytotoxicity and ability to stimulate the production of inflammatory mediators in mouse RAW264.7 and human 28SC macrophage cell lines and in the human A549 lung epithelial cell line in 24-hr exposure to 10(5), 10(6), and 10(7) microbes/mL. We studied time dependency by terminating the exposure to 10(6) microbes/mL after 3, 6, 12, 24, and 48 hr. We analyzed production of the cytokines tumor necrosis factor-alpha and interleukins 6 and 1ss (TNF-alpha, IL-6, IL-1ss, respectively) and measured nitric oxide production using the Griess method, expression of inducible NO-synthase with Western Blot analysis, and cytotoxicity with the MTT-test. All bacteria strongly induced the production of TNF-alpha, IL-6 and, to a lesser extent, the formation of IL-1ss in mouse macrophages. Only the spores of Str. californicus induced the production of NO and IL-6 in both human and mouse cells. In contrast, exposure to fungal strains did not markedly increase the production of NO or any cytokine in the studied cell lines except for Sta. chartarum, which increased IL-6 production somewhat in human lung epithelial cells. These microbes were less cytotoxic to human cells than to mouse cells. On the basis of equivalent numbers of bacteria and spores of fungi added to cell cultures, the overall potency to stimulate the production of proinflammatory mediators decreased in the order Ps. fluorescens > Str. californicus > B. cereus > Sta. chartarum > A. versicolor > P. spinulosum. These data suggest that bacteria in water-damaged buildings should also be considered as causative agents of adverse inflammatory effects. PMID:12515684

  19. Pressurized Shell Molds For Metal-Matrix Composites

    NASA Technical Reports Server (NTRS)

    Kashalikar, Uday K.; Lusignea, Richard N.; Cornie, James

    1993-01-01

    Balanced-pressure molds used to make parts in complex shapes from fiber-reinforced metal-matrix composite materials. In single step, molding process makes parts in nearly final shapes; only minor finishing needed. Because molding pressure same on inside and outside, mold does not have to be especially strong and can be made of cheap, nonstructural material like glass or graphite. Fibers do not have to be cut to conform to molds. Method produces parts with high content of continuous fibers. Parts stiff but light in weight, and coefficients of thermal expansion adjusted. Parts resistant to mechanical and thermal fatigue superior to similar parts made by prior fabrication methods.

  20. Mold exposure and health effects following hurricanes Katrina and Rita.

    PubMed

    Barbeau, Deborah N; Grimsley, L Faye; White, LuAnn E; El-Dahr, Jane M; Lichtveld, Maureen

    2010-01-01

    The extensive flooding in the aftermath of Hurricanes Katrina and Rita created conditions ideal for indoor mold growth, raising concerns about the possible adverse health effects associated with indoor mold exposure. Studies evaluating the levels of indoor and outdoor molds in the months following the hurricanes found high levels of mold growth. Homes with greater flood damage, especially those with >3 feet of indoor flooding, demonstrated higher levels of mold growth compared with homes with little or no flooding. Water intrusion due to roof damage was also associated with mold growth. However, no increase in the occurrence of adverse health outcomes has been observed in published reports to date. This article considers reasons why studies of mold exposure after the hurricane do not show a greater health impact. PMID:20070193

  1. Molds on Food: Are They Dangerous?

    MedlinePlus

    ... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Molds on Food: Are they dangerous? Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...

  2. Chemorheology of in-mold coating for compression molded SMC applications

    NASA Astrophysics Data System (ADS)

    Ko, Seunghyun; Straus, Elliott J.; Castro, Jose M.

    2015-05-01

    In-mold coating (IMC) is applied to compression molded sheet molding compound (SMC) exterior automotive or truck body panels as an environmentally friendly alternative to make the surface conductive for subsequent electrostatic painting operations. The coating is a thermosetting liquid that when injected onto the surface of the part cures and bonds to provide a smooth conductive surface. In order to optimize the IMC process, it is essential to predict the time available for flow, that is the time before the thermosetting reaction starts (inhibition time) as well as the time when the coating has enough structural integrity so that the mold can be opened without damaging the part surface (cure time). To predict both the inhibition time and the cure time, it is critical to study the chemorheology of IMC. In this paper, we study the chemorheology for a typical commercial IMC system, and show its relevance to both the flow and cure time for the IMC stage during SMC compression molding.

  3. Mechanical behaviors of molded pulp material

    NASA Astrophysics Data System (ADS)

    Ji, Hongwei; Wang, Huaiwen; Chen, Jinlong

    2008-11-01

    Many mechanical phenomena of interest for web-like materials, such as molded pulp, take place at the micro-scale. A SEM (scanning electron microscope) with SHIMADZU electrohydraulic servo experimental system was employed to study the micro-scale mechanical behavior of molded pulp materials. Uniaxial tension tests of molded pulp specimens were carried out, resulting in the stress-strain curves. Experimental results indicated that the material is not only elasticplastic, but also emplastic. The surface morphology evolution of the tensile specimen was visually monitored during the process of loading, and some SEM micrographs were captured under different load levels. Full-field deformations over an area of 190x170 μm2 were obtained using the digital image correlation method. The higher strains occurred at the fibre fines zone or around voids whereas the lower strains were obviously found at long fibres, demonstrating that the strain distribution is obviously uneven. The reason may be due to the random orientation and the fraction of the fibres, and the presence of impurities and voids as well.

  4. Development effort of sheet molding compound (SMC) parabolic trough panels

    SciTech Connect

    Kirsch, P.A.; Champion, R.L.

    1982-01-01

    The objectives of the development effort are to: investigate the problems of molding parabolic trough solar reflector panels of sheet molding compound (SMC); develop molding techniques and processes by which silvered glass reflector sheets can be integrally molded into SMC trough panels; provide representative prototype panels for evaluation; and provide information regarding the technical feasibility of molding SMC panels in high volume production. The approach taken to meet the objectives was to design the parabolic panel, fabricate a prototype die, choose an SMC formulation and mold the glass and SMC together into a vertex to rim mirrored panel. The main thrust of the program was to successfully co-mold a mirrored glass sheet with the SMC. Results indicate that mirrored glass sheets, if properly strengthened to withstand the temperature and pressure of the molding process, can be successfully molded with SMC in a single press stroke using standard compression molding techniques. The finalized design of the trough panel is given. The SMC formulation chosen is a low shrink, low profile SMC using 40% by weight one inch chopped glass fibers in a uv stabilized polyester resin matrix. A program to test for the adhesion between mirrored glass sheets and the SMC is discussed briefly. (LEW)

  5. Heat pipe cooling of an aerospace foam mold manufacturing process

    SciTech Connect

    Hahn, D.R.; Feldman, K.T.; Marjon, P.L.

    1980-01-01

    A passive heat pipe cooling system was developed to cool a Bendix foam mold used to manufacture aerospace foam parts. The cooling system consists of ten copper-water heat pipes with cooling fins implanted into the aluminum mold and cooled by a domestic size fan blowing ambient air. The number and location of the heat pipes was determined to provide the most effective cooling and mold isothermalization based on experimental measurements of mold temperatures during the exothermic foaming process and from practical considerations of the mold geometry and use. Performance tests were cnducted on an individual heat pipe and on the ten heat pipes implanted in the mold. Both exothermic foam heating and internal electrical heat input were used in the experiments. The experimental test results indicate that the heat pipe cooling system with a fan is four to six times faster than free convection cooling of the mold with no heat pipes or fan and nearly twice as fast as cooling by the fan only. Similarly fast increases in mold heating time in the cure furnace could be realized if the heat pipes are used during this part of the production process. The heat pipes also cool hot spots in the mold and help isothermalize the mold so that better quality foam parts should be produced.

  6. Microinjection molding of thermoplastic polymers: morphological comparison with conventional injection molding

    NASA Astrophysics Data System (ADS)

    Giboz, Julien; Copponnex, Thierry; Mélé, Patrice

    2009-02-01

    The skin-core crystalline morphology of injection-molded semi-crystalline polymers is well documented in the scientific literature. The thermomechanical environment provokes temperature and shear gradients throughout the entire thickness of the part during molding, thus influencing the polymer crystallization. Crystalline morphologies of a high-density polyethylene (HDPE) micromolded part (μpart) and a classical part (macropart) are compared with optical, thermal and x-ray diffraction analyses. Results show that the crystalline morphologies with regard to thickness vary between the two parts. While a 'skin-core' morphology is present for the macropart, the μpart exhibits a specific 'core-free' morphology, i.e. no spherulite is present at the center of the thickness. This result seems to be generated under the specific conditions used in microinjection molding that lead to the formation of smaller and more oriented crystalline entities.

  7. MONITORING MYCOTOXIN PRODUCTION AT THE GENETIC LEVEL ON VARIOUS GROWTH SUBSTRATES USING QUANTITATIVE REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION?EXPERIMENT DESIGN

    EPA Science Inventory

    The paper describes a method of analyzing the production of mycotoxins at the genetic level by monitoring the intracellular levels of messenger RNA (mRNA). Initial work will focus on threshing out the mycotoxin gene clusters in Stachybotrys chartarum followed by analysis of toxin...

  8. Effect of mold treatment by solvent on PDMS molding into nanoholes

    NASA Astrophysics Data System (ADS)

    Con, Celal; Cui, Bo

    2013-09-01

    Polydimethylsiloxane (PDMS) is the most popular and versatile material for soft lithography due to its flexibility and easy fabrication by molding process. However, for nanoscale patterns, it is challenging to fill uncured PDMS into the holes or trenches on the master mold that is coated with a silane anti-adhesion layer needed for clean demolding. PDMS filling was previously found to be facilitated by diluting it with toluene or hexane, which was attributed to the great reduction of viscosity for diluted PDMS. Here, we suggest that the reason behind the improved filling for diluted PDMS is that the diluent solvent increases in situ the surface energy of the silane-treated mold and thus the wetting of PDMS to the mold surface. We treated the master mold surface (that was already coated with a silane anti-adhesion monolayer) with toluene or hexane, and found that the filling by undiluted PMDS into the nanoscale holes on the master mold was improved despite the high viscosity of the undiluted PDMS. A simple estimation based on capillary filing into a channel also gives a filling time on the millisecond scale, which implies that the viscosity of PMDS should not be the limiting factor. We achieved a hole filling down to sub-200-nm diameter that is smaller than those of the previous studies using regular Sylgard PDMS (not hard PDMS, Dow Corning Corporation, Midland, MI, USA). However, we are not able to explain using a simple argument based on wetting property why smaller, e.g., sub-100-nm holes, cannot be filled, for which we suggested a few possible factors for its explanation.

  9. Influence of mold surface temperature on polymer part warpage in rapid heat cycle molding

    NASA Astrophysics Data System (ADS)

    Berger, G. R.; Pacher, G. A.; Pichler, A.; Friesenbichler, W.; Gruber, D. P.

    2014-05-01

    Dynamic mold surface temperature control was examined for its influence on the warpage. A test mold, featuring two different rapid heat cycle molding (RHCM) technologies was used to manufacture complex plate-shaped parts having different ribs, varying thin-wall regions, and both, circular and rectangular cut-outs. The mold's nozzle side is equipped with the areal heating and cooling technology BFMOLD®, where the heating/cooling channels are replaced by a ball-filled slot near the cavity surface flooded through with hot and cold water sequentially. Two local electrical ceramic heating elements are installed into the mold's ejection side. Based on a 23 full-factorial design of experiments (DoE) plan, varying nozzle temperature (Tnozzle), rapid heat cycle molding temperature (TRHCM) and holding pressure (pn), specimens of POM were manufactured systematically. Five specimens were examined per DoE run. The resulting warpage was measured at 6 surface line scans per part using the non-contact confocal topography system FRT MicroProf®. Two warpage parameters were calculated, the curvature of a 2nd order approximation a, and the vertical deflection at the profile center d. Both, the influence strength and the acting direction of the process parameters and their interactions on a and d were calculated by statistical analysis. Linear mathematical process models were determined for a and d to predict the warpage as a function of the process parameter settings. Finally, an optimum process setting was predicted, based on the process models and Microsoft Excel GRG solver. Clear and significant influences of TRHCM, pn, Tnozzle, and the interaction of TRHCM and pn were determined. While TRHCM was dominant close to the gate, pn became more effective as the flow length increased.

  10. Implications of diamond-turned versus diamond-ground mold fabrication techniques on precision-molded optics

    NASA Astrophysics Data System (ADS)

    Mertus, Lou; Symmons, Alan

    2012-10-01

    In recent years, the trend within the molded optics community has been an overall advancement in the capability to diamond grind molds using a variety of grinding techniques. Improvements in grinding equipment, materials and tooling have enabled higher quality ceramic and carbide molds and thereby lenses. Diamond turned molds from ductile metals are still used prevalently throughout the molding industry. Each technology presents a unique set of advantages and disadvantages whether used for precision injection molding of plastic optics or precision glass molding. This paper reviews the manufacturing techniques for each approach and applicable molding process. The advantages and disadvantages of each are compared and analyzed. The subtle differences that exist in optics molded from each technique and the impact they have on the performance in various applications is reviewed. Differences stemming from tooling material properties, material-specific minor defects, as well as cutting and grinding process-induced artifacts are described in detail as well as their influence on the roughness, waviness, and form errors present on the molded surface. A comparison with results between similar surfaces for both diamond grinding and diamond turning is presented.

  11. Metallic glass mold insert for hot embossing of polymers

    NASA Astrophysics Data System (ADS)

    Ma, J.; Zhang, X.; Wang, W. H.

    2012-07-01

    Molding of micro components from thermoplastic polymers (TPs) has become a routinely used industrial production process. To find hard, ductile and durable material for mold insert and to fabricate the mold insert are two big challenges for the thermoplastic polymers fabrication techniques. We report that a Pd-based metallic glass (MG) mold insert was readily fabricated in its supercooled liquid region, and the atomic force microscope measurement and time-temperature-transformation analysis show that the metallic glass mold insert has very fine surface quality and long service life. We show that the metallic glasses, which have remarkable mechanical properties and excellent thermoplastic forming ability, are new ideal materials for hot embossing mold insert of thermoplastic polymers.

  12. To develop a geometric matching method for precision mold alignment

    NASA Astrophysics Data System (ADS)

    Chen, Chun-Jen; Chang, Chun-Li; Jywe, Wenyuh

    2014-09-01

    In order to develop a high accuracy optical alignment system for precision molding machine, a geometric matching method was developed in this paper. The alignment system includes 4 high magnification lenses, 4 CCD cameras and 4 LED light sources. In the precision molding machine, a bottom metal mold and a top glass mold are used to produce a micro lens. The two molds combination does not use any pin or alignment part. They only use the optical alignment system to alignment. In this optical alignment system, the off-axis alignment method was used. The alignment accuracy of the alignment system is about 0.5 μm. There are 2 cross marks on the top glass mold and 2 cross marks on the bottom metal mod. In this paper did not use edge detection to recognize the mask center because the mask easy wears when the combination times increased. Therefore, this paper develops a geometric matching method to recognize mask center.

  13. Evacuated, displacement compression mold. [of tubular bodies from thermosetting plastics

    NASA Technical Reports Server (NTRS)

    Heier, W. C. (Inventor)

    1974-01-01

    A process of molding long thin-wall tubular bodies from thermosetting plastic molding compounds is described wherein the tubular body lengths may be several times the diameters. The process is accomplished by loading a predetermined quantity of molding compound into a female mold cavity closed at one end by a force mandrel. After closing the other end of the female mold with a balance mandrel, the loaded cavity is evacuated by applying a vacuum of from one-to-five mm pressure for a period of fifteen-to-thirty minutes. The mold temperature is raised to the minimum temperature at which the resin constituent of the compound will soften or plasticize and a pressure of 2500 psi is applied.

  14. Preliminary concepts for high-temperature mold heating and cooling

    SciTech Connect

    Larson, J.P.

    1990-12-01

    The feasibility and limitations of various methods for mold heating and cooling were investigated. Two methods were chosen for evaluation: electrical heating and water cooling, and electrical heating and heat pipe conduction cooling. A model mold of each method was built. Test results indicated that the electrical heating and circulated water cooling was the better method. An injection mold utilizing this method was fabricated and temperature-cycled between 300 and 770{degree}F. 1 ref., 2 figs., 7 tabs.

  15. Effect of mold rotation on the bifilar electroslag remelting process

    NASA Astrophysics Data System (ADS)

    Shi, Xiao-fang; Chang, Li-zhong; Wang, Jian-jun

    2015-10-01

    A novel electroslag furnace with a rotating mold was fabricated, and the effects of mold rotational speed on the electroslag remelting process were investigated. The results showed that the chemical element distribution in ingots became uniform and that their compact density increased when the mold rotational speed was increased from 0 to 28 r/min. These results were attributed to a reasonable mold speed, which resulted in a uniform temperature in the slag pool and scattered the metal droplets randomly in the metal pool. However, an excessive rotational speed caused deterioration of the solidification structure. When the mold rotational speeds was increased from 0 to 28 r/min, the size of Al2O3 inclusions in the electroslag ingot decreased from 4.4 to 1.9 μm. But the excessive mold rotational speed would decrease the ability of the electroslag remelting to remove the inclusions. The remelting speed gradually increased, which resulted in reduced power consumption with increasing mold rotational speed. This effect was attributed to accelerated heat exchange between the consumable electrode and the molten slag, which resulted from mold rotation. Nevertheless, when the rotational speed reached 28 r/min, the remelting speed did not change because of limitations of metal heat conduction. Mold rotation also improved the surface quality of the ingots by promoting a uniform temperature distribution in the slag pool.

  16. Injection molding of ceramics using a polyacetal based binder system

    SciTech Connect

    Ebenhoech, J.S.

    1996-06-01

    Among the production routes to small complex ceramic parts, powder injection molding is the most attractive alternative. It combines near net shape capability with good surface finish and is easy to automate. With the development of the catalytic debinding process for polyacetal binders, the main impediments for the acceptance of ceramic injection molding as a mass production method can be overcome. The use of this system ensures short molding cycle times, high green strength and fast debinding without deformation. Ready to mold compounds are commercially available for various oxide and non-oxide ceramic materials as well as the equipment needed for this process.

  17. Mold and human health: separating the wheat from the chaff.

    PubMed

    Pettigrew, H David; Selmi, Carlo F; Teuber, Suzanne S; Gershwin, M Eric

    2010-04-01

    The term "mold" is utilized to define the ubiquitous fungal species commonly found in household dust and observed as visible multicellular filaments. Several well-defined human diseases are known to be caused or exacerbated by mold or by exposure to their byproducts. Among these, a solid connection has been established with infections, allergic bronchopulmonary aspergillosis, allergic fungal rhinosinusitis, hypersensitivity pneumonitis, and asthma. In the past decades, other less-defined and generally false conditions have also been ascribed to mold. We will herein review and critically discuss the available evidence on the influence of mold on human health. PMID:19714500

  18. Thermal monitoring of the thermoplastic injection molding process with FBGs

    NASA Astrophysics Data System (ADS)

    Alberto, Nélia J.; Nogueira, Rogério N.; Neto, Victor F.

    2014-08-01

    Injection molding is an important polymer processing method for manufacturing plastic components. In this work, the thermal monitoring of the thermoplastic injection molding is presented, since temperature is a critical parameter that influences the process features. A set of fiber Bragg gratings were multiplexed, aiming a two dimensional monitoring of the mold. The results allowed to identify the different stages of the thermoplastic molding cycle. Additionally, the data provide information about the heat transfer phenomena, an important issue for the thermoplastic injection sector, and thus for an endless number of applications that employ this type of materials.

  19. Applying simulation to optimize plastic molded optical parts

    NASA Astrophysics Data System (ADS)

    Jaworski, Matthew; Bakharev, Alexander; Costa, Franco; Friedl, Chris

    2012-10-01

    Optical injection molded parts are used in many different industries including electronics, consumer, medical and automotive due to their cost and performance advantages compared to alternative materials such as glass. The injection molding process, however, induces elastic (residual stress) and viscoelastic (flow orientation stress) deformation into the molded article which alters the material's refractive index to be anisotropic in different directions. Being able to predict and correct optical performance issues associated with birefringence early in the design phase is a huge competitive advantage. This paper reviews how to apply simulation analysis of the entire molding process to optimize manufacturability and part performance.

  20. A reusable mold in directional solidification for silicon solar cells

    NASA Astrophysics Data System (ADS)

    Saito, T.; Shimura, A.; Ichikawa, S.

    1983-12-01

    Directional solidification of silicon was achieved by using a SiC coated carbon mold together with Si3N4 powder mold releasing agent. Crack-free polycrystalline silicon ingots were able to be extracted easily out of the mold. The mold was easily able to withstand more than 12 utilizations. Silicon ingot impurity contents were less than 3 ppm and the average polycrystalline grain diameter was 0.8 mm. Solar cells made of this material gave an AM1 maximum conversion of 10.8 deg.

  1. Universal signals control slime mold stalk formation.

    PubMed

    van Es, S; Nieuwenhuijsen, B W; Lenouvel, F; van Deursen, E M; Schaap, P

    1994-08-16

    The primitive slime mold Dictyostelium minutum does not display oscillations during aggregation, cannot form migrating slugs, and does not form a prestalk/prespore pattern, all of which are characteristic for development of its advanced relative Dictyostelium discoideum. We used D. minutum to investigate whether slime molds share common mechanisms controlling development. In D. discoideum, the morphogen differentiation inducing factor (DIF) can induce stalk-cell differentiation in vitro. However, stalk formation in vivo is supposedly triggered by local depletion of DIF antagonists such as ammonia or cAMP. A homologue of the D. discoideum stalk gene ecmB was cloned in D. minutum that encodes a 3.4-kb mRNA, and its deduced amino acid sequence shows repeats of 24 amino acids that are characteristic for the D. discoideum ecmB gene. Remarkably, DIF effectively induces expression of the D. minutum ecmB gene and ammonia inhibits its expression. D. discoideum cells were transformed with a construct of the D. minutum ecmB promoter fused to the lacZ reporter gene and showed expression in the stalk, but not in the upper and lower cup of the fruiting body, which also express the D. discoideum ecmB gene. In D. discoideum, the D. minutum ecmB and the ecmB promoter are similarly activated by DIF and repressed by both cAMP and ammonia, suggesting that additional signaling is required for ecmB expression in upper and lower cup cells. Our data indicate that the extracellular signals controlling stalk formation and their intracellular signaling cascades including gene regulatory proteins remained highly conserved during slime mold evolution. PMID:8058783

  2. Investigations on injection molded, glass-fiber reinforced polyamide 6 integral foams using breathing mold technology

    NASA Astrophysics Data System (ADS)

    Roch, A.; Kehret, L.; Huber, T.; Henning, F.; Elsner, P.

    2015-05-01

    Investigations on PA6-GF50 integral foams have been carried out using different material systems: longfiber- and shortfiber-reinforced PA6 as well as unreinforced PA6 as a reference material. Both chemical and physical blowing agents were applied. Breathing mold technology (decompression of the mold) was selected for the foaming process. The integral foam design, which can be conceived as a sandwich structure, helps to save material in the neutral axis area and maintains a distance between load-bearing, unfoamed skin layers. For all test series an initial mold gap of 2.5 mm was chosen and the same amount of material was injected. In order to realize different density reductions, the mold opening stroke was varied. The experiments showed that, at a constant mass per unit area, integral polyamide 6 foams have a significantly higher bending stiffness than compact components, due to their higher area moment of inertia after foaming. At a constant surface weight the bending stiffness in these experiments could be increased by up to 600 %. Both shortfiber- and longfiber-reinforced polyamide 6 showed an increase in energy absorption during foaming.

