Matched Interface and Boundary Method for Elasticity Interface Problems

PubMed Central

Wang, Bao; Xia, Kelin; Wei, Guo-Wei

2015-01-01

Elasticity theory is an important component of continuum mechanics and has had widely spread applications in science and engineering. Material interfaces are ubiquity in nature and man-made devices, and often give rise to discontinuous coefficients in the governing elasticity equations. In this work, the matched interface and boundary (MIB) method is developed to address elasticity interface problems. Linear elasticity theory for both isotropic homogeneous and inhomogeneous media is employed. In our approach, Lamé’s parameters can have jumps across the interface and are allowed to be position dependent in modeling isotropic inhomogeneous material. Both strong discontinuity, i.e., discontinuous solution, and weak discontinuity, namely, discontinuous derivatives of the solution, are considered in the present study. In the proposed method, fictitious values are utilized so that the standard central finite different schemes can be employed regardless of the interface. Interface jump conditions are enforced on the interface, which in turn, accurately determines fictitious values. We design new MIB schemes to account for complex interface geometries. In particular, the cross derivatives in the elasticity equations are difficult to handle for complex interface geometries. We propose secondary fictitious values and construct geometry based interpolation schemes to overcome this difficulty. Numerous analytical examples are used to validate the accuracy, convergence and robustness of the present MIB method for elasticity interface problems with both small and large curvatures, strong and weak discontinuities, and constant and variable coefficients. Numerical tests indicate second order accuracy in both L∞ and L2 norms. PMID:25914439

Exchange-Induced Relaxation in the Presence of a Fictitious Field

PubMed Central

Sorce, Dennis J.; Mangia, Silvia; Liimatainen, Timo; Garwood, Michael; Michaeli, Shalom

2014-01-01

In the present study we derive a solution for two site fast exchange-induced relaxation in the presence of a fictitious magnetic field as generated by amplitude and frequency modulated RF pulses. This solution provides a means to analyze data obtained from relaxation experiments with the method called RAFFn (Relaxation Along a Fictitious Field of rank n), in which a fictitious field is created in a coordinate frame undergoing multi-fold rotation about n axes (rank n). The RAFF2 technique is relevant to MRI relaxation methods that provide good contrast enhancement for tumor detection. The relaxation equations for n = 2 are derived for the fast exchange regime using density matrix formalism. The method of derivation can be further extended to obtain solutions for n > 2. PMID:24911888

Numerical study of spherical Taylor-Couette flow

NASA Technical Reports Server (NTRS)

Yang, R.-J.

1989-01-01

A new technique to simulate Taylor vortices in a spherical gap between a rotating inner sphere and a stationary outer one has been developed and tested. Paths leading to zero-, one-, and two-vortex flows are designed heuristically. Fictitious symmetric boundaries near the equator are imposed, and the choice of the location of the fictitious boundaries is determined by either one- or two-vortex flow being stimulated. The imposition of one or two fictitious boundaries during the initial calculation generates the state suitable for one-or two-vortex flow to exist. After removing the fictitious boundaries, the flow settles down into its own attractor. Using this method, the three steady flow modes can be simulated by using a half domain. The technique can converge to desired flows very fast, and its results show excellent agreement with experimental ones.

Iterative optimizing quantization method for reconstructing three-dimensional images from a limited number of views

DOEpatents

Lee, Heung-Rae

1997-01-01

A three-dimensional image reconstruction method comprises treating the object of interest as a group of elements with a size that is determined by the resolution of the projection data, e.g., as determined by the size of each pixel. One of the projections is used as a reference projection. A fictitious object is arbitrarily defined that is constrained by such reference projection. The method modifies the known structure of the fictitious object by comparing and optimizing its four projections to those of the unknown structure of the real object and continues to iterate until the optimization is limited by the residual sum of background noise. The method is composed of several sub-processes that acquire four projections from the real data and the fictitious object: generate an arbitrary distribution to define the fictitious object, optimize the four projections, generate a new distribution for the fictitious object, and enhance the reconstructed image. The sub-process for the acquisition of the four projections from the input real data is simply the function of acquiring the four projections from the data of the transmitted intensity. The transmitted intensity represents the density distribution, that is, the distribution of absorption coefficients through the object.

Fictitious domain method for fully resolved reacting gas-solid flow simulation

NASA Astrophysics Data System (ADS)

Zhang, Longhui; Liu, Kai; You, Changfu

2015-10-01

Fully resolved simulation (FRS) for gas-solid multiphase flow considers solid objects as finite sized regions in flow fields and their behaviours are predicted by solving equations in both fluid and solid regions directly. Fixed mesh numerical methods, such as fictitious domain method, are preferred in solving FRS problems and have been widely researched. However, for reacting gas-solid flows no suitable fictitious domain numerical method has been developed. This work presents a new fictitious domain finite element method for FRS of reacting particulate flows. Low Mach number reacting flow governing equations are solved sequentially on a regular background mesh. Particles are immersed in the mesh and driven by their surface forces and torques integrated on immersed interfaces. Additional treatments on energy and surface reactions are developed. Several numerical test cases validated the method and a burning carbon particles array falling simulation proved the capability for solving moving reacting particle cluster problems.

Extraction of α-humulene-enriched oil from clove using ultrasound-assisted supercritical carbon dioxide extraction and studies of its fictitious solubility.

PubMed

Wei, Ming-Chi; Xiao, Jianbo; Yang, Yu-Chiao

2016-11-01

Clove buds are used as a spice and food flavoring. In this study, clove oil and α-humulene was extracted from cloves using supercritical carbon dioxide extraction with and without ultrasound assistance (USC-CO2 and SC-CO2, respectively) at different temperatures (32-50°C) and pressures (9.0-25.0MPa). The results of these extractions were compared with those of heat reflux extraction and steam distillation methods conducted in parallel. The extracts obtained using these four techniques were analyzed using gas chromatography and gas chromatography/mass spectrometry (GC/MS). The results demonstrated that the USC-CO2 extraction procedure may extract clove oil and α-humulene from clove buds with better yields and shorter extraction times than conventional extraction techniques while utilizing less severe operating parameters. Furthermore, the experimental fictitious solubility data obtained using the dynamic method were well correlated with density-based models, including the Chrastil model, the Bartle model and the Kumar and Johnston model. Copyright © 2016 Elsevier Ltd. All rights reserved.

Iterative optimizing quantization method for reconstructing three-dimensional images from a limited number of views

DOEpatents

Lee, H.R.

1997-11-18

A three-dimensional image reconstruction method comprises treating the object of interest as a group of elements with a size that is determined by the resolution of the projection data, e.g., as determined by the size of each pixel. One of the projections is used as a reference projection. A fictitious object is arbitrarily defined that is constrained by such reference projection. The method modifies the known structure of the fictitious object by comparing and optimizing its four projections to those of the unknown structure of the real object and continues to iterate until the optimization is limited by the residual sum of background noise. The method is composed of several sub-processes that acquire four projections from the real data and the fictitious object: generate an arbitrary distribution to define the fictitious object, optimize the four projections, generate a new distribution for the fictitious object, and enhance the reconstructed image. The sub-process for the acquisition of the four projections from the input real data is simply the function of acquiring the four projections from the data of the transmitted intensity. The transmitted intensity represents the density distribution, that is, the distribution of absorption coefficients through the object. 5 figs.

Effect of time dependence on probabilistic seismic-hazard maps and deaggregation for the central Apennines, Italy

USGS Publications Warehouse

Akinci, A.; Galadini, F.; Pantosti, D.; Petersen, M.; Malagnini, L.; Perkins, D.

2009-01-01

We produce probabilistic seismic-hazard assessments for the central Apennines, Italy, using time-dependent models that are characterized using a Brownian passage time recurrence model. Using aperiodicity parameters, ?? of 0.3, 0.5, and 0.7, we examine the sensitivity of the probabilistic ground motion and its deaggregation to these parameters. For the seismic source model we incorporate both smoothed historical seismicity over the area and geological information on faults. We use the maximum magnitude model for the fault sources together with a uniform probability of rupture along the fault (floating fault model) to model fictitious faults to account for earthquakes that cannot be correlated with known geologic structural segmentation.

Fictitious Science

ERIC Educational Resources Information Center

Foladori, Guillermo

2016-01-01

Science and Technology (S&T), like Research and Development (R&D), has become a case of capital investment like any other economic sector. This has distanced R&D from social needs, to the extent that part of R&D ends up actually being fictitious, in the sense that it acquires a price on the market but never becomes part of material…

78 FR 38240 - Authentication of Electronic Signatures on Electronically Filed Statements of Account

Federal Register 2010, 2011, 2012, 2013, 2014

2013-06-26

... up by any trick, scheme, or device a material fact; (2) makes any materially false, fictitious, or fraudulent statement or representation; or (3) makes or uses any false writing or document knowing the same to contain any materially false, fictitious, or fraudulent statement or entry; shall be fined under...

A novel CFS-PML boundary condition for transient electromagnetic simulation using a fictitious wave domain method

NASA Astrophysics Data System (ADS)

Hu, Yanpu; Egbert, Gary; Ji, Yanju; Fang, Guangyou

2017-01-01

In this study, we apply fictitious wave domain (FWD) methods, based on the correspondence principle for the wave and diffusion fields, to finite difference (FD) modeling of transient electromagnetic (TEM) diffusion problems for geophysical applications. A novel complex frequency shifted perfectly matched layer (PML) boundary condition is adapted to the FWD to truncate the computational domain, with the maximum electromagnetic wave propagation velocity in the FWD used to set the absorbing parameters for the boundary layers. Using domains of varying spatial extent we demonstrate that these boundary conditions offer significant improvements over simpler PML approaches, which can result in spurious reflections and large errors in the FWD solutions, especially for low frequencies and late times. In our development, resistive air layers are directly included in the FWD, allowing simulation of TEM responses in the presence of topography, as is commonly encountered in geophysical applications. We compare responses obtained by our new FD-FWD approach and with the spectral Lanczos decomposition method on 3-D resistivity models of varying complexity. The comparisons demonstrate that our absorbing boundary condition in FWD for the TEM diffusion problems works well even in complex high-contrast conductivity models.

Apparent volume dependence of 1/f noise in thin film structures: role of contacts.

PubMed

Barone, C; Pagano, S; Méchin, L; Routoure, J-M; Orgiani, P; Maritato, L

2008-05-01

The experimental investigation of low-frequency noise properties in new materials is very useful for the understanding of the involved physical transport mechanisms. In this paper it is shown that, when contact noise is present, the experimental values of the normalized Hooge parameter show a fictitious linear dependence on the volume of the analyzed samples. Experimental data on noise measurements of La0.7Sr0.3MnO3 thin films are reported to demonstrate the validity of the analysis performed.

A new fictitious domain approach for Stokes equation

NASA Astrophysics Data System (ADS)

Yang, Min

2017-10-01

The purpose of this paper is to present a new fictitious domain approach based on the Nietzsche’s method combining with a penalty method for the Stokes equation. This method allows for an easy and flexible handling of the geometrical aspects. Stability and a priori error estimate are proved. Finally, a numerical experiment is provided to verify the theoretical findings.

Density functional theory based molecular dynamics study of hydration and electronic properties of aqueous La(3+).

PubMed

Terrier, Cyril; Vitorge, Pierre; Gaigeot, Marie-Pierre; Spezia, Riccardo; Vuilleumier, Rodolphe

2010-07-28

Structural and electronic properties of La(3+) immersed in bulk water have been assessed by means of density functional theory (DFT)-based Car-Parrinello molecular dynamics (CPMD) simulations. Correct structural properties, i.e., La(III)-water distances and La(III) coordination number, can be obtained within the framework of Car-Parrinello simulations providing that both the La pseudopotential and conditions of the dynamics (fictitious mass and time step) are carefully set up. DFT-MD explicitly treats electronic densities and is shown here to provide a theoretical justification to the necessity of including polarization when studying highly charged cations such as lanthanoids(III) with classical MD. La(3+) was found to strongly polarize the water molecules located in the first shell, giving rise to dipole moments about 0.5 D larger than those of bulk water molecules. Finally, analyzing Kohn-Sham orbitals, we found La(3+) empty 4f orbitals extremely compact and to a great extent uncoupled from the water conduction band, while the 5d empty orbitals exhibit mixing with unoccupied states of water.

Analysis of phase transitions in spin-crossover compounds by using atom - phonon coupling model

NASA Astrophysics Data System (ADS)

Gîndulescu, A.; Rotaru, A.; Linares, J.; Dimian, M.; Nasser, J.

2011-01-01

The spin - crossover compounds (SCO) have become of great interest recently due to their potential applications in memories, sensors, switches, and display devices. These materials are particularly interesting because upon application of heat, light, pressure or other physical stimulus, they feature a phase transition between a low-spin (LS) diamagnetic ground state and a high-spin (HS) paramagnetic state, accompanied in some cases by color change. The phase transition can be discontinuous (with hysteresis), in two steps or gradual. Our analysis is performed by using the atom - phonon coupling (APC) model which considers that neighboring molecules are connected through a spring characterized by an elastic constant depending on molecules electronic state. By associating a fictitious spin to each molecule that has -1 and +1 eigenvalues corresponding to LS and HS levels respectively, an Ising type model can be developed for the analysis of metastable states and phase transitions in spin-crossover compounds. This contribution is aimed at providing a review of our recent results in this area, as well as novel aspects related to SCO compounds behavior at low temperature. In the framework of the APC model, we will discuss about the existence of metastable and unstable states, phase transitions and hysteresis phenomena, as well as their dependence on sample size.

