Science.gov

Sample records for mold stachybotrys chartarum

  1. Indoor Mold, Toxigenic Fungi, and Stachybotrys chartarum: Infectious Disease Perspective

    PubMed Central

    Kuhn, D. M.; Ghannoum, M. A.

    2003-01-01

    Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors. PMID:12525430

  2. Facts about Stachybotrys chartarum and Other Molds

    MedlinePlus

    ... Program in Brief Related Issues Resources Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ... be removed. Â Top of Page Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ...

  3. ELISA MEASUREMENT OF STACHYLYSIN IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Problem- To develop a measurable indicator of human exposure to Stachybotys chartarum.

    Methods- Antibodies were produced against the hemolytic agent stachylysin obtained from the mold S. chartarum. These antibodies were used to develop two enzyme-linked immunosorbent ass...

  4. IS YOUR STACHYBOTRYS CHARTARUM A GENUINE S. CHARTARUM?

    EPA Science Inventory

    The fungus Stachybotrys chartarum is the type species of the genus Stachybotrys. Certain strains of the species are known to produce trichothecene mycotoxins,. It is a celluolytic saprophyte with worldwide distribution and frequently discovered in water-damaged buildings. Evid...

  5. Cryptic species in Stachybotrys chartarum.

    PubMed

    Cruse, Michael; Telerant, Robin; Gallagher, Thomas; Lee, Thomas; Taylor, John W

    2002-01-01

    Stachybotrys chartarum has received much attention as a possible cause of sick-building syndrome. Because morphological species recognition in fungi can hide diversity, we applied a phylogenetic approach to search for cryptic species. We examined 23 isolates from the San Francisco Bay Area, and another seven from around the US. Using markers we developed for three polymorphic protein coding loci (chitin synthase 1, beta-tubulin 2, and trichodiene synthase 5), we infer that two distinct phylogenetic species exist within the single described morphological species. We have found no correlation between genetic isolation and geographic distance. PMID:21156555

  6. CHARACTERIZATION OF THE HEMOLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920
    Da as determ...

  7. ELISA MEASUREMENT OF STACHYLYSIN (TM) IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Antibodies were produced against the hemolytic agent stachylysin obtained from the mold Stachybotryis chartarum. These antibodies were used to develop two enzyme-linked immunosorbent assay (ELISA) methods for the analysis of stachylysin in human and rat sera and environmental sa...

  8. GROWTH RESPONSE OF STACHYBOTRYS CHARTARUM TO MOISTURE VARIATION ON COMMON BUILDING MATERIALS

    EPA Science Inventory

    The mold Stachybotrys chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants and has been studied for toxin production and its occurrence in water damaged buildings. Growth of S. chartarum on building materials such as drywall has been frequentl...

  9. Genome sequence of Stachybotrys chartarum Strain 51-11

    EPA Science Inventory

    Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina Hiseq 2000 and PacBio long read technology. Since Stachybotrys chartarum has been implicated in health impacts within water-damaged buildings, any information extracted from the geno...

  10. PARTIAL CHARACTERIZATION OF ALLERGENS IN EXTRACTS OF STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    PARTIAL CHARACTERIZATION OF ALLERGENS IN EXTRACTS OF Stachybotrys chartarum. M E Viana1, MJ Selgrade2, and M D Ward2. 1NCSU, Raleigh, NC, USA. 2NHEERL, ORD, US EPA, RTP, NC, USA.

    Exposure to Stachybotrys chartarum has been associated with the development of serious health ...

  11. CHARACTERISTIC GROWTH REQUIREMENTS OF THE TOXIC MOLD STACHYBOTRYS CHARTARAM

    EPA Science Inventory

    The paper discusses the results of a study of the environmental factors leading to the growth of the mold Stachybotrys chartarum. S. chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants, and its toxin production and occurrence in water damaged...

  12. Satratoxin G from the black mold Stachybotrys chartarum evokes olfactory sensory neuron loss and inflammation in the murine nose and brain.

    PubMed

    Islam, Zahidul; Harkema, Jack R; Pestka, James J

    2006-07-01

    Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the "black mold" suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose-response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 microg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 microg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 microg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-alpha, interleukin-6 (IL-6) , and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings.

  13. Satratoxin-G from the black mold Stachybotrys chartarum induces rhinitis and apoptosis of olfactory sensory neurons in the nasal airways of rhesus monkeys.

    PubMed

    Carey, Stephan A; Plopper, Charles G; Hyde, Dallas M; Islam, Zahidul; Pestka, James J; Harkema, Jack R

    2012-08-01

    Satratoxin-G (SG) is a trichothecene mycotoxin of Stachybotrys chartarum, the black mold suggested to contribute etiologically to illnesses associated with water-damaged buildings. We have reported that intranasal exposure to SG evokes apoptosis of olfactory sensory neurons (OSNs) and acute inflammation in the nose and brain of laboratory mice. To further assess the potential human risk of nasal airway injury and neurotoxicity, we developed a model of SG exposure in monkeys, whose nasal airways more closely resemble those of humans. Adult, male rhesus macaques received a single intranasal instillation of 20 µg SG (high dose, n = 3), or 5 µg SG daily for four days (repeated low dose, n = 3) in one nasal passage, and saline vehicle in the contralateral nasal passage. Nasal tissues were examined using light and electron microscopy and morphometric analysis. SG induced acute rhinitis, atrophy of the olfactory epithelium (OE), and apoptosis of OSNs in both groups. High-dose and repeated low-dose SG elicited a 13% and 66% reduction in OSN volume density, and a 14-fold and 24-fold increase in apoptotic cells of the OE, respectively. This model provides new insight into the potential risk of nasal airway injury and neurotoxicity caused by exposure to water-damaged buildings.

  14. CHARACTERIZATION OF MICROBIAL VOLATILE ORGANIC COMPOUNDS (MVOC) EMITTED BY STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a filamentous fungi usually found in water-damaged buildings. Severe illnesses have been reported after indoor exposure to this mold. Toxicity has caused the production of secondary metabolites or mycotoxins, and the emission of by-products, specifically...

  15. The relative allergenicity of Stachybotrys chartarum compared to house dust mite extracts in a mouse model

    EPA Science Inventory

    A report by the Institute of Medicine suggested that more research is needed to better understand mold effects on allergic disease, particularly asthma development. The authors compared the ability of the fungus Stachybotrys chartarum (SCE) and house dust mite (HDM) extracts to i...

  16. Genome Sequence of Stachybotrys chartarum Strain 51-11.

    PubMed

    Betancourt, Doris A; Dean, Timothy R; Kim, Jean; Levy, Josh

    2015-01-01

    The Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina HiSeq 2000 and PacBio technologies. Since S. chartarum has been implicated as having health impacts within water-damaged buildings, any information extracted from the genomic sequence data relating to toxins or the metabolism of the fungus might be useful.

  17. CHARACTERIZATION OF THE HEMOLYSIN, STACHYLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage/hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its monomeric form, has a molecular wieght of 11,920 daltons as determined by m...

  18. STACHYLYSIN MAY BE CAUSE OF HEMORRAHAGING IN STACHYBOTRYS CHARTARUM EXPOSURES

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns like nasal bleeding in adults and pulmonary hemosiderosis (PH) in infants. Stachylysin is a glycosylated protein, with the deglycosylated molecular mass of 21.5 kDa. Seven of eight ...

  19. EVALUATION OF STACHYBOTRYS CHARTARUM IN THE HOUSE OF AN INFANT WITH PULMONARY HEMORRHAGE: QUANTITATIVE ASSESSMENT BEFORE, DURING, AND AFTER REMEDIATION

    EPA Science Inventory

    Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...

  20. Occurrence of Stachybotrys chartarum chemotype S in dried culinary herbs.

    PubMed

    Biermaier, Barbara; Gottschalk, Christoph; Schwaiger, Karin; Gareis, Manfred

    2015-02-01

    Stachybotrys (S.) chartarum is an omnipresent cellulolytic mould which produces secondary metabolites, such as the highly toxic macrocyclic trichothecenes. While it is known to occur in animal feed like hay and straw as well as in water-damaged indoor environments, there is little knowledge about the occurrence of S. chartarum and its secondary metabolites in food. The objective of the present study was to examine selected dried culinary herbs for the presence of S. chartarum chemotype S, to assess the potential risk of a contamination of foods with macrocyclic trichothecenes. In total, 50 Stachybotrys isolates from different types of culinary herbs (n=100) such as marjoram (Origanum majorana Linné (L.)), oregano (Origanum vulgare L.), thyme (Thymus vulgaris L.), and savory (Satureja hortensis L.) were examined by MTT-cell culture test (effect-based bioassay), ELISA, and by liquid chromatography tandem mass spectrometry (LC-MS/MS). Selected toxic and non-toxic isolates (n=15) were genetically characterized by PCR and sequencing. Five isolates (10%) were highly toxic in the MTT-cell culture test, and the production of macrocyclic trichothecenes was proven by ELISA and LC-MS/MS. These five isolates were genetically confirmed as S. chartarum chemotype S. To the best of our knowledge, this is the first report about a contamination of dried culinary herbs with toxigenic S. chartarum. PMID:25346283

  1. DNA fragmentation in developing lung fibroblasts exposed to Stachybotrys chartarum (atra) toxins.

    PubMed

    McCrae, K C; Rand, T G; Shaw, R A; Mantsch, H H; Sowa, M G; Thliveris, J A; Scott, J E

    2007-07-01

    Stachybotrys chartarum (atra) is a toxic mold that grows on water-damaged cellulose-based materials. Research has revealed also that inhalation of S. chartarum spores caused marked changes in respiratory epithelium, especially to developing lungs. We analyzed the epigenetic potential of S. chartarum spore toxins on developing rat lung fibroblasts using single cell gel electrophoresis (comet assay). Isolated fetal lung fibroblasts were exposed to S. chartarum spore toxins for 15 min, 3, 14, or 24 hr and control cells were exposed to saline under the same conditions. Cells were embedded in agarose, electrophoresed under alkaline conditions and silver stained. DNA damage was assessed in terms of fragmentation as measured by comet tail length (DNA migration) and intensity (% DNA contained within head and tail). Upon visual inspection, control fibroblasts showed no DNA fragmentation whereas S. chartarum-treated cells had definable comets of various degrees depending upon the time-course. Analyses of the comets revealed that exposure to S. chartarum spore toxins for at least 15 min to 14 hr, induced increased DNA fragmentation in a time-dependent manner. The fact that exposure to toxins for 24 hr showed less damage suggested that developing lung fibroblasts may have the capability of repairing DNA fragmentation. PMID:17534970

  2. Satratoxin G from the Black Mold Stachybotrys chartarum Evokes Olfactory Sensory Neuron Loss and Inflammation in the Murine Nose and Brain

    PubMed Central

    Islam, Zahidul; Harkema, Jack R.; Pestka, James J.

    2006-01-01

    Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the “black mold” suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose–response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 μg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 μg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 μg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-α, interleukin-6 (IL-6), and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings. PMID:16835065

  3. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  4. SOLVENT COMPARISON IN THE ISOLATION, SOLUBILIZATION, AND TOXICITY OF STACHYBOTRYS CHARTARUM SPORE TRICHOTHECENE MYCOTOXINS IN AN ESTABLISHED IN VITRO LUMINESCENCE PROTEIN TRANSLATION INHIBITION ASSAY

    EPA Science Inventory

    It is well known that non-viable mold contaminants such as macrocyclic trichothecene mycotoxins of Stachybotrys chartarum are highly toxinigenic to humans. However, there is no agreed upon method of recovering native mycotoxin. The purpose of this study was to provide quantitativ...

  5. AN EXTRACT OF STACHYBOTRYS CHARTARUM CAUSES ALLERGIC RESPONSE IN A BALB/C MOUSE MODEL

    EPA Science Inventory

    ABSTRACT
    Environmental exposure to Stachybotrys chartarum has been associated with adverse health effects in humans. The goal of this study was to assess soluble components of this fungus for allergenic potential. Five isolates of S. chartarum were combined and extracted to fo...

  6. GERMINATION, VIABILITY AND CLEARANCE OF STACHYBOTRYS CHARTARUM IN THE LUNGS OF INFANT RATS

    EPA Science Inventory

    The fungus Stachybotrys chartarum has been associated with many adverse health effects including the condition known as idiopathic pulmonary hemorrhage in infants. In order to gain some insight into possible mechanisms, viable conidia of S. chartarum were instilled into the lung...

  7. IDENTIFICATION OF SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenitic relati...

  8. MALDI-TOF mass spectrometry fingerprinting: A diagnostic tool to differentiate dematiaceous fungi Stachybotrys chartarum and Stachybotrys chlorohalonata.

    PubMed

    Gruenwald, Maike; Rabenstein, Andreas; Remesch, Markko; Kuever, Jan

    2015-08-01

    Stachybotrys chartarum and Stachybotrys chlorohalonata are two closely related species. Unambiguous identification of these two species is a challenging task if relying solely on morphological criteria and therefore smarter and less labor-intensive approaches are needed. Here we show that even such closely related species of fungi as S. chartarum and S. chlorohalonata are unequivocally discriminated by their highly reproducible MALDI-TOF-MS fingerprints (matrix assisted laser desorption/ionization time-of-flight mass spectrometry fingerprints). We examined 19 Stachybotrys and one Aspergillus isolate by MALDI-TOF-MS. All but one isolate produced melanin containing conidia on malt extract agar. Mass spectra were obtained in good quality from the analysis of hyaline and darkly pigmented conidia by circumventing the property of melanin which causes signal suppression. MALDI-TOF fingerprint analysis clearly discriminated not only the two morphologically similar species S. chartarum and S. chlorohalonata from each other but separated them precisely from Stachybotrys bisbyi and Aspergillus versicolor isolates. Furthermore, even S. chartarum chemotypes A and S could be differentiated into two distinct groups by their MALDI-TOF fingerprints. The chemotypes of S. chartarum isolates were identified by trichodiene synthase 5 (tri5) sequences prior to mass spectra analysis. Additionally, species identities of all isolates were verified by their 18S rRNA and tri5 gene sequences. PMID:26036596

  9. Stachybotrys chartarum-Induced Hypersensitivity Pneumonitis Is TLR9 Dependent

    PubMed Central

    Bhan, Urvashi; Newstead, Michael J.; Zeng, Xianying; Ballinger, Megan N.; Standiford, Louis R.; Standiford, Theodore J.

    2011-01-01

    Hypersensitivity pneumonitis (HP), an inflammatory lung disease, develops after repeated exposure to inhaled particulate antigen and is characterized by a vigorous T helper type 1-mediated immune response, resulting in the release of IL-12 and interferon (IFN)-γ. These T helper type 1 cytokines may participate in the pathogenesis of HP. Stachybotrys chartarum (SC) is a dimorphic fungus implicated in a number of respiratory illnesses, including HP. Here, we have developed a murine model of SC-induced HP that reproduces pathology observed in human HP and hypothesized that toll receptor-like 9 (TLR9)-mediated dendritic cell responses are required for the generation of granulomatous inflammation induced by inhaled SC. Mice sensitized and challenged with 106 SC spores develop granulomatous inflammation with multinucleate giant cells, accompanied by increased accumulation of neutrophils and CD4+ and CD8+ T cells. SC sensitization and challenge resulted in robust pulmonary expression of tumor necrosis factor-α, IL-12, and IFN-γ. SC-mediated granulomatous inflammation required IFN-γ and was TLR9 dependent, because TLR9−/− mice displayed reduced peribronchial inflammation, decreased accumulation and/or activation of polymorphonuclear (PMN) and CD4+ and CD8+ T cells, and reduced lung expression of type 1 cytokines and chemokines. T-cell production of IFN-γ was IL-12 dependent. Our studies suggest that TLR9 is critical for dendritic cell-mediated development of a type 1 granulomatous inflammation in the lung in response to SC. PMID:21982832

  10. IDENTIFICATION OF PUTATIVE SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachbotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relatio...

  11. INITIAL CHARACTERIZATION OF MONOCLONAL ANTIBODIES AGAINST THE FUNGAL HEMOLYSIN STACHYLYSIN FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is known to produce the hemolysin stachylysin and its detection in human serum has been proposed as a biomarker for exposure to the fungus. In this study we report the initial characterization of monoclonal antibodies (mAbs) against stachylysin and the dev...

  12. DESTRUCTION OF ASPERGILLUS VERSICOLOR, PENICILLIUM CRYSOGENUM, STACHYBOTRYS CHARTARUM, AND CLADOSPORIUM CLADOSPORIDES SPORES USING CHEMICAL OXIDATION TREATMENT PROCESS

    EPA Science Inventory

    The survival of aqueous suspensions of Penicillium chrysogenum, Stachybotrys chartarum, Aspergillus versicolor, and Cladosporium cladosporioides spores was evaluated using various combinations of hydrogen peroxide and iron (II) as catalyst. Spores were suspended in water and trea...

  13. Stachybotrys chartarum, trichothecene mycotoxins, and damp building-related illness: new insights into a public health enigma.

    PubMed

    Pestka, James J; Yike, Iwona; Dearborn, Dorr G; Ward, Marsha D W; Harkema, Jack R

    2008-07-01

    Damp building-related illnesses (DBRI) include a myriad of respiratory, immunologic, and neurologic symptoms that are sometimes etiologically linked to aberrant indoor growth of the toxic black mold, Stachybotrys chartarum. Although supportive evidence for such linkages is limited, there are exciting new findings about this enigmatic organism relative to its environmental dissemination, novel bioactive components, unique cellular targets, and molecular mechanisms of action which provide insight into the S. chartarum's potential to evoke allergic sensitization, inflammation, and cytotoxicity in the upper and lower respiratory tracts. Macrocyclic trichothecene mycotoxins, produced by one chemotype of this fungus, are potent translational inhibitors and stress kinase activators that appear to be a critical underlying cause for a number of adverse effects. Notably, these toxins form covalent protein adducts in vitro and in vivo and, furthermore, cause neurotoxicity and inflammation in the nose and brain of the mouse. A second S. chartarum chemotype has recently been shown to produce atranones-mycotoxins that can induce pulmonary inflammation. Other biologically active products of this fungus that might contribute to pathophysiologic effects include proteinases, hemolysins, beta-glucan, and spirocyclic drimanes. Solving the enigma of whether Stachybotrys inhalation indeed contributes to DBRI will require studies of the pathophysiologic effects of low dose chronic exposure to well-characterized, standardized preparations of S. chartarum spores and mycelial fragments, and, coexposures with other environmental cofactors. Such studies must be linked to improved assessments of human exposure to this fungus and its bioactive constituents in indoor air using both state-of-the-art sampling/analytical methods and relevant biomarkers.

  14. AN EXTRACT OF STACHYBOTRYS CHARTARUM CAUSES ALLERGIC RESPONSES IN A BALB/C MOUSE MODEL: I. BIOCHEMICAL AND PATHOLOGICAL RESPONSES

    EPA Science Inventory

    Environmental exposure to Stachybotrys chartarum has been associated with adverse health effects in humans. The goal of this study was to assess soluble components of this fungus for allergenic potential. Five isolates of S. chartarum were combined and extracted to form a crude...

  15. Pulmonary Responses to Stachybotrys chartarum and Its Toxins: Mouse Strain Affects Clearance and Macrophage Cytotoxicity

    PubMed Central

    Lichtenstein, Jamie H. Rosenblum; Molina, Ramon M.; Donaghey, Thomas C.; Amuzie, Chidozie J.; Pestka, James J.; Coull, Brent A.; Brain, Joseph D.

    2010-01-01

    We investigated differences in the pulmonary and systemic clearance of Stachybotrys chartarum spores in two strains of mice, BALB/c and C57BL/6J. To evaluate clearance, mice were intratracheally instilled with a suspension of radiolabeled S. chartarum spores or with unlabeled spores. The lungs of C57BL/6J mice showed more rapid spore clearance than the lungs of BALB/c mice, which correlated with increased levels of spore-associated radioactivity in the GI tracts of C57BL/6J as compared with BALB/c mice. To identify mechanisms responsible for mouse strain differences in spore clearance and previously described lung inflammatory responses, we exposed alveolar macrophages (AMs) lavaged from BALB/c and C57BL/6J mice to S. chartarum spores, S. chartarum spore toxin (SST), and satratoxin G (SG) in vitro. The S. chartarum spores were found to be highly toxic with most cells from either mouse strain being killed within 24 h when exposed to a spore:cell ratio of 1:75. The spores were more lethal to AMs from C57BL/6J than those from BALB/c mice. In mice, the SST elicited many of the same inflammatory responses as the spores in vivo, including AM recruitment, pulmonary hemorrhage, and cytokine production. Our data suggest that differences in pulmonary spore clearance may contribute to the differences in pulmonary responses to S. chartarum between BALB/c and C57BL/6J mice. Enhanced AM survival and subsequent macrophage-mediated inflammation may also contribute to the higher susceptibility of BALB/c mice to S. chartarum pulmonary effects. Analogous genetic differences among humans may contribute to reported variable sensitivity to S. chartarum. PMID:20385656

  16. Protein translation inhibition by Stachybotrys chartarum conidia with and without the mycotoxin containing polysaccharide matrix.

    PubMed

    Karunasena, Enusha; Cooley, J Danny; Straus, Douglas; Straus, David C

    2004-07-01

    Recent studies have correlated the presence of Stachybotrys chartarum in structures with SBS. S. chartarum produces mycotoxins that are thought to produce some of the symptoms reported in sick-building syndrome (SBS). The conidia (spores) produced by Stachybotrys species are not commonly found in the air of buildings that have been found to contain significant interior growth of this organism. This could be due in part to the large size of the Stachybotrys spores, or the organism growing in hidden areas such as wall cavities. However, individuals in buildings with significant Stachybotrys growth frequently display symptoms that may be attributed to exposure to the organism's mycotoxins. In addition, Stachybotrys colonies produce a "slime" or polysaccharide (carbohydrate) matrix that coats the hyphae and the spores. The intent of this project was to determine whether the carbohydrate matrix and the mycotoxins embedded in it could be removed from the spores by repeated washings with either aqueous or organic solvents. The results demonstrated that the process of spore washing removed compounds that were toxic in a protein translation assay as compared to spores that were washed with an organic solution, however a correlation between carbohydrate removal during the washing process and the removal of mycotoxins from the spore surface was not observed. These data demonstrated that mycotoxins are not likely to be found exclusively in the carbohydrate matrix of the spores. Therefore, mycotoxin removal from the spore surface can occur without significant loss of polysaccharide. We also showed that toxic substances may be removed from the spore surface with an aqueous solution. These results suggest that satratoxins are soluble in aqueous solutions without being bound to water-soluble moieties, such as the carbohydrate slime matrix. PMID:15487326

  17. RESPIRATORY PHYSIOLOGICAL AND ALLERGIC-TYPE RESPONSES TO AN EXTRACT OF STACHYBOTRYS CHARTARUM IN BALB/C MICE

    EPA Science Inventory

    RESPIRATORY PHYSIOLOGICAL AND ALLERGIC-TYPE RESPONSES TO AN EXTRACT OF Stachybotrys chartarum IN BALB/C MICE. ME Viana1, N Haykal-Coates2, S H Gavett2, MJ Selgrade2, and M D W Ward2. 1APR/CVM, NCSU, Raleigh, NC, USA. 2NHEERL, ORD, US EPA, RTP, NC, USA.
    Rationale: assess the ab...

  18. PURIFICATION AND COMPARATIVE NEUROTOXICITY OF THE TRICHOTHECENES SATRATOXIN G AND RORIDIN L2 FROM STACHYBOTRYS CHARTARUM

    PubMed Central

    Islam, Zahidul; Shinozuka, Junko; Harkema, Jack R.; Pestka, James J.

    2009-01-01

    Satratoxin G (SG), a macrocyclic trichothecene produced by Stachybotrys chartarum, induces apoptosis in cultured neuronal cells as well as nasal olfactory sensory neurons (OSN) in the nose and brain of mice exposed intranasally to this toxin. The purpose of this study was to (1) develop a facile method for production and purification of both SG, and its putative biosynthetic precursor, roridin L2 (RL2), from S. chartarum cultures and (2) compare their relative neurotoxicity in vitro and in vivo. S. chartarum 29-58-17 was cultured in Fernbach flasks on rice (5×105 spores /250g rice) for 4 to 6 weeks. Following extraction with acetonitrile, the extract was dried, dissolved in dichloromethane and subjected to Michel-Miller silica gel chromatography using a stepwise acetonitrile-dichloromethane gradient with SG and RL2 eluting in the 30 and 40% acetonitrile fractions, respectively. Purification of the two compounds was completed by C18 semi-preparative reverse phase liquid chromatography using an acetonitrile-water gradient and purity confirmed by electrospray ionization/collision-induced dissociation (ESI-CID) tandem mass spectroscopy. Although viability significantly decreased in PC-12 neuronal cells treated with 10 to 25 ng/ml of SG, RL2 at concentrations up to 1000 ng/ml were not toxic. Flow cytometry and agarose DNA fragmentation assays revealed that SG at 10 to 25 ng/ml induced apoptotic death in the PC-12 cells while RL2 at concentrations up to 1000 ng/ml were without effect. In similar fashion, intranasal exposure of mice (female B6C3F1) to SG at 100 µg/kg bw induced marked OSN apoptosis and atrophy of the olfactory epithelium whereas RL2 at the equivalent dose did not exhibit toxicity. Taken together, an optimized protocol for production and isolation of trichothecenes from S. chartarum cultures is described and further demonstrates that while the macrocyclic SG was neurotoxic in vitro and in vivo, its biosynthetic precursor, RL2 was non-toxic. PMID:20077192

  19. ASSESSMENT OF STACHYBOTRYS REGROWTH ON CONTAMINATED WALLBOARD AFTER TREATMENT WITH COMMON SURFACE CLEANERS/DISINFECTANTS

    EPA Science Inventory

    The paper describes results of experiments assessing the efficacy of treating mold-contaminated gypsum wallboard with cleaners and/or disinfectants. Although the accepted recommendations for handling Stachybotrys chartarum contaminated gypsum wallboard are removal and replacement...

  20. Comparison of four different methods for extraction of Stachybotrys chartarum spore DNA and verification by real-time PCR.

    PubMed

    Black, J A; Foarde, K K

    2007-07-01

    A comparison of four different methods for the extraction of spore DNA from Stachybotrys chartarum was conducted. Spore DNA was extracted and purified using either one of three different commercial kits or water. All preparations utilized bead milling. Genomic DNA extracted from 10(1) to 10(7) spores was assessed by both agarose gel electrophoresis and real-time quantitative polymerase chain reaction (qPCR) performed against multi-copy (rRNA) and single-(tubulin) gene targets. The spore isolation technique we employed was verified to be pure by light microscopy. Although all preparatory methods led to successful detection by qPCR, S. chartarum spore DNA prepared using the Qiagen Plant kit was notably better over the extraction range.

  1. STACHYBOTRYS CHARTARU Trichothecene Mycotoxins and Damp Building-Related Illness: New Insights into a Public Health Enigma

    EPA Science Inventory

    Damp building-related illnesses (DBRI) include a myriad of respiratory, immunologic, and neurologic symptoms that are sometimes etiologically linked to aberrant indoor growth of the toxic black mold, Stachybotrys chartarum. Although supportive evidence for such linkages is limite...

  2. Biological Responses of Raw 264.7 Macrophage Exposed to Two Strains of Stachybotrys chartarum Spores Grown on Four Different Wallboard Types

    EPA Science Inventory

    The focus of this research was to provide a better understanding of the health impacts caused by Stachybotrys chartarum (Houston and 51-11) spores grown on four gypsum products two of which were resistant to microbes. Raw 264.7 cells were exposed to whole spores and fragmented 51...

  3. Co-cultivation of Streptomyces californicus and Stachybotrys chartarum stimulates the production of cytostatic compound(s) with immunotoxic properties

    SciTech Connect

    Penttinen, Piia . E-mail: Piia.Penttinen@ktl.fi; Pelkonen, Jukka; Huttunen, Kati; Hirvonen, Maija-Riitta

    2006-12-15

    We have recently shown that the actinobacterium Streptomyces californicus and the fungus Stachybotrys chartarum originating from moisture damaged buildings possess both immunotoxic and immunostimulatory characteristics, which are synergistically potentiated by microbial interaction. In the search for the causative agent(s) behind the immunotoxicity, the cytostatic effects of the co-cultivated spores of S. californicus and S. chartarum were compared to those caused by widely used cytostatic agents produced by streptomycetes. The RAW264.7 macrophages were exposed to four doses of doxorubicin (DOX), actinomycin D (AMD), mitomycin C (MMC) or phleomycin (PHLEO) for 24 h. Kinetics of the spores of the co-cultivated and the separately cultivated microbes (1 x 10{sup 6} spores/ml) was compared to DOX (0.15 {mu}M). Apoptotic responses were analyzed by measuring DNA content and mitochondria membrane depolarization with flow cytometer, and by the fluorometric caspase-3 assay. The present data indicate that interactions during co-cultivation of S. californicus and S. chartarum stimulate the production of an unidentified cytostatic compound(s) capable of inducing mitochondria mediated apoptosis and cell cycle arrest at S-G{sub 2}/M. The spores of co-cultivated microbes caused a 4-fold collapse of mitochondrial membrane potential and an almost 6-fold caspase-3 activation and DNA fragmentation when compared to control. Similar responses were induced by DNA cleaving compounds, especially DOX and AMD, at the relatively low concentrations, but not the spores of the same microbes when they were grown separately. These data suggest that when growing in the same habitat, interactions between S. californicus and S. chartarum stimulates the production of an unknown cytostatic compound(s) which evoke immunotoxic effects similar to those by chemotherapeutic drugs.

  4. FACTORS RELATING TO THE RELEASE OF STACHYBOTRYS CHARTARUM SPORES FROM CONTAMINATED SOURCES

    EPA Science Inventory

    The paper describes preliminary results of a research project to determine the factors that control the release of S. chartarum spores from a contaminated source and test ways to reduce spore release and thus exposure. As anticipated, S. chartarum spore emissions from gypsum boar...

  5. Toxigenic diversity of two different RAPD groups of Stachybotrys chartarum isolates analyzed by potential for trichothecene production and for boar sperm cell motility inhibition.

    PubMed

    Peltola, J; Niessen, L; Nielsen, K F; Jarvis, B B; Andersen, B; Salkinoja-Salonen, M; Möller, E M

    2002-11-01

    Thirty-one isolates of Stachybotrys chartarum from indoor and outdoor environments were analyzed for the presence of the trichodiene synthase (Tri5) gene, trichothecenes, boar sperm cell motility inhibition, and randomly amplified polymorphic DNA banding patterns (RAPDs). Twenty-two S. chartarum isolates tested positive for the Tri5 gene and nine were negative when tested using novel Tri5 gene-specific PCR primer pair. The Tri5 gene positive isolates contained satratoxins (five isolates) or the simple trichothecene, trichodermol (11 isolates). The Tri5 gene negative isolates did not produce satratoxins or trichodermol. Nineteen S. chartarum isolates, distributed among the Tri5 gene negative and positive groups, inhibited boar spermatozoan motility at concentrations of < or = 60 microg of crude cell extract/mL. The inhibition of motility was independent of satratoxins or atranones. Unweighted pair group method of arithmetic averages (UPGMA) cluster analysis of RAPD fragments clustered the 31 S. chartarum isolates in two distinct groups designated as RAPD groups 1 and 2. The grouping of S. chartarum isolates obtained by UPGMA cluster analysis of RAPD fragments was identical to the grouping obtained by Tri5 gene-specific PCR. This indicates that the S. chartarum isolates belonging to different groups were genetically distinct in a much wider area than just the Tri5 gene. PMID:12556129

  6. Microbial Volatile Organic Compound Emissions from Stachybotrys chartarum growing on Gypsum Wallboard and Ceiling tile

    EPA Science Inventory

    This study compared seven toxigenic strains of S. chartarum found in water-damaged buildings to characterize the microbial volatile organic compound (MVOC) emissions profile while growing on gypsum wallboard (W) and ceiling tile (C) coupons. The inoculated coupons with their sub...

  7. Co-cultivated damp building related microbes Streptomyces californicus and Stachybotrys chartarum induce immunotoxic and genotoxic responses via oxidative stress.

    PubMed

    Markkanen Penttinen, Piia; Pelkonen, Jukka; Tapanainen, Maija; Mäki-Paakkanen, Jorma; Jalava, Pasi I; Hirvonen, Maija-Riitta

    2009-08-01

    Oxidative stress has been proposed to be one mechanism behind the adverse health outcomes associated with living in a damp indoor environment. In the present study, the capability of damp building-related microbes Streptomyces californicus and Stachybotrys chartarum to induce oxidative stress was evaluated in vitro. In addition, the role of oxidative stress in provoking the detected cytotoxic, genotoxic, and inflammatory responses was studied by inhibiting the production of reactive oxygen species (ROS) using N-acetyl-l-cysteine (NAC). RAW264.7 macrophages were exposed in a dose- and time-dependent manner to the spores of co-cultivated S. californicus and S. chartarum, to their separately cultivated spore-mixture, or to the spores of these microbes alone. The intracellular peroxide production and cytotoxicity were measured by flow cytometric analysis, nitric oxide production was analyzed by the Griess method, DNA damage was determined by the comet assay, and cytokine production was measured by an immunochemical ELISA (enzyme-linked immunosorbent assay). All the studied microbial exposures triggered oxidative stress and subsequent cellular damage in RAW264.7 macrophages. The ROS scavenger, NAC, prevented growth arrest, apoptosis, DNA damage, and cytokine production induced by the co-culture since it reduced the intracellular level of ROS within macrophages. In contrast, the DNA damage and cell cycle arrest induced by the spores of S. californicus alone could not be prevented by NAC. Bioaerosol-induced oxidative stress in macrophages may be an important mechanism behind the frequent respiratory symptoms and diseases suffered by residents of moisture damaged buildings. Furthermore, microbial interactions during co-cultivation stimulate the production of highly toxic compound(s) which may significantly increase oxidative damage. PMID:19459771

  8. Visualization of the structural changes in plywood and gypsum board during the growth of Chaetomium globosum and Stachybotrys chartarum.

    PubMed

    Lewinska, Anna M; Hoof, Jakob B; Peuhkuri, Ruut H; Rode, Carsten; Lilje, Osu; Foley, Matthew; Trimby, Patrick; Andersen, Birgitte

    2016-10-01

    Fungal growth in indoor environments is associated with many negative health effects. Many studies focus on brown- and white-rot fungi and their effect on wood, but there is none that reveals the influence of soft-rot fungi, such as Stachybotrys spp. and Chaetomium spp., on the structure of building materials such as plywood and gypsum wallboard. This study focuses on using micro-computed tomography (microCT) to investigate changes of the structure of plywood and gypsum wallboard during fungal degradation by S. chartarum and C. globosum. Changes in the materials as a result of dampness and fungal growth were determined by measuring porosity and pore shape via microCT. The results show that the composition of the building material influenced the level of penetration by fungi as shown by scanning electron microscopy (SEM). Plywood appeared to be the most affected, with the penetration of moisture and fungi throughout the whole thickness of the sample. Conversely, fungi grew only on the top cardboard in the gypsum wallboard and they did not have significant influence on the gypsum wallboard structure. The majority of the observed changes in gypsum wallboard occurred due to moisture. This paper suggests that the mycelium distribution within building materials and the structural changes, caused by dampness and fungal growth, depend on the type of the material.

  9. Visualization of the structural changes in plywood and gypsum board during the growth of Chaetomium globosum and Stachybotrys chartarum.

    PubMed

    Lewinska, Anna M; Hoof, Jakob B; Peuhkuri, Ruut H; Rode, Carsten; Lilje, Osu; Foley, Matthew; Trimby, Patrick; Andersen, Birgitte

    2016-10-01

    Fungal growth in indoor environments is associated with many negative health effects. Many studies focus on brown- and white-rot fungi and their effect on wood, but there is none that reveals the influence of soft-rot fungi, such as Stachybotrys spp. and Chaetomium spp., on the structure of building materials such as plywood and gypsum wallboard. This study focuses on using micro-computed tomography (microCT) to investigate changes of the structure of plywood and gypsum wallboard during fungal degradation by S. chartarum and C. globosum. Changes in the materials as a result of dampness and fungal growth were determined by measuring porosity and pore shape via microCT. The results show that the composition of the building material influenced the level of penetration by fungi as shown by scanning electron microscopy (SEM). Plywood appeared to be the most affected, with the penetration of moisture and fungi throughout the whole thickness of the sample. Conversely, fungi grew only on the top cardboard in the gypsum wallboard and they did not have significant influence on the gypsum wallboard structure. The majority of the observed changes in gypsum wallboard occurred due to moisture. This paper suggests that the mycelium distribution within building materials and the structural changes, caused by dampness and fungal growth, depend on the type of the material. PMID:27476483

  10. Laboratory research on the efficacy of chlorine dioxide fumigation for the remediation of mold-contaminated buildings--conference paper

    EPA Science Inventory

    The purpose of this project was to determine the efficacy ofCl02 fumigation to inactivate viable mold, mycotoxins, and allergens on building materials. Alternaria alternata, Aspergillus versicolor, Aspergillus Jumigatus, Chaetomium globosum, and Stachybotrys chartarum were indivi...

  11. FR901459, a novel immunosuppressant isolated from Stachybotrys chartarum No. 19392. Taxonomy of the producing organism, fermentation, isolation, physico-chemical properties and biological activities.

    PubMed

    Sakamoto, K; Tsujii, E; Miyauchi, M; Nakanishi, T; Yamashita, M; Shigematsu, N; Tada, T; Izumi, S; Okuhara, M

    1993-12-01

    FR901459, a novel immunosuppressant, has been isolated from the fermentation broth of Stachybotrys chartarum No. 19392. The molecular formula of FR901459 was determined as C62H111N11O13. FR901459 was found to be a member of the cyclosporin family. However, it is structurally distinct from any other cyclosporins discovered so far, in that Leu is present at position 5 instead of Val. FR901459 was capable of prolonging the survival time of skin allografts in rats with one third the potency of cyclosporin A. PMID:8294235

  12. IMMUNOCYTOCHEMICAL LOCALIZATION OF STACHYLYSIN IN STACHYBOTRYS CHARTARUM SPORES AND SPORE-IMPACTED MOUSE AND RAT LUNG TISSUES

    EPA Science Inventory

    Stachylysin is a proteinaceous hemolytic agent that is producted by S. chartarum. Stachylysin was found, using immunohistochemistical and immunocytochemical methods, to be localized in S. chartarum spores/mycelia primarily in the inner wall suggesting that it is constitutively ...

  13. TLR9-Dependent IL-23/IL-17 is Required for the Generation of Stachybotrys chartarum-induced Hypersensitivity Pneumonitis

    PubMed Central

    Bhan, Urvashi; Newstead, Michael J.; Zeng, Xianying; Podsaid, Amy; Goswami, Moloy; Ballinger, Megan N.; Kunkel, Steven L.; Standiford, Theodore J.

    2012-01-01

    Hypersensitivity pneumonitis (HP) is an inflammatory lung disease that develops following repeated exposure to inhaled particulate antigen. Stachybotrys chartarum (SC) is a dimorphic fungus that has been implicated in a number of respiratory illnesses, including HP (1). In this study we have developed a murine model of SC- induced HP that reproduces pathology observed in human HP and hypothesized that TLR9–mediated IL-23/IL-17 responses are required for the generation of granulomatous inflammation induced by inhaled SC. Mice that undergo i.p. sensitization and i.t. challenge with 106 SC spores developed granulomatous inflammation with multinucleate giant cells, accompanied by increased accumulation of T cells. SC sensitization and challenge resulted in robust pulmonary expression of IL-17 and IL-23. SC-mediated granulomatous inflammation required intact IL-23/IL-17 responses and required TLR9, as TLR9−/− mice displayed reduced IL-17 and IL-23 expression in whole lung associated with decreased accumulation of IL-17 expressing CD4+ and γδ T cells. As compared to SC-sensitized dendritic cells (DC) isolated from WT mice, DC isolated from TLR9−/− mice had a reduced ability to produce IL-23 in responses to SC. Moreover, shRNA knockdown of IL-23 in DC abolished IL-17 production from splenocytes in response to antigen challenge. Finally, the i.t. reconstitution of IL-23 in TLR9−/− mice recapitulated the immunopathology observed in WT mice. In conclusion, our studies suggest that TLR9 is critical for development of Th17-mediated granulomatous inflammation in the lung in response to SC. PMID:23180821

  14. TESTING ANTIMICROBIAL PAINT EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Often mold contaminated building materials are not properly removed, some surface cleaning is performed and paint is applied in an attempt to alleviate the problem. The efficacy of antimicrobial paints to eliminate or control mold regrowth on surfaces can easily be tested on non-...

  15. TESTING ANTIMICROBIAL CLEANER EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Reducing occupant exposure to indoor mold growth is the goal of this research, through the efficacy testing of antimicrobial cleaners. Often mold contaminated building materials are not properly removed, but instead surface cleaners are applied in an attempt to alleviate the prob...

  16. Interactions between Streptomyces californicus and Stachybotrys chartarum can induce apoptosis and cell cycle arrest in mouse RAW264.7 macrophages

    SciTech Connect

    Penttinen, Piia . E-mail: Piia.Penttinen@ktl.fi; Pelkonen, Jukka; Huttunen, Kati; Toivola, Mika; Hirvonen, Maija-Riitta

    2005-02-01

    Exposure to complex mixtures of bacteria and fungi in moisture-damaged buildings is a potential cause of inflammatory related symptoms among occupants. The present study assessed interactions between two characteristic moldy house microbes Streptomyces californicus and Stachybotrys chartarum. Differences in cytotoxic and inflammatory responses in mouse (RAW264.7) macrophages were studied after exposure to the spores of co-cultivated microbes, the mixture of separately cultivated spores, and the spores of either of these microbes cultivated alone. The RAW264.7 cells were exposed to six doses (1 x 10{sup 4} to 3 x 10{sup 6} spores/ml) for 24 h, and the time course of the induced responses was evaluated after 4, 8, 16, and 24 h of exposure (1 x 10{sup 6} spores/ml). The cytotoxic potential of the spores was characterized by the MTT test, DNA content analysis, and enzyme assay for caspase-3 activity. The production of cytokines (IL-1{beta}, IL-6, IL-10, TNF{alpha}, and MIP2) was measured immunochemically and nitric oxide by the Griess method. Co-cultivation increased the ability of the spores to cause apoptosis by more than 4-fold and the proportion of RAW264.7 cells at the G{sub 2}/M stage increased nearly 2-fold when compared to the response induced by the mixture of spores. In contrast, co-cultivation decreased significantly the ability of the spores to trigger the production of NO and IL-6 in RAW264.7 cells. In conclusion, these data suggest that co-culture of S. californicus and S. chartarum can result in microbial interactions that significantly potentiate the ability of the spores to cause apoptosis and cell cycle arrest in mammalian cells.

  17. DNA damage, redox changes, and associated stress-inducible signaling events underlying the apoptosis and cytotoxicity in murine alveolar macrophage cell line MH-S by methanol-extracted Stachybotrys chartarum toxins

    SciTech Connect

    Wang Huiyan; Yadav, Jagjit S. . E-mail: Jagjit.Yadav@uc.edu

    2006-08-01

    Spore-extracted toxins of the indoor mold Stachybotrys chartarum (SC) caused cytotoxicity (release of lactate dehydrogenase), inhibition of cell proliferation, and cell death in murine alveolar macrophage cell line MH-S in a dose- and time-dependent manner. Apoptotic cell death, confirmed based on morphological changes, DNA ladder formation, and caspase 3/7 activation, was detectable as early as at 3 h during treatment with a toxin concentration of 1 spore equivalent/macrophage and was preceded by DNA damage beginning at 15 min, as evidenced by DNA comet formation in single cell gel electrophoresis assay. The apoptotic dose of SC toxins did not induce detectable nitric oxide and pro-inflammatory cytokines (IL-1{beta}, IL-6, and TNF-{alpha}) but showed exacerbated cytotoxicity in presence of a non-apoptotic dose of the known pro-inflammatory agent LPS (10 ng/ml). Intracellular reduced glutathione (GSH) level showed a significant decrease beginning at 9 h of the toxin treatment whereas oxidized glutathione (GSSG) showed a corresponding significant increase, indicating a delayed onset of oxidative stress in the apoptosis process. The toxin-treated macrophages accumulated p53, an indicator of DNA damage response, and showed activation of the stress-inducible MAP kinases, JNK, and p38, in a time-dependent manner. Chemical blocking of either p38 or p53 inhibited in part the SC toxin-induced apoptosis whereas blocking of JNK did not show any such effect. This study constitutes the first report on induction of DNA damage and associated p53 activation by SC toxins, and demonstrates the involvement of p38- and p53-mediated signaling events in SC toxin-induced apoptosis of alveolar macrophages.

  18. EMISSION EXPOSURE MODEL FOR TRANSPORT OF TOXIC MOLD

    EPA Science Inventory

    The paper presents the results of a study of the release of Stachybotrys chartarum spores from contaminated gypsum wallboard and of tests on the effects of environmental conditions on the release of viable and non-viable spores and fragments. Biocontaminants such as mold spores a...

  19. Production and characterization of IgM monoclonal antibodies against hyphal antigens of Stachybotrys species

    EPA Science Inventory

    Stachybotrys is a hydrophilic fungal genus that is well known for its ability to colonize water-damaged building materials in indoor environments. Personal exposure to Stachybotrys chartarum allergens, mycotoxins, cytolytic peptides, and other immunostimulatory macromolecules has...

  20. Patterns of volatile metabolites and nonvolatile trichothecenes produced by isolates of Stachybotrys, Fusarium, Trichoderma, Trichothecium and Memnoniella.

    PubMed

    Wilkins, Ken; Nielsen, Kristian Fog; Din, Sla Ud

    2003-01-01

    We reported previously that trichodiene, a volatile trichothecene derivative, was produced by a Stachybotrys isolate, also known to produce highly cytotoxic, non-volatile, macrocyclic trichothecenes (satrotoxins). We investigated the relationship between the production of trichodiene and various non-volatile trichothecenes for several molds. Volatile metabolites were concentrated by adsorption on Tenax TA and analyzed by GC/MS, while non-volatile metabolites were separated by HPLC, derivatized and analyzed by GC/MS. Stachybotrys chartarum isolates producing macrocyclic trichothecenes secreted significantly larger amounts of trichodiene and other sesquiterpenes than isolates which only produced simple trichothecenes. The amounts of secreted trichodiene were relatively small in all cases. With the exception of Memnoniella, which excreted small amounts of sesquiterpenes, the other isolates produced varying amounts of sesquiterpenes, including trichodiene, as well as simple tricothecenes, no detectable trichodiene, but large amounts of griseofulvin derivatives. In Stachybotrys there is apparently a correlation between trichodiene and macrocyclic trichothecene production. In the remaining isolates, there was no simple relationship between trichodiene and non-volatile trichothecene synthesis. Trichodiene is produced in larger amounts by Stachybotrys isolates, which also produce satratoxins, but it will be difficult to utilize this metabolite to detect toxic isolates in buildings due to the relatively small amounts excreted. PMID:12846376

  1. Differentiation of Toxic Molds via Headspace SPME-GC/MS and Canine Detection

    PubMed Central

    Griffith, Robert T.; Jayachandran, Krishnaswamy; Shetty, Kateel G.; Whitstine, William; Furton, Kenneth G.

    2007-01-01

    Indoor mold growth has recently become a concern in the legal world in regards to insurance litigation. Hazardous mold exposure to humans has been linked to many acute and chronic adverse health effects including death. As it grows, mold produces several types of primary and secondary metabolites, including microbial volatile organic compounds (MVOCs). Microbial volatile organic compound emission may be used as a preliminary indication of a mold infestation that is invisible to the unaided eye. The objective of the study is to identify the unique odor signatures of three species of molds, Aspergillus versicolor, Penicillium chrysogenum, and Stachybotrys chartarum by SPME-GC/MS analysis. Determining the compounds that are emitted by the selected species has made it possible to conduct validation studies of canine detection of these mold species through a series of field tests.

  2. Mold growth on gypsum wallboard--a summary of three techniques.

    PubMed

    Menetrez, M Y; Foarde, K K; Webber, T D; Dean, T R; Betancourt, D A

    2009-01-01

    Reducing occupant exposure to mold growing on damp gypsum wallboard and controlling mold contamination in the indoor environment was studied through 1) delineation of environmental conditions required to promote and avoid mold growth and 2) efficacy testing of antimicrobial products, specifically cleaners and paints, on gypsum wallboard (GWB) surfaces. The effects of moisture and relative humidity (RH) on mold growth and transport are important in avoiding and eliminating problems. These effects have been demonstrated on GWB and are discussed in this article for use as control guidance. The authors discuss the efficacy of antimicrobial cleaners and paints to remove, eliminate, or control mold growth on GWB. Research to control Stachybotrys chartarum growth using 13 separate antimicrobial cleaners and nine varieties of antimicrobial paint on contaminated GWB was performed in laboratory testing. GWB surfaces were subjected to high RH. GWB control measures are summarized and combined, and the antimicrobial product results are explained.