  3. Comparison of injection molding and injection/compression molding for the replication of microstructure

    NASA Astrophysics Data System (ADS)

    Hong, Seokkwan; Hwang, Jeongho; Kang, Jeongjin; Yoon, Kyunghwan

    2015-11-01

    Because of increasing interest in the functional surfaces including micro- or nano-patterns, the mass production of such surfaces has been actively researched. Both conventional injection molding (CIM) and injection/compression molding (ICM) of micro-patterns were investigated in the present study. The molding subject is a multi-scale structure that consists of a macro-scale thin plate and micro-scale patterns formed regularly on its surface. The transcription ratios of micro pattern made by CIM and ICM for different flow length were experimentally measured, and the origin of the obtained results was identified through numerical analysis. It was found that the cavity pressure and polymer temperature are the most important factors for micro-pattern filling; in particular, the polymer temperature is the key factor determining the transcription ratio. It was also found that the difference in CIM and ICM micro-pattern transcription ratios originates from the differences in the cavity pressure history if other molding conditions are the same.

  4. Precision grinding of tungsten carbide mold insert for molding of sub-millimeter glass aspheric lenses

    NASA Astrophysics Data System (ADS)

    Chao, Choung-Lii; Chang, Chia-Jung; Chen, Chun-Chieh; Chou, Wen-Chen; Ma, Kung-Jeng

    2013-06-01

    As the demand for precision optical components with sub-millimeter feature size steadily increasing, numerous efforts have been made in developing new techniques and in improving the existing approaches to efficiently and economically produce those components. Glass molding process (GMP) is one of these methods to enable mass production of precision glass optical components in recent years. One of the key issues in GMP is precision mold insert fabrication. Since the mould are normally made of hard and brittle materials such as tungsten carbide (WC) and silicon carbide (SiC), precision diamond grinding is by far the principal choice used to machine the GMP mould. As the feature size of optical component gets smaller, the size of mould and grinding wheel used to fabricate the mould gets smaller too. This makes the grinding process a very time consuming and expensive task. This research aimed to improve the small mold fabrication processes by developing an effective way of producing small diamond wheels and in-process monitoring wheel profile. Diamond wheels of around 0.2mm to 0.5mm in diameter after truing and WC aspheric mold insert of form accuracy around 0.47μm were successfully produced in this research.

  5. Dip-molded t-shaped cannula

    NASA Technical Reports Server (NTRS)

    Broyles, H. F.; Cuddihy, E. F.; Moacanin, J.

    1978-01-01

    Cannula, fabricated out of polyetherurethane, has been designed for long-term service. Improved cannula is T-shaped to collect blood from both directions, thus replacing two conventional cannulas that are usually required and eliminating need for large surgical wound. It is fabricated by using dip-molding process that can be adapted to other elastomeric objects having complex shapes. Dimensions of cannula were chosen to optimize its blood-flow properties and to reduce danger of excessive clotting, making it suitable for continuous service up to 21 days in vein or artery of patient.

  6. Microminiature molding techniques for cochlear electrode arrays.

    PubMed

    Loeb, G E; Peck, R A; Smith, D W

    1995-12-01

    We provide a general method for producing a variety of small, complex electrode arrays based on injection molds produced using computer-aided drafting and machining (CAD-CAM) procedures and a novel method for connecting to the very fine electrical leads associated with the individual contacts of such arrays. Cat-sized cochlear electrode arrays with up to eight contacts were built according to these methods and their electrical contacts were characterized in vitro by impedance spectroscopy and in vivo by monitoring impedance for over 1 year of intermittent stimulation in chronically instrumented animals. PMID:8788052

  7. Pathology-designed custom molded foot orthoses.

    PubMed

    Rosenbloom, Kevin B

    2011-01-01

    Treating patients with custom foot orthoses for common pathologies is a rewarding experience when the proper steps are taken during foot casting and custom-orthosis prescription writing. This article describes successful methods for orthoses casting and prescription writing for custom-molded orthoses for Achilles tendonitis, pes planus, hallux limitus, plantar fasciitis/heel spurs, lateral ankle instability, metatarsalgia, and pes cavus. In addition, a summary of orthotic laboratory instructions for each pathology-designed custom orthosis is provided, which should be considered by orthotic laboratories. PMID:21276525

  8. Resin transfer molding of textile composites

    NASA Technical Reports Server (NTRS)

    Falcone, Anthony; Dursch, Harry; Nelson, Karl; Avery, William

    1993-01-01

    The design and manufacture of textile composite panels, tubes, and angle sections that were provided to NASA for testing and evaluation are documented. The textile preform designs and requirements were established by NASA in collaboration with Boeing and several vendors of textile reinforcements. The following four types of preform architectures were used: stitched uniweave, 2D-braids, 3D-braids, and interlock weaves. The preforms consisted primarily of Hercules AS4 carbon fiber; Shell RSL-1895 resin was introduced using a resin transfer molding process. All the finished parts were inspected using ultrasonics.

  9. 40 CFR Table 3 to Subpart Wwww of... - Organic HAP Emissions Limits for Existing Open Molding Sources, New Open Molding Sources Emitting...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Existing Open Molding Sources, New Open Molding Sources Emitting Less Than 100 TPY of HAP, and New and...) AIR PROGRAMS (CONTINUED) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS FOR SOURCE... Limits for Existing Open Molding Sources, New Open Molding Sources Emitting Less Than 100 TPY of HAP,...

  10. Integrally cored ceramic investment casting mold fabricated by ceramic stereolithography

    NASA Astrophysics Data System (ADS)

    Bae, Chang-Jun

    Superalloy airfoils are produced by investment casting (IC), which uses ceramic cores and wax patterns with ceramic shell molds. Hollow cored superalloy airfoils in a gas turbine engine are an example of complex IC parts. The complex internal hollow cavities of the airfoil are designed to conduct cooling air through one or more passageways. These complex internal passageways have been fabricated by a lost wax process requiring several processing steps; core preparation, injection molding for wax pattern, and dipping process for ceramic shell molds. Several steps generate problems such as high cost and decreased accuracy of the ceramic mold. For example, costly tooling and production delay are required to produce mold dies for complex cores and wax patterns used in injection molding, resulting in a big obstacle for prototypes and smaller production runs. Rather than using separate cores, patterns, and shell molds, it would be advantageous to directly produce a mold that has the casting cavity and the ceramic core by one process. Ceramic stereolithography (CerSLA) can be used to directly fabricate the integrally cored ceramic casting mold (ICCM). CerSLA builds ceramic green objects from CAD files from many thin liquid layers of powder in monomer, which are solidified by polymerization with a UV laser, thereby "writing" the design for each slice. This dissertation addresses the integrally cored casting ceramic mold (ICCM), the ceramic core with a ceramic mold shell in a single patternless construction, fabricated by ceramic stereolithography (CerSLA). CerSLA is considered as an alternative method to replace lost wax processes, for small production runs or designs too complex for conventional cores and patterns. The main topic is the development of methods to successfully fabricate an ICCM by CerSLA from refractory silica, as well as related issues. The related issues are the segregation of coarse fused silica powders in a layer, the degree of segregation parameter to

  11. Composite fabrication via resin transfer molding technology

    SciTech Connect

    Jamison, G.M.; Domeier, L.A.

    1996-04-01

    The IMPReS (Integrated Modeling and Processing of Resin-based Structures) Program was funded in FY95 to consolidate, evaluate and enhance Sandia`s capabilities in the design and fabrication of composite structures. A key driver of this and related programs was the need for more agile product development processes and for model based design and fabrication tools across all of Sandia`s material technologies. A team of polymer, composite and modeling personnel was assembled to benchmark Sandia`s existing expertise in this area relative to industrial and academic programs and to initiate the tasks required to meet Sandia`s future needs. RTM (Resin Transfer Molding) was selected as the focus composite fabrication technology due to its versatility and growing use in industry. Modeling efforts focused on the prediction of composite mechanical properties and failure/damage mechanisms and also on the uncured resin flow processes typical of RTM. Appropriate molds and test composites were fabricated and model validation studies begun. This report summarizes and archives the modeling and fabrication studies carried out under IMPReS and evaluates the status of composite technology within Sandia. It should provide a complete and convenient baseline for future composite technology efforts within Sandia.

  12. Method for collecting spores from a mold

    DOEpatents

    Au, Frederick H. F.; Beckert, Werner F.

    1977-01-01

    A technique and apparatus used therewith for determining the uptake of plutonium and other contaminants by soil microorganisms which, in turn, gives a measure of the plutonium and/or other contaminants available to the biosphere at that particular time. A measured quantity of uncontaminated spores of a selected mold is added to a moistened sample of the soil to be tested. The mixture is allowed to sit a predetermined number of days under specified temperature conditions. An agar layer is then applied to the top of the sample. After three or more days, when spores of the mold growing in the sample have formed, the spores are collected by a miniature vacuum collection apparatus operated under preselected vacuum conditions, which collect only the spores with essentially no contamination by mycelial fragments or culture medium. After collection, the fungal spores are dried and analyzed for the plutonium and/or other contaminants. The apparatus is also suitable for collection of pollen, small insects, dust and other small particles, material from thin-layer chromatography plates, etc.

  13. Gravitational response of the slime mold Physarum

    NASA Astrophysics Data System (ADS)

    Block, I.; Wolke, A.; Briegleb, W.

    1994-08-01

    The acellular slime mold Physarum polycephalum is used as a model system to investigate the graviresponse of single cells which possess no receptors specialized for the perception of gravity. To obtain insights into the gravity-signal transduciton mechanism the light response of the cell is used: Macroplsmodia of the slime mold show clear geo- and phototaxes. Gravity increases and white light decreases transiently the concentration frequency of plasmodial strands whereby both responses follow the same time pattern. Since mitochodria play major role in changing the contraction rhythm in response to light and gravity stimuli, the simultaneous and subsequent inductions of the opposing light and gravity responses and their mutual influences on one another were investigated. The experiments were performed in weightlessness (0 g) - simulated on the fast-rotating clinostat as well as in actual weightlessness during the IML-1 Space-Shuttle mission. The results indicate that mitochondria (chondriome) are part of the acceleration-stimulus reaction chain in Physarum. Two models for a direct gravireceptor mechanism are discussed.

  14. Characterization of white mold disease avoidance in common bean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    White mold, caused by Sclerotinia sclerotiorum, is a devastating fungal disease of common bean (Phaseolus vulgaris L.) worldwide. Physiological resistance and disease avoidance conferred by plant architecture-related traits contribute to white mold field resistance. Our objective was to further exam...

  15. A programmable nanoreplica molding for the fabrication of nanophotonic devices

    NASA Astrophysics Data System (ADS)

    Liu, Longju; Zhang, Jingxiang; Badshah, Mohsin Ali; Dong, Liang; Li, Jingjing; Kim, Seok-Min; Lu, Meng

    2016-03-01

    The ability to fabricate periodic structures with sub-wavelength features has a great potential for impact on integrated optics, optical sensors, and photovoltaic devices. Here, we report a programmable nanoreplica molding process to fabricate a variety of sub-micrometer periodic patterns using a single mold. The process utilizes a stretchable mold to produce the desired periodic structure in a photopolymer on glass or plastic substrates. During the replica molding process, a uniaxial force is applied to the mold and results in changes of the periodic structure, which resides on the surface of the mold. Direction and magnitude of the force determine the array geometry, including the lattice constant and arrangement. By stretching the mold, 2D arrays with square, rectangular, and triangular lattice structures can be fabricated. As one example, we present a plasmonic crystal device with surface plasmon resonances determined by the force applied during molding. In addition, photonic crystal slabs with different array patterns are fabricated and characterized. This unique process offers the capability of generating various periodic nanostructures rapidly and inexpensively.

  16. 25. CORES, WHICH FORM THE INTERIOR SURFACES OF MOLDS BY ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    25. CORES, WHICH FORM THE INTERIOR SURFACES OF MOLDS BY PROVIDING A SOLID STRUCTURE FOR MOLTEN IRON TO FLOW AROUND ARE CAREFULLY PLACED INTO THE CAVITIES OF MOLDS IN THE BRASS FOUNDRY, CA. 1950. - Stockham Pipe & Fittings Company, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  17. Looking east inside of the ingot mold stripper building for ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Looking east inside of the ingot mold stripper building for the 44" slab mill at a row of ingots. A row of ingot molds are pictured east on the left. - U.S. Steel Edgar Thomson Works, 44" Slab Mill, Along Monongahela River, Braddock, Allegheny County, PA

  18. View of foundrymen casting ingot molds; The flames from the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of foundrymen casting ingot molds; The flames from the mold in the center-right of the photo are present immediately after the pour has been completed - Bethlehem Steel Corporation, South Bethlehem Works, Iron Foundry, Along Lehigh River, North of Fourth Street, West of Minsi Trail Bridge, Bethlehem, Northampton County, PA

  19. 42. PRESSING A SLAB OF CLAY ONTO A MOSAIC MOLD. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    42. PRESSING A SLAB OF CLAY ONTO A MOSAIC MOLD. THE MOLD, WHICH HAS A RAISED DESIGN, LEAVES AND OUTLINE IN THE SLAB, THE PIECES THUS DEFINED, ARE THEN CUT APART TO BE FIRED SEPARATELY AND REASSEMBLED. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  20. 30. SECOND FLOOR, NORTHEAST ROOM, SOUTH WALL. Bolection mold fireplace ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    30. SECOND FLOOR, NORTHEAST ROOM, SOUTH WALL. Bolection mold fireplace surround probably original with house and only remaining one thus. Note bolection panel molds on raised-panel door, also probably original with house. - Mulberry, Cooper River, West Branch, Moncks Corner, Berkeley County, SC

  1. 47 CFR 76.805 - Access to molding.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 4 2011-10-01 2011-10-01 false Access to molding. 76.805 Section 76.805 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES MULTICHANNEL VIDEO AND CABLE TELEVISION SERVICE Cable Inside Wiring § 76.805 Access to molding. (a) An MVPD shall be...

  2. 47 CFR 76.805 - Access to molding.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Access to molding. 76.805 Section 76.805 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES MULTICHANNEL VIDEO AND CABLE TELEVISION SERVICE Cable Inside Wiring § 76.805 Access to molding. (a) An MVPD shall be...

  3. MOLD GROWTH ON GYPSUM WALLBOARD--A RESEARCH SUMMARY

    EPA Science Inventory

    Reducing occupant exposure to mold growing on damp gypsum wallboard is a research objective of the U.S. Environmental Protection Agency. Often mold contaminated building materials are not properly removed but instead surface cleaners are used and then paint is applied in an attem...

  4. A programmable nanoreplica molding for the fabrication of nanophotonic devices.

    PubMed

    Liu, Longju; Zhang, Jingxiang; Badshah, Mohsin Ali; Dong, Liang; Li, Jingjing; Kim, Seok-Min; Lu, Meng

    2016-01-01

    The ability to fabricate periodic structures with sub-wavelength features has a great potential for impact on integrated optics, optical sensors, and photovoltaic devices. Here, we report a programmable nanoreplica molding process to fabricate a variety of sub-micrometer periodic patterns using a single mold. The process utilizes a stretchable mold to produce the desired periodic structure in a photopolymer on glass or plastic substrates. During the replica molding process, a uniaxial force is applied to the mold and results in changes of the periodic structure, which resides on the surface of the mold. Direction and magnitude of the force determine the array geometry, including the lattice constant and arrangement. By stretching the mold, 2D arrays with square, rectangular, and triangular lattice structures can be fabricated. As one example, we present a plasmonic crystal device with surface plasmon resonances determined by the force applied during molding. In addition, photonic crystal slabs with different array patterns are fabricated and characterized. This unique process offers the capability of generating various periodic nanostructures rapidly and inexpensively. PMID:26925828

  5. 34. THESE INGOT MOLDS OF STEEL 32' X 83' ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    34. THESE INGOT MOLDS OF STEEL - 32' X 83' IN SIZE - ARE READY TO BE TAKEN TO THE STRIPPER, WHERE THE MOLDS WILL BE REMOVED. INGOTS WILL NEXT BE PLACED INTO A 'SOAKING PIT,' WHERE THEY ARE HEATED TO A UNIFORM TEMPERATURE PRIOR TO ROLLING. - Corrigan, McKinney Steel Company, 3100 East Forty-fifth Street, Cleveland, Cuyahoga County, OH

  6. 14. IN 1922, PRIOR TO THE INSTALLATION OF MOLDING MACHINES ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. IN 1922, PRIOR TO THE INSTALLATION OF MOLDING MACHINES AND CONVEYORS, MOLDERS, SUCH AS THESE FROM THE GREY IRON FOUNDRY, HAND PACKED MOLDS AND LAID THEM OUT IN ROWS ON THE FLOOR TO BE POURED BY HAND-HELD CRUCIBLES, SHAKEN OUT, AND CLEANED. - Stockham Pipe & Fittings Company, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  7. SPECIFIC MOLDS ASSOCIATED WITH ASTHMA IN WATER-DAMAGED HOMES

    EPA Science Inventory

    Objective: We sought to determine if specific molds were found in significantly higher concentrations in the water-damaged homes of asthmatic children compared to homes with no visible water damage. Methods: The mold concentrations in the dust in asthmatic children's bedrooms i...

  8. Using Cellular Slime Molds in the High School Laboratory

    ERIC Educational Resources Information Center

    Haskins, P. B.

    1977-01-01

    Described is the life cycle of the cellular slime molds Acrasiales. Experiments that can be used to explore the aggregation, migration, and culmination activities of the organism are suggested. Laboratory procedures for culturing these slime molds and listings of biological supply houses and literature references are also given. (MA)

  9. New methods and materials for molding and casting ice formations

    NASA Technical Reports Server (NTRS)

    Reehorst, Andrew L.; Richter, G. Paul

    1987-01-01

    This study was designed to find improved materials and techniques for molding and casting natural or simulated ice shapes that could replace the wax and plaster method. By utilizing modern molding and casting materials and techniques, a new methodology was developed that provides excellent reproduction, low-temperature capability, and reasonable turnaround time. The resulting casts are accurate and tough.

  10. IGE IN ASTHMATIC HUMAN SERA IS REACTIVE AGAINST MOLD EXTRACTS

    EPA Science Inventory

    Molds have been associated with various health effects including asthma, but their role in induction of asthma is unclear. However, the presence of mold-specific IgE indicates their capacity to induce allergic responses and possibly exacerbate asthma symptoms. This study was und...

  11. Improved molding process ensures plastic parts of higher tensile strength

    NASA Technical Reports Server (NTRS)

    Heier, W. C.

    1968-01-01

    Single molding process ensures that plastic parts /of a given mechanical design/ produced from a conventional thermosetting molding compound will have a maximum tensile strength. The process can also be used for other thermosetting compounds to produce parts with improved physical properties.

  12. Crack-resistant siloxane molding compounds. [Patent application

    DOEpatents

    McFarland, J.W.; Swearngin, C.B.

    1980-11-03

    The crack resistance of phenyl silicone molding resins containing siliceous fillers is improved by incorporating therein about 0.5 to 5.5% by weight of ..beta..-eucryptite, a lithium aluminum silicate having a negative thermal expansion coefficient. These molding resins are particularly suitable for encapsulating electronic devices such as diodes, coils, resistors, and the like.

  13. Grinding aspheric and freeform micro-optical molds

    NASA Astrophysics Data System (ADS)

    Tohme, Yazid E.

    2007-02-01

    Fueled by the need for better performing optics, glass optics are now replacing plastic optics in many industrial and consumer electronic devices. One of these devices is the mobile phone camera. The optical sub-assembly in a mobile phone includes several micro lenses that are spherical and/or aspherical in shape and require form tolerances in the submicron range. These micro glass lenses are mass produced by a replication process known as glass press molding. The process entails the compression of a glass gob between two precise optical quality molds at an elevated temperature, usually near the transition temperature of the glass material. The elevated forces and temperatures required in the glass molding process limits the materials of the molds to very tough materials such as tungsten carbide or silicon carbide. These materials can withstand large pressing forces at high temperatures without any significant deformation. These materials offer great mechanical properties for glass press molding but they are also a challenge to machine to submicron accuracy. The work in this paper discusses a deterministic micro grinding manufacturing process referred to as wheel normal grinding, which is utilized to produce these optical quality molds. Wheel normal grinding is more accurate and more deterministic than most other grinding techniques and can produce molds to the form and finish tolerances required for optical molding. This method relies on the ability to recognize and compensate for grinding wheel wear and machine repeatable errors. Results will be presented to illustrate the accuracy of this micro grinding technique.

  14. A fabrication method of microneedle molds with controlled microstructures.

    PubMed

    Wang, Qi Lei; Zhu, Dan Dan; Chen, Yang; Guo, Xin Dong

    2016-08-01

    Microneedle (MN) offers an attractive, painless and minimally invasive approach for transdermal drug delivery. Polymer microneedles are normally fabricated by using the micromolding method employing a MN mold, which is suitable for mass production due to high production efficiency and repeat-using of the mold. Most of the MN molds are prepared by pouring sylgard polymer over a MN master to make an inverse one after curing, which is limited in optimizing or controlling the MN structures and failing to keep the sharpness of MNs. In this work we describe a fabrication method of MN mold with controlled microstructures, which is meaningful for the fabrication of polymer MNs with different geometries. Laser micro-machining method was employed to drill on the surface of PDMS sheets to obtain MN molds. In the fabrication process, the microstructures of MN molds are precisely controlled by changing laser parameters and imported patterns. The MNs prepared from these molds are sharp enough to penetrate the skin. This scalable MN mold fabrication method is helpful for future applications of MNs. PMID:27157736

  15. 18. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON GREY IRON UNIT NO. 1 MOLD CONVEYOR WITH MOLTEN IRON FROM MOBILE LADLES AS THEY STAND ON WHAT USED TO BE A PLATFORM MOVING AT THE SAME RATE OF SPEED AS THE CONVEYOR. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  16. Injection molded polymer optics in the 21st Century

    NASA Astrophysics Data System (ADS)

    Beich, William S.

    2005-08-01

    Precision polymer optics, manufactured by injection molding techniques, has been a key enabling technology for several decades now. The technology, which can be thought of as a subset of the wider field of precision optics manufacturing, was pioneered in the United States by companies such as Eastman Kodak, US Precision Lens, and Polaroid. In addition to suppliers in the U.S. there are several companies worldwide that design and manufacture precision polymer optics, for example Philips High Tech Plastics in Europe and Fujinon in Japan. Designers who are considering using polymer optics need a fundamental understanding of exactly how the optics are created. This paper will survey the technology and processes that are employed in the successful implementation of a polymer optic solution from a manufacturer's perspective. Special emphasis will be paid to the unique relationship between the molds and the optics that they produce. We will discuss the key elements of production: molding resins, molds and molding equipment, and metrology. Finally we will offer a case study to illustrate just how the optics designer carries a design concept through to production. The underlying theme throughout the discussion of polymer optics is the need for the design team to work closely with an experienced polymer optics manufacturer with a solid track record of success in molded optics. As will be seen shortly, the complex interaction between thermoplastics, molds, and molding machines dictates the need for working closely with a supplier who has the critical knowledge needed to manage all aspects of the program.

  17. THE CHALLENGE OF MOLDS FOR THE U.S. ARMY

    EPA Science Inventory

    The US Army and all armies have been interested in molds since there were armies. The most obvious interest was human infections by molds like trench foot. Then there were losses of military animals and contamination of their fodder, most notably the Soviet loss of thousands o...