Parallel Decomposition of the Fictitious Lagrangian Algorithm and its Accuracy for Molecular Dynamics Simulations of Semiconductors.

NASA Astrophysics Data System (ADS)

Yeh, Mei-Ling

We have performed a parallel decomposition of the fictitious Lagrangian method for molecular dynamics with tight-binding total energy expression into the hypercube computer. This is the first time in literature that the dynamical simulation of semiconducting systems containing more than 512 silicon atoms has become possible with the electrons treated as quantum particles. With the utilization of the Intel Paragon system, our timing analysis predicts that our code is expected to perform realistic simulations on very large systems consisting of thousands of atoms with time requirements of the order of tens of hours. Timing results and performance analysis of our parallel code are presented in terms of calculation time, communication time, and setup time. The accuracy of the fictitious Lagrangian method in molecular dynamics simulation is also investigated, especially the energy conservation of the total energy of ions. We find that the accuracy of the fictitious Lagrangian scheme in small silicon cluster and very large silicon system simulations is good for as long as the simulations proceed, even though we quench the electronic coordinates to the Born-Oppenheimer surface only in the beginning of the run. The kinetic energy of electrons does not increase as time goes on, and the energy conservation of the ionic subsystem remains very good. This means that, as far as the ionic subsystem is concerned, the electrons are on the average in the true quantum ground states. We also tie up some odds and ends regarding a few remaining questions about the fictitious Lagrangian method, such as the difference between the results obtained from the Gram-Schmidt and SHAKE method of orthonormalization, and differences between simulations where the electrons are quenched to the Born -Oppenheimer surface only once compared with periodic quenching.

Tunable fictitious substituent effects on the π-π interactions of substituted sandwich benzene dimers.

PubMed

Garcia, Amee M; Determan, John J; Janesko, Benjamin G

2014-05-08

Substituent effects on the π-π interactions of aromatic rings are a topic of much recent debate. Real substituents give a complicated combination of inductive, resonant, dispersion, and other effects. To help partition these effects, we present calculations on fictitious "pure" σ donor/acceptor substituents, hydrogen atoms with nuclear charges other than 1. "Pure" σ donors with nuclear charge <1 weaken π-π stacking in the sandwich benzene dimer. This result is consistent with the electrostatic model of Hunter and Sanders, and different from real substituents. Calculated inductive effects are largely additive and transferable, consistent with a local direct interaction model. A second series of fictitious substituents, neutral hydrogen atoms with an artificially broadened nuclear charge distribution, give similar trends though with reduced additivity. These results provide an alternative perspective on substituent effects in noncovalent interactions.

A semi-analytical method for near-trapped mode and fictitious frequencies of multiple scattering by an array of elliptical cylinders in water waves

NASA Astrophysics Data System (ADS)

Chen, Jeng-Tzong; Lee, Jia-Wei

2013-09-01

In this paper, we focus on the water wave scattering by an array of four elliptical cylinders. The null-field boundary integral equation method (BIEM) is used in conjunction with degenerate kernels and eigenfunctions expansion. The closed-form fundamental solution is expressed in terms of the degenerate kernel containing the Mathieu and the modified Mathieu functions in the elliptical coordinates. Boundary densities are represented by using the eigenfunction expansion. To avoid using the addition theorem to translate the Mathieu functions, the present approach can solve the water wave problem containing multiple elliptical cylinders in a semi-analytical manner by introducing the adaptive observer system. Regarding water wave problems, the phenomena of numerical instability of fictitious frequencies may appear when the BIEM/boundary element method (BEM) is used. Besides, the near-trapped mode for an array of four identical elliptical cylinders is observed in a special layout. Both physical (near-trapped mode) and mathematical (fictitious frequency) resonances simultaneously appear in the present paper for a water wave problem by an array of four identical elliptical cylinders. Two regularization techniques, the combined Helmholtz interior integral equation formulation (CHIEF) method and the Burton and Miller approach, are adopted to alleviate the numerical resonance due to fictitious frequency.

One Family's Journey: Medical Home and the Network of Supports It Offers Children and Youth with Special Health Care Needs. Part One

ERIC Educational Resources Information Center

MacDonald, Sarah; Gatto, Molly; Walker, Deb; Turchi, Renee

2007-01-01

This is the first article in a year long series that presents the experiences of a fictitious couple, Amita and Samir, as they learn to adapt to the reality of having a premature baby with special needs. Doris, the fictitious nurse who took care of baby Anjali in the neonatal intensive care unit (NICU), has had ten years of experience working in…

A parallel direct-forcing fictitious domain method for simulating microswimmers

NASA Astrophysics Data System (ADS)

Gao, Tong; Lin, Zhaowu

2017-11-01

We present a 3D parallel direct-forcing fictitious domain method for simulating swimming micro-organisms at small Reynolds numbers. We treat the motile micro-swimmers as spherical rigid particles using the ``Squirmer'' model. The particle dynamics are solved on the moving Larangian meshes that overlay upon a fixed Eulerian mesh for solving the fluid motion, and the momentum exchange between the two phases is resolved by distributing pseudo body-forces over the particle interior regions which constrain the background fictitious fluids to follow the particle movement. While the solid and fluid subproblems are solved separately, no inner-iterations are required to enforce numerical convergence. We demonstrate the accuracy and robustness of the method by comparing our results with the existing analytical and numerical studies for various cases of single particle dynamics and particle-particle interactions. We also perform a series of numerical explorations to obtain statistical and rheological measurements to characterize the dynamics and structures of Squirmer suspensions. NSF DMS 1619960.

An extension of the finite cell method using boolean operations

NASA Astrophysics Data System (ADS)

Abedian, Alireza; Düster, Alexander

2017-05-01

In the finite cell method, the fictitious domain approach is combined with high-order finite elements. The geometry of the problem is taken into account by integrating the finite cell formulation over the physical domain to obtain the corresponding stiffness matrix and load vector. In this contribution, an extension of the FCM is presented wherein both the physical and fictitious domain of an element are simultaneously evaluated during the integration. In the proposed extension of the finite cell method, the contribution of the stiffness matrix over the fictitious domain is subtracted from the cell, resulting in the desired stiffness matrix which reflects the contribution of the physical domain only. This method results in an exponential rate of convergence for porous domain problems with a smooth solution and accurate integration. In addition, it reduces the computational cost, especially when applying adaptive integration schemes based on the quadtree/octree. Based on 2D and 3D problems of linear elastostatics, numerical examples serve to demonstrate the efficiency and accuracy of the proposed method.

The effect of hippocampal damage in children on recalling the past and imagining new experiences.

PubMed

Cooper, Janine M; Vargha-Khadem, Faraneh; Gadian, David G; Maguire, Eleanor A

2011-06-01

Compared to adults, relatively little is known about autobiographical memory and the ability to imagine fictitious and future scenarios in school-aged children, despite the importance of these functions for development and subsequent independent living. Even less is understood about the effect of early hippocampal damage on children's memory and imagination abilities. To bridge this gap, we devised a novel naturalistic autobiographical memory task that enabled us to formally assess the memory for recent autobiographical experiences in healthy school-aged children. Contemporaneous with the autobiographical memories being formed, the children also imagined and described fictitious scenarios. Having established the performance of healthy school-aged children on these tasks, we proceeded to make comparisons with children (n=21) who had experienced neonatal hypoxia/ischaemia, and consequent bilateral hippocampal damage. Our results showed that healthy children could recall autobiographical events, including spatiotemporal information and specific episodic details. By contrast, children who had experienced neonatal hypoxia/ischaemia had impaired recall, with the specific details of episodes being lost. Despite this significant memory deficit they were able to construct fictitious scenarios. This is in clear contrast to adults with hippocampal damage, who typically have impaired autobiographical memory and deficits in the construction of fictitious and future scenarios. We speculate that the paediatric patients' relatively intact semantic memory and/or some functionality in their residual hippocampi may underpin their scene construction ability. Copyright © 2011 Elsevier Ltd. All rights reserved.

Ephemeral penalty functions for contact-impact dynamics

NASA Technical Reports Server (NTRS)

De La Fuente, Horacio M.; Felippa, Carlos A.

1991-01-01

The use of penalty functions to treat a class of structural contact-impact problems is investigated, with emphasis on ones in which the impact phenomena are primarily nondestructive in nature and in which only the gross characterization of the response is required. The dynamic equations of motion are integrated by the difference method. The penalty is represented as an ephemeral fictitious nonlinear spring that is inserted on anticipation of contact. The magnitude and variation of the penalty force is determined through energy balancing considerations. The 'bell shape' of the penalty force function for positive gap was found to be satisfactory, as it depends on only two parameters that can be directly assigned the physical meaning of force and distance. The determination of force law parameters by energy balance worked well. The incorporation of restitution coefficients by the area balancing method yielded excellent results, and no substantial modifications are anticipated. Extensional penalty springs are obviously sufficient for the simple examples treated.

Relaxation dispersion in MRI induced by fictitious magnetic fields.

PubMed

Liimatainen, Timo; Mangia, Silvia; Ling, Wen; Ellermann, Jutta; Sorce, Dennis J; Garwood, Michael; Michaeli, Shalom

2011-04-01

A new method entitled Relaxation Along a Fictitious Field (RAFF) was recently introduced for investigating relaxations in rotating frames of rank ≥ 2. RAFF generates a fictitious field (E) by applying frequency-swept pulses with sine and cosine amplitude and frequency modulation operating in a sub-adiabatic regime. In the present work, MRI contrast is created by varying the orientation of E, i.e. the angle ε between E and the z″ axis of the second rotating frame. When ε > 45°, the amplitude of the fictitious field E generated during RAFF is significantly larger than the RF field amplitude used for transmitting the sine/cosine pulses. Relaxation during RAFF was investigated using an invariant-trajectory approach and the Bloch-McConnell formalism. Dipole-dipole interactions between identical (like) spins and anisochronous exchange (e.g., exchange between spins with different chemical shifts) in the fast exchange regime were considered. Experimental verifications were performed in vivo in human and mouse brain. Theoretical and experimental results demonstrated that changes in ε induced a dispersion of the relaxation rate constants. The fastest relaxation was achieved at ε ≈ 56°, where the averaged contributions from transverse components during the pulse are maximal and the contribution from longitudinal components are minimal. RAFF relaxation dispersion was compared with the relaxation dispersion achieved with off-resonance spin lock T(₁ρ) experiments. As compared with the off-resonance spin lock T(₁ρ) method, a slower rotating frame relaxation rate was observed with RAFF, which under certain experimental conditions is desirable. Copyright © 2011 Elsevier Inc. All rights reserved.

Water's role in the force-induced unfolding of ubiquitin.

PubMed

Li, Jingyuan; Fernandez, Julio M; Berne, B J

2010-11-09

In atomic force spectroscopic studies of the elastomeric protein ubiquitin, the β-strands 1-5 serve as the force clamp. Simulations show how the rupture force in the force-induced unfolding depends on the kinetics of water molecule insertion into positions where they can eventually form hydrogen bonding bridges with the backbone hydrogen bonds in the force-clamp region. The intrusion of water into this region is slowed down by the hydrophobic shielding effect of carbonaceous groups on the surface residues of β-strands 1-5, which thereby regulates water insertion prior to hydrogen bond breakage. The experiments show that the unfolding of the mechanically stressed protein is nonexponential due to static disorder. Our simulations show that different numbers and/or locations of bridging water molecules give rise to a long-lived distribution of transition states and static disorder. We find that slowing down the translational (not rotational) motions of the water molecules by increasing the mass of their oxygen atoms, which leaves the force field and thereby the equilibrium structure of the solvent unchanged, increases the average rupture force; however, the early stages of the force versus time behavior are very similar for our "normal" and fictitious "heavy" water models. Finally, we construct six mutant systems to regulate the hydrophobic shielding effect of the surface residues in the force-clamp region. The mutations in the two termini of β-sheets 1-5 are found to determine a preference for different unfolding pathways and change mutant's average rupture force.

Indirect boundary element method to simulate elastic wave propagation in piecewise irregular and flat regions

NASA Astrophysics Data System (ADS)

Perton, Mathieu; Contreras-Zazueta, Marcial A.; Sánchez-Sesma, Francisco J.