  3. Epidemics of mold poisoning past and present.

    PubMed

    Meggs, William J

    2009-01-01

    Molds are ubiquitous throughout the biosphere of planet earth and cause infectious, allergic, and toxic diseases. Toxic diseases arise from exposure to mycotoxins produced by molds. Throughout history, there have been a number of toxic epidemics associated with exposure to mycotoxins. Acute epidemics of ergotism are caused by consumption of grain infested by fungi of the genus Claviceps, which produce the bioactive amine ergotamine that mimics the neurotransmitters norepinephrine, serotonin, and dopamine. Acute aflatoxin outbreaks have occurred from ingestion of corn stored in damp conditions that potentiate growth of the molds of the species Aspergillus. Contemporary construction methods that use cellulose substrates such as fiber board and indoor moisture have caused an outbreak of contaminated buildings with Stachybotrys chartarum, with the extent of health effects still a subject of debate and ongoing research. This article reviews several of the more prominent epidemics and discusses the nature of the toxins. Two diseases that were leading causes of childhood mortality in England in the 1970s and vanished with changing dietary habits, putrid malignant fever, and slow nervous fever were most likely toxic mold epidemics. PMID:19808743

  4. Mold remediation in a hospital.

    PubMed

    Lee, Tang G

    2009-01-01

    As occupants in a hospital, patients are susceptible to air contaminants that can include biological agents dispersed throughout the premise. An exposed patient can become ill and require medical intervention. A consideration for patients is that they may have become environmentally sensitive and require placement in an environment that does not compromise their health. Unfortunately, the hospital environment often contains more biological substances than can be expected in an office or home environment. When a hospital also experiences water intrusion such as flooding or water leaks, resulting mold growth can seriously compromise the health of patients and others such as nursing staff and physicians (Burge, Indoor Air and Infectious Disease. Occupational Medicine: State of the Art Reviews, 1980; Lutz et al., Clinical Infectious Diseases 37: 786-793, 2003). Micro-organism growth can propagate if the water is not addressed quickly and effectively. Immunocompromised patients are particularly at risk when subjected to fungal infection such that the US Center for Disease Control issued guideline for building mold in health care facilities (Centers for Disease and Control [CDC], Centers for Disease and Control: Questions and Answers on Stachybotrys chartarum and Other Molds, 2000). This paper is based on mold remediation of one portion of a hospital unit due to water from construction activity and inadequate maintenance, resulting in mold growth. A large proportion of the hospital staff, primarily nurses in the dialysis unit, exhibited health symptoms consistent with mold exposure. Unfortunately, the hospital administrators did not consider the mold risk to be serious and refused an independent consultant retained by the nurse's union to examine the premise (Canadian Broadcasting Corporation [CBC], Nurses file complaints over mold at Foothills. Canadian Broadcasting Corporation, 2003). The nurse's union managed to have the premise examined by submitting a court order of

  5. Environmental Mold and Mycotoxin Exposures Elicit Specific Cytokine and Chemokine Responses

    PubMed Central

    Rosenblum Lichtenstein, Jamie H.; Hsu, Yi-Hsiang; Gavin, Igor M.; Donaghey, Thomas C.; Molina, Ramon M.; Thompson, Khristy J.; Chi, Chih-Lin; Gillis, Bruce S.; Brain, Joseph D.

    2015-01-01

    Background Molds can cause respiratory symptoms and asthma. We sought to use isolated peripheral blood mononuclear cells (PBMCs) to understand changes in cytokine and chemokine levels in response to mold and mycotoxin exposures and to link these levels with respiratory symptoms in humans. We did this by utilizing an ex vivo assay approach to differentiate mold-exposed patients and unexposed controls. While circulating plasma chemokine and cytokine levels from these two groups might be similar, we hypothesized that by challenging their isolated white blood cells with mold or mold extracts, we would see a differential chemokine and cytokine release. Methods and Findings Peripheral blood mononuclear cells (PBMCs) were isolated from blood from 33 patients with a history of mold exposures and from 17 controls. Cultured PBMCs were incubated with the most prominent Stachybotrys chartarum mycotoxin, satratoxin G, or with aqueous mold extract, ionomycin, or media, each with or without PMA. Additional PBMCs were exposed to spores of Aspergillus niger, Cladosporium herbarum and Penicillium chrysogenum. After 18 hours, cytokines and chemokines released into the culture medium were measured by multiplex assay. Clinical histories, physical examinations and pulmonary function tests were also conducted. After ex vivo PBMC exposures to molds or mycotoxins, the chemokine and cytokine profiles from patients with a history of mold exposure were significantly different from those of unexposed controls. In contrast, biomarker profiles from cells exposed to media alone showed no difference between the patients and controls. Conclusions These findings demonstrate that chronic mold exposures induced changes in inflammatory and immune system responses to specific mold and mycotoxin challenges. These responses can differentiate mold-exposed patients from unexposed controls. This strategy may be a powerful approach to document immune system responsiveness to molds and other inflammation

  6. Molds, mycotoxins, and sick building syndrome.

    PubMed

    Straus, David C

    2009-01-01

    The following is a review of some of the work we have done since 2004 regarding the importance of molds and their mycotoxins in the phenomenon of sick building syndrome (SBS). In these studies we showed that the macrocyclic trichothecene mycotoxins (MTM) of Stachybotrys chartarum (SC) are easily dissociated from the surface of the organism as it grows and could therefore be consequently spread in buildings as the fungus experiences additional water events. We then showed that SC and Penicillium chrysogenum (PC) colonies remain viable long after a water source has been removed, and the MTM produced by SC remain toxic over extended periods of time. We next showed that PC when inhaled, can release in vivo, a protease allergen that can cause a significant allergic inflammatory reaction in the lungs of mice. We then showed, in a laboratory study, that the MTM of SC can become airborne attached to spores or SC particulates smaller than spores. Following that study, we next showed that the same phenomenon actually occurred in SC infested buildings where people were complaining of health problems potentially associated with SBS. Finally, we were able to demonstrate the presence of MTM in the sera of individuals who had been exposed to SC in indoor environments. This last study was done with enough mold exposed individuals to allow for the statistical significance of SC exposure to be evaluated. PMID:19854820

  7. Quantifying Mold Biomass on Gypsum Board: Comparison of Ergosterol and Beta-N-Acetylhexosaminidase as Mold Biomass Parameters

    PubMed Central

    Reeslev, M.; Miller, M.; Nielsen, K. F.

    2003-01-01

    Two mold species, Stachybotrys chartarum and Aspergillus versicolor, were inoculated onto agar overlaid with cellophane, allowing determination of a direct measurement of biomass density by weighing. Biomass density, ergosterol content, and beta-N-acetylhexosaminidase (3.2.1.52) activity were monitored from inoculation to stationary phase. Regression analysis showed a good linear correlation to biomass density for both ergosterol content and beta-N-acetylhexosaminidase activity. The same two mold species were inoculated onto wallpapered gypsum board, from which a direct biomass measurement was not possible. Growth was measured as an increase in ergosterol content and beta-N-acetylhexosaminidase activity. A good linear correlation was seen between ergosterol content and beta-N-acetylhexosaminidase activity. From the experiments performed on agar medium, conversion factors (CFs) for estimating biomass density from ergosterol content and beta-N-acetylhexosaminidase activity were determined. The CFs were used to estimate the biomass density of the molds grown on gypsum board. The biomass densities estimated from ergosterol content and beta-N-acetylhexosaminidase activity data gave similar results, showing significantly slower growth and lower stationary-phase biomass density on gypsum board than on agar. PMID:12839773

  8. A multi-gene phylogeny for Stachybotrys evidences lack of trichodiene synthase (tri5) gene for isolates of one of three intrageneric lineages.

    PubMed

    Koster, Brenda; Wong, Bess; Straus, Neil; Malloch, David

    2009-08-01

    Members of the mitosporic fungal form-genus Stachybotrys, including common indoor contaminants Stachybotrys chartarum, Stachybotrys echinata and Stachybotrys chlorohalonata, are capable of producing potent, protein synthesis-inhibiting, trichothecene mycotoxins. A combined multi-gene approach was used to investigate relationships among species of Stachybotrys against which the presence/absence of the trichothecene biosynthetic pathway gene, trichodiene synthase (tri5), was evaluated. Phylogenetic analyses partitioned species of Stachybotrys into three strongly supported lineages, two of which contained common indoor taxa. No tri5 PCR product was amplified from members of the third clade, which included the only member of the group with a known sexual state, Stachybotrys albipes. Isolates grouped with S. albipes also tested negative for tri5 in Southern analyses. The phylogenetic distribution of tri5 was consistent with known toxin production for the group. For isolates with tri5 product, Bayesian analysis suggested that signal from amino acid determining sites conflicted with the combined phylogeny. Incongruence however, was not supported by either SH-test results or maximum likelihood analyses. Moreover, sites rates analysis showed that tri5 was highly conserved at the amino acid level suggesting that identity at variable sites, among otherwise divergent taxa, might be the result of chance events. PMID:19422915

  9. Molds

    MedlinePlus

    Molds are fungi that can be found both outdoors and indoors. They grow best in warm, damp and humid conditions. If ... spots in your house, you will probably get mold. Molds can cause health problems. Inhaling or touching ...

  10. Health symptoms caused by molds in a courthouse.

    PubMed

    Lee, Tang G

    2003-07-01

    A majority of occupants of a newly renovated historic courthouse in Calgary, Alberta, Canada, reported multiple (3 or more) health-related symptoms, and several reported more than 10 persistent symptoms. Most required at least 1 day outside of the building to recover from their symptoms. Molds that produce mycotoxins, such as Stachybotrys chartarum and Emericella nidulans, were identified in the building, along with fungal organisms of the genera Aspergillus, Penicillium, Streptomyces, Cladosporium, Chaetomium, Rhizopus/Mucor, Alternaria, Ulocladium, and Basidiomycetes. Renovations to this historic had building failed to provide adequate thermal and vapor barriers, thus allowing moist indoor air to migrate into the building enclosure, causing condensation to develop. Mold grew on the condensation and was dispersed throughout the courthouse, including on furniture and files. The courthouse was closed and a new facility was modified with low-offgassing materials, better ventilation and air filtration, and strict building maintenance to accommodate those occupants of the older building who had developed multiple chemical sensitivities.

  11. Adverse human health effects associated with molds in the indoor environment.

    PubMed

    Hardin, Bryan D; Kelman, Bruce J; Saxon, Andrew

    2003-05-01

    inhalation exposure to fungi, bacteria, and other organic matter, usually in industrial or agricultural settings. Molds growing indoors are believed by some to cause building-related symptoms. Despite a voluminous literature on the subject, the causal association remains weak and unproven, particularly with respect to causation by mycotoxins. One mold in particular, Stachybotrys chartarum, is blamed for a diverse array of maladies when it is found indoors. Despite its well-known ability to produce mycotoxins under appropriate growth conditions, years of intensive study have failed to establish exposure to S. chartarum in home, school, or office environments as a cause of adverse human health effects. Levels of exposure in the indoor environment, dose-response data in animals, and dose-rate considerations suggest that delivery by the inhalation route of a toxic dose of mycotoxins in the indoor environment is highly unlikely at best, even for the hypothetically most vulnerable subpopulations. Mold spores are present in all indoor environments and cannot be eliminated from them. Normal building materials and furnishings provide ample nutrition for many species of molds, but they can grow and amplify indoors only when there is an adequate supply of moisture. Where mold grows indoors there is an inappropriate source of water that must be corrected before remediation of the mold colonization can succeed. Mold growth in the home, school, or office environment should not be tolerated because mold physically destroys the building materials on which it grows, mold growth is unsightly and may produce offensive odors, and mold is likely to sensitize and produce allergic responses in allergic individuals. Except for persons with severely impaired immune systems, indoor mold is not a source of fungal infections. Current scientific evidence does not support the proposition that human health has been adversely affected by inhaled mycotoxins in home, school, or office environments.

  12. Brainstem auditory evoked response in adolescents with acoustic mycotic neuroma due to environmental exposure to toxic molds.

    PubMed

    Anyanwu, Ebere; Campbell, Andrew W; High, William

    2002-01-01

    Indoor air contamination with toxic opportunistic molds is an emerging health risk worldwide. Some of the opportunistic molds include: Stachybotrys chartarum, Aspergillus species (A. fumigatus, A. flavus, A. niger, A. versicolor etc.), Cadosporium, Alternaria, Penicillium, Trichoderma, Fusarium graminearum etc. These molds flourish in homes that are moist and damp. Reports of floods are now evident in many parts of the world. With these global changes in climatic conditions that favor the opportunistic mode of living among these molds, some health authorities are beginning to feel concerned about the diversity and the extent to which opportunistic molds can cause adverse health effects in humans. Mycotoxicosis is the collective name for all the diseases caused by toxic molds. Frequently, we have cases of acoustic neuroma due to mycotoxicity in our Center. Mycotic neuroma probably has not been reported before and the application of brainstem auditory evoked response (BAER) techniques in acoustic mycotic neuroma have not been reported either. The aim of this study, therefore, was to report cases and measurements of acoustic mycotic neuroma in adolescents using the brainstem auditory evoked response. The patients' case history, clinical neurological and neurobehavioral questionnaires were assessed. Then, the BAERs were recorded between Cz and Ai, with a second channel, Cz-Ac. The case histories and the questionnaires were analyzed in conjunction with the outcome of the objective brainstem auditory evoked response measurements. The prevalent subjective findings in the patients were headaches, memory loss, hearing loss, lack of concentration, fatigue, sleep disturbance, facial swelling, rashes, nosebleeds, diarrhea, abdominal pains and respiratory difficulties. Objective BAER showed overall abnormalities in all the patients. Although the waveform abnormalities varied, 1-3 interpeak latencies were abnormal in all the patients. Overall results showed the presence of

  13. Mold Allergy

    MedlinePlus

    ... navigation Home ▸ Conditions & Treatments ▸ Allergies ▸ Mold Allergy Share | Mold Allergy Overview Symptoms & Diagnosis Treatment & Management Mold Allergy Overview Molds are tiny fungi whose spores ...

  14. Mold Allergy

    MedlinePlus

    ... the Allergist Health Professionals Partners Media Donate Allergies Mold Allergy What Is a Mold Allergy? If you have an allergy that occurs ... or basement. What Are the Symptoms of a Mold Allergy? The symptoms of mold allergy are very ...

  15. Prototheca species and Pithomyces chartarum as Causative Agents of Rhinitis and/or Sinusitis in Horses.

    PubMed

    Schöniger, S; Roschanski, N; Rösler, U; Vidovic, A; Nowak, M; Dietz, O; Wittenbrink, M M; Schoon, H-A

    2016-01-01

    Pyogranulomatous rhinitis associated with an algal infection was diagnosed in a 25-year-old gelding and a 23-year-old mare had necrotizing sinusitis with intralesional algae and pigmented fungi. Algae were identified immunohistochemically in both cases as Prototheca spp. In the gelding, further characterization by polymerase chain reaction and sequencing revealed that the organism was Prototheca zopfii genotype 2. Fungi from the mare were identified as Pithomyces chartarum by molecular analysis. Prototheca species are achlorophyllous algae and P. chartarum represents a dematiaceous fungus; they are saprophytes and facultative pathogens. Prototheca spp. and P. chartarum should be considered as rare respiratory pathogens of horses. PMID:27394651

  16. MOLDING APPARATUS

    DOEpatents

    Fleming, P.G.

    1963-10-01

    Molding apparatus capable of coating multiple elements each molding cycle is described. The apparatus comprises a centrally disposed reservoir penetrated by a plurality of circumferentially arranged and radially extending passageways. These passageways, in turn, communicate with passages in a separable annular member that retains selectively configured molds and mold seating arrangements. Each mold, which is readily removable from its respective seat, is adapted to retain an element therein in spaced relation to the interior of the mold by utilizing element positioning means within the mold seat and the mold so that coating material may flow about the entire outer surface of the element. (AEC)

  17. ELISA MEASUREMENT FOR STACHYLYSIN

    EPA Science Inventory

    The consumption of food commodities contaminated with the mold, Stachybotrys charatrum, has a long history of causing severe illness, and even death, in humans and animals. More recently, negative health effects have been linked to indoor inhalation exposures to S. chartarum. F...

  18. Prevalence and airborne spore levels of Stachybotrys spp. in 200 houses with water incursions in Houston, Texas.

    PubMed

    Kuhn, Ryan C; Trimble, Mingyi W; Hofer, Vasanthi; Lee, Michael; Nassof, Russell S

    2005-01-01

    Two hundred homes with a history of water incursion were sampled for fungi to determine the prevalence and airborne spore levels of Stachybotrys spp. Sampling methods included room air, surface, and wall cavity air sampling. Stachybotrys spp. were detected with at least one of the methods in 58.5% of the houses tested, but only 9.6% of the room air samples contained Stachybotrys spores. Aerosolization of Stachybotrys spores was correlated with both wall cavity and surface contamination. However, after adjustment for the surface effect, Stachybotrys spores detected in wall cavities were not a significant factor contributing to spores detected in room air samples. We conclude that Stachybotrys spp. are commonly found on water-damaged building materials. In addition, the observations made in this study suggest that the impact on the living space air is low if the fungal spores are contained within a wall cavity.

  19. The Effect of Spaceflight on Growth of Ulocladium chartarum Colonies on the International Space Station

    PubMed Central

    Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

    2013-01-01

    The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions. PMID:23637980

  20. The effect of spaceflight on growth of Ulocladium chartarum colonies on the international space station.

    PubMed

    Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

    2013-01-01

    The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions.

  1. DETECTION OF STACHYBOTRYS CHARTARUM USING rRNA, tri5, AND Β-TUBULIN PRIMERS AND DETERMINING THEIR RELATIVE COPY NUMBER BY REAL TIME PCR

    EPA Science Inventory

    This research utilizes the quantitative polymerase chain reaction (qPCR) to determine ribosomal copy number of fungal organisms found in unhealthy indoor environments. Knowing specific copy numbers will allow for greater accuracy in quantification when utilizing current pQCR tec...

  2. ) Mold Fluxes

    NASA Astrophysics Data System (ADS)

    Seo, Myung-Duk; Shi, Cheng-Bin; Cho, Jung-Wook; Kim, Seon-Hyo

    2014-10-01

    The effects of basicity (CaO/SiO2), B2O3, and Li2O addition on the crystallization behaviors of lime-silica-based mold fluxes have been investigated by non-isothermal differential scanning calorimetry (DSC), field emission scanning electron microscopy, X-ray diffraction (XRD), and single hot thermocouple technique. It was found that the crystallization temperature of cuspidine increased with increasing the basicity of mold fluxes. The crystallization of wollastonite was suppressed with increasing the mold flux basicity due to the enhancement of cuspidine crystallization. The addition of B2O3 suppresses the crystallization of mold flux. The crystallization temperature of mold flux decreases with Li2O addition. The size of cuspidine increases, while the number of cuspidine decreases with increasing mold flux basicity. The morphology of cuspidine in mold fluxes with lower basicity is largely dendritic. The dendritic cuspidine in mold fluxes is composed of many fine cuspidine crystals. On the contrary, in mold fluxes with higher basicity, the cuspidine crystals are larger in size with mainly faceted morphology. The crystalline phase evolution was also calculated using a thermodynamic database, and compared with the experimental results determined by DSC and XRD. The results of thermodynamic calculation of crystalline phase formation are in accordance with the results determined by DSC and XRD.

  3. Mold Charlatans.

    ERIC Educational Resources Information Center

    Woody, Daniel

    2002-01-01

    Offers a primer on toxic mold and its removal, warning against ignorant or unethical mold remediation companies and offering five considerations (checking references, considering the big picture, sampling more than the air, considering release, and considering the source) when hiring such services. (EV)

  4. MOLD POLLUTION

    EPA Science Inventory

    Mold pollution is the growth of molds in a building resulting in a negative impact on the use of that structure. The negative impacts generally fall into two categories: destruction of the structure itself and adverse health impacts on the building's occupants. It is estimated...

  5. Identification of a novel fungus, Leptosphaerulina chartarum SJTU59 and characterization of its xylanolytic enzymes.

    PubMed

    Wu, Qiong; Li, Yaqian; Li, Yingying; Gao, Shigang; Wang, Meng; Zhang, Tailong; Chen, Jie

    2013-01-01

    Xylanolytic enzymes are widely used in processing industries, e.g., pulp and paper, food, livestock feeds, and textile. Furthermore, certain xylanotic enzymes have demonstrated the capability to improve the resistance and immunity of plants. Screening of high-yield microbial xylanolytic enzyme producers is significant for improving large-scale cost-effective xylanolytic enzyme production. This study provided new evidence of high-level xylanolytic enzyme production by a novel fungus, designated Leptosphaerulina chartarum SJTU59. Under laboratory conditions, L. chartarum SJTU59 produced xylanolytic enzymes of up to 17.566 U/mL (i.e., 878.307 U/g substrate). The enzyme solution was relatively stable over a wide range of pH (pH 3.0 to pH 9.0) and temperature (40°C to 65°C) while showing high resistance to the majority of metal ions tested. Composition analysis of the hydrolytic products of xylan showed sufficient degradation by xylanolytic enzymes from L. chartarum SJTU59, mainly the monosaccharide xylose, and a small amount of xylobiose were enzymatically produced; whereas in the presence of sufficient xylan substrates, mainly xylooligosaccharides, an emerging prebiotic used in food industry, were produced. In addition, the xylanolytic enzyme preparation from L. chartarum SJTU59 could initiate tissue necrosis and oxidative burst in tobacco leaves, which may be related to enhanced plant defense to adversity and disease. L. chartarum SJTU59 possessed a complex xylanolytic enzyme system, from which two novel endo-β-1,4-xylanases of the glycoside hydrolase (GH) family 10, one novel endo-β-1,4-xylanase of the GH family 11, and one novel β-xylosidase of the GH family 43 were obtained via rapid amplification of complementary DNA ends. Given the high yield and stable properties of xylanolytic enzymes produced by L. chartarum SJTU59, future studies will be conducted to characterize the properties of individual xylanolytic enzymes from L. chartarum SJTU59. xylanolytic

  6. Identification of a Novel Fungus, Leptosphaerulina chartarum SJTU59 and Characterization of Its Xylanolytic Enzymes

    PubMed Central

    Wu, Qiong; Li, Yaqian; Li, Yingying; Gao, Shigang; Wang, Meng; Zhang, Tailong; Chen, Jie

    2013-01-01

    Xylanolytic enzymes are widely used in processing industries, e.g., pulp and paper, food, livestock feeds, and textile. Furthermore, certain xylanotic enzymes have demonstrated the capability to improve the resistance and immunity of plants. Screening of high-yield microbial xylanolytic enzyme producers is significant for improving large-scale cost-effective xylanolytic enzyme production. This study provided new evidence of high-level xylanolytic enzyme production by a novel fungus, designated Leptosphaerulina chartarum SJTU59. Under laboratory conditions, L. chartarum SJTU59 produced xylanolytic enzymes of up to 17.566 U/mL (i.e., 878.307 U/g substrate). The enzyme solution was relatively stable over a wide range of pH (pH 3.0 to pH 9.0) and temperature (40°C to 65°C) while showing high resistance to the majority of metal ions tested. Composition analysis of the hydrolytic products of xylan showed sufficient degradation by xylanolytic enzymes from L. chartarum SJTU59, mainly the monosaccharide xylose, and a small amount of xylobiose were enzymatically produced; whereas in the presence of sufficient xylan substrates, mainly xylooligosaccharides, an emerging prebiotic used in food industry, were produced. In addition, the xylanolytic enzyme preparation from L. chartarum SJTU59 could initiate tissue necrosis and oxidative burst in tobacco leaves, which may be related to enhanced plant defense to adversity and disease. L. chartarum SJTU59 possessed a complex xylanolytic enzyme system, from which two novel endo-β-1,4-xylanases of the glycoside hydrolase (GH) family 10, one novel endo-β-1,4-xylanase of the GH family 11, and one novel β-xylosidase of the GH family 43 were obtained via rapid amplification of complementary DNA ends. Given the high yield and stable properties of xylanolytic enzymes produced by L. chartarum SJTU59, future studies will be conducted to characterize the properties of individual xylanolytic enzymes from L. chartarum SJTU59. xylanolytic

  7. The role of Stachybotrys mycotoxins in building-related illness.

    PubMed

    Page, E H; Trout, D B

    2001-01-01

    Recently there has been increased attention among both the public and health professionals regarding the potential role of mycotoxins, primarily from fungi of the genus Stachybotrys, as etiologic agents related to illness among persons exposed in the indoor (nonindustrial) environment. Recommendations for the remediation of buildings are being made based in part on reported health effects believed to be due to mycotoxins. A search of NIOSHTIC (a literature database maintained by the National Institute for Occupational Safety and Health) and MEDLINE (from 1965 to present) for literature related to fungi, mycotoxins, and the indoor environment was conducted. References from relevant articles also were reviewed. This strategy yielded a total of 13 articles. Important issues concerning exposure assessment and case definitions are inadequately addressed in the literature reviewed, making it difficult to implicate mycotoxins as a cause of building-related illness. The literature review indicates that currently there is inadequate evidence supporting a causal relationship between symptoms or illness among building occupants and exposure to mycotoxins. Research involving the identification and isolation of specific fungal toxins in the environment and in humans is needed before a more definitive link between health outcomes and mycotoxins can be made.

  8. Allergies, asthma, and molds

    MedlinePlus

    Reactive airway - mold; Bronchial asthma - mold; Triggers - mold; Allergic rhinitis - pollen ... Things that make allergies or asthma worse are called triggers. Mold is a common trigger. When your asthma or allergies become worse due to mold, you are ...

  9. Trichothecene mycotoxins in aerosolized conidia of Stachybotrys atra.

    PubMed Central

    Sorenson, W G; Frazer, D G; Jarvis, B B; Simpson, J; Robinson, V A

    1987-01-01

    Stachybotrys atra is the etiologic agent of stachybotryotoxicosis, and this fungus and its trichothecene mycotoxins were recently implicated in an outbreak of unexplained illness in homes. S. atra was grown on sterile rice, autoclaved, dried, and then aerosolized by acoustic vibration. The distribution of particles (mass and number) was monitored on an aerodynamic particle sizer interfaced with a computer. Dust was collected on preweighed glass-fiber filters and extracted with 90% aqueous methanol. Extracts were tested for the ability to inhibit protein synthesis in rat alveolar macrophages, the ability to inhibit the proliferation of mouse thymocytes, and the presence of specific trichothecene mycotoxins. Virtually all of the particles were less than 15 micron in aerodynamic diameter, and the mass median diameter was 5 micron. Thus, most of the particles were respirable. Microscopic analysis of the generated dust revealed that ca. 85% of the dust particles were conidia of S. atra, another 6% were hyphal fragments, and the remainder of the particles were unidentifiable. Thus, greater than 90% of the particles were of fungal origin. The extracts strongly inhibited protein synthesis and thymocyte proliferation. Purified satratoxin H was also highly toxic in the same systems. Each of the individual filters contained satratoxin H (average, 9.5 ng/mg of dust). Satratoxin G and trichoverrols A and B were found in lesser amounts in some, but not all, of the filters. The limit of analysis is ca. 50 ng. These results establish that the conidia of S. atra contain trichothecene mycotoxins. In view of the potent toxicity of the trichothecenes, the inhalation of aerosols containing high concentrations of these conidia could be a potential hazard to health. PMID:3496850

  10. INGOT MOLD

    DOEpatents

    Mangold, A.J. Jr.; MaHaffey, J.W.; Reese, S.L.

    1958-04-29

    An improved ingot-mold assembly is described, consisting of a body having a cavity and a recess extending through to the bottom of the body from the cavity, and the bottom of the cavity having an internal shoulder extending downward and a plug having an external shoulder. The plug extends above the shoulders and below the bottom of the body.

  11. [Photosensitization in cattle grazing on pastures of Brahciaria decumbens Stapf infested with Pithomyces chartarum (Berk. & Curt.) M.B. Ellis].

    PubMed

    Andrade, S O; da Silva Lopes, H O; de Almeida Barros, M; Leite, G G; Dias, S M; Saueressig, M; Nobre, D; Temperini, J A

    1978-01-01

    Aspects of photosensitization in bovines grazing on pastures of Brachiaria decumbens Stapf infested with Pithomyces chartarum (Berk. & Curt.) M.B. Ellis infested all pastures 45(2):117-136, 1978. This paper reports experimental studies on photosensitization in bovines grazing on different pastures of Brachiaria decumbens Stapf in the "Cerrados" region (Planaltina, DF). Climatic conditions, zinc content and occurence of fungi on pastures were investigated. Pithomyces chartarum (Berk. & Curt.) M.B. Ellis infested all pastures examined. Photosensitization was observed in one animal maintained on a pasture of B. decumbens formed with seeds from Australia. Clinical and necropsy data were similar to those related in literature for sporidesmin-intoxicated animals. An isolate of P. chartarum and samples of bovine bile were assayed for sporidesmin presence.

  12. [Photosensitization in cattle grazing on pastures of Brahciaria decumbens Stapf infested with Pithomyces chartarum (Berk. & Curt.) M.B. Ellis].

    PubMed

    Andrade, S O; da Silva Lopes, H O; de Almeida Barros, M; Leite, G G; Dias, S M; Saueressig, M; Nobre, D; Temperini, J A

    1978-01-01

    Aspects of photosensitization in bovines grazing on pastures of Brachiaria decumbens Stapf infested with Pithomyces chartarum (Berk. & Curt.) M.B. Ellis infested all pastures 45(2):117-136, 1978. This paper reports experimental studies on photosensitization in bovines grazing on different pastures of Brachiaria decumbens Stapf in the "Cerrados" region (Planaltina, DF). Climatic conditions, zinc content and occurence of fungi on pastures were investigated. Pithomyces chartarum (Berk. & Curt.) M.B. Ellis infested all pastures examined. Photosensitization was observed in one animal maintained on a pasture of B. decumbens formed with seeds from Australia. Clinical and necropsy data were similar to those related in literature for sporidesmin-intoxicated animals. An isolate of P. chartarum and samples of bovine bile were assayed for sporidesmin presence. PMID:573108

  13. Identification of signatory secondary metabolites during mycoparasitism of Rhizoctonia solani by Stachybotrys elegans.

    PubMed

    Chamoun, Rony; Aliferis, Konstantinos A; Jabaji, Suha

    2015-01-01

    Stachybotrys elegans is able to parasitize the fungal plant pathogen Rhizoctonia solani AG-3 following a complex and intimate interaction, which, among others, includes the production of cell wall-degrading enzymes, intracellular colonization, and expression of pathogenic process encoding genes. However, information on the metabolome level is non-existent during mycoparasitism. Here, we performed a direct-infusion mass spectrometry (DIMS) metabolomics analysis using an LTQ Orbitrap analyzer in order to detect changes in the profiles of induced secondary metabolites of both partners during this mycoparasitic interaction 4 and 5 days following its establishment. The diketopiperazine(s) (DKPs) cyclo(S-Pro-S-Leu)/cyclo(S-Pro-S-Ile), ethyl 2-phenylacetate, and 3-nitro-4-hydroxybenzoic acid were detected as the primary response of Rhizoctonia 4 days following dual-culturing with Stachybotrys, whereas only the latter metabolite was up-regulated 1 day later. On the other hand, trichothecenes and atranones were mycoparasite-derived metabolites identified during mycoparasitism 4 and 5 days following dual-culturing. All the above secondary metabolites are known to exhibit bioactivity, including fungitoxicity, and represent key elements that determine the outcome of the interaction being studied. Results could be further exploited in programs for the evaluation of the bioactivity of these metabolites per se or their chemical analogs, and/or genetic engineering programs to obtain more efficient mycoparasite strains with improved efficacy and toxicological profiles.

  14. Identification of signatory secondary metabolites during mycoparasitism of Rhizoctonia solani by Stachybotrys elegans

    PubMed Central

    Chamoun, Rony; Aliferis, Konstantinos A.; Jabaji, Suha

    2015-01-01

    Stachybotrys elegans is able to parasitize the fungal plant pathogen Rhizoctonia solani AG-3 following a complex and intimate interaction, which, among others, includes the production of cell wall-degrading enzymes, intracellular colonization, and expression of pathogenic process encoding genes. However, information on the metabolome level is non-existent during mycoparasitism. Here, we performed a direct-infusion mass spectrometry (DIMS) metabolomics analysis using an LTQ Orbitrap analyzer in order to detect changes in the profiles of induced secondary metabolites of both partners during this mycoparasitic interaction 4 and 5 days following its establishment. The diketopiperazine(s) (DKPs) cyclo(S-Pro-S-Leu)/cyclo(S-Pro-S-Ile), ethyl 2-phenylacetate, and 3-nitro-4-hydroxybenzoic acid were detected as the primary response of Rhizoctonia 4 days following dual-culturing with Stachybotrys, whereas only the latter metabolite was up-regulated 1 day later. On the other hand, trichothecenes and atranones were mycoparasite-derived metabolites identified during mycoparasitism 4 and 5 days following dual-culturing. All the above secondary metabolites are known to exhibit bioactivity, including fungitoxicity, and represent key elements that determine the outcome of the interaction being studied. Results could be further exploited in programs for the evaluation of the bioactivity of these metabolites per se or their chemical analogs, and/or genetic engineering programs to obtain more efficient mycoparasite strains with improved efficacy and toxicological profiles. PMID:25972848

  15. Molds in the Environment

    MedlinePlus

    ... Program in Brief Related Issues Resources Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ... ng Việt [PDF - 273 KB] Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ...

  16. QUANTIFYING INDOOR MOLDS

    EPA Science Inventory

    There is growing awareness that indoor molds/fungi may be connected to such conditions as asthma, allergies, hemorrhaging, chronic rhinosinusitis, memory loss, and a symptom complex called sick-building-syndrome. In addition, molds cause frequently fatal nosocomical infections. ...

  17. Pyrotechnic filled molding powder

    DOEpatents

    Hartzel, Lawrence W.; Kettling, George E.

    1978-01-01

    The disclosure relates to thermosetting molding compounds and more particularly to a pyrotechnic filled thermosetting compound comprising a blend of unfilled diallyl phthalate molding powder and a pyrotechnic mixture.

  18. Mold-Resistant Construction.

    ERIC Educational Resources Information Center

    Huckabee, Christopher

    2003-01-01

    Asserts that one of the surest ways to prevent indoor air quality and mold issues is to use preventive construction materials, discussing typical resistance to dealing with mold problems (usually budget-related) and describing mold-resistant construction, which uses concrete masonry, brick, and stone and is intended to withstand inevitable…

  19. Molds for cable dielectrics

    DOEpatents

    Roose, L.D.

    1996-12-10

    Molds for use in making end moldings for high-voltage cables are described wherein the dielectric insulator of a cable is heated and molded to conform to a desired shape. As a consequence, high quality substantially bubble-free cable connectors suitable for mating to premanufactured fittings are made. 5 figs.

  20. Molds for cable dielectrics

    DOEpatents

    Roose, Lars D.

    1996-01-01

    Molds for use in making end moldings for high-voltage cables are described wherein the dielectric insulator of a cable is heated and molded to conform to a desired shape. As a consequence, high quality substantially bubble-free cable connectors suitable for mating to premanufactured fittings are made.

  1. Bleach Neutralizes Mold Allergens

    ERIC Educational Resources Information Center

    Science Teacher, 2005

    2005-01-01

    Researchers at National Jewish Medical and Research Center have demonstrated that dilute bleach not only kills common household mold, but may also neutralize the mold allergens that cause most mold-related health complaints. The study, published in the Journal of Allergy and Clinical Immunology, is the first to test the effect on allergic…

  2. Mold and Children's Health.

    ERIC Educational Resources Information Center

    Tuscano, Antoinette

    1998-01-01

    Mold can seriously affect the health of children with asthma or allergies. Indoor air problems related to mold can be difficult to identify, but when several students who spend time in the same classroom area show allergic symptoms, it is important to consider mold and air quality. Failure to respond promptly can have serious consequences. (SM)

  3. Mold: "tsara'at," Leviticus, and the history of a confusion.

    PubMed

    Heller, Richard M; Heller, Toni W; Sasson, Jack M

    2003-01-01

    The noun tsara'at appears about two dozen times in the Hebrew Bible, almost exclusively in Leviticus, where it is used to describe a state of ritual defilement manifested as a scaly condition of the skin, a condition of cloth, leather, and the walls of houses. In the Septuagint, the Greek translation of the Hebrew Bible, negac tsara'at was translated as aphe lepras; in the Latin Vulgate, this became plega leprae. These words in Greek and Latin implied a condition that spread over the body, not a term of ritual impurity. Tsara'at has continued to be translated as "leprosy," even though this term is not appropriate, as there was no leprosy as we know it in the Middle East during the time period the Hebrew Bible was written. Others have suggested that the proper translation of tsara'at is "mold." The recent identification of a specific mold (Stachybotrys sp.) that contaminates buildings and causes respiratory distress, memory loss, and rash, and the fact that mold has been present for millennia, lend support to the translation of tsara'at as "mold."

  4. Effects of toxic exposure to molds and mycotoxins in building-related illnesses.

    PubMed

    Rea, William J; Didriksen, Nancy; Simon, Theodore R; Pan, Yaqin; Fenyves, Ervin J; Griffiths, Bertie

    2003-07-01

    The authors studied 100 patients who had been exposed to toxic molds in their homes. The predominant molds identified were Alternaria, Cladosporium, Aspergillus, Penicillium, Stachybotrys, Curvularia, Basidiomycetes, Myxomycetes, smuts, Epicoccus, Fusarium, Bipolaris, and Rhizopus. A variety of tests were performed on all, or on subgroups of, these patients. Sensitivities and exposures were confirmed in all patients by intradermal skin testing for individual molds (44-98% positive), and by measurement of serum antibodies. Abnormalities in T and B cells, and subsets, were found in more than 80% of the patients. The findings of trichothecene toxin and breakdown products in the urine, serum antibodies to molds, and positive intradermal skin tests confirmed mycotoxin exposure. Respiratory signs (e.g., rhinorrhea, sinus tenderness, wheezing) were found in 64% of all patients, and physical signs and symptoms of neurological dysfunction (e.g., inability to stand on the toes or to walk a straight line with eyes closed, as well as short-term memory loss) were identified in 70% of all patients. Objective abnormal autonomic nervous system tests were positive in all 100 patients tested. Brain scans, conducted using triple-head single photon emission computed tomography, were abnormal in 26 (86%) of 30 (subgroup of the 100) patients tested. Objective neuropsychological evaluations of 46 of the patients who exhibited symptoms of neurological impairment showed typical abnormalities in short-term memory, executive function/judgment, concentration, and hand/eye coordination. PMID:15143852

  5. Laboratory experiments on membrane filter sampling of airborne mycotoxins produced by Stachybotrys atra corda

    NASA Astrophysics Data System (ADS)

    Pasanen, A.-L.; Nikulin, M.; Tuomainen, M.; Berg, S.; Parikka, P.; Hintikka, E.-L.

    A membrane filter method for sampling of airborne stachybotrystoxins was studied in the laboratory. Toxigenic strains of Stachybotrys atra on wallpaper, grain, hay and straw were used as toxin sources in the experiments. Air samples were collected on cellulose nitrate and polycarbonate membrane filters at air flow rates of 10-20 ℓ min -1. After the filter sampling, the air was passed through methanol. The results showed that stachybotrystoxins (trichothecenes) were concentrated in airborne fungal propagules, and thus can be collected on filters. Polycarbonate filters with a pore size of 0.2 μm collected the highest percentage of toxic samples. The laboratory experiments indicated that polycarbonate filter sampling for the collection of airborne mycotoxins is a promising method for extension to field measurements.

  6. Microfungal contamination of damp buildings--examples of risk constructions and risk materials.

    PubMed Central

    Gravesen, S; Nielsen, P A; Iversen, R; Nielsen, K F

    1999-01-01

    To elucidate problems with microfungal infestation in indoor environments, a multidisciplinary collaborative pilot study, supported by a grant from the Danish Ministry of Housing and Urban Affairs, was performed on 72 mold-infected building materials from 23 buildings. Water leakage through roofs, rising damp, and defective plumbing installations were the main reasons for water damage with subsequent infestation of molds. From a score system assessing the bioavailability of the building materials, products most vulnerable to mold attacks were water damaged, aged organic materials containing cellulose, such as wooden materials, jute, wallpaper, and cardboard. The microfungal genera most frequently encountered were Penicillium (68%), Aspergillus (56%), Chaetomium (22%), Ulocladium, (21%), Stachybotrys (19%) and Cladosporium (15%). Penicillium chrysogenum, Aspergillus versicolor, and Stachybotrys chartarum were the most frequently occurring species. Under field conditions, several trichothecenes were detected in each of three commonly used building materials, heavily contaminated with S. chartarum. Under experimental conditions, four out of five isolates of S. chartarum produced satratoxin H and G when growing on new and old, very humid gypsum boards. A. versicolor produced the carcinogenic mycotoxin sterigmatocystin and 5-methoxysterigmatocystin under the same conditions. PMID:10347000

  7. Investigations on hydrolytic activities from Stachybotrys microspora and their use as an alternative in yeast DNA extraction.

    PubMed

    Abdeljalil, Salma; Ben Hmad, Ines; Saibi, Walid; Amouri, Bahia; Maalej, Wiem; Kaaniche, Marwa; Koubaa, Aida; Gargouri, Ali

    2014-02-01

    Stachybotrys microspora is a filamentous fungus characterized by the secretion of multiple hydrolytic activities (cellulolytic and non-cellulolytic enzymes). The production of these biocatalysts was studied under submerged culture using glucose, cellulose, and wheat bran as carbon sources. Endoglucanases, pectinases, xylanases, β-glucanases, chitinases, and proteases were induced on cellulose-based medium and repressed on glucose in both strains with higher amounts produced by the mutant. β-glucosidases were roughly equally produced by both strains under glucose and cellulose conditions. The yield of chitinases, β-glucanases, and proteases produced by Stachybotrys strains was as much higher than the commercialized lysing enzyme called "zymolyase," currently used in yeast DNA extraction. In this context, we showed that S. microspora hydrolases can be successfully applied in the extraction of yeast DNA.

  8. Immunotherapy for mold allergy.

    PubMed

    Coop, Christopher A

    2014-12-01

    The objective of this article is to review the available studies regarding mold immunotherapy. A literature search was conducted in MEDLINE to identify peer-reviewed articles related to mold immunotherapy using the following keywords: mold, allergy, asthma, and immunotherapy. In addition, references cited within these articles were also reviewed. Articles were selected based on their relevance to the topic. Allergic responses to inhaled mold antigens are a recognized factor in allergic rhinitis and asthma. There are significant problems with respect to the production of relevant allergen material for the diagnosis and treatment of mold allergy with immunotherapy. Mold allergens contain proteases and should not be mixed with other allergens for immunotherapy. Most of the immunotherapy studies focus on two molds, Alternaria and Cladosporium. There is a lack of randomized placebo-controlled trials when evaluating the efficacy of mold immunotherapy with trials only focusing on immunotherapy to Alternaria and Cladosporium. Additional studies are needed regarding mold allergy and immunotherapy focusing on which molds are important for causing allergic disease.

  9. Immunotherapy for mold allergy.

    PubMed

    Coop, Christopher A

    2014-12-01

    The objective of this article is to review the available studies regarding mold immunotherapy. A literature search was conducted in MEDLINE to identify peer-reviewed articles related to mold immunotherapy using the following keywords: mold, allergy, asthma, and immunotherapy. In addition, references cited within these articles were also reviewed. Articles were selected based on their relevance to the topic. Allergic responses to inhaled mold antigens are a recognized factor in allergic rhinitis and asthma. There are significant problems with respect to the production of relevant allergen material for the diagnosis and treatment of mold allergy with immunotherapy. Mold allergens contain proteases and should not be mixed with other allergens for immunotherapy. Most of the immunotherapy studies focus on two molds, Alternaria and Cladosporium. There is a lack of randomized placebo-controlled trials when evaluating the efficacy of mold immunotherapy with trials only focusing on immunotherapy to Alternaria and Cladosporium. Additional studies are needed regarding mold allergy and immunotherapy focusing on which molds are important for causing allergic disease. PMID:24057512

  10. 53. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    53. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL MOLDS IN THE MORAVIAN POTTERY AND TILE WORKS COLLECTION, AND ARE USED TO PRESS TILES. THE FACTORY KEEPS TEN PRODUCTION MOLDS FOR EACH IMAGE. THE ORIGINAL MOLDS ARE NOT USED IN PRODUCTION. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  11. Comparative sampling molds evaluation

    SciTech Connect

    Pierrard, L.; Jarry, P.; Charbonnier, J.; Rigaut, C.

    1996-10-01

    The metallurgical industry needs to cast alloys with narrow tolerances in their chemical composition in order to reduce variability of their use properties. Therefore appropriate sampling practices and analytical methods are required. Both accuracy and precision of the analytical results are limited by the non-homogeneity of as-cast disk or cylinder samples, which results from macrosegregation phenomenon. This paper presents a comparison between six commonly used molds: four molds recommended by ASTM standards (center-pour molds type B and vacuum mold), mushroom shaped and cylinder molds. Two complementary approaches are exhibited for the different molds designs: (1) solidification modeling in order to predict macrosegregation localization using the Simulor software; (2) experimental characterization. Radial and axial segregation profiles are determined by Analytical Scanning Electron Microscopy in addition to analytical precision evaluation by spark optical emission and X-Ray fluorescence spectrometries for a given machining depth.

  12. Guide to Molds at School.

    ERIC Educational Resources Information Center

    Healthy Schools Network, Inc., Albany, NY.

    Asserting that molds growing in schools can be harmful to children's health and learning, this guide offers information about the issue. It provides an overview of the basics, then addresses testing, types of molds, molds and health, monitoring schools for mold, mold prevention and clean-up tips for schools, and what parents should do if they…

  13. Molded Magnetic Article

    NASA Technical Reports Server (NTRS)

    Bryant, Robert G. (Inventor); Namkung, Min (Inventor); Wincheski, Russell A. (Inventor); Fulton, James P. (Inventor); Fox, Robert L. (Inventor)

    2000-01-01

    A molded magnetic article and fabrication method are provided. Particles of ferromagnetic material embedded in a polymer binder are molded under heat and pressure into a geometric shape. Each particle is an oblate spheroid having a radius-to-thickness aspect ratio approximately in the range of 15-30. Each oblate spheroid has flattened poles that are substantially in perpendicular alignment to a direction of the molding pressure throughout the geometric shape.

  14. BRITISH MOLDING MACHINE, PBQ AUTOMATIC COPE AND DRAG MOLDING MACHINE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    BRITISH MOLDING MACHINE, PBQ AUTOMATIC COPE AND DRAG MOLDING MACHINE MAKES BOTH MOLD HALVES INDIVIDUALLY WHICH ARE LATER ROTATED, ASSEMBLED, AND LOWERED TO POURING CONVEYORS BY ASSISTING MACHINES. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  15. Silicon micro-mold

    DOEpatents

    Morales, Alfredo M.

    2006-10-24

    The present invention describes a method for rapidly fabricating a robust 3-dimensional silicon-mold for use in preparing complex metal micro-components. The process begins by depositing a conductive metal layer onto one surface of a silicon wafer. A thin photoresist and a standard lithographic mask are then used to transfer a trace image pattern onto the opposite surface of the wafer by exposing and developing the resist. The exposed portion of the silicon substrate is anisotropically etched through the wafer thickness down to conductive metal layer to provide an etched pattern consisting of a series of rectilinear channels and recesses in the silicon which serve as the silicon micro-mold. Microcomponents are prepared with this mold by first filling the mold channels and recesses with a metal deposit, typically by electroplating, and then removing the silicon micro-mold by chemical etching.

  16. Silicone plesiotherapy molds

    SciTech Connect

    Karolis, C.; Reay-Young, P.S.; Walsh, W.; Velautham, G.

    1983-04-01

    Plesiotherapy, the treatment of superficial lesions by radioactive molds has largely been replaced by teletherapy techniques involving high energy photon and electron beams. There are, however, situations for which a short distance type treatment, in one form or another, is superior to any other presently available. Traditionally, molds have taken the form of rigid devices incorporating clamps to attach them to the patient. This ensures a reproducible geometry about a localized region since the molds are applied on a daily basis. To make such devices requires considerable skill and patience. This article describes an alternative method that eliminates the use of cumbersome devices in many situations. Silicone molds made from a plaster cast model have been found suitable for the treatment of surface lesions and especially for lesions in the oral and nasal cavities. With the use of radioactive gold seeds the molds may be left in place for a few days without fear of them moving.

  17. A novel neutral, halophile Stachybotrys microspora-based endoglucanase active impact on β-glucan.

    PubMed

    Benhmad, Ines; Boudabbous, Manel; Yaîch, Asma; Rebai, Maryem; Gargouri, Ali

    2016-04-01

    The production of cellulases from Stachybotrys microspora strain (A19) has been improved by fed-batch fermentation on Avicel cellulose 10 mg/ml. An endoglucanase EG2 was purified to homogeneity. This cellulase has a molecular mass estimated to 50 kDa when analyzed by a denaturant gel electrophoresis. It exhibited an optimal activity at 50 °C, pH 7.0 and 0.85 M NaCl. Specifically, these results show the thermo-active, alkali-tolerant and halo-tolerant properties of EG2. In addition, this endoglucanase showed its highest activity on barley-β-glucan, compared to the CMC. Moreover, it was less active on Avicel cellulose. Furthermore, the EG2 activity was stimulated in the presence of EDTA, urea and β-mercaptoethanol whereas it was reduced in the presence of SDS. This cellulase was highly stable in the presence of organic solvents such as acetone and n-hexane. TLC showed that the main hydrolysis products from EG2 were cellobiose and glucose. This fungal endoglucanase could be potentially important in the conversion of grass-derived biomass into fermentable sugars. PMID:26861652

  18. A novel neutral, halophile Stachybotrys microspora-based endoglucanase active impact on β-glucan.

    PubMed

    Benhmad, Ines; Boudabbous, Manel; Yaîch, Asma; Rebai, Maryem; Gargouri, Ali

    2016-04-01

    The production of cellulases from Stachybotrys microspora strain (A19) has been improved by fed-batch fermentation on Avicel cellulose 10 mg/ml. An endoglucanase EG2 was purified to homogeneity. This cellulase has a molecular mass estimated to 50 kDa when analyzed by a denaturant gel electrophoresis. It exhibited an optimal activity at 50 °C, pH 7.0 and 0.85 M NaCl. Specifically, these results show the thermo-active, alkali-tolerant and halo-tolerant properties of EG2. In addition, this endoglucanase showed its highest activity on barley-β-glucan, compared to the CMC. Moreover, it was less active on Avicel cellulose. Furthermore, the EG2 activity was stimulated in the presence of EDTA, urea and β-mercaptoethanol whereas it was reduced in the presence of SDS. This cellulase was highly stable in the presence of organic solvents such as acetone and n-hexane. TLC showed that the main hydrolysis products from EG2 were cellobiose and glucose. This fungal endoglucanase could be potentially important in the conversion of grass-derived biomass into fermentable sugars.