  18. A programmable nanoreplica molding for the fabrication of nanophotonic devices

    PubMed Central

    Liu, Longju; Zhang, Jingxiang; Badshah, Mohsin Ali; Dong, Liang; Li, Jingjing; Kim, Seok-min; Lu, Meng

    2016-01-01

    The ability to fabricate periodic structures with sub-wavelength features has a great potential for impact on integrated optics, optical sensors, and photovoltaic devices. Here, we report a programmable nanoreplica molding process to fabricate a variety of sub-micrometer periodic patterns using a single mold. The process utilizes a stretchable mold to produce the desired periodic structure in a photopolymer on glass or plastic substrates. During the replica molding process, a uniaxial force is applied to the mold and results in changes of the periodic structure, which resides on the surface of the mold. Direction and magnitude of the force determine the array geometry, including the lattice constant and arrangement. By stretching the mold, 2D arrays with square, rectangular, and triangular lattice structures can be fabricated. As one example, we present a plasmonic crystal device with surface plasmon resonances determined by the force applied during molding. In addition, photonic crystal slabs with different array patterns are fabricated and characterized. This unique process offers the capability of generating various periodic nanostructures rapidly and inexpensively. PMID:26925828

  19. METHOD FOR EVALUATING MOLD GROWTH ON CEILING TILE

    EPA Science Inventory

    A method to extract mold spores from porous ceiling tiles was developed using a masticator blender. Ceiling tiles were inoculated and analyzed using four species of mold. Statistical analysis comparing results obtained by masticator extraction and the swab method was performed. T...

  20. 21 CFR 177.2410 - Phenolic resins in molded articles.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Phenolic resins in molded articles. 177.2410... as Components of Articles Intended for Repeated Use § 177.2410 Phenolic resins in molded articles... articles intended for repeated use in contact with nonacid food (pH above 5.0), in accordance with...

  1. ASTHMATIC HUMAN SERUM IGE-REACTIVITY WITH MOLD EXTRACTS

    EPA Science Inventory

    Although molds have demonstrated the ability to induce allergic asthma-like responses in mouse models, their role in human disease is unclear. This study was undertaken to provide insight into the prevalence of human IgE-reactivity and identify the target mold protein(s). The st...

  2. Silicon micro-mold and method for fabrication

    DOEpatents

    Morales, Alfredo M.

    2005-01-11

    The present invention describes a method for rapidly fabricating a robust 3-dimensional silicon micro-mold for use in preparing complex metal micro-components. The process begins by depositing a conductive metal layer onto one surface of a silicon wafer. A thin photoresist and a standard lithographic mask are then used to transfer a trace image pattern onto the opposite surface of the wafer by exposing and developing the resist. The exposed portion of the silicon substrate is anisotropically etched through the wafer thickness down to conductive metal layer to provide an etched pattern consisting of a series of rectilinear channels and recesses in the silicon which serve as the silicon micro-mold. Microcomponents are prepared with this mold by first filling the mold channels and recesses with a metal deposit, typically by electroplating, and then removing the silicon micro-mold by chemical etching.

  3. Factors of importance in determining the prevalence of indoor molds.

    PubMed

    Kozak, P P; Gallup, J; Cummins, L H; Gillman, S A

    1979-08-01

    The concentration of molds isolated in 68 homes of allergic patients in southern California using the Andersen volumetric sampler varied from a minimum of 36 to a maximum of 5,984 isolate/M3 air sampled. The most frequently isolated included Cladosporium, Penicillium species. Alternaria, Sterile (Non-sporulating) Mycelium, Epicoccum, Aspergillus species, Aureobasidium and Dreschlera. Statistically significant higher mold isolates were associated with high shade and high levels of organic debris near the home and poor landscaping and landscape maintenance. Low concentrations of mold isolates were associated with the presence of a central electrostatic filtration system and good compliance with dust controls. The viable mold spore levels were lower in homes where the electrostatic filtration unit was operated continuously rather than intermittently. No statistically significant correlations could be made between indoor mold isolates and any of the following: number and age of the occupants, age and size of home, month of survey or the presence of indoor plants. PMID:464350

  4. Standard Molded Composite Rocket Pyrogen Igniter - A progress report

    NASA Technical Reports Server (NTRS)

    Lucy, M. H.

    1978-01-01

    The pyrogen igniter has the function to furnish a controlled, high temperature, high pressure gas to ignite solid propellant surfaces in a rocket motor. Present pyrogens consist of numerous inert components. The Standard Molded Pyrogen Igniter (SMPI) consists of three basic parts, a cap with several integrally molded features, an ignition pellet retainer plate, and a tube with additional integrally molded features. A description is presented of an investigation which indicates that the SMPI concept is a viable approach to the design and manufacture of pyrogen igniters for solid propellant rocket motors. For some applications, combining the structural and thermal properties of molded composites can result in the manufacture of lighter assemblies at considerable cost reduction. It is demonstrated that high strength, thin walled tubes with high length to diameter ratios can be fabricated from reinforced plastic molding compound using the displacement compression process.

  5. Public health and economic impact of dampness and mold

    SciTech Connect

    Mudarri, David; Fisk, William J.

    2007-06-01

    The public health risk and economic impact of dampness and mold exposures was assessed using current asthma as a health endpoint. Individual risk of current asthma from exposure to dampness and mold in homes from Fisk et al. (2007), and asthma risks calculated from additional studies that reported the prevalence of dampness and mold in homes were used to estimate the proportion of U.S. current asthma cases that are attributable to dampness and mold exposure at 21% (95% confidence internal 12-29%). An examination of the literature covering dampness and mold in schools, offices, and institutional buildings, which is summarized in the appendix, suggests that risks from exposure in these buildings are similar to risks from exposures in homes. Of the 21.8 million people reported to have asthma in the U.S., approximately 4.6 (2.7-6.3) million cases are estimated to be attributable to dampness and mold exposure in the home. Estimates of the national cost of asthma from two prior studies were updated to 2004 and used to estimate the economic impact of dampness and mold exposures. By applying the attributable fraction to the updated national annual cost of asthma, the national annual cost of asthma that is attributable to dampness and mold exposure in the home is estimated to be $3.5 billion ($2.1-4.8 billion). Analysis indicates that exposure to dampness and mold in buildings poses significant public health and economic risks in the U.S. These findings are compatible with public policies and programs that help control moisture and mold in buildings.

  6. Predicting and preventing mold spoilage of food products.

    PubMed

    Dagnas, Stéphane; Membré, Jeanne-Marie

    2013-03-01

    This article is a review of how to quantify mold spoilage and consequently shelf life of a food product. Mold spoilage results from having a product contaminated with fungal spores that germinate and form a visible mycelium before the end of the shelf life. The spoilage can be then expressed as the combination of the probability of having a product contaminated and the probability of mold growth (germination and proliferation) up to a visible mycelium before the end of the shelf life. For products packed before being distributed to the retailers, the probability of having a product contaminated is a function of factors strictly linked to the factory design, process, and environment. The in-factory fungal contamination of a product might be controlled by good manufacturing hygiene practices and reduced by particular processing practices such as an adequate air-renewal system. To determine the probability of mold growth, both germination and mycelium proliferation can be mathematically described by primary models. When mold contamination on the product is scarce, the spores are spread on the product and more than a few spores are unlikely to be found at the same spot. In such a case, models applicable for a single spore should be used. Secondary models can be used to describe the effect of intrinsic and extrinsic factors on either the germination or proliferation of molds. Several polynomial models and gamma-type models quantifying the effect of water activity and temperature on mold growth are available. To a lesser extent, the effect of pH, ethanol, heat treatment, addition of preservatives, and modified atmospheres on mold growth also have been quantified. However, mold species variability has not yet been properly addressed, and only a few secondary models have been validated for food products. Once the probability of having mold spoilage is calculated for various shelf lives and product formulations, the model can be implemented as part of a risk management

  7. Precision lens molding of asphero diffractive surfaces in chalcogenide materials

    NASA Astrophysics Data System (ADS)

    Nelson, J.; Scordato, M.; Schwertz, K.; Bagwell, J.

    2015-10-01

    Finished lens molding, and the similar process of precision lens molding, have long been practiced for high volume, accurate replication of optical surfaces on oxide glass. The physics surrounding these processes are well understood, and the processes are capable of producing high quality optics with great fidelity. However, several limitations exist due to properties inherent with oxide glasses. Tooling materials that can withstand the severe environmental conditions of oxide glass molding cannot easily be machined to produce complex geometries such as diffractive surfaces, lens arrays, and off axis features. Current machining technologies coupled with a limited selection of tool materials greatly limits the type of structures that can be molded into the finished optic. Tooling for chalcogenide glasses are not bound by these restrictions since the molding temperatures required are much lower than for oxide glasses. Innovations in tooling materials and manufacturing techniques have enabled the production of complex geometries to optical quality specifications and have demonstrated the viability of creating tools for molding diffractive surfaces, off axis features, datums, and arrays. Applications for optics having these features are found in automotive, defense, security, medical, and industrial domains. This paper will discuss results achieved in the study of various molding techniques for the formation of positive diffractive features on a concave spherical surface molded from As2Se3 chalcogenide glass. Examples and results of molding with tools having CTE match with the glass and non CTE match will be reviewed. The formation of stress within the glass during molding will be discussed, and methods of stress management will also be demonstrated and discussed. Results of process development methods and production of good diffractive surfaces will be shown.

  8. Development of a Mold Cracking Simulator: The Study of Breakout and Crack Formation in Continuous Casting Mold

    NASA Astrophysics Data System (ADS)

    Zhang, Yexin; Wang, Wanlin; Zhang, Haihui

    2016-08-01

    Based on the mold simulator technology, a mold-cracking simulator has been successfully developed to study the process of breakout and the shell surface crack formation during the initial solidification of molten steel inside the continuous casting mold. First, a spheroidal protrusion was installed on the mold hot surface to mimic the abnormal force that generated by mold wall deformation, and then the external force was applied to the initial solidified shell, to facilitate the formation of breakout and shell surface cracks. Second, the responding temperature and heat flux across mold hot surface were recovered by an inverse heat conduction problem. The experimental results indicated that the mold breakout occurs around the shell tip by the combined efforts from external horizontal force, ferrostatic pressure, and thermal stresses during positive strip time. The breakout tends to introduce the peak of the responding temperature and heat flux across the mold hot surface. The vertical propagation velocity of the rupture point in the solidification shell has been calculated as 0.42 m/s in this study, which is in good agreement with industrial slabs. The paper also suggested that surface transverse crack formation is related to the segregation of sulfur during the initial solidification of molten steel.

  9. Development of a Mold Cracking Simulator: The Study of Breakout and Crack Formation in Continuous Casting Mold

    NASA Astrophysics Data System (ADS)

    Zhang, Yexin; Wang, Wanlin; Zhang, Haihui

    2016-06-01

    Based on the mold simulator technology, a mold-cracking simulator has been successfully developed to study the process of breakout and the shell surface crack formation during the initial solidification of molten steel inside the continuous casting mold. First, a spheroidal protrusion was installed on the mold hot surface to mimic the abnormal force that generated by mold wall deformation, and then the external force was applied to the initial solidified shell, to facilitate the formation of breakout and shell surface cracks. Second, the responding temperature and heat flux across mold hot surface were recovered by an inverse heat conduction problem. The experimental results indicated that the mold breakout occurs around the shell tip by the combined efforts from external horizontal force, ferrostatic pressure, and thermal stresses during positive strip time. The breakout tends to introduce the peak of the responding temperature and heat flux across the mold hot surface. The vertical propagation velocity of the rupture point in the solidification shell has been calculated as 0.42 m/s in this study, which is in good agreement with industrial slabs. The paper also suggested that surface transverse crack formation is related to the segregation of sulfur during the initial solidification of molten steel.

  10. ''Heat Transfer at the Mold-Metal Interface in Permanent Mold Casting of Aluminum Alloys'' Final Project Report

    SciTech Connect

    Professor R. D. Pehlke, Principal Investigator, Dr. John M. Cookson, Dr. Shouwei Hao, Dr. Prasad Krishna, Kevin T. Bilkey

    2001-12-14

    This project on heat transfer coefficients in metal permanent mold casting has been conducted in three areas. They are the theoretical study at the University of Michigan, the experimental investigation of squeeze casting at CMI-Tech Center (Now Hayes-Lemmerz Technical Center) and the experimental investigation of low pressure permanent mold casting at Amcast Automotive.

  11. Mold Simulator Study of the Initial Solidification of Molten Steel in Continuous Casting Mold. Part I: Experiment Process and Measurement

    NASA Astrophysics Data System (ADS)

    Zhang, Haihui; Wang, Wanlin; Ma, Fanjun; Zhou, Lejn

    2015-10-01

    A mold simulator has been successfully used to study the initial solidification behavior of the molten low carbon steel. Coupled with 2D-IHCD calculation and PSD analysis, the variations of the responding temperatures and heat fluxes, as well as the relationship between shell surface profile, heat flux, shell thickness, mold level fluctuation, and the infiltrated slag film, were investigated in this article. The results suggested that the mold high-frequency temperatures and heat fluxes above liquid steel level vary with the oscillation of the mold, and show an opposite variation pattern as those below the shell tip. The formed shell surface profile is directly correlated to the variation of high-frequency heat fluxes, where the formation of oscillation mark is associated with a sudden increase of the heat flux during negative strip time. Mold level fluctuation contributes to the formation of the extra oscillation marks. The growth of shell thickness follows the square root law, and the instantaneous solidification factor is large near the shell tip and becomes small in the area where the deep shell surface depression is formed. The thickness of the slag film in between mold and shell is in the range of 1.4 to 2.46 mm, and the crystallization of mold flux in mold/shell gap is dynamic.

  12. Injection molding and debinding of micro gears fabricated by micro powder injection molding

    NASA Astrophysics Data System (ADS)

    Ni, Xin-lei; Yin, Hai-qing; Liu, Lin; Yi, Shan-jie; Qu, Xuan-hui

    2013-01-01

    Micro powder injection molding (μPIM) was investigated for possible mass production of micro-components at relatively low cost. However, scaling down to such a level produces challenges in injection molding and debinding. Micro gears were fabricated by μPIM from in-house feedstock. The effect of injection speed and injection pressure on the replication of the micro gear cavity was investigated. Solvent debinding and thermal debinding processes were discussed. The results show that micro gears can be successfully fabricated under the injection pressure of 70 MPa and the 60% injection speed. Either too low or too high injection speed can cause incomplete filling of micro gears. The same is the case with too low injection pressure. Too high injection pressure can bring cracks. Solvent debinding of micro gears was performed in a mixture of petroleum ether and ethanol. Subsequently, micro gears were successfully debound by a multistep heating schedule.

  13. Preparation and properties of an internal mold release for rigid urethane foam

    NASA Astrophysics Data System (ADS)

    Paker, B. G.

    1980-08-01

    Most mold release agents used in the molding of rigid polyurethane foam are applied to the internal surfaces of the mold. These materials form a thin layer between the surface of the mold and the foam, allowing for easy release of the molded parts. This type of mold release must be applied prior to each molding operation; and, after repeated use, cleaning of the mold is required. Small amounts of this mold release are transferred to the molded part, resulting in a part with poor surface bondability characteristics. An internal release agent, which can be mixed in a urethane foam resin was investigated. The internal mold release provided good releasability and resulted in urethane foam that has excellent surface bondability. No compatibility problems are expected from the use of this type of release agent.

  14. Laser removal of mold growth from paper

    NASA Astrophysics Data System (ADS)

    Rosati, C.; Ciofini, D.; Osticioli, I.; Giorgi, R.; Tegli, S.; Siano, S.

    2014-10-01

    The potential of laser ablation in conservation of paper artifacts of cultural interest is under investigation since the second half of nineties. However, the works carried out on the topic are relatively a few as compared with those dedicated to stone, metal and painted artworks. Furthermore, in the latter cases, widespread applications have been successfully carried out, whereas laser cleaning of aged paper is still far from the conservation practice. There are serious risks to produce short- and/or long-term chemical alterations and/or mechanical damages at relatively low fluences. Here, we report a systematic investigation on laser removal of mold growths from prepared and naturally aged paper samples. Fundamental wavelength and second harmonic of QS Nd:YAG laser are tested and compared through optical and spectroscopic characterizations. This allowed defining optimized irradiation conditions and foreseeing further improvements from pulse duration optimization.

  15. Star Mapping with Slime Mold Physarum Polycephalum

    NASA Astrophysics Data System (ADS)

    Mihklepp, M.; Domnitch, E.; Gelfand, D.; Foing, B. H.; van der Heide, E.

    2014-04-01

    Human curiosity and exploration towards outer space has led to many fantastic inventions and given way to alternative scenarios about the origins of life. In the Space Science in the Arts course together with ESTEC with support from ILEWG. I got interested about unicellular slime mold Physarum polycephalum. There has been and still is a lot of research on Physarum polycephalum. This brainless eucaryotic microbe has its smartness and external memory strategies. Physarum can navigate through a maze made of agar using the shortest route possible when two pieces of food are placed at two separate exits of the maze. It can build efficient networks - Physarum created network similar to the existing Tokyo train system. It is being used to control a robot, in USB-sensor and in sound synthesis. Right now there is a lot of research about using Physarum in bio-computing.

  16. Optomechanical details in injection-molded assemblies

    NASA Astrophysics Data System (ADS)

    Hebert, Raymond T.

    1995-12-01

    With the advent of low-cost electro-optic components such as LEDs, laser diodes and CCD imaging devices, the cost and performance demands now fall upon the optical subsystems in order to achieve realistic marketing targets for many emerging commercial and consumer products. One of the many benefits of injection-molded plastic optics is the diversity of features that are available to the design team. Once designed and incorporated into the tooling, many features are virtually free in high-volume production. These features can include mechanical details as well as optical functions. Registration features can be included for precisely positioning optical elements to one another or to other assemblies such as printed circuit boards or housings. Snaps, compression features, spring-loading elements, standoffs, self-tapping screws or ultrasonically weldable features can greatly facilitate ease of assembly.

  17. Effects of polymer melt compressibility on mold filling in micro-injection molding

    NASA Astrophysics Data System (ADS)

    Nguyen, Q. M. P.; Chen, X.; Lam, Y. C.; Yue, C. Y.

    2011-09-01

    In conventional injection molding, the molten polymer in the filling stage is generally assumed to be incompressible. However, this assumption may not be valid in micro-injection molding, since high injection pressure is normally required to avoid short shots. This paper presents both numerical and experimental investigations on the effects of polymer melt compressibility on mold filling into a micro-thickness impression. The study was conducted on six different part thicknesses ranging from 920 to 370 µm. A high-flow COC TOPAS 5013L-10 polymer was chosen as the TOPAS family has recently attracted significant interest for its use in microfluidic applications. A combined finite element/finite difference/control volume approach was adopted to simulate the compressible flow. The shear viscosity of a polymer melt was characterized by the Cross-WLF model, while the melt compressibility was modeled with a double-domain Tait equation. The results obtained indicated that the compressibility of the polymer melt has significant effects on impression pressure and density distribution in the fully filled part with thickness smaller than 620 µm and that the effects become more pronounced with a decrease in part thickness.

  18. Replication of optical microlens array using photoresist coated molds.

    PubMed

    Chakrabarti, M; Dam-Hansen, C; Stubager, J; Pedersen, T F; Pedersen, H C

    2016-05-01

    A cost reduced method of producing injection molding tools is reported and demonstrated for the fabrication of optical microlens arrays. A standard computer-numerical-control (CNC) milling machine was used to make a rough mold in steel. Surface treatment of the steel mold by spray coating with photoresist is used to smooth the mold surface providing good optical quality. The tool and process are demonstrated for the fabrication of an ø50 mm beam homogenizer for a color mixing LED light engine. The acceptance angle of the microlens array is optimized, in order to maximize the optical efficiency from the light engine. Polymer injection molded microlens arrays were produced from both the rough and coated molds and have been characterized for lenslet parameters, surface quality, light scattering, and acceptance angle. The surface roughness (Ra) is improved approximately by a factor of two after the coating process and the light scattering is reduced so that the molded microlens array can be used for the color mixing application. The measured accepted angle of the microlens array is 40° which is in agreement with simulations. PMID:27137566

  19. Interface conditions of two-shot molded parts

    SciTech Connect

    Kisslinger, Thomas; Bruckmoser, Katharina Resch, Katharina; Lucyshyn, Thomas E-mail: guenter.langecker@unileoben.ac.at; Langecker, Guenter Ruediger E-mail: guenter.langecker@unileoben.ac.at; Holzer, Clemens

    2014-05-15

    The focus of this work is on interfaces of two-shot molded parts. It is well known that e.g. material combination, process parameters and contact area structures show significant effects on the bond strength of multi-component injection molded parts. To get information about the bond strength at various process parameter settings and material combinations a test mold with core back technology was used to produce two-component injection molded tensile test specimens. At the core back process the different materials are injected consecutively, so each component runs through the whole injection molding cycle (two-shot process). Due to this consecutive injection molding processes, a cold interface is generated. This is defined as overmolding of a second melt to a solidified polymer preform. Strong interest lies in the way the interface conditions change during the adhesion formation between the individual components. Hence the interface conditions were investigated by computed tomography and Raman spectroscopy. By analyzing these conditions the understanding of the adhesion development during the multi-component injection molding was improved.

  20. Smart plastic functionalization by nanoimprint and injection molding

    NASA Astrophysics Data System (ADS)

    Zalkovskij, Maksim; Thamdrup, Lasse H.; Smistrup, Kristian; Andén, Thomas; Johansson, Alicia C.; Mikkelsen, Niels Jørgen; Madsen, Morten Hannibal; Garnæs, Jørgen; Kristiansen, Tommy Tungelund; Diemer, Mads; Døssing, Michael; Minzari, Daniel; Tang, Peter Torben; Kristensen, Anders; Taboryski, Rafael; Essendrop, Søren; Nielsen, Theodor; Bilenberg, Brian

    2015-03-01

    In this paper, we present a route for making smart functionalized plastic parts by injection molding with sub-micrometer surface structures. The method is based on combining planar processes well known and established within silicon micro and sub-micro fabrication with proven high resolution and high fidelity with truly freeform injection molding inserts. The link between the planar processes and the freeform shaped injection molding inserts is enabled by the use of nanoimprint with flexible molds for the pattern definition combined with unidirectional sputter etching for transferring the pattern. With this approach, we demonstrate the transfer of down to 140 nm wide holes on large areas with good structure fidelity on an injection molding steel insert. The durability of the sub-micrometer structures on the inserts have been investigated by running two production series of 102,000 and 73,000 injection molded parts, respectively, on two different inserts and inspecting the inserts before and after the production series and the molded parts during the production series.

  1. Measurement of Melt Pressure Distribution on Injection Mold Cavity Surface

    NASA Astrophysics Data System (ADS)

    Murata, Yasuhiko; Nukariya, Akihiro; Matsui, Hiroshi; Yoshinaga, Kazuhiro; Yokoi, Hidetoshi

    In order to clarify undesirable molding phenomena in injection molding, it is important to measure melt pressure distribution on the injection mold cavity in detail. In a previous paper, we reported a new method for measuring melt pressure distribution on the injection mold cavity surface using a mold with a pressure transmission pin array and tactile sensor. In this study, we attempted to measure the variation of melt pressure distribution when the injection rate and the holding pressure are changed. The results indicate phenomenon in which pressure remains near the gate in the cavity until the instant the mold is opened. This phenomenon is considered to be due to the extreme increase in melt density from the filling process through the pressure holding process and cooling process, which causes the melt to cool and solidify before it can shrink adequately. Furthermore, it was also found that there exists a close relation between the thickness distribution, residual pressure distribution and birefringence pattern of molded products.