2016-06-01

A new implementation of indirect boundary element method allows simulating the elastic wave propagation in complex configurations made of embedded regions that are homogeneous with irregular boundaries or flat layers. In an older implementation, each layer of a flat layered region would have been treated as a separated homogeneous region without taking into account the flat boundary information. For both types of regions, the scattered field results from fictitious sources positioned along their boundaries. For the homogeneous regions, the fictitious sources emit as in a full-space and the wave field is given by analytical Green's functions. For flat layered regions, fictitious sources emit as in an unbounded flat layered region and the wave field is given by Green's functions obtained from the discrete wavenumber (DWN) method. The new implementation allows then reducing the length of the discretized boundaries but DWN Green's functions require much more computation time than the full-space Green's functions. Several optimization steps are then implemented and commented. Validations are presented for 2-D and 3-D problems. Higher efficiency is achieved in 3-D.

Numerical Investigations of the Thermal, Pressure and Size Effects on 2D Spin Crossover Nanoparticles

NASA Astrophysics Data System (ADS)

Harlé, C.; Allal, S. E.; Sohier, D.; Dufaud, T.; Caballero, R.; de Zela, F.; Dahoo, P. R.; Boukheddaden, K.; Linares, J.

2017-12-01

In the framework of the Ising-like model, the thermal and pressure effects on the spin crossover systems are evaluated through two-states fictitious spin operators σ with eigenvalues 𝜎 = -1 and 𝜎 = +1 respectively associated with the low-spin (LS) and highspin (HS) states of each spin-crossover (SCO) molecule. Based on each configurational state, the macroscopic SCO system, is described by the following variables: m=Σ σi, s=Σ σi σj and c=Σ σk standing respectively for the total magnetization, the short-range correlations and surface magnetization. To solve this problem, we first determine the density of macrostates d[m][s][c], giving the number of microscopic configurations with the same m, s and c values. In this contribution, two different ways have been performed to calculate this important quantity: (i) the entropic sampling method, based on Monte Carlo simulations and (ii) a new algorithm based on specific dynamic programming. These two methods were tested on the 2D SCO nanoparticles for which, we calculated the average magnetization < σ> taking into account for short-, long-range interactions as well as for the interaction between surface molecules with their surrounding matrix. We monitored the effect of the pressure, temperature and size on the properties of the SCO nanoparticles.

Inferring the parameters of a Markov process from snapshots of the steady state

NASA Astrophysics Data System (ADS)

Dettmer, Simon L.; Berg, Johannes

2018-02-01

We seek to infer the parameters of an ergodic Markov process from samples taken independently from the steady state. Our focus is on non-equilibrium processes, where the steady state is not described by the Boltzmann measure, but is generally unknown and hard to compute, which prevents the application of established equilibrium inference methods. We propose a quantity we call propagator likelihood, which takes on the role of the likelihood in equilibrium processes. This propagator likelihood is based on fictitious transitions between those configurations of the system which occur in the samples. The propagator likelihood can be derived by minimising the relative entropy between the empirical distribution and a distribution generated by propagating the empirical distribution forward in time. Maximising the propagator likelihood leads to an efficient reconstruction of the parameters of the underlying model in different systems, both with discrete configurations and with continuous configurations. We apply the method to non-equilibrium models from statistical physics and theoretical biology, including the asymmetric simple exclusion process (ASEP), the kinetic Ising model, and replicator dynamics.

Spatial Analysis of Handwritten Texts as a Marker of Cognitive Control.

PubMed

Crespo, Y; Soriano, M F; Iglesias-Parro, S; Aznarte, J I; Ibáñez-Molina, A J

2017-12-01

We explore the idea that cognitive demands of the handwriting would influence the degree of automaticity of the handwriting process, which in turn would affect the geometric parameters of texts. We compared the heterogeneity of handwritten texts in tasks with different cognitive demands; the heterogeneity of texts was analyzed with lacunarity, a measure of geometrical invariance. In Experiment 1, we asked participants to perform two tasks that varied in cognitive demands: transcription and exposition about an autobiographical episode. Lacunarity was significantly lower in transcription. In Experiment 2, we compared a veridical and a fictitious version of a personal event. Lacunarity was lower in veridical texts. We contend that differences in lacunarity of handwritten texts reveal the degree of automaticity in handwriting.

Modeling non-locality of plasmonic excitations with a fictitious film

NASA Astrophysics Data System (ADS)

Kong, Jiantao; Shvonski, Alexander; Kempa, Krzysztof

Non-local effects, requiring a wavevector (q) dependent dielectric response are becoming increasingly important in studies of plasmonic and metamaterial structures. The phenomenological hydrodynamic approximation (HDA) is the simplest, and most often used model, but it often fails. We show that the d-function formalism, exact to first order in q, is a powerful and simple-to-use alternative. Recently, we developed a mapping of the d-function formalism into a purely local fictitious film. This geometric mapping allows for non-local extensions of any local calculation scheme, including FDTD. We demonstrate here, that such mapped FDTD simulation of metallic nanoclusters agrees very well with various experiments.

Quantum mechanics in noninertial reference frames: Relativistic accelerations and fictitious forces

NASA Astrophysics Data System (ADS)

Klink, W. H.; Wickramasekara, S.

2016-06-01

One-particle systems in relativistically accelerating reference frames can be associated with a class of unitary representations of the group of arbitrary coordinate transformations, an extension of the Wigner-Bargmann definition of particles as the physical realization of unitary irreducible representations of the Poincaré group. Representations of the group of arbitrary coordinate transformations become necessary to define unitary operators implementing relativistic acceleration transformations in quantum theory because, unlike in the Galilean case, the relativistic acceleration transformations do not themselves form a group. The momentum operators that follow from these representations show how the fictitious forces in noninertial reference frames are generated in quantum theory.

Quantum mechanics in noninertial reference frames: Relativistic accelerations and fictitious forces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klink, W.H., E-mail: william-klink@uiowa.edu; Wickramasekara, S., E-mail: wickrama@grinnell.edu

2016-06-15

One-particle systems in relativistically accelerating reference frames can be associated with a class of unitary representations of the group of arbitrary coordinate transformations, an extension of the Wigner–Bargmann definition of particles as the physical realization of unitary irreducible representations of the Poincaré group. Representations of the group of arbitrary coordinate transformations become necessary to define unitary operators implementing relativistic acceleration transformations in quantum theory because, unlike in the Galilean case, the relativistic acceleration transformations do not themselves form a group. The momentum operators that follow from these representations show how the fictitious forces in noninertial reference frames are generated inmore » quantum theory.« less

A 3D, fully Eulerian, VOF-based solver to study the interaction between two fluids and moving rigid bodies using the fictitious domain method

NASA Astrophysics Data System (ADS)

Pathak, Ashish; Raessi, Mehdi

2016-04-01

We present a three-dimensional (3D) and fully Eulerian approach to capturing the interaction between two fluids and moving rigid structures by using the fictitious domain and volume-of-fluid (VOF) methods. The solid bodies can have arbitrarily complex geometry and can pierce the fluid-fluid interface, forming contact lines. The three-phase interfaces are resolved and reconstructed by using a VOF-based methodology. Then, a consistent scheme is employed for transporting mass and momentum, allowing for simulations of three-phase flows of large density ratios. The Eulerian approach significantly simplifies numerical resolution of the kinematics of rigid bodies of complex geometry and with six degrees of freedom. The fluid-structure interaction (FSI) is computed using the fictitious domain method. The methodology was developed in a message passing interface (MPI) parallel framework accelerated with graphics processing units (GPUs). The computationally intensive solution of the pressure Poisson equation is ported to GPUs, while the remaining calculations are performed on CPUs. The performance and accuracy of the methodology are assessed using an array of test cases, focusing individually on the flow solver and the FSI in surface-piercing configurations. Finally, an application of the proposed methodology in simulations of the ocean wave energy converters is presented.

Isogeometric frictionless contact analysis with the third medium method

NASA Astrophysics Data System (ADS)

Kruse, R.; Nguyen-Thanh, N.; Wriggers, P.; De Lorenzis, L.

2018-01-01

This paper presents an isogeometric formulation for frictionless contact between deformable bodies, based on the recently proposed concept of the third medium. This concept relies on continuum formulations not only for the contacting bodies but also for a fictitious intermediate medium in which the bodies can move and interact. Key to the formulation is a suitable definition of the constitutive behavior of the third medium. In this work, based on a number of numerical tests, the role of the material parameters of the third medium is systematically assessed. We also assess the rate of spatial convergence for higher-order discretizations, stemming from the regularization of the non-smooth contact problem inherent to the third medium approach. Finally, problems with self contact are considered and turn out to be an attractive application of the method.

3D transient electromagnetic simulation using a modified correspondence principle for wave and diffusion fields

NASA Astrophysics Data System (ADS)

Hu, Y.; Ji, Y.; Egbert, G. D.

2015-12-01

The fictitious time domain method (FTD), based on the correspondence principle for wave and diffusion fields, has been developed and used over the past few years primarily for marine electromagnetic (EM) modeling. Here we present results of our efforts to apply the FTD approach to land and airborne TEM problems which can reduce the computer time several orders of magnitude and preserve high accuracy. In contrast to the marine case, where sources are in the conductive sea water, we must model the EM fields in the air; to allow for topography air layers must be explicitly included in the computational domain. Furthermore, because sources for most TEM applications generally must be modeled as finite loops, it is useful to solve directly for the impulse response appropriate to the problem geometry, instead of the point-source Green functions typically used for marine problems. Our approach can be summarized as follows: (1) The EM diffusion equation is transformed to a fictitious wave equation. (2) The FTD wave equation is solved with an explicit finite difference time-stepping scheme, with CPML (Convolutional PML) boundary conditions for the whole computational domain including the air and earth , with FTD domain source corresponding to the actual transmitter geometry. Resistivity of the air layers is kept as low as possible, to compromise between efficiency (longer fictitious time step) and accuracy. We have generally found a host/air resistivity contrast of 10-3 is sufficient. (3)A "Modified" Fourier Transform (MFT) allow us recover system's impulse response from the fictitious time domain to the diffusion (frequency) domain. (4) The result is multiplied by the Fourier transformation （FT） of the real source current avoiding time consuming convolutions in the time domain. (5) The inverse FT is employed to get the final full waveform and full time response of the system in the time domain. In general, this method can be used to efficiently solve most time-domain EM simulation problems for non-point sources.

Seismological Investigations of the National Data Centre Preparedness Exercise 2015 (NPE2015)

NASA Astrophysics Data System (ADS)

Gestermann, Nicolai; Hartmann, Gernot; Ross, Jens-Ole

2017-04-01

The Comprehensive Nuclear-Test-Ban Treaty (CTBT) prohibits all kinds of nuclear explosions. For the detection of treaty violations the International Monitoring System (IMS) operates stations observing seismic, hydroacoustic, and infrasound signals as well as radioisotopes in the atmosphere. While the IMS data is collected, processed and technically analyzed in the International Data Center (IDC) of the CTBT-Organization, National Data Centers (NDC) provide interpretation and advice to their government concerning suspicious detections occurring in IMS data. The National Data Centre Preparedness Exercises (NPE) are regularly performed dealing with fictitious treaty violations to practice the combined analysis of CTBT verification technologies and national technical means. These exercises should help to evaluate the effectiveness of analysis procedures applied at NDCs and the quality, completeness and usefulness of IDC products. The NPE2015 is a combined radionuclide-waveform scenario. Fictitious particulate radionuclide and radioxenon measurements at stations of the IMS (International Monitoring System) of the CTBTO were reported to the international community. The type of isotopes and concentrations could arise from an underground nuclear explosion (UNE). The task of the exercise is to identify the scenario behind the provided data. The source region and time domain of a possible treaty violation activity was determined from ATM in backtracking mode with input data from the fictitious data. A time slot in October and a region around the mining area of Lubin could be identified as the possible source area of the fictitious measurements. The seismicity of the determined source region was investigated in detail to identify events which cannot be classified as natural or induced within the relevant time interval. The comparison of spectral characteristics and a cluster analysis was applied to search for a non-characteristic event within a number of known induced events in the area. The results reveal that none of the candidate events had an explosion like characteristic. All candidate events are part of event cluster with a minimum of seven events with comparable signature. The possibility of a treaty violation would be very low in a real scenario. If the nature of a suspicious event cannot be clarified with data of the IMS or national technical means, an on-site inspection (OSI) can be requested by the member states. Taking into account the results of the seismological investigations it could be decided that an OSI is not necessary for the possible source region to exclude the possibility of a fictitious clandestine underground nuclear explosion.

A fictitious domain finite element method for simulations of fluid-structure interactions: The Navier-Stokes equations coupled with a moving solid

NASA Astrophysics Data System (ADS)

Court, Sébastien; Fournié, Michel

2015-05-01

The paper extends a stabilized fictitious domain finite element method initially developed for the Stokes problem to the incompressible Navier-Stokes equations coupled with a moving solid. This method presents the advantage to predict an optimal approximation of the normal stress tensor at the interface. The dynamics of the solid is governed by the Newton's laws and the interface between the fluid and the structure is materialized by a level-set which cuts the elements of the mesh. An algorithm is proposed in order to treat the time evolution of the geometry and numerical results are presented on a classical benchmark of the motion of a disk falling in a channel.