  19. Glass molding process with mold lubrication

    DOEpatents

    Davey, Richard G.

    1978-06-27

    Improvements are provided in glass forming processes of the type wherein hot metal blank molds are employed by using the complementary action of a solid film lubricant layer, of graphite dispersed in a cured thermoset organopolysiloxane, along with an overspray of a lubricating oil.

  20. Resin film infusion mold tooling and molding method

    NASA Technical Reports Server (NTRS)

    Burgess, Roger (Inventor); Grossheim, Brian (Inventor); Mouradian, Karbis (Inventor); Thrash, Patrick J. (Inventor)

    1999-01-01

    A mold apparatus and method for resin film infusion molding including an outer mold tool having a facing sheet adapted to support a resin film and preform assembly. The facing sheet includes attachment features extending therefrom. An inner mold tool is positioned on the facing sheet to enclose the resin film and preform assembly for resin film infusion molding. The inner mold tool includes a plurality of mandrels positioned for engagement with the resin film and preform assembly. Each mandrel includes a slot formed therein. A plurality of locating bars cooperate with the slots and with the attachment features for locating the mandrels longitudinally on the outer mold tool.

  1. 92. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    92. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL MOLDS IN THE MORAVIAN POTTERY AND TILE WORKS COLLECTION, AND ARE USED TO PRESS TILES. THE FACTORY KEEPS TEN PRODUCTION MOLDS FOR EACH IMAGE. THE ORIGINAL MOLDS ARE NOT USED IN PRODUCTION. SAME VIEW AS PA-107-53. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  2. Newborn head molding

    MedlinePlus

    ... molding. In: Graham JM, Sanchez-Lara PA, eds. Smiths' Recognizable Patterns of Human Deformation . 4th ed. Philadelphia, PA: Elsevier; 2016:chap 35. Smith J. Initial evaluation. In: Gleason CA, Devaskar SU, ...

  3. Breaking the Mold.

    ERIC Educational Resources Information Center

    Huckabee, Christopher

    2003-01-01

    Using the example of a Texas elementary school, describes how to eliminate mold and mildew from school facilities, including discovering the problem, responding quickly, reconstructing the area, and crisis planning and prevention. (EV)

  4. Mold After a Disaster

    MedlinePlus

    ... Health Matters What's New Preparation & Planning Disasters & Severe Weather Earthquakes Extreme Heat Floods Hurricanes Landslides Tornadoes Tsunamis ... Disaster Mold Removal After a Disaster Disasters & Severe Weather Earthquakes Extreme Heat Floods Hurricanes Landslides Tornadoes Tsunamis ...

  5. MOLDS FOR CASTING PLUTONIUM

    DOEpatents

    Anderson, J.W.; Miley, F.; Pritchard, W.C.

    1962-02-27

    A coated mold for casting plutonium comprises a mold base portion of a material which remains solid and stable at temperatures as high as the pouring temperature of the metal to be cast and having a thin coating of the order of 0.005 inch thick on the interior thereof. The coating is composed of finely divided calcium fluoride having a particle size of about 149 microns. (AEC)

  6. Pressure molding of powdered materials improved by rubber mold insert

    NASA Technical Reports Server (NTRS)

    1964-01-01

    Pressure molding tungsten microspheres is accomplished by applying hydraulic pressure to a silicone rubber mold insert with several barrel shaped chambers which is placed in a steel die cavity. This technique eliminates castings containing shear fractures.

  7. FILLING MOLDS MADE ON THE BRITISH MOLDING MACHINE, AUTOMATIC COPE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    FILLING MOLDS MADE ON THE BRITISH MOLDING MACHINE, AUTOMATIC COPE AND DRAG (BMM) FROM MOBILE LADLE. EMPTY BULL LADLE IN FOREGROUND. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  8. TENDING THE MOLD, DURING THE TRANSFER FROM TUNDISH TO MOLD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    TENDING THE MOLD, DURING THE TRANSFER FROM TUNDISH TO MOLD TO CONTAINMENT CHAMBER IS CONTINUOUS CASTING OPERATOR, CALVIN ANDERS. - U.S. Steel, Fairfield Works, Continuous Caster, Fairfield, Jefferson County, AL

  9. End moldings for cable dielectrics

    DOEpatents

    Roose, Lars D.

    2000-01-01

    End moldings for high-voltage cables are described wherein the dielectric insulator of the cable is heated and molded to conform to a desired shape. As a consequence, high quality substantially bubble-free cable connectors suitable for mating to premanufactured fittings are made. Disclosed is a method for making the cable connectors either in the field or in a factory, molds suitable for use with the method, and the molded cable connectors, themselves.

  10. Molding process for imidazopyrrolone polymers

    NASA Technical Reports Server (NTRS)

    Johnson, C. L. (Inventor)

    1973-01-01

    A process is described for producing shaped articles of imidazopyrrolone polymers comprising molding imidazopyrrolone polymer molding power under pressure and at a temperature greater than 475 C. Moderate pressures may be employed. Preferably, prior to molding, a preform is prepared by isostatic compression. The preform may be molded at a relatively low initial pressure and temperature; as the temperature is increased to a value greater than 475 C., the pressure is also increased.

  11. REFRACTORY COATING FOR GRAPHITE MOLDS

    DOEpatents

    Stoddard, S.D.

    1958-06-24

    Refractory coating for graphite molds used in the casting of uranium is described. The coating is an alumino-silicate refractory composition which may be used as a mold surface in solid form or as a coating applied to the graphite mold. The composition consists of a mixture of ball clay, kaolin, alumina cement, alumina, water, sodium silicate, and sodium carbonate.

  12. MOLDED SEALING ELEMENT

    DOEpatents

    Bradford, B.W.; Skinner, W.J.

    1959-03-24

    Molded sealing elements suitable for use under conditions involving exposure to uranium hexafluoride vapor are described. Such sealing elements are made by subjecting graphitic carbons to a preliminary treatment with uranium hexafluoride vapor, and then incorporating polytetrafluorethylene in them. The resulting composition has good wear resistant and frictional properties and is resistant to disintegration by uranium hexafluoride over long periods of exposure.

  13. QUANTIFYING INDOOR MOLDS

    EPA Science Inventory

    The US EPA has patented a mold ID technology (#6,387,652) licensed by 15 companies in the US and EU. This technology is based upon DNA sequences. In conjunction with HUD, this technology will be used in a National Survey of Homes.

  14. High Cost/High Risk Components to Chalcogenide Molded Lens Model: Molding Preforms and Mold Technology

    SciTech Connect

    Bernacki, Bruce E.

    2012-10-05

    This brief report contains a critique of two key components of FiveFocal's cost model for glass compression molding of chalcogenide lenses for infrared applications. Molding preforms and mold technology have the greatest influence on the ultimate cost of the product and help determine the volumes needed to select glass molding over conventional single-point diamond turning or grinding and polishing. This brief report highlights key areas of both technologies with recommendations for further study.

  15. Nonpost mold cure compound

    NASA Astrophysics Data System (ADS)

    Hirata, Akihiro

    1997-08-01

    The recent low price trend of electronic products has made IC manufacturing efficiency a top priority in the semiconductor industry. Post mold cure (PMC) process, which generally involves heating the packages in the oven at 175 C for 4 to 8 hours, takes up much longer time than most other assembly processes. If this PMC process can be reduced or eliminated, semiconductor makers will be rewarded with a much higher cost merit. We define the purpose of Non-PMC as 'to get high reliability with suitable physical and electrical properties without PMC'. We compared carious properties of molding compound before and after PMC. We found that curing reaction has almost complete through DSC and C-NMR measurement, but several properties have not stabilized yet, and that not all properties after PMC were better than before PMC. We developed new grade of molding compound considering these facts. And we found that main factors to accomplish non-PMC compound are curability and flowability, and more, increasing of fundamental properties. To accomplish non-PMC, at first, molding compound need to have very high curability. Generally speaking, too high curability causes low flowability, and causes incomplete filing, wire sweep, pad shift, and weak adhesion to inner parts of IC packages. To prevent these failures, various compound properties were studied, and we achieved in adding good flowability to very high curable molding compound. Finally, anti-popcorn property was improved by adding low moisture, high adhesion, high Tg, and high flexural strengths at high temperature. Through this study, we developed new compound grade for various package, especially large QFP using standard ECN resin.

  16. Sesquiterpenoids and xanthones derivatives produced by sponge-derived fungus Stachybotry sp. HH1 ZSDS1F1-2.

    PubMed

    Qin, Chun; Lin, Xiuping; Lu, Xin; Wan, Junting; Zhou, Xuefeng; Liao, Shengrong; Tu, Zhengchao; Xu, Shihai; Liu, Yonghong

    2015-02-01

    A new (2) and four known (1, 8-10) sesquiterpenoids, two new (3 and 4) and eight known (5-7, 11-15) xanthone derivatives were isolated from the cultures of sponge-derived fungus Stachybotry sp. HH1 ZDDS1F1-2. The structure of the compounds 1-15 was determined mainly by analysis of the one-dimensional and two-dimensional NMR spectroscopic data and by analogy with the data of those reported. Compound 1 was confirmed by X-ray crystallography. All the compounds were tested for their cytotoxic, antiinflammatory and antiviral (EV71) effects. Compounds 5, 7 and 11 showed significant cytotoxicity against selected human tumor cell lines. Compounds 3, 4 and 11 also displayed significant inhibitory activity against cycloooxygenase (COX-2). Compounds 4, 5 and 11 showed activities against intestinal virus EV71.

  17. World Allergy Organization Study on Aerobiology for Creating First Pollen and Mold Calendar With Clinical Significance in Islamabad, Pakistan; A Project of World Allergy Organization and Pakistan Allergy, Asthma & Clinical Immunology Centre of Islamabad

    PubMed Central

    2012-01-01

    Pollen and mold allergies are highly problematic in Islamabad. This study was conducted to investigate the type and concentration of airborne pollens/molds causing allergic diseases in susceptible individuals. A volumetric spore trap (Burkard) was placed at the height of 11 m and ran continuously for 3 years. Once a week, the collecting drum was prepared by affixing Melinex tape with a double sided adhesive that was coated with a thin layer of silicone grease. Every Sunday at 9:00 AM the drum was replaced by another drum and the pollen/mold spores were removed and permanently mounted on slides. Using a microscope, the trapped particles were identified and recorded as counts per cubic meter of air per hour. From these data, the pollen and mold calendars were constructed and expressed as counts per cubic meter of air per day. Skin prick tests were performed on more than 1000 patients attending the Pakistan Allergy, Asthma & Clinical Immunology Centre of Islamabad. The results indicated that there were 2 main pollen plants that contributed to seasonal allergies. These were Broussonetia papyrifera and Cannabis sativa during the March/April season and the July/September season, respectively. Although mold spores were continuously detected throughout the year, the most prominent mold was undetected mold and unconfirmed mold species similar to Stachybotrys species, which was high from July to September/October. Two additional molds contributing to allergic reactions were Pithomyces species and Cladosporium species, which were active during January and April, with the latter also being detected between October and November. These results may prove beneficial to both patients and physicians in planning a therapeutic protocol for avoidance and amelioration. PMID:23283209

  18. Effect of chlorine dioxide gas on fungi and mycotoxins associated with sick building syndrome.

    PubMed

    Wilson, S C; Wu, C; Andriychuk, L A; Martin, J M; Brasel, T L; Jumper, C A; Straus, D C

    2005-09-01

    The growth of indoor molds and their resulting products (e.g., spores and mycotoxins) can present health hazards for human beings. The efficacy of chlorine dioxide gas as a fumigation treatment for inactivating sick building syndrome-related fungi and their mycotoxins was evaluated. Filter papers (15 per organism) featuring growth of Stachybotrys chartarum, Chaetomium globosum, Penicillium chrysogenum, and Cladosporium cladosporioides were placed in gas chambers containing chlorine dioxide gas at either 500 or 1,000 ppm for 24 h. C. globosum was exposed to the gas both as colonies and as ascospores without asci and perithecia. After treatment, all organisms were tested for colony growth using an agar plating technique. Colonies of S. chartarum were also tested for toxicity using a yeast toxicity assay with a high specificity for trichothecene mycotoxins. Results showed that chlorine dioxide gas at both concentrations completely inactivated all organisms except for C. globosum colonies which were inactivated an average of 89%. More than 99% of ascospores of C. globosum were nonculturable. For all ascospore counts, mean test readings were lower than the controls (P < 0.001), indicating that some ascospores may also have been destroyed. Colonies of S. chartarum were still toxic after treatment. These data show that chlorine dioxide gas can be effective to a degree as a fumigant for the inactivation of certain fungal colonies, that the perithecia of C. globosum can play a slightly protective role for the ascospores and that S. chartarum, while affected by the fumigation treatment, still remains toxic. PMID:16151130

  19. Method for molding ceramic powders

    DOEpatents

    Janney, M.A.

    1990-01-16

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, where after the product may be sintered.

  20. Method for molding ceramic powders

    DOEpatents

    Janney, Mark A.

    1990-01-01

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, whereafter the product may be sintered.

  1. Low-pressure injection molding

    SciTech Connect

    Mangels, J.A. )

    1994-05-01

    Ceramic injection molding experienced a revival in the 1970s and 1980s with the application of ceramics for gas turbine components. Concurrently, techniques were being developed for the injection molding of powdered metal compositions into complex shaped articles. The impetus for the development of injection molding as a ceramic fabrication process lay in the potential to produce complex-shaped components to near-net shape. In the ceramic injection molding process, ceramic powders are processed to obtain the desired particle size, distribution and morphology and blended to obtain a homogeneous distribution. These powders are then mixed with the organic binders, generally in a heated, highshear mixer at temperatures above the melting point of the organic binders. The injection molding mix is pelletized, cooled and fed into an injection molding machine. The molding mix is reheated to a fluid state and injected under high pressure (7--70 MPa) into a die cavity. The molded part is removed from the tooling after the molding mix has solidified in the die. The organic binders are then removed from the component at temperatures up to 400 C, generally by some combination of wicking and thermal decomposition. Finally, the component is sintered to obtain its final ceramic properties, using conventional ceramic processes.

  2. MOLD SPECIFIC QUANTITATIVE PCR: THE EMERGING STANDARD IN MOLD ANALYSIS

    EPA Science Inventory

    Today I will talk about the use of quantitative or Real time PCR for the standardized identification and quantification of molds. There are probably at least 100,000 species of molds or fungi. But there are actually about 100 typically found indoors. Some pose a threat to human...

  3. 8. VIEW OF A MOLD FOR PRECISION CASTING. THE MOLD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. VIEW OF A MOLD FOR PRECISION CASTING. THE MOLD WAS USED IN FOUNDRY OPERATIONS THAT CAST PLUTONIUM EITHER AS INGOTS SUITABLE FOR ROLLING AND FURTHER WROUGHT PROCESSING OR INTO SHAPES AMENABLE TO DIRECT MACHINING OPERATIONS. (5/6/59) - Rocky Flats Plant, Plutonium Fabrication, Central section of Plant, Golden, Jefferson County, CO

  4. Method of continuously producing compression molded coal

    SciTech Connect

    Yoshida, H.; Ishihara, N.; Kuwashima, S.

    1986-08-19

    This patent describes a method of producing a continuous cake of compression molded coal for chamber type coke ovens comprising steps of charging raw material coking coal into a molding box, and pressurizing the raw material coking coal with a pressing plate to obtain compression molded coal and to push the compression molded coal out of the molding box through an outlet. The improvement described here includes: the coking coal having a water content of more than 8.5% is charged into a chamber of the molding box at a side opposite the outlet, the pressing plate in the chamber is so advanced in the molding box to compression mold the coking coal into the preceding compression molded coal at a pressure no more than about 100 Kg/cm/sup 2/ so that the molded coal has a bulk density of at least 1.0 wet ton/m/sup 3/, and to push the molded coal in the molding box toward the outlet, the molded coal pressurized by the pressing plate partly remains in the molding box for supporting the coking coal freshly charged for the following cycle of the operation, and the freshly charged coal is pressed by the pressing plate so that the subsequent molded coal is combined with the preceding compression molded coal and the preceding molded coal is pushed out of the molding box whereby by repeating the serial steps of the operation, continuous cake of compression molded coal is produced.

  5. A RAPID METHOD FOR THE EXTRACTION OF FUNGAL DNA FROM ENVIRONMENTAL SAMPLES: EVALUATION IN THE QUANTITATIVE ANALYSIS OF MEMNONIELLA ECHINATA CONIDIA USING REAL TIME DETECTION OF PCR PRODUCTS

    EPA Science Inventory

    New technologies are creating the potential for using nucleic acid sequence detection to perform routine microbiological analyses of environmental samples. Our laboratory has recently reported on the development of a method for the quantitative detection of Stachybotrys chartarum...

  6. Mold Materials For Permanent Molding of Aluminum Alloys

    SciTech Connect

    John F Wallace; David Schwam; Wen Hong dxs11@po.cwru.edu

    2001-09-14

    A test that involves immersion of the potential mod materials for permanent molds has been developed that provides a thermal cycle that is similar to the experienced during casting of aluminum in permanent molds. This test has been employed to determine the relative thermal fatigue resistance of several different types of mold materials. Four commercial mold coatings have been evaluated for their insulating ability, wear resistance and roughness. The results indicate that composition and structure of the mold materials have considerable effect on their thermal fatigue cracking behavior. Irons with a gray iron structure are the most prone to thermal fatigue cracking followed by compacted graphite irons with the least thermal fatigue cracking of the cast irons experienced by ductile iron. The composition of these various irons affects their behavior.

  7. Processing studies in sheet molding compound compression molding

    NASA Astrophysics Data System (ADS)

    Abrams, Lisa Marie

    Due to its high strength to weight ratio, corrosion resistance, and low cost. Sheet Molding Compound (SMC) production offers great potential for growth in the automotive and trucking industry. Much attention is now being given to improving the economy of SMC compression molding by reducing the cycle time required to produce acceptable parts in steady production. One of the fastest growing applications of Sheet Molding Compound (SMC) compression molding panels is the manufacture of truck body panels. Due to their large size, the molding forces developed are substantial and have a major influence in the molding cycle. The relevant process models for SMC flow are reviewed and a procedure is developed that can be used to obtain the closing force and calculate the needed material parameters. Experiments were done using commercially made SMC varying quantities of glass, filler, and thickener to verify the validity of this model and the compression force was predicted for commercially made automotive hoods. It was found that glass and filler had a significant impact on the material parameters. When the amount of glass was increased, both material parameters m/deltan and eta increased. Similar trends were seen when increasing the amount of filler. For the thickener used in this research (magnesium oxide), it was found that it had minimal effect on the material parameters. Molding conditions and initial SMC charge configurations were also varied to see their effects on molding force and material parameters. Initial charge dimensions and volume as well as mold closing speed showed no effect on material parameters, while molding temperature showed a minimal effect. Material parameters were calculated for each SMC composition. These parameters were used to predict the compression force for the Corvette hood and Fiero hood. These predictions were compared with actual Corvette and Fiero hoods manufactured in industry. They predicted the commercially made parts quite well.

  8. Twistable mold for helicopter blades

    NASA Technical Reports Server (NTRS)

    Carter, E. S.; Kiely, E. F.

    1972-01-01

    Design is described of mold for fabrication of blades composed of sets of aerodynamic shells having same airfoil section characteristics but different distributions. Mold consists of opposing stacks of thin templates held together by long bolts. When bolts are loosened, templates can be set at different positions with respect to each other and then locked in place.

  9. Thermophilic molds: Biology and applications.

    PubMed

    Singh, Bijender; Poças-Fonseca, Marcio J; Johri, B N; Satyanarayana, Tulasi

    2016-11-01

    Thermophilic molds thrive in a variety of natural habitats including soils, composts, wood chip piles, nesting materials of birds and other animals, municipal refuse and others, and ubiquitous in their distribution. These molds grow in simple media containing carbon and nitrogen sources and mineral salts. Polyamines are synthesized in these molds and the composition of lipids varies considerably, predominantly containing palmitic, oleic and linoleic acids with low levels of lauric, palmiotoleic and stearic acids. Thermophilic molds are capable of efficiently degrading organic materials by secreting thermostable enzymes, which are useful in the bioremediation of industrial wastes and effluents that are rich in oil, heavy metals, anti-nutritional factors such as phytic acid and polysaccharides. Thermophilic molds synthesize several antimicrobial substances and biotechnologically useful miscellaneous enzymes. The analysis of genomes of thermophilic molds reveals high G:C contents, shorter introns and intergenic regions with lesser repetitive sequences, and further confirms their ability to degrade agro-residues efficiently. Genetic engineering has aided in ameliorating the characteristics of the enzymes of thermophilic molds. This review is aimed at focusing on the biology of thermophilic molds with emphasis on recent developments in the analysis of genomes, genetic engineering and potential applications.

  10. INDOOR MOLDS AND ALLERGIC POTENTIAL

    EPA Science Inventory

    Rationale: Damp/moldy environments have been associated with asthma exacerbation, but mold¿s role in allergic asthma induction is less clear. Recently, 5 molds were statistically associated with water-damaged asthmatic homes in the Cleveland area. The asthma exacerbation...

  11. Thermophilic molds: Biology and applications.

    PubMed

    Singh, Bijender; Poças-Fonseca, Marcio J; Johri, B N; Satyanarayana, Tulasi

    2016-11-01

    Thermophilic molds thrive in a variety of natural habitats including soils, composts, wood chip piles, nesting materials of birds and other animals, municipal refuse and others, and ubiquitous in their distribution. These molds grow in simple media containing carbon and nitrogen sources and mineral salts. Polyamines are synthesized in these molds and the composition of lipids varies considerably, predominantly containing palmitic, oleic and linoleic acids with low levels of lauric, palmiotoleic and stearic acids. Thermophilic molds are capable of efficiently degrading organic materials by secreting thermostable enzymes, which are useful in the bioremediation of industrial wastes and effluents that are rich in oil, heavy metals, anti-nutritional factors such as phytic acid and polysaccharides. Thermophilic molds synthesize several antimicrobial substances and biotechnologically useful miscellaneous enzymes. The analysis of genomes of thermophilic molds reveals high G:C contents, shorter introns and intergenic regions with lesser repetitive sequences, and further confirms their ability to degrade agro-residues efficiently. Genetic engineering has aided in ameliorating the characteristics of the enzymes of thermophilic molds. This review is aimed at focusing on the biology of thermophilic molds with emphasis on recent developments in the analysis of genomes, genetic engineering and potential applications. PMID:26777293

  12. INJECTION-MOLDING APPARATUS

    DOEpatents

    Lobell, G.M.

    1958-02-11

    This patent is drawn to an injection molding apparatus for producing a tube closed at one end wherein the normally unsupported end of the core located in the cavity during the injection of the molten material to fill the space between the core and cavity wall, which supporting means is automatically removed from operation during the forming of the closed end of the tube. This support means is a plug extending through the end of the core into a recess in the bottom of the cavity where the closed end of the tube is to be formed. The plug is spring pressed into said recess and is forced out of the recess by a slidable bushing at the top of the cavity which is moved against the force of the spring by the molten material when it fills the uppormost open end portion of the cavity, thereby permitting the closed end of the tube to be formed.

  13. Mold-induced hypersensitivity pneumonitis.

    PubMed

    Greenberger, Paul A

    2004-01-01

    Mold-induced hypersensitivity pneumonitis results from macrophage- and lymphocyte-driven inflammation, which may be attributable to contaminated humidifiers or heating-ventilation systems or sources in homes, schools, or workplaces. A case may be suspected when there is water intrusion or inadequate drainage. Some fungal causes include species of Alternaria, Aspergillus, Cryptostroma, Penicillium, Pullularia, Rhodotorula, and Trichosporon. The differential diagnosis includes mold-induced asthma, sick building syndrome, mass psychogenic illness (epidemic hysteria), unjustified fears of "toxic" molds, and conditions causing recurrent pneumonitis. PMID:15510579

  14. ILLUSTRATED HANDBOOK OF SOME COMMON MOLDS.

    ERIC Educational Resources Information Center

    CHANDLER, MARION N.

    THIS DOCUMENT IS A PICTURE GUIDE FOR THE IDENTIFICATION OF TEN COMMON MOLDS. IT IS DESIGNED FOR USE WITH THE ELEMENTARY SCIENCE STUDY UNIT "MICROGARDENING" AND IS SUGGESTED FOR UPPER ELEMENTARY GRADES. INCLUDED FOR EACH MOLD ARE COLOR PHOTOGRAPHS AND PHOTOMICROGRAPHS OF THE INTACT MOLD MASS AND OF THE MOLD'S SPORE PRODUCING STRUCTURES. ALSO…

  15. Transfer molding of PMR-15 polyimide resin

    NASA Technical Reports Server (NTRS)

    Reardon, J. P.; Moyer, D. W.; Nowak, B. E.

    1985-01-01

    Transfer molding is an economically viable method of producing small shapes of PMR-15 polyimide. It is shown that with regard to flexural, compressive, and tribological properties transfer-molded PMR-15 polyimide is essentially equivalent to PMR-15 polyimide produced by the more common method of compression molding. Minor variations in anisotropy are predictable effects of molding design and secondary finishing operations.

  16. Rapid control of mold temperature during injection molding process

    SciTech Connect

    Liparoti, Sara; Titomanlio, Giuseppe; Hunag, Tsang Min; Cakmak, Mukerrem; Sorrentino, Andrea

    2015-05-22

    The control of mold surface temperature is an important factor that determines surface morphology and its dimension in thickness direction. It can also affect the frozen molecular orientation and the mold surface replicability in injection molded products. In this work, thin thermally active films were used to quickly control the mold surface temperature. In particular, an active high electrical conductivity carbon black loaded polyimide composites sandwiched between two insulating thin polymeric layers was used to condition the mold surface. By controlling the heating time, it was possible to control precisely the temporal variation of the mold temperature surface during the entire cycle. The surface heating rate was about 40°C/s and upon contact with the polymer the surface temperature decreased back to 40°C within about 5 s; the overall cycle time increased only slightly. The effect on cross section sample morphology of samples of iPP were analyzed and discussed on the basis of the recorded temperature evolution.

  17. White mold of Jerusalem artichoke

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Jerusalem artichoke (Helianthus tuberosus) is a Native American food plant closely related to the common sunflower (Helianthus annuus). Tubers of Jerusalem artichoke are increasingly available in retail grocery outlets. White mold (Sclerotinia stem rot), caused by the fungus, Sclerotinia sclerotioru...

  18. [Health effects of indoor molds].

    PubMed

    Buzina, Walter

    2007-01-01

    Molds are found almost everywhere in the environment. Their airborne propagules (conidia, spores, hyphal fragments) can--under certain circumstances--cause a variety of health problems like mycotic infections, allergies, asthma, irritations or toxic syndromes. PMID:18030548

  19. Galvanotaxis of slime mold.

    PubMed

    ANDERSON, J D

    1951-09-01

    The plasmodium of Physarum polycephalum reacts to direct current by migration toward the cathode. Cathodal migration was obtained upon a variety of substrata such as baked clay, paper, cellophane, and agar with a current density in the substratum of 1.0 microa./mm.(2) Injury was produced by current densities of 8.0 to 12.0 microa./mm.(2) The negative galvanotactic response was not due to electrode products. Attempts to demonstrate that the response was due to gradients or orientation in the substratum, pH changes in the mold, cataphoresis, electroosmosis, or endosmosis were not successful. The addition of salts (CaCl(2), LiCl, NaCl, Na(2)SO(4), NaHCO(3), KCl, MgSO(4), sodium citrate, and sea water) to agar indicated that change of cations had more effect than anions upon galvanotaxis and that the effect was upon threshold values. K ion (0.01 M KCl) increased the lower threshold value to 8.0 microa./mm.(2) and the upper threshold value to 32.0 microa./mm.(2), whereas the Li ion (0.01 M LiCl) increased the lower threshold to only 4.0 microa./mm.(2) and the upper threshold to only 16.0 microa./mm.(2) The passage of electric current produced no increase in the rate of cathodal migration; neither was there a decrease until injurious current densities were reached. With increase of subthreshold current densities there was a progressive decrease in rate of migration toward the anode until complete anodal inhibition occurred. There was orientation at right angles to the electrodes in alternating current (60 cycle) with current density of 4.0 microa./mm.(2) and in direct current of 5.0 microa./mm.(2) when polarity of current was reversed every minute. It is concluded that the negative galvanotactic response of P. polycephalum is due to inhibition of migration on the anodal side of the plasmodium and that this inhibition results in the limitation of the normal migration of the mold to a cathodal direction. The mechanism of the anodal inhibition has not been elucidated.

  20. Molded polymer solar water heater

    DOEpatents

    Bourne, Richard C.; Lee, Brian E.

    2004-11-09

    A solar water heater has a rotationally-molded water box and a glazing subassembly disposed over the water box that enhances solar gain and provides an insulating air space between the outside environment and the water box. When used with a pressurized water system, an internal heat exchanger is integrally molded within the water box. Mounting and connection hardware is included to provide a rapid and secure method of installation.

  1. Oscillator for continuous casting mold

    SciTech Connect

    Behrends, G.

    1993-06-15

    In a continuous casting machine comprising a chilled mold disposed to receive molten metal which is discharged from the mold as a curved casting having a predetermined casting radius, and an oscillating drive for oscillating the mold relative to the casting, wherein the improvement described comprises mold guidance means having a first tensile element having an inner end and an outer end, the outer end being anchored to a fixed external frame and the inner end being secured to move with the mold, the first tensile element lying on a first radius extending from the center of curvature of said pre-determined casting radius; and a second tensile element having an inner and an outer end both anchored to a fixed external frame and secured to move with the mold intermediate the inner and outer ends, at least one end having variable tensioning means adapted to apply a tensile force to the second tensile element, the second tensile element lying on a second radius extending from the center of curvature of said predetermined casting radius.

  2. Aerodynamic characteristics and respiratory deposition of fungal fragments

    NASA Astrophysics Data System (ADS)

    Cho, Seung-Hyun; Seo, Sung-Chul; Schmechel, Detlef; Grinshpun, Sergey A.; Reponen, Tiina

    The purpose of this study was to investigate the aerodynamic characteristics of fungal fragments and to estimate their respiratory deposition. Fragments and spores of three different fungal species ( Aspergillus versicolor, Penicillium melinii, and Stachybotrys chartarum) were aerosolized by the fungal spore source strength tester (FSSST). An electrical low-pressure impactor (ELPI) measured the size distribution in real-time and collected the aerosolized fungal particles simultaneously onto 12 impactor stages in the size range of 0.3-10 μm utilizing water-soluble ZEF-X10 coating of the impaction stages to prevent spore bounce. For S. chartarum, the average concentration of released fungal fragments was 380 particles cm -3, which was about 514 times higher than that of spores. A. versicolor was found to release comparable amount of spores and fragments. Microscopic analysis confirmed that S. chartarum and A. versicolor did not show any significant spore bounce, whereas the size distribution of P. melinii fragments was masked by spore bounce. Respiratory deposition was calculated using a computer-based model, LUDEP 2.07, for an adult male and a 3-month-old infant utilizing the database on the concentration and size distribution of S. chartarum and A. versicolor aerosols measured by the ELPI. Total deposition fractions for fragments and spores were 27-46% and 84-95%, respectively, showing slightly higher values in an infant than in an adult. For S. chartarum, fragments demonstrated 230-250 fold higher respiratory deposition than spores, while the number of deposited fragments and spores of A. versicolor were comparable. It was revealed that the deposition ratio (the number of deposited fragments divided by that of deposited spores) in the lower airways for an infant was 4-5 times higher than that for an adult. As fungal fragments have been shown to contain mycotoxins and antigens, further exposure assessment should include the measurement of fungal fragments for

  3. Rotationally Molded Liquid Crystalline Polymers

    NASA Technical Reports Server (NTRS)

    Rogers, Martin; Scribben, Eric; Baird, Donald; Hulcher, Bruce

    2002-01-01

    Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semirigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers. This paper will also highlight the interactions between academia and small businesses in developing new products and processes.

  4. Rotationally Molded Liquid Crystalline Polymers

    NASA Technical Reports Server (NTRS)

    Rogers, Martin; Stevenson, Paige; Scribben, Eric; Baird, Donald; Hulcher, Bruce

    2002-01-01

    Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers advantages of low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semi-rigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers.

  5. Experimental study of glass molding process and transcription characteristics of mold surface in molding of aspheric glass lenses

    NASA Astrophysics Data System (ADS)

    Cha, Du Hwan; Park, Heung Su; Hwang, Yeon; Kim, Jeong-Ho; Kim, Hye-Jeong

    2011-03-01

    The effects of the process parameters in the molding of aspheric glass lenses for camera phone modules have been investigated experimentally and the surface topographies of the mold and the molded lens were compared to ascertain the transcription characteristics. The molding conditions were optimized with respect to the form error (PV) (the response variable) of the molded lens. The experimental conditions were obtained by employing a factorial design method. From the analysis of variance (ANOVA) and P-value (significance level), the slow cooling rate was found to affect the response variable most significantly. For the form topography, the lens molded under the optimum molding condition showed a transcription ratio of 93.4% against the mold.

  6. Staged mold for encapsulating hazardous wastes

    DOEpatents

    Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

    1988-01-01

    A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

  7. Staged mold for encapsulating hazardous wastes

    DOEpatents

    Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

    1990-01-01

    A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

  8. Flow behavior in liquid molding

    NASA Technical Reports Server (NTRS)

    Hunston, D.; Phelan, F.; Parnas, R.

    1992-01-01

    The liquid molding (LM) process for manufacturing polymer composites with structural properties has the potential to significantly lower fabrication costs and increase production rates. LM includes both resin transfer molding and structural reaction injection molding. To achieve this potential, however, the underlying science base must be improved to facilitate effective process optimization and implementation of on-line process control. The National Institute of Standards and Technology (NIST) has a major program in LM that includes materials characterization, process simulation models, on-line process monitoring and control, and the fabrication of test specimens. The results of this program are applied to real parts through cooperative projects with industry. The key feature in the effort is a comprehensive and integrated approach to the processing science aspects of LM. This paper briefly outlines the NIST program and uses several examples to illustrate the work.

  9. MOLD-SPECIFIC QUANTITATIVE PCR: THE EMERGING STANDARD IN MOLD ANALYSIS

    EPA Science Inventory

    Molds can cause health problems like infections and allergies, destroy crops, and contaminate our food or pharmaceuticals. We can't avoid molds. Molds are essential players in the biological processes on earth, but we can now identify and quantify the molds that will be most pr...

  10. Making Internal Molds Of Long, Curved Tubes

    NASA Technical Reports Server (NTRS)

    Burley, Richard K.

    1989-01-01

    Mold material carried to internal weld joint and removed after impression taken. Remotely operated device makes impression mold of interior surface of tube at weld joint. Mold provides indication of extent of mismatch between members at joint. Maneuvered to weld inspected through curved tube 3 in. in diameter by 50 in. long. Readily adapted to making molds to measure depth of corrosion in boiler tubes or other pipes.

  11. Blow molding of melt processible rubber

    SciTech Connect

    Abell, W.R.; Stuart, R.E.; Myrick, R.E.

    1991-07-01

    This article discusses the advantages of making hollow rubber parts by blow molding thermoplastic elastomers (TPEs) versus conventional rubber processing. It describes the various types of blow molding processes and it provides some insight into the rheological properties of melt processible rubber (MPR) and how MPR should be molded by each of these processes. A number of blow molded applications for MPR are also discussed.

  12. The Mold that Almost Ate the Principal

    ERIC Educational Resources Information Center

    Barry, Wayne; Bishop, Chuck; Byars, Jennifer

    2006-01-01

    New-building mold was a bane for many home construction companies and new homeowners during the 1990s. It was not unusual to read or watch the news and see the tragedy played out in one's local community. Untold, however, is the story of the toll new-building mold can take on school systems and their principals, especially as these mold problems…

  13. Attack of the Killer Mold Spores.

    ERIC Educational Resources Information Center

    Moore, Mary

    1999-01-01

    Describes experiences at the Arkansas State University at Jonesboro library when mold was discovered in a large portion of the monograph collection. Discusses causes of mold formation, equipment needed, news media coverage, staff involvement in the cleanup, and possible health hazards from mold. (LRW)

  14. Injection Molding of Plastics from Agricultural Materials

    SciTech Connect

    Bhattacharya, M.; Ruan, R.

    2001-02-22

    The objective of this research was to conduct a systematic study to relate injection molding parameters to properties of blends of starch and synthetic polymer. From this study, we wished to develop a thorough understanding of the injection molding process and gain significant insight into designing molds and aiding in developing products cheaply and efficiently.

  15. ALLERGIC POTENTIAL OF INDOOR MOLDS

    EPA Science Inventory

    Many fungi have been associated with allergic lung disease, but few are well studied and even fewer allergens of fungal origin are well characterized. Exposure to damp moldy environments has been associated with the exacerbation of asthma, but the role of molds in the induction o...

  16. Emittance of investment casting molds

    SciTech Connect

    Havstad, M.A.

    1994-07-15

    This document describes measurements of the directional spectral emittance of four ceramic mold materials. The work was performed with the samples at {approximately} 900{degree}C in a vacuum vessel pumped to {approximately}3 {times} 10{sup {minus}6}Torr. Results conform to expectations derived from prior work done with similar samples.

  17. Is Mold the New Asbestos?

    ERIC Educational Resources Information Center

    Colgan, Craig

    2003-01-01

    Mold and indoor air quality (IAQ) are matters of major concern to architects and their educational clients. The Environmental Protection Agency's Indoor Air Quality Tools for Schools program offers help to districts seeking to tackle IAQ issues. Strengthening community relations is one way to be ready in case of a bad environmental or IAQ report.…

  18. ANIMAL MODELS OF MOLD ALLERGY

    EPA Science Inventory

    The concept of molds as causative agents for allergy/asthma is not new. In fact many fungal genera have been associated with allergic lung disease, but only a few fungi are well studied and even fewer fungal allergens well characterized. The complexity and variety of fungal pro...

  19. Molded Concrete Center Mine Wall

    NASA Technical Reports Server (NTRS)

    Lewis, E. V.

    1987-01-01

    Proposed semiautomatic system forms concrete-foam wall along middle of coal-mine passage. Wall helps support roof and divides passage into two conduits needed for ventilation of coal face. Mobile mold and concrete-foam generator form sections of wall in place.

  20. Mold production for polymer optics

    NASA Astrophysics Data System (ADS)

    Boerret, Rainer; Raab, Jonas; Speich, Marco

    2014-09-01

    The fields of application for polymer optics are huge and thus the need for polymer optics is steadily growing. Most polymer optics are produced in high numbers by injection molding. Therefore molds and dies that fulfill special requirements are needed. Polishing is usually the last process in the common process chain for production of molds for polymer optics. Usually this process step is done manually by experienced polishers. Due to the small number of skilled professionals and health problems because of the monotonous work the idea was to support or probably supersede manual polishing. Polishing using an industrial robot as movement system enables totally new possibilities in automated polishing. This work focuses on the surface generation with a newly designed polishing setup and on the code generation for the robot movement. The process starts on ground surfaces and with different tools and polishing agents surfaces that fulfill the requirements for injection molding of optics can be achieved. To achieve this the attention has to be focused not only on the process itself but also on tool path generation. A proprietary software developed in the Centre for Optical Technologies in Aalen University allows the tool path generation on almost any surface. This allows the usage of the newly developed polishing processes on different surfaces and enables an easy adaption. Details of process and software development will be presented as well as results from different polishing tests on different surfaces.

  1. Precision injection molding of freeform optics

    NASA Astrophysics Data System (ADS)

    Fang, Fengzhou; Zhang, Nan; Zhang, Xiaodong

    2016-08-01

    Precision injection molding is the most efficient mass production technology for manufacturing plastic optics. Applications of plastic optics in field of imaging, illumination, and concentration demonstrate a variety of complex surface forms, developing from conventional plano and spherical surfaces to aspheric and freeform surfaces. It requires high optical quality with high form accuracy and lower residual stresses, which challenges both optical tool inserts machining and precision injection molding process. The present paper reviews recent progress in mold tool machining and precision injection molding, with more emphasis on precision injection molding. The challenges and future development trend are also discussed.

  2. HIGH TEMPERATURE REFRACTORY COATING FOR GRAPHITE MOLDS

    DOEpatents

    Stoddard, S.D.

    1958-10-21

    An improved foundry mold coating for use with graphite molds used in the casting of uranium is presented. The refractory mold coating serves to keep the molten uranium from contact with graphite of the mold and thus prevents carbon pickup by the molten metal. The refractory coating is made by dry mixing certain specific amounts of aluminum oxide, bentonite, Tennessee ball clay, and a soluble silicate salt. Water is then added to the mixture and the suspension thus formed is applied by spraying onto the mold.

  3. Injection molding ceramics to high green densities

    NASA Technical Reports Server (NTRS)

    Mangels, J. A.; Williams, R. M.

    1983-01-01

    The injection molding behavior of a concentrated suspension of Si powder in wax was studied. It was found that the injection molding behavior was a function of the processing techniques used to generate the powder. Dry ball-milled powders had the best molding behavior, while air classified and impact-milled powders demonstrated poorer injection moldability. The relative viscosity of these molding batches was studied as a function of powder properties: distribution shape, surface area, packing density, and particle morphology. The experimental behavior, in all cases, followed existing theories. The relative viscosity of an injection molding composition composed of dry ball-milled powders could be expressed using Farris' relation.

  4. Recombinant expression of a GH12 β-glucanase carrying its own signal peptide from Stachybotrys atra in yeast and filamentous fungi.

    PubMed

    Picart, Pere; Orejas, Margarita; Pastor, F I Javier

    2016-08-01

    The β-glucanase Cel12A gene from Stachybotrys atra has been cloned and heterologously expressed in Aspergillus nidulans and Saccharomyces cerevisiae. The recombinant strains constructed, contained the exonic sequence of cel12A including its own signal peptide coding sequence. SDS-PAGE and zymography revealed that recombinant Cel12A has a molecular mass of 24 kDa which agrees with that deduced from its amino acid sequence, indicating that it is expressed in the non-glycosylated active form. Recombinant A. nidulans showed about eightfold greater activity yield than S. cerevisiae recombinant strain, namely 0.71 and 0.09 β-glucanase Units/ml of culture, respectively. In both host strains most of the activity was secreted to the extracellular media, evidencing the functionality of Cel12A signal peptide in yeast and fungi. This novel signal peptide might facilitate the expression and efficient secretion of other recombinant proteins difficult to secrete. PMID:27339304

  5. Influence of mold length and mold heat transfer on horizontal continuous casting of nonferrous alloy rods

    NASA Astrophysics Data System (ADS)

    Verwijs, J. P.; Weckman, D. C.

    1988-04-01

    The influence of mold length and mold heat transfer on the conventional hot-top D.C. continuous casting process was studied through numerical simulations and experiments with horizontally cast 20 mm diameter lead and zinc rods. The minimum casting speed was found to be a nonlinear function of the mold length. For short molds, an inverse relationship between mold length and minimum casting speed was observed. However, the minimum casting speed for zinc cast from molds longer than 12 mm was constant at 2.5 mm/s. For lead cast in molds longer than 12 mm, the minimum observed casting speed was constant at 4.0 mm/s. The observed nonlinear relationship between minimum casting speed and mold length was predicted using a numerical model of the process. For this, an analytical expression for the mold boundary conditions was derived which included the influence of gas gap formation between the rod and the mold due to thermoelastic deformations of both the rod and the mold. Correlation between observed and predicted behavior was demonstrated for both the lead and zinc rods. Maximum casting speed was observed to increase with increased mold length; however, this speed was found to be critically dependent on process attributes such as mold and pinch wheel alignment and mold lubrication.

  6. Precision compression molding of chalcogenide glass optical elements

    NASA Astrophysics Data System (ADS)

    Qi, Chaowei; Ma, Tao; Chen, Fan

    2013-12-01

    Precision glass molding process (GMP) is a promising process to manufacture small precision optical elements in large volume. In this paper, we report on the fabrication of a molded chalcogenide glass lens as an optical element. A set of mold was designed and manufactured with silicon carbide material for the molding test. The structure of the mold set was semi-closed and detachable which can make the molded lens easy releasing with non-invasion. The surfaces of the mold cores are coated with thin protecting DLC film to relieve adhesion problem and increase the working life. Experiments were also performed using a precision glass molding machine Toshiba GMP-311V to determine the molding parameters i.e. molding temperature, pressure and cooling rate. The glass lens breakage during precision molding process was analyzed according to the glass property and the molding parameters. By modifying the mold design and optimization the processing parameters, ultimately achieve the desired molded lens.

  7. High Temperature Transfer Molding Resins

    NASA Technical Reports Server (NTRS)

    Connell, John W. (Inventor); Smith, Joseph G., Jr. (Inventor); Hergenrother, Paul M. (Inventor)

    2000-01-01

    High temperature resins containing phenylethynyl groups that are processable by transfer molding have been prepared. These phenylethynyl containing oligomers were prepared from aromatic diamines containing phenylethynyl groups and various ratios of phthalic anhydride and 4-phenylethynlphthalic anhydride in glacial acetic acid to form a mixture of imide compounds in one step. This synthetic approach is advantageous since the products are a mixture of compounds and consequently exhibit a relatively low melting temperature. In addition, these materials exhibit low melt viscosities which are stable for several hours at 210-275 C, and since the thermal reaction of the phenylethynyl group does not occur to any appreciable extent at temperatures below 300 C, these materials have a broad processing window. Upon thermal cure at approximately 300-350 C, the phenylethynyl groups react to provide a crosslinked resin system. These new materials exhibit excellent properties and are potentially useful as adhesives, coatings, films, moldings and composite matrices.

  8. Compression molding of aerogel microspheres

    DOEpatents

    Pekala, Richard W.; Hrubesh, Lawrence W.

    1998-03-24

    An aerogel composite material produced by compression molding of aerogel microspheres (powders) mixed together with a small percentage of polymer binder to form monolithic shapes in a cost-effective manner. The aerogel composites are formed by mixing aerogel microspheres with a polymer binder, placing the mixture in a mold and heating under pressure, which results in a composite with a density of 50-800 kg/m.sup.3 (0.05-0.80 g/cc). The thermal conductivity of the thus formed aerogel composite is below that of air, but higher than the thermal conductivity of monolithic aerogels. The resulting aerogel composites are attractive for applications such as thermal insulation since fabrication thereof does not require large and expensive processing equipment. In addition to thermal insulation, the aerogel composites may be utilized for filtration, ICF target, double layer capacitors, and capacitive deionization.

  9. Compression molding of aerogel microspheres

    DOEpatents

    Pekala, R.W.; Hrubesh, L.W.

    1998-03-24

    An aerogel composite material produced by compression molding of aerogel microspheres (powders) mixed together with a small percentage of polymer binder to form monolithic shapes in a cost-effective manner is disclosed. The aerogel composites are formed by mixing aerogel microspheres with a polymer binder, placing the mixture in a mold and heating under pressure, which results in a composite with a density of 50--800 kg/m{sup 3} (0.05--0.80 g/cc). The thermal conductivity of the thus formed aerogel composite is below that of air, but higher than the thermal conductivity of monolithic aerogels. The resulting aerogel composites are attractive for applications such as thermal insulation since fabrication thereof does not require large and expensive processing equipment. In addition to thermal insulation, the aerogel composites may be utilized for filtration, ICF target, double layer capacitors, and capacitive deionization. 4 figs.

  10. Onychomycosis due to opportunistic molds*

    PubMed Central

    Martínez-Herrera, Erick Obed; Arroyo-Camarena, Stefanie; Tejada-García, Diana Luz; Porras-López, Carlos Francisco; Arenas, Roberto

    2015-01-01

    BACKGROUND: Onychomycosis are caused by dermatophytes and Candida, but rarely by non- dermatophyte molds. These opportunistic agents are filamentous fungi found as soil and plant pathogens. OBJECTIVES: To determine the frequency of opportunistic molds in onychomycosis. METHODS: A retrospective analysis of 4,220 cases with onychomycosis, diagnosed in a 39-month period at the Institute of Dermatology and Skin surgery "Prof. Dr. Fernando A. Cordero C." in Guatemala City, and confirmed with a positive KOH test and culture. RESULTS: 32 cases (0.76%) of onychomycosis caused by opportunistic molds were confirmed. The most affected age group ranged from 41 to 65 years (15 patients, 46.9%) and females were more commonly affected (21 cases, 65.6%) than males. Lateral and distal subungual onychomycosis (OSD-L) was detected in 20 cases (62.5%). The microscopic examination with KOH showed filaments in 19 cases (59.4%), dermatophytoma in 9 cases (28.1%), spores in 2 cases (6.25%), and filaments and spores in 2 cases (6.25%). Etiologic agents: Aspergillus sp., 11 cases (34.4%); Scopulariopsis brevicaulis, 8 cases (25.0%); Cladosporium sp., 3 cases (9.4%); Acremonium sp., 2 cases (6.25%); Paecilomyces sp., 2 cases (6.25%); Tritirachium oryzae, 2 cases (6.25%); Fusarium sp., Phialophora sp., Rhizopus sp. and Alternaria alternate, 1 case (3.1%) each. CONCLUSIONS: We found onychomycosis by opportunistic molds in 0.76% of the cases and DLSO was present in 62.5%. The most frequent isolated etiological agents were: Aspergillus sp. and Scopulariopsis brevicaulis. PMID:26131862

  11. Gating of Permanent Molds for ALuminum Casting

    SciTech Connect

    David Schwam; John F. Wallace; Tom Engle; Qingming Chang

    2004-03-30

    This report summarizes a two-year project, DE-FC07-01ID13983 that concerns the gating of aluminum castings in permanent molds. The main goal of the project is to improve the quality of aluminum castings produced in permanent molds. The approach taken was determine how the vertical type gating systems used for permanent mold castings can be designed to fill the mold cavity with a minimum of damage to the quality of the resulting casting. It is evident that somewhat different systems are preferred for different shapes and sizes of aluminum castings. The main problems caused by improper gating are entrained aluminum oxide films and entrapped gas. The project highlights the characteristic features of gating systems used in permanent mold aluminum foundries and recommends gating procedures designed to avoid common defects. The study also provides direct evidence on the filling pattern and heat flow behavior in permanent mold castings.