  2. Screening Tools to Estimate Mold Burdens in Homes

    SciTech Connect

    Vesper, Sephen J.; McKinstry, Craig A.; Bradham, Karen; Ashley, Peter; Cox, David F.; DeWalt, Gary; Lin, King-teh N.

    2009-01-01

    Objective: The objective of this study was to develop screening tools that could be used to estimate the mold burden in a home which would indicate whether more detailed testing might be useful. Methods: Previously, in the American Healthy Home Survey, a DNA-based method of analysis called mold specific quantitative PCR was used to measure 36 molds in standard protocol dust samples. This resulted in a national index called the Environmental Relative Moldiness Index. In this current study, two possible screening methods were considered: use of the vacuum cleaner bag dust rather than the standard protocol dust samples and reducing the number of molds needed to be quantified resulting in the creation of a simpler mold burden scale. Results: Comparison of vacuum bag and standard dust samples from 157 of the same homes demonstrated that most molds had higher detection rates in vacuum bag dust compared to the standard dust samples but the ERMI values were still related to each other. The second approach to simplifying the screening for mold burdens produced a correlated (ρ=0.80) index to the ERMI called the American Relative Moldiness Index (ARMI) which requires the analysis of only 12 species. Conclusions: Vacuum bag dust sample ERMI values were predictive in placing a home into the lower or upper 50% of homes on the ERMI scale. If it is not possible to obtain the standard dust sample, the vacuum cleaner bag dust may be a useful screening tool for estimating mold burdens in homes. If the standard sample is available and a simpler screening test is sought to estimate the mold burden in homes, the ARMI scale might be useful.

  3. Fabrication of sinterable silicon nitride by injection molding

    NASA Technical Reports Server (NTRS)

    Quackenbush, C. L.; French, K.; Neil, J. T.

    1982-01-01

    Transformation of structural ceramics from the laboratory to production requires development of near net shape fabrication techniques which minimize finish grinding. One potential technique for producing large quantities of complex-shaped parts at a low cost, and microstructure of sintered silicon nitride fabricated by injection molding is discussed and compared to data generated from isostatically dry-pressed material. Binder selection methodology, compounding of ceramic and binder components, injection molding techniques, and problems in binder removal are discussed. Strength, oxidation resistance, and microstructure of sintered silicon nitride fabricated by injection molding is discussed and compared to data generated from isostatically dry-pressed material.

  4. Residual orientation in micro-injection molded parts

    SciTech Connect

    Healy, John; Edward, Graham H.; Knott, Robert B.

    2008-06-30

    The residual orientation following micro-injection molding of small rectangular plates with linear polyethylene has been examined using small-angle neutron scattering, and small- and wide-angle X-ray scattering. The effect of changing the molding conditions has been examined, and the residual chain orientation has been compared to the residual orientation of the crystallites as a function of position in the sample. This study has found that, for micromoldings, the orientation of the crystallites decreases with increasing injection speed and increasing mold thickness. The combined data suggest that the majority of the orientation present comes from oriented crystal growth rather than residual chain orientation.

  5. Atmospheric transport of mold spores in clouds of desert dust

    USGS Publications Warehouse

    Shinn, E.A.; Griffin, Dale W.; Seba, D.B.

    2003-01-01

    Fungal spores can be transported globally in clouds of desert dust. Many species of fungi (commonly known as molds) and bacteria--including some that are human pathogens--have characteristics suited to long-range atmospheric transport. Dust from the African desert can affect air quality in Africa, Europe, the Middle East, and the Americas. Asian desert dust can affect air quality in Asia, the Arctic, North America, and Europe. Atmospheric exposure to mold-carrying desert dust may affect human health directly through allergic induction of respiratory stress. In addition, mold spores within these dust clouds may seed downwind ecosystems in both outdoor and indoor environments.

  6. Rapid and low-cost prototyping of medical devices using 3D printed molds for liquid injection molding.

    PubMed

    Chung, Philip; Heller, J Alex; Etemadi, Mozziyar; Ottoson, Paige E; Liu, Jonathan A; Rand, Larry; Roy, Shuvo

    2014-01-01

    Biologically inert elastomers such as silicone are favorable materials for medical device fabrication, but forming and curing these elastomers using traditional liquid injection molding processes can be an expensive process due to tooling and equipment costs. As a result, it has traditionally been impractical to use liquid injection molding for low-cost, rapid prototyping applications. We have devised a method for rapid and low-cost production of liquid elastomer injection molded devices that utilizes fused deposition modeling 3D printers for mold design and a modified desiccator as an injection system. Low costs and rapid turnaround time in this technique lower the barrier to iteratively designing and prototyping complex elastomer devices. Furthermore, CAD models developed in this process can be later adapted for metal mold tooling design, enabling an easy transition to a traditional injection molding process. We have used this technique to manufacture intravaginal probes involving complex geometries, as well as overmolding over metal parts, using tools commonly available within an academic research laboratory. However, this technique can be easily adapted to create liquid injection molded devices for many other applications. PMID:24998993

  7. A review on the importance of surface coating of micro/nano-mold in micro/nano-molding processes

    NASA Astrophysics Data System (ADS)

    Saha, Biswajit; Toh, Wei Quan; Liu, Erjia; Beng Tor, Shu; Hardt, David E.; Lee, Junghoon

    2016-01-01

    Micro/nano hot-embossing and injection molding are two promising manufacturing processes for the mass production of workpieces bearing micro/nanoscale features. However, both the workpiece and micro/nano-mold are susceptive to structural damage due to high thermal stress, adhesion and friction, which occur at the interface between the workpiece and the mold during these processes. Hence, major constraints of micro/nano-molds are mainly attributed to improper replication and their inability to withstand a prolonged sliding surface contact because of high sidewall friction and/or high adhesion. Consequently, there is a need for proper surface coating as it can improve the surface properties of micro/nano-molds such as having a low friction coefficient, low adhesion and low wear rate. This review deals with the physical, mechanical and tribological properties of various surface coatings and their impact on the replication efficiency and lifetime of micro/nano-molds that are used in micro/nano hot-embossing and injection molding processes.

  8. Rapid and Low-cost Prototyping of Medical Devices Using 3D Printed Molds for Liquid Injection Molding

    PubMed Central

    Chung, Philip; Heller, J. Alex; Etemadi, Mozziyar; Ottoson, Paige E.; Liu, Jonathan A.; Rand, Larry; Roy, Shuvo

    2014-01-01

    Biologically inert elastomers such as silicone are favorable materials for medical device fabrication, but forming and curing these elastomers using traditional liquid injection molding processes can be an expensive process due to tooling and equipment costs. As a result, it has traditionally been impractical to use liquid injection molding for low-cost, rapid prototyping applications. We have devised a method for rapid and low-cost production of liquid elastomer injection molded devices that utilizes fused deposition modeling 3D printers for mold design and a modified desiccator as an injection system. Low costs and rapid turnaround time in this technique lower the barrier to iteratively designing and prototyping complex elastomer devices. Furthermore, CAD models developed in this process can be later adapted for metal mold tooling design, enabling an easy transition to a traditional injection molding process. We have used this technique to manufacture intravaginal probes involving complex geometries, as well as overmolding over metal parts, using tools commonly available within an academic research laboratory. However, this technique can be easily adapted to create liquid injection molded devices for many other applications. PMID:24998993

  9. Method of reusably sealing a silicone rubber vacuum bag to a mold for composite manufacture

    NASA Technical Reports Server (NTRS)

    Steinbach, John (Inventor)

    1989-01-01

    A silicone rubber vacuum bag for use in composite article manufacture is reusably sealed to a mold, without mechanical clamping means. The mold-mating portion of the bag is primed with a silicone rubber adhesive, which is cured thereto, and a layer of semiadhesive sealer is applied between the primed mold-mating portion of the bag and the mold.

  10. Detail of arched window and eaves molding on west elevation; ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Detail of arched window and eaves molding on west elevation; camera facing east. - Mare Island Naval Shipyard, Old Administrative Offices, Eighth Street, north side between Railroad Avenue & Walnut Avenue, Vallejo, Solano County, CA

  11. Method and mold for casting thin metal objects

    DOEpatents

    Pehrson, Brandon P; Moore, Alan F

    2014-04-29

    Provided herein are various embodiments of systems for casting thin metal plates and sheets. Typical embodiments include layers of mold cavities that are oriented vertically for casting the metal plates. In some embodiments, the mold cavities include a beveled edge such that the plates that are cast have a beveled edge. In some embodiments, the mold cavities are filled with a molten metal through an open horizontal edge of the cavity. In some embodiments, the mold cavities are filled through one or more vertical feed orifices. Further disclosed are methods for forming a thin cast metal plate or sheet where the thickness of the cast part is in a range from 0.005 inches to 0.2 inches, and the surface area of the cast part is in a range from 16 square inches to 144 square inches.

  12. 36. LARGE MOLD MAKING MACHINE, GREY IRON UNIT #4 SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    36. LARGE MOLD MAKING MACHINE, GREY IRON UNIT #4 SHOWING PATTERNS THAT FLASKS FIT OVER PRIOR TO BEING FILLED WITH SAND AND COMPRESSED. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  13. INTERIOR VIEW, PREPARING LARGE MOLD IN BOX FLOOR AREA. WORKERS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR VIEW, PREPARING LARGE MOLD IN BOX FLOOR AREA. WORKERS JUST FILLED THE FLASK WITH SAND FROM A HIGH VELOCITY MECHANICAL SAND THRUSTER. - Stockham Pipe & Fittings Company, Ductile Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  14. 31. FLOOR MOLDING PROCESS. THE WORKER IS 'PARTING DOWN' THE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. FLOOR MOLDING PROCESS. THE WORKER IS 'PARTING DOWN' THE MOULDING SAND TO REMOVE THE PATTERN FROM THE FLASK LOADED WITH SAND. WORKER: GEORGE URIARTE. - Knight Foundry, 13 Eureka Street, Sutter Creek, Amador County, CA

  15. Research on machine vision system of monitoring injection molding processing

    NASA Astrophysics Data System (ADS)

    Bai, Fan; Zheng, Huifeng; Wang, Yuebing; Wang, Cheng; Liao, Si'an

    2016-01-01

    With the wide development of injection molding process, the embedded monitoring system based on machine vision has been developed to automatically monitoring abnormality of injection molding processing. First, the construction of hardware system and embedded software system were designed. Then camera calibration was carried on to establish the accurate model of the camera to correct distortion. Next the segmentation algorithm was applied to extract the monitored objects of the injection molding process system. The realization procedure of system included the initialization, process monitoring and product detail detection. Finally the experiment results were analyzed including the detection rate of kinds of the abnormality. The system could realize the multi-zone monitoring and product detail detection of injection molding process with high accuracy and good stability.

  16. Cork is used to make tooling patterns and molds

    NASA Technical Reports Server (NTRS)

    Hoffman, F. J.

    1965-01-01

    Sheet and waste cork are cemented together to provide a tooling pattern or mold. The cork form withstands moderately high temperatures under vacuum or pressure with minimum expansion, shrinkage, or distortion.

  17. 55. August 17, 1913 "Clearing off mold from surface ground, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    55. August 17, 1913 "Clearing off mold from surface ground, Pinnacles Road, mile six. Note mould raked aside and piled up preparatory to burning." - Crater Lake National Park Roads, Klamath Falls, Klamath County, OR

  18. PNEUMATICALLY CLEANING TOP HALF OF LARGE MOLD IN BOX FLOOR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    PNEUMATICALLY CLEANING TOP HALF OF LARGE MOLD IN BOX FLOOR AREA TO REMOVE ANY EXCESS OR LOOSE SAND. - Stockham Pipe & Fittings Company, Ductile Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  19. SHAKE OUT WORKER DUMPING COOLED MOLDS ONTO THE VIBRATING CONVEYOR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    SHAKE OUT WORKER DUMPING COOLED MOLDS ONTO THE VIBRATING CONVEYOR THAT TRANSPORTS SAND AND CASTINGS TO THE SEPARATION SCREEN. - Southern Ductile Casting Company, Centerville Foundry, 101 Airport Road, Centreville, Bibb County, AL

  20. EVALUATION OF POLLUTION PREVENTION OPPORTUNITIES FOR MOLD RELEASE AGENTS

    EPA Science Inventory

    The report gives results of an assessment of the processes, materials, installation practices, and emission characteristics associated with the application of mold release agents (MRAs). Emissions were estimated based on available information on MRA composition and consumption. V...

  1. Molded composite pyrogen igniter for rocket motors. [solid propellant ignition

    NASA Technical Reports Server (NTRS)

    Heier, W. C.; Lucy, M. H. (Inventor)

    1978-01-01

    A lightweight pyrogen igniter assembly including an elongated molded plastic tube adapted to contain a pyrogen charge was designed for insertion into a rocket motor casing for ignition of the rocket motor charge. A molded plastic closure cap provided for the elongated tube includes an ignition charge for igniting the pyrogen charge and an electrically actuated ignition squib for igniting the ignition charge. The ignition charge is contained within a portion of the closure cap, and it is retained therein by a noncorrosive ignition pellet retainer or screen which is adapted to rest on a shoulder of the elongated tube when the closure cap and tube are assembled together. A circumferentially disposed metal ring is provided along the external circumference of the closure cap and is molded or captured within the plastic cap in the molding process to provide, along with O-ring seals, a leakproof rotary joint.

  2. Slope-deviation measurement of Fresnel-shaped mold surfaces.

    PubMed

    Kiefel, Peter; Hornung, Thorsten; Nitz, Peter; Reinecke, Holger

    2016-03-10

    Molds are used to dictate their shape to other materials in embossing or filling processes. In optics fabrication especially, the exact surface slope of the polymer replica is of high relevance. The quality control of molds is challenging: non-invasive, optical metrologies struggle with shiny surfaces that minimize the scattering of light. In addition, the inspection of complex shaped molds with a stepped optical surface can be difficult. In response, the authors show a backward ray-tracing approach combined with fringe-reflection technique to determine the slopes of a Fresnel-shaped mold surface with topography features in the magnitude order of a quarter millimeter. The error is kept small by stitching together several measurements with different sample rotations. PMID:26974807

  3. 10. INTERIOR VIEW WITH CORES FOR VALVE MOLDING. STOCKHAM EMPLOYEES ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. INTERIOR VIEW WITH CORES FOR VALVE MOLDING. STOCKHAM EMPLOYEES REFER TO THESE CORES AS THE STAR WARS CASTINGS. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  4. VIEW FACING EAST. ORE TRESTLE WINDS AROUND THE INGOT MOLD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW FACING EAST. ORE TRESTLE WINDS AROUND THE INGOT MOLD CONDITIONING BUILDING IN FOREGROUND. PITTSBURGH & LAKE ERIE TRACKS WIND THROUGH TOWN TOWARDS PITTSBURGH AT RIGHT. - Pittsburgh Steel Company, Monessen Works, Donner Avenue, Monessen, Westmoreland County, PA

  5. The Mold Insurance Crisis: Less than It Appears.

    ERIC Educational Resources Information Center

    Mangan, Joseph F.

    2003-01-01

    Discusses two different but closely related problems that must be solved when determining what insurance coverage a campus needs for mold losses: issues of property insurance and of liability insurance. (EV)

  6. Residual stresses in injection molded shape memory polymer parts

    NASA Astrophysics Data System (ADS)

    Katmer, Sukran; Esen, Huseyin; Karatas, Cetin

    2016-03-01

    Shape memory polymers (SMPs) are materials which have shape memory effect (SME). SME is a property which has the ability to change shape when induced by a stimulator such as temperature, moisture, pH, electric current, magnetic field, light, etc. A process, known as programming, is applied to SMP parts in order to alter them from their permanent shape to their temporary shape. In this study we investigated effects of injection molding and programming processes on residual stresses in molded thermoplastic polyurethane shape memory polymer, experimentally. The residual stresses were measured by layer removal method. The study shows that injection molding and programming process conditions have significantly influence on residual stresses in molded shape memory polyurethane parts.

  7. 10. VIEW OF DEPLETED URANIUM INGOT AND MOLD IN FOUNDRY. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. VIEW OF DEPLETED URANIUM INGOT AND MOLD IN FOUNDRY. (11/11/56) - Rocky Flats Plant, Non-Nuclear Production Facility, South of Cottonwood Avenue, west of Seventh Avenue & east of Building 460, Golden, Jefferson County, CO

  8. Mold Heating and Cooling Pump Package Operator Interface Controls Upgrade

    SciTech Connect

    Josh A. Salmond

    2009-08-07

    The modernization of the Mold Heating and Cooling Pump Package Operator Interface (MHC PP OI) consisted of upgrading the antiquated single board computer with a proprietary operating system to off-the-shelf hardware and off-the-shelf software with customizable software options. The pump package is the machine interface between a central heating and cooling system that pumps heat transfer fluid through an injection or compression mold base on a local plastic molding machine. The operator interface provides the intelligent means of controlling this pumping process. Strict temperature control of a mold allows the production of high quality parts with tight tolerances and low residual stresses. The products fabricated are used on multiple programs.

  9. Thermal deformation compensation in the molding of aspheric glass lenses

    NASA Astrophysics Data System (ADS)

    Lee, Dong-kil; Oh, Jun-girl; Jang, Won-Gun; Kim, Yang-gyu; Lee, Kwanghoon; Park, Anjin; Yang, Young-Soo

    2014-06-01

    Generally, aspheric glass lenses are manufactured using a glass molding press (GMP) method and a tungsten carbide mold core. This study analyzes the thermal deformation that occurs during the GMP process, and the results were applied to compensate an aspheric glass lens. After the compensation process, the form accuracy of aspheric glass lenses improved from ˜3.7 to ˜0.35 μm. The compensated lens complied with the actual specifications.

  10. 22. INTERIOR VIEW WITH INTERIOR VIEW OF MOLDING SANDS CONTROL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. INTERIOR VIEW WITH INTERIOR VIEW OF MOLDING SANDS CONTROL AND TEST LAB FOR UNIT NO. 2 GREY IRON DISAMATIC. SAND CASTING TECHNICIAN, ROY BATES, TESTS THE WEIGHT OF THE SAND, DRYS IT, AND WEIGHT IT AGAINST STANDARDS TO CALCULATE THE CORRECT MOISTURE NEEDED FOR DIFFERENT MOLDS. THE SAND MIX VARY WITH THE SIZE AND COMPOSITION OF THE CASTING. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  11. Evaluation of Additive Manufacturing for Composite Part Molds

    SciTech Connect

    Duty, Chad E.; Springfield, Robert M.

    2015-02-01

    The ORNL Manufacturing Demonstration Facility (MDF) collaborated with Tru-Design to test the quality and durability of molds used for making fiber reinforced composites using additive manufacturing. The partners developed surface treatment techniques including epoxy coatings and machining to improve the quality of the surface finish. Test samples made using the printed and surface finished molds demonstrated life spans suitable for one-of-a-kind and low-volume applications, meeting the project objective.

  12. Regeneration of imprint molds using vacuum ultraviolet light

    NASA Astrophysics Data System (ADS)

    Nakao, Masashi; Yamaguchi, Masanori; Yabu, Shintaro

    2011-04-01

    Etching characteristics of various resins by a vacuum ultraviolet (VUV, λ=172 nm) light have been examined under conditions of exposure time, substrate temperature, radiation distance and ambient oxygen concentration. The VUV light have used to clean the imprinted molds which are contaminated by organic substances such as ultraviolet-resins through many times of imprinting processes, and it has revealed that the VUV light has effectively regenerated the contaminated molds manufactured by quartz, silicon-carbide and nickel.

  13. Fabrication of microinjection-molded miniature freeform Alvarez lenses.

    PubMed

    Li, Likai; Raasch, Thomas W; Sieber, Ingo; Beckert, Erik; Steinkopf, Ralf; Gengenbach, Ulrich; Yi, Allen Y

    2014-07-01

    Microinjection molding is a mass production method to fabricate affordable optical components. However, the intense nature of this process often results in part deformation and uneven refractive index distribution. These two factors limit the precision of replicated optics. In order to understand the influences of injection molding on freeform optical devices, in this study, finite element method (FEM) was employed to investigate the miniature microinjection-molded Alvarez lenses. In addition, an innovative metrology setup was proposed to evaluate the optical wavefront patterns in the molded lenses using an interferometer-based wavefront measurement system. This measurement setup utilized an optical matching liquid to reduce or eliminate the lenses' surface power such that the wavefront pattern with large deviation from the freeform lenses can be measured by a regular wavefront setup. The FEM simulation results were also used to explain the differences between the nominal and experimentally measured wavefront patterns of the microinjection-molded Alvarez lenses. In summary, the proposed method combining simulation and wavefront measurements is shown to be an effective approach for studying injection molding of freeform optics. PMID:25089987

  14. Mold-filling experiments for validation of modeling encapsulation. Part 1, "wine glass" mold.

    SciTech Connect

    Castaneda, Jaime N.; Grillet, Anne Mary; Altobelli, Stephen A.; Cote, Raymond O.; Mondy, Lisa Ann

    2005-06-01

    The C6 project 'Encapsulation Processes' has been designed to obtain experimental measurements for discovery of phenomena critical to improving these processes, as well as data required in the verification and validation plan (Rao et al. 2001) for model validation of flow in progressively complex geometries. We have observed and recorded the flow of clear, Newtonian liquids and opaque, rheologically complex suspensions in two mold geometries. The first geometry is a simple wineglass geometry in a cylinder and is reported here in Part 1. The results in a more realistic encapsulation geometry are reported in Part 2.

  15. Thermomechanical Behavior of Molded Metallic Glass Nanowires

    PubMed Central

    Magagnosc, Daniel J.; Chen, Wen; Kumar, Golden; Schroers, Jan; Gianola, Daniel S.

    2016-01-01

    Metallic glasses are disordered materials that offer the unique ability to perform thermoplastic forming operations at low thermal budget while preserving excellent mechanical properties such as high strength, large elastic strain limits, and wear resistance owing to the metallic nature of bonding and lack of internal defects. Interest in molding micro- and nanoscale metallic glass objects is driven by the promise of robust and high performance micro- and nanoelectromechanical systems and miniature energy conversion devices. Yet accurate and efficient processing of these materials hinges on a robust understanding of their thermomechanical behavior. Here, we combine large-scale thermoplastic tensile deformation of collections of Pt-based amorphous nanowires with quantitative thermomechanical studies of individual nanowires in creep-like conditions to demonstrate that superplastic-like flow persists to small length scales. Systematic studies as a function of temperature, strain-rate, and applied stress reveal the transition from Newtonian to non-Newtonian flow to be ubiquitous across the investigated length scales. However, we provide evidence that nanoscale specimens sustain greater free volume generation at elevated temperatures resulting in a flow transition at higher strain-rates than their bulk counterparts. Our results provide guidance for the design of thermoplastic processing methods and methods for verifying the flow response at the nanoscale. PMID:26787400

  16. Thermomechanical Behavior of Molded Metallic Glass Nanowires.

    PubMed

    Magagnosc, Daniel J; Chen, Wen; Kumar, Golden; Schroers, Jan; Gianola, Daniel S

    2016-01-01

    Metallic glasses are disordered materials that offer the unique ability to perform thermoplastic forming operations at low thermal budget while preserving excellent mechanical properties such as high strength, large elastic strain limits, and wear resistance owing to the metallic nature of bonding and lack of internal defects. Interest in molding micro- and nanoscale metallic glass objects is driven by the promise of robust and high performance micro- and nanoelectromechanical systems and miniature energy conversion devices. Yet accurate and efficient processing of these materials hinges on a robust understanding of their thermomechanical behavior. Here, we combine large-scale thermoplastic tensile deformation of collections of Pt-based amorphous nanowires with quantitative thermomechanical studies of individual nanowires in creep-like conditions to demonstrate that superplastic-like flow persists to small length scales. Systematic studies as a function of temperature, strain-rate, and applied stress reveal the transition from Newtonian to non-Newtonian flow to be ubiquitous across the investigated length scales. However, we provide evidence that nanoscale specimens sustain greater free volume generation at elevated temperatures resulting in a flow transition at higher strain-rates than their bulk counterparts. Our results provide guidance for the design of thermoplastic processing methods and methods for verifying the flow response at the nanoscale. PMID:26787400

  17. Thermomechanical Behavior of Molded Metallic Glass Nanowires

    NASA Astrophysics Data System (ADS)

    Magagnosc, Daniel J.; Chen, Wen; Kumar, Golden; Schroers, Jan; Gianola, Daniel S.