Dynamics of some fictitious satellites of Venus and Mars

NASA Astrophysics Data System (ADS)

Yokoyama, Tadashi

1999-05-01

The dynamics of some fictitious satellites of Venus and Mars are studied considering only solar perturbation and the oblateness of the planet, as disturbing forces. Several numerical integrations of the averaged system, taking different values of the obliquity of ecliptic (ε), show the existence of strong chaotic motion, provided that the semi major axis is near a critical value. As a consequence, large increase of eccentricities occur and the satellites may collide with the planet or cross possible internal orbits. Even starting from almost circular and equatorial orbits, most satellites can easily reach prohibitive values. The extension of the chaotic zone depends clearly on the value of ε, so that, previous regular regions may become chaotic, provided ε increases sufficiently.

Second order Method for Solving 3D Elasticity Equations with Complex Interfaces

PubMed Central

Wang, Bao; Xia, Kelin; Wei, Guo-Wei

2015-01-01

Elastic materials are ubiquitous in nature and indispensable components in man-made devices and equipments. When a device or equipment involves composite or multiple elastic materials, elasticity interface problems come into play. The solution of three dimensional (3D) elasticity interface problems is significantly more difficult than that of elliptic counterparts due to the coupled vector components and cross derivatives in the governing elasticity equation. This work introduces the matched interface and boundary (MIB) method for solving 3D elasticity interface problems. The proposed MIB elasticity interface scheme utilizes fictitious values on irregular grid points near the material interface to replace function values in the discretization so that the elasticity equation can be discretized using the standard finite difference schemes as if there were no material interface. The interface jump conditions are rigorously enforced on the intersecting points between the interface and the mesh lines. Such an enforcement determines the fictitious values. A number of new techniques has been developed to construct efficient MIB elasticity interface schemes for dealing with cross derivative in coupled governing equations. The proposed method is extensively validated over both weak and strong discontinuity of the solution, both piecewise constant and position-dependent material parameters, both smooth and nonsmooth interface geometries, and both small and large contrasts in the Poisson’s ratio and shear modulus across the interface. Numerical experiments indicate that the present MIB method is of second order convergence in both L∞ and L2 error norms for handling arbitrarily complex interfaces, including biomolecular surfaces. To our best knowledge, this is the first elasticity interface method that is able to deliver the second convergence for the molecular surfaces of proteins.. PMID:25914422

Transient analysis of 1D inhomogeneous media by dynamic inhomogeneous finite element method

NASA Astrophysics Data System (ADS)

Yang, Zailin; Wang, Yao; Hei, Baoping

2013-12-01

The dynamic inhomogeneous finite element method is studied for use in the transient analysis of onedimensional inhomogeneous media. The general formula of the inhomogeneous consistent mass matrix is established based on the shape function. In order to research the advantages of this method, it is compared with the general finite element method. A linear bar element is chosen for the discretization tests of material parameters with two fictitious distributions. And, a numerical example is solved to observe the differences in the results between these two methods. Some characteristics of the dynamic inhomogeneous finite element method that demonstrate its advantages are obtained through comparison with the general finite element method. It is found that the method can be used to solve elastic wave motion problems with a large element scale and a large number of iteration steps.

Numerical simulation of a shear-thinning fluid through packed spheres

NASA Astrophysics Data System (ADS)

Liu, Hai Long; Moon, Jong Sin; Hwang, Wook Ryol

2012-12-01

Flow behaviors of a non-Newtonian fluid in spherical microstructures have been studied by a direct numerical simulation. A shear-thinning (power-law) fluid through both regular and randomly packed spheres has been numerically investigated in a representative unit cell with the tri-periodic boundary condition, employing a rigorous three-dimensional finite-element scheme combined with fictitious-domain mortar-element methods. The present scheme has been validated for the classical spherical packing problems with literatures. The flow mobility of regular packing structures, including simple cubic (SC), body-centered cubic (BCC), face-centered cubic (FCC), as well as randomly packed spheres, has been investigated quantitatively by considering the amount of shear-thinning, the pressure gradient and the porosity as parameters. Furthermore, the mechanism leading to the main flow path in a highly shear-thinning fluid through randomly packed spheres has been discussed.

Practical Use of Operation Data in the Process Industry

NASA Astrophysics Data System (ADS)

Kano, Manabu

This paper aims to reveal real problems in the process industry and introduce recent development to solve such problems from the viewpoint of effective use of operation data. Two topics are discussed: virtual sensor and process control. First, in order to clarify the present state and problems, a part of our recent questionnaire survey of process control is quoted. It is emphasized that maintenance is a key issue not only for soft-sensors but also for controllers. Then, new techniques are explained. The first one is correlation-based just-in-time modeling (CoJIT), which can realize higher prediction performance than conventional methods and simplify model maintenance. The second is extended fictitious reference iterative tuning (E-FRIT), which can realize data-driven PID control parameter tuning without process modeling. The great usefulness of these techniques are demonstrated through their industrial applications.

Feasibility of inverse problem solution for determination of city emission function from night sky radiance measurements

NASA Astrophysics Data System (ADS)

Petržala, Jaromír

2018-07-01

The knowledge of the emission function of a city is crucial for simulation of sky glow in its vicinity. The indirect methods to achieve this function from radiances measured over a part of the sky have been recently developed. In principle, such methods represent an ill-posed inverse problem. This paper deals with the theoretical feasibility study of various approaches to solving of given inverse problem. Particularly, it means testing of fitness of various stabilizing functionals within the Tikhonov's regularization. Further, the L-curve and generalized cross validation methods were investigated as indicators of an optimal regularization parameter. At first, we created the theoretical model for calculation of a sky spectral radiance in the form of a functional of an emission spectral radiance. Consequently, all the mentioned approaches were examined in numerical experiments with synthetical data generated for the fictitious city and loaded by random errors. The results demonstrate that the second order Tikhonov's regularization method together with regularization parameter choice by the L-curve maximum curvature criterion provide solutions which are in good agreement with the supposed model emission functions.

The Benign Hamburger.

ERIC Educational Resources Information Center

Peaslee, Graham; Lantz, Juliette M.; Walczak, Mary M.

1998-01-01

Uses a case study of food poisoning from hamburgers at the fictitious Jill-at-the-Grill to teach the nuclear science behind food irradiation. Includes case teaching notes on the benign hamburger. (ASK)

Effects of feedback accountability and self-rating information on employee appraisals: a replication and extension.

PubMed

Shore, Ted H; Tashchian, Armen

2007-06-01

The influence of feedback accountability and self-rating information on employee performance appraisals was examined. Undergraduate business student participants assumed the role of "supervisor" and evaluated a fictitious "subordinate" whose performance on a clerical task was either moderately poor or very good. Participants were either given fictitious self-rating information, or no self-rating information, and were told they were expected to provide performance feedback to their ratee, or there was no feedback expectation. As expected, in Study 1 both self-rating information and expected feedback-sharing independently resulted in lenient ratings for poor performance, and the combined effects resulted in the highest ratings. By contrast, results for good performance (Study 2) were not significant. Implications of the findings for human resource management practice and research were discussed.

Grape Expectations.

ERIC Educational Resources Information Center

Rye, James A.

1997-01-01

Details an investigation concerned with the composition of a grape to illustrate how food and nutrition topics can drive inquiry-oriented science learning. Students design experiments that surround the development of a fictitious new beverage. (DDR)

Numerical Model for the Study of the Strength and Failure Modes of Rock Containing Non-Persistent Joints

NASA Astrophysics Data System (ADS)

Vergara, Maximiliano R.; Van Sint Jan, Michel; Lorig, Loren

2016-04-01

The mechanical behavior of rock containing parallel non-persistent joint sets was studied using a numerical model. The numerical analysis was performed using the discrete element software UDEC. The use of fictitious joints allowed the inclusion of non-persistent joints in the model domain and simulating the progressive failure due to propagation of existing fractures. The material and joint mechanical parameters used in the model were obtained from experimental results. The results of the numerical model showed good agreement with the strength and failure modes observed in the laboratory. The results showed the large anisotropy in the strength resulting from variation of the joint orientation. Lower strength of the specimens was caused by the coalescence of fractures belonging to parallel joint sets. A correlation was found between geometrical parameters of the joint sets and the contribution of the joint sets strength in the global strength of the specimen. The results suggest that for the same dip angle with respect to the principal stresses; the uniaxial strength depends primarily on the joint spacing and the angle between joints tips and less on the length of the rock bridges (persistency). A relation between joint geometrical parameters was found from which the resulting failure mode can be predicted.

A fictitious domain approach for the Stokes problem based on the extended finite element method

NASA Astrophysics Data System (ADS)

Court, Sébastien; Fournié, Michel; Lozinski, Alexei

2014-01-01

In the present work, we propose to extend to the Stokes problem a fictitious domain approach inspired by eXtended Finite Element Method and studied for Poisson problem in [Renard]. The method allows computations in domains whose boundaries do not match. A mixed finite element method is used for fluid flow. The interface between the fluid and the structure is localized by a level-set function. Dirichlet boundary conditions are taken into account using Lagrange multiplier. A stabilization term is introduced to improve the approximation of the normal trace of the Cauchy stress tensor at the interface and avoid the inf-sup condition between the spaces for velocity and the Lagrange multiplier. Convergence analysis is given and several numerical tests are performed to illustrate the capabilities of the method.

Production of oridonin-rich extracts from Rabdosia rubescens using hyphenated ultrasound-assisted supercritical carbon dioxide extraction.

PubMed

Yang, Yu-Chiao; Lin, Pei-Hui; Wei, Ming-Chi

2017-08-01

Among active components in Rabdosia rubescens, oridonin has been considered a key component and the most valuable compound because it has a wide range of activities beneficial to human health. To produce a high-quality oridonin extract, an alternative hyphenated procedure involving an ultrasound-assisted and supercritical carbon dioxide (HSC-CO 2 ) extraction method to extract oridonin from R. rubescens was developed in this study. Fictitious solubilities of oridonin in supercritical CO 2 (SC-CO 2 ) with ultrasound assistance were measured by using the dynamic method at temperatures ranging from 305.15 K to 342.15 K over a pressure range of 11.5 to 33.5 MPa. Fictitious solubilities of oridonin at different temperatures and pressures were over the range of 2.13 × 10 -6 to 10.09 × 10 -6 (mole fraction) and correlated well with the density-based models, including the Bartle model, the Chrastil model, the Kumar and Johnston model and the Mendez-Santiago and Teja model, with overall average absolute relative deviations (AARDs) of 6.29%, 4.39%, 3.12% and 5.07%, respectively. Oridonin exhibits retrograde solubility behaviour in the supercritical state. Fictitious solubility data were further determined and obtained a good fit with four semi-empirical models. Simultaneously, the values of the total heat of solution, vaporisation and solvation of oridonin were estimated. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

A nonlinear flow-induced energy harvester by considering effects of fictitious springs

NASA Astrophysics Data System (ADS)

Zhang, Guangcheng; Lin, Yueh-Jaw

2018-01-01

In this paper, a newly proposed energy harvesting approach involving nonlinear coupling effects is demonstrated by utilizing a pair of inducing bluff bodies that are put on both sides of the flag-shaped cantilever beam, and placed in a side-by-side configuration to harvest the energy of the flow. One patch of macro fiber composite is attached to the fixed end of the cantilever beam to facilitate converting the kinetic energy into electric power. It is the first time in recent literature that two fluid dynamic phenomena (i.e. the vortex shedding and the Bernoulli effect) are considered simultaneously in the flow-induced energy harvesting field. The fictitious springs are introduced to explain the nonlinear characteristics of the proposed structure. With the effect of the fictitious springs, the speed range of the flow-induced energy harvester is extended. The proposed structure not only improves the output of the induced-based energy harvester compared to one that has just one cylinder, but can also be utilized in an actual hostile ambient environment. The experimental results for the energy harvester prototype are also investigated. The output power of the energy harvester with two cylinders (D = 25 mm) is measured to be 1.12 μW when the flow speed is 0.325 m s-1 and the center-to-center transverse spacing is 45 mm. This research also delves into the geometric variations of the proposed structure and its optimization.

Pseudo-conformer models for linear molecules: Joint treatment of spectroscopic, electron diffraction and ab initio data for the C3O2 molecule

NASA Astrophysics Data System (ADS)

Tarasov, Yury I.; Kochikov, Igor V.

2018-06-01

Dynamic analysis of the molecules with large-amplitude motions (LAM) based on the pseudo-conformer approach has been successfully applied to various molecules. Floppy linear molecules present a special class of molecular structures that possess a pair of conjugate LAM coordinates but allow one-dimensional treatment. In this paper, previously developed treatment for the semirigid molecules is applied to the carbon suboxide molecule. This molecule characterized by the extremely large CCC bending has been thoroughly investigated by spectroscopic and ab initio methods. However, the earlier electron diffraction investigations were performed within a static approach, obtaining thermally averaged parameters. In this paper we apply a procedure aimed at obtaining the short list of self-consistent reference geometry parameters of a molecule, while all thermally averaged parameters are calculated based on reference geometry, relaxation dependencies and quadratic and cubic force constants. We show that such a model satisfactorily describes available electron diffraction evidence with various QC bending potential energy functions when r.m.s. CCC angle is in the interval 151 ± 2°. This leads to a self-consistent molecular model satisfying spectroscopic and GED data. The parameters for linear reference geometry have been defined as re(CO) = 1.161(2) Å and re(CC) = 1.273(2) Å.