  12. Amorphous materials molded IR lens progress report

    NASA Astrophysics Data System (ADS)

    Hilton, A. R., Sr.; McCord, James; Timm, Ronald; Le Blanc, R. A.

    2008-04-01

    Amorphous Materials began in 2000 a joint program with Lockheed Martin in Orlando to develop molding technology required to produce infrared lenses from chalcogenide glasses. Preliminary results were reported at this SPIE meeting by Amy Graham1 in 2003. The program ended in 2004. Since that time, AMI has concentrated on improving results from two low softening glasses, Amtir 4&5. Both glasses have been fully characterized and antireflection coatings have been developed for each. Lenses have been molded from both glasses, from Amtir 6 and from C1 Core glass. A Zygo unit is used to evaluate the results of each molded lens as a guide to improving the molding process. Expansion into a larger building has provided room for five production molding units. Molded lens sizes have ranged from 8 mm to 136 mm in diameter. Recent results will be presented

  13. Hydrogen silsesquioxane mold coatings for improved replication of nanopatterns by injection molding

    NASA Astrophysics Data System (ADS)

    Hobæk, Thor Christian; Matschuk, Maria; Kafka, Jan; Pranov, Henrik J.; Larsen, Niels B.

    2015-03-01

    We demonstrate the replication of nanosized pillars in polymer (cyclic olefin copolymer) by injection molding using nanostructured thermally cured hydrogen silsesquioxane (HSQ) ceramic coatings on stainless steel mold inserts with mold nanostructures produced by a simple embossing process. At isothermal mold conditions, the average pillar height increases by up to 100% and a more uniform height distribution is observed compared to a traditional metal mold insert. Thermal heat transfer simulations predict that the HSQ film retards the cooling of the polymer melt during the initial stages of replication, thus allowing more time to fill the nanoscale cavities compared to standard metal molds. A monolayer of a fluorinated silane (heptadecafluorotrichlorosilane) deposited on the mold surface reduces the mold/polymer interfacial energy to support demolding of the polymer replica. The mechanical stability of thermally cured HSQ makes it a promising material for nanopattern replication on an industrial scale without the need for slow and energy intensive variotherm processes.

  14. Mold in My School: What Do I Do?

    ERIC Educational Resources Information Center

    National Clearinghouse for Educational Facilities, Washington, DC.

    This publication provides information on the most important indoor mold-related health concerns and discusses how school districts can keep school facilities mold-free and avoid these problems. The document addresses when to be concerned, how molds cause health problems, symptoms caused by mold allergies, indoor molds that form toxins, who is most…

  15. Mold For Casting Radius-Inspection Specimens

    NASA Technical Reports Server (NTRS)

    Ball, Robert N.

    1988-01-01

    Thin replicas viewed on comparator without sectioning. New mold machined from piece of transparent poly(methyl methacrylate). Fits around base of post. Two slots machined into inner surface form channels for casting inspection sections. Bottom of mold fits flush against surface around bottom of post. When surface slanted, mold automatically aligns in proper orientation. Time required to inspect elliptical radii located at bottoms of series of small posts reduced from 18 hours to 3 hours.

  16. Porous media heat transfer for injection molding

    DOEpatents

    Beer, Neil Reginald

    2016-05-31

    The cooling of injection molded plastic is targeted. Coolant flows into a porous medium disposed within an injection molding component via a porous medium inlet. The porous medium is thermally coupled to a mold cavity configured to receive injected liquid plastic. The porous medium beneficially allows for an increased rate of heat transfer from the injected liquid plastic to the coolant and provides additional structural support over a hollow cooling well. When the temperature of the injected liquid plastic falls below a solidifying temperature threshold, the molded component is ejected and collected.

  17. Mold Infections of the Central Nervous System

    PubMed Central

    McCarthy, Matthew; Rosengart, Axel; Schuetz, Audrey N.; Kontoyiannis, Dimitrios P.; Walsh, Thomas J.

    2016-01-01

    The recent outbreak of exserohilum rostratum meningitis linked to epidural injections of methylprednisolone acetate has brought renewed attention to mold infections of the central nervous system (CNS).1 Although uncommon, these infections are often devastating and difficult to treat. This focused review of the epidemiologic aspects, clinical characteristics, and treatment of mold infections of the CNS covers a group of common pathogens: aspergillus, fusarium, and scedosporium species, molds in the order Mucorales, and dematiaceous molds. Infections caused by these pathogen groups have distinctive epidemiologic profiles, clinical manifestations, microbiologic characteristics, and therapeutic implications, all of which clinicians should understand. PMID:25006721

  18. Analysis of optical properties in injection-molded and compression-molded optical lenses.

    PubMed

    Wang, Chung Yen; Wang, Pei Jen

    2014-04-10

    Numerical mold-flow simulations and experimental measurements for injection-molded lenses have been investigated in form accuracy on a two-cavity mold with various process conditions. First, form profiles of the molded lenses have been measured together with the corresponding simulated mold-temperature distribution and displacement distribution of the lens in the z direction. A flow-through type layout of cooling channels has been devised for balance of mold-temperature distribution in mold cavities with various parametric distances for assessments in uniformity of temperature distribution. Finally, a compression-molding process is proposed for the post-process of birefringence relaxation as well as adequate form accuracy of lenses. In conclusion, optimization of process parameters to achieve good form accuracy in a multicavity mold with symmetric geometry but nonuniform cooling conditions is difficult. A good design of cooling channels plus optimized process conditions could provide uniform mold-temperature distribution so that molded lenses of good quality would be possible. Then, the profile deviation of lenses could be further compensated by profile geometry corrections. In conclusion, the post-compression-molding process could make birefringence-free plastic lenses with good form accuracy.

  19. Indoor mold and Children's health

    PubMed

    Etzel; Rylander

    1999-06-01

    Reactive airways disease in children is increasing in many countries around the world. The clinical diagnosis of asthma or reactive airways disease includes a variable airflow and an increased sensitivity in the airways. This condition can develop after an augmented reaction to a specific agent (allergen) and may cause a life-threatening situation within a very short period of exposure. It can also develop after a long-term exposure to irritating agents that cause an inflammation in the airways in the absence of an allergen. (paragraph) Several environmental agents have been shown to be associated with the increased incidence of childhood asthma. They include allergens, cat dander, outdoor as well as indoor air pollution, cooking fumes, and infections. There is, however, increasing evidence that mold growth indoors in damp buildings is an important risk factor. About 30 investigations from various countries around the world have demonstrated a close relationship between living in damp homes or homes with mold growth, and the extent of adverse respiratory symptoms in children. Some studies show a relation between dampness/mold and objective measures of lung function. Apart from airways symptoms, some studies demonstrate the presence of general symptoms that include fatigue and headache and symptoms from the central nervous system. At excessive exposures, an increased risk for hemorraghic pneumonia and death among infants has been reported. (paragraph) The described effects may have important consequences for children in the early years of life. A child's immune system is developing from birth to adolescence and requires a natural, physiologic stimulation with antigens as well as inflammatory agents. Any disturbances of this normal maturing process will increase the risk for abnormal reactions to inhaled antigens and inflammagenic agents in the environment. (paragraph) The knowledge about health risks due to mold exposure is not widespread and health authorities in

  20. Use of acrylic sheet molds for elastomeric products

    NASA Technical Reports Server (NTRS)

    Heisman, R. M.; Koerner, A. E.; Messineo, S. M.

    1970-01-01

    Molds constructed of acrylic sheet are more easily machined than metal, are transparent to ensure complete filling during injection, and have smooth surfaces free of contamination. Technique eliminates flashing on molded parts and mold release agents.

  1. Plastic molds reduce cost of encapsulating electric cable connectors

    NASA Technical Reports Server (NTRS)

    Knott, D.

    1964-01-01

    Resin casting of the aluminum master pattern forms a plastic mold for encapsulating a cable connector. An elastomer is injected into the mold and cured. The mold is disassembled leaving an elastomeric encapsulation around the connector.

  2. Commercial and Residential Water Damage: The Mold Connection.

    ERIC Educational Resources Information Center

    Williams, Del

    2002-01-01

    Describes the problem of toxic mold in residential and commercial property resulting from excess moisture. Includes common sources of unwanted moisture, design and construction flaws, determining the presence of mold, and advice for identifying and hiring reputable mold remediators. (PKP)

  3. INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER FREDERICK THOMAS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER FREDERICK THOMAS MOLDING A NO. 8507. - Lawler Machine & Foundry Company, Molding Area, 760 North Forty-fourth Street, Birmingham, Jefferson County, AL

  4. INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER, R. L. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER, R. L. BRANDY, MOLDING A RAIL CASTING (LAWLER NO. 1337). - Lawler Machine & Foundry Company, Molding Area, 760 North Forty-fourth Street, Birmingham, Jefferson County, AL

  5. Mold

    MedlinePlus

    ... Clin Immunol 130(1):267–270. 12 Chulada PC, Kennedy S, Mvula MM, Jaffee K, Wildfire J, Thornton ... 120(11): 1592–1599. 13 Grimsley LF, Chulada PC, Kennedy S, White L, Wildfire J, Cohn RD, Mitchell ...

  6. Process for Making Ceramic Mold

    NASA Technical Reports Server (NTRS)

    Buck, Gregory M. (Inventor); Vasquez, Peter (Inventor)

    2001-01-01

    An improved process for slip casting molds that can be more economically automated and that also exhibits greater dimensional stability is disclosed. The process involves subjecting an investment pattern, preferably made from wax, to successive cycles of wet-dipping in a slurry of colloidal, silica-based binder and dry powder-coating, or stuccoing with plaster of Paris or calcium sulfate mixtures to produce a multi-layer shell over the pattern. The invention as claimed entails applying a primary and a secondary coating to the investment pattern. At least two wet-dipping on in a primary slurry and dry-stuccoing cycles provide the primary coating, and an additional two wet-dippings and dry-stuccoing cycles provide the secondary, or back-up, coating. The primary and secondary coatings produce a multi-layered shell pattern. The multi-layered shell pattern is placed in a furnace first to cure and harden, and then to vaporize the investment pattern, leaving a detailed, high precision shell mold.

  7. The Thermal Distortion of a Funnel Mold

    NASA Astrophysics Data System (ADS)

    Hibbeler, Lance C.; Thomas, Brian G.; Schimmel, Ronald C.; Abbel, Gert

    2012-10-01

    This article investigates the thermal distortion of a funnel mold for continuous casting of thin slabs and explores the implications on taper and solidification of the steel shell. The three-dimensional mold temperatures are calculated using shell-mold heat flux and cooling water profiles that were calibrated with plant measurements. The thermal stresses and distorted shape of the mold are calculated with a detailed finite-element model of a symmetric fourth of the entire mold and waterbox assembly, and they are validated with plant thermocouple data and measurements of the wear of the narrow-face copper mold plates. The narrow-face mold distorts into the typical parabolic arc, and the wide face distorts into a "W" shape owing to the large variation in bolt stiffnesses. The thermal expansion of the wide face works against the applied narrow-face taper and funnel effects, so the effect of thermal distortion must be considered to accurately predict the ideal mold taper.

  8. Mold Remediation in Schools and Commercial Buildings.

    ERIC Educational Resources Information Center

    Environmental Protection Agency, Washington, DC. Office of Radiation and Indoor Air.

    This document describes how to investigate and evaluate moisture and mold problems in educational facilities, and presents the key steps for implementing a remediation plan. A checklist is provided for conducting mold remediation efforts along with a resource list of helpful organizations and governmental agencies. Appendices contain a glossary,…

  9. Dynamic Feed Control For Injection Molding

    DOEpatents

    Kazmer, David O.

    1996-09-17

    The invention provides methods and apparatus in which mold material flows through a gate into a mold cavity that defines the shape of a desired part. An adjustable valve is provided that is operable to change dynamically the effective size of the gate to control the flow of mold material through the gate. The valve is adjustable while the mold material is flowing through the gate into the mold cavity. A sensor is provided for sensing a process condition while the part is being molded. During molding, the valve is adjusted based at least in part on information from the sensor. In the preferred embodiment, the adjustable valve is controlled by a digital computer, which includes circuitry for acquiring data from the sensor, processing circuitry for computing a desired position of the valve based on the data from the sensor and a control data file containing target process conditions, and control circuitry for generating signals to control a valve driver to adjust the position of the valve. More complex embodiments include a plurality of gates, sensors, and controllable valves. Each valve is individually controllable so that process conditions corresponding to each gate can be adjusted independently. This allows for great flexibility in the control of injection molding to produce complex, high-quality parts.

  10. 21ST CENTURY MOLD ANALYSIS IN FOOD

    EPA Science Inventory

    Traditionally, the indoor air community has relied on mold analysis performed by either microscopic observations or the culturing of molds on various media to assess indoor air quality. These techniques were developed in the 19th century and are very laborious and time consumin...

  11. EXPOSURE OF CHILDREN TO INDOOR MOLDS

    EPA Science Inventory

    Children now spend more than 90% of their time indoors. Thus, any exposure to indoor pollutants may be critical to their health. Molds are one of the most important pollutants children are exposed to indoors. Molds produce hundreds of allergens and toxins. These products ha...

  12. Strong, easy-to-mold, spiral buttress thread

    NASA Technical Reports Server (NTRS)

    Heier, W. C.

    1971-01-01

    Buttress thread with steep taper connects two molded plastic cylinders without changing wall thickness or sacrificing longitudinal strength at the juncture. Technique lends itself to conventional molding methods.

  13. IC chip stress during plastic package molding

    SciTech Connect

    Palmer, D.W.; Benson, D.A.; Peterson, D.W.; Sweet, J.N.

    1998-02-01

    Approximately 95% of the world`s integrated chips are packaged using a hot, high pressure transfer molding process. The stress created by the flow of silica powder loaded epoxy can displace the fine bonding wires and can even distort the metalization patterns under the protective chip passivation layer. In this study the authors developed a technique to measure the mechanical stress over the surface of an integrated circuit during the molding process. A CMOS test chip with 25 diffused resistor stress sensors was applied to a commercial lead frame. Both compression and shear stresses were measured at all 25 locations on the surface of the chip every 50 milliseconds during molding. These measurements have a fine time and stress resolution which should allow comparison with computer simulation of the molding process, thus allowing optimization of both the manufacturing process and mold geometry.

  14. Castable plastic mold with electroplatable base

    DOEpatents

    Domeier, Linda A.; Morales, Alfredo M.; Gonzales, Marcela G.; Keifer, Patrick M.

    2004-01-20

    A sacrificial plastic mold having an electroplatable backing is provided as are methods of making such a mold via the infusion of a castable liquid formulation through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale master mold. Upon casting and demolding, the porous metal substrate is embedded within the cast formulation and projects a plastic structure with features determined by the mold tool. The plastic structure provides a sacrificial plastic mold mechanically bonded to the porous metal substrate, which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved, leaving the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

  15. Fabrication of metallic nanodots in large-area arrays by mold-to-mold cross imprinting (MTMCI).

    PubMed

    Kwon, Sunghoon; Yan, Xiaoming; Contreras, Anthony M; Liddle, J Alexander; Somorjai, Gabor A; Bokor, Jeffrey

    2005-12-01

    We have developed a mold-to-mold cross imprint (MTMCI) process, which redefines an imprint mold with another imprint mold. By performing MTMCI on two identical imprint molds with silicon spacer nanowires in a perpendicular arrangement, we fabricated a large array of sub-30-nm silicon nanopillars. Large-area arrays of Pt dots are then produced using nanoimprint lithography with the silicon nanopillar mold. PMID:16351215

  16. Mold Simulator Study of the Initial Solidification of Molten Steel in Continuous Casting Mold: Part II. Effects of Mold Oscillation and Mold Level Fluctuation

    NASA Astrophysics Data System (ADS)

    Zhang, Haihui; Wang, Wanlin

    2016-04-01

    The surface quality of the continuous casting strands is closely related to the initial solidification of liquid steel in the vicinity of the mold meniscus, and thus the clear understanding of the behavior of molten steel initial solidification would be of great importance for the control of the quality of final slab. With the development of the mold simulator techniques, the complex interrelationship between the solidified shell surface profile, heat flux, shell thickness, mold level fluctuation, and the infiltrated slag film was well illustrated in our previous study. As the second part, this article investigated the effect of the mold oscillation frequency, stroke, and mold level fluctuation on the initial solidification of the molten steel through the conduction of five different experiments. Results suggested that in the case of the stable mold level, the oscillation marks (OMs) exhibit equally spaced horizon depressions on the shell surface, where the heat flux at the meniscus area raises rapidly during negative strip time (NST) period and the presence of each OMs on the shell surface is corresponding to a peak value of the heat flux variation rate. Otherwise, the shell surface is poorly defined by the existence of wave-type defects, such as ripples or deep depressions, and the heat flux variation is irregular during NST period. The rising of the mold level leads to the longer-pitch and deeper OMs formation; conversely, the falling of mold level introduces shorter-pitch and shallower OMs. With the increase of the mold oscillation frequency, the average value of the low-frequency heat flux at the meniscus increases; however, it decreases when the mold oscillation stroke increases. Additionally, the variation amplitude of the high-frequency temperature and the high-frequency heat flux decreases with the increase of the oscillation frequency and the reduction of the oscillation stroke.

  17. Cloning, molecular characterization, and mRNA expression of the thermostable family 3 β-glucosidase from the rare fungus Stachybotrys microspora.

    PubMed

    Abdeljalil, Salma; Trigui-Lahiani, Héla; Lazzez, Houcine; Gargouri, Ali

    2013-07-01

    The filamentous fungus Stachybotrys microspora possess a rich β-glucosidase system composed of five β-glucosidases. Three of them were already purified to homogeneity and characterized. In order to isolate the β-glucosidase genes from S. microspora and study their regulation, a PCR strategy using consensus primers was used as a first step. This approach enabled the isolation of three different fragments of family 3 β-glucosidase gene. A representative genomic library was constructed and probed with one amplified fragment gene belonging to family 3 of β-glucosidase. After two rounds of hybridization, seven clones were obtained and the analysis of DNA plasmids leads to the isolation of one clone (CF3) with the largest insert of 7 kb. The regulatory region shows multiple TC-rich elements characteristic of constitutive promoter, explaining the expression of this gene under glucose condition, as shown by zymogram and RT-PCR analysis. The tertiary structure of the deduced amino acid sequence of Smbgl3 was predicted and has shown three conserved domains: an (α/β)8 triose phosphate isomerase (TIM) barrel, (α/β)5 sandwich, and fibronectin type III domain involved in protein thermostability. Zymogram analysis highlighted such thermostable character of this novel β-glucosidase.

  18. Cloning, molecular characterization, and mRNA expression of the thermostable family 3 β-glucosidase from the rare fungus Stachybotrys microspora.

    PubMed

    Abdeljalil, Salma; Trigui-Lahiani, Héla; Lazzez, Houcine; Gargouri, Ali

    2013-07-01

    The filamentous fungus Stachybotrys microspora possess a rich β-glucosidase system composed of five β-glucosidases. Three of them were already purified to homogeneity and characterized. In order to isolate the β-glucosidase genes from S. microspora and study their regulation, a PCR strategy using consensus primers was used as a first step. This approach enabled the isolation of three different fragments of family 3 β-glucosidase gene. A representative genomic library was constructed and probed with one amplified fragment gene belonging to family 3 of β-glucosidase. After two rounds of hybridization, seven clones were obtained and the analysis of DNA plasmids leads to the isolation of one clone (CF3) with the largest insert of 7 kb. The regulatory region shows multiple TC-rich elements characteristic of constitutive promoter, explaining the expression of this gene under glucose condition, as shown by zymogram and RT-PCR analysis. The tertiary structure of the deduced amino acid sequence of Smbgl3 was predicted and has shown three conserved domains: an (α/β)8 triose phosphate isomerase (TIM) barrel, (α/β)5 sandwich, and fibronectin type III domain involved in protein thermostability. Zymogram analysis highlighted such thermostable character of this novel β-glucosidase. PMID:23242634

  19. Characterization of fiberglass-filled diallyl phthalate plastic molding resins and molded parts

    SciTech Connect

    Whitaker, R.B.; Glaub, J.E.; Bonekowski, N.R.; Gillham, P.D.

    1980-12-01

    Characterization of diallyl phthalate (DAP) molding resins was undertaken by differential scanning calorimetry (DSC) and by combined size exclusion chromatography (SEC)/low angle laser light scattering (LALLS) in order to better predict moldability and storage life limits. Completeness of cure of molded parts, before and after any post-curing, was also determined by thermal analysis. Molecular weights and molecular weight distributions of the DAP molding resins by SEC/LALLS indicated that the better molding resins have lower M/sub w//M/sub n/ ratios. Association effects were observed, which could not be overcome by solvent modification alone. Determination of DAP molding resin heats of reaction by DSC indicated a linear relation between ..delta..H/sub R/ and weight percent filler for the good molding resins. DSC analyses of molded DAP parts showed that 95% cure was achieved in some as-molded parts, with a post-cure temperature of 165/sup 0/C being required to complete the cure to 100%. Thickness of the parts was a factor, with the thicker parts being 100% cured as molded. The glass transition temperature (T/sub g/) of the molded parts increased as cure was completed, to approx. 160 to 165/sup 0/C maximum. These results are consistent with a model of thermoset resin curing behavior which states that 100% cure can be achieved only if a post-curing operation is conducted above the T/sub g infinity/ (T/sub g/ at complete cure) of the polymer.

  20. Mold management of wetted carpet.

    PubMed

    Ong, Kee-Hean; Dixit, Anupma; Lewis, Roger D; MacDonald Perkins, Maureen; Backer, Denis; Condoor, Sridhar; Emo, Brett; Yang, Mingan

    2014-01-01

    This study evaluated the growth and removal of fungi on wetted carpet using newly designed technologies that rely on physical principles of steam, heat, and fluid flow. Sixty samples of carpet were embedded with heat-treated house dust, followed by embedding, wearing with a hexapod, and wetting. Samples were inoculated using a liquid suspension of Cladosporium sphaerospermum prior to placement over a water-saturated foam pad. Incubation times were 24 hr, 7 days, and 30 days. Cleaning was performed using three methods; high-flow hot water extraction, hot water and detergent, and steam. Fungal loading increased from approximately 1500 colony forming units per area (CFU/cm(2)) in 24 hr to a maximum of approximately 10,200 CFU/cm(2) after 7 days with a slight decline to 9700 CFU/cm(2) after 30 days incubation. Statistically significant differences were found among all three methods for removal of fungi for all three time periods (p < 0.05). Steam-vapor was significantly better than the alternative methods (p <0.001) with over 99% efficiency in mold spore decline from wetted carpet after 24 hr and 30 days, and over 92% efficiency after 7 days. The alternative methods exhibited lower efficiencies with a decline over time, from a maximum of 82% and 81% at 24 hr down to 60% and 43% at 30 days for detergent-hot water and high-flow, hot water extraction, respectively. The net effect of the mold management study demonstrates that while steam has a consistent fungal removal rate, the detergent and high-flow, hot water methods decline in efficiency with increasing incubation time.

  1. Study on heat flux from resin to mold in injection molding process

    SciTech Connect

    Nishiwaki, Nobuhiko; Hori, Sankei

    1999-07-01

    Recently, an injection molding of thermoplastic is widely used in many industries, because this manufacturing method is very suitable for mass production. For injection molding processes, a number of software packages for simulating an injection molding process have been developed. It is assumed in these software packages that the heat transfer coefficient between the resin and the mold surface is constant at the filling or cooling stages. In general, when melted resin flows into the mold, heat is generated in the flowing resin because of the high viscosity at the filling stage. Moreover at the cooling stage, a separation of the molded part from the mold surface generally occurs because of shrinkage of the molded material. Therefore, the heat transfer coefficient has not been accurately obtained yet at these stages. In this paper, the temperature near the surface of the mold cavity has been experimentally measured, so the heat flux that flows from the resin to the mold has been able to be analytically estimated by an inverse conduction method. On the other hand, the separating behavior of the resin from the mold surface has been measured using an ultrasonic transducer attached to the outer surface of the stationary mold. The heat flux that flows from the resin to the mold has been analytically estimated. The apparent heat transfer coefficient can be obtained from the heat flux and the representative temperature difference, which is measured by an ultrasonic technique. It was discovered that the heat flux and the apparent heat transfer coefficient are hardly influenced by the separation.

  2. Investigation of foaming behaviors in injection molding using mold pressure profile

    NASA Astrophysics Data System (ADS)

    Lee, John W. S.

    This thesis is intended to improve the understanding of foaming behaviors in various foam injection molding processes: structural foam molding, gas counter pressure molding, and gas counter pressure with mold opening. The foaming behavior in foam injection molding is different from foam extrusion in two ways. First, foaming occurs in a confined volume, which consists of a mold, whereas, it occurs in an open environment in foam extrusion. And second, while the foaming behavior in foam extrusion does not change with time once the steady state is reached, foam injection molding is on the other hand, time-dependent. These differences made it very challenging to study the foaming behaviors in foam injection molding. In this thesis, experiments were first conducted in foam extrusion to understand the effects of processing and material parameters on cell nucleation and growth behaviors. Subsequently, the knowledge obtained from the foam extrusion experiments was transferred to the foam injection molding process and the fundamental foaming mechanisms in foam injection molding were developed by conducting extensive experiments. Four processing parameters were mainly studied in this thesis: injection speed, void fraction setting (i.e., shot size), nitrogen content, and gate resistance. The experimental results revealed that the mold pressure profile during the foam injection molding process governed its foaming behaviors. Furthermore, by analyzing the mold pressure profile during the structural foam molding, it was possible to predict the achievable cell density in structural foam molding based on the foam extrusion results. When the gas counter pressure was employed, the analysis of the foaming behavior was relatively easier since the cell nucleation did not occur during the injection stage. However, the cell density that was achieved by using the gas counter pressure was generally lower than that obtained in structural foam molding due to the lower pressure drop rate

  3. Slimeware: engineering devices with slime mold.

    PubMed

    Adamatzky, Andrew

    2013-01-01

    The plasmodium of the acellular slime mold Physarum polycephalum is a gigantic single cell visible to the unaided eye. The cell shows a rich spectrum of behavioral patterns in response to environmental conditions. In a series of simple experiments we demonstrate how to make computing, sensing, and actuating devices from the slime mold. We show how to program living slime mold machines by configurations of repelling and attracting gradients and demonstrate the workability of the living machines on tasks of computational geometry, logic, and arithmetic.

  4. Slimeware: engineering devices with slime mold.

    PubMed

    Adamatzky, Andrew

    2013-01-01

    The plasmodium of the acellular slime mold Physarum polycephalum is a gigantic single cell visible to the unaided eye. The cell shows a rich spectrum of behavioral patterns in response to environmental conditions. In a series of simple experiments we demonstrate how to make computing, sensing, and actuating devices from the slime mold. We show how to program living slime mold machines by configurations of repelling and attracting gradients and demonstrate the workability of the living machines on tasks of computational geometry, logic, and arithmetic. PMID:23834592

  5. Mucormycosis, Pseudallescheriasis, and Other Uncommon Mold Infections

    PubMed Central

    Quan, Clifford; Spellberg, Brad

    2010-01-01

    Serious infections due to non-Aspergillus molds are being encountered with increasing frequency. Factors likely responsible for the rise of these infections include aging populations in countries with advanced medical technologies, the resultant increase in incidence of many cancers, increasingly intensive myeloablative therapies for these cancers, increasingly intensive care for critically ill patients, and increases in the frequency of solid organ and hematopoietic stem cell transplantation. Although diagnostic and therapeutic modalities have improved, mortality rates for invasive mold infections remain high. In this review, we summarize current knowledge about non-Aspergillus mold infections of the chest, with a focus on risk factors, clinical features, diagnosis, and treatment. PMID:20463250

  6. Residual stresses in injection molded products

    NASA Astrophysics Data System (ADS)

    Jansen, K. M. B.

    2015-12-01

    During the molding process residual stresses are formed due to thermal contraction during cooling as well as the local pressure history during solidification. In this paper a simple analytical model is reviewed which relates residual stresses, product shrinkage as well as warpage to the temperature and pressure histories during molding. Precise excimer laser layer removal measurements were performed to verify the predicted residual stress distributions. In addition, detailed shrinkage and warpage measurements on a large series of polymers and for different molding conditions were performed and are shown to compare well with the model predictions.

  7. The biocontaminants and complexity of damp indoor spaces: more than what meets the eyes.

    PubMed

    Thrasher, Jack D; Crawley, Sandra

    2009-01-01

    Nine types of biocontaminants in damp indoor environments from microbial growth are discussed: (1) indicator molds; (2) Gram negative and positive bacteria; (3) microbial particulates; (4) mycotoxins; (5) volatile organic compounds, both microbial (MVOCs) and non-microbial (VOCs); (6) proteins; (7) galactomannans; (8) 1-3-beta-D-glucans (glucans) and (9) lipopolysaccharides (LPS--endotoxins). When mold species exceed those outdoors contamination is deduced. Gram negative bacterial endotoxins, LPS in indoor environments, synergize with mycotoxins. The gram positive Bacillus species, Actinomycetes (Streptomyces, Nocardia and Mycobacterium), produce exotoxins. The Actinomycetes are associated with hypersensitivity pneumonitis, lung and invasive infections. Mycobacterial mycobacterium infections not from M. tuberculosis are increasing in immunocompetent individuals. In animal models, LPS enhance the toxicity of roridin A, satratoxins G and aflatoxin B1 to damage the olfactory epithelium, tract and bulbs (roridin A, satratoxin G) and liver (aflatoxin B1). Aflatoxin B1 and probably trichothecenes are transported along the olfactory tract to the temporal lobe. Co-cultured Streptomyces californicus and Stachybotrys chartarum produce a cytotoxin similar to doxorubicin and actinomycin D (chemotherapeutic agents). Trichothecenes, aflatoxins, gliotoxin and other mycotoxins are found in dust, bulk samples, air and ventilation systems of infested buildings. Macrocyclic trichothecenes are present in airborne particles <2 microm. Trichothecenes and stachylysin are present in the sera of individuals exposed to S. chartarum in contaminated indoor environments. Haemolysins are produced by S. chartarum, Memnoniella echinata and several species of Aspergillus and Penicillium. Galactomannans, glucans and LPS are upper and lower respiratory tract irritants. Gliotoxin, an immunosuppressive mycotoxin, was identified in the lung secretions and sera of cancer patients with aspergillosis

  8. INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER, R. L. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER, R. L. BRANDY MOLDING A RAIL CASTING (LAWLER NO. 1337, A 16' x 35' MOLD WITH A 5' COPE AND A 4' DRAG). DRAG IS FILLED WITH SAND. - Lawler Machine & Foundry Company, Molding Area, 760 North Forty-fourth Street, Birmingham, Jefferson County, AL

  9. RUN OUTS OCCUR WHEN IRON HAS UNSEATED MOLDING SAND AND ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    RUN OUTS OCCUR WHEN IRON HAS UNSEATED MOLDING SAND AND RUN OUT OF THE MOLD UNDER POURING JACKETS AND SPILLS ONTO THE MOLDING PLATFORM. WORKERS GENERALLY WAIT SEVERAL MINUTES FOR THE IRON TO SOLIDIFY AND, WHILE IT IS STILL RED-HOT, REMOVE IT FROM THE PLATFORM AND SCRAP THE MOLD. - Southern Ductile Casting Company, Centerville Foundry, 101 Airport Road, Centreville, Bibb County, AL

  10. Hydraulically-assisted compression molding material and process development

    SciTech Connect

    Collister, J.E.; Butler, K.I.; Rinz, J.E.

    1996-11-01

    The Sheet Molding Compound (SMC) industry has recently seen an introduction of novel materials which are claimed to allow molders of SMC parts to alter their process to mold at substantially lower molding pressures. Although this is viewed as a major advantage for SMC molders, little description of molding processes has been given which take full advantage of these novel materials. The work reported in this paper describes one possible alternative process which will enable molders to capture the low-cost potential of reducing the required molding pressures. This process involves the use of low-cost mold construction, and the use of a novel method of applying molding pressure that obviates the need for a high-cost compression press, which causes the authors to apply a new name to this process; Hydraulic-Assisted Compression Molding. Molding results are presented for SMC which was designed to be molded at reduced pressures and temperatures (6.9 bar and 100 C).

  11. Assessment of mold concentrations in Singapore shopping centers using mold-specific quantitative PCR (MSQPCR) analysis.

    PubMed

    Yap, Jennifer; Toh, Zhen Ann; Goh, Vivien; Ng, Lee Chen; Vesper, Stephen

    2009-09-01

    Molds can pose a human health threat and may amplify in buildings in humid climates. The objective of this study was to evaluate the mold growth in Singapore shopping centers based on the collection of 40 dust samples from 15 shopping centers, including one with a history of water damage. The dust was analyzed by a DNA-based technology called mold-specific quantitative PCR (MSQPCR). In a water-damaged shopping center, most of the 26 water-damage indicator species were detected at some concentration and many were much more abundant than the average in the shopping centers. MSQPCR is a useful method for quantifying indoor molds in tropical climates.

  12. Custom molded thermal MRg-FUS phantom

    NASA Astrophysics Data System (ADS)

    Eames, Matthew D. C.; Snell, John W.; Hananel, Arik; Kassell, Neal F.

    2012-11-01

    This article describes a method for creating custom-molded thermal phantoms for use with MR-guided focused ultrasound systems. The method is defined here for intracranial applications, though it may be modified for other anatomical targets.

  13. Sacrificial plastic mold with electroplatable base

    DOEpatents

    Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.

    2002-01-01

    A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

  14. Sacrificial Plastic Mold With Electroplatable Base

    DOEpatents

    Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.

    2005-08-16

    A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

  15. Antimicrobial Treatments of Indoor Mold and Bacteria

    EPA Science Inventory

    Biological contaminants especially mold in buildings are known to act as sources of indoor air pollution, discomfort, asthma and pulmonary disease to building occupants. Sick buildings are evidence of extremely problematic indoor air quality (IAQ), often resulting from unacceptab...

  16. Organic materials for ceramic molding processes

    NASA Technical Reports Server (NTRS)

    Saito, K.

    1984-01-01

    Ceramic molding processes are examined. Binders, wetting agents, lubricants, plasticizers, surface active agents, dispersants, etc., for pressing, rubber pressing, sip casting, injection casting, taping, extrusion, etc., are described, together with forming machines.

  17. Traditional Mold Analysis Compared to a DNA-based Method of Mold Analysis with Applications in Asthmatics' Homes

    EPA Science Inventory

    Traditional environmental mold analysis is based-on microscopic observations and counting of mold structures collected from the air on a sticky surface or culturing of molds on growth media for identification and quantification. A DNA-based method of mold analysis called mol...

  18. Indoor Molds and Respiratory Hypersensitivity: A Comparison of Selected Molds and House Dust Mite Induced Responses in a Mouse Model**

    EPA Science Inventory

    Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases. Damp/moldy environments have been associated with asthma exacerbation, but mold's role in allergic asthma induction is less clear. The molds selected for these studies are commonl...

  19. Gating of Permanent Molds for Aluminum Casting

    SciTech Connect

    David Schwam; John F. Wallace; Tom Engle; Qingming Chang

    2004-01-01

    This report summarizes a two-year project, DE-FC07-011D13983 that concerns the gating of aluminum castings in permanent molds. The main goal of the project is to improve the quality of aluminum castings produced in permanent molds. The approach taken was to determine how the vertical type gating systems used for permanent mold castings can be designed to fill the mold cavity with a minimum of damage to the quality of the resulting casting. It is evident that somewhat different systems are preferred for different shapes and sizes of aluminum castings. The main problems caused by improper gating are entrained aluminum oxide films and entrapped gas. The project highlights the characteristic features of gating systems used in permanent mold aluminum foundries and recommends gating procedures designed to avoid common defects. The study also provides direct evidence on the filling pattern and heat flow behavior in permanent mold castings. Equipment and procedure for real time X-Ray radiography of molten aluminum flow into permanent molds have been developed. Other studies have been conducted using water flow and behavior of liquid aluminum in sand mold using real time photography. This investigation utilizes graphite molds transparent to X-Rays making it possible to observe the flow pattern through a number of vertically oriented grating systems. These have included systems that are choked at the base of a rounded vertical sprue and vertical gating systems with a variety of different ingates into the bottom of a mold cavity. These systems have also been changed to include gating systems with vertical and horizontal gate configurations. Several conclusions can be derived from this study. A sprue-well, as designed in these experiments, does not eliminate the vena contracta. Because of the swirling at the sprue-base, the circulating metal begins to push the entering metal stream toward the open runner mitigating the intended effect of the sprue-well. Improved designs of

  20. A Mold by Any Other Name: One Librarian's Battle Against a Mold Bloom.

    ERIC Educational Resources Information Center

    Smith, Laura Katz

    1997-01-01

    Describes how library staff at Virginia Polytechnic Institute and State University cleaned up materials after a mold bloom in the rare book room. Includes advice for controlling mold: set up a hygrothermograph, clean dust from books, set up fans, do a "skin" test at regular intervals, keep windows closed, have dehumidifiers available. (PEN)

  1. Rapid control of mold temperature during injection molding process: Effect of packing pressure

    NASA Astrophysics Data System (ADS)

    Liparoti, Sara; Sorrentino, Andrea; Titomanlio, Giuseppe

    2015-12-01

    A thorough analysis of the effect of operative conditions of injection molding process on the morphology distribution inside the obtained molded is performed, with particular reference to semi- crystalline polymers. In particular, fully characterized injection molding tests are presented using an isotactic polypropylene, previously carefully characterized as far as most of properties of interest. The effects of mold temperature and packing conditions are analyzed. The mold temperature was controlled by a thin heating device, composed by polyimide as insulating layer and polyimide loaded carbon black as electrical conductive layer, that is able to increase temperature on mold surface in few seconds (70°C/s) by joule effect and cool down soon after. The shear layer thickness in the molded is reduced in the samples produced at high mold temperatures, that means high electrical power and long heating time, and this reduction is more significant at lower packing pressures, indeed, at 360bar as packing pressure and 20s as heating time the shear layer disappear. The resulting morphology was analyzed by optical microscope.

  2. Study on 100 Gbit/inch2 Density Molding Using Double-Sided Heat Insulated Mold

    NASA Astrophysics Data System (ADS)

    Inoue, Kazuo; Hayashi, Kazuhiro; Kawasaki, Yoshihiro; Ohno, Eiji; Masuhara, Shin; Kaneko, Masahiko

    2004-07-01

    Previously we showed substrates without any pit deformation in the case of injection molding a 40 Gbit/inch2 read only memory (ROM) substrate using the single-sided heat insulated mold, in which a heat insulating plate was located below a stamper, and the slow mold opening method. This type of mold is characterized by the fact that pits on the substrates can be replicated at a low mold temperature, to avoid the twisting of substrates. However, it was found that the radial tilt was large. Therefore, we investigated this phenomenon using simulations, and fabricated a double-sided heat insulated mold with a symmetric structure in the thickness direction of the substrates. We showed that performing injection molding using this double-sided mold rendered the radial tilt of substrates controllable, so that it was possible to obtain flat disks. Furthermore, we obtained a 120-mm-diameter 100 Gbit/inch2 ROM substrate, which had no pit deformation over the entire pit area even though the pit wall angle was greater than 80 deg. This density corresponds to approximately 140 Gbyte.

  3. Induction of cytotoxicity and production of inflammatory mediators in raw264.7 macrophages by spores grown on six different plasterboards.

    PubMed

    Murtoniemi, T; Nevalainen, A; Suutari, M; Toivola, M; Komulainen, H; Hirvonen, M R

    2001-03-01

    Dampness and microbial growth in buildings are associated with respiratory symptoms in the occupants, but details of the phenomenon are not sufficiently understood. The current study examined the effects of growth conditions provided by six plasterboards on cytotoxicity and inflammatory potential of the spores of Streptomyces californicus, Penicillium spinulosum, Aspergillus versicolor, and Stachybotrys chartarum. The microbes were isolated from mold problem buildings and thereafter grown on six different plasterboards. The spores were harvested, applied to RAW264.7 macrophages (10(4), 10(5), 10(6) spores/10(6) cells), and evaluated 24 h after exposure for the ability to cause cytotoxicity and to stimulate production of nitric oxide (NO), interleukin-1 beta (IL-1beta), tumor necrosis factor alpha (TNFalpha) and interleukin-6 (IL-6). The data indicate clear differences between spores of different microbes in their ability to induce the production of these inflammatory mediators and to cause cell death in macrophages. Also, for each microbe, the induction ability specifically depended on the brand of plasterboard. The spores of Streptomyces californicus collected from all plasterboards were the most potent at inducing NO and cytokine production. Cytotoxicity caused by P. spinulosum and Streptomyces californicus spores was consistent with NO, IL-1beta and IL-6 production induced by those microbes. However, the production of these inflammatory mediators by the spores of Stachybotrys chartarum was not parallel to their ability to cause cell death. The low productions of NO and cytokines were associated with high cytotoxicity caused by the spores of the A. versicolor. These data suggest that growth condition of microbes on different plasterboards affect the ability of microbial spores to induce inflammatory responses and cytotoxicity in macrophages.

  4. Onychomycosis Due to Nondermatophytic Molds

    PubMed Central

    Hwang, Sung Min; Ha, Gyoung Yim

    2012-01-01

    Background Although there have been many studies about onychomycosis due to nondermatophytic molds (NDM), few studies about etiologic agents including NDM in onychomycosis have been reported in Korea. Objective: This study investigated onychomycosis due to NDM in the Gyeongju area of Korea. Objective This study investigated onychomycosis due to NDM in the Gyeongju area of Korea. Methods In the 10-year period from 1999~2009, we reviewed 59 patients with onychomycosis due to NDM. The etiologic agents were identified by cultures on Sabouraud's Dextrose agar with and without cycloheximide. In some cases, internal transcribed spacer sequence analysis was done. NDM isolated considered pathogens when the presence of fungal elements was identified by direct microscopy observation and in follow-up cultures yielding the same fungi. Results Onychomycosis due to NDM comprised 2.3% of all onychomycosis. Of the 59 patients with onychomycosis due to NDM, 84.7% were toenail onychomycosis and 15.3% were fingernail onychomycosis. The incidence rate was highest in the fifth decade (27.1%). The ratio of male to female patients was 1:1.6. The frequency of associated diseases, in descending order, was hypertension, diabetes mellitus, and cerebral hematoma. Distal and lateral subungual onychomycosis (86.4%) was the most common clinical type of onychomycosis. Aspergillus spp. was the most frequently isolated etiologic agent of onychomycosis due to NDM (83.0%). Other causative agents were Scopulariopsis brevicaulis (10.2%), Acremonium spp. (3.4%), Fusarium solani (1.7%), and Chaetomium globosum (1.7%). Conclusion Because of the increase in onychomycosis due to NDM, we suggest the need of a careful mycological examination in patients with onychomycosis. PMID:22577268

  5. Development of sheet molding compound solar collectors with molded-in silvered glass reflective surfaces

    SciTech Connect

    Champion, R. L.; Allred, R. E.

    1980-01-01

    An approach to the fabrication of a line-focusng parabolic trough reflector structure which offers the potential of high performance while utilizing mass production type technology with potential for low cost is discussed. The concept is one of a molded structure of fiber reinforced plastic with an integrally molded silvered glass reflective surface. Sheet molding compound (SMC), a mixture of glass fibers and inorganic fillers in polyester resin, has been selected for evaluation as representative of reinforced plastic molding materials. The purpose of the work was to establish the feasibility of molding glass mirrors into SMC structural trough panels. If the effort proved successful, the next stage of development would be demonstration of the structure in a trough collector which incorporates individual SMC reflector panels. The trough has a 2 x 6 m aperture with six individual SMC panels mounted on a torque tube as the main support structure. Results are described. (WHK)

  6. Effects of mold geometry on fiber orientation of powder injection molded metal matrix composites

    SciTech Connect

    Ahmad, Faiz Aslam, Muhammad Altaf, Khurram Shirazi, Irfan

    2015-07-22

    Fiber orientations in metal matrix composites have significant effect on improving tensile properties. Control of fiber orientations in metal injection molded metal composites is a difficult task. In this study, two mold cavities of dimensions 6x6x90 mm and 10x20x180 mm were used for comparison of fiber orientation in injection molded metal composites test parts. In both mold cavities, convergent and divergent flows were developed by modifying the sprue dimensions. Scanning electron microscope (SEM) was used to examine the fiber orientations within the test samples. The results showed highly aligned fiber in injection molded test bars developed from the convergent melt flow. Random orientation of fibers was noted in the composites test bars produced from divergent melt flow.

  7. Creating mold-free buildings: a key to avoiding health effects of indoor molds.

    PubMed

    Small, Bruce M

    2003-08-01

    In view of the high costs of building diagnostics and repair subsequent to water damage--as well as the large medical diagnostic and healthcare costs associated with mold growth in buildings--commitment to a philosophy of proactive preventive maintenance for home, apartment, school, and commercial buildings could result in considerable cost savings and avoidance of major health problems among building occupants. The author identifies common causes of mold growth in buildings and summarizes key building design and construction principles essential for preventing mold contamination indoors. Physicians and healthcare workers must be made aware of conditions within buildings that can give rise to mold growth, and of resulting health problems. Timely advice provided to patients already sensitized by exposure to molds could save these individuals, and their families, from further exposures as a result of inadequate building maintenance or an inappropriate choice of replacement housing. PMID:15259432

  8. Mathematical modeling of the process of filling a mold during injection molding of ceramic products

    NASA Astrophysics Data System (ADS)

    Kulkov, S. N.; Korobenkov, M. V.; Bragin, N. A.

    2015-10-01

    Using the software package Fluent it have been predicted of the filling of a mold in injection molding of ceramic products is of great importance, because the strength of the final product is directly related to the presence of voids in the molding, making possible early prediction of inaccuracies in the mold prior to manufacturing. The calculations were performed in the formulation of mathematical modeling of hydrodynamic turbulent process of filling a predetermined volume of a viscous liquid. The model used to determine the filling forms evaluated the influence of density and viscosity of the feedstock, and the injection pressure on the mold filling process to predict the formation of voids in the area caused by the shape defect geometry.

  9. Injection molding simulation with variothermal mold temperature control of highly filled polyphenylene sulfide

    NASA Astrophysics Data System (ADS)

    Birkholz, A.; Tschiersky, M.; Wortberg, J.

    2015-05-01

    For the installation of a fuel cell stack to convert chemical energy into electricity it is common to apply bipolar plates to separate and distribute reaction gases and cooling agents. For reducing manufacturing costs of bipolar plates a fully automated injection molding process is examined. The high performance thermoplastic matrix material, polyphenylene sulfide (PPS), defies against the chemical setting and the operation temperature up to 200 °C. To adjust also high electrical and thermal conductivity, PPS is highly filled with various carbon fillers up to an amount of 65 percentage by volume. In the first step two different structural plates (one-sided) with three different gate heights and molds are designed according to the characteristics of a bipolar plate. To cope with the approach that this plate should be producible on standard injection molding machines with variothermal mold temperature control, injection molding simulation is used. Additionally, the simulation should allow to formulate a quality prediction model, which is transferrable to bipolar plates. Obviously, the basis for a precise simulation output is an accurate description of the material properties and behavior of the highly filled compound. This, the design of the structural plate and mold and the optimization via simulation is presented, as well. The influence of the injection molding process parameters, e.g. injection time, cycle times, packing pressure, mold temperature, and melt temperature on the form filling have been simulated to determine optimal process conditions. With the aid of the simulation and the variothermal mold temperature control it was possible to reduce the required melt temperature below the decomposition temperature of PPS. Thereby, hazardous decomposition products as hydrogen sulfide are obviated. Thus, the health of the processor, the longevity of the injection molding machine as well as the material and product properties can be protected.

  10. Powder Injection Molding of Titanium Components

    SciTech Connect

    Simmons, Kevin L.; Nyberg, Eric A.; Weil, K. Scott; Miller, Megan R.

    2005-01-01

    Powder injection molding (PIM) is a well-established, cost-effective method of fabricating small-to-moderate size metal components. Derived from plastic injection molding and employing a mixture of metal powder and plastic binder, the process has been used with great success in manufacturing a wide variety of metal products, including those made from stainless steel, nickel-based superalloys, and copper alloys. Less progress has been achieved with titanium and other refractory metal alloys because of problems with alloy impurities that are directly attributable to the injection molding process. Specifically, carbon, oxygen, and nitrogen are left behind during binder removal and become incorporated into the chemistry and microstructure of the material during densification. Even at low concentration, these impurities can cause severe degradation in the mechanical properties of titanium and its alloys. We have developed a unique blend of PIM constituents where only a small volume fraction of binder (~5 – 10 vol%) is required for injection molding; the remainder of the mixture consists of the metal powder and binder solvent. Because of the nature of decomposition in the binder system and the relatively small amount used, the binder is eliminated almost completely from the pre-sintered component during the initial stage of a two-step heat treatment process. Results will be presented on the first phase of this research, in which the binder, injection molding, de-binding and sintering schedule were developed. Additional data on the mechanical and physical properties of the material produced will be discussed.