    2016-01-01

    Metallic glasses are disordered materials that offer the unique ability to perform thermoplastic forming operations at low thermal budget while preserving excellent mechanical properties such as high strength, large elastic strain limits, and wear resistance owing to the metallic nature of bonding and lack of internal defects. Interest in molding micro- and nanoscale metallic glass objects is driven by the promise of robust and high performance micro- and nanoelectromechanical systems and miniature energy conversion devices. Yet accurate and efficient processing of these materials hinges on a robust understanding of their thermomechanical behavior. Here, we combine large-scale thermoplastic tensile deformation of collections of Pt-based amorphous nanowires with quantitative thermomechanical studies of individual nanowires in creep-like conditions to demonstrate that superplastic-like flow persists to small length scales. Systematic studies as a function of temperature, strain-rate, and applied stress reveal the transition from Newtonian to non-Newtonian flow to be ubiquitous across the investigated length scales. However, we provide evidence that nanoscale specimens sustain greater free volume generation at elevated temperatures resulting in a flow transition at higher strain-rates than their bulk counterparts. Our results provide guidance for the design of thermoplastic processing methods and methods for verifying the flow response at the nanoscale.

  18. Investigation of Heat Transfer at the Mold/Metal Interface in Permanent Mold Casting of Light Alloys

    SciTech Connect

    Robert D. Pehlke; John T. Berry

    2005-12-16

    Accurate modeling of the metal casting process prior to creating a mold design demands reliable knowledge of the interfacial heat transfer coefficient at the mold metal interface as a function of both time and location. The phenomena concerned with the gap forming between the mold and the solidifying metal are complex but need to be understood before any modeling is attempted. The presence of mold coatings further complicates the situation. A commercial casting was chosen and studied in a gravity permanent mold casting process. The metal/mold interfacial heat transfer coefficient (IHTC) was the focus of the research. A simple, direct method has been used to evaluate the IHTC. Both the simulation and experiments have shown that a reasonably good estimate of the heat transfer coefficient could be made in the case studied. It has been found that there is a good agreement between experiments and simulations in the temperature profiles during the solidification process, given that the primary mechanism of heat transfer across the gap in permanent mold casting of light alloys is by conduction across the gap. The procedure utilized to determine the interfacial heat transfer coefficient can be applied to other casting processes. A recently completed project involving The University of Michigan and Mississippi State University, together with several industrial partners, which was supported by the USDOE through the Cast Metals Coalition, examined a number of cases of thermal contact. In an investigation which gave special consideration to the techniques of measurement, several mold coatings were employed and results presented as a function of time. Realistic conditions of coating thickness and type together with an appropriate combination of mold preheat and metal pouring temperature were strictly maintained throughout the investigation. Temperature sensors, in particular thermocouples, play an important part in validating the predictions of solidification models. Cooling

  19. Degradation of Perfluorotrichlorosilane Antisticking Layers: The Impact on Mold Cleaning, Ultraviolet-Nanoimprinting, and Bonded Ultraviolet-Nanoimprint Molds

    NASA Astrophysics Data System (ADS)

    Kirchner, Robert; Teng, Lichao; Lu, Bo; Adolphi, Barbara; Fischer, Wolf-Joachim

    2011-06-01

    A reduction of the adhesion between imprint resist and mold is crucial for defect free imprints and is commonly achieved by silane based antisticking layers. Highly stable antisticking layers are required for high throughputs and long imprint mold lifetimes. Hybrid nanoimprint molds avoid the imprint inherent residual polymer layer in UV-assisted nanoimprinting. Such hybrid molds have chemically heterogeneous surfaces of silica and, e.g., chromium oxide regions. The chemical stability of vapor-coated 1H,1H,2H,2H-perfluorodecyltrichlorosilane antisticking layers against acetone, acidic piranha, reactive ion etching and UV-assisted nanoimprinting was investigated. To evaluate the behavior of hybrid mold surfaces, flat silica and antireflective chromium-oxynitride surfaces were used. The antisticking layer on both surfaces was highly chemical resistant against acetone. A continuous antisticking layer degradation with a surface free energy increase of 0.9 mN/m per 10 min piranha treatment and 1.2 mN/m per 10 subsequent UV-assisted imprints was found for silica surfaces. On the chromium surfaces, the antisticking layer quality was much lower than on fused silica and degraded much faster. The surface free energy of silane coated chromium surfaces was increased by 2.3 mN/m after 10 imprints and the antisticking layer was completely degraded after a single 10 min piranha cleaning step. The lower antisticking layer quality on antireflective chromium was attributed to the surface itself. Additionally, the high chemical resistance of the vapor coated silane was used to successfully protect the adhesive joints of cost-efficient, adhesively bonded nanoimprint molds from being degraded by acidic piranha during mold cleaning. This can significantly increase the life-time of such bonded molds.

  20. Effect of cross sectional geometry on PDMS micro peristaltic pump performance: comparison of SU-8 replica molding vs. micro injection molding.

    PubMed

    Graf, Neil J; Bowser, Michael T

    2013-10-01

    Two different fabrication methods were employed to fabricate micropumps with different cross-sectional channel geometries. The first was to fabricate rectangular cross-sectional microchannel geometries using the well known fabrication method of replica molding (REM). The second, and far less utilized fabrication technique, was to create microchannel molds using an in-house fabricated handheld micro injection molding apparatus. The injection mold apparatus was designed for use with elastomeric room temperature vulcanization (RTV) polymers, as opposed to most other injection molding machines, which are designed for use with thermoplastic polymers. The injection mold's bottom plate was used as a microchannel molding template. The molding template was created by threading a small-diameter wire (150 μm or less) through the injection mold's bottom plate, with subsequent adhesion and smoothing of a thin piece of aluminum foil over the wire-raised injection mold template. When molded against, the template produced a rounded/Gaussian-shaped PDMS microchannel. The design of the injection mold will be presented, along with a direct comparison for micropump performance metrics such as flow rate, valving characteristics, and maximum backpressures attainable for each of the respective micropump channel geometries. PMID:23917263

  1. High resolution PFPE-based molding High resolution PFPE-based molding High resolution PFPE-based molding techniques for nanofabrication of high pattern density sub-20 nm features: A fundamental materials approach

    SciTech Connect

    Williams, Stuart S; Samulski, Edward; Lopez, Renee; Ruiz, Ricardo; DeSimone, Joseph; Retterer, Scott T

    2010-01-01

    ABSTRACT. Described herein is the development and investigation of PFPE-based elastomers for high resolution replica molding applications. The modulus of the elastomeric materials was increased through synthetic and additive approaches while maintaining relatively low surface energies (<25 mN/m). Using practically relevant large area master templates, we show that the resolution of the molds is strongly dependant upon the elastomeric mold modulus. A composite mold approach was used to form flexible molds out of stiff, high modulus materials that allow for replication of sub-20 nm post structures. Sub-100 nm line grating master templates, formed using e-beam lithography, were used to determine the experimental stability of the molding materials. It was observed that as the feature spacing decreased, high modulus composite molds were able to effectively replicate the nano-grating structures without cracking or tear-out defects that typically occur with high modulus elastomers.

  2. Nanoelectrode lithography using flexible conductive molds

    NASA Astrophysics Data System (ADS)

    Li, Y. F.; Chen, K. H.; Ootera, Y.; Toshiyoshi, H.; Fujita, H.

    2015-11-01

    This paper reports a pattern transfer technique based on an anodic oxidation reaction (AOR) using two kinds of flexible conductive molds (FCMs). This technique enables fine pattern transfer on an uneven surface with 1.8-µm-deep recesses and also improves the transfer uniformity on a flat surface. Both FCMs consist of a base, a flexible insulating pattern on the top of the base and a nanometric thick metal film deposited on the top of the base and the insulating pattern as a conductive layer. Oxide patterns corresponding to the conductive pattern are transferred on the surface of the target material via an AOR between the FCM and the target. The flexibility of the base and the insulating pattern not only enables the FCM to come close enough to the recess of the target material with an uneven surface to generate oxide patterns but also enables a uniform electrical contact between the FCM and the target material with a flat surface to improve transfer uniformity. The conductive pattern on the FCM makes it possible to generate oxide patterns on the surface of the target material in a resistless process via the AOR. A microelectromechanical system technique is used to fabricate the proposed FCMs, and two kinds of FCMs are developed: A film-type FCM with a conductive pattern whose line width is from 5 to 20 µm and a resin-type FCM with a 200-nm half-pitch conductive pattern. Oxide patterns with a line width and a half pitch corresponding to the conductive patterns of the two developed FCMs were collectively transferred on an uneven surface with 1.8-µm-deep recesses and a flat surface of silicon substrate in a millimeter-scale area.

  3. An investigation into the injection molding of PMR-15 polyimide

    NASA Technical Reports Server (NTRS)

    Colaluca, M. A.

    1984-01-01

    The chemorheological behavior of the PRM-15 molding compounds were characterized, the range of suitable processing parameters for injection molding in a reciprocating screw injection molding machine was determined, and the effects of the injection molding processing parameters on the mechanical properties of molded PMR-15 parts were studied. The apparatus and procedures for measuring viscosity and for determining the physical response of the material during heating are described. Results show that capillary rheometry can be effectively used with thermosets if the equipment is designed to overcome some of the inherent problems of these materials. A uniform temperature was provided in the barrel by using a circulating hot oil system. Standard capillary rheometry methods can provide the dependence of thermoset apparent viscosity on shear rate, temperature, and time. Process conditions resulting in complete imidization should be carefully defined. Specification of controlled oven temperature is inadequate and can result in incomplete imidization. For completely imidized PMR-15 heat at 15 C/min melt flow without gas evolution occurs in the temperature range of 325 C to 400 C.

  4. Mold and mycotoxin problems encountered during malting and brewing.

    PubMed

    Wolf-Hall, Charlene E

    2007-10-20

    Fusarium infections in grains can have severe effects on malt and beer. While some degree of Fusarium mycotoxins, such as deoxynivalenol, present in infected barley may be lost during steeping, the Fusarium mold is still capable of growth and mycotoxin production during steeping, germination and kilning. Therefore, detoxification of grain before malting may not be practical unless further growth of the mold is also prevented. Methods to reduce the amount of mold growth during malting are needed. Physical, chemical and biological methods are reviewed. Irradiation looks very promising as a means to prevent Fusarium growth during malting, but the effect on the surviving mold to produce mycotoxins and the effect on malt quality needs further study. Chemical treatments such as ozonation, which would not leave residual chemical in the beer also appear to be promising. Although biological control methods may be desirable, due to the use of "natural" inhibition, the effects of these inhibitors on malt and beer quality requires further investigation. It may also be possible to incorporate detoxifying genes into fermentation yeasts, which would result in detoxification of the wort when mold growth is no longer a problem. Development of these types of technological interventions should help improve the safety of products, such as beer, made from Fusarium infected grain. PMID:17727998

  5. Autosterilization of biodegradable implants by injection molding process.

    PubMed

    König, C; Ruffieux, K; Wintermantel, E; Blaser, J

    1997-01-01

    Sterilization of degradable implants by standard procedures may damage the parts due to the labile chemical nature of the polymers. This study examined whether the injection molding process used for the production of polymeric parts may itself sterilize the implant due to high temperature, pressure, and shear forces applied. Poly-D,L-lactic acid (PDLLA) and poly-L-lactic acid (PLLA) granules were contaminated with thermoresistant spores of Bacillus stearothermophilus (>10(5) spores/g). Sterile and contaminated granules of both polymers were injection molded and tested for sterility. All 27 samples produced with sterile PDLLA and processed at 120 degrees C and all 18 samples produced with sterile PLLA at 200 degrees C remained sterile after injection molding and handling. However, in five out of 28 PDLLA samples and in one out of 26 PLLA samples produced with contaminated material, spores had survived the process. In conclusion, the injection molding process could not reliably sterilize parts produced with polylactic acid granules that were heavily contaminated with thermoresistant organisms. However, the number of viable spores was significantly reduced by more than 99.99%. Thus, the injection molding process might allow the autosterilization of parts produced with raw material that is not heavily contaminated. PMID:9178738

  6. Diversity and Significance of Mold Species in Norwegian Drinking Water▿

    PubMed Central

    Hageskal, Gunhild; Knutsen, Ann Kristin; Gaustad, Peter; de Hoog, G. Sybren; Skaar, Ida

    2006-01-01

    In order to determine the occurrence, distribution, and significance of mold species in groundwater- and surface water-derived drinking water in Norway, molds isolated from 273 water samples were identified. Samples of raw water, treated water, and water from private homes and hospital installations were analyzed by incubation of 100-ml membrane-filtered samples on dichloran-18% glycerol agar. The total count (number of CFU per 100 ml) of fungal species and the species diversity within each sample were determined. The identification of mold species was based on morphological and molecular methods. In total, 94 mold species belonging to 30 genera were identified. The mycobiota was dominated by species of Penicillium, Trichoderma, and Aspergillus, with some of them occurring throughout the drinking water system. Several of the same species as isolated from water may have the potential to cause allergic reactions or disease in humans. Other species are common contaminants of food and beverages, and some may cause unwanted changes in the taste or smell of water. The present results indicate that the mycobiota of water should be considered when the microbiological safety and quality of drinking water are assessed. In fact, molds in drinking water should possibly be included in the Norwegian water supply and drinking water regulations. PMID:17028226

  7. An in-mold packaging process for plastic fluidic devices.

    PubMed

    Yoo, Y E; Lee, K H; Je, T J; Choi, D S; Kim, S K

    2011-01-01

    Micro or nanofluidic devices have many channel shapes to deliver chemical solutions, body fluids or any fluids. The channels in these devices should be covered to prevent the fluids from overflowing or leaking. A typical method to fabricate an enclosed channel is to bond or weld a cover plate to a channel plate. This solid-to-solid bonding process, however, takes a considerable amount of time for mass production. In this study, a new process for molding a cover layer that can enclose open micro or nanochannels without solid-to-solid bonding is proposed and its feasibility is estimated. First, based on the design of a model microchannel, a brass microchannel master core was machined and a plastic microchannel platform was injection-molded. Using this molded platform, a series of experiments was performed for four process or mold design parameters. Some feasible conditions were successfully found to enclosed channels without filling the microchannels for the injection molding of a cover layer over the plastic microchannel platform. In addition, the bond strength and seal performance were estimated in a comparison with those done by conventional bonding or welding processes. PMID:21446432

  8. Controlled mold geometry for surgical deficit treatment planning.

    PubMed

    Anderson, L L; Zlotolow, I M; McCormick, B; Harrison, L B

    1995-03-01

    The relatively precise placement of brachytherapy sources afforded by stereotactic frames for brain implants is not generally achievable for other sites, which lack the fixed geometry of the cranium and its contents. An exception is a source-containing rigid mold that delivers brachytherapy when inserted securely in a surgical defect. A technique has been developed in which an acrylic mold of the region to be treated is suspended in a demountable aluminum box, which is then filled to a suitable level with dental stone to form a casting that supports the mold and that can be removed intact. First, the box is aligned on a mill table and a ball mill is used to drill three parallel holes in the acrylic mold, with precisely known locations and depths and as widely separated as possible. The spherical air cavities that result from plugging these holes with ball-milled acrylic rods become reference markers in subsequent computed tomography (CT) scans. After optimum CT-coordinate locations have been planned for 125I seeds in catheters, they are transformed to mill coordinates using a matrix developed from the known marker coordinates in the two systems. Catheter holes are then drilled with the mold in the reassembled casting and box. The method has been used to treat both recurrent maxillary cancer and recurrent orbital rhabdomyosarcoma. PMID:7596320

  9. Improved plastic molding technology for magneto-optical disk substrate

    NASA Astrophysics Data System (ADS)

    Galic, George J.

    1991-03-01

    A patented new injection-molding technology which already has been coninercially licensed nonexclusively to worldleading plastic magnetooptical (MO) mediamakers gives very high moldpacking pressures (needed for maximum microsurface replication) without high birefringence (minimized by reducing constrictiveness during fill) even with high viscosity plastics. I . " STATFMENT OF ThE PROBLIM" FOB ERASABLE OPTICALDI 5K MOLDINQ Al though gl ass and new cross 1 inkabl e p1 as t i cs are cont ending wi th polycarbonate and other injection moldable thermoplastics for this new market polycarbonate has prevailed as " first generation" erasable media substrate (although product life considerations may require added barrier coat to the MO coating stacks thereof). If performance of all these substrate contenders were equal the injection moldable thermoplastics will be preferred due to lowest cost and most automatable production If molded thermoplastics don''t ultimately win out a main reason will have been that these disk products require a long narrow mold cavity to be filled by the thermoplastic of choice then packed at double the pressures used for digital audio compact disks (CDs) in order to force the molten thermoplastic against the staner microsurface until detailed microreplication is assured yet only very low moldedin stresses can be tolerated (typically 1/2 to 1/5 those of audio CDs) 1. 1 Fillrelated Molding Problems M-O disks typically are 130am or 86nin in diameter and as molded thickness of a single

  10. Preparation and properties of an internal mold release for rigid urethane foam

    SciTech Connect

    Parker, B.G.

    1980-08-01

    Internal mold releases which can be added to urethane foam resin were synthesized and evaluated. The use of this type of release agent eliminates the repeated cleaning and recoating of molds, a procedure required with surface-applied mold releases. The internal mold releases investigated are the reaction products of a fatty acid ester, containing an active hydrogen, and a monoisocycanate. The use of an internal mold release resulted in urethane foam with good releasability and excellent surface bondability. Several properties of rigid urethane foam formulated with the use of an internal mold release are presented.

  11. Two-component co-injection and transfer molding and gas-assisted injection molding of polymers: Simulation and experiment

    NASA Astrophysics Data System (ADS)

    Li, Chengtao

    Two-component molding is a novel process for manufacturing polymer products with a sandwich structure or a hollow structure. Typically, two different materials are injected or transferred into a mold sequentially or simultaneously. The skin is generally a prime polymer with required surface and bulk properties for intended use. The core can be solid, foam or gas. Obtaining a uniform encapsulated structure is difficult and there are no science-based rules for optimization of process setup. Thus, a physical model and process simulations have been developed based on the kinematics and dynamics of a moving interface, and Hele-Shaw approximation. The model has incorporated temperature and shear rate dependences of viscosity of both skin and core component into the transient interface evolution. Based on the developed model, simulations have been carried out to study flow rate controlled simultaneous co-injection molding of thermoplastics, pressure-controlled sequential transfer molding of rubber compounds, and gas-assisted injection molding (GAIM). The simulation results were compared with the experimental data, and in general, good agreement was found between the predicted and experimentally measured interface distribution in moldings. For simultaneous co-injection molding, it is found that material pairs with a broad range of viscosities may be utilized. Breakthrough phenomena are mainly determined by the volume of melt of initial single phase injection and rheological properties of material combinations. When the core has a lower viscosity than the skin, or the volume of initial injection of skin melt is smaller, breakthrough is very likely. However, the breakthrough can be eliminated by controlling injection rate of the skin and core melts. For sequential transfer molding, it is found that the rubber distribution in moldings are dominated by the rheological properties of components and the volume fraction transferred, but independent of the gate pressure. When the

  12. Proteases in cellular slime mold development: evidence for their involvement.

    PubMed Central

    Fong, D; Bonner, J T

    1979-01-01

    Protein degradation appears to be essential for normal differentiation in the cellular slime mold Dictyostelium discoideum. Several protease inhibitors block normal differentiation, and in most cases this inhibition can be reversed by addition of amino acids. For example, chloroquine, which inhibits slime mold cathepsin B activity, interferred with development by blocking sorocarp formation, and this inhibition was reversed by the addition of amino acids. Tosyllysyl chloromethyl ketone also blocked development, and this inhibition was reversed by simultaneous additions of amino acids and glutathione. Moreover, the addition of antipain and leupeptin delayed sorocarp formation. These results, together with the finding reported earlier that cathepsin B activity is differentially localized in the prestalk-prespore zones of the migrating slugs, suggest that proteolysis might play a regulatory role in cellular slime mold differentiation. Images PMID:293735

  13. Fabricating microfluidic valve master molds in SU-8 photoresist

    NASA Astrophysics Data System (ADS)

    Dy, Aaron J.; Cosmanescu, Alin; Sluka, James; Glazier, James A.; Stupack, Dwayne; Amarie, Dragos

    2014-05-01

    Multilayer soft lithography has become a powerful tool in analytical chemistry, biochemistry, material and life sciences, and medical research. Complex fluidic micro-circuits require reliable components that integrate easily into microchips. We introduce two novel approaches to master mold fabrication for constructing in-line micro-valves using SU-8. Our fabrication techniques enable robust and versatile integration of many lab-on-a-chip functions including filters, mixers, pumps, stream focusing and cell-culture chambers, with in-line valves. SU-8 created more robust valve master molds than the conventional positive photoresists used in multilayer soft lithography, but maintained the advantages of biocompatibility and rapid prototyping. As an example, we used valve master molds made of SU-8 to fabricate PDMS chips capable of precisely controlling beads or cells in solution.