Adiabatic description of superfocusing of femtosecond plasmon polaritons

NASA Astrophysics Data System (ADS)

Golovinski, P. A.; Manuylovich, E. S.; Astapenko, V. A.

2018-05-01

A surface plasmon polariton is a collective oscillation of free electrons at a metal-dielectric interface. As wave phenomena, surface plasmon polaritons can be focused with the use of an appropriate excitation geometry of metal structures. In the adiabatic approximation, we demonstrate a possibility to control nanoscale short pulse superfocusing based on generation of a radially polarized surface plasmon polariton mode of a conical metal needle in view of wave reflection. The results of numerical simulations of femtosecond pulse propagation along a nanoneedle are discussed. The space-time evolution of a pulse for the near field strongly depends on a linear chirp of an initial laser pulse, which can partially compensate wave dispersion. The field distribution is calculated for different metals, chirp parameters, cone opening angles and propagation distances. The electric field near a sharp tip is described as a field of a fictitious time-dependent electric dipole located at the tip apex.

Resonance treatment using pin-based pointwise energy slowing-down method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choi, Sooyoung, E-mail: csy0321@unist.ac.kr; Lee, Changho, E-mail: clee@anl.gov; Lee, Deokjung, E-mail: deokjung@unist.ac.kr

A new resonance self-shielding method using a pointwise energy solution has been developed to overcome the drawbacks of the equivalence theory. The equivalence theory uses a crude resonance scattering source approximation, and assumes a spatially constant scattering source distribution inside a fuel pellet. These two assumptions cause a significant error, in that they overestimate the multi-group effective cross sections, especially for {sup 238}U. The new resonance self-shielding method solves pointwise energy slowing-down equations with a sub-divided fuel rod. The method adopts a shadowing effect correction factor and fictitious moderator material to model a realistic pointwise energy solution. The slowing-down solutionmore » is used to generate the multi-group cross section. With various light water reactor problems, it was demonstrated that the new resonance self-shielding method significantly improved accuracy in the reactor parameter calculation with no compromise in computation time, compared to the equivalence theory.« less

Two-time correlation function of an open quantum system in contact with a Gaussian reservoir

NASA Astrophysics Data System (ADS)

Ban, Masashi; Kitajima, Sachiko; Shibata, Fumiaki

2018-05-01

An exact formula of a two-time correlation function is derived for an open quantum system which interacts with a Gaussian thermal reservoir. It is provided in terms of functional derivative with respect to fictitious fields. A perturbative expansion and its diagrammatic representation are developed, where the small expansion parameter is related to a correlation time of the Gaussian thermal reservoir. The two-time correlation function of the lowest order is equivalent to that calculated by means of the quantum regression theorem. The result clearly shows that the violation of the quantum regression theorem is caused by a finiteness of the reservoir correlation time. By making use of an exactly solvable model consisting of a two-level system and a set of harmonic oscillators, it is shown that the two-time correlation function up to the first order is a good approximation to the exact one.

Mathematical simulation of sound propagation in a flow channel with impedance walls

NASA Astrophysics Data System (ADS)

Osipov, A. A.; Reent, K. S.

2012-07-01

The paper considers the specifics of calculating tonal sound propagating in a flow channel with an installed sound-absorbing device. The calculation is performed on the basis of numerical integrating on linearized nonstationary Euler equations using a code developed by the authors based on the so-called discontinuous Galerkin method. Using the linear theory of small perturbations, the effect of the sound-absorbing lining of the channel walls is described with the modified value of acoustic impedance proposed by the authors, for which, under flow channel conditions, the traditional classification of the active and reactive types of lining in terms of the real and imaginary impedance values, respectively, remains valid. To stabilize the computation process, a generalized impedance boundary condition is proposed in which, in addition to the impedance value itself, some additional parameters are introduced characterizing certain fictitious properties of inertia and elasticity of the impedance surface.

Alterations to the relativistic Love-Franey model and their application to inelastic scattering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zeile, J.R.

The fictitious axial-vector and tensor mesons for the real part of the relativistic Love-Franey interaction are removed. In an attempt to make up for this loss, derivative couplings are used for the {pi} and {rho} mesons. Such derivative couplings require the introduction of axial-vector and tensor contact term corrections. Meson parameters are then fit to free nucleon-nucleon scattering data. The resulting fits are comparable to those of the relativistic Love-Franey model provided that the contact term corrections are included and the fits are weighted over the physically significant quantity of twice the tensor minus the axial-vector Lorentz invariants. Failure tomore » include contact term corrections leads to poor fits at higher energies. The off-shell behavior of this model is then examined by looking at several applications from inelastic proton-nucleus scattering.« less

Crossover from Super- to Subdiffusive Motion and Memory Effects in Crystalline Organic Semiconductors

NASA Astrophysics Data System (ADS)

De Filippis, G.; Cataudella, V.; Mishchenko, A. S.; Nagaosa, N.; Fierro, A.; de Candia, A.

2015-02-01

The transport properties at finite temperature of crystalline organic semiconductors are investigated, within the Su-Schrieffer-Heeger model, by combining an exact diagonalization technique, Monte Carlo approaches, and a maximum entropy method. The temperature-dependent mobility data measured in single crystals of rubrene are successfully reproduced: a crossover from super- to subdiffusive motion occurs in the range 150 ≤T ≤200 K , where the mean free path becomes of the order of the lattice parameter and strong memory effects start to appear. We provide an effective model, which can successfully explain features of the absorption spectra at low frequencies. The observed response to slowly varying electric field is interpreted by means of a simple model where the interaction between the charge carrier and lattice polarization modes is simulated by a harmonic interaction between a fictitious particle and an electron embedded in a viscous fluid.

Crossover from super- to subdiffusive motion and memory effects in crystalline organic semiconductors.

PubMed

De Filippis, G; Cataudella, V; Mishchenko, A S; Nagaosa, N; Fierro, A; de Candia, A

2015-02-27

The transport properties at finite temperature of crystalline organic semiconductors are investigated, within the Su-Schrieffer-Heeger model, by combining an exact diagonalization technique, Monte Carlo approaches, and a maximum entropy method. The temperature-dependent mobility data measured in single crystals of rubrene are successfully reproduced: a crossover from super- to subdiffusive motion occurs in the range 150≤T≤200  K, where the mean free path becomes of the order of the lattice parameter and strong memory effects start to appear. We provide an effective model, which can successfully explain features of the absorption spectra at low frequencies. The observed response to slowly varying electric field is interpreted by means of a simple model where the interaction between the charge carrier and lattice polarization modes is simulated by a harmonic interaction between a fictitious particle and an electron embedded in a viscous fluid.

Optimal design for robust control of uncertain flexible joint manipulators: a fuzzy dynamical system approach

NASA Astrophysics Data System (ADS)

Han, Jiang; Chen, Ye-Hwa; Zhao, Xiaomin; Dong, Fangfang

2018-04-01

A novel fuzzy dynamical system approach to the control design of flexible joint manipulators with mismatched uncertainty is proposed. Uncertainties of the system are assumed to lie within prescribed fuzzy sets. The desired system performance includes a deterministic phase and a fuzzy phase. First, by creatively implanting a fictitious control, a robust control scheme is constructed to render the system uniformly bounded and uniformly ultimately bounded. Both the manipulator modelling and control scheme are deterministic and not IF-THEN heuristic rules-based. Next, a fuzzy-based performance index is proposed. An optimal design problem for a control design parameter is formulated as a constrained optimisation problem. The global solution to this problem can be obtained from solving two quartic equations. The fuzzy dynamical system approach is systematic and is able to assure the deterministic performance as well as to minimise the fuzzy performance index.

Transforming Lessons with Technology

ERIC Educational Resources Information Center

Currie, Brad

2016-01-01

Using a fictitious learning environment, the author demonstrates a variety of technological tools that teachers can infuse into their classrooms. Come away with some innovative, practical methods to help students show what they know about the topic at hand.

Identity Verification Systems as a Critical Infrastructure

DTIC Science & Technology

2012-03-01

COVERED Master’s Thesis 4 . TITLE AND SUBTITLE Identity Verification Systems as a Critical Infrastructure 5. FUNDING NUMBERS 6. AUTHOR(S...43 3. Cybercrime .........................................................................................45 4 ...24 Figure 3. Uses of Fictitious or Stolen Identity ................................................................30 Figure 4

Trojans in habitable zones.

PubMed

Schwarz, Richard; Pilat-Lohinger, Elke; Dvorak, Rudolf; Erdi, Balint; Sándor, Zsolt

2005-10-01

With the aid of numerical experiments we examined the dynamical stability of fictitious terrestrial planets in 1:1 mean motion resonance with Jovian-like planets of extrasolar planetary systems. In our stability study of the so-called "Trojan" planets in the habitable zone, we used the restricted three-body problem with different mass ratios of the primary bodies. The application of the three-body problem showed that even massive Trojan planets can be stable in the 1:1 mean motion resonance. From the 117 extrasolar planetary systems only 11 systems were found with one giant planet in the habitable zone. Out of this sample set we chose four planetary systems--HD17051, HD27442, HD28185, and HD108874--for further investigation. To study the orbital behavior of the stable zone in the different systems, we used direct numerical computations (Lie Integration Method) that allowed us to determine the escape times and the maximum eccentricity of the fictitious "Trojan planets."

Exercise promotes positive impression formation towards both men and women.

PubMed

Kanarek, Robin B; Mathes, Wendy Foulds; D'Anci, Kristen E

2012-06-01

Exercise is endorsed for its physiological and psychological benefits, and has been proposed to have positive effects on impression formation. To test this proposal, 62 female and 44 male college students read one of three brief descriptions of either a fictitious male or female "target" student. The descriptions varied only in exercise level: no exercise; moderate exercise and intensive exercise. Participants then rated the fictitious student on 38 personality traits. Ratings of characteristics that are associated with exercise (e.g. athletic; energetic) increased, while ratings associated with the lack of exercise (e.g. lazy; weak) decreased as a function of the reported level of exercise. Exercise level also positively influenced ratings of characteristics not related to exercise. These data show that even minimal information about exercise is an important component of first impressions in both men and women. Copyright © 2012 Elsevier Ltd. All rights reserved.

Quantized mode of a leaky cavity

NASA Astrophysics Data System (ADS)

Dutra, S. M.; Nienhuis, G.

2000-12-01

We use Thomson's classical concept of mode of a leaky cavity to develop a quantum theory of cavity damping. This theory generalizes the conventional system-reservoir theory of high-Q cavity damping to arbitrary Q. The small system now consists of damped oscillators corresponding to the natural modes of the leaky cavity rather than undamped oscillators associated with the normal modes of a fictitious perfect cavity. The formalism unifies semiclassical Fox-Li modes and the normal modes traditionally used for quantization. It also lays the foundations for a full quantum description of excess noise. The connection with Siegman's semiclassical work is straightforward. In a wider context, this theory constitutes a radical departure from present models of dissipation in quantum mechanics: unlike conventional models, system and reservoir operators no longer commute with each other. This noncommutability is an unavoidable consequence of having to use natural cavity modes rather than normal modes of a fictitious perfect cavity.

Pumping of magnons in a Dzyaloshinskii-Moriya ferromagnet

NASA Astrophysics Data System (ADS)

Kovalev, Alexey A.; Zyuzin, Vladimir A.; Li, Bo

2017-04-01

We formulate a microscopic linear response theory of magnon pumping applicable to multiple-magnonic-band uniform ferromagnets with Dzyaloshinskii-Moriya interactions. From the linear response theory, we identify the extrinsic and intrinsic contributions where the latter is expressed via the Berry curvature of magnonic bands. We observe that in the presence of a time-dependent magnetization Dzyaloshinskii-Moriya interactions can act as fictitious electric fields acting on magnons. We study various current responses to this fictitious field and analyze the role of Berry curvature. In particular, we obtain an analog of the Hall-like response in systems with nontrivial Berry curvature of magnon bands. After identifying the magnon-mediated contribution to the equilibrium Dzyaloshinskii-Moriya interaction, we also establish the Onsager reciprocity between the magnon mediated thermal torques and heat pumping. We apply our theory to the magnonic heat pumping and torque responses in honeycomb and kagome lattice ferromagnets.

A combined finite element-boundary element formulation for solution of axially symmetric bodies

NASA Technical Reports Server (NTRS)

Collins, Jeffrey D.; Volakis, John L.

1991-01-01

A new method is presented for the computation of electromagnetic scattering from axially symmetric bodies. To allow the simulation of inhomogeneous cross sections, the method combines the finite element and boundary element techniques. Interior to a fictitious surface enclosing the scattering body, the finite element method is used which results in a sparce submatrix, whereas along the enclosure the Stratton-Chu integral equation is enforced. By choosing the fictitious enclosure to be a right circular cylinder, most of the resulting boundary integrals are convolutional and may therefore be evaluated via the FFT with which the system is iteratively solved. In view of the sparce matrix associated with the interior fields, this reduces the storage requirement of the entire system to O(N) making the method attractive for large scale computations. The details of the corresponding formulation and its numerical implementation are described.