  11. Modeling the thin-slab continuous-casting mold

    SciTech Connect

    O'Connor, T.G. . Applied Superconductivity Group); Dantzig, J.A. . Dept. of Mechanical and Industrial Engineering)

    1994-06-01

    A three-dimensional mathematical model has been developed to compute the thermomechanical state in the mold of thin-slab continuous casters. The thin-slab mold differs from those used in conventional slab casters in that the upper portion of the broad side walls defines a funnel-shaped chamber which allows the nozzle to be submerged into the liquid metal. The chamber converges with distance down the mold, reducing to the rectangular cross section of the finished casting near the mold exit. The new mold, along with casting speeds up to 6 m/min, allows slabs to be cast 50--60 mm thick, compared with 150 to 350 mm in conventional continuous slab casting. However, the mold shape and high casting speed lead to higher mold temperatures and shorter mold life than are found in conventional slab casters. In this article, the author develop mathematical models of the process to determine the role of various process parameters in determining the mold life. Finite-element analysis is used to determine the temperatures in the mold and cast slab, and these data are then used in an elastic-viscoplastic analysis to investigate the deformation of the mold wall in service. Cyclic inelastic strains up to 1.75 pct are found in a region below the meniscus along the funnel edge. These large strains result from the combination of locally high temperatures coupled with geometric restraint of the mold. The deformation leads to short mold life because of thermal fatigue cracking of the mold. The computed locations and time to failure of the mold in fatigue agree very well with observations of the appearance of mold surface cracks in an operating caster. The models are also used to develop an improved mold design.

  12. Modeling the thin-slab continuous-casting mold

    NASA Astrophysics Data System (ADS)

    Oconnor, Thomas G.; Dantzig, Jonathan A.

    1994-06-01

    A three-dimensional mathematical model has been developed to compute the thermomechanical state in the mold of thin-slab continuous casters. The thin-slab mold differs from those used in conventional slab casters in that the upper portion of the broad side walls defines a funnel-shaped chamber which allows the nozzle to be submerged into the liquid metal. The chamber converges with distance down the mold, reducing to the rectangular cross section of the finished casting near the mold exit. The new mold, along with casting speeds up to 6 m/min, allows slabs to be cast 50 60 mm thick, compared with 150 to 350 mm in conventional continuous slab casting. However, the mold shape and high casting speed lead to higher mold temperatures and shorter mold life than are found in conventional slab casters. In this article, we develop mathematical models of the process to determine the role of various process parameters in determining the mold life. Finite-element analysis is used to determine the temperatures in the mold and cast slab, and these data are then used in an elastic-viscoplastic analysis to investigate the deformation of the mold wall in service. Cyclic inelastic strains up to 1.75 Pct are found in a region below the meniscus along the funnel edge. These large strains result from the combination of locally high temperatures coupled with geometric restraint of the mold. The deformation leads to short mold life because of thermal fatigue cracking of the mold. The computed locations and time to failure of the mold in fatigue agree very well with observations of the appearance of mold surface cracks in an operating caster. The models are also used to develop an improved mold design.

  13. Method for encapsulating hazardous wastes using a staged mold

    DOEpatents

    Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

    1989-01-01

    A staged mold and method for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

  14. Development of a silicone transfer molding compound

    SciTech Connect

    Parker, B.G.

    1992-05-01

    Molding compound MS 2072067, designated BRP 50206, is currently used in the manufacture of bobbins and coils. This material was developed as a compression molding compound and is reinforced with 1/4 inch glass fibers. The production yield for coils and bobbins has improved over the years; however, it is still not at a desirable level. A milled glass reinforced version of MS 2072067 silicone molding compound was developed in the laboratory. Milled glass fibers with lengths of 1/32, 1/16, and 1/8 inch were used in place of the 1/4 inch chopped glass fibers in the formulations. The tensile strength, tensile moduli, thermal expansion, and flow properties of these materials were evaluated. These materials exhibited improved flow properties over the existing 1/4 inch glass fiber reinforced material. The new materials also had the same or better tensile strength, as compared to the current production material, and maintained similar thermal expansion characteristics.

  15. Neonatal Ear Molding: Timing and Technique.

    PubMed

    Anstadt, Erin Elizabeth; Johns, Dana Nicole; Kwok, Alvin Chi-Ming; Siddiqi, Faizi; Gociman, Barbu

    2016-03-01

    The incidence of auricular deformities is believed to be ∼11.5 per 10,000 births, excluding children with microtia. Although not life-threatening, auricular deformities can cause undue distress for patients and their families. Although surgical procedures have traditionally been used to reconstruct congenital auricular deformities, ear molding has been gaining acceptance as an efficacious, noninvasive alternative for the treatment of newborns with ear deformations. We present the successful correction of bilateral Stahl's ear deformity in a newborn through a straightforward, nonsurgical method implemented on the first day of life. The aim of this report is to make pediatric practitioners aware of an effective and simple molding technique appropriate for correction of congenital auricular anomalies. In addition, it stresses the importance of very early initiation of ear cartilage molding for achieving the desired outcome.

  16. High rate fabrication of compression molded components

    DOEpatents

    Matsen, Marc R.; Negley, Mark A.; Dykstra, William C.; Smith, Glen L.; Miller, Robert J.

    2016-04-19

    A method for fabricating a thermoplastic composite component comprises inductively heating a thermoplastic pre-form with a first induction coil by inducing current to flow in susceptor wires disposed throughout the pre-form, inductively heating smart susceptors in a molding tool to a leveling temperature with a second induction coil by applying a high-strength magnetic field having a magnetic flux that passes through surfaces of the smart susceptors, shaping the magnetic flux that passes through surfaces of the smart susceptors to flow substantially parallel to a molding surface of the smart susceptors, placing the heated pre-form between the heated smart susceptors; and applying molding pressure to the pre-form to form the composite component.

  17. Mold filling of titanium alloys in two different wedge-shaped molds.

    PubMed

    Shimizu, H; Habu, T; Takada, Y; Watanabe, K; Okuno, O; Okabe, T

    2002-06-01

    Pure titanium and titanium alloys are potential materials for the fabrication of cast dental appliances. One important factor in producing sound castings is the capacity of the metal to fill the mold. This study used a wedge-shaped mold to compare the mold filling of titanium with that of conventional dental casting alloys. The metals used were CP Ti, Ti-6Al-7Nb, Ti-6Al-4V, Ti with 1 and 4wt% Cu and ADA Type III gold alloy and an Ni-Cr alloy. The castings were cut into four pieces parallel to the triangular surface. Mold filling was evaluated as the distance between the tip of the cast wedge and theoretical tip of the triangle. The mold filling of the gold alloy was superior compared to all the metals tested, while the mold filling of the Ni-Cr alloy was the worst. There were no statistical differences at the 30 degrees marginal angle for all the cast titanium metals. At the sharper 15 degrees angle, CP Ti and Ti-6Al-7Nb was superior to both the Ti-Cu alloys. Although the mold filling of titanium was inferior compared to the gold alloy, the data justify the use of titanium for the production of dental appliances.

  18. Numerical recipes for mold filling simulation

    SciTech Connect

    Kothe, D.; Juric, D.; Lam, K.; Lally, B.

    1998-07-01

    Has the ability to simulate the filling of a mold progressed to a point where an appropriate numerical recipe achieves the desired results? If results are defined to be topological robustness, computational efficiency, quantitative accuracy, and predictability, all within a computational domain that faithfully represents complex three-dimensional foundry molds, then the answer unfortunately remains no. Significant interfacial flow algorithm developments have occurred over the last decade, however, that could bring this answer closer to maybe. These developments have been both evolutionary and revolutionary, will continue to transpire for the near future. Might they become useful numerical recipes for mold filling simulations? Quite possibly. Recent progress in algorithms for interface kinematics and dynamics, linear solution methods, computer science issues such as parallelization and object-oriented programming, high resolution Navier-Stokes (NS) solution methods, and unstructured mesh techniques, must all be pursued as possible paths toward higher fidelity mold filling simulations. A detailed exposition of these algorithmic developments is beyond the scope of this paper, hence the authors choose to focus here exclusively on algorithms for interface kinematics. These interface tracking algorithms are designed to model the movement of interfaces relative to a reference frame such as a fixed mesh. Current interface tracking algorithm choices are numerous, so is any one best suited for mold filling simulation? Although a clear winner is not (yet) apparent, pros and cons are given in the following brief, critical review. Highlighted are those outstanding interface tracking algorithm issues the authors feel can hamper the reliable modeling of today`s foundry mold filling processes.

  19. Nickel electroplating for nanostructure mold fabrication.

    PubMed

    Lin, Xiaohui; Dou, Xinyuan; Wang, Xiaolong; Chen, Ray T

    2011-08-01

    We demonstrated a practical process of fabricating nickel molds for nanoimprinting. Dual-side polished glass is chosen as the substrate on which nickel nanostructures are successfully electroplated. Photonic crystal structures with 242 nm diameters and other nanoscale pillars down to 9 nm diameters are achieved over a large area. The electroplating parameters are investigated and optimized. This process extends the feasibility of electroplating process to nanoscale and shows great potential in nanoimprint mold fabrication with its low cost, straightforward process and controllable pattern structures.

  20. Relationship Between Casting Distortion, Mold Filling, and Interfacial Heat Transfer in Sand Molds

    SciTech Connect

    J. K. Parker; K. A. Woodbury; T. S. Piwonka; Y. Owusu

    1999-09-30

    This project sought to determine the relationship between casting dimensions and interfacial heat transfer in aluminum alloy sand castings. The program had four parts; measurement of interfacial heat transfer coefficients in resin bonded and green sand molds, the measurement of gap formation in these molds, the analysis of castings made in varying gatings, orientations and thicknesses, and the measurement of residual stresses in castings in the as-cast and gate removed condition. New values for interfacial heat transfer coefficients were measured, a novel method for gap formation was developed, and the variation of casting dimensions with casting method, gating, and casting orientation in the mold was documented.

  1. Chemotaxis in the Plasmodial Slime Mold, Physarum polycephalum.

    ERIC Educational Resources Information Center

    Bozzone, Donna M.; Martin, Denise A.

    1998-01-01

    Describes a biology unit designed so that students pose their own questions and perform experiments to answer these questions. Plasmodial slime mold is employed as the focus of the study with background information about the mold provided. (DDR)

  2. MOLD SPECIFIC QUANTITATIVE PCR FOR RAPID IDENTIFICATION AND ENUMERATION

    EPA Science Inventory

    There is growing awareness that indoor molds/fungi may be connected to such conditions as asthma, allergies, hemorrhaging, chronic rhinosinusitis, memory loss, and a symptom complex called sick-building-syndrome. In addition, molds cause frequently fatal nosocomical infections. ...

  3. 27. June 1962 WINDOW JAMB MOLDING DETAILMOLDING CAN BE REMOVED ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    27. June 1962 WINDOW JAMB MOLDING DETAIL--MOLDING CAN BE REMOVED BY TURNING WOODEN THUMBSCREWS; WINDOW FRAMES CAN THEN BE REMOVED FOR CLEANING, ETC. - Shaker Church Family Main Dwelling House, U.S. Route 20, Hancock, Berkshire County, MA

  4. MOLD MACHINE, BRASS FOUNDRY, USED TO COMPRESS CONDITIONED SAND IN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MOLD MACHINE, BRASS FOUNDRY, USED TO COMPRESS CONDITIONED SAND IN FLASKS OVER PATTERNS TO CREATE MOLD CAVITIES WHICH ARE LATER FILLED WITH MOLTEN BRONZE. - Stockham Pipe & Fittings Company, Brass Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  5. HUNTER 20 MATCHPLATE MOLDING MACHINE 'SQUEEZING' BOTH HALVES OF A ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    HUNTER 20 MATCHPLATE MOLDING MACHINE 'SQUEEZING' BOTH HALVES OF A MOLD SURROUNDING A MATCHPLATE PATTERN, DENNIS GRAY OPERATOR. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  6. Looking east inside of the ingot mold stripeer building at ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Looking east inside of the ingot mold stripeer building at a mold being stripped from an ingot. - U.S. Steel Edgar Thomson Works, 44" Slab Mill, Along Monongahela River, Braddock, Allegheny County, PA

  7. 20. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON GREY IRON UNIT NO. 1 MOLD CONVEYOR. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  8. INTERIOR VIEW WITH CORE SET IN MOLD HALF IN BOX ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR VIEW WITH CORE SET IN MOLD HALF IN BOX FLOOR AREA. AWAITING OTHER MOLD HALF TO BE PLACED ON TOP. - Stockham Pipe & Fittings Company, Ductile Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  9. 19. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    19. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON GREY IRON UNIT NO. 1 MOLD CONVEYOR. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  10. TRUFLO GONDOLA, USED WITH THE HUNTER 10 MOLDING MACHINE, OPERATES ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    TRUFLO GONDOLA, USED WITH THE HUNTER 10 MOLDING MACHINE, OPERATES THE SAME AS THE TWO LARGER TRUFLOS USED IN CONJUNCTION WITH THE TWO HUNTER 20S. EACH GONDOLA IS CONNECTED TO THE NEXT AND RIDES ON A SINGLE TRACK RAIL FROM MOLDING MACHINES THROUGH POURING AREAS CARRYING A MOLD AROUND TWICE BEFORE THE MOLD IS PUSHED OFF ONTO A VIBRATING SHAKEOUT CONVEYOR. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  11. 56. ORIGINAL MOLDS. THE MORAVIAN POTTERY AND TILE WORKS HAS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    56. ORIGINAL MOLDS. THE MORAVIAN POTTERY AND TILE WORKS HAS APPROXIMATELY 6,000 PLASTER MOLDS OF VARIOUS TYPES, INCLUDING THE DEEP CAVITY MOLDS IN THE CENTER OF THE PHOTOGRAPH. THESE MOLDS PRODUCED ALLEGORICAL FIGURES TO BE INSTALLED AROUND THE CORNICES OF PUBLIC SCHOOLS. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  12. Analysis of cracking in glass molds made of cast iron

    NASA Astrophysics Data System (ADS)

    Leushin, I. O.; Chistyakov, D. G.

    2014-09-01

    The cracking in the parts of cast iron molds intended for glass is considered, and this cracking substantially affects the operation of glass-blowing equipment, maintainability, and the replacement of mold sets. The processes that cause cracking in the parts of glass molds and initiate crack growth are studied.

  13. Improved mold release for filled-silicone compounds

    NASA Technical Reports Server (NTRS)

    Accountius, O. E.

    1973-01-01

    Ceramic and filled-plastic materials used for fabrication of tiles are relatively brittle and easily break as they are being removed from molds. Dusting mold surfaces with commercially available glass microspheres provides mold release superior to existing spray releases. Glass-microsphere dusting also permits removal of uncured tile which has very little strength.

  14. 17. INTERIOR VIEW WITH GREY UNIT NO. 1 MOLD CONVEYOR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. INTERIOR VIEW WITH GREY UNIT NO. 1 MOLD CONVEYOR SHOWING CHAIN HELD WEIGHTS THAT TRAVEL AT THE SAME SPEED AS THE CONVEYOR AND REST ON COMPLETED MOLDS TO HOLD THE SAND SEAMS TOGETHER AS MOLTED IRON IS POURED INTO THE MOLD CAVITY. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  15. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Middle ear mold. 874.3430 Section 874.3430 Food... DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  16. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Middle ear mold. 874.3430 Section 874.3430 Food... DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  17. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Middle ear mold. 874.3430 Section 874.3430 Food... DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  18. HUNTER 20 MATCHPLATE MOLDING MACHINE, OPERATING THE SAME AS THE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    HUNTER 20 MATCHPLATE MOLDING MACHINE, OPERATING THE SAME AS THE HUNTER 10 AND OTHER HUNTER 20 COMPRESSES BOTH MOLD HALVES OVER A DOUBLE-SIDED MATCH PLATE PATTERN. DENNIS GRAY TESTS A MOLD'S HARDNESS TO ENSURE SAND MIXTURE AND MACHINE COMPRESSIBILITY ARE CORRECT. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  19. 1928 MALLEABLE FOUNDRY MOLD CONVEYOR #1 SHOWING CONVEYOR AND TRACK ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1928 MALLEABLE FOUNDRY MOLD CONVEYOR #1 SHOWING CONVEYOR AND TRACK ARRANGEMENTS WITH OVERHEAD POURING WEIGHTS THAT REST ON A MOLD'S TOP SURFACE TO ENSURE THAT IRON DOES NOT FLOW OUT OF THE MOLD WHEN IT IS BEING POURED THROUGH THE OPENING IN THE WEIGHT. - Stockham Pipe & Fittings Company, Malleable Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  20. 14. INTERIOR VIEW WITH JOHNNY TAYLOR REMOVING A MOLD HALF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. INTERIOR VIEW WITH JOHNNY TAYLOR REMOVING A MOLD HALF FROM THE PATTERN ON THE MOLDING MACHINE, REVEALING THE CAVITY THAT WILL BE FILLED WITH MOLTEN IRON AFTER IT IS ASSEMBLED WITH THE OTHER MOLD HALF INSIDE GREY IRON UNIT NO. 1. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  1. Experimental Determination of Heat Transfer Within the Metal/Mold Gap in a DC Casting Mold: Part II. Effect of Casting Metal, Mold Material, and Other Casting Parameters

    NASA Astrophysics Data System (ADS)

    Prasad, Arvind; Bainbridge, Ian F.

    2013-07-01

    Extensive experimental studies were conducted to quantify the effect of different parameters that can affect the heat transfer from the metal to the mold during the steady-state phase of DC casting. In the first part previously published, the experimental technique was established and results were reported for the effect of gas type (atmosphere within the mold) and the gap between the metal and the mold. The results showed the significant effect of gas thermal conductivity and the metal-mold gap on the mold wall heat transfer coefficient. In this second publication on heat transfer in the mold wall region of a DC casting mold, the results from the effect of casting temperature, gas flow rate, casting alloy, mold material, and the mold insert material on the mold wall heat transfer coefficient are described. The experiments reported in the current paper show that these additional factors tested do not affect the heat flux through the mold wall to the same extent as the gap size or the gas type. The heat transfer coefficient changes by less than 5 pct when casting temperature is changed by ±25 K, less than 15 pct when the gas flow rate within the metal-mold gap flows at up to 3 LPM, and approximately 30 pct when the mold material is changed from stainless steel to AA601 to copper. Similar results were obtained when different insert materials were used. These results are explained with the help of an electrical analogy of heat transfer and are consistent with the heat transfer theory.

  2. Molding cork sheets to complex shapes

    NASA Technical Reports Server (NTRS)

    Sharpe, M. H.; Simpson, W. G.; Walker, H. M.

    1977-01-01

    Partially cured cork sheet is easily formed to complex shapes and then final-cured. Temperature and pressure levels required for process depend upon resin system used and final density and strength desired. Sheet can be bonded to surface during final cure, or can be first-formed in mold and bonded to surface in separate step.

  3. Illinois Occupational Skill Standards: Plastics Molding Cluster.

    ERIC Educational Resources Information Center

    Illinois Occupational Skill Standards and Credentialing Council, Carbondale.

    This document, which is intended to serve as a guide for work force preparation program providers, details the Illinois occupational skill standards for programs preparing students for employment in jobs in the plastics molding industry. Agency partners involved in this project include: the Illinois State Board of Education, Illinois Community…

  4. Foundry air contaminants from green sand molds.

    PubMed

    Scott, W D; James, R H; Bates, C E

    1976-06-01

    The major gases evolved from foundry molds have been determined in the laboratory. The principal gases evolved during pouring and shakeout of castings include hydrogen, carbon monoxide, carbon dioxide, methane and other low molecular weight hydrocarbons with smaller amounts of ammonia, hydrogen cyanide, and sulfur dioxide. PMID:937172

  5. Streaming instability of aggregating slime mold amoebae

    NASA Astrophysics Data System (ADS)

    Levine, Herbert; Reynolds, William

    1991-05-01

    We propose a new model of aggregation in the cellular slime mold D. Discoideum. Our approach couples the excitable signaling system to amoeba chemotaxis; the resultant system of equations is tractable to analytical and numerical approaches. Using our model, we derive the existence of a streaming instability for the concentric target aggregation pattern.

  6. Bell X-5 Model and Molds

    NASA Technical Reports Server (NTRS)

    1953-01-01

    A Langley model maker examines the molds used to form a model of the Bell X-5, a variable sweep craft that first flew in June of 1951. Photograph published in Winds of Change, 75th Anniversary NASA publication (page 64), by James Schultz.

  7. Contamination of PDMS microchannels by lithographic molds.

    PubMed

    Bubendorfer, Andrea J; Ingham, Bridget; Kennedy, John V; Arnold, W Mike

    2013-11-21

    By use of synchrotron X-ray fluorescence and Rutherford backscattering spectrometry, we show the SU-8 soft lithographic process contaminates PDMS. Residues of the antimony containing photoinitiator are transferred from the master mold to the surface of PDMS, uncontrollably intensifying the surface potential, leading to electroosmotic flow variability in PDMS microfluidic devices. PMID:24080639

  8. Flexible Interior-Impression-Molding Tray

    NASA Technical Reports Server (NTRS)

    Anders, Jeffrey E.

    1991-01-01

    Device used inside combustion chamber of complicated shape for nondestructive evaluation of qualities of welds, including such features as offset, warping, misalignment of parts, and dropthrough. Includes flexible polypropylene tray trimmed to fit desired interior surface contour. Two neodymium boron magnets and inflatable bladder attached to tray. Tray and putty inserted in cavity to make mold of interior surface.

  9. Resin transfer molding speeds composite making

    NASA Astrophysics Data System (ADS)

    Valenti, Michael

    1992-11-01

    Fabrication resin transfer molding (RTM) composite parts for different industrial applications is discussed. These applications include composite aerospace parts, sports car components, and high performance sporting equipment. It is pointed out that RTM parts are lighter than metals and can be formulated to have superior durability. But like all composite parts, they are expensive and are made in limited runs.

  10. Molding Compound For Inspection Of Internal Contours

    NASA Technical Reports Server (NTRS)

    Adams, Jim; Ricklefs, Steve

    1988-01-01

    Material clean, sets rapidly, and easy to use. Silicone elastomer, Citrocon or equivalent, commonly used in dentistry, in combination with mold-release agent (Also see MFS-29240), speeds and facilitates making of impressions of interior surfaces so surface contours examined. Elastomer easily moved around in cavity until required location found.

  11. A REVOLUTION IN MOLD IDENTIFICATION AND ENUMERATION

    EPA Science Inventory

    More than 100 assay were developed to identify and quantify indoor molds using quantitiative PCR (QPCR) assays. This technology incorporates fluorigenic 5' nuclease (TaqMan�) chemistry directed at the nuclear ribosomal RNA operon internal transcribed spacer regions (ITS1 or ITS2...

  12. Mold Die Making. 439-322/324.

    ERIC Educational Resources Information Center

    Yunke, P.; And Others

    Each unit in this curriculum guide on mold die making contains an introduction, objectives, materials required, lessons, space for notes, figures, and diagrams. There are 10 units in this guide: (1) introduction to Electrical Discharge Machining (EDM); (2) EDM principles; (3) the single pulse; (4) EDM safety; (5) electrode material; (6) electrode…

  13. Onychomycosis by molds. Report of 78 cases.

    PubMed

    Bonifaz, Alexandro; Cruz-Aguilar, Pamela; Ponce, Rosa María

    2007-01-01

    A retrospective study of onychomycohosis by molds was carried out during a 14-year period (1992-2005). All cases were clinically and mycologically proven (repetitive KOH and culture) and then each of the molds was identified. A total of 5,221 cases of onychomycosis were evaluated, 78 of which were molds (1.49%). Mean patient age was 44.1 years. 75/78 cases occurred in toenails. Associated factors were detected in 39/78 (50.0%) cases, with the major ones being: peripheral vascular disease, contact with soil, and trauma. The most frequent clinical presentation was distal and lateral subungual onychomycosis (DLSO), in 54/78 cases (69%). The most frequent causative agents were: Scopulariopsis brevicaulis in 34/78 cases and Aspergillus niger in 13/78 cases. Onychomycoses by molds are infrequent; in this study they accounted for 1.49% of cases. The clinical features are virtually similar to those caused by dermatophytes, which makes the clinicomycological tests necessary.

  14. Clinical reactivity to ingestion challenge with mixed mold extract may be enhanced in subjects sensitized to molds.

    PubMed

    Luccioli, Stefano; Malka-Rais, Jonathan; Nsouli, Talal M; Bellanti, Joseph A

    2009-01-01

    Manifestations of mold allergy are classically associated with inhalation of mold spores leading to symptoms of asthma and other respiratory illnesses. It is largely unknown, however, whether ingestion of aeroallergenic molds, mold spores, or other fungi found in food can also elicit hypersensitivity reactions in mold-sensitive individuals. The aim of this study was to evaluate the association between exposure to molds by oral challenge and elicitation of symptoms in mold- versus nonmold-sensitive individuals. Thirty-four adult atopic subjects were randomized into mold-sensitive groups based on skin test reactivity by skin percutaneous testing (SPT) and/or intradermal (ID) testing to a mixed mold (MM) extract preparation. All subjects underwent a single-blinded, placebo-controlled food challenge to the MM preparation. A modified scoring system was used to grade the clinical severity of symptoms elicited by challenge. All subjects tolerated challenges to the maximal oral mold dose concentration. However, higher symptom scores after challenge were found in mold-sensitive subjects compared with nonmold-sensitive subjects (p = 0.01). When mold-sensitive subjects were compared based on SPT and/or ID reactivity, higher symptom scores and lower symptom-eliciting concentrations of mold were associated with the SPT reactive subgroup compared with the subgroup with ID reactivity alone. In summary, based on our challenge results and scoring model, mold-sensitive subjects compared with nonmold-sensitive subjects experienced cumulatively higher symptom scores after oral challenge to an MM extract preparation. Future studies are warranted to confirm whether ingestion of aeroallergenic molds in food may be another contributor to symptoms in mold-sensitive individuals.

  15. Matched metal die compression molded structural random fiber sheet molding compound flywheel

    DOEpatents

    Kulkarni, Satish V.; Christensen, Richard M.; Toland, Richard H.

    1985-01-01

    A flywheel (10) is described that is useful for energy storage in a hybrid vehicle automotive power system or in some stationary applications. The flywheel (10) has a body of essentially planar isotropic high strength structural random fiber sheet molding compound (SMC-R). The flywheel (10) may be economically produced by a matched metal die compression molding process. The flywheel (10) makes energy intensive efficient use of a fiber/resin composite while having a shape designed by theory assuming planar isotropy.

  16. Matched metal die compression molded structural random fiber sheet molding compound flywheel. [Patent application

    DOEpatents

    Kulkarni, S.V.; Christensen, R.M.; Toland, R.H.

    1980-09-24

    A flywheel is described that is useful for energy storage in a hybrid vehicle automotive power system or in some stationary applications. The flywheel has a body of essentially planar isotropic high strength structural random fiber sheet molding compound (SMC-R). The flywheel may be economically produced by a matched metal die compression molding process. The flywheel makes energy intensive efficient use of a fiber/resin composite while having a shape designed by theory assuming planar isotropy.

  17. Multilevel micro-structuring of glassy carbon molds for precision glass molding

    NASA Astrophysics Data System (ADS)

    Prater, Karin; Dukwen, Julia; Scharf, Toralf; Herzig, Hans Peter; Plöger, Sven; Hermerschmidt, Andreas

    2015-09-01

    Replication techniques for diffractive optical elements (DOEs) in soft materials such as plastic injection molding are state of the art. For precision glass molding in glasses with high transition temperatures, molds with extreme thermal resistivity, low chemical reactivity and high mechanical strength are needed. Glassy Carbon can be operated up to 2000°C making it possible to mold almost all glasses including Fused Silica with a transition temperatures above 1060°C. For the structuring of Glassy Carbon wafers photolithography and a RIE process is used. We have developed a process using Si as a hard mask material. If the flow rates of the etching gases O2 and SF6 are chosen properly, high selectivity of GC to Si 19:1 can be achieved, which provides excellent conditions to realize high resolution elements with feature size down to 1 micron and fulfills requirements for optical applications. We fabricated several multilevel GC molds with 8 levels of structuring. Two different optical functionalities were implemented: 6x6 array beamsplitter and 1x4 linear beamsplitter. The molds were applied for precision glass molding of a low Tg glass L-BAL 42 (from Ohara) with a transition temperature of 565°C. Their optical performance was measured. A more detailed analysis of the impact of mold fabrication defects on optical performance is done. Rigorous coupled wave analysis simulations are performed, where we included fabrication constrains such as duty cycle, edge depth errors, wall verticality and misalignment errors. We will compare the results with the design specifications and discuss the influence of fabrication errors introduced during the different process steps.

  18. Indoor Molds and Respiratory Hypersensitivity: A Comparison of Selected Molds and House Dust Mite Induced Responses in a Mouse Model

    EPA Science Inventory

    Introduction/Study Goal Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases including allergic lung diseases. The Institute of Medicine reports and WHO gUidelines concluded that the role of molds in asthma induction is not clear bu...

  19. Pressurized Shell Molds For Metal-Matrix Composites

    NASA Technical Reports Server (NTRS)

    Kashalikar, Uday K.; Lusignea, Richard N.; Cornie, James

    1993-01-01

    Balanced-pressure molds used to make parts in complex shapes from fiber-reinforced metal-matrix composite materials. In single step, molding process makes parts in nearly final shapes; only minor finishing needed. Because molding pressure same on inside and outside, mold does not have to be especially strong and can be made of cheap, nonstructural material like glass or graphite. Fibers do not have to be cut to conform to molds. Method produces parts with high content of continuous fibers. Parts stiff but light in weight, and coefficients of thermal expansion adjusted. Parts resistant to mechanical and thermal fatigue superior to similar parts made by prior fabrication methods.

  20. Brightness field distributions of microlens arrays using micro molding.

    PubMed

    Cheng, Hsin-Chung; Huang, Chiung-Fang; Lin, Yi; Shen, Yung-Kang

    2010-12-20

    This study describes the brightness field distributions of microlens arrays fabricated by micro injection molding (μIM) and micro injection-compression molding (μICM). The process for fabricating microlens arrays used room-temperature imprint lithography, photoresist reflow, electroforming, μIM, μICM, and optical properties measurement. Analytical results indicate that the brightness field distribution of the molded microlens arrays generated by μICM is better than those made using μIM. Our results further demonstrate that mold temperature is the most important processing parameter for brightness field distribution of molded microlens arrays made by μIM or μICM.

  1. Direct micropatterning of polymer materials by ice mold

    NASA Astrophysics Data System (ADS)

    Yu, Xinhong; Xing, Rubo; Luan, Shifang; Wang, Zhe; Han, Yanchun

    2006-10-01

    Micropatterning of functional polymer materials by micromolding in capillaries (MIMIC) with ice mold is reported in this paper. Ice mold was selected due to its thaw or sublimation. Thus, the mold can be easily removed. Furthermore, the polymer solution did not react with, swell, or adhere to the ice mold, so the method is suitable for many kinds of materials (such as P3HT, PMMA Alq 3/PVK, PEDOT: PSS, PS, P2VP, etc.). Freestanding polymer microstructures, binary polymer pattern, and microchannels have been fabricated by the use of ice mold freely.

  2. A comparison of molding procedures - Contact, injection and vacuum injection

    NASA Astrophysics Data System (ADS)

    Cathiard, G.

    1980-06-01

    The technical and economic aspects of the contact, injection and vacuum injection molding of reinforced plastic components are compared for the example of a tractor roof with a gel-coated surface. Consideration is given to the possibility of reinforcement, number of smooth faces, condition of the gel-coated surface, reliability, and labor and workplace requirements of the three processes, and advantages of molding between the mold and a countermold in smooth faces, reliability, labor requirements, working surface and industrial hygiene are pointed out. The times and labor requirements of each step in the molding cycles are examined, and material requirements and yields, investment costs, amortization and product cost prices of the processes are compared. It is concluded that, for the specific component examined, the processes of vacuum injection and injection molding appear very interesting, with injection molding processes resulting in lower cost prices than contact molding for any production volume.

  3. Mold exposure and health effects following hurricanes Katrina and Rita.

    PubMed

    Barbeau, Deborah N; Grimsley, L Faye; White, LuAnn E; El-Dahr, Jane M; Lichtveld, Maureen

    2010-01-01

    The extensive flooding in the aftermath of Hurricanes Katrina and Rita created conditions ideal for indoor mold growth, raising concerns about the possible adverse health effects associated with indoor mold exposure. Studies evaluating the levels of indoor and outdoor molds in the months following the hurricanes found high levels of mold growth. Homes with greater flood damage, especially those with >3 feet of indoor flooding, demonstrated higher levels of mold growth compared with homes with little or no flooding. Water intrusion due to roof damage was also associated with mold growth. However, no increase in the occurrence of adverse health outcomes has been observed in published reports to date. This article considers reasons why studies of mold exposure after the hurricane do not show a greater health impact.

  4. MONITORING MYCOTOXIN PRODUCTION AT THE GENETIC LEVEL ON VARIOUS GROWTH SUBSTRATES USING QUANTITATIVE REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION?EXPERIMENT DESIGN

    EPA Science Inventory

    The paper describes a method of analyzing the production of mycotoxins at the genetic level by monitoring the intracellular levels of messenger RNA (mRNA). Initial work will focus on threshing out the mycotoxin gene clusters in Stachybotrys chartarum followed by analysis of toxin...

  5. Molds on Food: Are They Dangerous?

    MedlinePlus

    ... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Molds on Food: Are they dangerous? Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...

  6. Chemorheology of in-mold coating for compression molded SMC applications

    NASA Astrophysics Data System (ADS)

    Ko, Seunghyun; Straus, Elliott J.; Castro, Jose M.

    2015-05-01

    In-mold coating (IMC) is applied to compression molded sheet molding compound (SMC) exterior automotive or truck body panels as an environmentally friendly alternative to make the surface conductive for subsequent electrostatic painting operations. The coating is a thermosetting liquid that when injected onto the surface of the part cures and bonds to provide a smooth conductive surface. In order to optimize the IMC process, it is essential to predict the time available for flow, that is the time before the thermosetting reaction starts (inhibition time) as well as the time when the coating has enough structural integrity so that the mold can be opened without damaging the part surface (cure time). To predict both the inhibition time and the cure time, it is critical to study the chemorheology of IMC. In this paper, we study the chemorheology for a typical commercial IMC system, and show its relevance to both the flow and cure time for the IMC stage during SMC compression molding.

  7. Gastroresistant capsular device prepared by injection molding.

    PubMed

    Zema, Lucia; Loreti, Giulia; Melocchi, Alice; Maroni, Alessandra; Palugan, Luca; Gazzaniga, Andrea

    2013-01-20

    In the present work, the possibility of manufacturing by injection molding (IM) a gastro-resistant capsular device based on hydroxypropyl methyl cellulose acetate succinate (HPMCAS) was investigated. By performing as an enteric soluble container, such a device may provide a basis for the development of advantageous alternatives to coated dosage forms. Preliminarily, the processability of the selected thermoplastic polymer was evaluated, and the need for a plasticizer (polyethylene glycol 1500) in order to counterbalance the glassy nature of the molded items was assessed. However, some critical issues related to the physical/mechanical stability (shrinkage and warpage) and opening time of the device after the pH change were highlighted. Accordingly, an in-depth formulation study was carried out taking into account differing release modifiers potentially useful for enhancing the dissolution/disintegration rate of the capsular device at intestinal pH values. Capsule prototypes with thickness of 600 and 900 μm containing Kollicoat(®) IR and/or Explotab(®) CLV could be manufactured, and a promising performance was achieved with appropriate gastric resistance in pH 1.2 medium and break-up in pH 6.8 within 1h. These results would support the design of a dedicated mold for the development of a scalable manufacturing process. PMID:22683648

  8. Characterization of airborne fungal levels after mold remediation.

    PubMed

    Kleinheinz, G T; Langolf, B M; Englebert, E

    2006-01-01

    The overall objective of this project was to evaluate levels of airborne fungi present after a mold remediation project and determine the effectiveness of this remediation using airborne mold levels to determine the success of these projects. Andersen N6 (viable) and Air-O-Cell (non-viable) sampling techniques were utilized. Both test methodologies demonstrated that levels of mold in the successfully remediated portions of buildings were significantly different (p<0.05) from the levels found in non-complaint and outdoor samples from the same building, respectively. Conversely, levels in unsuccessful remediation projects were not significantly different (p>0.05) to non-complaint and outdoor samples. Both techniques showed high variability in the overall mold levels found between sites; however, the ratios of specific mold groups in each area tested, within the same site, were remarkably similar. The use of either viable or non-viable mold sampling techniques after mold remediation is essential for determining the success of such projects. This project demonstrates the relationship between mold levels and the success of a mold remediation projects, and will assist in the interpretation of data collected at the conclusion of a mold remediation project.

  9. Development effort of sheet molding compound (SMC) parabolic trough panels

    SciTech Connect

    Kirsch, P.A.; Champion, R.L.

    1982-01-01

    The objectives of the development effort are to: investigate the problems of molding parabolic trough solar reflector panels of sheet molding compound (SMC); develop molding techniques and processes by which silvered glass reflector sheets can be integrally molded into SMC trough panels; provide representative prototype panels for evaluation; and provide information regarding the technical feasibility of molding SMC panels in high volume production. The approach taken to meet the objectives was to design the parabolic panel, fabricate a prototype die, choose an SMC formulation and mold the glass and SMC together into a vertex to rim mirrored panel. The main thrust of the program was to successfully co-mold a mirrored glass sheet with the SMC. Results indicate that mirrored glass sheets, if properly strengthened to withstand the temperature and pressure of the molding process, can be successfully molded with SMC in a single press stroke using standard compression molding techniques. The finalized design of the trough panel is given. The SMC formulation chosen is a low shrink, low profile SMC using 40% by weight one inch chopped glass fibers in a uv stabilized polyester resin matrix. A program to test for the adhesion between mirrored glass sheets and the SMC is discussed briefly. (LEW)

  10. Heat pipe cooling of an aerospace foam mold manufacturing process

    SciTech Connect

    Hahn, D.R.; Feldman, K.T.; Marjon, P.L.

    1980-01-01

    A passive heat pipe cooling system was developed to cool a Bendix foam mold used to manufacture aerospace foam parts. The cooling system consists of ten copper-water heat pipes with cooling fins implanted into the aluminum mold and cooled by a domestic size fan blowing ambient air. The number and location of the heat pipes was determined to provide the most effective cooling and mold isothermalization based on experimental measurements of mold temperatures during the exothermic foaming process and from practical considerations of the mold geometry and use. Performance tests were cnducted on an individual heat pipe and on the ten heat pipes implanted in the mold. Both exothermic foam heating and internal electrical heat input were used in the experiments. The experimental test results indicate that the heat pipe cooling system with a fan is four to six times faster than free convection cooling of the mold with no heat pipes or fan and nearly twice as fast as cooling by the fan only. Similarly fast increases in mold heating time in the cure furnace could be realized if the heat pipes are used during this part of the production process. The heat pipes also cool hot spots in the mold and help isothermalize the mold so that better quality foam parts should be produced.

  11. Effect of mold treatment by solvent on PDMS molding into nanoholes

    PubMed Central

    2013-01-01

    Polydimethylsiloxane (PDMS) is the most popular and versatile material for soft lithography due to its flexibility and easy fabrication by molding process. However, for nanoscale patterns, it is challenging to fill uncured PDMS into the holes or trenches on the master mold that is coated with a silane anti-adhesion layer needed for clean demolding. PDMS filling was previously found to be facilitated by diluting it with toluene or hexane, which was attributed to the great reduction of viscosity for diluted PDMS. Here, we suggest that the reason behind the improved filling for diluted PDMS is that the diluent solvent increases in situ the surface energy of the silane-treated mold and thus the wetting of PDMS to the mold surface. We treated the master mold surface (that was already coated with a silane anti-adhesion monolayer) with toluene or hexane, and found that the filling by undiluted PMDS into the nanoscale holes on the master mold was improved despite the high viscosity of the undiluted PDMS. A simple estimation based on capillary filing into a channel also gives a filling time on the millisecond scale, which implies that the viscosity of PMDS should not be the limiting factor. We achieved a hole filling down to sub-200-nm diameter that is smaller than those of the previous studies using regular Sylgard PDMS (not hard PDMS, Dow Corning Corporation, Midland, MI, USA). However, we are not able to explain using a simple argument based on wetting property why smaller, e.g., sub-100-nm holes, cannot be filled, for which we suggested a few possible factors for its explanation. PMID:24059263

  12. Effect of mold treatment by solvent on PDMS molding into nanoholes.

    PubMed

    Con, Celal; Cui, Bo

    2013-01-01

    Polydimethylsiloxane (PDMS) is the most popular and versatile material for soft lithography due to its flexibility and easy fabrication by molding process. However, for nanoscale patterns, it is challenging to fill uncured PDMS into the holes or trenches on the master mold that is coated with a silane anti-adhesion layer needed for clean demolding. PDMS filling was previously found to be facilitated by diluting it with toluene or hexane, which was attributed to the great reduction of viscosity for diluted PDMS. Here, we suggest that the reason behind the improved filling for diluted PDMS is that the diluent solvent increases in situ the surface energy of the silane-treated mold and thus the wetting of PDMS to the mold surface. We treated the master mold surface (that was already coated with a silane anti-adhesion monolayer) with toluene or hexane, and found that the filling by undiluted PMDS into the nanoscale holes on the master mold was improved despite the high viscosity of the undiluted PDMS. A simple estimation based on capillary filing into a channel also gives a filling time on the millisecond scale, which implies that the viscosity of PMDS should not be the limiting factor. We achieved a hole filling down to sub-200-nm diameter that is smaller than those of the previous studies using regular Sylgard PDMS (not hard PDMS, Dow Corning Corporation, Midland, MI, USA). However, we are not able to explain using a simple argument based on wetting property why smaller, e.g., sub-100-nm holes, cannot be filled, for which we suggested a few possible factors for its explanation.

  13. Effect of mold treatment by solvent on PDMS molding into nanoholes

    NASA Astrophysics Data System (ADS)

    Con, Celal; Cui, Bo

    2013-09-01

    Polydimethylsiloxane (PDMS) is the most popular and versatile material for soft lithography due to its flexibility and easy fabrication by molding process. However, for nanoscale patterns, it is challenging to fill uncured PDMS into the holes or trenches on the master mold that is coated with a silane anti-adhesion layer needed for clean demolding. PDMS filling was previously found to be facilitated by diluting it with toluene or hexane, which was attributed to the great reduction of viscosity for diluted PDMS. Here, we suggest that the reason behind the improved filling for diluted PDMS is that the diluent solvent increases in situ the surface energy of the silane-treated mold and thus the wetting of PDMS to the mold surface. We treated the master mold surface (that was already coated with a silane anti-adhesion monolayer) with toluene or hexane, and found that the filling by undiluted PMDS into the nanoscale holes on the master mold was improved despite the high viscosity of the undiluted PDMS. A simple estimation based on capillary filing into a channel also gives a filling time on the millisecond scale, which implies that the viscosity of PMDS should not be the limiting factor. We achieved a hole filling down to sub-200-nm diameter that is smaller than those of the previous studies using regular Sylgard PDMS (not hard PDMS, Dow Corning Corporation, Midland, MI, USA). However, we are not able to explain using a simple argument based on wetting property why smaller, e.g., sub-100-nm holes, cannot be filled, for which we suggested a few possible factors for its explanation.

  14. Replication of the nano-scale mold fabricated with focused ion beam

    NASA Astrophysics Data System (ADS)

    Gao, J. X.; Chan-Park, M. B.; Xie, D. Z.; Ngoi, Bryan K. A.

    2004-12-01

    Silicon mold fabricated with Focused Ion Beam lithography (FIB) was used to make silicone elastomer molds. The silicon mold is composed of lattice of holes which the diameter and depth are about 200 nm and 60 nm, respectively. The silicone elastomer material was then used to replicate slavery mold. Our study show the replication process with the elastomer mold had been performed successfully and the diameter of humps on the elastomer mold is near to that of holes on the master mold. But the height of humps in the elastomer mold is only 42 nm and it is different from the depth of holes in the master mold.

  15. Evacuated, displacement compression mold. [of tubular bodies from thermosetting plastics

    NASA Technical Reports Server (NTRS)

    Heier, W. C. (Inventor)

    1974-01-01

    A process of molding long thin-wall tubular bodies from thermosetting plastic molding compounds is described wherein the tubular body lengths may be several times the diameters. The process is accomplished by loading a predetermined quantity of molding compound into a female mold cavity closed at one end by a force mandrel. After closing the other end of the female mold with a balance mandrel, the loaded cavity is evacuated by applying a vacuum of from one-to-five mm pressure for a period of fifteen-to-thirty minutes. The mold temperature is raised to the minimum temperature at which the resin constituent of the compound will soften or plasticize and a pressure of 2500 psi is applied.

  16. Snow molds: A group of fungi that prevail under snow.

    PubMed

    Matsumoto, Naoyuki

    2009-01-01

    Snow molds are a group of fungi that attack dormant plants under snow. In this paper, their survival strategies are illustrated with regard to adaptation to the unique environment under snow. Snow molds consist of diverse taxonomic groups and are divided into obligate and facultative fungi. Obligate snow molds exclusively prevail during winter with or without snow, whereas facultative snow molds can thrive even in the growing season of plants. Snow molds grow at low temperatures in habitats where antagonists are practically absent, and host plants deteriorate due to inhibited photosynthesis under snow. These features characterize snow molds as opportunistic parasites. The environment under snow represents a habitat where resources available are limited. There are two contrasting strategies for resource utilization, i.e., individualisms and collectivism. Freeze tolerance is also critical for them to survive freezing temperatures, and several mechanisms are illustrated. Finally, strategies to cope with annual fluctuations in snow cover are discussed in terms of predictability of the habitat.

  17. Preliminary concepts for high-temperature mold heating and cooling

    SciTech Connect

    Larson, J.P.

    1990-12-01

    The feasibility and limitations of various methods for mold heating and cooling were investigated. Two methods were chosen for evaluation: electrical heating and water cooling, and electrical heating and heat pipe conduction cooling. A model mold of each method was built. Test results indicated that the electrical heating and circulated water cooling was the better method. An injection mold utilizing this method was fabricated and temperature-cycled between 300 and 770{degree}F. 1 ref., 2 figs., 7 tabs.

  18. Mold and human health: separating the wheat from the chaff.

    PubMed

    Pettigrew, H David; Selmi, Carlo F; Teuber, Suzanne S; Gershwin, M Eric

    2010-04-01

    The term "mold" is utilized to define the ubiquitous fungal species commonly found in household dust and observed as visible multicellular filaments. Several well-defined human diseases are known to be caused or exacerbated by mold or by exposure to their byproducts. Among these, a solid connection has been established with infections, allergic bronchopulmonary aspergillosis, allergic fungal rhinosinusitis, hypersensitivity pneumonitis, and asthma. In the past decades, other less-defined and generally false conditions have also been ascribed to mold. We will herein review and critically discuss the available evidence on the influence of mold on human health.

  19. Injection molding of ceramics using a polyacetal based binder system

    SciTech Connect

    Ebenhoech, J.S.

    1996-06-01

    Among the production routes to small complex ceramic parts, powder injection molding is the most attractive alternative. It combines near net shape capability with good surface finish and is easy to automate. With the development of the catalytic debinding process for polyacetal binders, the main impediments for the acceptance of ceramic injection molding as a mass production method can be overcome. The use of this system ensures short molding cycle times, high green strength and fast debinding without deformation. Ready to mold compounds are commercially available for various oxide and non-oxide ceramic materials as well as the equipment needed for this process.

  20. Universal signals control slime mold stalk formation.

    PubMed

    van Es, S; Nieuwenhuijsen, B W; Lenouvel, F; van Deursen, E M; Schaap, P

    1994-08-16

    The primitive slime mold Dictyostelium minutum does not display oscillations during aggregation, cannot form migrating slugs, and does not form a prestalk/prespore pattern, all of which are characteristic for development of its advanced relative Dictyostelium discoideum. We used D. minutum to investigate whether slime molds share common mechanisms controlling development. In D. discoideum, the morphogen differentiation inducing factor (DIF) can induce stalk-cell differentiation in vitro. However, stalk formation in vivo is supposedly triggered by local depletion of DIF antagonists such as ammonia or cAMP. A homologue of the D. discoideum stalk gene ecmB was cloned in D. minutum that encodes a 3.4-kb mRNA, and its deduced amino acid sequence shows repeats of 24 amino acids that are characteristic for the D. discoideum ecmB gene. Remarkably, DIF effectively induces expression of the D. minutum ecmB gene and ammonia inhibits its expression. D. discoideum cells were transformed with a construct of the D. minutum ecmB promoter fused to the lacZ reporter gene and showed expression in the stalk, but not in the upper and lower cup of the fruiting body, which also express the D. discoideum ecmB gene. In D. discoideum, the D. minutum ecmB and the ecmB promoter are similarly activated by DIF and repressed by both cAMP and ammonia, suggesting that additional signaling is required for ecmB expression in upper and lower cup cells. Our data indicate that the extracellular signals controlling stalk formation and their intracellular signaling cascades including gene regulatory proteins remained highly conserved during slime mold evolution. PMID:8058783

  1. Comparison of injection molding and injection/compression molding for the replication of microstructure

    NASA Astrophysics Data System (ADS)

    Hong, Seokkwan; Hwang, Jeongho; Kang, Jeongjin; Yoon, Kyunghwan

    2015-11-01

    Because of increasing interest in the functional surfaces including micro- or nano-patterns, the mass production of such surfaces has been actively researched. Both conventional injection molding (CIM) and injection/compression molding (ICM) of micro-patterns were investigated in the present study. The molding subject is a multi-scale structure that consists of a macro-scale thin plate and micro-scale patterns formed regularly on its surface. The transcription ratios of micro pattern made by CIM and ICM for different flow length were experimentally measured, and the origin of the obtained results was identified through numerical analysis. It was found that the cavity pressure and polymer temperature are the most important factors for micro-pattern filling; in particular, the polymer temperature is the key factor determining the transcription ratio. It was also found that the difference in CIM and ICM micro-pattern transcription ratios originates from the differences in the cavity pressure history if other molding conditions are the same.