  14. Selection of thermotropic liquid crystalline polymers for rotational molding

    NASA Astrophysics Data System (ADS)

    Scribben, Eric

    Thermotropic liquid crystalline polymers (TLCPs) possess a number of physical and mechanical properties such as: excellent chemical resistance, low permeability, low coefficient of thermal expansion, high tensile strength and modulus, and good impact resistance, which make them desirable for use in the storage of cryogenic fluids. Rotational molding was selected as the processing method for these containers because it is convenient for manufacturing large storage vessels from thermoplastics. Unfortunately, there are no reports of successful TLCP rotational molding in the technical literature. The only related work reported involved the static coalescence of two TLCP powders, where three key results were reported that were expected to present problems that preclude the rotational molding process. The first result was that conventional grinding methods produced powders that were composed of high aspect ratio particles. Secondly, coalescence was observed to be either slow or incomplete and speculated that the observed difficulties with coalescence may be due to large values of the shear viscosity at low deformation rates. Finally, complete densification was not observed for the high aspect ratio particles. However, the nature of these problems were not evaluated to determine if they did, in fact, create processing difficulties for rotational molding or if it was possible to develop solutions to the problems to achieve successful rotational molding. This work is concerned with developing a resin selection method to identify viable TLCP candidates and establish processing conditions for successful rotational molding. This was accomplished by individually investigating each of the phenomenological steps of rotational molding to determine the requirements for acceptable performance in, or successful completion of, each step. The fundamental steps were: the characteristics and behavior of the powder in solids flow, the coalescence behavior of isolated particles, and the

  15. Applications of thin carbon coatings and films in injection molding

    NASA Astrophysics Data System (ADS)

    Cabrera, Eusebio Duarte

    In this research, the technical feasibility of two novel applications of thin carbon coatings is demonstrated. The first application consists of using thin carbon coatings on molds for molding ultra-thin plastic parts (<0.5 mm thickness) with lower pressures by promoting wall slip. The second application consists of a new approach to provide electromagnetic interference (EMI) shielding for plastic parts using in mold coated nanoparticle thin films or nanopapers to create a conductive top layer. During this research, the technical feasibility of a new approach was proven which provides injection molding of ultra-thin parts at lower pressures, without the need of fast heating/fast cooling or other expensive mold modification. An in-house developed procedure by other members of our group, was employed for coating the mold surface using chemical vapor deposition (CVD) resulting in a graphene coating with carbide bonding to the mold surface. The coating resulted in a significant decrease of surface friction and consequently easiness of flow when compared to their uncoated counterparts. Thermoplastic polymers and their composites are a very attractive alternative but are hindered by the non-conductive nature of polymers. There are two general approaches used to date to achieve EMI shielding for plastic products. One is to spray a conductive metal coating onto the plastic surface forming a layer that must maintain its shielding effectiveness (SE), and its adhesion to the plastic throughout the expected life of the product. However, metal coatings add undesirable weight and tend to corrode over time. Furthermore, scratching the coating may create shielding failure; therefore, a protective topcoat may be required. The other approach is to use polymer composites filled with conductive fillers such as carbon black (CB), carbon nanofiber (CNF), and carbon nanotube (CNT). While conductive fillers may increase the electrical conductivity of polymer composites, the loading of

  16. Ultra-short Pulse Laser Structuring of Molding Tools

    NASA Astrophysics Data System (ADS)

    Conrad, Daniel; Richter, Lars

    The machining of highly filled abrasive polymer plastics in injection molding processes determines high resistant tools in the industrial production. One of the most important points is a long durability of the molding tools to reduce the costs of production. Thus, the adhesion force and abrasion will be reduced with the help of defined surface properties. To achieve appropriate surface conditions, an ultra-short pulse laser is used for a micro structuring. Additional a laser polishing of the micro-structured surfaces to optimize the frictional properties is presented. This paper shows the research results of investigations on the laser modification of steel surfaces, to generate high-quality and wear-resistant surfaces for injection molding tools.

  17. Mold filling and microhardness of 1% Fe titanium alloys.

    PubMed

    Sato, Hideki; Komatsu, Masashi; Miller, Barbara; Shimizu, Hiroshi; Fujii, Hideki; Okabe, Toru

    2004-06-01

    We examined the mold filling capacity and microhardness of two industrial 1% Fe titanium alloys: Super-TIX800 (Nippon Steel Corp.) (Fe: 0.910%, O: 0.370%, N: 0.005%) and Super-TIX800N (Nippon Steel Corp.) (Fe: 0.960%, O: 0.300%, N: 0.041%). Two wedge-shaped acrylic patterns (with 30 degrees or 15 degrees angles) were prepared. Each alloy was cast in a centrifugal casting machine. Mold filling was evaluated as the missing length between the tip of the casting and the theoretical tip. Vickers hardness of the edge of the castings was also determined. For both angles tested, there were no significant differences (p>0.05) in mold filling among these alloys and the control (CP Ti). The results of testing the microhardness near the cast surfaces indicated that the hardened reaction layers on these alloys were thinner at the edge compared to CP Ti. PMID:15287570

  18. 3D molding of hierarchical micro- and nanostructures

    NASA Astrophysics Data System (ADS)

    Farshchian, Bahador; Hurst, Steven M.; Lee, Jaejong; Park, Sunggook

    2011-03-01

    We show a simple and effective process to produce large area, hierarchical 3D micro- and nanostructures via a modified hot embossing process, which we name 3D molding. The 3D molding process takes advantage of both a hard mold from hot embossing and the flexibility of a thin, elastomeric intermediate stamp from soft lithography. Using this method, we have demonstrated the formation of various micro- and nanostructures in non-planar microscale structures including microchannels and step surfaces. The ability to produce micro/nanopatterns within microchannels will have potential applications in bioanalytic micro/nanofluidic devices by allowing for the manipulation of a broader range of surface properties and thus control over surface interactions with biomaterials flowing through the microfluidic channels.

  19. EFFECT OF TETRACYCLINES ON THE INTRACELLULAR AMINO ACIDS OF MOLDS.

    PubMed

    FREEMAN, B A; CIRCO, R

    1963-07-01

    Freeman, Bob A. (University of Chicago, Chicago, Ill.) and Richard Circo. Effect of tetracyclines on the intracellular amino acids of molds. J. Bacteriol. 86:38-44. 1963.-The tetracycline antibiotics were shown to alter the amino acid metabolism of molds whose growth is not markedly affected. Eight molds were grown in the presence of these antiobiotics; four exhibited a general reduction in the concentration of the intracellular amino acids, except for glutamic acid and alanine. In most of these four cultures, the tetracyclines also caused the complete disappearance of arginine, lysine, proline, phenylalanine, and tyrosine from the intracellular amino acid pool. The significance of these observations and the usefulness of the method in the study of the mechanisms of antibiotic action are discussed. PMID:14051820

  20. Invasive Mold Infections in Solid Organ Transplant Recipients

    PubMed Central

    Crabol, Yoann; Lortholary, Olivier

    2014-01-01

    Invasive mold infections represent an increasing source of morbidity and mortality in solid organ transplant recipients. Whereas there is a large literature regarding invasive molds infections in hematopoietic stem cell transplants, data in solid organ transplants are scarcer. In this comprehensive review, we focused on invasive mold infection in the specific population of solid organ transplant. We highlighted epidemiology and specific risk factors for these infections and we assessed the main clinical and imaging findings by fungi and by type of solid organ transplant. Finally, we attempted to summarize the diagnostic strategy for detection of these fungi and tried to give an overview of the current prophylaxis treatments and outcomes of these infections in solid organ transplant recipients. PMID:25525551

  1. Decontamination formulation with additive for enhanced mold remediation

    DOEpatents

    Tucker, Mark D.; Irvine, Kevin; Berger, Paul; Comstock, Robert

    2010-02-16

    Decontamination formulations with an additive for enhancing mold remediation. The formulations include a solubilizing agent (e.g., a cationic surfactant), a reactive compound (e.g., hydrogen peroxide), a carbonate or bicarbonate salt, a water-soluble bleaching activator (e.g., propylene glycol diacetate or glycerol diacetate), a mold remediation enhancer containing Fe or Mn, and water. The concentration of Fe.sup.2+ or Mn.sup.2+ ions in the aqueous mixture is in the range of about 0.0001% to about 0.001%. The enhanced formulations can be delivered, for example, as a foam, spray, liquid, fog, mist, or aerosol for neutralization of chemical compounds, and for killing certain biological compounds or agents and mold spores, on contaminated surfaces and materials.

  2. Rigiflex, spontaneously wettable polymeric mold for forming reversibly bonded nanocapillaries.

    PubMed

    Kim, Pilnam; Suh, Kahp Y

    2007-04-10

    We present a novel ultraviolet (UV)-curable mold that enables the formation of reversibly bonded nanocapillaries (500-50 nm) on a gold or silicon substrate. A sheet-type ( approximately 50 microm) polyethylene diacrylate (PEG-DA) mold was used for its rigiflex nature; it provides rigidity high enough for maintaining nanostructures (elastic modulus >70 MPa) and also flexibility good enough for intimate contact over a large area aided by weak electrostatic forces (zeta potential approximately -113.55 mW). The electrostatic charge is generated on a rigiflex PEG-DA mold upon peeling from an original engraved silicon master by mechanical friction, thereby assisting the formation of spontaneous contact with the gold or silicon substrate. PMID:17343400

  3. Method for Molding Structural Parts Utilizing Modified Silicone Rubber

    NASA Technical Reports Server (NTRS)

    Weiser, Erik S. (Inventor); Baucom, Robert M. (Inventor); Snoha, John J. (Inventor)

    1998-01-01

    This invention improves upon a method for molding structural parts from preform material. Preform material to be used for the part is provided. A silicone rubber composition containing entrained air voids is prepared. The silicone rubber and preform material assembly is situated within a rigid mold cavity used to shape the preform material to die desired shape. The entire assembly is heated in a standard heating device so that the thermal expansion of the silicone rubber exerts the pressure necessary to force the preform material into contact with the mold container. The introduction of discrete air voids into the silicone rubber allows for accurately controlled pressure application on the preform material at the cure temperature.

  4. Molecular orientation distributions during injection molding of liquid crystalline polymers: Ex situ investigation of partially filled moldings

    SciTech Connect

    Fang, Jun; Burghardt, Wesley R.; Bubeck, Robert A.

    2013-01-10

    The development of molecular orientation in thermotropic liquid crystalline polymers (TLCPs) during injection molding has been investigated using two-dimensional wide-angle X-ray scattering coordinated with numerical computations employing the Larson-Doi polydomain model. Orientation distributions were measured in 'short shot' moldings to characterize structural evolution prior to completion of mold filling, in both thin and thick rectangular plaques. Distinct orientation patterns are observed near the filling front. In particular, strong extension at the melt front results in nearly transverse molecular alignment. Far away from the flow front shear competes with extension to produce complex spatial distributions of orientation. The relative influence of shear is stronger in the thin plaque, producing orientation along the filling direction. Exploiting an analogy between the Larson-Doi model and a fiber orientation model, we test the ability of process simulation tools to predict TLCP orientation distributions during molding. Substantial discrepancies between model predictions and experimental measurements are found near the flow front in partially filled short shots, attributed to the limits of the Hele-Shaw approximation used in the computations. Much of the flow front effect is however 'washed out' by subsequent shear flow as mold filling progresses, leading to improved agreement between experiment and corresponding numerical predictions.

  5. Permanent Mold Casting of JIS-AC4C Aluminum Alloy Using a Low-Temperature Mold

    SciTech Connect

    Yamagata, Hiroshi; Nikawa, Makoto

    2011-01-17

    Permanent mold casting using mold temperatures below 200 deg. C was conducted to obtain a high-strength, thin-walled casting. Al-7.36 mass% Si -0.18 Cu- 0.27Mg-0.34Fe alloy JIS-AC4C was cast using a bottom pouring cast plan. The product had a rectangular tube shape (70 mm W x 68 mm D x 180 mm H) with wall thicknesses of 1, 3 and 5 mm. The effect of heat insulation at the melt path was compared when using a sand runner insert and when using a steel runner insert as well as a powder mold release agent. Fine microstructures were observed in the casting. The smaller the thickness, the higher the hardness with smaller secondary dendrite arm spacing (SDAS). However, the hardness and the SDAS were unaffected by the mold temperature. It was proposed that the avoidance of the formation of primary {alpha} dendrite at the melt path generates a higher strength casting with adequate mold filling.

  6. Permanent Mold Casting of JIS-AC4C Aluminum Alloy Using a Low-Temperature Mold

    NASA Astrophysics Data System (ADS)

    Yamagata, Hiroshi; Nikawa, Makoto

    2011-01-01

    Permanent mold casting using mold temperatures below 200° C was conducted to obtain a high-strength, thin-walled casting. Al-7.36 mass% Si -0.18 Cu- 0.27Mg-0.34Fe alloy JIS-AC4C was cast using a bottom pouring cast plan. The product had a rectangular tube shape (70 mm W x 68 mm D x 180 mm H) with wall thicknesses of 1, 3 and 5 mm. The effect of heat insulation at the melt path was compared when using a sand runner insert and when using a steel runner insert as well as a powder mold release agent. Fine microstructures were observed in the casting. The smaller the thickness, the higher the hardness with smaller secondary dendrite arm spacing (SDAS). However, the hardness and the SDAS were unaffected by the mold temperature. It was proposed that the avoidance of the formation of primary α dendrite at the melt path generates a higher strength casting with adequate mold filling.

  7. A micro powder injection molding apparatus for high aspect ratio metal micro-structure production

    NASA Astrophysics Data System (ADS)

    Fu, Gang; Tor, Shubeng; Loh, Ngiaphiang; Tay, Beeyen; Hardt, David E.

    2007-09-01

    A new variotherm molding apparatus is presented in this paper for the fabrication of high aspect ratio 316L stainless steel micro-structures using micro powder injection molding (μPIM) technology. The molding apparatus prototype includes an injection mold in which a silicon insert with an array of 24 × 24 (576) microcavities is mounted, a set of rapid tempering systems for the mold and a set of vacuum systems. The key advantage of this molding apparatus lies in the real-time monitoring and rapid adjustment of the mold cavity temperature during injection molding and part ejection, which makes molding and demolding of high aspect ratio green micro-structures possible. For example, incomplete filling occurs while injection molding micro-structures of 60 µm × height 191 µm with an aspect ratio of 3.2 using a conventional mold. In comparison, smaller micro-structures with higher aspect ratio are produced successfully in the case of the new molding apparatus, e.g. micro-structures of 40 µm × height 174 µm with an aspect ratio of 4.35 and 20 µm × height 160 µm with an aspect ratio of 8 were molded successfully.

  8. Infant Origins of Childhood Asthma Associated with Specific Molds

    PubMed Central

    Reponen, Tiina; Lockey, James; Bernstein, David I.; Vesper, Stephen J.; Levin, Linda; Khurana Hershey, Gurjit K.; Zheng, Shu; Ryan, Patrick; Grinshpun, Sergey A.; Villareal, Manuel; LeMasters, Grace

    2012-01-01

    Background The specific cause(s) of asthma development must be identified in order to prevent this disease. Objective Our hypothesis was that specific mold exposures are associated with childhood asthma development. Methods Infants were identified from birth certificates. Dust samples were collected from 289 homes when the infants were age eight months. Samples were analyzed for concentrations of 36 molds that comprise the Environmental Relative Moldiness Index (ERMI) and endotoxin, house dust mite, cat, dog, and cockroach allergens. Children were evaluated at age seven for asthma based on reported symptoms and objective measures of lung function. Host, environmental exposures and home characteristics evaluated included history of parental asthma, race, gender, upper and lower respiratory symptoms, season of birth, family income, cigarette smoke exposure, air conditioning, dehumidifier, carpeting, age of home, and visible mold at age one and child positive skin prick test (SPT) to aeroallergens and molds at age seven. Results Asthma was diagnosed in 24% of the children at age seven. A statistically significant increase in asthma risk at age seven was associated with high ERMI levels in the child’s home in infancy (adjusted risk ratio (aRR) for a 10-unit increase in ERMI = 1.8, 95% CI=1.5, 2.2). The summation of levels of three mold species, Aspergillus ochraceus, Aspergillus unguis, and Penicillium variabile was significantly associated with asthma (aRR = 2.2, 95% CI=1.8, 2.7). Conclusion In this birth cohort study, exposure during infancy to three mold species common to water-damaged buildings was associated with childhood asthma at age seven. PMID:22789397

  9. Improved Probe for Evaluating Compaction of Mold Sand

    NASA Technical Reports Server (NTRS)

    Overfelt, Ruel A.; Bakhtiyarov, Sayavur I.

    2008-01-01

    A nominally stationary tubular probe denoted a telescopic probe has been developed as an improved alternative to a prior movable probe used to evaluate the local degree of compaction of mold sand. The probe is inserted vertically to a desired depth in a sand-filled molding flask and the back pressure at the given rate of flow of air is recorded as a measure of the degree of partial impermeability and, hence, of the degree of compaction of sand in the vicinity of the probe tip.

  10. Terahertz lenses made by compression molding of micropowders.

    PubMed

    Scherger, Benedikt; Scheller, Maik; Jansen, Christian; Koch, Martin; Wiesauer, Karin

    2011-05-20

    We present a simple and versatile approach for fabricating terahertz lenses based on compression molding of micropowder polymer materials in a tabletop hydraulic press. To demonstrate the feasibility of this approach, a biconvex lens shape is calculated using a ray-tracing algorithm and lenses based on two different micropowders are fabricated. As the powder materials have different refractive indices, the resulting lenses share the same geometric shape but differ in their respective focal length. The focusing properties of the lenses are evaluated by transversal and sagittal beam profile measurements in a fiber-coupled terahertz time-domain spectroscopy system, confirming the excellent imaging qualities of the compression molded lenses. PMID:21614120

  11. Fabrication of ceramic components using mold shape deposition manufacturing

    NASA Astrophysics Data System (ADS)

    Cooper, Alexander G.

    Mold Shape Deposition Manufacturing (Mold SDM) is a new process for the fabrication of geometrically complex, structural ceramic components. This thesis describes the development of the Mold SDM process, including process steps, materials selection, planning strategies and automation. Initial characterization results are presented and these are used to compare the process to competing manufacturing processes. A range of current and potential applications for ceramic, as well as metal and polymer parts are discussed. The benefits and limitations of ceramic materials for structural applications are discussed to motivate the need for a manufacturing process capable of rapidly producing high quality, geometrically complex, structural ceramic components. The Mold SDM process was developed to address this need. Mold SDM is based on Shape Deposition Manufacturing (SDM) and uses SDM techniques to build fugitive wax molds which can then be used to build ceramic parts by gelcasting. SDM is an additive-subtractive layered manufacturing process which allows it to build geometrically complex parts. The subtraction step differentiates Mold SDM from other layered manufacturing processes and allows accurate, high quality surfaces to be produced. The performance of the process was increased by identifying the key material properties and then selecting improved materials combinations. Candidate materials were evaluated in terms of machinability, shrinkage, heat resistance and chemical compatibility. A number of preferred materials combinations were developed and used to produce ceramic, metal and polymer parts. A number of new process planning strategies and build techniques were developed. The manufacturability analysis determines whether a part is manufacturable and the orientation selection guidelines help in the selection of optimum build directions. New decomposition techniques take advantage of process capabilities to improve part quality and build rate. Initial process

  12. Magnetohydrodynamic calculation of in-mold electromagnetic stirring

    SciTech Connect

    Fujisaki, Keisuke; Ueyama, Takatsugu; Okazawa, Kensuke

    1997-03-01

    The in-mold electromagnetic stirring is used to control the initial solidification of molten steel of the continuous casting. To get the optimal operation of in-mold electromagnetic stirring through the fundamental characteristics, the authors did the magnetohydrodynamic calculation. The electromagnetic force has the eddy distribution through the electromagnetic analysis in case of the rotating stirring mode which is thought to give the uniform velocity at surface. However, it does not much influence on the fluid dynamics, because the inertial effect and the continuity are large enough.

  13. Application of statistical methods for analyzing the relationship between casting distortion, mold filling, and interfacial heat transfer in sand molds

    SciTech Connect

    Y. A. Owusu

    1999-03-31

    This report presents a statistical method of evaluating geometric tolerances of casting products using point cloud data generated by coordinate measuring machine (CMM) process. The focus of this report is to present a statistical-based approach to evaluate the differences in dimensional and form variations or tolerances of casting products as affected by casting gating system, molding material, casting thickness, and casting orientation at the mold-metal interface. Form parameters such as flatness, parallelism, and other geometric profiles such as angularity, casting length, and height of casting products were obtained and analyzed from CMM point cloud data. In order to relate the dimensional and form errors to the factors under consideration such as flatness and parallelism, a factorial analysis of variance and statistical test means methods were performed to identify the factors that contributed to the casting distortion at the mold-metal interface.

  14. Finite element stress analysis of a compression mold. Final report. [Using SASL and WILSON codes

    SciTech Connect

    Watterson, C.E.

    1980-03-01

    Thermally induced stresses occurring in a compression mold during production molding were evaluated using finite element analysis. A complementary experimental stress analysis, including strain gages and thermocouple arrays, verified the finite element model under typical loading conditions.

  15. Curing rate and flowing properties of silicone rubber at injection molding

    SciTech Connect

    Yoshino, M.; Nakamura, T. )

    1992-04-01

    Generally, silicone rubbers are mold-cured after mixing the rubber and peroxide curing agent with a two-roll mill or a kneader. Typically this is done at pressures of 5 MPa to 10 MPa and at temperatures between 120 to 200 C. Compression molding, transfer molding and injection molding are common molding ways for silicone rubbers. Recently, injection molding techniques are developing rapidly that have the advantages of molding automatically with high cycle mechanisms. To reduce the molding time and to make a precision part, both the flowing and curing properties of a particular rubber compound will be important. In this article, correlations between the curing and the flowing properties of silicone rubber are investigated by using the Rheovulkameter device.

  16. Farmer's Lung: Causes and Symptoms of Mold and Dust Induced Respiratory Illness

    MedlinePlus

    ... Educational Resources Farmer's Lung: Causes and Symptoms of Mold and Dust Induced Respiratory Illness ID 442-602 ( ... noninfectious allergic disease that is caused by inhaling mold spores in the dust from moldy hay, straw, ...

  17. 46 CFR 148.245 - Direct reduced iron (DRI); lumps, pellets, and cold-molded briquettes.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... resistant to fire and passage of water. (c) DRI lumps, pellets, or cold-molded briquettes that are wet, or... cold-molded briquettes in bulk must ensure that an inert atmosphere of less than 5 percent oxygen and...

  18. Injection molding of thermoplastic elastomers for microstructured substrates

    NASA Astrophysics Data System (ADS)

    Birkar, Smita

    Amorphous and semi-crystalline thermoplastic polymers have been widely investigated for injection molding of parts with microstructured surfaces. Microstructured surfaces injection molded from thermoplastic elastomers have emerging applications as superhydrobic surfaces and patterned adhesives, but there is a limited understanding of the factors affecting replication with these materials. This research was a continued investigation of block copolymer thermoplastic elastomers as well as the first in-depth examination of thermoplastic vulcanizates for injection molding microfeatures. The first focus of this research was the interactions between tooling aspect ratio and feature orientation (negative and positive tooling) and thermoplastic elastomer hard segment content on microfeature replication. Electroformed nickel tooling having positive and negative features with different geometries and aspect ratios of 0.02:1 to 2:1 were molded from three copolyester thermoplastic elastomers with similar chemistry and different hardness values. The tooling and part features were characterized for feature depth and height as well as feature definition using scanning electron microscopy and optical profilometry. Results were correlated with elastomer properties. In the second parts of this research, the effects of microfeature spacing on the replication of thermoplastic elastomer features was investigated using micropillars with two diameters (10 and 20 mum) and three spacing ratios (0.5:1, 1:1, and 2:1). The tooling and part features were characterized for feature depth and height as well as feature definition using scanning electron microscopy and optical profilometry. Feature spacing significantly affected the replication of micropillars using a thermoplastic elastomer. This replication was competition between cooling and pressurization of the melt. Wider spacing between smaller features allowed cooling in the tooling lands to dominate the feature filling. Higher pressures did

  19. Numerical Simulation of Fluid Flow in a Round Bloom Mold with In-Mold Rotary Electromagnetic Stirring

    NASA Astrophysics Data System (ADS)

    Liu, Heping; Xu, Mianguang; Qiu, Shengtao; Zhang, Hui

    2012-12-01

    In this article, an electromagnetic field simulation and a flow analysis model are performed to describe the three-dimensional electromagnetic field distribution and the electromagnetically driven flow characteristics in a round-bloom mold with a low-frequency in-mold rotary electromagnetic stirrer. The interaction between the induced flow and the inertial impinging jet from a straight-through submerged entry nozzle (SEN) of the caster is considered. The effects of stirrer current and frequency on the electromagnetic field and the flow in the round-bloom mold are investigated, and a strategy to optimize the stirring parameters is proposed. The results show that the distributions of magnetic flux density and electromagnetic force magnitude are nonuniform in a three-dimensional electromagnetic stirring (EMS) configuration. There exists a significant axial induced component of electromagnetic force. The flow in the in-mold EMS system is characterized by a dominant swirling movement at the transverse sections, coupled with the recirculating flows in the axial direction. An upper recirculation zone and a lower recirculation zone with the reverse melt flowing are found near the strand wall at the axial location close to the middle of the stirrer, and another recirculation zone is formed due to the interference of the induced flow with the jet from SEN. The meniscus surface has a swirl flow, and the meniscus level rises near the bloom strand wall and sinks around the SEN wall. All of these flow features are closely associated with metallurgical performances of the in-mold rotary stirrer. With the increase of stirring current and the decrease of frequency, the magnetic flux magnitude increases. There is an optimum frequency to obtain a peak of electromagnetic force magnitude and maximum tangential velocity. For a mold rotary EMS system, to determine the optimum stirring intensity, it is necessary to make a compromise between a larger tangential velocity and a relatively

  20. The reflectivity, wettability and scratch durability of microsurface features molded in the injection molding process using a dynamic tool tempering system

    NASA Astrophysics Data System (ADS)

    Kuhn, Sascha; Burr, August; Kübler, Michael; Deckert, Matthias; Bleesen, Christoph

    2011-02-01

    In this paper the replication qualities of periodically and randomly arranged micro-features molded in the injection molding process and their effects on surface properties are studied. The features are molded in PC, PMMA and PP at different mold wall temperatures in order to point out the necessity and profitability of a variotherm mold wall temperature control system. A one-dimensional heat conduction model is proposed to predict the cycle times of the variotherm injection molding processes. With regard to these processes, the molding results are compared to the molded surface feature heights using an atomic force microscope. In addition, the effects of the molded surface features on macroscopic surfaces are characterized in terms of light reflection using a spectrometer and in terms of water wettability by measuring the static contact angle. Furthermore, due to the sensitivity of the surface features on the molded parts, their durability is compared in a scratch test with a diamond tip. This leads to successful implementation in applications in which the optical appearance, in terms of gloss and reflection, and the water repellence, in terms of drag flow and adhesion, are of importance.