Using imagination to understand the neural basis of episodic memory

PubMed Central

Hassabis, Demis; Kumaran, Dharshan; Maguire, Eleanor A.

2008-01-01

Functional MRI (fMRI) studies investigating the neural basis of episodic memory recall, and the related task of thinking about plausible personal future events, have revealed a consistent network of associated brain regions. Surprisingly little, however, is understood about the contributions individual brain areas make to the overall recollective experience. In order to examine this, we employed a novel fMRI paradigm where subjects had to imagine fictitious experiences. In contrast to future thinking, this results in experiences that are not explicitly temporal in nature or as reliant on self-processing. By using previously imagined fictitious experiences as a comparison for episodic memories, we identified the neural basis of a key process engaged in common, namely scene construction, involving the generation, maintenance and visualisation of complex spatial contexts. This was associated with activations in a distributed network, including hippocampus, parahippocampal gyrus, and retrosplenial cortex. Importantly, we disambiguated these common effects from episodic memory-specific responses in anterior medial prefrontal cortex, posterior cingulate cortex and precuneus. These latter regions may support self-schema and familiarity processes, and contribute to the brain's ability to distinguish real from imaginary memories. We conclude that scene construction constitutes a common process underlying episodic memory and imagination of fictitious experiences, and suggest it may partially account for the similar brain networks implicated in navigation, episodic future thinking, and the default mode. We suggest that further brain regions are co-opted into this core network in a task-specific manner to support functions such as episodic memory that may have additional requirements. PMID:18160644

The effect of a fictitious peer on young children's choice of familiar v. unfamiliar low- and high-energy-dense foods.

PubMed

Bevelander, Kirsten E; Anschütz, Doeschka J; Engels, Rutger C M E

2012-09-28

The present experimental study was the first to investigate the impact of a remote (non-existent) peer on children's food choice of familiar v. unfamiliar low- and high-energy-dense food products. In a computer task, children (n 316; 50·3 % boys; mean age 7·13 (SD 0·75) years) were asked to choose between pictures of familiar and unfamiliar foods in four different choice blocks using the following pairs: (1) familiar v. unfamiliar low-energy-dense foods (fruits and vegetables), (2) familiar v. unfamiliar high-energy-dense foods (high sugar, salt and/or fat content), (3) familiar low-energy-dense v. unfamiliar high-energy-dense foods and (4) unfamiliar low-energy-dense v. familiar high-energy-dense foods. Participants who were not in the control group were exposed to the food choices (either always the familiar or always the unfamiliar food product) of a same-sex and same-age fictitious peer who was supposedly completing the same task at another school. The present study provided insights into children's choices between (un)familiar low- and high-energy-dense foods in an everyday situation. The findings revealed that the use of fictitious peers increased children's willingness to try unfamiliar foods, although children tended to choose high-energy-dense foods over low-energy-dense foods. Intervention programmes that use peer influence to focus on improving children's choice of healthy foods should take into account children's strong aversion to unfamiliar low-energy-dense foods as well as their general preference for familiar and unfamiliar high-energy-dense foods.

Using imagination to understand the neural basis of episodic memory.

PubMed

Hassabis, Demis; Kumaran, Dharshan; Maguire, Eleanor A

2007-12-26

Functional MRI (fMRI) studies investigating the neural basis of episodic memory recall, and the related task of thinking about plausible personal future events, have revealed a consistent network of associated brain regions. Surprisingly little, however, is understood about the contributions individual brain areas make to the overall recollective experience. To examine this, we used a novel fMRI paradigm in which subjects had to imagine fictitious experiences. In contrast to future thinking, this results in experiences that are not explicitly temporal in nature or as reliant on self-processing. By using previously imagined fictitious experiences as a comparison for episodic memories, we identified the neural basis of a key process engaged in common, namely scene construction, involving the generation, maintenance and visualization of complex spatial contexts. This was associated with activations in a distributed network, including hippocampus, parahippocampal gyrus, and retrosplenial cortex. Importantly, we disambiguated these common effects from episodic memory-specific responses in anterior medial prefrontal cortex, posterior cingulate cortex and precuneus. These latter regions may support self-schema and familiarity processes, and contribute to the brain's ability to distinguish real from imaginary memories. We conclude that scene construction constitutes a common process underlying episodic memory and imagination of fictitious experiences, and suggest it may partially account for the similar brain networks implicated in navigation, episodic future thinking, and the default mode. We suggest that additional brain regions are co-opted into this core network in a task-specific manner to support functions such as episodic memory that may have additional requirements.

Stimulus appraisal modulates cardiac reactivity to briefly presented mutilation pictures.

PubMed

Mocaiber, Izabela; Perakakis, Pandelis; Pereira, Mirtes Garcia; Pinheiro, Walter Machado; Volchan, Eliane; de Oliveira, Letícia; Vila, Jaime

2011-09-01

Emotional reactions to threatening situations can be either advantageous for human adaptation or unfavorable for physical and mental health if sustained over prolonged periods of time. These contrasting effects mostly depend on the individual's capacity for emotion regulation. It has been shown, for example, that changing appraisal can alter the course of emotional processing. In the present study, the influence of stimulus appraisal over cardiac reactivity to briefly presented (200ms) mutilation pictures was tested in the context of an affective classification task. Heart rate and reaction time of twenty-four undergraduate students were monitored during the presentation of pictures (neutral or mutilated bodies) in successive blocks. In one condition (real), participants were told that the pictures depicted real events. In the other condition (fictitious), they were told that the pictures were taken from movie scenes. As expected, the results showed a more pronounced bradycardia to mutilation pictures, in comparison to neural pictures, in the real context. In the fictitious context, a significant attenuation of the emotional modulation (defensive bradycardia) was observed. However, this attenuation seemed to be transient because it was only observed in the first presentation block of the fictitious context. Reaction time to classify mutilation pictures, compared to neutral pictures, was slower in both contexts, reflecting the privileged processing of emotionally laden material. The present findings show that even briefly presented mutilation pictures elicit a differential cardiac reactivity and modulate behavioral performance. Importantly, changing stimulus appraisal attenuates the emotional modulation of cardiac reactivity (defensive bradycardia). Copyright © 2011 Elsevier B.V. All rights reserved.

Multiwavelength Thermometry at High Temperature: Why It is Advantageous to Work in the Ultraviolet

NASA Astrophysics Data System (ADS)

Girard, F.; Battuello, M.; Florio, M.

2014-07-01

In principle, multiwavelength radiation thermometry allows one to correctly measure the temperature of surfaces of unknown and varying surface emissivity. Unfortunately, none of the practical realizations proposed in the past proved to be sufficiently reliable because of a strong influence of the errors arising from incorrect modeling of the emissivity and of the limited number of operating wavelengths. The use of array detectors allows a high degree of flexibility both in terms of number and spectral position of the working wavelength bands. In the case of applications at high temperatures, i.e., near 2000 C or above, an analysis of the theoretical measuring principles of multiwavelength thermometry, suggests the opportunity of investigating the possible advantages in extending the operating wavelengths toward the ultraviolet region. To this purpose, a simulation program was developed which allows investigation of the effect of different influencing parameters. This paper presents a brief theoretical introduction and practical analysis of the method. The best choices are derived in terms of the different influencing parameters and data relative to the simulation of both real materials and fictitious emissivity curves and have been studied and analyzed with different emissivity models to check the robustness of the method.

Closed-form eigensolutions of nonviscously, nonproportionally damped systems based on continuous damping sensitivity

NASA Astrophysics Data System (ADS)

Lázaro, Mario

2018-01-01

In this paper, nonviscous, nonproportional, vibrating structures are considered. Nonviscously damped systems are characterized by dissipative mechanisms which depend on the history of the response velocities via hereditary kernel functions. Solutions of the free motion equation lead to a nonlinear eigenvalue problem involving mass, stiffness and damping matrices. Viscoelasticity leads to a frequency dependence of this latter. In this work, a novel closed-form expression to estimate complex eigenvalues is derived. The key point is to consider the damping model as perturbed by a continuous fictitious parameter. Assuming then the eigensolutions as function of this parameter, the computation of the eigenvalues sensitivity leads to an ordinary differential equation, from whose solution arises the proposed analytical formula. The resulting expression explicitly depends on the viscoelasticity (frequency derivatives of the damping function), the nonproportionality (influence of the modal damping matrix off-diagonal terms). Eigenvectors are obtained using existing methods requiring only the corresponding eigenvalue. The method is validated using a numerical example which compares proposed with exact ones and with those determined from the linear first order approximation in terms of the damping matrix. Frequency response functions are also plotted showing that the proposed approach is valid even for moderately or highly damped systems.

24 CFR 968.320 - HUD review and approval of comprehensive plan (including five-year action plan).

Code of Federal Regulations, 2012 CFR

2012-04-01

... modifications required to make the comprehensive plan approvable. The PHA must re-submit the comprehensive plan... writing containing any false, fictitious or fraudulent statement or entry, in any matter within the...

24 CFR 968.320 - HUD review and approval of comprehensive plan (including five-year action plan).

Code of Federal Regulations, 2011 CFR

2011-04-01

... modifications required to make the comprehensive plan approvable. The PHA must re-submit the comprehensive plan... writing containing any false, fictitious or fraudulent statement or entry, in any matter within the...

Bed Partner "Gas-Lighting" as a Cause of Fictitious Sleep-Talking.

PubMed

Bashford, James; Leschziner, Guy

2015-10-15

A case report highlighting a rare and striking, but perhaps under-recognized, cause of reported sleep-talking to a specialist sleep clinic, involving "gas-lighting" by the bed partner. © 2015 American Academy of Sleep Medicine.

Computation of Hypersonic Shock Wave Flows of Multi-Component Reactive Gas Mixtures Using the Generalized Boltzmann Equation

DTIC Science & Technology

2009-03-27

ones like the Lennard - Jones potential with established parameters for each gas (e.g. N2 and 02), and for inelastic collisions DSMC method employs...solution of the collision integral. Lennard - Jones potential with two free parameters is used to obtain the elastic cross-section of the gas molecules...and the so called "combinatory relations" are used to obtain parameters of Lennard - Jones potential for an interaction of molecule A with molecule B

Adaptive switching of interaction potentials in the time domain: an extended Lagrangian approach tailored to transmute force field to QM/MM simulations and back.

PubMed

Böckmann, Marcus; Doltsinis, Nikos L; Marx, Dominik

2015-06-09

An extended Lagrangian formalism that allows for a smooth transition between two different descriptions of interactions during a molecular dynamics simulation is presented. This time-adaptive method is particularly useful in the context of multiscale simulation as it provides a sound recipe to switch on demand between different hierarchical levels of theory, for instance between ab initio ("QM") and force field ("MM") descriptions of a given (sub)system in the course of a molecular dynamics simulation. The equations of motion can be integrated straightforwardly using the usual propagators, such as the Verlet algorithm. First test cases include a bath of harmonic oscillators, of which a subset is switched to a different force constant and/or equilibrium position, as well as an all-MM to QM/MM transition in a hydrogen-bonded water dimer. The method is then applied to a smectic 8AB8 liquid crystal and is shown to be able to switch dynamically a preselected 8AB8 molecule from an all-MM to a QM/MM description which involves partition boundaries through covalent bonds. These examples show that the extended Lagrangian approach is not only easy to implement into existing code but that it is also efficient and robust. The technique moreover provides easy access to a conserved energy quantity, also in cases when Nosé-Hoover chain thermostatting is used throughout dynamical switching. A simple quadratic driving potential proves to be sufficient to guarantee a smooth transition whose time scale can be easily tuned by varying the fictitious mass parameter associated with the auxiliary variable used to extend the Lagrangian. The method is general and can be applied to time-adaptive switching on demand between two different levels of theory within the framework of hybrid scale-bridging simulations.

Afferent control of central pattern generators: experimental analysis of scratching in the decerebrate cat.

PubMed

Baev, K V; Esipenko, V B; Shimansky, Y P

1991-01-01

Systematic quantitative analysis of changes in the spinal scratching generator motor activity evoked by tonic and phasic peripheral afferent signals during "fictitious" scratching was carried out in the cat. Correlations between the kinematics of hindlimb scratching movement, sensory inflow, and primary afferent depolarization were investigated. Reliable correlations between the parameters of generator motor activity during fictitious scratching were revealed: they depended on tonic peripheral afferent inflow. The functional role of these dependencies consists of providing stability for aiming the hindlimb to the itch site. It was shown that scratching generator reaction to a phasic sensory signal depended significantly on afferent input, signal intensity, and its arrival phase in the cycle of motor activity. Phase correction of "scratching" rhythm was performed by inhibition of the current stage of "scratching" cycle, the inhibition magnitude depending on the intensity of a sensory signal run along high threshold afferent fibers. The moments in the scratching cycle, in which the afferent signal caused no rearrangement in scratching generator activity, were discovered for all investigated afferent inputs. These moments corresponded to the transitions from one scratching cycle phase to another. Integral afferent activity was distributed unevenly in the cycle during real scratching. The main part of it was observed just in that scratching cycle part which included the above mentioned no rearrangement phase points. The data obtained allowed us to conclude that the scratching generator should be considered as a working program for the motor optimal control system containing the intrinsic model of the controlled object dynamics (e.g. hindlimb scratching movement dynamics), which produces an inner analog of peripheral flow. This inner flow interacts with peripheral afferent inflow just as one of the latter components. Centrally originated modulation of primary afferent depolarization is a result of affecting the depolarization generating system by this inner "sensory" activity. It is the model, with the aid of which the generator can work after deafferentation. The functional organization of a central pattern generator is considered.