  2. Investigations on injection molded, glass-fiber reinforced polyamide 6 integral foams using breathing mold technology

    NASA Astrophysics Data System (ADS)

    Roch, A.; Kehret, L.; Huber, T.; Henning, F.; Elsner, P.

    2015-05-01

    Investigations on PA6-GF50 integral foams have been carried out using different material systems: longfiber- and shortfiber-reinforced PA6 as well as unreinforced PA6 as a reference material. Both chemical and physical blowing agents were applied. Breathing mold technology (decompression of the mold) was selected for the foaming process. The integral foam design, which can be conceived as a sandwich structure, helps to save material in the neutral axis area and maintains a distance between load-bearing, unfoamed skin layers. For all test series an initial mold gap of 2.5 mm was chosen and the same amount of material was injected. In order to realize different density reductions, the mold opening stroke was varied. The experiments showed that, at a constant mass per unit area, integral polyamide 6 foams have a significantly higher bending stiffness than compact components, due to their higher area moment of inertia after foaming. At a constant surface weight the bending stiffness in these experiments could be increased by up to 600 %. Both shortfiber- and longfiber-reinforced polyamide 6 showed an increase in energy absorption during foaming.

  3. Precision grinding of tungsten carbide mold insert for molding of sub-millimeter glass aspheric lenses

    NASA Astrophysics Data System (ADS)

    Chao, Choung-Lii; Chang, Chia-Jung; Chen, Chun-Chieh; Chou, Wen-Chen; Ma, Kung-Jeng

    2013-06-01

    As the demand for precision optical components with sub-millimeter feature size steadily increasing, numerous efforts have been made in developing new techniques and in improving the existing approaches to efficiently and economically produce those components. Glass molding process (GMP) is one of these methods to enable mass production of precision glass optical components in recent years. One of the key issues in GMP is precision mold insert fabrication. Since the mould are normally made of hard and brittle materials such as tungsten carbide (WC) and silicon carbide (SiC), precision diamond grinding is by far the principal choice used to machine the GMP mould. As the feature size of optical component gets smaller, the size of mould and grinding wheel used to fabricate the mould gets smaller too. This makes the grinding process a very time consuming and expensive task. This research aimed to improve the small mold fabrication processes by developing an effective way of producing small diamond wheels and in-process monitoring wheel profile. Diamond wheels of around 0.2mm to 0.5mm in diameter after truing and WC aspheric mold insert of form accuracy around 0.47μm were successfully produced in this research.

  4. Microminiature molding techniques for cochlear electrode arrays.

    PubMed

    Loeb, G E; Peck, R A; Smith, D W

    1995-12-01

    We provide a general method for producing a variety of small, complex electrode arrays based on injection molds produced using computer-aided drafting and machining (CAD-CAM) procedures and a novel method for connecting to the very fine electrical leads associated with the individual contacts of such arrays. Cat-sized cochlear electrode arrays with up to eight contacts were built according to these methods and their electrical contacts were characterized in vitro by impedance spectroscopy and in vivo by monitoring impedance for over 1 year of intermittent stimulation in chronically instrumented animals. PMID:8788052

  5. Dip-molded t-shaped cannula

    NASA Technical Reports Server (NTRS)

    Broyles, H. F.; Cuddihy, E. F.; Moacanin, J.

    1978-01-01

    Cannula, fabricated out of polyetherurethane, has been designed for long-term service. Improved cannula is T-shaped to collect blood from both directions, thus replacing two conventional cannulas that are usually required and eliminating need for large surgical wound. It is fabricated by using dip-molding process that can be adapted to other elastomeric objects having complex shapes. Dimensions of cannula were chosen to optimize its blood-flow properties and to reduce danger of excessive clotting, making it suitable for continuous service up to 21 days in vein or artery of patient.

  6. Resin transfer molding of textile composites

    NASA Technical Reports Server (NTRS)

    Falcone, Anthony; Dursch, Harry; Nelson, Karl; Avery, William

    1993-01-01

    The design and manufacture of textile composite panels, tubes, and angle sections that were provided to NASA for testing and evaluation are documented. The textile preform designs and requirements were established by NASA in collaboration with Boeing and several vendors of textile reinforcements. The following four types of preform architectures were used: stitched uniweave, 2D-braids, 3D-braids, and interlock weaves. The preforms consisted primarily of Hercules AS4 carbon fiber; Shell RSL-1895 resin was introduced using a resin transfer molding process. All the finished parts were inspected using ultrasonics.

  7. Integrally cored ceramic investment casting mold fabricated by ceramic stereolithography

    NASA Astrophysics Data System (ADS)

    Bae, Chang-Jun

    Superalloy airfoils are produced by investment casting (IC), which uses ceramic cores and wax patterns with ceramic shell molds. Hollow cored superalloy airfoils in a gas turbine engine are an example of complex IC parts. The complex internal hollow cavities of the airfoil are designed to conduct cooling air through one or more passageways. These complex internal passageways have been fabricated by a lost wax process requiring several processing steps; core preparation, injection molding for wax pattern, and dipping process for ceramic shell molds. Several steps generate problems such as high cost and decreased accuracy of the ceramic mold. For example, costly tooling and production delay are required to produce mold dies for complex cores and wax patterns used in injection molding, resulting in a big obstacle for prototypes and smaller production runs. Rather than using separate cores, patterns, and shell molds, it would be advantageous to directly produce a mold that has the casting cavity and the ceramic core by one process. Ceramic stereolithography (CerSLA) can be used to directly fabricate the integrally cored ceramic casting mold (ICCM). CerSLA builds ceramic green objects from CAD files from many thin liquid layers of powder in monomer, which are solidified by polymerization with a UV laser, thereby "writing" the design for each slice. This dissertation addresses the integrally cored casting ceramic mold (ICCM), the ceramic core with a ceramic mold shell in a single patternless construction, fabricated by ceramic stereolithography (CerSLA). CerSLA is considered as an alternative method to replace lost wax processes, for small production runs or designs too complex for conventional cores and patterns. The main topic is the development of methods to successfully fabricate an ICCM by CerSLA from refractory silica, as well as related issues. The related issues are the segregation of coarse fused silica powders in a layer, the degree of segregation parameter to

  8. Method for collecting spores from a mold

    DOEpatents

    Au, Frederick H. F.; Beckert, Werner F.

    1977-01-01

    A technique and apparatus used therewith for determining the uptake of plutonium and other contaminants by soil microorganisms which, in turn, gives a measure of the plutonium and/or other contaminants available to the biosphere at that particular time. A measured quantity of uncontaminated spores of a selected mold is added to a moistened sample of the soil to be tested. The mixture is allowed to sit a predetermined number of days under specified temperature conditions. An agar layer is then applied to the top of the sample. After three or more days, when spores of the mold growing in the sample have formed, the spores are collected by a miniature vacuum collection apparatus operated under preselected vacuum conditions, which collect only the spores with essentially no contamination by mycelial fragments or culture medium. After collection, the fungal spores are dried and analyzed for the plutonium and/or other contaminants. The apparatus is also suitable for collection of pollen, small insects, dust and other small particles, material from thin-layer chromatography plates, etc.

  9. Gravitational response of the slime mold Physarum

    NASA Astrophysics Data System (ADS)

    Block, I.; Wolke, A.; Briegleb, W.

    1994-08-01

    The acellular slime mold Physarum polycephalum is used as a model system to investigate the graviresponse of single cells which possess no receptors specialized for the perception of gravity. To obtain insights into the gravity-signal transduciton mechanism the light response of the cell is used: Macroplsmodia of the slime mold show clear geo- and phototaxes. Gravity increases and white light decreases transiently the concentration frequency of plasmodial strands whereby both responses follow the same time pattern. Since mitochodria play major role in changing the contraction rhythm in response to light and gravity stimuli, the simultaneous and subsequent inductions of the opposing light and gravity responses and their mutual influences on one another were investigated. The experiments were performed in weightlessness (0 g) - simulated on the fast-rotating clinostat as well as in actual weightlessness during the IML-1 Space-Shuttle mission. The results indicate that mitochondria (chondriome) are part of the acceleration-stimulus reaction chain in Physarum. Two models for a direct gravireceptor mechanism are discussed.

  10. The cellular slime mold: eukaryotic model microorganism.

    PubMed

    Urushihara, Hideko

    2009-04-01

    Cellular slime molds are eukaryotic microorganisms in the soil. They feed on bacteria as solitary amoebae but conditionally construct multicellular forms in which cell differentiation takes place. Therefore, they are attractive for the study of fundamental biological phenomena such as phagocytosis, cell division, chemotactic movements, intercellular communication, cell differentiation, and morphogenesis. The most widely used species, Dictyostelium discoideum, is highly amenable to experimental manipulation and can be used with most recent molecular biological techniques. Its genome and cDNA analyses have been completed and well-annotated data are publicly available. A larger number of orthologues of human disease-related genes were found in D. discoideum than in yeast. Moreover, some pathogenic bacteria infect Dictyostelium amoebae. Thus, this microorganism can also offer a good experimental system for biomedical research. The resources of cellular slime molds, standard strains, mutants, and genes are maintained and distributed upon request by the core center of the National BioResource Project (NBRP-nenkin) to support Dictyostelium community users as well as new users interested in new platforms for research and/or phylogenic consideration.

  11. Effect of antioxidants of aflatoxigenic molds

    SciTech Connect

    Ahmad, M.M.

    1986-01-01

    Growth and aflatoxin production by Aspergillus flavus and A. parasiticus were measured in synthetic media and chicken feed treated with butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethoxyquin (EXQ), propyl gallate (PG) or t-butylhydroquinone (TBHQ) at 50-250 ..mu..g/g and 50-1000 ..mu..g/g, respectively. BHA at 50 ..mu..g/g in broth or agar inhibited growth and alfatoxin production by both molds. In poultry feeds, 1000 ..mu..g/g BHA was required to depress CO/sub 2/ production at day 5 of incubation, while 200 ..mu..g/g decreased aflatoxin B/sub 1/ 23.8%. BHT, EXQ, and PG had slight effects on mold growth while TBHQ enhanced growth on broth but reduced it on agar. Afaltoxin B/sub 1/ production was stimulated by EXQ, although G/sub 1/ production declines. Measurement of cellular constituents released from mycelia over 5 hours indicated that BHA doubled the release of UV-absorbing materials and increase by threefold the release of previously incorporated radiolabeled compounds. Furthermore, BHA inhibited the uptake of /sup 14/C-amino acids 8 and 44%, /sup 3/H-uridine 65 and 91%, and /sup 3/H-methyl thymidine 67 and 71%, for A. flavus and A. parasiticus, respectively, compared to untreated controls.

  12. Low cost molded optics for IR imaging

    NASA Astrophysics Data System (ADS)

    Zhao, Jing; DiFilippo, Vincent; Li, Michael

    2009-05-01

    Infrared sensors play a critical role in detection, guidance, and targeting in today's military systems and warfighter equipment, ranging from man-portable to space-borne. Although significant progress is being made in the development of IR imagers, another important component of IR sensors has not evolved significantly-the optics. Current IR lenses are primarily made of expensive single-crystal germanium with tedious mechanical fabrication operations that include grinding, polishing, and edging. There is an industry wide need for lower cost and higher performance IR lenses. Agiltron has developed a technology to directly mold IR lenses to net-shape without additional finishing operations. This manufacturing technology produces optics with many-fold reductions in cost, size, weight, and fabrication time. The ability to reproducibly manufacture aspheric optics with complex net-shapes reduces the number of lenses traditionally required for imaging systems, providing aberration correction as well as system weight and size reductions. Additionally, anti-reflective surfaces can be molded into the glass, eliminating the need for expensive AR coatings. This technology utilizes a new chalcogenide glass material that reduces temperature induced index of refraction changes to near zero, and has a thermal expansion coefficient similar to aluminum. The result is a new generation of low cost, high performance and thermally robust IR lens systems.

  13. Composite fabrication via resin transfer molding technology

    SciTech Connect

    Jamison, G.M.; Domeier, L.A.

    1996-04-01

    The IMPReS (Integrated Modeling and Processing of Resin-based Structures) Program was funded in FY95 to consolidate, evaluate and enhance Sandia`s capabilities in the design and fabrication of composite structures. A key driver of this and related programs was the need for more agile product development processes and for model based design and fabrication tools across all of Sandia`s material technologies. A team of polymer, composite and modeling personnel was assembled to benchmark Sandia`s existing expertise in this area relative to industrial and academic programs and to initiate the tasks required to meet Sandia`s future needs. RTM (Resin Transfer Molding) was selected as the focus composite fabrication technology due to its versatility and growing use in industry. Modeling efforts focused on the prediction of composite mechanical properties and failure/damage mechanisms and also on the uncured resin flow processes typical of RTM. Appropriate molds and test composites were fabricated and model validation studies begun. This report summarizes and archives the modeling and fabrication studies carried out under IMPReS and evaluates the status of composite technology within Sandia. It should provide a complete and convenient baseline for future composite technology efforts within Sandia.

  14. Rotational molding of bio-polymers

    NASA Astrophysics Data System (ADS)

    Greco, Antonio; Maffezzoli, Alfonso; Forleo, Stefania

    2014-05-01

    This paper is aimed to study the suitability of bio-polymers, including poly-lactic acid (PLLA) and Mater-Bi, for the production of hollow components by rotational molding. In order to reduce the brittleness of PLLA, the material was mixed with two different plasticizers, bis-ethyl-hexyl-phthalate (DEHP) and poly-ethylene-glycol (PEG). The materials were characterized in terms of sinterability. To this purpose, thermomechanical (TMA) analysis was performed at different heating rates, in order to identify the endset temperatures of densification and the onset temperatures of degradation. Results obtained indicated that the materials are characterized by a very fast sintering process, occurring just above the melting temperature, and an adequately high onset of degradation. The difference between the onset of degradation and the endset of sintering, defined as the processing window of the polymer, is sufficiently wide, indicating that the polymers can be efficiently processed by rotational molding. Therefore, a laboratory scale apparatus was used for the production of PLLA and Mater-Bi prototypes. The materials were processed using very similar conditions to those used for LLDPE. The production of void-free samples of uniform wall thickness was considered as an indication of the potentiality of the process for the production of biodegradable containers.

  15. METHOD FOR EVALUATING MOLD GROWTH ON CEILING TILE

    EPA Science Inventory

    A method to extract mold spores from porous ceiling tiles was developed using a masticator blender. Ceiling tiles were inoculated and analyzed using four species of mold. Statistical analysis comparing results obtained by masticator extraction and the swab method was performed. T...

  16. MOLD GROWTH ON GYPSUM WALLBOARD--A RESEARCH SUMMARY

    EPA Science Inventory

    Reducing occupant exposure to mold growing on damp gypsum wallboard is a research objective of the U.S. Environmental Protection Agency. Often mold contaminated building materials are not properly removed but instead surface cleaners are used and then paint is applied in an attem...

  17. 21 CFR 177.2410 - Phenolic resins in molded articles.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Phenolic resins in molded articles. 177.2410... as Components of Articles Intended for Repeated Use § 177.2410 Phenolic resins in molded articles... articles intended for repeated use in contact with nonacid food (pH above 5.0), in accordance with...

  18. 21 CFR 177.2410 - Phenolic resins in molded articles.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Phenolic resins in molded articles. 177.2410... as Components of Articles Intended for Repeated Use § 177.2410 Phenolic resins in molded articles... articles intended for repeated use in contact with nonacid food (pH above 5.0), in accordance with...

  19. THE CHALLENGE OF MOLDS FOR THE U.S. ARMY

    EPA Science Inventory

    The US Army and all armies have been interested in molds since there were armies. The most obvious interest was human infections by molds like trench foot. Then there were losses of military animals and contamination of their fodder, most notably the Soviet loss of thousands o...

  20. Using Cellular Slime Molds in the High School Laboratory

    ERIC Educational Resources Information Center

    Haskins, P. B.

    1977-01-01

    Described is the life cycle of the cellular slime molds Acrasiales. Experiments that can be used to explore the aggregation, migration, and culmination activities of the organism are suggested. Laboratory procedures for culturing these slime molds and listings of biological supply houses and literature references are also given. (MA)

  1. Occurrence of Fuligo gyrosa Causing Slime Mold of Oriental Melon.

    PubMed

    Kim, Wan Gyu; Choi, Hyo Won; Hong, Sung Kee; Lee, Young Kee; Lee, Su Heon

    2009-09-01

    Recently, a severe slime mold infestation affected oriental melon plants in fields in Chilgok county, Gyeongbuk province, Korea. Specimens were collected from the fields and examined for identification. A species of Myxomycetes, Fuligo gyrosa, was identified based on its morphological characteristics. This is the first report that F. gyrosa causes slime mold of oriental melon.

  2. Physarum attraction: Why slime mold behaves as cats do?

    PubMed

    Adamatzky, Andrew; Costello, Ben De Lacy

    2012-05-01

    We discuss potential chemical substances responsible for attracting acellular slime mold Physarun polycephalum to valerian root. The contributes toward fundamental research into pheromones and chemo-attracts of primitive organisms such as slime molds. The results show that significant information could be gained about the action of compounds on higher organisms.

  3. New methods and materials for molding and casting ice formations

    NASA Technical Reports Server (NTRS)

    Reehorst, Andrew L.; Richter, G. Paul

    1987-01-01

    This study was designed to find improved materials and techniques for molding and casting natural or simulated ice shapes that could replace the wax and plaster method. By utilizing modern molding and casting materials and techniques, a new methodology was developed that provides excellent reproduction, low-temperature capability, and reasonable turnaround time. The resulting casts are accurate and tough.

  4. SPECIFIC MOLDS ASSOCIATED WITH ASTHMA IN WATER-DAMAGED HOMES

    EPA Science Inventory

    Objective: We sought to determine if specific molds were found in significantly higher concentrations in the water-damaged homes of asthmatic children compared to homes with no visible water damage. Methods: The mold concentrations in the dust in asthmatic children's bedrooms i...

  5. Occurrence of household mold and efficacy of sodium hypochlorite disinfectant.

    PubMed

    Reynolds, Kelly A; Boone, Stephanie; Bright, Kelly R; Gerba, Charles P

    2012-01-01

    The occurrence and distribution of mold on household surfaces and the efficacy of bleach-based (sodium hypochlorite, NaOCl) disinfectants on mold viability and allergenicity was documented. Household microenvironments prone to increased moisture were specifically targeted. Using the sticky tape method, 1330 samples were collected from non-porous indoor surfaces of 160 homes across the United States, and analyzed for mold. Homes were randomly selected and recruited via phone interviews. Culture and immunoassays were used to measure the viability and reduction of allergenic properties of Aspergillus fumigatus following 2.4% NaOCl treatment. All homes and 72.9% of surfaces tested positive for mold. Windowsills were the most frequently contaminated site (87.5%) and Cladosporium the most commonly identified mold (31.0%). Five-minute exposures to 2.4% NaOCl resulted in a >3 to >6-log₁₀ reduction of culturable mold counts in controlled laboratory studies. Organisms were nonculturable after 5- and 10-min contact times on non-porous and porous ceramic carriers, respectively, and A. fumigatus spore-eluted allergen levels were reduced by an average 95.8% in 30 sec, as indicated by immunoassay. All homes are contaminated with some level of mold, and regrowth is likely in moisture-prone microenvironments. The use of low concentrations (2.4%) of NaOCl for the reduction of culturable indoor mold and related allergens is effective and recommended.

  6. Grinding aspheric and freeform micro-optical molds

    NASA Astrophysics Data System (ADS)

    Tohme, Yazid E.

    2007-02-01

    Fueled by the need for better performing optics, glass optics are now replacing plastic optics in many industrial and consumer electronic devices. One of these devices is the mobile phone camera. The optical sub-assembly in a mobile phone includes several micro lenses that are spherical and/or aspherical in shape and require form tolerances in the submicron range. These micro glass lenses are mass produced by a replication process known as glass press molding. The process entails the compression of a glass gob between two precise optical quality molds at an elevated temperature, usually near the transition temperature of the glass material. The elevated forces and temperatures required in the glass molding process limits the materials of the molds to very tough materials such as tungsten carbide or silicon carbide. These materials can withstand large pressing forces at high temperatures without any significant deformation. These materials offer great mechanical properties for glass press molding but they are also a challenge to machine to submicron accuracy. The work in this paper discusses a deterministic micro grinding manufacturing process referred to as wheel normal grinding, which is utilized to produce these optical quality molds. Wheel normal grinding is more accurate and more deterministic than most other grinding techniques and can produce molds to the form and finish tolerances required for optical molding. This method relies on the ability to recognize and compensate for grinding wheel wear and machine repeatable errors. Results will be presented to illustrate the accuracy of this micro grinding technique.

  7. 18. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON GREY IRON UNIT NO. 1 MOLD CONVEYOR WITH MOLTEN IRON FROM MOBILE LADLES AS THEY STAND ON WHAT USED TO BE A PLATFORM MOVING AT THE SAME RATE OF SPEED AS THE CONVEYOR. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  8. A fabrication method of microneedle molds with controlled microstructures.

    PubMed

    Wang, Qi Lei; Zhu, Dan Dan; Chen, Yang; Guo, Xin Dong

    2016-08-01

    Microneedle (MN) offers an attractive, painless and minimally invasive approach for transdermal drug delivery. Polymer microneedles are normally fabricated by using the micromolding method employing a MN mold, which is suitable for mass production due to high production efficiency and repeat-using of the mold. Most of the MN molds are prepared by pouring sylgard polymer over a MN master to make an inverse one after curing, which is limited in optimizing or controlling the MN structures and failing to keep the sharpness of MNs. In this work we describe a fabrication method of MN mold with controlled microstructures, which is meaningful for the fabrication of polymer MNs with different geometries. Laser micro-machining method was employed to drill on the surface of PDMS sheets to obtain MN molds. In the fabrication process, the microstructures of MN molds are precisely controlled by changing laser parameters and imported patterns. The MNs prepared from these molds are sharp enough to penetrate the skin. This scalable MN mold fabrication method is helpful for future applications of MNs. PMID:27157736

  9. Physarum attraction: Why slime mold behaves as cats do?

    PubMed Central

    Adamatzky, Andrew; Costello, Ben De Lacy

    2012-01-01

    We discuss potential chemical substances responsible for attracting acellular slime mold Physarun polycephalum to valerian root. The contributes toward fundamental research into pheromones and chemo-attracts of primitive organisms such as slime molds. The results show that significant information could be gained about the action of compounds on higher organisms. PMID:22896798

  10. Crack-resistant siloxane molding compounds. [Patent application

    DOEpatents

    McFarland, J.W.; Swearngin, C.B.

    1980-11-03

    The crack resistance of phenyl silicone molding resins containing siliceous fillers is improved by incorporating therein about 0.5 to 5.5% by weight of ..beta..-eucryptite, a lithium aluminum silicate having a negative thermal expansion coefficient. These molding resins are particularly suitable for encapsulating electronic devices such as diodes, coils, resistors, and the like.

  11. Characterization of white mold disease avoidance in common bean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    White mold, caused by Sclerotinia sclerotiorum, is a devastating fungal disease of common bean (Phaseolus vulgaris L.) worldwide. Physiological resistance and disease avoidance conferred by plant architecture-related traits contribute to white mold field resistance. Our objective was to further exam...

  12. A programmable nanoreplica molding for the fabrication of nanophotonic devices

    PubMed Central

    Liu, Longju; Zhang, Jingxiang; Badshah, Mohsin Ali; Dong, Liang; Li, Jingjing; Kim, Seok-min; Lu, Meng

    2016-01-01

    The ability to fabricate periodic structures with sub-wavelength features has a great potential for impact on integrated optics, optical sensors, and photovoltaic devices. Here, we report a programmable nanoreplica molding process to fabricate a variety of sub-micrometer periodic patterns using a single mold. The process utilizes a stretchable mold to produce the desired periodic structure in a photopolymer on glass or plastic substrates. During the replica molding process, a uniaxial force is applied to the mold and results in changes of the periodic structure, which resides on the surface of the mold. Direction and magnitude of the force determine the array geometry, including the lattice constant and arrangement. By stretching the mold, 2D arrays with square, rectangular, and triangular lattice structures can be fabricated. As one example, we present a plasmonic crystal device with surface plasmon resonances determined by the force applied during molding. In addition, photonic crystal slabs with different array patterns are fabricated and characterized. This unique process offers the capability of generating various periodic nanostructures rapidly and inexpensively. PMID:26925828

  13. Two species of myxomycetes causing slime mold of sweet potato.

    PubMed

    Kim, Wan Gyu; Lee, Sang Yeob; Cho, Weon Dae

    2007-06-01

    Specimens collected from sweet potato plants with slime mold symptoms in fields in Daejeon, Korea were examined. Two species of Myxomycetes, Fuligo septica and Stemonitis herbatica were identified based on their morphological characteristics. This is the first report that the two species of Myxomycetes cause slime mold of sweet potato in Korea.

  14. 34. THESE INGOT MOLDS OF STEEL 32' X 83' ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    34. THESE INGOT MOLDS OF STEEL - 32' X 83' IN SIZE - ARE READY TO BE TAKEN TO THE STRIPPER, WHERE THE MOLDS WILL BE REMOVED. INGOTS WILL NEXT BE PLACED INTO A 'SOAKING PIT,' WHERE THEY ARE HEATED TO A UNIFORM TEMPERATURE PRIOR TO ROLLING. - Corrigan, McKinney Steel Company, 3100 East Forty-fifth Street, Cleveland, Cuyahoga County, OH

  15. ASTHMATIC HUMAN SERUM IGE-REACTIVITY WITH MOLD EXTRACTS

    EPA Science Inventory

    Although molds have demonstrated the ability to induce allergic asthma-like responses in mouse models, their role in human disease is unclear. This study was undertaken to provide insight into the prevalence of human IgE-reactivity and identify the target mold protein(s). The st...

  16. 21 CFR 177.2410 - Phenolic resins in molded articles.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Phenolic resins in molded articles. 177.2410... as Components of Articles Intended for Repeated Use § 177.2410 Phenolic resins in molded articles. Phenolic resins identified in this section may be safely used as the food-contact surface of...

  17. View of foundrymen casting ingot molds; The flames from the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of foundrymen casting ingot molds; The flames from the mold in the center-right of the photo are present immediately after the pour has been completed - Bethlehem Steel Corporation, South Bethlehem Works, Iron Foundry, Along Lehigh River, North of Fourth Street, West of Minsi Trail Bridge, Bethlehem, Northampton County, PA

  18. Looking east inside of the ingot mold stripper building for ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Looking east inside of the ingot mold stripper building for the 44" slab mill at a row of ingots. A row of ingot molds are pictured east on the left. - U.S. Steel Edgar Thomson Works, 44" Slab Mill, Along Monongahela River, Braddock, Allegheny County, PA

  19. 25. CORES, WHICH FORM THE INTERIOR SURFACES OF MOLDS BY ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    25. CORES, WHICH FORM THE INTERIOR SURFACES OF MOLDS BY PROVIDING A SOLID STRUCTURE FOR MOLTEN IRON TO FLOW AROUND ARE CAREFULLY PLACED INTO THE CAVITIES OF MOLDS IN THE BRASS FOUNDRY, CA. 1950. - Stockham Pipe & Fittings Company, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  20. 30. SECOND FLOOR, NORTHEAST ROOM, SOUTH WALL. Bolection mold fireplace ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    30. SECOND FLOOR, NORTHEAST ROOM, SOUTH WALL. Bolection mold fireplace surround probably original with house and only remaining one thus. Note bolection panel molds on raised-panel door, also probably original with house. - Mulberry, Cooper River, West Branch, Moncks Corner, Berkeley County, SC

  1. 14. IN 1922, PRIOR TO THE INSTALLATION OF MOLDING MACHINES ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. IN 1922, PRIOR TO THE INSTALLATION OF MOLDING MACHINES AND CONVEYORS, MOLDERS, SUCH AS THESE FROM THE GREY IRON FOUNDRY, HAND PACKED MOLDS AND LAID THEM OUT IN ROWS ON THE FLOOR TO BE POURED BY HAND-HELD CRUCIBLES, SHAKEN OUT, AND CLEANED. - Stockham Pipe & Fittings Company, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  2. 42. PRESSING A SLAB OF CLAY ONTO A MOSAIC MOLD. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    42. PRESSING A SLAB OF CLAY ONTO A MOSAIC MOLD. THE MOLD, WHICH HAS A RAISED DESIGN, LEAVES AND OUTLINE IN THE SLAB, THE PIECES THUS DEFINED, ARE THEN CUT APART TO BE FIRED SEPARATELY AND REASSEMBLED. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  3. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  4. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  5. IGE IN ASTHMATIC HUMAN SERA IS REACTIVE AGAINST MOLD EXTRACTS

    EPA Science Inventory

    Molds have been associated with various health effects including asthma, but their role in induction of asthma is unclear. However, the presence of mold-specific IgE indicates their capacity to induce allergic responses and possibly exacerbate asthma symptoms. This study was und...

  6. A fabrication method of microneedle molds with controlled microstructures.

    PubMed

    Wang, Qi Lei; Zhu, Dan Dan; Chen, Yang; Guo, Xin Dong

    2016-08-01

    Microneedle (MN) offers an attractive, painless and minimally invasive approach for transdermal drug delivery. Polymer microneedles are normally fabricated by using the micromolding method employing a MN mold, which is suitable for mass production due to high production efficiency and repeat-using of the mold. Most of the MN molds are prepared by pouring sylgard polymer over a MN master to make an inverse one after curing, which is limited in optimizing or controlling the MN structures and failing to keep the sharpness of MNs. In this work we describe a fabrication method of MN mold with controlled microstructures, which is meaningful for the fabrication of polymer MNs with different geometries. Laser micro-machining method was employed to drill on the surface of PDMS sheets to obtain MN molds. In the fabrication process, the microstructures of MN molds are precisely controlled by changing laser parameters and imported patterns. The MNs prepared from these molds are sharp enough to penetrate the skin. This scalable MN mold fabrication method is helpful for future applications of MNs.

  7. Silicon micro-mold and method for fabrication

    DOEpatents

    Morales, Alfredo M.

    2005-01-11

    The present invention describes a method for rapidly fabricating a robust 3-dimensional silicon micro-mold for use in preparing complex metal micro-components. The process begins by depositing a conductive metal layer onto one surface of a silicon wafer. A thin photoresist and a standard lithographic mask are then used to transfer a trace image pattern onto the opposite surface of the wafer by exposing and developing the resist. The exposed portion of the silicon substrate is anisotropically etched through the wafer thickness down to conductive metal layer to provide an etched pattern consisting of a series of rectilinear channels and recesses in the silicon which serve as the silicon micro-mold. Microcomponents are prepared with this mold by first filling the mold channels and recesses with a metal deposit, typically by electroplating, and then removing the silicon micro-mold by chemical etching.

  8. Prevalence of dampness and mold in European housing stock.

    PubMed

    Haverinen-Shaughnessy, Ulla

    2012-09-01

    An assessment of the prevalence of dampness and mold in European housing stock was carried out. It is based on general indicators of dampness and mold in dwellings reported in the literature. The assessment relies on recent studies, taking into account regional and climatic differences, as well as differences in study design, methodology, and definitions. Data were available from 31 European countries. Weighted prevalence estimates are 12.1% for damp, 10.3% for mold, 10.0% for water damage, and 16.5% for a combination of any one or more indicators. Significant (up to 18%) differences were observed for dampness and mold prevalence estimates depending on survey factors, region, and climate. In conclusion, dampness and/or mold problems could be expected to occur in one of every six of the dwellings in Europe. Prevalence and occurrence of different types of problems may vary across geographical areas, which can be partly explained by differences in climate.

  9. Injection-molded nanocomposites and materials based on wheat gluten.

    PubMed

    Cho, S-W; Gällstedt, M; Johansson, E; Hedenqvist, M S

    2011-01-01

    This is, to our knowledge, the first study of the injection molding of materials where wheat gluten (WG) is the main component. In addition to a plasticizer (glycerol), 5 wt.% natural montmorillonite clay was added. X-ray indicated intercalated clay and transmission electron microscopy indicated locally good clay platelet dispersion. Prior to feeding into the injection molder, the material was first compression molded into plates and pelletized. The filling of the circular mold via the central gate was characterized by a divergent flow yielding, in general, a stronger and stiffer material in the circumferential direction. It was observed that 20-30 wt.% glycerol yielded the best combination of processability and mechanical properties. The clay yielded improved processability, plate homogeneity and tensile stiffness. IR spectroscopy and protein solubility indicated that the injection molding process yielded a highly aggregated structure. The overall conclusion was that injection molding is a very promising method for producing WG objects.

  10. Standard Molded Composite Rocket Pyrogen Igniter - A progress report

    NASA Technical Reports Server (NTRS)

    Lucy, M. H.

    1978-01-01

    The pyrogen igniter has the function to furnish a controlled, high temperature, high pressure gas to ignite solid propellant surfaces in a rocket motor. Present pyrogens consist of numerous inert components. The Standard Molded Pyrogen Igniter (SMPI) consists of three basic parts, a cap with several integrally molded features, an ignition pellet retainer plate, and a tube with additional integrally molded features. A description is presented of an investigation which indicates that the SMPI concept is a viable approach to the design and manufacture of pyrogen igniters for solid propellant rocket motors. For some applications, combining the structural and thermal properties of molded composites can result in the manufacture of lighter assemblies at considerable cost reduction. It is demonstrated that high strength, thin walled tubes with high length to diameter ratios can be fabricated from reinforced plastic molding compound using the displacement compression process.

  11. Fabrication of plasmonic crystals using programmable nanoreplica molding process

    NASA Astrophysics Data System (ADS)

    Liu, Longju; Badshah, Mohsin A.; Kim, Seok-min; Lu, Meng

    2016-03-01

    The development of many photonic devices, such as photonic integrated circuit, optical sensors, and photovoltaic devices, demands low-cost and reliable fabrication technologies to fabricate sub-wavelength features. Here, we report a programmable nanoreplica molding process, which is capable of producing photonic devices with a variety of submicrometer patterns. The process utilizes a stretchable plastic mold to generate the desired periodic pattern using a UVcurable polymer on plastic substrates. During the replica molding process, a uniaxial force is applied to the mold and results in changes of the periodic structure, which locates on the surface of the mold. The geometry of the replicated pattern, including the lattice constant and arrangement, is determined by the magnitude and direction of the force. As an example, we present a plasmonic crystal device with surface plasmon resonances carefully tuned by using the uniaxial force. This unique process offers an inexpensive route to generate various periodic nanostructures rapidly.

  12. THE DURABILITY OF LARGE-SCALE ADDITIVE MANUFACTURING COMPOSITE MOLDS

    SciTech Connect

    Post, Brian K; Love, Lonnie J; Duty, Chad; Vaidya, Uday; Pipes, R. Byron; Kunc, Vlastimil

    2016-01-01

    Oak Ridge National Laboratory s Big Area Additive Manufacturing (BAAM) technology permits the rapid production of thermoplastic composite molds using a carbon fiber filled Acrylonitrile-Butadiene-Styrene (ABS) thermoplastic. Demonstration tools (i.e. 0.965 m X 0.559 m X 0.152 m) for composite part fabrication have been printed, coated, and finished with a traditional tooling gel. We present validation results demonstrating the stability of thermoplastic printed molds for room temperature Vacuum Assisted Resin Transfer Molding (VARTM) processes. Arkema s Elium thermoplastic resin was investigated with a variety of reinforcement materials. Experimental results include dimensional characterization of the tool surface using laser scanning technique following demolding of 10 parts. Thermoplastic composite molds offer rapid production compared to traditionally built thermoset molds in that near-net deposition allows direct digital production of the net geometry at production rate of 45 kg/hr.

  13. Mathematical modeling of the in-mold coating process for injection-molded thermoplastic parts

    NASA Astrophysics Data System (ADS)

    Chen, Xu

    In-Mold Coating (IMC) has been successfully used for many years for exterior body panels made from compression molded Sheet Molding Compound (SMC). The coating material is a single component reactive fluid, designed to improve the surface quality of SMC moldings in terms of functional and cosmetic properties. When injected onto a cured SMC part, IMC cures and bonds to provide a pain-like surface. Because of its distinct advantages, IMC is being considered for application to injection molded thermoplastic parts. For a successful in mold coating operation, there are two key issues related to the flow of the coating. First, the injection nozzle should be located such that the thermoplastic substrate is totally covered and the potential for air trapping is minimized. The selected location should be cosmetically acceptable since it most likely will leave a mark on the coated surface. The nozzle location also needs to be accessible for easy of maintenance. Secondly, the hydraulic force generated by the coating injection pressure should not exceed the available clamping tonnage. If the clamping force is exceeded, coating leakage will occur. In this study, mathematical models for IMC flow on the compressible thermoplastic substrate have been developed. Finite Difference Method (FDM) is first used to solve the 1 dimensional (1D) IMC flow problem. In order to investigate the application of Control Volume based Finite Element Method (CV/FEM) to more complicated two dimensional IMC flow, that method is first evaluated by solving the 1D IMC flow problem. An analytical solution, which can be obtained when a linear relationship between the coating thickness and coating injection pressure is assumed, is used to verify the numerical results. The mathematical models for the 2 dimensional (2D) IMC flow are based on the generalized Hele-Shaw approximation. It has been found experimentally that the power law viscosity model adequately predicts the rheological behavior of the coating

  14. Public health and economic impact of dampness and mold

    SciTech Connect

    Mudarri, David; Fisk, William J.

    2007-06-01

    The public health risk and economic impact of dampness and mold exposures was assessed using current asthma as a health endpoint. Individual risk of current asthma from exposure to dampness and mold in homes from Fisk et al. (2007), and asthma risks calculated from additional studies that reported the prevalence of dampness and mold in homes were used to estimate the proportion of U.S. current asthma cases that are attributable to dampness and mold exposure at 21% (95% confidence internal 12-29%). An examination of the literature covering dampness and mold in schools, offices, and institutional buildings, which is summarized in the appendix, suggests that risks from exposure in these buildings are similar to risks from exposures in homes. Of the 21.8 million people reported to have asthma in the U.S., approximately 4.6 (2.7-6.3) million cases are estimated to be attributable to dampness and mold exposure in the home. Estimates of the national cost of asthma from two prior studies were updated to 2004 and used to estimate the economic impact of dampness and mold exposures. By applying the attributable fraction to the updated national annual cost of asthma, the national annual cost of asthma that is attributable to dampness and mold exposure in the home is estimated to be $3.5 billion ($2.1-4.8 billion). Analysis indicates that exposure to dampness and mold in buildings poses significant public health and economic risks in the U.S. These findings are compatible with public policies and programs that help control moisture and mold in buildings.

  15. Precision lens molding of asphero diffractive surfaces in chalcogenide materials

    NASA Astrophysics Data System (ADS)

    Nelson, J.; Scordato, M.; Schwertz, K.; Bagwell, J.

    2015-10-01

    Finished lens molding, and the similar process of precision lens molding, have long been practiced for high volume, accurate replication of optical surfaces on oxide glass. The physics surrounding these processes are well understood, and the processes are capable of producing high quality optics with great fidelity. However, several limitations exist due to properties inherent with oxide glasses. Tooling materials that can withstand the severe environmental conditions of oxide glass molding cannot easily be machined to produce complex geometries such as diffractive surfaces, lens arrays, and off axis features. Current machining technologies coupled with a limited selection of tool materials greatly limits the type of structures that can be molded into the finished optic. Tooling for chalcogenide glasses are not bound by these restrictions since the molding temperatures required are much lower than for oxide glasses. Innovations in tooling materials and manufacturing techniques have enabled the production of complex geometries to optical quality specifications and have demonstrated the viability of creating tools for molding diffractive surfaces, off axis features, datums, and arrays. Applications for optics having these features are found in automotive, defense, security, medical, and industrial domains. This paper will discuss results achieved in the study of various molding techniques for the formation of positive diffractive features on a concave spherical surface molded from As2Se3 chalcogenide glass. Examples and results of molding with tools having CTE match with the glass and non CTE match will be reviewed. The formation of stress within the glass during molding will be discussed, and methods of stress management will also be demonstrated and discussed. Results of process development methods and production of good diffractive surfaces will be shown.

  16. Predicting and preventing mold spoilage of food products.

    PubMed

    Dagnas, Stéphane; Membré, Jeanne-Marie

    2013-03-01

    This article is a review of how to quantify mold spoilage and consequently shelf life of a food product. Mold spoilage results from having a product contaminated with fungal spores that germinate and form a visible mycelium before the end of the shelf life. The spoilage can be then expressed as the combination of the probability of having a product contaminated and the probability of mold growth (germination and proliferation) up to a visible mycelium before the end of the shelf life. For products packed before being distributed to the retailers, the probability of having a product contaminated is a function of factors strictly linked to the factory design, process, and environment. The in-factory fungal contamination of a product might be controlled by good manufacturing hygiene practices and reduced by particular processing practices such as an adequate air-renewal system. To determine the probability of mold growth, both germination and mycelium proliferation can be mathematically described by primary models. When mold contamination on the product is scarce, the spores are spread on the product and more than a few spores are unlikely to be found at the same spot. In such a case, models applicable for a single spore should be used. Secondary models can be used to describe the effect of intrinsic and extrinsic factors on either the germination or proliferation of molds. Several polynomial models and gamma-type models quantifying the effect of water activity and temperature on mold growth are available. To a lesser extent, the effect of pH, ethanol, heat treatment, addition of preservatives, and modified atmospheres on mold growth also have been quantified. However, mold species variability has not yet been properly addressed, and only a few secondary models have been validated for food products. Once the probability of having mold spoilage is calculated for various shelf lives and product formulations, the model can be implemented as part of a risk management

  17. Predicting and preventing mold spoilage of food products.

    PubMed

    Dagnas, Stéphane; Membré, Jeanne-Marie

    2013-03-01

    This article is a review of how to quantify mold spoilage and consequently shelf life of a food product. Mold spoilage results from having a product contaminated with fungal spores that germinate and form a visible mycelium before the end of the shelf life. The spoilage can be then expressed as the combination of the probability of having a product contaminated and the probability of mold growth (germination and proliferation) up to a visible mycelium before the end of the shelf life. For products packed before being distributed to the retailers, the probability of having a product contaminated is a function of factors strictly linked to the factory design, process, and environment. The in-factory fungal contamination of a product might be controlled by good manufacturing hygiene practices and reduced by particular processing practices such as an adequate air-renewal system. To determine the probability of mold growth, both germination and mycelium proliferation can be mathematically described by primary models. When mold contamination on the product is scarce, the spores are spread on the product and more than a few spores are unlikely to be found at the same spot. In such a case, models applicable for a single spore should be used. Secondary models can be used to describe the effect of intrinsic and extrinsic factors on either the germination or proliferation of molds. Several polynomial models and gamma-type models quantifying the effect of water activity and temperature on mold growth are available. To a lesser extent, the effect of pH, ethanol, heat treatment, addition of preservatives, and modified atmospheres on mold growth also have been quantified. However, mold species variability has not yet been properly addressed, and only a few secondary models have been validated for food products. Once the probability of having mold spoilage is calculated for various shelf lives and product formulations, the model can be implemented as part of a risk management

  18. Mold Simulator Study of the Initial Solidification of Molten Steel in Continuous Casting Mold. Part I: Experiment Process and Measurement

    NASA Astrophysics Data System (ADS)

    Zhang, Haihui; Wang, Wanlin; Ma, Fanjun; Zhou, Lejn

    2015-10-01

    A mold simulator has been successfully used to study the initial solidification behavior of the molten low carbon steel. Coupled with 2D-IHCD calculation and PSD analysis, the variations of the responding temperatures and heat fluxes, as well as the relationship between shell surface profile, heat flux, shell thickness, mold level fluctuation, and the infiltrated slag film, were investigated in this article. The results suggested that the mold high-frequency temperatures and heat fluxes above liquid steel level vary with the oscillation of the mold, and show an opposite variation pattern as those below the shell tip. The formed shell surface profile is directly correlated to the variation of high-frequency heat fluxes, where the formation of oscillation mark is associated with a sudden increase of the heat flux during negative strip time. Mold level fluctuation contributes to the formation of the extra oscillation marks. The growth of shell thickness follows the square root law, and the instantaneous solidification factor is large near the shell tip and becomes small in the area where the deep shell surface depression is formed. The thickness of the slag film in between mold and shell is in the range of 1.4 to 2.46 mm, and the crystallization of mold flux in mold/shell gap is dynamic.

  19. ''Heat Transfer at the Mold-Metal Interface in Permanent Mold Casting of Aluminum Alloys'' Final Project Report

    SciTech Connect

    Professor R. D. Pehlke, Principal Investigator, Dr. John M. Cookson, Dr. Shouwei Hao, Dr. Prasad Krishna, Kevin T. Bilkey

    2001-12-14

    This project on heat transfer coefficients in metal permanent mold casting has been conducted in three areas. They are the theoretical study at the University of Michigan, the experimental investigation of squeeze casting at CMI-Tech Center (Now Hayes-Lemmerz Technical Center) and the experimental investigation of low pressure permanent mold casting at Amcast Automotive.

  20. Development of a Mold Cracking Simulator: The Study of Breakout and Crack Formation in Continuous Casting Mold

    NASA Astrophysics Data System (ADS)

    Zhang, Yexin; Wang, Wanlin; Zhang, Haihui

    2016-08-01

    Based on the mold simulator technology, a mold-cracking simulator has been successfully developed to study the process of breakout and the shell surface crack formation during the initial solidification of molten steel inside the continuous casting mold. First, a spheroidal protrusion was installed on the mold hot surface to mimic the abnormal force that generated by mold wall deformation, and then the external force was applied to the initial solidified shell, to facilitate the formation of breakout and shell surface cracks. Second, the responding temperature and heat flux across mold hot surface were recovered by an inverse heat conduction problem. The experimental results indicated that the mold breakout occurs around the shell tip by the combined efforts from external horizontal force, ferrostatic pressure, and thermal stresses during positive strip time. The breakout tends to introduce the peak of the responding temperature and heat flux across the mold hot surface. The vertical propagation velocity of the rupture point in the solidification shell has been calculated as 0.42 m/s in this study, which is in good agreement with industrial slabs. The paper also suggested that surface transverse crack formation is related to the segregation of sulfur during the initial solidification of molten steel.

  1. Preparation and properties of an internal mold release for rigid urethane foam

    NASA Astrophysics Data System (ADS)

    Paker, B. G.

    1980-08-01

    Most mold release agents used in the molding of rigid polyurethane foam are applied to the internal surfaces of the mold. These materials form a thin layer between the surface of the mold and the foam, allowing for easy release of the molded parts. This type of mold release must be applied prior to each molding operation; and, after repeated use, cleaning of the mold is required. Small amounts of this mold release are transferred to the molded part, resulting in a part with poor surface bondability characteristics. An internal release agent, which can be mixed in a urethane foam resin was investigated. The internal mold release provided good releasability and resulted in urethane foam that has excellent surface bondability. No compatibility problems are expected from the use of this type of release agent.

  2. Injection molding and debinding of micro gears fabricated by micro powder injection molding

    NASA Astrophysics Data System (ADS)

    Ni, Xin-lei; Yin, Hai-qing; Liu, Lin; Yi, Shan-jie; Qu, Xuan-hui

    2013-01-01

    Micro powder injection molding (μPIM) was investigated for possible mass production of micro-components at relatively low cost. However, scaling down to such a level produces challenges in injection molding and debinding. Micro gears were fabricated by μPIM from in-house feedstock. The effect of injection speed and injection pressure on the replication of the micro gear cavity was investigated. Solvent debinding and thermal debinding processes were discussed. The results show that micro gears can be successfully fabricated under the injection pressure of 70 MPa and the 60% injection speed. Either too low or too high injection speed can cause incomplete filling of micro gears. The same is the case with too low injection pressure. Too high injection pressure can bring cracks. Solvent debinding of micro gears was performed in a mixture of petroleum ether and ethanol. Subsequently, micro gears were successfully debound by a multistep heating schedule.

  3. Laser removal of mold growth from paper

    NASA Astrophysics Data System (ADS)

    Rosati, C.; Ciofini, D.; Osticioli, I.; Giorgi, R.; Tegli, S.; Siano, S.

    2014-10-01

    The potential of laser ablation in conservation of paper artifacts of cultural interest is under investigation since the second half of nineties. However, the works carried out on the topic are relatively a few as compared with those dedicated to stone, metal and painted artworks. Furthermore, in the latter cases, widespread applications have been successfully carried out, whereas laser cleaning of aged paper is still far from the conservation practice. There are serious risks to produce short- and/or long-term chemical alterations and/or mechanical damages at relatively low fluences. Here, we report a systematic investigation on laser removal of mold growths from prepared and naturally aged paper samples. Fundamental wavelength and second harmonic of QS Nd:YAG laser are tested and compared through optical and spectroscopic characterizations. This allowed defining optimized irradiation conditions and foreseeing further improvements from pulse duration optimization.

  4. Star Mapping with Slime Mold Physarum Polycephalum

    NASA Astrophysics Data System (ADS)

    Mihklepp, M.; Domnitch, E.; Gelfand, D.; Foing, B. H.; van der Heide, E.

    2014-04-01

    Human curiosity and exploration towards outer space has led to many fantastic inventions and given way to alternative scenarios about the origins of life. In the Space Science in the Arts course together with ESTEC with support from ILEWG. I got interested about unicellular slime mold Physarum polycephalum. There has been and still is a lot of research on Physarum polycephalum. This brainless eucaryotic microbe has its smartness and external memory strategies. Physarum can navigate through a maze made of agar using the shortest route possible when two pieces of food are placed at two separate exits of the maze. It can build efficient networks - Physarum created network similar to the existing Tokyo train system. It is being used to control a robot, in USB-sensor and in sound synthesis. Right now there is a lot of research about using Physarum in bio-computing.