  1. Effect of Cross Sectional Geometry on PDMS Micro Peristaltic Pump Performance: Comparison of SU-8 Replica Molding vs. Micro Injection Molding

    PubMed Central

    Graf, Neil J.

    2013-01-01

    Two different fabrication methods were employed to fabricate micropumps with different cross-sectional channel geometries. The first was to fabricate rectangular cross-sectional microchannel geometries using the well known fabrication method of replica molding (REM).1 The second, and far less utilized fabrication technique, was to create microchannel molds using an in-house fabricated handheld micro injection molding apparatus. The injection mold apparatus was designed for use with elastomeric room temperature vulcanization (RTV) polymers, as opposed to most other injection molding machines, which are designed for use with thermoplastic polymers. The injection mold’s bottom plate was used as a microchannel molding template. The molding template was created by threading a small-diameter wire (150 μm or less) through the injection mold’s bottom plate, with subsequent adhesion and smoothing of a thin piece of aluminum foil over the wire-raised injection mold template. When molded against, the template produced a rounded/Gaussian-shaped PDMS microchannel. The design of the injection mold will be presented, along with a direct comparison for micropump performance metrics such as flow rate, valving characteristics, and maximum backpressures attainable for each of the respective micropump channel geometries. PMID:23917263

  2. The effect of mold materials on the overlay accuracy of a roll-to-roll imprinting system using UV LED illumination within a transparent mold

    NASA Astrophysics Data System (ADS)

    Choi, Sungwoo; Kook, YunHo; Kim, ChulHo; Yoo, SoonSung; Park, Kwon-Shik; Kim, Seok-min; Kang, Shinill

    2016-06-01

    Although several studies on the roll-to-roll (R2R) imprinting process have reported achieving flexible electronics, improving the alignment accuracy in the overlay process of R2R imprinting is recognized as the biggest problem for the commercialization of this technology. For an overlay technique with high alignment accuracy, it is essential to develop a roll mold with high positional accuracy. In this study, a method for fabricating a roll mold with high positional accuracy is proposed by wrapping a thin glass substrate flexible mold around the transparent roll base, because it can provide higher mechanical strength and thermal stability than a conventional polymer substrate. To confirm the usability of the proposed process, the prepared roll mold was used to fabricate a test pattern of thin-film transistor backplane for a rollable display. The positional and overlay accuracy of the roll mold with the proposed thin glass substrate flexible mold were compared with the roll mold with a conventional polymer substrate flexible mold. Large-area transparent flexible molds with a size of 470  ×  370 mm were fabricated by an ultraviolet (UV) imprinting process on thin glass and polyethylene terephthalate substrates, and these flexible molds were wrapped around a roll base of 125 mm radius through a precision alignment process. After an anti-adhesion treatment and the wrapping process, the roll mold with the polymer substrate showed a ~180 μm positional error, whereas the thin glass substrate showed a ~30 μm positional error. After the overlay process using the R2R imprinting system with the alignment system, an average overlay error of ~3 μm was obtained when the thin glass flexible wrapped roll mold was used, whereas a ~22 μm overlay error was obtained when the polymer substrate flexible wrapped roll mold was used.

  3. Injection molding of iPP samples in controlled conditions and resulting morphology

    NASA Astrophysics Data System (ADS)

    Sessa, Nino; De Santis, Felice; Pantani, Roberto

    2015-12-01

    Injection molded parts are driven down in size and weight especially for electronic applications. In this work, an investigation was carried out on the process of injection molding of thin iPP samples and on the morphology of these parts. Melt flow in the mold cavity was analyzed and described with a mathematical model. Influence of mold temperature and injection pressure was analyzed. Samples orientation was studied using optical microscopy.

  4. Injection molding of iPP samples in controlled conditions and resulting morphology

    SciTech Connect

    Sessa, Nino De Santis, Felice Pantani, Roberto

    2015-12-17

    Injection molded parts are driven down in size and weight especially for electronic applications. In this work, an investigation was carried out on the process of injection molding of thin iPP samples and on the morphology of these parts. Melt flow in the mold cavity was analyzed and described with a mathematical model. Influence of mold temperature and injection pressure was analyzed. Samples orientation was studied using optical microscopy.

  5. Mold Species in Dust from the International Space Station Identified and Quantified by Mold Specific Quantitative PCR

    NASA Technical Reports Server (NTRS)

    Vesper, Stephen J.; Wong, Wing; Kuo, C. Mike; Pierson, Duane L.

    2008-01-01

    Dust was collected over a period of several weeks in 2007 from various HEPA filters in the U.S. Laboratory Module of the International Space Station (ISS). The dust was returned on the Space Shuttle Atlantis, mixed, sieved, and the DNA was extracted. Using a DNA-based method called mold specific quantitative PCR (MSQPCR), 39 molds were measured in the dust. Opportunistic pathogens Aspergillus flavus and A. niger and toxin producers Penicillium chrysogenum and P. brevicompactum were found at relatively high concentrations (compared to U.S. homes). No cells of the opportunistic pathogens A. fumigatus, A. terreus, Fusarium solani or Candida albicans were detected.

  6. Differential allergy induction by molds found in water-damaged homes**

    EPA Science Inventory

    Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases including allergic lung diseases. The Institute of Medicine reports (NAS, 2004) and World Health Organization guidelines (WHO, 2009) concluded that the role of molds in asthma indu...

  7. 21 CFR 177.1460 - Melamine-formaldehyde resins in molded articles.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Melamine-formaldehyde resins in molded articles... Repeated Use Food Contact Surfaces § 177.1460 Melamine-formaldehyde resins in molded articles. Melamine-formaldehyde resins may be safely used as the food-contact surface of molded articles intended for use...

  8. 49 CFR 176.907 - Polymeric Beads and Plastic Molding Compounds.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 2 2013-10-01 2013-10-01 false Polymeric Beads and Plastic Molding Compounds. 176.907 Section 176.907 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS..., and Plastic Molding Compounds § 176.907 Polymeric Beads and Plastic Molding Compounds. (a)...

  9. 49 CFR 176.907 - Polymeric Beads and Plastic Molding Compounds.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 2 2014-10-01 2014-10-01 false Polymeric Beads and Plastic Molding Compounds. 176.907 Section 176.907 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS..., and Plastic Molding Compounds § 176.907 Polymeric Beads and Plastic Molding Compounds. (a)...

  10. Epoxy-resin patterns speed shell-molding of aluminum parts

    NASA Technical Reports Server (NTRS)

    1965-01-01

    Half patterns cast from commercial epoxy resin containing aluminum powder are used for shell-molding of aluminum parts. The half patterns are cast in plastic molds of the original wooden pattern. Ten serviceable sand resin molds are made from each epoxy pattern.

  11. 75 FR 55340 - Recovery Fact Sheet 9580.100, Mold Remediation

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-10

    ... SECURITY Federal Emergency Management Agency Recovery Fact Sheet 9580.100, Mold Remediation AGENCY: Federal... Emergency Management Agency (FEMA) is accepting comments on Recovery Fact Sheet RP9580.100, Mold Remediation... The Recovery Fact Sheet RP9580.100, Mold Remediation, identifies the expenses related to...

  12. System for Image-Processing-Based Inspection of a Screw Hole on a Molded Plastic Frame

    NASA Astrophysics Data System (ADS)

    Satoh, Hironobu; Takeda, Fumiaki

    A screw hole is incorrectly molded if the pin on the mold is broken when the plastic is molded by injection molding. Sampling inspection is carried out manually to identify the incorrectly molded screw hole. In the sampling inspection, the incorrectly molded screw hole on the molded plastic frame is rarely overlooked. Therefore, the development of a system for the high-precision identification of the incorrectly molded screw hole is required. The purpose of this study is to develop a screw-hole inspection system that distinguishes between a correctly molded screw hole and an incorrectly molded one. In this paper, a screw-hole inspection system is proposed. There is a need to capture clearly the screw hole on an uneven plastic frame and therefore, a multi-camera system is used. The proposed system consists of several Web cameras with the individual adjustable focus. Moreover, the inspection of the screw holes is performed using an inspection algorithm that is developed for a multi-camera system. When 2548 correctly molded screw holes and 2940 incorrectly molded screw holes were inspected by the proposed system, the inspection success rate was 100.0%. Finally, we have verified its effectiveness by performing an experiment.

  13. CROSS REACTIVITY IN ALLERGIC ASTHMA-LIKE RESPONSES BETWEEN MOLD AND HOUSE DUST MITE IN MICE

    EPA Science Inventory

    Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases including allergic asthma. Some mold allergens have been implicated as the causal agent for allergic asthma. Western blot analysis demonstrated IgE-binding cross-reactivity among m...

  14. Mold with improved core for metal casting operation

    DOEpatents

    Gritzner, Verne B.; Hackett, Donald W.

    1977-01-01

    The present invention is directed to a mold containing an improved core for use in casting hollow, metallic articles. The core is formed of, or covered with, a layer of cellular material which possesses sufficient strength to maintain its structural integrity during casting, but will crush to alleviate the internal stresses that build up if the normal contraction during solidification and cooling is restricted.

  15. New sources of grain mold resistance among accessions from Sudan

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fifty-nine sorghum accessions from Sudan were evaluated in replicated plots at Isabela, Puerto Rico, for resistance against Fusarium thapsinum, one of the causal agents of grain mold. The environmental conditions during this study, especially at and after physiological maturity were optimal for gra...

  16. VIEW POURING PLATFORM SHOWING MOLD POURING JACKETS AND WEIGHTS AND, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW POURING PLATFORM SHOWING MOLD POURING JACKETS AND WEIGHTS AND, IN THE FOREGROUND, SAND RETURN FROM THE SHAKEOUT ACTUATING A SIMPLE LEVER SYSTEM THAT ADDED FRESH WATER TO THE SAND IN PREPARATION FOR ITS REUSE. - Southern Ductile Casting Company, Centerville Foundry, 101 Airport Road, Centreville, Bibb County, AL

  17. PHYSICAL PROPERTIES OF EXTRUDED AND INJECTION MOLDED CORN GLUTEN MEAL

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study was performed to investigate the compounding of corn gluten meal (CGM) and decanoic acid and to evaluate their mechanical properties. The mixture of CGM and 30% decanoic acid was compounded in a twin screw extruder, followed by injection molding. Scanning electron microscopy (SEM), tens...

  18. Resin transfer molding for advanced composite primary aircraft structures

    NASA Technical Reports Server (NTRS)

    Markus, Alan; Palmer, Ray

    1991-01-01

    Resin Transfer Molding (RTM) has been identified by Douglas Aircraft Company (DAC) and industry to be one of the promising processes being developed today which can break the cost barrier of implementing composite primary structures into a commercial aircraft production environment. The RTM process developments and scale-up plans Douglas Aircrart will be conducting under the NASA ACT contract are discussed.

  19. Development of resins for composites by resin transfer molding

    NASA Technical Reports Server (NTRS)

    Woo, Edmund P.; Puckett, Paul M.; Maynard, Shawn J.

    1991-01-01

    Designed to cover a wide range of resin technology and to meet the near-term and long-term needs of the aircraft industry, this research has three objectives: to produce resin transfer molding (RES) resins with improved processability, to produce prepreg systems with high toughness and service temperature, and to produce new resin systems. Progress on reaching the objectives is reported.

  20. Vaginal molds for intracavitary curietherapy: a new method of preparation

    SciTech Connect

    Bertoni, F.; Bertoni, G.; Bignardi, M.

    1983-10-01

    A new method of preparing vaginal molds for afterloading intracavitary brachytherapy is described. Our technique makes it possible to obtain the most accurate individualization of therapy as far as dose distribution is concerned by taking into account the patient's anatomy and target volume.

  1. Natural formation of styrene by cinnamon mold flora.

    PubMed

    Lafeuille, J-L; Buniak, M-L; Vioujas, M-C; Lefevre, S

    2009-08-01

    Tests on 106 dried pure cinnamon samples of diverse origins showed that some samples were naturally contaminated with high levels of styrene, up to 524 microg/g. Styrene taint can be associated with high water activity levels and thus with microorganism growth. The mold flora of a Korintji cinnamon sample in which styrene had been found at a 50 microg/g concentration was analyzed and 5 species of mold were isolated. An investigation into the ability of the 5 species of mold to produce styrene showed that 3 of them--namely, Penicillium citrinum, Penicillium oxalicum, Aspergillus niger--produced styrene in vitro in buffered peptone water at 25 degrees C within 5 d in the presence of several natural cinnamon volatile constituents containing the styrene structure. The conversion of these compounds into styrene by these 3 cinnamon fungal species has never been previously reported. A standardized inoculation with the 3 mold species was carried out on 10 g cinnamon samples of various origins followed by a 10-d incubation and highlighting styrene production except for Sri Lanka origin. PMID:19723212

  2. INTERIOR DETAIL, EAST CHAMBER OVER THE SALOON. THE ARCHITRAVE MOLDING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR DETAIL, EAST CHAMBER OVER THE SALOON. THE ARCHITRAVE MOLDING AROUND THE WINDOW AND AROUND THE CLOSET AT REAR—ONCE AN EXTERIOR WINDOW OPENING—LIKELY DATE FROM THE HOUSE’S EARLIEST STATE - The Woodlands, 4000 Woodlands Avenue, Philadelphia, Philadelphia County, PA

  3. Innovative molding technologies for the fabrication of components for microsystems

    NASA Astrophysics Data System (ADS)

    Piotter, Volker; Benzler, Tobias; Hanemann, Thomas; Woellmer, Heinz; Ruprecht, Robert; Hausselt, Juergen H.

    1999-03-01

    Economic success of microsystems technology requires a wide range of materials as well as the related manufacturing processes. A suitable technology for medium/large scale production is micro injection molding which actually allows the manufacturing of plastic microstructures with 20 microns minimum thickness, structural details of approximately 0.2 microns or maximum aspect ratios of more than 20. These microstructures are, for example, applied as components in micro optics, micro fluidics or minimally invasive surgery. This is demonstrated by microparts that are currently available or will be available soon. For higher economic efficiency and cost reduction, fully electrical injection modeling machines of higher accuracy have been applied. Also, micro insert injection molding reduces mounting costs. Manufacturing of metal or ceramic microparts by powder injection modeling allows large-scale production of complex shaped microstructures with a wide range of materials. Typical examples are sintered structured like stepped LIGA- gear wheels with minimal dimensions of 50 microns in different metal and ceramic materials. Micro Precision Casting originating from conventional investment casting is a suitable process for small/medium-scale production. Examples are microturbine housings made of precious metal alloys. An approach similar to rapid prototyping applies photocurable reactive resins. Photoinduced molding of low viscous resins under ambient conditions leads to significantly reduced cycle times. Additionally, rapid testing of new composite materials can be performed easily. Microcomponents molded from polymers and different composites like dyes with nonlinear optical properties and nanosized ceramic powders will be presented.

  4. Screening Tools to Estimate Mold Burdens in Homes

    EPA Science Inventory

    Objective: The objective of this study was to develop screening tools that could be used to estimate the mold burden in a home which would indicate whether more detailed testing might be useful. Methods: Previously, in the American Healthy Home Survey, a DNA-based method of an...

  5. QTLs for Snow Mold Disease Resistance in Creeping Bentgrass

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Snow molds caused by Typhula spp. are the most economically important winter diseases of turfgrass in the northern and alpine regions of the United States and Canada. During winter, the psychrophilic pathogens take advantage of the weakened host plants at low temperatures under persistent snow cover...

  6. UVC Sheds New Light on School Mold Problems.

    ERIC Educational Resources Information Center

    Freeman, James

    2002-01-01

    Describes how the LaPorte Independent School District in Texas turned to ultraviolent light devices installed within the HVAC system to combat mold and fungus after conventional approaches failed. Describes the additional benefits of energy savings from the system. (EV)

  7. Through fiber orientation investigation to visualize compression molding

    NASA Astrophysics Data System (ADS)

    Hsu, Chih-Chung; Chiu, Hsien-Sen; Huang, Chao-Tsai; Chang, Rong-Yeu

    2014-05-01

    Please leave one line blank after the abstract. In a pure compression process, polymer melt is compressed to flow by moving the movable platen of the mold to complete melt filling. Compression of the melt is then continued by the pressure exerted from the mold wall of the core side. This process provides a more uniform pressure on the cavity wall and requires a lower molding pressure for the post-filling process. Since the fiber orientation distribution affects both the elastic properties of the finished part, it is important to know the influence in the development of shrinkage and warpage. This study introduces a true 3D finite volume based simulation tool to simulate the nonisothermal compression molding process with the fiber orientation prediction. For the compression action, a novel dynamic moving grid approach is adopted, where the computational domain will deform with time to realize the complex advancing flow front during compression. By means of simulation tool, the distribution of fiber orientation can be tailored through the interpolation of fiber orientation tensor and further investigate the effect of different initial orientation assignment in the pre-filled charge area. The results illustrate the potential practice of an effective 3D approach tool of being an extremely cost effective method to optimize the process.

  8. Vacuum isostatic micro molding of diffractive structures into PTFE materials

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd E.; Ohar, Orest

    2007-09-01

    Polytetrafluoroethylene (PTFE) is an ideal material for use in industrial, automotive and consumer electronics. Specifically, PTFE has outstanding physical properties; such as chemical inertness and resistance to chemical corrosion, even when exposed to a strong acid, alkali and oxidants. Its properties provide for superior electrical insulation and thermal stability, which is not affected by wide ranges in temperature and frequency. Its non-absorption of moisture makes it a perfect material for consideration in micro optical, retro-reflector or diffuser type devices used in handheld displays, flat panel displays as well as automotive, industrial and home lighting. This paper presents an overview of a unique fabrication method that incorporates a variety of elements to establish a processing technique that can form micro diffractive, holographic and reflective structures into PTFE materials. By means of modifying an existing known molding process, this new technique incorporates the addition of a vacuum to assist in the reliable molding and densification of the PTFE as well the use of a micro-structured electroformed shim to form small microstructures into the surface of the PTFE material. The combination of the vacuum and the electroformed shim within the molding process noticeably increases the precision, reproducibility and resolution of micro-structures that can be realized. The paper will describe the molding hardware involved, process parameters and the resulting structures formed. Optical function testing and metrology of the micro-structure geometry formed on each sample will be compared to the original design mandrel geometry [1].

  9. Injection molding of optics for high volume consumer products

    NASA Astrophysics Data System (ADS)

    de Schipper, Rien

    2012-03-01

    For high volume consumer products using optical technology, plastics injection molding is a very suitable technology. In optical component fabrication, astonishing results are be booked. However, to achieve success, excellent performance is needed in mastering different technologies such as polymer processing, evaporated coatings, tool making, ultra-precision turning of metals and optical metrology.

  10. Detecting Mold in School Buildings: An Exercise in Biodiversity

    ERIC Educational Resources Information Center

    Farone, Anthony L.

    2005-01-01

    A project was designed to introduce students to fungi in which students surveyed their school buildings for different types of mold. The students were able to make connections between structure and function of the fungal components and learn how these different components enhance survival in the environment.

  11. Molding compositions having an enhanced resistance to gasoline

    SciTech Connect

    Chung, J. Y. J.; Rosthauser, J. W.

    1985-06-11

    The present invention is directed to thermoplastic molding compositions which comprise a blend containing a thermoplastic polyester, a polycarbonate resin and an impact modifier and an amount of a blocked polyisocyanate prepolymer sufficient to improve the impact resistance and gasoline resistance of said blend.

  12. Simulation of SMC compression molding: Filling, curing, and volume changes

    SciTech Connect

    Hill, R.R. Jr.

    1992-01-01

    Sheet molding compound (SMC) is a composite material made from polyester resin, styrene, fiberglass reinforcement, and other additives. It is widely recognized that SMC is a good candidate for replacing sheet metals of automotive body exteriors because SMC is relatively inexpensive, has a high strength-to-density ratio, and has good corrosion resistance. The focus of this research was to develop computer models to simulate the important features of SMC compression molding (i.e., material flow, heat transfer, curing, material expansion, and shrinkage), and to characterize these features experimentally. A control volume/finite element approach was used to obtain the pressure and velocity fields and to compute the flow progression during compression mold filling. The energy equation and a kinetic model were solved simultaneously for the temperature and conversion profiles. A series of molding experiments was conducted to record the flow-front location and material temperature. Predictions obtained from the model were compared to experimental results which incorporated a non-isothermal temperature profile, and reasonable agreement was obtained.

  13. Seating tool for preparing molded-plug terminations on FCC

    NASA Technical Reports Server (NTRS)

    Chambers, C. M.; Corum, C. C.

    1971-01-01

    Hand-operated tool positions and seats window piece and conductor spacer onto conductors of two stripped cables during process of terminating cables with molded plug. Tool accommodates cables up to 3 in. wide and is used in conjunction with folding tools.

  14. 12. VIEW OF DEPLETED URANIUM INGOT AND MOLDS. DEPLETED URANIUM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. VIEW OF DEPLETED URANIUM INGOT AND MOLDS. DEPLETED URANIUM CASTING OPERATIONS CEASED IN 1988. (11/14/57) - Rocky Flats Plant, Non-Nuclear Production Facility, South of Cottonwood Avenue, west of Seventh Avenue & east of Building 460, Golden, Jefferson County, CO

  15. Optimizing biomass blends for manufacturing molded packaging materials using mycelium

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polystyrene is one of the most widely used plastics and is commonly produced in three forms: 1) Extruded polystyrene – disposable utensils, CD/DVD cases, yogurt containers, smoke alarm housing, etc.; 2) Expanded polystyrene foam – molded packaging materials and packaging "peanuts"; 3) Extruded polys...

  16. System for control of electroslag casting in a collar mold

    SciTech Connect

    McEnerney , J.W.; Dewey, B.R.; Hutton, J.T.; David, S.A.

    1980-01-01

    This report describes the initial development of an electroslag casting control system. The main emphasis of our work and the results reported herein deal with the attempts to develop techniques for locating and controlling the liquid slag-metal interface. Thermocouples embedded in the mold wall provide a simple but accurate means for locating the interface.