Afferent control of central pattern generators: experimental analysis of locomotion in the decerebrate cat.

PubMed

Baev, K V; Esipenko, V B; Shimansky YuP

1991-01-01

Changes in the motor activity of the spinal locomotor generator evoked by tonic and phasic peripheral afferent signals during fictitious locomotion of both slow and fast rhythms were analysed in the cat. The tonic afferent inflow was conditioned by the position of the hindlimb. The phasic afferent signals were imitated by electrical stimulation of hindlimb nerves. The correlation between the kinematics of hindlimb locomotor movement and sensory inflow was investigated during actual locomotion. Reliable correlations between motor activity parameters during fictitious locomotion were revealed in cases of both slow and fast "locomotor" rhythms. The main difference between these cases was that correlations "duration-intensity" were positive in the first and negative in the second case. The functional role of "locomotor" pattern dependence on tonic sensory inflow consisted of providing stability for planting the hindlimb on the ground. For any investigated afferent input the phase moments in the "locomotor" cycle were found, in which an afferent signal caused no rearrangement in locomotor generator activity. These moments corresponded to the transitions between "flexion" and "extension" phases and to the bursts of integral afferent activity observed during real locomotion. The data obtained are compared with the results previously described for the scratching generator. The character of changes in "locomotor" activity in response to tonic and phasic sensory signals was similar to that of such changes in "scratching" rhythm in the case of fast "locomotion". Intensification of the "flexion" phase caused by phasic high-intensity stimulation of cutaneous afferents during low "locomotor" rhythm was changed to inhibition (such as observed during "scratching") when this rhythm was fast. It is concluded that the main regularities of peripheral afferent control for both the locomotor and scratching generators are the same. Moreover, these central pattern generators are just working regimes of a general spinal motor optimal control system containing the intrinsic model of limb movement dynamics. The consequences of this concept and ways of further research are discussed.

Electronegativity Equalization Method: Parameterization and Validation for Large Sets of Organic, Organohalogene and Organometal Molecule

PubMed Central

Vařeková, Radka Svobodová; Jiroušková, Zuzana; Vaněk, Jakub; Suchomel, Šimon; Koča, Jaroslav

2007-01-01

The Electronegativity Equalization Method (EEM) is a fast approach for charge calculation. A challenging part of the EEM is the parameterization, which is performed using ab initio charges obtained for a set of molecules. The goal of our work was to perform the EEM parameterization for selected sets of organic, organohalogen and organometal molecules. We have performed the most robust parameterization published so far. The EEM parameterization was based on 12 training sets selected from a database of predicted 3D structures (NCI DIS) and from a database of crystallographic structures (CSD). Each set contained from 2000 to 6000 molecules. We have shown that the number of molecules in the training set is very important for quality of the parameters. We have improved EEM parameters (STO-3G MPA charges) for elements that were already parameterized, specifically: C, O, N, H, S, F and Cl. The new parameters provide more accurate charges than those published previously. We have also developed new parameters for elements that were not parameterized yet, specifically for Br, I, Fe and Zn. We have also performed crossover validation of all obtained parameters using all training sets that included relevant elements and confirmed that calculated parameters provide accurate charges.

The Directed Case Method.

ERIC Educational Resources Information Center

Cliff, William H.; Curtin, Leslie Nesbitt

2000-01-01

Provides an example of a directed case on human anatomy and physiology. Uses brief real life newspaper articles and clinical descriptions of medical reference texts to describe an actual, fictitious, or composite event. Includes interrelated human anatomy and physiology topics in the scenario. (YDS)

Inventing Life-Forms: The Creation of an Extraterrestrial Species.

ERIC Educational Resources Information Center

Science Activities, 1996

1996-01-01

Presents activities in which students play the role of cadets performing missions for the fictitious SETI (Search for Extraterrestrial Intelligence) Academy. Guides students toward an understanding of evolutionary forces and how they are affected by the physical environment. (JRH)

Our Town

ERIC Educational Resources Information Center

Robinson, Amanda

2015-01-01

This article outlines an issue-based lesson for a physical science course in which students investigate potential alternative energy sources for Alternatown, a fictitious city. Students are randomly selected to serve as town council members or as representatives of different alternative energy source options put before the council. The…

Rapid jetting status inspection and accurate droplet volume measurement for a piezo drop-on-demand inkjet print head using a scanning mirror for display applications

NASA Astrophysics Data System (ADS)

Shin, Dong-Youn; Kim, Minsung

2017-02-01

Despite the inherent fabrication simplicity of piezo drop-on-demand inkjet printing, the non-uniform deposition of colourants or electroluminescent organic materials leads to faulty display products, and hence, the importance of rapid jetting status inspection and accurate droplet volume measurement increases from a process perspective. In this work, various jetting status inspections and droplet volume measurement methods are reviewed by discussing their advantages and disadvantages, and then, the opportunities for the developed prototype with a scanning mirror are explored. This work demonstrates that jetting status inspection of 384 fictitious droplets can be performed within 17 s with maximum and minimum measurement accuracies of 0.2 ± 0.5 μ m for the fictitious droplets of 50 μ m in diameter and -1.2 ± 0.3 μ m for the fictitious droplets of 30 μ m in diameter, respectively. In addition to the new design of an inkjet monitoring instrument with a scanning mirror, two novel methods to accurately measure the droplet volume by amplifying a minute droplet volume difference and then converting to other physical properties are suggested and the droplet volume difference of ±0.3% is demonstrated to be discernible using numerical simulations, even with the low measurement accuracy of 1 μ m . When the fact is considered that the conventional vision-based method with a CCD camera requires the optical measurement accuracy less than 25 nm to measure the volume of an in-flight droplet in the nominal diameter of 50 μ m at the same volume measurement accuracy, the suggested method with the developed prototype offers a whole new opportunity to inkjet printing for display applications.

Rapid jetting status inspection and accurate droplet volume measurement for a piezo drop-on-demand inkjet print head using a scanning mirror for display applications.

PubMed

Shin, Dong-Youn; Kim, Minsung

2017-02-01

Despite the inherent fabrication simplicity of piezo drop-on-demand inkjet printing, the non-uniform deposition of colourants or electroluminescent organic materials leads to faulty display products, and hence, the importance of rapid jetting status inspection and accurate droplet volume measurement increases from a process perspective. In this work, various jetting status inspections and droplet volume measurement methods are reviewed by discussing their advantages and disadvantages, and then, the opportunities for the developed prototype with a scanning mirror are explored. This work demonstrates that jetting status inspection of 384 fictitious droplets can be performed within 17 s with maximum and minimum measurement accuracies of 0.2 ± 0.5 μm for the fictitious droplets of 50 μm in diameter and -1.2 ± 0.3 μm for the fictitious droplets of 30 μm in diameter, respectively. In addition to the new design of an inkjet monitoring instrument with a scanning mirror, two novel methods to accurately measure the droplet volume by amplifying a minute droplet volume difference and then converting to other physical properties are suggested and the droplet volume difference of ±0.3% is demonstrated to be discernible using numerical simulations, even with the low measurement accuracy of 1 μm. When the fact is considered that the conventional vision-based method with a CCD camera requires the optical measurement accuracy less than 25 nm to measure the volume of an in-flight droplet in the nominal diameter of 50 μm at the same volume measurement accuracy, the suggested method with the developed prototype offers a whole new opportunity to inkjet printing for display applications.

Fictitious Domain Methods for Fracture Models in Elasticity.

NASA Astrophysics Data System (ADS)

Court, S.; Bodart, O.; Cayol, V.; Koko, J.

2014-12-01

As surface displacements depend non linearly on sources location and shape, simplifying assumptions are generally required to reduce computation time when inverting geodetic data. We present a generic Finite Element Method designed for pressurized or sheared cracks inside a linear elastic medium. A fictitious domain method is used to take the crack into account independently of the mesh. Besides the possibility of considering heterogeneous media, the approach permits the evolution of the crack through time or more generally through iterations: The goal is to change the less things we need when the crack geometry is modified; In particular no re-meshing is required (the boundary conditions at the level of the crack are imposed by Lagrange multipliers), leading to a gain of computation time and resources with respect to classic finite element methods. This method is also robust with respect to the geometry, since we expect to observe the same behavior whatever the shape and the position of the crack. We present numerical experiments which highlight the accuracy of our method (using convergence curves), the optimality of errors, and the robustness with respect to the geometry (with computation of errors on some quantities for all kind of geometric configurations). We will also provide 2D benchmark tests. The method is then applied to Piton de la Fournaise volcano, considering a pressurized crack - inside a 3-dimensional domain - and the corresponding computation time and accuracy are compared with results from a mixed Boundary element method. In order to determine the crack geometrical characteristics, and pressure, inversions are performed combining fictitious domain computations with a near neighborhood algorithm. Performances are compared with those obtained combining a mixed boundary element method with the same inversion algorithm.

U-2 with fictitious NASA markings to support CIA cover story for pilot Gary Powers, shot down over S

NASA Technical Reports Server (NTRS)

1960-01-01

After Francis Gary Powers was shot down over the Soviet Union during a CIA spy flight on 1 May 1960, NASA issued a press release with a cover story about a U-2 conducting weather research that may have strayed off course after the pilot 'reported difficulties with his oxygen equipment.' To bolster the cover-up, a U-2 was quickly painted in NASA markings, with a fictitious NASA serial number, and put on display for the news media at the NASA Flight Research Center at Edwards Air Force Base on 6 May 1960. The next day, Soviet Premier Nikita Kruschev exposed the cover-up by revealing that the pilot had been captured, and espionage equipment had been recovered from the wreckage. 7 May 1956 - NACA Director Dr. Hugh L. Dryden issues a press release stating that U-2 aircraft are conducting weather research for NACA with Air Force support from Watertown, Nevada. 22 May 1956 - A second press release is issued with cover story for U-2 aircraft operating overseas. 1 May 1960 - Francis Gary Powers is shot down near Sverdlovsk. 6 May 1960 - U-2 with fictitious NASA serial number and NASA markings is shown to news media to bolster cover story of NASA weather research flights with U-2. 7 May 1960 - Soviet Premier Kruschev announces capture and confession of Powers. 1960 - Dr. Hugh L. Dryden tells senate committee that some 200 U-2 flights carrying NASA weather instrumentation have taken place since 1956. 2 April 1971 - NASA receives two U-2C aircraft for high-altitude research.

Teens With Heavy Prenatal Cocaine Exposure Respond to Experimental Social Provocation with Escape Not Aggression

PubMed Central

Greenwald, M.K.; Chiodo, L.M.; Hannigan, J.H.; Sokol, R.J.; Janisse, J.; Delaney-Black, V.

2010-01-01

Preclinical data show that, compared to no exposure, prenatal cocaine exposure (PCE) has age-dependent effects on social interaction and aggression. The aim of this clinical study was to determine how heavy/persistent PCE – after controlling for other prenatal drug exposures, sex and postnatal factors – predicts behavioral sensitivity to provocation (i.e., reactive aggression) using a well-validated human laboratory model of aggression. African American teens (mean = 14.2 yrs old) with histories of heavy/persistent PCE (maternal cocaine use ≥ 2 times/week during pregnancy, or positive maternal or infant urine/meconium test at delivery; n = 86) or none/some exposure (NON: maternal cocaine use < 2 times/week during pregnancy; n = 330) completed the Point Subtraction Aggression Paradigm. In this task, teens competed in a computer game against a fictitious opponent. There were three possible responses: (a) earn points, to exchange for money later; or (b) “aggress” against the fictitious opponent by subtracting their points; or (c) escape temporarily from point subtraction perpetrated by the fictitious opponent. The PCE group responded significantly more frequently on the escape option than the NON group, but did not differ in aggressive or money-earning responses. These data indicate that PCE-teens provoked with a social stressor exhibit a behavioral preference for escape (negative reinforcement) more than for aggressive (retaliatory) or appetitive (point- or money-reinforced) responses. These findings are consistent with preclinical data showing that social provocation of adolescent or young adult offspring after PCE is associated with greater escape behavior, inferring greater submission, social withdrawal, or anxiety, as opposed to aggressive behavior. PMID:20600841

Use of Direct Dynamics Simulations to Determine Unimolecular Reaction Paths and Arrhenius Parameters for Large Molecules.