  5. Replication of optical microlens array using photoresist coated molds.

    PubMed

    Chakrabarti, M; Dam-Hansen, C; Stubager, J; Pedersen, T F; Pedersen, H C

    2016-05-01

    A cost reduced method of producing injection molding tools is reported and demonstrated for the fabrication of optical microlens arrays. A standard computer-numerical-control (CNC) milling machine was used to make a rough mold in steel. Surface treatment of the steel mold by spray coating with photoresist is used to smooth the mold surface providing good optical quality. The tool and process are demonstrated for the fabrication of an ø50 mm beam homogenizer for a color mixing LED light engine. The acceptance angle of the microlens array is optimized, in order to maximize the optical efficiency from the light engine. Polymer injection molded microlens arrays were produced from both the rough and coated molds and have been characterized for lenslet parameters, surface quality, light scattering, and acceptance angle. The surface roughness (Ra) is improved approximately by a factor of two after the coating process and the light scattering is reduced so that the molded microlens array can be used for the color mixing application. The measured accepted angle of the microlens array is 40° which is in agreement with simulations. PMID:27137566

  6. Replica mold for nanoimprint lithography from a novel hybrid resin.

    PubMed

    Lee, Bong Kuk; Hong, Lan-Young; Lee, Hea Yeon; Kim, Dong-Pyo; Kawai, Tomoji

    2009-10-01

    The use of durable replica molds with high feature resolution has been proposed as an inexpensive and convenient route for manufacturing nanostructured materials. A simple and fast duplication method, involving the use of a master mold to create durable polymer replicas as imprinting molds, has been demonstrated using both UV- and thermal nanoimprinting lithography (NIL). To obtain a high-durability replicating material, a dual UV/thermal-curable, organic-inorganic hybrid resin was synthesized using a sol-gel-based combinatorial method. The cross-linked hybrid resin exhibited high transparency to UV light and resistance to organic solvents. Molds made of this material showed good mechanical properties (Young's modulus=1.76 GPa) and gas permeability. The low viscosity of the hybrid resin (approximately 29 cP) allowed it to be easily transferred to relief nanostructures on transparent glass substrates using UV-NIL at room temperature and low pressure (0.2 MPa) over a relatively short time (80 s). A low surface energy release agent was successfully coated onto the hybrid mold surface without destroying the imprinted nanostructures, even after O2 plasma treatment. Nanostructures with feature sizes down to 80 nm were successfully reproduced using these molds in both UV- and thermal-NIL processes. After repeating 10 imprinting cycles at relatively high temperature and pressure, no detectable collapse or contamination of the replica surface was observed. These results indicate that the hybrid molds could tolerate repeated UV- and thermal-NIL processes.

  7. Flexible Nonstick Replica Mold for Transfer Printing of Ag Ink.

    PubMed

    Lee, Bong Kuk; Yu, Han Young; Kim, Yarkyeon; Yoon, Yong Sun; Jang, Won Ik; Do, Lee-Mi; Park, Ji-Ho; Park, Jaehoon

    2016-03-01

    We report the fabrication of flexible replica molds for transfer printing of Ag ink on a rigid glass substrate. As mold precursors, acrylic mixtures were prepared from silsesquioxane-based materials, silicone acrylate, poly(propylene glycol) diacrylate, 3,3,4,4,5,5,6,6,7,7,8,8, 9,9,10,10,10-heptadecafluorodecyl methacrylate, and photoinitiator. By using these materials, the replica molds were fabricated from a silicon master onto a flexible substrate by means of UV-assisted molding process at room temperature. The wettability of Ag ink decreased with increase in the water contact angle of replica molds. On the other hand, the transfer rate of Ag ink onto adhesive-modified substrates increased with increase in the water contact angle of replica molds. Transferred patterns were found to be thermally stable on the photocurable adhesive layer, whereas Ag-ink patterns transferred on non-photocurable adhesives were distorted by thermal treatment. We believe that these characteristics of replica molds and adhesives offer a new strategy for the development of the transfer printing of solution-based ink materials. PMID:27455689

  8. Interface conditions of two-shot molded parts

    SciTech Connect

    Kisslinger, Thomas; Bruckmoser, Katharina Resch, Katharina; Lucyshyn, Thomas E-mail: guenter.langecker@unileoben.ac.at; Langecker, Guenter Ruediger E-mail: guenter.langecker@unileoben.ac.at; Holzer, Clemens

    2014-05-15

    The focus of this work is on interfaces of two-shot molded parts. It is well known that e.g. material combination, process parameters and contact area structures show significant effects on the bond strength of multi-component injection molded parts. To get information about the bond strength at various process parameter settings and material combinations a test mold with core back technology was used to produce two-component injection molded tensile test specimens. At the core back process the different materials are injected consecutively, so each component runs through the whole injection molding cycle (two-shot process). Due to this consecutive injection molding processes, a cold interface is generated. This is defined as overmolding of a second melt to a solidified polymer preform. Strong interest lies in the way the interface conditions change during the adhesion formation between the individual components. Hence the interface conditions were investigated by computed tomography and Raman spectroscopy. By analyzing these conditions the understanding of the adhesion development during the multi-component injection molding was improved.

  9. Smart plastic functionalization by nanoimprint and injection molding

    NASA Astrophysics Data System (ADS)

    Zalkovskij, Maksim; Thamdrup, Lasse H.; Smistrup, Kristian; Andén, Thomas; Johansson, Alicia C.; Mikkelsen, Niels Jørgen; Madsen, Morten Hannibal; Garnæs, Jørgen; Kristiansen, Tommy Tungelund; Diemer, Mads; Døssing, Michael; Minzari, Daniel; Tang, Peter Torben; Kristensen, Anders; Taboryski, Rafael; Essendrop, Søren; Nielsen, Theodor; Bilenberg, Brian

    2015-03-01

    In this paper, we present a route for making smart functionalized plastic parts by injection molding with sub-micrometer surface structures. The method is based on combining planar processes well known and established within silicon micro and sub-micro fabrication with proven high resolution and high fidelity with truly freeform injection molding inserts. The link between the planar processes and the freeform shaped injection molding inserts is enabled by the use of nanoimprint with flexible molds for the pattern definition combined with unidirectional sputter etching for transferring the pattern. With this approach, we demonstrate the transfer of down to 140 nm wide holes on large areas with good structure fidelity on an injection molding steel insert. The durability of the sub-micrometer structures on the inserts have been investigated by running two production series of 102,000 and 73,000 injection molded parts, respectively, on two different inserts and inspecting the inserts before and after the production series and the molded parts during the production series.

  10. Replication of optical microlens array using photoresist coated molds.

    PubMed

    Chakrabarti, M; Dam-Hansen, C; Stubager, J; Pedersen, T F; Pedersen, H C

    2016-05-01

    A cost reduced method of producing injection molding tools is reported and demonstrated for the fabrication of optical microlens arrays. A standard computer-numerical-control (CNC) milling machine was used to make a rough mold in steel. Surface treatment of the steel mold by spray coating with photoresist is used to smooth the mold surface providing good optical quality. The tool and process are demonstrated for the fabrication of an ø50 mm beam homogenizer for a color mixing LED light engine. The acceptance angle of the microlens array is optimized, in order to maximize the optical efficiency from the light engine. Polymer injection molded microlens arrays were produced from both the rough and coated molds and have been characterized for lenslet parameters, surface quality, light scattering, and acceptance angle. The surface roughness (Ra) is improved approximately by a factor of two after the coating process and the light scattering is reduced so that the molded microlens array can be used for the color mixing application. The measured accepted angle of the microlens array is 40° which is in agreement with simulations.

  11. Screening Tools to Estimate Mold Burdens in Homes

    SciTech Connect

    Vesper, Sephen J.; McKinstry, Craig A.; Bradham, Karen; Ashley, Peter; Cox, David F.; DeWalt, Gary; Lin, King-teh N.

    2009-01-01

    Objective: The objective of this study was to develop screening tools that could be used to estimate the mold burden in a home which would indicate whether more detailed testing might be useful. Methods: Previously, in the American Healthy Home Survey, a DNA-based method of analysis called mold specific quantitative PCR was used to measure 36 molds in standard protocol dust samples. This resulted in a national index called the Environmental Relative Moldiness Index. In this current study, two possible screening methods were considered: use of the vacuum cleaner bag dust rather than the standard protocol dust samples and reducing the number of molds needed to be quantified resulting in the creation of a simpler mold burden scale. Results: Comparison of vacuum bag and standard dust samples from 157 of the same homes demonstrated that most molds had higher detection rates in vacuum bag dust compared to the standard dust samples but the ERMI values were still related to each other. The second approach to simplifying the screening for mold burdens produced a correlated (ρ=0.80) index to the ERMI called the American Relative Moldiness Index (ARMI) which requires the analysis of only 12 species. Conclusions: Vacuum bag dust sample ERMI values were predictive in placing a home into the lower or upper 50% of homes on the ERMI scale. If it is not possible to obtain the standard dust sample, the vacuum cleaner bag dust may be a useful screening tool for estimating mold burdens in homes. If the standard sample is available and a simpler screening test is sought to estimate the mold burden in homes, the ARMI scale might be useful.

  12. Residual orientation in micro-injection molded parts

    SciTech Connect

    Healy, John; Edward, Graham H.; Knott, Robert B.

    2008-06-30

    The residual orientation following micro-injection molding of small rectangular plates with linear polyethylene has been examined using small-angle neutron scattering, and small- and wide-angle X-ray scattering. The effect of changing the molding conditions has been examined, and the residual chain orientation has been compared to the residual orientation of the crystallites as a function of position in the sample. This study has found that, for micromoldings, the orientation of the crystallites decreases with increasing injection speed and increasing mold thickness. The combined data suggest that the majority of the orientation present comes from oriented crystal growth rather than residual chain orientation.

  13. Atmospheric transport of mold spores in clouds of desert dust

    USGS Publications Warehouse

    Shinn, E.A.; Griffin, Dale W.; Seba, D.B.

    2003-01-01

    Fungal spores can be transported globally in clouds of desert dust. Many species of fungi (commonly known as molds) and bacteria--including some that are human pathogens--have characteristics suited to long-range atmospheric transport. Dust from the African desert can affect air quality in Africa, Europe, the Middle East, and the Americas. Asian desert dust can affect air quality in Asia, the Arctic, North America, and Europe. Atmospheric exposure to mold-carrying desert dust may affect human health directly through allergic induction of respiratory stress. In addition, mold spores within these dust clouds may seed downwind ecosystems in both outdoor and indoor environments.

  14. Subnanometer replica molding of molecular steps on ionic crystals.

    PubMed

    Elhadj, Selim; Rioux, Robert M; Dickey, Michael D; DeYoreo, James J; Whitesides, George M

    2010-10-13

    Replica molding with elastomeric polymers has been used routinely to replicate features less than 10 nm in size. Because the theoretical limit of this technique is set by polymer-surface interactions, atomic radii, and accessible volumes, replication at subnanometer length scales should be possible. Using polydimethylsiloxane to create a mold and polyurethane to form the replica, we demonstrate replication of elementary steps 3-5 Å in height that define the minimum separation between molecular layers in the lattices of the ionic crystals potassium dihydrogen phosphate and calcite. This work establishes the operation of replica molding at the molecular scale.

  15. Atmospheric transport of mold spores in clouds of desert dust.

    PubMed

    Shinn, Eugene A; Griffin, Dale W; Seba, Douglas B

    2003-08-01

    Fungal spores can be transported globally in clouds of desert dust. Many species of fungi (commonly known as molds) and bacteria--including some that are human pathogens--have characteristics suited to long-range atmospheric transport. Dust from the African desert can affect air quality in Africa, Europe, the Middle East, and the Americas. Asian desert dust can affect air quality in Asia, the Arctic, North America, and Europe. Atmospheric exposure to mold-carrying desert dust may affect human health directly through allergic induction of respiratory stress. In addition, mold spores within these dust clouds may seed downwind ecosystems in both outdoor and indoor environments.

  16. Fabrication of sinterable silicon nitride by injection molding

    NASA Technical Reports Server (NTRS)

    Quackenbush, C. L.; French, K.; Neil, J. T.

    1982-01-01

    Transformation of structural ceramics from the laboratory to production requires development of near net shape fabrication techniques which minimize finish grinding. One potential technique for producing large quantities of complex-shaped parts at a low cost, and microstructure of sintered silicon nitride fabricated by injection molding is discussed and compared to data generated from isostatically dry-pressed material. Binder selection methodology, compounding of ceramic and binder components, injection molding techniques, and problems in binder removal are discussed. Strength, oxidation resistance, and microstructure of sintered silicon nitride fabricated by injection molding is discussed and compared to data generated from isostatically dry-pressed material.

  17. Rapid and low-cost prototyping of medical devices using 3D printed molds for liquid injection molding.

    PubMed

    Chung, Philip; Heller, J Alex; Etemadi, Mozziyar; Ottoson, Paige E; Liu, Jonathan A; Rand, Larry; Roy, Shuvo

    2014-01-01

    Biologically inert elastomers such as silicone are favorable materials for medical device fabrication, but forming and curing these elastomers using traditional liquid injection molding processes can be an expensive process due to tooling and equipment costs. As a result, it has traditionally been impractical to use liquid injection molding for low-cost, rapid prototyping applications. We have devised a method for rapid and low-cost production of liquid elastomer injection molded devices that utilizes fused deposition modeling 3D printers for mold design and a modified desiccator as an injection system. Low costs and rapid turnaround time in this technique lower the barrier to iteratively designing and prototyping complex elastomer devices. Furthermore, CAD models developed in this process can be later adapted for metal mold tooling design, enabling an easy transition to a traditional injection molding process. We have used this technique to manufacture intravaginal probes involving complex geometries, as well as overmolding over metal parts, using tools commonly available within an academic research laboratory. However, this technique can be easily adapted to create liquid injection molded devices for many other applications. PMID:24998993

  18. Rapid and Low-cost Prototyping of Medical Devices Using 3D Printed Molds for Liquid Injection Molding

    PubMed Central

    Chung, Philip; Heller, J. Alex; Etemadi, Mozziyar; Ottoson, Paige E.; Liu, Jonathan A.; Rand, Larry; Roy, Shuvo

    2014-01-01

    Biologically inert elastomers such as silicone are favorable materials for medical device fabrication, but forming and curing these elastomers using traditional liquid injection molding processes can be an expensive process due to tooling and equipment costs. As a result, it has traditionally been impractical to use liquid injection molding for low-cost, rapid prototyping applications. We have devised a method for rapid and low-cost production of liquid elastomer injection molded devices that utilizes fused deposition modeling 3D printers for mold design and a modified desiccator as an injection system. Low costs and rapid turnaround time in this technique lower the barrier to iteratively designing and prototyping complex elastomer devices. Furthermore, CAD models developed in this process can be later adapted for metal mold tooling design, enabling an easy transition to a traditional injection molding process. We have used this technique to manufacture intravaginal probes involving complex geometries, as well as overmolding over metal parts, using tools commonly available within an academic research laboratory. However, this technique can be easily adapted to create liquid injection molded devices for many other applications. PMID:24998993

  19. Rapid and low-cost prototyping of medical devices using 3D printed molds for liquid injection molding.

    PubMed

    Chung, Philip; Heller, J Alex; Etemadi, Mozziyar; Ottoson, Paige E; Liu, Jonathan A; Rand, Larry; Roy, Shuvo

    2014-06-27

    Biologically inert elastomers such as silicone are favorable materials for medical device fabrication, but forming and curing these elastomers using traditional liquid injection molding processes can be an expensive process due to tooling and equipment costs. As a result, it has traditionally been impractical to use liquid injection molding for low-cost, rapid prototyping applications. We have devised a method for rapid and low-cost production of liquid elastomer injection molded devices that utilizes fused deposition modeling 3D printers for mold design and a modified desiccator as an injection system. Low costs and rapid turnaround time in this technique lower the barrier to iteratively designing and prototyping complex elastomer devices. Furthermore, CAD models developed in this process can be later adapted for metal mold tooling design, enabling an easy transition to a traditional injection molding process. We have used this technique to manufacture intravaginal probes involving complex geometries, as well as overmolding over metal parts, using tools commonly available within an academic research laboratory. However, this technique can be easily adapted to create liquid injection molded devices for many other applications.

  20. A review on the importance of surface coating of micro/nano-mold in micro/nano-molding processes

    NASA Astrophysics Data System (ADS)

    Saha, Biswajit; Toh, Wei Quan; Liu, Erjia; Beng Tor, Shu; Hardt, David E.; Lee, Junghoon

    2016-01-01

    Micro/nano hot-embossing and injection molding are two promising manufacturing processes for the mass production of workpieces bearing micro/nanoscale features. However, both the workpiece and micro/nano-mold are susceptive to structural damage due to high thermal stress, adhesion and friction, which occur at the interface between the workpiece and the mold during these processes. Hence, major constraints of micro/nano-molds are mainly attributed to improper replication and their inability to withstand a prolonged sliding surface contact because of high sidewall friction and/or high adhesion. Consequently, there is a need for proper surface coating as it can improve the surface properties of micro/nano-molds such as having a low friction coefficient, low adhesion and low wear rate. This review deals with the physical, mechanical and tribological properties of various surface coatings and their impact on the replication efficiency and lifetime of micro/nano-molds that are used in micro/nano hot-embossing and injection molding processes.

  1. Method of reusably sealing a silicone rubber vacuum bag to a mold for composite manufacture

    NASA Technical Reports Server (NTRS)

    Steinbach, John (Inventor)

    1989-01-01

    A silicone rubber vacuum bag for use in composite article manufacture is reusably sealed to a mold, without mechanical clamping means. The mold-mating portion of the bag is primed with a silicone rubber adhesive, which is cured thereto, and a layer of semiadhesive sealer is applied between the primed mold-mating portion of the bag and the mold.

  2. 40 CFR 63.5728 - What standards must I meet for closed molding resin operations?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... molding resin operations? 63.5728 Section 63.5728 Protection of Environment ENVIRONMENTAL PROTECTION... Standards for Closed Molding Resin Operations § 63.5728 What standards must I meet for closed molding resin operations? (a) If a resin application operation meets the definition of closed molding specified in §...

  3. 46 CFR 148.250 - Direct reduced iron (DRI); hot-molded briquettes.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 5 2013-10-01 2013-10-01 false Direct reduced iron (DRI); hot-molded briquettes. 148... Materials § 148.250 Direct reduced iron (DRI); hot-molded briquettes. (a) Before loading DRI hot-molded... and recognized by the Commandant (CG-ENG-5) that at the time of loading the DRI hot-molded...

  4. 46 CFR 148.250 - Direct reduced iron (DRI); hot-molded briquettes.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 5 2014-10-01 2014-10-01 false Direct reduced iron (DRI); hot-molded briquettes. 148... Materials § 148.250 Direct reduced iron (DRI); hot-molded briquettes. (a) Before loading DRI hot-molded... and recognized by the Commandant (CG-ENG-5) that at the time of loading the DRI hot-molded...

  5. 46 CFR 148.250 - Direct reduced iron (DRI); hot-molded briquettes.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 5 2012-10-01 2012-10-01 false Direct reduced iron (DRI); hot-molded briquettes. 148... Materials § 148.250 Direct reduced iron (DRI); hot-molded briquettes. (a) Before loading DRI hot-molded... and recognized by the Commandant (CG-ENG-5) that at the time of loading the DRI hot-molded...

  6. 40 CFR 63.5728 - What standards must I meet for closed molding resin operations?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... molding resin operations? 63.5728 Section 63.5728 Protection of Environment ENVIRONMENTAL PROTECTION... Standards for Closed Molding Resin Operations § 63.5728 What standards must I meet for closed molding resin operations? (a) If a resin application operation meets the definition of closed molding specified in §...

  7. Mold Heating and Cooling Pump Package Operator Interface Controls Upgrade

    SciTech Connect

    Josh A. Salmond

    2009-08-07

    The modernization of the Mold Heating and Cooling Pump Package Operator Interface (MHC PP OI) consisted of upgrading the antiquated single board computer with a proprietary operating system to off-the-shelf hardware and off-the-shelf software with customizable software options. The pump package is the machine interface between a central heating and cooling system that pumps heat transfer fluid through an injection or compression mold base on a local plastic molding machine. The operator interface provides the intelligent means of controlling this pumping process. Strict temperature control of a mold allows the production of high quality parts with tight tolerances and low residual stresses. The products fabricated are used on multiple programs.

  8. Cork is used to make tooling patterns and molds

    NASA Technical Reports Server (NTRS)

    Hoffman, F. J.

    1965-01-01

    Sheet and waste cork are cemented together to provide a tooling pattern or mold. The cork form withstands moderately high temperatures under vacuum or pressure with minimum expansion, shrinkage, or distortion.

  9. Method and mold for casting thin metal objects

    DOEpatents

    Pehrson, Brandon P; Moore, Alan F

    2014-04-29

    Provided herein are various embodiments of systems for casting thin metal plates and sheets. Typical embodiments include layers of mold cavities that are oriented vertically for casting the metal plates. In some embodiments, the mold cavities include a beveled edge such that the plates that are cast have a beveled edge. In some embodiments, the mold cavities are filled with a molten metal through an open horizontal edge of the cavity. In some embodiments, the mold cavities are filled through one or more vertical feed orifices. Further disclosed are methods for forming a thin cast metal plate or sheet where the thickness of the cast part is in a range from 0.005 inches to 0.2 inches, and the surface area of the cast part is in a range from 16 square inches to 144 square inches.

  10. The Mold Insurance Crisis: Less than It Appears.

    ERIC Educational Resources Information Center

    Mangan, Joseph F.

    2003-01-01

    Discusses two different but closely related problems that must be solved when determining what insurance coverage a campus needs for mold losses: issues of property insurance and of liability insurance. (EV)

  11. VIEW FACING EAST. ORE TRESTLE WINDS AROUND THE INGOT MOLD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW FACING EAST. ORE TRESTLE WINDS AROUND THE INGOT MOLD CONDITIONING BUILDING IN FOREGROUND. PITTSBURGH & LAKE ERIE TRACKS WIND THROUGH TOWN TOWARDS PITTSBURGH AT RIGHT. - Pittsburgh Steel Company, Monessen Works, Donner Avenue, Monessen, Westmoreland County, PA

  12. 55. August 17, 1913 "Clearing off mold from surface ground, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    55. August 17, 1913 "Clearing off mold from surface ground, Pinnacles Road, mile six. Note mould raked aside and piled up preparatory to burning." - Crater Lake National Park Roads, Klamath Falls, Klamath County, OR

  13. Technique for removing resin from a molded object

    NASA Technical Reports Server (NTRS)

    Hemmi, I.; Morishita, T.; Ono, T.

    1983-01-01

    Resin is removed from a molded object in such a way that no cracks or expansion occurs in the casting. The resin is first mixed with a ceramics powder or metal powder. This mixture is then molded and the resin is removed by heat. The molded object is then placed into a container which is sealed and large enough to allow the gas from the resin to be controlled by heat from the resin. The gas pressure at the surface of the object is increased by the gas pressure generated from the resin and the resin removed. The increase in gas pressure from the surface of the molded object is 1.5 atm to 3 atm at 350 C to 400 C.

  14. 10. INTERIOR VIEW WITH CORES FOR VALVE MOLDING. STOCKHAM EMPLOYEES ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. INTERIOR VIEW WITH CORES FOR VALVE MOLDING. STOCKHAM EMPLOYEES REFER TO THESE CORES AS THE STAR WARS CASTINGS. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  15. 36. LARGE MOLD MAKING MACHINE, GREY IRON UNIT #4 SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    36. LARGE MOLD MAKING MACHINE, GREY IRON UNIT #4 SHOWING PATTERNS THAT FLASKS FIT OVER PRIOR TO BEING FILLED WITH SAND AND COMPRESSED. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  16. 31. FLOOR MOLDING PROCESS. THE WORKER IS 'PARTING DOWN' THE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. FLOOR MOLDING PROCESS. THE WORKER IS 'PARTING DOWN' THE MOULDING SAND TO REMOVE THE PATTERN FROM THE FLASK LOADED WITH SAND. WORKER: GEORGE URIARTE. - Knight Foundry, 13 Eureka Street, Sutter Creek, Amador County, CA

  17. EVALUATION OF POLLUTION PREVENTION OPPORTUNITIES FOR MOLD RELEASE AGENTS

    EPA Science Inventory

    The report gives results of an assessment of the processes, materials, installation practices, and emission characteristics associated with the application of mold release agents (MRAs). Emissions were estimated based on available information on MRA composition and consumption. V...

  18. Molded composite pyrogen igniter for rocket motors. [solid propellant ignition

    NASA Technical Reports Server (NTRS)

    Heier, W. C.; Lucy, M. H. (Inventor)

    1978-01-01

    A lightweight pyrogen igniter assembly including an elongated molded plastic tube adapted to contain a pyrogen charge was designed for insertion into a rocket motor casing for ignition of the rocket motor charge. A molded plastic closure cap provided for the elongated tube includes an ignition charge for igniting the pyrogen charge and an electrically actuated ignition squib for igniting the ignition charge. The ignition charge is contained within a portion of the closure cap, and it is retained therein by a noncorrosive ignition pellet retainer or screen which is adapted to rest on a shoulder of the elongated tube when the closure cap and tube are assembled together. A circumferentially disposed metal ring is provided along the external circumference of the closure cap and is molded or captured within the plastic cap in the molding process to provide, along with O-ring seals, a leakproof rotary joint.

  19. Slope-deviation measurement of Fresnel-shaped mold surfaces.

    PubMed

    Kiefel, Peter; Hornung, Thorsten; Nitz, Peter; Reinecke, Holger

    2016-03-10

    Molds are used to dictate their shape to other materials in embossing or filling processes. In optics fabrication especially, the exact surface slope of the polymer replica is of high relevance. The quality control of molds is challenging: non-invasive, optical metrologies struggle with shiny surfaces that minimize the scattering of light. In addition, the inspection of complex shaped molds with a stepped optical surface can be difficult. In response, the authors show a backward ray-tracing approach combined with fringe-reflection technique to determine the slopes of a Fresnel-shaped mold surface with topography features in the magnitude order of a quarter millimeter. The error is kept small by stitching together several measurements with different sample rotations. PMID:26974807

  20. INTERIOR VIEW, PREPARING LARGE MOLD IN BOX FLOOR AREA. WORKERS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR VIEW, PREPARING LARGE MOLD IN BOX FLOOR AREA. WORKERS JUST FILLED THE FLASK WITH SAND FROM A HIGH VELOCITY MECHANICAL SAND THRUSTER. - Stockham Pipe & Fittings Company, Ductile Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  1. Research on machine vision system of monitoring injection molding processing

    NASA Astrophysics Data System (ADS)

    Bai, Fan; Zheng, Huifeng; Wang, Yuebing; Wang, Cheng; Liao, Si'an

    2016-01-01

    With the wide development of injection molding process, the embedded monitoring system based on machine vision has been developed to automatically monitoring abnormality of injection molding processing. First, the construction of hardware system and embedded software system were designed. Then camera calibration was carried on to establish the accurate model of the camera to correct distortion. Next the segmentation algorithm was applied to extract the monitored objects of the injection molding process system. The realization procedure of system included the initialization, process monitoring and product detail detection. Finally the experiment results were analyzed including the detection rate of kinds of the abnormality. The system could realize the multi-zone monitoring and product detail detection of injection molding process with high accuracy and good stability.

  2. The investigation of mold life for glass thermal imprint

    NASA Astrophysics Data System (ADS)

    Chen, L. K.; Hung, Y. M.; Sung, C. K.

    2011-12-01

    Thermal imprint provides a stable and rapid approach in the fabrication of precision V-groove structures. This paper presents a theoretical and experimental study focusing on the estimation of mold life based on both the formation and wear mechanisms. In the experiment, BK-7 was used as the substrate, and the mold with V-groove patterns was fabricated with glassy carbon. The formation of V-groove microstructures on BK-7 glass substrate was implemented by a lab made thermal imprint equipment, while the precision of imprinted pattern was measured by an optical measurement system. Additionally, the micro-scale friction and wear theories were adopted to estimate the mold life. Finally, the prediction model of mold life can be estimated by the relative friction and wear theories and measurement data, which enable us to efficiently optimize the glass thermal imprint process.

  3. PNEUMATICALLY CLEANING TOP HALF OF LARGE MOLD IN BOX FLOOR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    PNEUMATICALLY CLEANING TOP HALF OF LARGE MOLD IN BOX FLOOR AREA TO REMOVE ANY EXCESS OR LOOSE SAND. - Stockham Pipe & Fittings Company, Ductile Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  4. Detail, capital molding on corner boards at northwest corner of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Detail, capital molding on corner boards at northwest corner of two-story block, forming corner pilaster. This is the only extant corner board capital. - Drew-Sherwood Farm, House, 7927 Elk Grove Boulevard, Elk Grove, Sacramento County, CA

  5. Powder Injection Molding of Ceramic Engine Components for Transportation

    NASA Astrophysics Data System (ADS)

    Lenz, Juergen; Enneti, Ravi K.; Onbattuvelli, Valmikanathan; Kate, Kunal; Martin, Renee; Atre, Sundar

    2012-03-01

    Silicon nitride has been the favored material for manufacturing high-efficiency engine components for transportation due to its high temperature stability, good wear resistance, excellent corrosion resistance, thermal shock resistance, and low density. The use of silicon nitride in engine components greatly depends on the ability to fabricate near net-shape components economically. The absence of a material database for design and simulation has further restricted the engineering community in developing parts from silicon nitride. In this paper, the design and manufacturability of silicon nitride engine rotors for unmanned aerial vehicles by the injection molding process are discussed. The feedstock material property data obtained from experiments were used to simulate the flow of the material during injection molding. The areas susceptible to the formation of defects during the injection molding process of the engine component were identified from the simulations. A test sample was successfully injection molded using the feedstock and sintered to 99% density without formation of significant observable defects.

  6. Residual stresses in injection molded shape memory polymer parts

    NASA Astrophysics Data System (ADS)

    Katmer, Sukran; Esen, Huseyin; Karatas, Cetin

    2016-03-01

    Shape memory polymers (SMPs) are materials which have shape memory effect (SME). SME is a property which has the ability to change shape when induced by a stimulator such as temperature, moisture, pH, electric current, magnetic field, light, etc. A process, known as programming, is applied to SMP parts in order to alter them from their permanent shape to their temporary shape. In this study we investigated effects of injection molding and programming processes on residual stresses in molded thermoplastic polyurethane shape memory polymer, experimentally. The residual stresses were measured by layer removal method. The study shows that injection molding and programming process conditions have significantly influence on residual stresses in molded shape memory polyurethane parts.

  7. 10. VIEW OF DEPLETED URANIUM INGOT AND MOLD IN FOUNDRY. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. VIEW OF DEPLETED URANIUM INGOT AND MOLD IN FOUNDRY. (11/11/56) - Rocky Flats Plant, Non-Nuclear Production Facility, South of Cottonwood Avenue, west of Seventh Avenue & east of Building 460, Golden, Jefferson County, CO

  8. SHAKE OUT WORKER DUMPING COOLED MOLDS ONTO THE VIBRATING CONVEYOR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    SHAKE OUT WORKER DUMPING COOLED MOLDS ONTO THE VIBRATING CONVEYOR THAT TRANSPORTS SAND AND CASTINGS TO THE SEPARATION SCREEN. - Southern Ductile Casting Company, Centerville Foundry, 101 Airport Road, Centreville, Bibb County, AL

  9. Diamond machining of steel molds for optical components

    NASA Astrophysics Data System (ADS)

    Bohr, Roland

    2016-08-01

    The requirement of ultra precision diamond machining of lens molds in steel is identified. A solution for this type of machining is presented and results of such a machining in steel compared to standard milling and polishing process are shown.

  10. Molding of top skull in the treatment of Apert syndrome.

    PubMed

    Shen, Weimin; Cui, Jie; Chen, Jianbin; Weiping, Shen

    2015-03-01

    Patients with Apert syndrome have bilateral coronal craniosynostosis, along with a distinguishing feature of their many deformity, called tower skull. Surgical correction of this deformity is the mainstay of treatment. We describe 3 patients molded top skull after front bone osteotomy orbital bar advancement. This successfully restricted growth of their top skull while allowing growth in other dimensions. Utilization of top-skull molding after cranial surgery shows promise of satisfaction in this setting.

  11. Evaluation of Additive Manufacturing for Composite Part Molds

    SciTech Connect

    Duty, Chad E.; Springfield, Robert M.

    2015-02-01

    The ORNL Manufacturing Demonstration Facility (MDF) collaborated with Tru-Design to test the quality and durability of molds used for making fiber reinforced composites using additive manufacturing. The partners developed surface treatment techniques including epoxy coatings and machining to improve the quality of the surface finish. Test samples made using the printed and surface finished molds demonstrated life spans suitable for one-of-a-kind and low-volume applications, meeting the project objective.

  12. 22. INTERIOR VIEW WITH INTERIOR VIEW OF MOLDING SANDS CONTROL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. INTERIOR VIEW WITH INTERIOR VIEW OF MOLDING SANDS CONTROL AND TEST LAB FOR UNIT NO. 2 GREY IRON DISAMATIC. SAND CASTING TECHNICIAN, ROY BATES, TESTS THE WEIGHT OF THE SAND, DRYS IT, AND WEIGHT IT AGAINST STANDARDS TO CALCULATE THE CORRECT MOISTURE NEEDED FOR DIFFERENT MOLDS. THE SAND MIX VARY WITH THE SIZE AND COMPOSITION OF THE CASTING. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  13. Localized rapid heating process for precision chalcogenide glass molding

    NASA Astrophysics Data System (ADS)

    Li, Hui; He, Peng; Yu, Jianfeng; Lee, L. James; Yi, Allen Y.

    2015-10-01

    Precision glass molding is an important process for high volume optical fabrication. However, conventional glass molding is a bulk heating process that usually requires a long thermal cycle, where molding assembly and other mechanical parts are heated and cooled together. This often causes low efficiency and other heating and cooling related problems, such as large thermal expansion in both the molds and molded optics. To cope with this issue, we developed a localized rapid heating process to effectively heat only very small part of the glass. This localized rapid heating study utilized a fused silica wafer coated with a thin graphene layer to heat only the surface of the glass. The graphene coating functions as an electrical resistant heater when a power source was applied across the thin film coating, generating heat on and near the coating. The feasibility of this process was validated by both experiments and numerical simulation. To demonstrate the advantages of the localized rapid heating, both localized rapid heating process and bulk heating process were performed and carefully compared. The uniformity and quality of the molded sample by localized rapid heating process was also demonstrated. In summary, localized rapid heating process by using graphene coated fused silica wafer was characterized and can be readily implemented in replication of micro scale chalcogenide glasses. A fused silica wafer coated with a thin graphene layer was utilized for localized rapid heating only the surface of the glass. The graphene coating functions as an electrical resistant heater when a power source was applied across the thin film coating, generating high temperature on and near the coating. This process is fast and efficient since only interested areas are heated without affecting the entire glass substrate or the mold assembly. The uniformity and quality of the molded sample by localized rapid heating process was demonstrated by comparing both localized rapid heating

  14. Thermal deformation compensation in the molding of aspheric glass lenses

    NASA Astrophysics Data System (ADS)

    Lee, Dong-kil; Oh, Jun-girl; Jang, Won-Gun; Kim, Yang-gyu; Lee, Kwanghoon; Park, Anjin; Yang, Young-Soo

    2014-06-01

    Generally, aspheric glass lenses are manufactured using a glass molding press (GMP) method and a tungsten carbide mold core. This study analyzes the thermal deformation that occurs during the GMP process, and the results were applied to compensate an aspheric glass lens. After the compensation process, the form accuracy of aspheric glass lenses improved from ˜3.7 to ˜0.35 μm. The compensated lens complied with the actual specifications.

  15. Fabrication of microinjection-molded miniature freeform Alvarez lenses.

    PubMed

    Li, Likai; Raasch, Thomas W; Sieber, Ingo; Beckert, Erik; Steinkopf, Ralf; Gengenbach, Ulrich; Yi, Allen Y

    2014-07-01

    Microinjection molding is a mass production method to fabricate affordable optical components. However, the intense nature of this process often results in part deformation and uneven refractive index distribution. These two factors limit the precision of replicated optics. In order to understand the influences of injection molding on freeform optical devices, in this study, finite element method (FEM) was employed to investigate the miniature microinjection-molded Alvarez lenses. In addition, an innovative metrology setup was proposed to evaluate the optical wavefront patterns in the molded lenses using an interferometer-based wavefront measurement system. This measurement setup utilized an optical matching liquid to reduce or eliminate the lenses' surface power such that the wavefront pattern with large deviation from the freeform lenses can be measured by a regular wavefront setup. The FEM simulation results were also used to explain the differences between the nominal and experimentally measured wavefront patterns of the microinjection-molded Alvarez lenses. In summary, the proposed method combining simulation and wavefront measurements is shown to be an effective approach for studying injection molding of freeform optics. PMID:25089987

  16. Precision glass molding of high-resolution diffractive optical elements

    NASA Astrophysics Data System (ADS)

    Prater, Karin; Dukwen, Julia; Scharf, Toralf; Herzig, Hans P.; Plöger, Sven; Hermerschmidt, Andreas

    2016-04-01

    The demand of high resolution diffractive optical elements (DOE) is growing. Smaller critical dimensions allow higher deflection angles and can fulfill more demanding requirements, which can only be met by using electron-beam lithography. Replication techniques are more economical, since the high cost of the master can be distributed among a larger number of replicas. The lack of a suitable mold material for precision glass molding has so far prevented an industrial use. Glassy Carbon (GC) offers a high mechanical strength and high thermal strength. No anti-adhesion coatings are required in molding processes. This is clearly an advantage for high resolution, high aspect ratio microstructures, where a coating with a thickness between 10 nm and 200 nm would cause a noticeable rounding of the features. Electron-beam lithography was used to fabricate GC molds with highest precision and feature sizes from 250 nm to 2 μm. The master stamps were used for precision glass molding of a low Tg glass L-BAL42 from OHARA. The profile of the replicated glass is compared to the mold with the help of SEM images. This allows discussion of the max. aspect-ratio and min. feature size. To characterize optical performances, beamsplitting elements are fabricated and their characteristics were investigated, which are in excellent agreement to theory.

  17. Prompt remediation of water intrusion corrects the resultant mold contamination in a home.

    PubMed

    Rockwell, William

    2005-01-01

    More patients are turning to their allergists with symptoms compatible with allergic rhinitis, allergic sinusitis, and/or bronchial asthma after exposure to mold-contaminated indoor environments. These patients often seek guidance from their allergists in the remediation of the contaminated home or office. The aim of this study was to determine baseline mold spore counts for noncontaminated homes and report a successful mold remediation in one mold-contaminated home. Indoor air quality was tested using volumetric spore counts in 50 homes where homeowners reported no mold-related health problems and in one mold-contaminated home that was remediated. The health of the occupant of the mold-contaminated home also was assessed. Indoor volumetric mold spore counts ranged from 300 to 1200 spores/m3 in the baseline homes. For the successful remediation, the mold counts started at 300 spores/m3, increased to 2800 spores/m3 at the height of the mold contamination, and then fell to 800 spores/m3 after remediation. The occupant's allergic symptoms ceased on complete remediation of the home. Indoor volumetric mold counts taken with the Allergenco MK-3 can reveal a potential indoor mold contamination, with counts above 1000 spores/m3 suggesting indoor mold contamination. Once the presence of indoor mold growth is found, a prompt and thorough remediation can bring mold levels back to near-baseline level and minimize negative health effects for occupants.

  18. Mold-filling experiments for validation of modeling encapsulation. Part 1, "wine glass" mold.

    SciTech Connect

    Castaneda, Jaime N.; Grillet, Anne Mary; Altobelli, Stephen A.; Cote, Raymond O.; Mondy, Lisa Ann

    2005-06-01

    The C6 project 'Encapsulation Processes' has been designed to obtain experimental measurements for discovery of phenomena critical to improving these processes, as well as data required in the verification and validation plan (Rao et al. 2001) for model validation of flow in progressively complex geometries. We have observed and recorded the flow of clear, Newtonian liquids and opaque, rheologically complex suspensions in two mold geometries. The first geometry is a simple wineglass geometry in a cylinder and is reported here in Part 1. The results in a more realistic encapsulation geometry are reported in Part 2.

  19. Potassium loss during galvanotaxis of slime mold.

    PubMed

    ANDERSON, J D

    1962-01-01

    The posterior reticulated regions of the plasmodia of the slime mold, Physarum polycephalum, whose migration has been oriented by direct current (3.0 to 5.0 microa/mm(2) in the agar substrate), contain 30 per cent less potassium than the advancing non-reticulated region. The anterior regions have the same potassium concentration as that of the controls, approximately 32 meq/kg wet weight. Differences in potassium concentration between anterior and posterior regions of control plasmodia, not oriented by electric current, are less than 5 per cent. Sodium, in contrast to potassium, is generally less concentrated in the anterior than in the posterior regions of electrically oriented plasmodia, but sodium concentrations are extremely variable. No significant difference in protein concentration was found between oriented and control plasmodia. Thirty-five per cent of the total potassium, but none of the sodium, is found in acidified ethanol precipitates from plasmodial homogenates. Potassium, but not sodium, appears to be closely associated with processes which differentiate anterior from posterior in an oriented plasmodium.

  20. Thermomechanical Behavior of Molded Metallic Glass Nanowires

    PubMed Central

    Magagnosc, Daniel J.; Chen, Wen; Kumar, Golden; Schroers, Jan; Gianola, Daniel S.

    2016-01-01

    Metallic glasses are disordered materials that offer the unique ability to perform thermoplastic forming operations at low thermal budget while preserving excellent mechanical properties such as high strength, large elastic strain limits, and wear resistance owing to the metallic nature of bonding and lack of internal defects. Interest in molding micro- and nanoscale metallic glass objects is driven by the promise of robust and high performance micro- and nanoelectromechanical systems and miniature energy conversion devices. Yet accurate and efficient processing of these materials hinges on a robust understanding of their thermomechanical behavior. Here, we combine large-scale thermoplastic tensile deformation of collections of Pt-based amorphous nanowires with quantitative thermomechanical studies of individual nanowires in creep-like conditions to demonstrate that superplastic-like flow persists to small length scales. Systematic studies as a function of temperature, strain-rate, and applied stress reveal the transition from Newtonian to non-Newtonian flow to be ubiquitous across the investigated length scales. However, we provide evidence that nanoscale specimens sustain greater free volume generation at elevated temperatures resulting in a flow transition at higher strain-rates than their bulk counterparts. Our results provide guidance for the design of thermoplastic processing methods and methods for verifying the flow response at the nanoscale. PMID:26787400

  1. Infrared curing simulations of liquid composites molding

    SciTech Connect

    Nakouzi, S.; Pancrace, J.; Schmidt, F. M.; Le Maoult, Y.; Berthet, F.

    2011-05-04

    Infrared radiation is an effective energy source to cure thermosetting polymers. Its usage is expected to reduce curing time in comparison with thermal heating and mold thermally regulated. In addition, because of the polymerization mechanism and instant on-off control of this power, an improvement in the final properties of the material is also expected. In this paper, we studied the infrared interaction with carbon (or glass) fibers reinforced epoxy matrix, where Liquid resin infusion (LRI) is used to manufacture the composite. Temperature of the composite is a key parameter that affects its mechanical properties and is controlled by the infrared emitters and the exothermic heat released from the polymerization. Radiative heat flux is computed using the in-lab developed software RAYHEAT. Then, the heat flux (or absorbed energy for glass fibers) is exported to the finite element based program COMSOLMULTIPHYSICS where heat balance equation is solved. This equation is coupled with the exothermic heat released during the curing process in order to predict the composite temperature versus time and degree of cure. Numerical simulations will be performed on planar parts (sheet shape) as well as curvilinear shapes. Experimental validations of the infrared curing carbon (glass)-epoxy composite system are presented in this paper Sheet surface temperature distribution are measured thanks to infrared camera. Kinetic parameters were estimated from differential scanning calorimeter (DSC) experimental data.

  2. Thermomechanical Behavior of Molded Metallic Glass Nanowires

    NASA Astrophysics Data System (ADS)

    Magagnosc, Daniel J.; Chen, Wen; Kumar, Golden; Schroers, Jan; Gianola, Daniel S.

    2016-01-01

    Metallic glasses are disordered materials that offer the unique ability to perform thermoplastic forming operations at low thermal budget while preserving excellent mechanical properties such as high strength, large elastic strain limits, and wear resistance owing to the metallic nature of bonding and lack of internal defects. Interest in molding micro- and nanoscale metallic glass objects is driven by the promise of robust and high performance micro- and nanoelectromechanical systems and miniature energy conversion devices. Yet accurate and efficient processing of these materials hinges on a robust understanding of their thermomechanical behavior. Here, we combine large-scale thermoplastic tensile deformation of collections of Pt-based amorphous nanowires with quantitative thermomechanical studies of individual nanowires in creep-like conditions to demonstrate that superplastic-like flow persists to small length scales. Systematic studies as a function of temperature, strain-rate, and applied stress reveal the transition from Newtonian to non-Newtonian flow to be ubiquitous across the investigated length scales. However, we provide evidence that nanoscale specimens sustain greater free volume generation at elevated temperatures resulting in a flow transition at higher strain-rates than their bulk counterparts. Our results provide guidance for the design of thermoplastic processing methods and methods for verifying the flow response at the nanoscale.

  3. Thermomechanical Behavior of Molded Metallic Glass Nanowires.

    PubMed

    Magagnosc, Daniel J; Chen, Wen; Kumar, Golden; Schroers, Jan; Gianola, Daniel S

    2016-01-01

    Metallic glasses are disordered materials that offer the unique ability to perform thermoplastic forming operations at low thermal budget while preserving excellent mechanical properties such as high strength, large elastic strain limits, and wear resistance owing to the metallic nature of bonding and lack of internal defects. Interest in molding micro- and nanoscale metallic glass objects is driven by the promise of robust and high performance micro- and nanoelectromechanical systems and miniature energy conversion devices. Yet accurate and efficient processing of these materials hinges on a robust understanding of their thermomechanical behavior. Here, we combine large-scale thermoplastic tensile deformation of collections of Pt-based amorphous nanowires with quantitative thermomechanical studies of individual nanowires in creep-like conditions to demonstrate that superplastic-like flow persists to small length scales. Systematic studies as a function of temperature, strain-rate, and applied stress reveal the transition from Newtonian to non-Newtonian flow to be ubiquitous across the investigated length scales. However, we provide evidence that nanoscale specimens sustain greater free volume generation at elevated temperatures resulting in a flow transition at higher strain-rates than their bulk counterparts. Our results provide guidance for the design of thermoplastic processing methods and methods for verifying the flow response at the nanoscale. PMID:26787400

  4. Determination of heat transfer coefficients at the polymer-mold-interface for injection molding simulation by means of calorimetry

    NASA Astrophysics Data System (ADS)

    Stricker, M.; Steinbichler, G.

    2014-05-01

    Appropriate modeling of heat transfer from the polymer material to the injection mold is essential to achieve accurate simulation results. The heat transfer is commonly modeled using convective heat transfer and applying heat transfer coefficients (HTC) to the polymer-mold-interface. The set HTC has an influence on the results for filling pressure, cooling performance and shrinkage, among others. The current paper, presents a new strategy to measure HTC in injection molding experiments using Newtons law of cooling. The heat flux is calculated out of demolding heat (measured by means of calorimetry), injection heat (measured by means of an IR-sensor), cooling time and part mass. Cavity surface area, average mold surface temperature and average part surface temperature lead to the HTC.

  5. Investigation of Heat Transfer at the Mold/Metal Interface in Permanent Mold Casting of Light Alloys

    SciTech Connect

    Robert D. Pehlke; John T. Berry

    2005-12-16

    Accurate modeling of the metal casting process prior to creating a mold design demands reliable knowledge of the interfacial heat transfer coefficient at the mold metal interface as a function of both time and location. The phenomena concerned with the gap forming between the mold and the solidifying metal are complex but need to be understood before any modeling is attempted. The presence of mold coatings further complicates the situation. A commercial casting was chosen and studied in a gravity permanent mold casting process. The metal/mold interfacial heat transfer coefficient (IHTC) was the focus of the research. A simple, direct method has been used to evaluate the IHTC. Both the simulation and experiments have shown that a reasonably good estimate of the heat transfer coefficient could be made in the case studied. It has been found that there is a good agreement between experiments and simulations in the temperature profiles during the solidification process, given that the primary mechanism of heat transfer across the gap in permanent mold casting of light alloys is by conduction across the gap. The procedure utilized to determine the interfacial heat transfer coefficient can be applied to other casting processes. A recently completed project involving The University of Michigan and Mississippi State University, together with several industrial partners, which was supported by the USDOE through the Cast Metals Coalition, examined a number of cases of thermal contact. In an investigation which gave special consideration to the techniques of measurement, several mold coatings were employed and results presented as a function of time. Realistic conditions of coating thickness and type together with an appropriate combination of mold preheat and metal pouring temperature were strictly maintained throughout the investigation. Temperature sensors, in particular thermocouples, play an important part in validating the predictions of solidification models. Cooling

  6. Effect of cross sectional geometry on PDMS micro peristaltic pump performance: comparison of SU-8 replica molding vs. micro injection molding.

    PubMed

    Graf, Neil J; Bowser, Michael T

    2013-10-01

    Two different fabrication methods were employed to fabricate micropumps with different cross-sectional channel geometries. The first was to fabricate rectangular cross-sectional microchannel geometries using the well known fabrication method of replica molding (REM). The second, and far less utilized fabrication technique, was to create microchannel molds using an in-house fabricated handheld micro injection molding apparatus. The injection mold apparatus was designed for use with elastomeric room temperature vulcanization (RTV) polymers, as opposed to most other injection molding machines, which are designed for use with thermoplastic polymers. The injection mold's bottom plate was used as a microchannel molding template. The molding template was created by threading a small-diameter wire (150 μm or less) through the injection mold's bottom plate, with subsequent adhesion and smoothing of a thin piece of aluminum foil over the wire-raised injection mold template. When molded against, the template produced a rounded/Gaussian-shaped PDMS microchannel. The design of the injection mold will be presented, along with a direct comparison for micropump performance metrics such as flow rate, valving characteristics, and maximum backpressures attainable for each of the respective micropump channel geometries.