  17. Modified Silicone-Rubber Tooling For Molding Composite Parts

    NASA Technical Reports Server (NTRS)

    Baucom, Robert M.; Snoha, John J.; Weiser, Erik S.

    1995-01-01

    Reduced-thermal-expansion, reduced-bulk-modulus silicone rubber for use in mold tooling made by incorporating silica powder into silicone rubber. Pressure exerted by thermal expansion reduced even further by allowing air bubbles to remain in silicone rubber instead of deaerating it. Bubbles reduce bulk modulus of material.

  18. RISK ASSESSMENT/RISK MANAGEMENT FOR INDOOR MOLD

    EPA Science Inventory

    In 1998, a team of eight EPA researchers from NERL, NHEERL, NRMRL and NCEA organized to examine the role of indoor molds/fungi in children's health. The make-up of the indoor environment is critical to the health of children in general and has a particularly important influence ...

  19. Recommended Best Practices for Mold Investigations in Minnesota Schools.

    ERIC Educational Resources Information Center

    Minnesota State Dept. of Health, St. Paul.

    The Minnesota Department of Health developed this guidance at the request of the Minnesota Department of Children, Families and Learning. The goal of the document is to assist school district staff of Minnesota public schools in responding to problems related to indoor mold. Its focus is on practical, cost-effective methods to identify indoor mold…

  20. Incipient flocculation molding: A new ceramic-forming technique

    NASA Astrophysics Data System (ADS)

    Arrasmith, Steven Reade

    Incipient Flocculation Molding (IFM) was conceived as a new near-net-shape forming technique for ceramic components. It was hypothesized that the development of a temperature-dependent deflocculant would result in a forming technique that is flexible, efficient, and capable of producing a superior microstructure with improved mechanical properties from highly reactive, submicron ceramic powders. IFM utilizes a concentrated, nonaqueous, sterically stabilized ceramic powder and/or colloidal suspension which is injected into a non-porous mold. The suspension is then flocculated by destabilizing the suspension by lowering the temperature. Flocculation is both rapid and reversible. Cooling to -20°C produces a green body with sufficient strength for removal from the mold. The solvent is removed from the green body by evaporation. The dried green body is subsequently sintered to form a dense ceramic monolith. This is the first ceramic forming method based upon the manipulation of a sterically-stabilized suspension. To demonstrate IFM, the process of grafting polyethylene glycol (PEG), with molecular weights from 600 to 8000, to alumina powders was investigated. The maximum grafted amounts were achieved by the technique of dispersing the alumina powders in molten polymer at 195°C. The ungrafted PEG was then removed by repeated centrifuging and redispersion in fresh distilled water. The rheological behavior of suspensions of the PEG-grafted powders in water, 2-propanol and 2-butanol were characterized. All of the aqueous suspensions were shear thinning. The PEG 4600-grafted alumina powder aqueous suspensions were the most fluid. Sample rods and bars were molded from 52 vol% PEG-grafted alumina suspensions in 2-butanol. The best results were obtained with a preheated aluminum mold lubricated with a fluorinated oil mold-release. The samples were dried, sintered, and their microstructure and density were compared with sintered samples dry pressed from the same alumina powder

  1. An unusual case of anaphylaxis. Mold in pancake mix.

    PubMed

    Bennett, A T; Collins, K A

    2001-09-01

    Anaphylactic reactions involve contact with an antigen that evokes an immune reaction that is harmful. This type of reaction is a rapidly developing immunologic reaction termed a type I hypersensitivity reaction. The antigen complexes with an IgE antibody that is bound to mast cells and basophils in a previously sensitized individual. Upon re-exposure, vasoactive and spasmogenic substances are released that act on vessels and smooth muscle. The reaction can be local or systemic and may be fatal. The authors report the death of a 19-year-old white male who had a history of "multiple allergies," including pets, molds, and penicillin. One morning, he and his friends made pancakes with a packaged mix that had been opened and in the cabinet for approximately 2 years. The friends stopped eating the pancakes because they said that they tasted like "rubbing alcohol." The decedent continued to eat the pancakes and suddenly became short of breath. He was taken to a nearby clinic, where he became unresponsive and died. At autopsy, laryngeal edema and hyperinflated lungs with mucous plugging were identified. Microscopically, edema and numerous degranulating mast cells were identified in the larynx. The smaller airways contained mucus, and findings of chronic asthma were noted. Serum tryptase was elevated at 14.0 ng/ml. The pancake mix was analyzed and found to contain a total mold count of 700/g of mix as follows: Penicillium, Fusarium, Mucor, and Aspergillus. Witness statements indicate that the decedent ate two pancakes; thus he consumed an approximate mold count of 21,000. The decedent had a history of allergies to molds and penicillin, and thus was allergic to the molds in the pancake mix. The authors present this unusual case of anaphylaxis and a review of the literature. PMID:11563743

  2. Three-Dimensional Numerical Simulation of Mold Filling Process in Compression Resin Transfer Molding

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Jin, Tianguo; Li, Jianguang; Bi, Fengyang

    2015-04-01

    Compression resin transfer molding (CRTM) is an effective process for the manufacturing of composite parts with large size and high fiber content, while the existence of open gap, the dynamically changing dimensions of cavity geometry and the deformation of preform during filling process bring great difficulties to the three-dimensional simulation of resin flow in CRTM. In order to develop a convenient and efficient three-dimensional simulation approach for CRTM filling process, a unified mathematical model for resin flow in both open gap and preform is established instead of considering the gap as high permeability preform, then the analysis of the clamping force and stress distribution are presented. In order to avoid direct solving the coupled equations of resin flow and cavity deformation, volume of fluid (VOF) multiphase flow technology and dynamic mesh model are applied to track the resin flow front and update the cavity geometry during filling simulation, respectively. The master-slave element method is used to modify the amount of resin release and ensure the resin mass conservation. The validity of the numerical approach is verified by comparison with analytical and experimental results, three-dimensional simulation examples are also presented.

  3. 21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... section may be warmed and is subjected to the action of a lactic acid-producing bacterial culture. One or... 95 percent relative humidity, until the characteristic mold growth has developed. During storage, the surface of the cheese may be scraped to remove surface growth of undesirable microorganisms. One or...

  4. Measurement Of Thermal Contact Resistance Between The Mold And The Polymer For The Stretch-blow Molding Process

    NASA Astrophysics Data System (ADS)

    Bordival, M.; Schmidt, F. M.; Le Maoult, Y.; Coment, E.

    2007-04-01

    In the stretch-blow molding process, the heat transfer between the polymer and the mold is of prime interest. Although the time of contact is very short (typically around 0.5 s), the heat transfer affects the mechanical properties of the bottle, and the quality of final parts. In order to model heat transfers at the interface, a classical approach — generally adopted in numerical softwares — is to impose the heat flux density boundary condition thanks to a parameter called Thermal Contact Resistance (TCR). This paper focuses on describing the experimental method developed in order to measure evolution of this thermal parameter (TCR) versus time, as well as results obtained on the CROMeP blowing machine. In this study, a mold has been instrumented with two different sensors. The first probe allows to estimate the heat flux density and temperature at the mold surface temperature, using a linear inverse heat condution problem (Function Specification Method). The second device is used to measure the surface temperature of the PET during the blowing. This measurement is non intrusive, and can be applied within an industrial environment during the blowing step. In addition, air pressure inside the preform is also measured during the blowing. This work is part of the European project "APT_PACK" (Advanced knowledge of Polymer deformation for Tomorrow's PACKaging).

  5. Investigation of micro-injection molding based on longitudinal ultrasonic vibration core.

    PubMed

    Qiu, Zhongjun; Yang, Xue; Zheng, Hui; Gao, Shan; Fang, Fengzhou

    2015-10-01

    An ultrasound-assisted micro-injection molding method is proposed to improve the rheological behavior of the polymer melt radically, and a micro-injection molding system based on a longitudinal ultrasonic vibration core is developed and employed in the micro-injection molding process of Fresnel lenses. The verification experiments show that the filling mold area of the polymer melt is increased by 6.08% to 19.12%, and the symmetric deviation of the Fresnel lens is improved 15.62% on average. This method improved the filling performance and replication quality of the polymer melt in the injection molding process effectively. PMID:26479615

  6. Effects of Process Parameters on Replication Accuracy of Microinjection Molded Cyclic Olefins Copolymers Parts

    NASA Astrophysics Data System (ADS)

    Lin, Hsuan-Liang; Chen, Chun-Sheng; Lee, Ruey-Tsung; Chen, Shia-Chung; Chien, Rean-Der; Jeng, Ming-Chang; Hwang, Jiun-Ren

    2013-04-01

    In this study, the effects of various processing parameters of microinjection molding on the replication accuracy of the micro featured fluidic platform used for DNA/RNA tests are investigated. LIGA-like processes were utilized to prepare a silicon-based SU-8 photoresist, followed by electroforming to make a Ni-Co-based stamp. A cyclic olefin copolymer (COC) was used as the injection molding material. The molding parameters associated with the replication accuracy of micro channel parts were investigated. It was found that for microinjection molded devices, the replication accuracies of the imprint width and depth increase with increasing of mold temperature, melt temperature, injection velocity, and packing pressure.

  7. The effect of process parameters on the thermal conditions during moving mold ESR

    SciTech Connect

    Heilman, J.E.; Damkroger, B.K.

    1994-09-01

    Several experimental melts were conducted using a moving mold electroslag remelting furnace. The conditions of electrode immersion depth, slag cap thickness, and melt current were varied. Mold wall temperatures and slag pool temperatures were measured and the heat flux through the mold wall was calculated. The relationships between varying ESR melt parameters and the resultant thermal conditions were examined. The thermal profile of the mold, the heat transfer to the mold coolant total and fractional, and the formation of a slag skin were studied.

  8. The fabrication of a flexible mold for high resolution soft ultraviolet nanoimprint lithography.

    PubMed

    Koo, Namil; Plachetka, Ulrich; Otto, Martin; Bolten, Jens; Jeong, Jun-Ho; Lee, Eung-Sug; Kurz, Heinrich

    2008-06-01

    One key issue for all nanoimprint techniques is an appropriate method for the fabrication of desirable molds. We report on a novel flexible mold fabrication process-pressure-assisted molding (PAM)-for high resolution soft ultraviolet nanoimprint lithography (soft UV-NIL). In PAM, enhanced master filling is achieved by applying an external pressure during the mold fabrication process. Flexible molds, fabricated with PAM using different pressures in the range of 10-90 kPa, are compared to determine the role of pressures applied in the imprint performance. PMID:21825759

  9. Casting/mold thermal contact heat transfer during solidification of Al-Cu-Si alloy (LM 21) plates in thick and thin molds

    NASA Astrophysics Data System (ADS)

    Prabhu, K. Narayan; Chowdary, Bheemappa; Venkataraman, N.

    2005-10-01

    Heat flow at the casting/mold interface was assessed and studied during solidification of Al-Cu-Si (LM 21) alloy in preheated cast iron molds of two different thicknesses, coated with graphite and alumina based dressings. The casting and the mold were instrumented with thermocouples connected to a computer controlled temperature data acquisition system. The thermal history at nodal locations in the mold and casting obtained during experimentation was used to estimate the heat flux by solving the one-dimensional inverse heat conduction problem. The cooling rate and solidification time were measured using the computer-aided cooling curve analysis data. The estimated heat flux transients showed a peak due to the formation of a stable solid shell, which has a higher thermal conductivity compared with the liquid metal in contact with the mold wall prior to the occurrence of the peak. The high values of heat flux transients obtained with thin molds were attributed to mold distortion due to thermal stresses. For thin molds, assumption of Newtonian heating yielded reliable interfacial heat transfer coefficients as compared with one-dimensional inverse modeling. The time of occurrence of peak heat flux increased with a decrease in the mold wall thickness and increase in the casting thickness.

  10. Mycoflora of air-conditioners dust from Riyadh, Saudi Arabia.

    PubMed

    Bagy, M M; Gohar, Y M

    1988-01-01

    Using the hair baiting technique, 6 genera and 14 species were collected on Sabouraud's dextrose agar from 37 dust samples from air-conditioners. The most common fungi were Chrysosporium tropicum, C. indicum, C. keratinophilum, Aspergillus flavus followed by Acremonium strictum and Scopulariopsis brevicaulis. Using the dilution-plate method, 26 genera and 52 species were collected from 37 dust samples on glucose-(23 genera and 45 species) and cellulose-(18 genera and 34 species) Czapek's agar at 28 degrees C. The most prevalent species were Aspergillus niger, A. flavus, Penicillium chrysogenum, Stachybotrys chartarum, Ulocladium atrum, Mucor racemosus and Fusarium solani and A. niger, A. flavus, Trichoderma viride, P. chrysogenum, Ulocladium atrum, Chaetomium globosum, C. spirale, Stachybotrys chartarum and Mucor racemosus on the two media, respectively. PMID:3236219

  11. Modeling injection molding of net-shape active ceramic components.

    SciTech Connect

    Baer, Tomas; Cote, Raymond O.; Grillet, Anne Mary; Yang, Pin; Hopkins, Matthew Morgan; Noble, David R.; Notz, Patrick K.; Rao, Rekha Ranjana; Halbleib, Laura L.; Castaneda, Jaime N.; Burns, George Robert; Mondy, Lisa Ann; Brooks, Carlton, F.

    2006-11-01

    To reduce costs and hazardous wastes associated with the production of lead-based active ceramic components, an injection molding process is being investigated to replace the current machining process. Here, lead zirconate titanate (PZT) ceramic particles are suspended in a thermoplastic resin and are injected into a mold and allowed to cool. The part is then bisque fired and sintered to complete the densification process. To help design this new process we use a finite element model to describe the injection molding of the ceramic paste. Flow solutions are obtained using a coupled, finite-element based, Newton-Raphson numerical method based on the GOMA/ARIA suite of Sandia flow solvers. The evolution of the free surface is solved with an advanced level set algorithm. This approach incorporates novel methods for representing surface tension and wetting forces that affect the evolution of the free surface. Thermal, rheological, and wetting properties of the PZT paste are measured for use as input to the model. The viscosity of the PZT is highly dependent both on temperature and shear rate. One challenge in modeling the injection process is coming up with appropriate constitutive equations that capture relevant phenomenology without being too computationally complex. For this reason we model the material as a Carreau fluid and a WLF temperature dependence. Two-dimensional (2D) modeling is performed to explore the effects of the shear in isothermal conditions. Results indicate that very low viscosity regions exist near walls and that these results look similar in terms of meniscus shape and fill times to a simple Newtonian constitutive equation at the shear-thinned viscosity for the paste. These results allow us to pick a representative viscosity to use in fully three-dimensional (3D) simulation, which because of numerical complexities are restricted to using a Newtonian constitutive equation. Further 2D modeling at nonisothermal conditions shows that the choice of

  12. Soft lithography of ceramic microparts using wettability-tunable poly(dimethylsiloxane) (PDMS) molds

    NASA Astrophysics Data System (ADS)

    Su, Bo; Zhang, Aijun; Meng, Junhu; Zhang, Zhaozhu

    2016-07-01

    Green alumina microparts were fabricated from a high solid content aqueous suspension by microtransfer molding using air plasma-treated poly(dimethylsiloxane) (PDMS) molds. The wettability of the air plasma-treated PDMS molds spontaneously changed between the hydrophilic and hydrophobic states during the process. Initial hydrophilicity of the air plasma-treated PDMS molds significantly improved the flowability of the concentrated suspension. Subsequent hydrophobic recovery of the air plasma-treated PDMS molds enabled a perfect demolding of the green microparts. Consequently, defect-free microchannel parts of 60 μm and a micromixer with an area of several square centimeters were successfully fabricated. In soft lithography, tuning the wetting behavior of PDMS molds has a great effect on the quality of ceramic microparts. Using wettability-tunable PDMS molds has great potential in producing complex-shaped and large-area ceramic microparts and micropatterns.

  13. Titanium casting: the surface reaction layer of castings obtained using ultra-low-temperature molds.

    PubMed

    Kikuchi, H; Onouchi, M; Hsu, H C; Kurotani, T; Nishiyama, M

    2001-03-01

    To examine whether the surface reaction layer of titanium castings can be reduced by lowering the mold temperature during casting, we cast titanium at three mold temperatures, including an ultra-low temperature produced by cooling the mold with liquid nitrogen, then measured the tensile strength and elongation of the castings. The titanium was cast using a centrifugal casting machine, and the molds were incinerated according to the manufacturers' instructions. Castings were then made with the molds at 200 degrees C, 600 degrees C, and an ultra-low temperature (-196 degrees C). The castability of titanium cast in the mold at the ultra-low temperature was good. The Vickers hardness near the surface layer of castings decreased as the mold temperature decreased. PMID:11383633

  14. Increasing prototype airfoil fabrication efficiency through the use of sectional molds

    NASA Astrophysics Data System (ADS)

    Karges, Adam T.

    Airfoil development has always been important in the aeronautics industry. Current airfoil development techniques are being applied to design larger and more efficient wind turbine blades. To verify simulation results, a prototype blade must be built and tested. Current wing or blade structures are fabricated using traditional molding techniques. These large molds, particularly those used for wind turbine blades, can be fabricated from composite materials formed over a master shape. This process can be time and material intensive. This project develops techniques and methodology to build cavity molds using sectional pieces directly fabricated by computer numerically controlled (CNC) milling. A mold cavity was machined into tooling foam using CNC milling. This process allowed for mold creation without fabricating a master airfoil. Employment of several mold sections makes the machining process much easier and allows machine shops to produce larger, previously unfeasible, airfoil molds using limited machining length.

  15. Modeling and flow analysis of pure nylon polymer for injection molding process

    NASA Astrophysics Data System (ADS)

    Nuruzzaman, D. M.; Kusaseh, N.; Basri, S.; Oumer, A. N.; Hamedon, Z.

    2016-02-01

    In the production of complex plastic parts, injection molding is one of the most popular industrial processes. This paper addresses the modeling and analysis of the flow process of the nylon (polyamide) polymer for injection molding process. To determine the best molding conditions, a series of simulations are carried out using Autodesk Moldflow Insight software and the processing parameters are adjusted. This mold filling commercial software simulates the cavity filling pattern along with temperature and pressure distributions in the mold cavity. In the modeling, during the plastics flow inside the mold cavity, different flow parameters such as fill time, pressure, temperature, shear rate and warp at different locations in the cavity are analyzed. Overall, this Moldflow is able to perform a relatively sophisticated analysis of the flow process of pure nylon. Thus the prediction of the filling of a mold cavity is very important and it becomes useful before a nylon plastic part to be manufactured.

  16. Increasing the life of molds for casting copper and its alloys

    NASA Astrophysics Data System (ADS)

    Smirnov, A. N.; Spiridonov, D. V.

    2010-12-01

    The work of the molds intended for casting copper and copper alloys in semicontinuous casters for producing flat billets is considered. It is shown that, to increase the resistance of mold plates, the inner space of the mold should have a taper shape toward the casting direction and take into account the shrinkage of the linear dimensions of the ingot during its motion in the mold. The taper shape increases the intensity and uniformity of heat removal due to close contact between the ingot and the mold inner surface. Testing of new design molds under industrial conditions demonstrates that their resistance increases by a factor of 4.0-4.5. The taper effect of the mold plates is much more pronounced in their narrow faces.

  17. Route 20, Autobahn 7, and Slime Mold: Approximating the Longest Roads in USA and Germany With Slime Mold on 3-D Terrains.

    PubMed

    Adamatzky, Andrew I

    2014-01-01

    A cellular slime mould Physarum polycephalum is a monstrously large single cell visible by an unaided eye. The slime mold explores space in parallel, is guided by gradients of chemoattractants, and propagates toward sources of nutrients along nearly shortest paths. The slime mold is a living prototype of amorphous biological computers and robotic devices capable of solving a range of tasks of graph optimization and computational geometry. When presented with a distribution of nutrients, the slime mold spans the sources of nutrients with a network of protoplasmic tubes. This protoplasmic network matches a network of major transport routes of a country when configuration of major urban areas is represented by nutrients. A transport route connecting two cities should ideally be a shortest path, and this is usually the case in computer simulations and laboratory experiments with flat substrates. What searching strategies does the slime mold adopt when exploring 3-D terrains? How are optimal and transport routes approximated by protoplasmic tubes? Do the routes built by the slime mold on 3-D terrain match real-world transport routes? To answer these questions, we conducted pioneer laboratory experiments with Nylon terrains of USA and Germany. We used the slime mold to approximate route 20, the longest road in USA, and autobahn 7, the longest national motorway in Europe. We found that slime mold builds longer transport routes on 3-D terrains, compared to flat substrates yet sufficiently approximates man-made transport routes studied. We demonstrate that nutrients placed in destination sites affect performance of slime mold, and show how the mold navigates around elevations. In cellular automaton models of the slime mold, we have shown variability of the protoplasmic routes might depends on physiological states of the slime mold. Results presented will contribute toward development of novel algorithms for sensorial fusion, information processing, and decision making, and

  18. Polymeric additives for antistatic treatment of sheet molding composites (SMC)

    NASA Astrophysics Data System (ADS)

    Gedan-Smolka, Michaela; Schubert, Katrin; Taeger, Antje; Marks, Hagen

    2016-03-01

    Novel oligomeric/polymeric additives with ionic units were synthesized in a one pot procedure in order to enhance the specific surface resistivity of SMC-materials. In contrast to industrially used inorganic salts or carbon materials, such as carbon black or CNT's, these substances are nearly colorless and matrix compatible and, resulting from that, easy to homogenize with the SMC-matrix. Furthermore, it was found, that additives which can be covalently bonded to the matrix during the molding procedure are preferred compared to physically mixed substances. The effectiveness of chemically bonded substances regarding with the lowering of the specific surface resistivity is higher and selected additives do not change the reactivity and resulting mechanical properties of the molded material.

  19. Direct processing of continuous fibers onto injection molding machines

    NASA Astrophysics Data System (ADS)

    Truckenmueller, F. M.

    1993-06-01

    A new injection molding process 'DIF' (Direct Incorporation of Continuous Fibers) is proposed whereby roving strands are directly incorporated into the polymer melt by using a reciprocating-screw-plasticating unit. The DIF-technology offers the possibility to substitute the relatively expensive pultrusion process which is used to produce long fiber pellets. Furthermore it can be used as a fast and flexible R&D tool. In order to improve fiber dispersion with minimum fiber breakage a new mixing non-return-valve 'LFMR' (Long Fiber Mixing Ring) was developed based on the 'Twente Mixing Ring'; Its mixing capacity and influence on processing characteristics, fiber breakage and property profile of the injection molded parts is examined and compared to a general purpose non-return-valve of the ring type. The results of fundamental mechanical and physical property investigations are presented including dispersion of fiber clusters and bundles, fiber length distribution and fiber orientation.

  20. Reusable molds for casting U-Zr alloys

    SciTech Connect

    Chen, P.S.; Stevens, W.C. ); Trybus, C.L. )

    1992-09-01

    Refractory oxides, carbides, nitrides and sulfides were examined as mold coating materials for use in casting nuclear fuel. The molds require excellent high temperature chemical and mechanical stability combined with reasonable room temperature ductility to allow for fuel removal. Coatings were applied onto quartz and refractory metal coupons using various techniques. Sessile drop tests employing molten U-10%Zr (by weight) at 1550[degrees]C were used to characterize coating performance. Results indicate that NbC, TiN, and Y[sub 2]O[sub 3] were non-wetting with U-10%Zr. However, only the Y[sub 2]O[sub 3] coating completely prevented adhesion of the fuel. The paper describes coating methods and details of the sessile drop experiments.