  7. Effect of cross sectional geometry on PDMS micro peristaltic pump performance: comparison of SU-8 replica molding vs. micro injection molding.

    PubMed

    Graf, Neil J; Bowser, Michael T

    2013-10-01

    Two different fabrication methods were employed to fabricate micropumps with different cross-sectional channel geometries. The first was to fabricate rectangular cross-sectional microchannel geometries using the well known fabrication method of replica molding (REM). The second, and far less utilized fabrication technique, was to create microchannel molds using an in-house fabricated handheld micro injection molding apparatus. The injection mold apparatus was designed for use with elastomeric room temperature vulcanization (RTV) polymers, as opposed to most other injection molding machines, which are designed for use with thermoplastic polymers. The injection mold's bottom plate was used as a microchannel molding template. The molding template was created by threading a small-diameter wire (150 μm or less) through the injection mold's bottom plate, with subsequent adhesion and smoothing of a thin piece of aluminum foil over the wire-raised injection mold template. When molded against, the template produced a rounded/Gaussian-shaped PDMS microchannel. The design of the injection mold will be presented, along with a direct comparison for micropump performance metrics such as flow rate, valving characteristics, and maximum backpressures attainable for each of the respective micropump channel geometries. PMID:23917263

  8. Foaming morphology control of microcellular injection molded parts with gas counter pressure and dynamic mold temperature control

    NASA Astrophysics Data System (ADS)

    Shiu, Tai-Yi; Huang, Chao-Tsai; Chang, Rong-Yu; Hwang, Shyh-Shin

    2014-05-01

    Microcellular injection molding process is a promising solution for products with special requirements such as weight reduction, extra thin wall, high dimensional stability, clamping force reduction, etc. Despite microcellular foaming application used in reciprocating screw injection molding machine was built more than a decade, some limitations, such as poor surface quality or poor foaming control, confine the usage of this technology. Earlier CAE simulation tool for microcellular injection molding was not successful due to insufficient physical and computational considerations, limited by complicated bubble growth mechanism; so that, an economic and efficient tool for examining foaming quality of injection foaming product was lack. In this study, a recent developed three-dimensional simulation tool is used to predict injection foaming process. Predictions are carried out with commodity polypropylene and polystyrene with nitrogen and carbon dioxide supercritical fluids (SCFs). Comparisons of simulations between microcellular injection molding with and without counter pressure are discussed to provide insights into the correlation of surface quality and cell size distribution near the surface of product. Furthermore, comparisons between simulation predictions and experimental results of molding process, which is featured with dynamic mold temperature and gas counter pressure, are given for understanding quality improvement by controlling foaming morphology, and benefit of industrial application.

  9. High resolution PFPE-based molding High resolution PFPE-based molding High resolution PFPE-based molding techniques for nanofabrication of high pattern density sub-20 nm features: A fundamental materials approach

    SciTech Connect

    Williams, Stuart S; Samulski, Edward; Lopez, Renee; Ruiz, Ricardo; DeSimone, Joseph; Retterer, Scott T

    2010-01-01

    ABSTRACT. Described herein is the development and investigation of PFPE-based elastomers for high resolution replica molding applications. The modulus of the elastomeric materials was increased through synthetic and additive approaches while maintaining relatively low surface energies (<25 mN/m). Using practically relevant large area master templates, we show that the resolution of the molds is strongly dependant upon the elastomeric mold modulus. A composite mold approach was used to form flexible molds out of stiff, high modulus materials that allow for replication of sub-20 nm post structures. Sub-100 nm line grating master templates, formed using e-beam lithography, were used to determine the experimental stability of the molding materials. It was observed that as the feature spacing decreased, high modulus composite molds were able to effectively replicate the nano-grating structures without cracking or tear-out defects that typically occur with high modulus elastomers.

  10. Nanoelectrode lithography using flexible conductive molds

    NASA Astrophysics Data System (ADS)

    Li, Y. F.; Chen, K. H.; Ootera, Y.; Toshiyoshi, H.; Fujita, H.

    2015-11-01

    This paper reports a pattern transfer technique based on an anodic oxidation reaction (AOR) using two kinds of flexible conductive molds (FCMs). This technique enables fine pattern transfer on an uneven surface with 1.8-µm-deep recesses and also improves the transfer uniformity on a flat surface. Both FCMs consist of a base, a flexible insulating pattern on the top of the base and a nanometric thick metal film deposited on the top of the base and the insulating pattern as a conductive layer. Oxide patterns corresponding to the conductive pattern are transferred on the surface of the target material via an AOR between the FCM and the target. The flexibility of the base and the insulating pattern not only enables the FCM to come close enough to the recess of the target material with an uneven surface to generate oxide patterns but also enables a uniform electrical contact between the FCM and the target material with a flat surface to improve transfer uniformity. The conductive pattern on the FCM makes it possible to generate oxide patterns on the surface of the target material in a resistless process via the AOR. A microelectromechanical system technique is used to fabricate the proposed FCMs, and two kinds of FCMs are developed: A film-type FCM with a conductive pattern whose line width is from 5 to 20 µm and a resin-type FCM with a 200-nm half-pitch conductive pattern. Oxide patterns with a line width and a half pitch corresponding to the conductive patterns of the two developed FCMs were collectively transferred on an uneven surface with 1.8-µm-deep recesses and a flat surface of silicon substrate in a millimeter-scale area.

  11. Preparation and properties of an internal mold release for rigid urethane foam

    SciTech Connect

    Parker, B.G.

    1980-08-01

    Internal mold releases which can be added to urethane foam resin were synthesized and evaluated. The use of this type of release agent eliminates the repeated cleaning and recoating of molds, a procedure required with surface-applied mold releases. The internal mold releases investigated are the reaction products of a fatty acid ester, containing an active hydrogen, and a monoisocycanate. The use of an internal mold release resulted in urethane foam with good releasability and excellent surface bondability. Several properties of rigid urethane foam formulated with the use of an internal mold release are presented.

  12. Diversity and significance of mold species in Norwegian drinking water.

    PubMed

    Hageskal, Gunhild; Knutsen, Ann Kristin; Gaustad, Peter; de Hoog, G Sybren; Skaar, Ida

    2006-12-01

    In order to determine the occurrence, distribution, and significance of mold species in groundwater- and surface water-derived drinking water in Norway, molds isolated from 273 water samples were identified. Samples of raw water, treated water, and water from private homes and hospital installations were analyzed by incubation of 100-ml membrane-filtered samples on dichloran-18% glycerol agar. The total count (number of CFU per 100 ml) of fungal species and the species diversity within each sample were determined. The identification of mold species was based on morphological and molecular methods. In total, 94 mold species belonging to 30 genera were identified. The mycobiota was dominated by species of Penicillium, Trichoderma, and Aspergillus, with some of them occurring throughout the drinking water system. Several of the same species as isolated from water may have the potential to cause allergic reactions or disease in humans. Other species are common contaminants of food and beverages, and some may cause unwanted changes in the taste or smell of water. The present results indicate that the mycobiota of water should be considered when the microbiological safety and quality of drinking water are assessed. In fact, molds in drinking water should possibly be included in the Norwegian water supply and drinking water regulations.

  13. Relevant Aspects in Modeling of Micro-injection Molding

    NASA Astrophysics Data System (ADS)

    Nguyen-Chung, Tham; Jüttner, Gábor; Pham, Tung; Mennig, Günter

    2008-07-01

    Growing demands in the manufacturing of micro and precision components in plastics require new concepts for molding machines and micro molds on the one hand. On the other hand, a deeper understanding of the filling and solidification process in a micro mold is indispensable. In this work, the filling process of a micro spiral was analyzed by modeling the compressible flow using pressure dependent viscosity and adjusted heat transfer coefficients. At the same time, experimental filling studies were carried out on an accurately controlled micro-injection molding machine. Based on the relationship between the injection pressure and the filling degree, essential factors for the quality of the simulation can be identified. It can be shown that the flow behavior of the melt in a micro cavity of high aspect ratio is extremely dependent on the melt compressibility in the injection cylinder which needs to be considered in the simulation in order to predict an accurate flow rate. Moreover, the heat transfer coefficients between the melt and the mold wall vary significantly when changing cavity thickness and processing conditions. It is believed that a pressure dependent model for the heat transfer coefficient would be able to improve the quality of the process simulation.

  14. Diversity and Significance of Mold Species in Norwegian Drinking Water▿

    PubMed Central

    Hageskal, Gunhild; Knutsen, Ann Kristin; Gaustad, Peter; de Hoog, G. Sybren; Skaar, Ida

    2006-01-01

    In order to determine the occurrence, distribution, and significance of mold species in groundwater- and surface water-derived drinking water in Norway, molds isolated from 273 water samples were identified. Samples of raw water, treated water, and water from private homes and hospital installations were analyzed by incubation of 100-ml membrane-filtered samples on dichloran-18% glycerol agar. The total count (number of CFU per 100 ml) of fungal species and the species diversity within each sample were determined. The identification of mold species was based on morphological and molecular methods. In total, 94 mold species belonging to 30 genera were identified. The mycobiota was dominated by species of Penicillium, Trichoderma, and Aspergillus, with some of them occurring throughout the drinking water system. Several of the same species as isolated from water may have the potential to cause allergic reactions or disease in humans. Other species are common contaminants of food and beverages, and some may cause unwanted changes in the taste or smell of water. The present results indicate that the mycobiota of water should be considered when the microbiological safety and quality of drinking water are assessed. In fact, molds in drinking water should possibly be included in the Norwegian water supply and drinking water regulations. PMID:17028226

  15. An investigation into the injection molding of PMR-15 polyimide

    NASA Technical Reports Server (NTRS)

    Colaluca, M. A.

    1984-01-01

    The chemorheological behavior of the PRM-15 molding compounds were characterized, the range of suitable processing parameters for injection molding in a reciprocating screw injection molding machine was determined, and the effects of the injection molding processing parameters on the mechanical properties of molded PMR-15 parts were studied. The apparatus and procedures for measuring viscosity and for determining the physical response of the material during heating are described. Results show that capillary rheometry can be effectively used with thermosets if the equipment is designed to overcome some of the inherent problems of these materials. A uniform temperature was provided in the barrel by using a circulating hot oil system. Standard capillary rheometry methods can provide the dependence of thermoset apparent viscosity on shear rate, temperature, and time. Process conditions resulting in complete imidization should be carefully defined. Specification of controlled oven temperature is inadequate and can result in incomplete imidization. For completely imidized PMR-15 heat at 15 C/min melt flow without gas evolution occurs in the temperature range of 325 C to 400 C.

  16. Improved plastic molding technology for magneto-optical disk substrate

    NASA Astrophysics Data System (ADS)

    Galic, George J.

    1991-03-01

    A patented new injection-molding technology which already has been coninercially licensed nonexclusively to worldleading plastic magnetooptical (MO) mediamakers gives very high moldpacking pressures (needed for maximum microsurface replication) without high birefringence (minimized by reducing constrictiveness during fill) even with high viscosity plastics. I . " STATFMENT OF ThE PROBLIM" FOB ERASABLE OPTICALDI 5K MOLDINQ Al though gl ass and new cross 1 inkabl e p1 as t i cs are cont ending wi th polycarbonate and other injection moldable thermoplastics for this new market polycarbonate has prevailed as " first generation" erasable media substrate (although product life considerations may require added barrier coat to the MO coating stacks thereof). If performance of all these substrate contenders were equal the injection moldable thermoplastics will be preferred due to lowest cost and most automatable production If molded thermoplastics don''t ultimately win out a main reason will have been that these disk products require a long narrow mold cavity to be filled by the thermoplastic of choice then packed at double the pressures used for digital audio compact disks (CDs) in order to force the molten thermoplastic against the staner microsurface until detailed microreplication is assured yet only very low moldedin stresses can be tolerated (typically 1/2 to 1/5 those of audio CDs) 1. 1 Fillrelated Molding Problems M-O disks typically are 130am or 86nin in diameter and as molded thickness of a single

  17. Method for Molding Structural Parts Utilizing Modified Silicone Rubber

    NASA Technical Reports Server (NTRS)

    Weiser, Erik S. (Inventor); Baucom, Robert M. (Inventor); Snoha, John J. (Inventor)

    1998-01-01

    This invention improves upon a method for molding structural parts from preform material. Preform material to be used for the part is provided. A silicone rubber composition containing entrained air voids is prepared. The silicone rubber and preform material assembly is situated within a rigid mold cavity used to shape the preform material to die desired shape. The entire assembly is heated in a standard heating device so that the thermal expansion of the silicone rubber exerts the pressure necessary to force the preform material into contact with the mold container. The introduction of discrete air voids into the silicone rubber allows for accurately controlled pressure application on the preform material at the cure temperature.

  18. Treatment principles for the management of mold infections.

    PubMed

    Kontoyiannis, Dimitrios P; Lewis, Russell E

    2014-11-06

    Survival rates among immunocompromised patients with invasive mold infections have markedly improved over the last decade with earlier diagnosis and new antifungal treatment options. Yet, increasing antifungal resistance, breakthrough infections with intrinsically resistant fungi, and potentially life-threatening adverse effects and drug interactions are becoming more problematic, especially with prolonged therapy. Evidence-based recommendations for treating invasive aspergillosis and mucormycosis provide excellent guidance on the initial workup and treatment of these molds, but they cannot address all of the key management issues. Herein, we discuss 10 general treatment principles in the management of invasive mold disease in immunocompromised patients and discuss how these principles can be integrated to develop an effective, individualized treatment plan.

  19. Long fiber polymer composite property calculation in injection molding simulation

    NASA Astrophysics Data System (ADS)

    Jin, Xiaoshi; Wang, Jin; Han, Sejin

    2013-05-01

    Long fiber filled polymer composite materials have attracted a great attention and usage in recent years. However, the injection and compression molded long fiber composite materials possess complex microstructures that include spatial variations in fiber orientation and length. This paper presents the recent implemented anisotropic rotary diffusion - reduced strain closure (ARD-RSC) model for predicting fiber orientation distribution[1] and a newly developed fiber breakage model[2] for predicting fiber length distribution in injection and compression molding simulation, and Eshelby-Mori-Tanaka model[3,4] with fiber-matrix de-bonding model[5] have been implemented to calculate the long fiber composite property distribution with predicted fiber orientation and fiber length distributions. A validation study on fiber orientation, fiber breakage and mechanical property distributions are given with injection molding process simulation.

  20. Development of a silicone transfer molding compound. Final report

    SciTech Connect

    Parker, B.G.

    1992-05-01

    Molding compound MS 2072067, designated BRP 50206, is currently used in the manufacture of bobbins and coils. This material was developed as a compression molding compound and is reinforced with 1/4 inch glass fibers. The production yield for coils and bobbins has improved over the years; however, it is still not at a desirable level. A milled glass reinforced version of MS 2072067 silicone molding compound was developed in the laboratory. Milled glass fibers with lengths of 1/32, 1/16, and 1/8 inch were used in place of the 1/4 inch chopped glass fibers in the formulations. The tensile strength, tensile moduli, thermal expansion, and flow properties of these materials were evaluated. These materials exhibited improved flow properties over the existing 1/4 inch glass fiber reinforced material. The new materials also had the same or better tensile strength, as compared to the current production material, and maintained similar thermal expansion characteristics.

  1. Computer-controlled compression molding system for composite processing

    SciTech Connect

    Farouk, A.; Kwon, T.H. )

    1990-07-01

    A simple, inexpensive yet flexible compression molding and cure monitoring system has been developed and used in studying the processing of advanced polymer composites. Compression molding is a promising method for manufacturing thermoset polymer composites which find usage in aerospace applications. The processing history of these composites determines their final properties. To improve quality and enable mass production, the processing-property relations need to be studied in detail. Process control and process monitoring as well as provision for user intervention during processing is essential in studying such problems. The computer-controlled molding system together with the control and data acquisition software aims at demonstrating how such a system may be built from off-the-shelf components.

  2. Invasive Mold Infections in Solid Organ Transplant Recipients

    PubMed Central

    Crabol, Yoann; Lortholary, Olivier

    2014-01-01

    Invasive mold infections represent an increasing source of morbidity and mortality in solid organ transplant recipients. Whereas there is a large literature regarding invasive molds infections in hematopoietic stem cell transplants, data in solid organ transplants are scarcer. In this comprehensive review, we focused on invasive mold infection in the specific population of solid organ transplant. We highlighted epidemiology and specific risk factors for these infections and we assessed the main clinical and imaging findings by fungi and by type of solid organ transplant. Finally, we attempted to summarize the diagnostic strategy for detection of these fungi and tried to give an overview of the current prophylaxis treatments and outcomes of these infections in solid organ transplant recipients. PMID:25525551

  3. Proteases in cellular slime mold development: evidence for their involvement.

    PubMed Central

    Fong, D; Bonner, J T

    1979-01-01

    Protein degradation appears to be essential for normal differentiation in the cellular slime mold Dictyostelium discoideum. Several protease inhibitors block normal differentiation, and in most cases this inhibition can be reversed by addition of amino acids. For example, chloroquine, which inhibits slime mold cathepsin B activity, interferred with development by blocking sorocarp formation, and this inhibition was reversed by the addition of amino acids. Tosyllysyl chloromethyl ketone also blocked development, and this inhibition was reversed by simultaneous additions of amino acids and glutathione. Moreover, the addition of antipain and leupeptin delayed sorocarp formation. These results, together with the finding reported earlier that cathepsin B activity is differentially localized in the prestalk-prespore zones of the migrating slugs, suggest that proteolysis might play a regulatory role in cellular slime mold differentiation. Images PMID:293735

  4. Applications of thin carbon coatings and films in injection molding

    NASA Astrophysics Data System (ADS)

    Cabrera, Eusebio Duarte

    In this research, the technical feasibility of two novel applications of thin carbon coatings is demonstrated. The first application consists of using thin carbon coatings on molds for molding ultra-thin plastic parts (<0.5 mm thickness) with lower pressures by promoting wall slip. The second application consists of a new approach to provide electromagnetic interference (EMI) shielding for plastic parts using in mold coated nanoparticle thin films or nanopapers to create a conductive top layer. During this research, the technical feasibility of a new approach was proven which provides injection molding of ultra-thin parts at lower pressures, without the need of fast heating/fast cooling or other expensive mold modification. An in-house developed procedure by other members of our group, was employed for coating the mold surface using chemical vapor deposition (CVD) resulting in a graphene coating with carbide bonding to the mold surface. The coating resulted in a significant decrease of surface friction and consequently easiness of flow when compared to their uncoated counterparts. Thermoplastic polymers and their composites are a very attractive alternative but are hindered by the non-conductive nature of polymers. There are two general approaches used to date to achieve EMI shielding for plastic products. One is to spray a conductive metal coating onto the plastic surface forming a layer that must maintain its shielding effectiveness (SE), and its adhesion to the plastic throughout the expected life of the product. However, metal coatings add undesirable weight and tend to corrode over time. Furthermore, scratching the coating may create shielding failure; therefore, a protective topcoat may be required. The other approach is to use polymer composites filled with conductive fillers such as carbon black (CB), carbon nanofiber (CNF), and carbon nanotube (CNT). While conductive fillers may increase the electrical conductivity of polymer composites, the loading of

  5. Decontamination formulation with additive for enhanced mold remediation

    DOEpatents

    Tucker, Mark D.; Irvine, Kevin; Berger, Paul; Comstock, Robert

    2010-02-16

    Decontamination formulations with an additive for enhancing mold remediation. The formulations include a solubilizing agent (e.g., a cationic surfactant), a reactive compound (e.g., hydrogen peroxide), a carbonate or bicarbonate salt, a water-soluble bleaching activator (e.g., propylene glycol diacetate or glycerol diacetate), a mold remediation enhancer containing Fe or Mn, and water. The concentration of Fe.sup.2+ or Mn.sup.2+ ions in the aqueous mixture is in the range of about 0.0001% to about 0.001%. The enhanced formulations can be delivered, for example, as a foam, spray, liquid, fog, mist, or aerosol for neutralization of chemical compounds, and for killing certain biological compounds or agents and mold spores, on contaminated surfaces and materials.

  6. Use of the smart tongue to monitor mold growth and discriminate between four mold species grown in liquid media.

    PubMed

    Zhao, Guangying; Lin, Xiaona; Dou, Wenchao; Tian, Shiyi; Deng, Shaoping; Shi, Jinqin

    2011-04-01

    A novel voltammetric electronic tongue, smart tongue, was employed to monitor the growth of mold and to differentiate between four types of mold grown in liquid medium. Principal component analysis (PCA) was used to extract the relevant information obtained by the smart tongue. Reference growth curves were based on measurements of dry weight and pH. The growth detected by the smart tongue was basically consistent with that observed by the measurement of dry weight and pH. The optimal combinations of electrodes and frequencies for monitoring growth were as follows: for Aspergillus, both the Pt and Au electrodes at 1 Hz, 10 Hz and 100 Hz; for Penicillium, the Pt and W electrodes at 100 Hz; for Mucor, the Pt, Pd and W electrodes at the three frequency segments; for Rhizopus, the Pd, Ti and Ag electrodes at the three frequency segments. The Ag electrode at 10 Hz or 100 Hz frequency could differentiate well between the four types of mold for culturing 6 h in the liquid media. Therefore, the smart tongue has a promising future as a modern rapid analytical technology for the real time detection of the growth of mold and for the classification model of mold.

  7. Permanent Mold Casting of JIS-AC4C Aluminum Alloy Using a Low-Temperature Mold

    SciTech Connect

    Yamagata, Hiroshi; Nikawa, Makoto

    2011-01-17

    Permanent mold casting using mold temperatures below 200 deg. C was conducted to obtain a high-strength, thin-walled casting. Al-7.36 mass% Si -0.18 Cu- 0.27Mg-0.34Fe alloy JIS-AC4C was cast using a bottom pouring cast plan. The product had a rectangular tube shape (70 mm W x 68 mm D x 180 mm H) with wall thicknesses of 1, 3 and 5 mm. The effect of heat insulation at the melt path was compared when using a sand runner insert and when using a steel runner insert as well as a powder mold release agent. Fine microstructures were observed in the casting. The smaller the thickness, the higher the hardness with smaller secondary dendrite arm spacing (SDAS). However, the hardness and the SDAS were unaffected by the mold temperature. It was proposed that the avoidance of the formation of primary {alpha} dendrite at the melt path generates a higher strength casting with adequate mold filling.

  8. Molecular orientation distributions during injection molding of liquid crystalline polymers: Ex situ investigation of partially filled moldings

    SciTech Connect

    Fang, Jun; Burghardt, Wesley R.; Bubeck, Robert A.

    2013-01-10

    The development of molecular orientation in thermotropic liquid crystalline polymers (TLCPs) during injection molding has been investigated using two-dimensional wide-angle X-ray scattering coordinated with numerical computations employing the Larson-Doi polydomain model. Orientation distributions were measured in 'short shot' moldings to characterize structural evolution prior to completion of mold filling, in both thin and thick rectangular plaques. Distinct orientation patterns are observed near the filling front. In particular, strong extension at the melt front results in nearly transverse molecular alignment. Far away from the flow front shear competes with extension to produce complex spatial distributions of orientation. The relative influence of shear is stronger in the thin plaque, producing orientation along the filling direction. Exploiting an analogy between the Larson-Doi model and a fiber orientation model, we test the ability of process simulation tools to predict TLCP orientation distributions during molding. Substantial discrepancies between model predictions and experimental measurements are found near the flow front in partially filled short shots, attributed to the limits of the Hele-Shaw approximation used in the computations. Much of the flow front effect is however 'washed out' by subsequent shear flow as mold filling progresses, leading to improved agreement between experiment and corresponding numerical predictions.

  9. 240 Mold Sensitization in Chronic Rhinosinusitis Patients

    PubMed Central

    Gawlik, Radoslaw; Czecior, Eugeniusz

    2012-01-01

    Background It is estimated that about 10% of the population have IgE antibodies to common inhalant molds. Exposure to fungal allergens could be linked to the presence and persistence of asthma, rhinitis and atopic dermatitis. Mold sensitization is a risk factor for development and deterioration of upper airway allergy, especially chronic rhinosinusitis. We addressed the incidence of mold allergy measured as specific IgE to molds and skin prick tests in chronic sinusitis patients. We assessed prevalence of allergic reactions to mould among surgery treated chronic sinusitis patients. Methods A group of 28 chronic sinusitis patients after surgery were included into the study. Routine medical examination, skin prick tests with common inhaled allergens and extended mold panel (Alternaria alternate, Cladosporium herbarium, Aspergilus fumigatus, Candida albicans, Mucor mucedo, Botrytis cinerea, Rhisopus nigricans, Penicilliumi notatum, Fusarum moniliforme Pullularia pullulans (Allergopharma, Germany), tIgE, asIgE measurement were performed (Phadia, Sweden). All investigated patients were consulted by laryngologist and mycological examination was performed. Results We found that sensitization to at least one allergen was present in 43.8(14/32) of sinusitis patients. The most prevalent was sensitization to house dust mite Dermatophagoides pt., found in 21.8 % (7/32) patients. Positive results of skin prick tests with Candida albicans we observed in 18.8% (6/32), with Alternaria alternate in 15,6% (5/32), Cladosporium herbarium in 6,3% (2/32), Aspergilus fumigatus in 3,13 % (1/32). None of investigated patients presented sensitization to other mold allergens. Microbiological methods demonstrated fungal infection only in 2 patients. Conclusions Almost half of chronic sinusitis patients presented sensitization to at least one allergen. Fungal allergy is relatively rare in chronic sinusitis patients.

  10. Infant Origins of Childhood Asthma Associated with Specific Molds

    PubMed Central

    Reponen, Tiina; Lockey, James; Bernstein, David I.; Vesper, Stephen J.; Levin, Linda; Khurana Hershey, Gurjit K.; Zheng, Shu; Ryan, Patrick; Grinshpun, Sergey A.; Villareal, Manuel; LeMasters, Grace

    2012-01-01

    Background The specific cause(s) of asthma development must be identified in order to prevent this disease. Objective Our hypothesis was that specific mold exposures are associated with childhood asthma development. Methods Infants were identified from birth certificates. Dust samples were collected from 289 homes when the infants were age eight months. Samples were analyzed for concentrations of 36 molds that comprise the Environmental Relative Moldiness Index (ERMI) and endotoxin, house dust mite, cat, dog, and cockroach allergens. Children were evaluated at age seven for asthma based on reported symptoms and objective measures of lung function. Host, environmental exposures and home characteristics evaluated included history of parental asthma, race, gender, upper and lower respiratory symptoms, season of birth, family income, cigarette smoke exposure, air conditioning, dehumidifier, carpeting, age of home, and visible mold at age one and child positive skin prick test (SPT) to aeroallergens and molds at age seven. Results Asthma was diagnosed in 24% of the children at age seven. A statistically significant increase in asthma risk at age seven was associated with high ERMI levels in the child’s home in infancy (adjusted risk ratio (aRR) for a 10-unit increase in ERMI = 1.8, 95% CI=1.5, 2.2). The summation of levels of three mold species, Aspergillus ochraceus, Aspergillus unguis, and Penicillium variabile was significantly associated with asthma (aRR = 2.2, 95% CI=1.8, 2.7). Conclusion In this birth cohort study, exposure during infancy to three mold species common to water-damaged buildings was associated with childhood asthma at age seven. PMID:22789397

  11. FIBER ORIENTATION IN INJECTION MOLDED LONG CARBON FIBER THERMOPLASTIC COMPOSITES

    SciTech Connect

    Wang, Jin; Nguyen, Ba Nghiep; Mathur, Raj N.; Sharma, Bhisham; Sangid, Michael D.; Costa, Franco; Jin, Xiaoshi; Tucker III, Charles L.; Fifield, Leonard S.

    2015-03-23

    A set of edge-gated and center-gated plaques were injection molded with long carbon fiber-reinforced thermoplastic composites, and the fiber orientation was measured at different locations of the plaques. Autodesk Simulation Moldflow Insight (ASMI) software was used to simulate the injection molding of these plaques and to predict the fiber orientation, using the anisotropic rotary diffusion and the reduced strain closure models. The phenomenological parameters of the orientation models were carefully identified by fitting to the measured orientation data. The fiber orientation predictions show very good agreement with the experimental data.

  12. Fabrication of ceramic components using mold shape deposition manufacturing

    NASA Astrophysics Data System (ADS)

    Cooper, Alexander G.

    Mold Shape Deposition Manufacturing (Mold SDM) is a new process for the fabrication of geometrically complex, structural ceramic components. This thesis describes the development of the Mold SDM process, including process steps, materials selection, planning strategies and automation. Initial characterization results are presented and these are used to compare the process to competing manufacturing processes. A range of current and potential applications for ceramic, as well as metal and polymer parts are discussed. The benefits and limitations of ceramic materials for structural applications are discussed to motivate the need for a manufacturing process capable of rapidly producing high quality, geometrically complex, structural ceramic components. The Mold SDM process was developed to address this need. Mold SDM is based on Shape Deposition Manufacturing (SDM) and uses SDM techniques to build fugitive wax molds which can then be used to build ceramic parts by gelcasting. SDM is an additive-subtractive layered manufacturing process which allows it to build geometrically complex parts. The subtraction step differentiates Mold SDM from other layered manufacturing processes and allows accurate, high quality surfaces to be produced. The performance of the process was increased by identifying the key material properties and then selecting improved materials combinations. Candidate materials were evaluated in terms of machinability, shrinkage, heat resistance and chemical compatibility. A number of preferred materials combinations were developed and used to produce ceramic, metal and polymer parts. A number of new process planning strategies and build techniques were developed. The manufacturability analysis determines whether a part is manufacturable and the orientation selection guidelines help in the selection of optimum build directions. New decomposition techniques take advantage of process capabilities to improve part quality and build rate. Initial process

  13. Improved Probe for Evaluating Compaction of Mold Sand

    NASA Technical Reports Server (NTRS)

    Overfelt, Ruel A.; Bakhtiyarov, Sayavur I.

    2008-01-01

    A nominally stationary tubular probe denoted a telescopic probe has been developed as an improved alternative to a prior movable probe used to evaluate the local degree of compaction of mold sand. The probe is inserted vertically to a desired depth in a sand-filled molding flask and the back pressure at the given rate of flow of air is recorded as a measure of the degree of partial impermeability and, hence, of the degree of compaction of sand in the vicinity of the probe tip.

  14. Biological Control of Olive Green Mold in Agaricus bisporus Cultivation.

    PubMed

    Tautorus, T E; Townsley, P M

    1983-02-01

    Successful methods to control the damaging weed mold Chaetomium olivaceum (olive green mold) in mushroom beds are not presently known. An attempt was made to control C. olivaceum by biological means. A thermophilic Bacillus sp. which showed dramatic activity against C. olivaceum on Trypticase soy agar (BBL Microbiology Systems)-0.4% yeast extract agar plates was isolated from commercial mushroom compost (phase I). When inoculated into conventional and hydroponic mushroom beds, the bacillus not only provided a significant degree of protection from C. olivaceum, but also increased yields of Agaricus bisporus.

  15. Terahertz lenses made by compression molding of micropowders.

    PubMed

    Scherger, Benedikt; Scheller, Maik; Jansen, Christian; Koch, Martin; Wiesauer, Karin

    2011-05-20

    We present a simple and versatile approach for fabricating terahertz lenses based on compression molding of micropowder polymer materials in a tabletop hydraulic press. To demonstrate the feasibility of this approach, a biconvex lens shape is calculated using a ray-tracing algorithm and lenses based on two different micropowders are fabricated. As the powder materials have different refractive indices, the resulting lenses share the same geometric shape but differ in their respective focal length. The focusing properties of the lenses are evaluated by transversal and sagittal beam profile measurements in a fiber-coupled terahertz time-domain spectroscopy system, confirming the excellent imaging qualities of the compression molded lenses.

  16. The study and fabrication of DLC micropattern on roll mold

    NASA Astrophysics Data System (ADS)

    Kwon, Young Woo; Lee, Tae Dong; Park, Yeong Min; Cho, Hyun; Kim, Jin Kon; Kim, Tae Gyu

    2015-03-01

    Diamond-like carbon (DLC) coating is becoming a promising protective coating layers due to its superior properties. In this study, instead of protective coating, DLC film was applied as the only component for micropattern then etched with lithography and lift-off process selectively. Furthermore, DLC film has been fabricated on aluminum roll mold. Then UV curing resin was applied to form the pattern on the polyethylene terephthalate (PET) film. The dimension and formation of the DLC micropattern on roll mold were analyzed. Moreover, the Raman spectroscopic of nitrogen-doped DLC film was analyzed.

  17. Curing rate and flowing properties of silicone rubber at injection molding

    SciTech Connect

    Yoshino, M.; Nakamura, T. )

    1992-04-01

    Generally, silicone rubbers are mold-cured after mixing the rubber and peroxide curing agent with a two-roll mill or a kneader. Typically this is done at pressures of 5 MPa to 10 MPa and at temperatures between 120 to 200 C. Compression molding, transfer molding and injection molding are common molding ways for silicone rubbers. Recently, injection molding techniques are developing rapidly that have the advantages of molding automatically with high cycle mechanisms. To reduce the molding time and to make a precision part, both the flowing and curing properties of a particular rubber compound will be important. In this article, correlations between the curing and the flowing properties of silicone rubber are investigated by using the Rheovulkameter device.

  18. Polymer microlens array integrated with imaging sensors by UV-molding technique

    NASA Astrophysics Data System (ADS)

    Lai, Jianjun; Zhao, Yue; Ke, Caijun; Yi, Xinjian; Zhang, TianXu

    2005-01-01

    Fabrication of Polymer microlens array based on UV-molding techniques is presented. UV-molding enables for the integration of polymer microlens array on top of arbitrary substrates like glass, silicon other polymeric films. In this technique, photoresist or glass mold is first fabricated by conventional photolithnic method and subsequently served as transparent replication tool. UV curable polymer resin is then coated on patterned or unpatterned substrates and a contact mask aligner is used to align substrates and replication mold tool and then make the mold immersed into the resin. Replication of polymer on substrates is achieved by UV photopolymerisation of the resin. Resin thickness and gap distance between mold and substrate are carefully controlled in order to obtain acceptable thickness of cured polymer base. The UV molding technique was used to molding of a polymer film carring microlens array on the surface of an experimental CCD imaging sensor chip in this paper to enhance its fill factor and sensitivity.

  19. Farmer's Lung: Causes and Symptoms of Mold and Dust Induced Respiratory Illness

    MedlinePlus

    ... Educational Resources Farmer's Lung: Causes and Symptoms of Mold and Dust Induced Respiratory Illness ID 442-602 ( ... noninfectious allergic disease that is caused by inhaling mold spores in the dust from moldy hay, straw, ...

  20. The presence of fungi associated with sick building syndrome in North American zoological institutions.

    PubMed

    Wilson, S C; Straus, D C

    2002-12-01

    A total of 110 sites from five zoological institutions were examined to determine whether fungi associated with sick building syndrome (SBS) were prevalent in the exhibits or night-time holding facilities and to investigate whether the presence of these organisms was associated with declining breeding rates or increases in morbidity and mortality (or both). Each site was sampled with an Andersen two-stage air sampler using Sabourauds dextrose agar media and a Burkard personal volumetric air sampler. Suspect surfaces were also sampled. High levels of airborne Penicillium chrysogenum, a fungal species associated with poor indoor air quality, were recovered from 16 sites out of all five institutions. Five culturable growth sites of Stachybotrys chartarum, a species strongly associated with SBS and commonly known as "black mold," were recovered from surfaces at two institutions. A wide range of other fungal species was recovered in low numbers from all institutions. A Fisher exact test analysis showed a significant nonrandom association between high levels of P. chrysogenum and sites with records of poor animal health. This study indicated that significant numbers of airborne fungi associated with SBS and poor indoor air quality are present in zoological institutions and that they could affect animal health and reproduction rates and zoo staff.

  1. Application of statistical methods for analyzing the relationship between casting distortion, mold filling, and interfacial heat transfer in sand molds

    SciTech Connect

    Y. A. Owusu

    1999-03-31

    This report presents a statistical method of evaluating geometric tolerances of casting products using point cloud data generated by coordinate measuring machine (CMM) process. The focus of this report is to present a statistical-based approach to evaluate the differences in dimensional and form variations or tolerances of casting products as affected by casting gating system, molding material, casting thickness, and casting orientation at the mold-metal interface. Form parameters such as flatness, parallelism, and other geometric profiles such as angularity, casting length, and height of casting products were obtained and analyzed from CMM point cloud data. In order to relate the dimensional and form errors to the factors under consideration such as flatness and parallelism, a factorial analysis of variance and statistical test means methods were performed to identify the factors that contributed to the casting distortion at the mold-metal interface.

  2. Effect of Cross Sectional Geometry on PDMS Micro Peristaltic Pump Performance: Comparison of SU-8 Replica Molding vs. Micro Injection Molding

    PubMed Central

    Graf, Neil J.

    2013-01-01

    Two different fabrication methods were employed to fabricate micropumps with different cross-sectional channel geometries. The first was to fabricate rectangular cross-sectional microchannel geometries using the well known fabrication method of replica molding (REM).1 The second, and far less utilized fabrication technique, was to create microchannel molds using an in-house fabricated handheld micro injection molding apparatus. The injection mold apparatus was designed for use with elastomeric room temperature vulcanization (RTV) polymers, as opposed to most other injection molding machines, which are designed for use with thermoplastic polymers. The injection mold’s bottom plate was used as a microchannel molding template. The molding template was created by threading a small-diameter wire (150 μm or less) through the injection mold’s bottom plate, with subsequent adhesion and smoothing of a thin piece of aluminum foil over the wire-raised injection mold template. When molded against, the template produced a rounded/Gaussian-shaped PDMS microchannel. The design of the injection mold will be presented, along with a direct comparison for micropump performance metrics such as flow rate, valving characteristics, and maximum backpressures attainable for each of the respective micropump channel geometries. PMID:23917263

  3. Injection molding of thermoplastic elastomers for microstructured substrates

    NASA Astrophysics Data System (ADS)

    Birkar, Smita

    Amorphous and semi-crystalline thermoplastic polymers have been widely investigated for injection molding of parts with microstructured surfaces. Microstructured surfaces injection molded from thermoplastic elastomers have emerging applications as superhydrobic surfaces and patterned adhesives, but there is a limited understanding of the factors affecting replication with these materials. This research was a continued investigation of block copolymer thermoplastic elastomers as well as the first in-depth examination of thermoplastic vulcanizates for injection molding microfeatures. The first focus of this research was the interactions between tooling aspect ratio and feature orientation (negative and positive tooling) and thermoplastic elastomer hard segment content on microfeature replication. Electroformed nickel tooling having positive and negative features with different geometries and aspect ratios of 0.02:1 to 2:1 were molded from three copolyester thermoplastic elastomers with similar chemistry and different hardness values. The tooling and part features were characterized for feature depth and height as well as feature definition using scanning electron microscopy and optical profilometry. Results were correlated with elastomer properties. In the second parts of this research, the effects of microfeature spacing on the replication of thermoplastic elastomer features was investigated using micropillars with two diameters (10 and 20 mum) and three spacing ratios (0.5:1, 1:1, and 2:1). The tooling and part features were characterized for feature depth and height as well as feature definition using scanning electron microscopy and optical profilometry. Feature spacing significantly affected the replication of micropillars using a thermoplastic elastomer. This replication was competition between cooling and pressurization of the melt. Wider spacing between smaller features allowed cooling in the tooling lands to dominate the feature filling. Higher pressures did

  4. The effect of mold materials on the overlay accuracy of a roll-to-roll imprinting system using UV LED illumination within a transparent mold

    NASA Astrophysics Data System (ADS)

    Choi, Sungwoo; Kook, YunHo; Kim, ChulHo; Yoo, SoonSung; Park, Kwon-Shik; Kim, Seok-min; Kang, Shinill

    2016-06-01

    Although several studies on the roll-to-roll (R2R) imprinting process have reported achieving flexible electronics, improving the alignment accuracy in the overlay process of R2R imprinting is recognized as the biggest problem for the commercialization of this technology. For an overlay technique with high alignment accuracy, it is essential to develop a roll mold with high positional accuracy. In this study, a method for fabricating a roll mold with high positional accuracy is proposed by wrapping a thin glass substrate flexible mold around the transparent roll base, because it can provide higher mechanical strength and thermal stability than a conventional polymer substrate. To confirm the usability of the proposed process, the prepared roll mold was used to fabricate a test pattern of thin-film transistor backplane for a rollable display. The positional and overlay accuracy of the roll mold with the proposed thin glass substrate flexible mold were compared with the roll mold with a conventional polymer substrate flexible mold. Large-area transparent flexible molds with a size of 470  ×  370 mm were fabricated by an ultraviolet (UV) imprinting process on thin glass and polyethylene terephthalate substrates, and these flexible molds were wrapped around a roll base of 125 mm radius through a precision alignment process. After an anti-adhesion treatment and the wrapping process, the roll mold with the polymer substrate showed a ~180 μm positional error, whereas the thin glass substrate showed a ~30 μm positional error. After the overlay process using the R2R imprinting system with the alignment system, an average overlay error of ~3 μm was obtained when the thin glass flexible wrapped roll mold was used, whereas a ~22 μm overlay error was obtained when the polymer substrate flexible wrapped roll mold was used.

  5. Injection molding of iPP samples in controlled conditions and resulting morphology

    SciTech Connect

    Sessa, Nino De Santis, Felice Pantani, Roberto

    2015-12-17

    Injection molded parts are driven down in size and weight especially for electronic applications. In this work, an investigation was carried out on the process of injection molding of thin iPP samples and on the morphology of these parts. Melt flow in the mold cavity was analyzed and described with a mathematical model. Influence of mold temperature and injection pressure was analyzed. Samples orientation was studied using optical microscopy.

  6. Injection molding of iPP samples in controlled conditions and resulting morphology

    NASA Astrophysics Data System (ADS)

    Sessa, Nino; De Santis, Felice; Pantani, Roberto

    2015-12-01

    Injection molded parts are driven down in size and weight especially for electronic applications. In this work, an investigation was carried out on the process of injection molding of thin iPP samples and on the morphology of these parts. Melt flow in the mold cavity was analyzed and described with a mathematical model. Influence of mold temperature and injection pressure was analyzed. Samples orientation was studied using optical microscopy.

  7. Mold Species in Dust from the International Space Station Identified and Quantified by Mold Specific Quantitative PCR

    NASA Technical Reports Server (NTRS)

    Vesper, Stephen J.; Wong, Wing; Kuo, C. Mike; Pierson, Duane L.

    2008-01-01

    Dust was collected over a period of several weeks in 2007 from various HEPA filters in the U.S. Laboratory Module of the International Space Station (ISS). The dust was returned on the Space Shuttle Atlantis, mixed, sieved, and the DNA was extracted. Using a DNA-based method called mold specific quantitative PCR (MSQPCR), 39 molds were measured in the dust. Opportunistic pathogens Aspergillus flavus and A. niger and toxin producers Penicillium chrysogenum and P. brevicompactum were found at relatively high concentrations (compared to U.S. homes). No cells of the opportunistic pathogens A. fumigatus, A. terreus, Fusarium solani or Candida albicans were detected.

  8. Mold species in dust from the International Space Station identified and quantified by mold-specific quantitative PCR.

    PubMed

    Vesper, Stephen J; Wong, Wing; Kuo, C Mike; Pierson, Duane L

    2008-01-01

    Dust was collected over a period of several weeks in 2007 from HEPA filters in the U.S. Laboratory Module of the International Space Station (ISS). The dust was returned on the Space Shuttle Atlantis, mixed, sieved and the DNA was extracted. Using a DNA-based method called mold-specific quantitative PCR (MSQPCR), 39 molds were measured in the dust. Potential opportunistic pathogens Aspergillus flavus and Aspergillus niger and potential moderate toxin producers Penicillium chrysogenum and Penicillium brevicompactum were noteworthy. No cells of the potential opportunistic pathogens Aspergillus fumigatus, Aspergillus terreus, Fusarium solani or Candida albicans were detected.

  9. 75 FR 55340 - Recovery Fact Sheet 9580.100, Mold Remediation

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-10

    ... SECURITY Federal Emergency Management Agency Recovery Fact Sheet 9580.100, Mold Remediation AGENCY: Federal... Emergency Management Agency (FEMA) is accepting comments on Recovery Fact Sheet RP9580.100, Mold Remediation... The Recovery Fact Sheet RP9580.100, Mold Remediation, identifies the expenses related to...

  10. CROSS REACTIVITY IN ALLERGIC ASTHMA-LIKE RESPONSES BETWEEN MOLD AND HOUSE DUST MITE IN MICE

    EPA Science Inventory

    Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases including allergic asthma. Some mold allergens have been implicated as the causal agent for allergic asthma. Western blot analysis demonstrated IgE-binding cross-reactivity among m...

  11. Epoxy-resin patterns speed shell-molding of aluminum parts

    NASA Technical Reports Server (NTRS)

    1965-01-01

    Half patterns cast from commercial epoxy resin containing aluminum powder are used for shell-molding of aluminum parts. The half patterns are cast in plastic molds of the original wooden pattern. Ten serviceable sand resin molds are made from each epoxy pattern.

  12. Differential allergy induction by molds found in water-damaged homes**

    EPA Science Inventory

    Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases including allergic lung diseases. The Institute of Medicine reports (NAS, 2004) and World Health Organization guidelines (WHO, 2009) concluded that the role of molds in asthma indu...

  13. 17. Interior, molded plaster cornice and overdoor decoration found in ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. Interior, molded plaster cornice and overdoor decoration found in a closet on the first floor. May have been part of a dining room at the turn of the century. - Trenton House Hotel, 20-24 North Warren Street & 1-19 East Hanover Street, Trenton, Mercer County, NJ

  14. RESEARCH AND DEVELOPMENT OF RISK MANAGEMENT ALTERNATIVES FOR CONTROLLING MOLD

    EPA Science Inventory

    EPA has, since 1995, conducted research into controlling biological contamination in the indoor environment. Six areas of research have been addressed: 1. a search for alternatives to prevent and control growth of mold by quantifying the effects of moisture, relative humidity and...

  15. Modified Silicone-Rubber Tooling For Molding Composite Parts

    NASA Technical Reports Server (NTRS)

    Baucom, Robert M.; Snoha, John J.; Weiser, Erik S.

    1995-01-01

    Reduced-thermal-expansion, reduced-bulk-modulus silicone rubber for use in mold tooling made by incorporating silica powder into silicone rubber. Pressure exerted by thermal expansion reduced even further by allowing air bubbles to remain in silicone rubber instead of deaerating it. Bubbles reduce bulk modulus of material.

  16. Air sampling of mold spores by slit impactors: yield comparison.

    PubMed

    Pityn, Peter J; Anderson, James

    2013-01-01

    The performance of simple slit impactors for air sampling of mold contamination was compared under field conditions. Samples were collected side-by-side, outdoors in quadruplicates with Burkhard (ambient sampler) and Allergenco MK3 spore traps and with two identical Allergenco slit cassettes operated at diverse flow rates of 5 and 15 L/min, respectively. The number and types of mold spores in each sample were quantified by microscopy. Results showed all four single-stage slit impactors produced similar spore yields. Moreover, paired slit cassettes produced similar outcomes despite a three-fold difference in their sampling rate. No measurable difference in the amount or mix of mold spores per m(3)of air was detected. The implications for assessment of human exposures and interpretation of indoor/outdoor fungal burden are discussed. These findings demonstrate that slit cassettes capture most small spores, effectively and without bias, when operated at a range of flow rates including the lower flow rates used for personal sampling. Our findings indicate sampling data for mold spores correlate for different single stage impactor collection methodologies and that data quality is not deteriorated by operating conditions deviating from manufacturers' norms allowing such sampling results to be used for scientific, legal, investigative, or property insurance purposes. The same conclusion may not be applied to other particle sampling instruments and mulit-stage impactors used for ambient particulate sampling, which represent an entirely different scenario. This knowledge may help facilitate comparison between scientific studies where methodological differences exist.

  17. Development of resins for composites by resin transfer molding

    NASA Technical Reports Server (NTRS)

    Woo, Edmund P.; Puckett, Paul M.; Maynard, Shawn J.

    1991-01-01

    Designed to cover a wide range of resin technology and to meet the near-term and long-term needs of the aircraft industry, this research has three objectives: to produce resin transfer molding (RES) resins with improved processability, to produce prepreg systems with high toughness and service temperature, and to produce new resin systems. Progress on reaching the objectives is reported.

  18. Screening Tools to Estimate Mold Burdens in Homes

    EPA Science Inventory

    Objective: The objective of this study was to develop screening tools that could be used to estimate the mold burden in a home which would indicate whether more detailed testing might be useful. Methods: Previously, in the American Healthy Home Survey, a DNA-based method of an...

  19. Detecting Mold in School Buildings: An Exercise in Biodiversity

    ERIC Educational Resources Information Center

    Farone, Anthony L.

    2005-01-01

    A project was designed to introduce students to fungi in which students surveyed their school buildings for different types of mold. The students were able to make connections between structure and function of the fungal components and learn how these different components enhance survival in the environment.

  20. UVC Sheds New Light on School Mold Problems.

    ERIC Educational Resources Information Center

    Freeman, James

    2002-01-01

    Describes how the LaPorte Independent School District in Texas turned to ultraviolent light devices installed within the HVAC system to combat mold and fungus after conventional approaches failed. Describes the additional benefits of energy savings from the system. (EV)