PubMed

Yang, Li; Sun, Rui; Hase, William L

2011-11-08

In a previous study (J. Chem. Phys.2008, 129, 094701) it was shown that for a large molecule, with a total energy much greater than its barrier for decomposition and whose vibrational modes are harmonic oscillators, the expressions for the classical Rice-Ramsperger-Kassel-Marcus (RRKM) (i.e., RRK) and classical transition-state theory (TST) rate constants become equivalent. Using this relationship, a molecule's unimolecular rate constants versus temperature may be determined from chemical dynamics simulations of microcanonical ensembles for the molecule at different total energies. The simulation identifies the molecule's unimolecular pathways and their Arrhenius parameters. In the work presented here, this approach is used to study the thermal decomposition of CH3-NH-CH═CH-CH3, an important constituent in the polymer of cross-linked epoxy resins. Direct dynamics simulations, at the MP2/6-31+G* level of theory, were used to investigate the decomposition of microcanonical ensembles for this molecule. The Arrhenius A and Ea parameters determined from the direct dynamics simulation are in very good agreement with the TST Arrhenius parameters for the MP2/6-31+G* potential energy surface. The simulation method applied here may be particularly useful for large molecules with a multitude of decomposition pathways and whose transition states may be difficult to determine and have structures that are not readily obvious.

A Memo from Machiavelli.

ERIC Educational Resources Information Center

Julius, Daniel J.; Pfeffer, Jeffrey; Baldridge, J. Victor

1999-01-01

A fictitious memorandum from Niccolo Machiavelli, a 15th-century author, to college presidents, senior administrators, and faculty leaders seeking change in higher education offers suggestions for organizational development and governance in the form of ten rules and related change tactics. Topics addressed include integrity, team-building,…

Detecting Discrimination in Audit and Correspondence Studies

ERIC Educational Resources Information Center

Neumark, David

2012-01-01

Audit studies testing for discrimination have been criticized because applicants from different groups may not appear identical to employers. Correspondence studies address this criticism by using fictitious paper applicants whose qualifications can be made identical across groups. However, Heckman and Siegelman (1993) show that group differences…

26 CFR 1.6015-0 - Table of contents.

Code of Federal Regulations, 2011 CFR

2011-04-01

... all qualifying joint filers. (a) In general. (b) Understatement. (c) Knowledge or reason to know. (d...) Actual knowledge. (i) In general. (A) Omitted income. (B) Deduction or credit. (1) Erroneous deductions in general. (2) Fictitious or inflated deduction. (ii) Partial knowledge. (iii) Knowledge of the...

The Australopithecus Afarensis (Lucy) of Higher Education.

ERIC Educational Resources Information Center

Gamble, John King

1999-01-01

Uses a fictitious character and story to express doubts about the use of business and marketing principles in American higher education. Asserts that higher education is profoundly different from other institutions, and that colleges and universities should be shielded from the vagaries of the market. (CAK)

Venus - Atmospheric rotation.

NASA Technical Reports Server (NTRS)

Scott, A. H.; Reese, E. J.

1972-01-01

Photographs of Venus taken in ultraviolet light from Sept. 29, 1963, to May 29, 1971, indicate a general planet-wide circulation in the upper atmosphere of that planet having velocities which varied with time from -87 to -127m/sec at the equator. Positional measurements on 67 pairs of photographs which show the recurrence of similar patterns after intervals of one to three rotations suggest an asymmetric bimodal distribution of these velocities. The ultraviolet markings appear to be randomly distributed and quite ephemeral in nature, rarely enduring in a recognizable pattern for more than 20 days and usually much less. Attention is directed to an apparent but fictitious mean sidereal rotation period of approximately 4.06 days derived from observations which are made at a single station and span many months or years. Under such conditions this fictitious value for the rotation period is produced by the commensurability of the one-day period of earth and the assumed four-day period of the atmosphere of Venus.

Time Domain Propagation of Quantum and Classical Systems using a Wavelet Basis Set Method

NASA Astrophysics Data System (ADS)

Lombardini, Richard; Nowara, Ewa; Johnson, Bruce

2015-03-01

The use of an orthogonal wavelet basis set (Optimized Maximum-N Generalized Coiflets) to effectively model physical systems in the time domain, in particular the electromagnetic (EM) pulse and quantum mechanical (QM) wavefunction, is examined in this work. Although past research has demonstrated the benefits of wavelet basis sets to handle computationally expensive problems due to their multiresolution properties, the overlapping supports of neighboring wavelet basis functions poses problems when dealing with boundary conditions, especially with material interfaces in the EM case. Specifically, this talk addresses this issue using the idea of derivative matching creating fictitious grid points (T.A. Driscoll and B. Fornberg), but replaces the latter element with fictitious wavelet projections in conjunction with wavelet reconstruction filters. Two-dimensional (2D) systems are analyzed, EM pulse incident on silver cylinders and the QM electron wave packet circling the proton in a hydrogen atom system (reduced to 2D), and the new wavelet method is compared to the popular finite-difference time-domain technique.

Agreeableness and alcohol-related aggression: the mediating effect of trait aggressivity.

PubMed

Miller, Cameron A; Parrott, Dominic J; Giancola, Peter R

2009-12-01

This study investigated the mediating effect of trait aggressivity on the relation between agreeableness and alcohol-related aggression in a laboratory setting. Participants were 116 healthy male social drinkers between 21 and 30 years of age. Agreeableness and trait aggressivity were measured using the Big Five Inventory and the Buss-Perry Aggression Questionnaire, respectively. Following the consumption of an alcohol or no-alcohol control beverage, participants completed a modified version of the Taylor Aggression Paradigm, in which electric shocks were received from and administered to a fictitious opponent during a competitive task. Aggression was operationalized as the proportion of the most extreme shocks delivered to the fictitious opponent under conditions of low and high provocation. Results indicated that lower levels of agreeableness were associated with higher levels of trait aggressivity. In turn, higher levels of trait aggressivity predicted extreme aggression in intoxicated, but not sober, participants under low, but not high, provocation. Findings highlight the importance of examining determinants of intoxicated aggression within a broader theoretical framework of personality.

Analysis of solid particles falling down and interacting in a channel with sedimentation using fictitious boundary method

NASA Astrophysics Data System (ADS)

Usman, K.; Walayat, K.; Mahmood, R.; Kousar, N.

2018-06-01

We have examined the behavior of solid particles in particulate flows. The interaction of particles with each other and with the fluid is analyzed. Solid particles can move freely through a fixed computational mesh using an Eulerian approach. Fictitious boundary method (FBM) is used for treating the interaction between particles and the fluid. Hydrodynamic forces acting on the particle's surface are calculated using an explicit volume integral approach. A collision model proposed by Glowinski, Singh, Joseph and coauthors is used to handle particle-wall and particle-particle interactions. The particulate flow is computed using multigrid finite element solver FEATFLOW. Numerical experiments are performed considering two particles falling and colliding and sedimentation of many particles while interacting with each other. Results for these experiments are presented and compared with the reference values. Effects of the particle-particle interaction on the motion of the particles and on the physical behavior of the fluid-particle system has been analyzed.

Efficient vibration mode analysis of aircraft with multiple external store configurations

NASA Technical Reports Server (NTRS)

Karpel, M.

1988-01-01

A coupling method for efficient vibration mode analysis of aircraft with multiple external store configurations is presented. A set of low-frequency vibration modes, including rigid-body modes, represent the aircraft. Each external store is represented by its vibration modes with clamped boundary conditions, and by its rigid-body inertial properties. The aircraft modes are obtained from a finite-element model loaded by dummy rigid external stores with fictitious masses. The coupling procedure unloads the dummy stores and loads the actual stores instead. The analytical development is presented, the effects of the fictitious mass magnitudes are discussed, and a numerical example is given for a combat aircraft with external wing stores. Comparison with vibration modes obtained by a direct (full-size) eigensolution shows very accurate coupling results. Once the aircraft and stores data bases are constructed, the computer time for analyzing any external store configuration is two to three orders of magnitude less than that of a direct solution.

Cometary spliting - a source for the Jupiter family?

NASA Astrophysics Data System (ADS)

Pittich, E. M.; Rickman, H.

1994-01-01

The quest for the origin of the Jupiter family of comets includes investigating the possibility that a large fraction of this population originates from past splitting events. In particular, one suggested scenario, albeit less attractive on physical grounds, maintains that a giant comet breakup is a major source of short-period comets. By simulating such events and integrating the motions of the fictitious fragments in an accurate solar system model for the typical lifetime of Jupiter family comets, it is possible to check whether the outcome may or may not be compatible with the observed orbital distribution. In this paper we present such integrations for a few typical progenitor orbits and analyze the ensuing thermalization process with particular attention to the Tisserand parameters. It is found that the sets of fragments lose their memory of a common origin very rapidly so that, in general terms, it is difficult to use the random appearance of the observed orbital distribution as evidence against the giant comet splitting hypothesis.

Proposal for generating synthetic magnetic fields in hexagonal optical lattices

NASA Astrophysics Data System (ADS)

Tian, Binbin; Endres, Manuel; Pekker, David

2015-05-01

We propose a new approach to generating synthetic magnetic fields in ultra cold atom systems that does not rely on either Raman transitions nor periodic drive. Instead, we consider a hexagonal optical lattice produced by the intersection of three laser beams at 120 degree angles, where the intensity of one or more of the beams is spatially non-uniform. The resulting optical lattice remains hexagonal, but has spatially varying hopping matrix elements. For atoms near the Dirac points, these spatial variations appear as a gauge field, similar to the fictitious gauge field that is induced for for electrons in strained graphene. We suggest that a robust way to generate a gauge field that corresponds to a uniform flux is to aligning three gaussian beams to intersect in an equilateral triangle. Using realistic experimental parameters, we show how the proposed setup can be used to observe cyclotron motion of an atom cloud - the conventional Hall effect and distinct Landau levels - the integer quantum Hall effect.

A wideband FMBEM for 2D acoustic design sensitivity analysis based on direct differentiation method

NASA Astrophysics Data System (ADS)

Chen, Leilei; Zheng, Changjun; Chen, Haibo

2013-09-01

This paper presents a wideband fast multipole boundary element method (FMBEM) for two dimensional acoustic design sensitivity analysis based on the direct differentiation method. The wideband fast multipole method (FMM) formed by combining the original FMM and the diagonal form FMM is used to accelerate the matrix-vector products in the boundary element analysis. The Burton-Miller formulation is used to overcome the fictitious frequency problem when using a single Helmholtz boundary integral equation for exterior boundary-value problems. The strongly singular and hypersingular integrals in the sensitivity equations can be evaluated explicitly and directly by using the piecewise constant discretization. The iterative solver GMRES is applied to accelerate the solution of the linear system of equations. A set of optimal parameters for the wideband FMBEM design sensitivity analysis are obtained by observing the performances of the wideband FMM algorithm in terms of computing time and memory usage. Numerical examples are presented to demonstrate the efficiency and validity of the proposed algorithm.

Simple, stable and reliable modeling of gas properties of organic working fluids in aerodynamic designs of turbomachinery for ORC and VCC

NASA Astrophysics Data System (ADS)

Kawakubo, T.

2016-05-01

A simple, stable and reliable modeling of the real gas nature of the working fluid is required for the aerodesigns of the turbine in the Organic Rankine Cycle and of the compressor in the Vapor Compression Cycle. Although many modern Computational Fluid Dynamics tools are capable of incorporating real gas models, simulations with such a gas model tend to be more time-consuming than those with a perfect gas model and even can be unstable due to the simulation near the saturation boundary. Thus a perfect gas approximation is still an attractive option to stably and swiftly conduct a design simulation. In this paper, an effective method of the CFD simulation with a perfect gas approximation is discussed. A method of representing the performance of the centrifugal compressor or the radial-inflow turbine by means of each set of non-dimensional performance parameters and translating the fictitious perfect gas result to the actual real gas performance is presented.

The Fast Scattering Code (FSC): Validation Studies and Program Guidelines

NASA Technical Reports Server (NTRS)

Tinetti, Ana F.; Dunn, Mark H.

2011-01-01

The Fast Scattering Code (FSC) is a frequency domain noise prediction program developed at the NASA Langley Research Center (LaRC) to simulate the acoustic field produced by the interaction of known, time harmonic incident sound with bodies of arbitrary shape and surface impedance immersed in a potential flow. The code uses the equivalent source method (ESM) to solve an exterior 3-D Helmholtz boundary value problem (BVP) by expanding the scattered acoustic pressure field into a series of point sources distributed on a fictitious surface placed inside the actual scatterer. This work provides additional code validation studies and illustrates the range of code parameters that produce accurate results with minimal computational costs. Systematic noise prediction studies are presented in which monopole generated incident sound is scattered by simple geometric shapes - spheres (acoustically hard and soft surfaces), oblate spheroids, flat disk, and flat plates with various edge topologies. Comparisons between FSC simulations and analytical results and experimental data are presented.

The Trial of Napoleon: A Case Study for Using Mock Trials.

ERIC Educational Resources Information Center

MacKay, Charles

2000-01-01

Describes a course entitled "The Trial of Napoleon Bonaparte" that focuses on a fictitious mock trial of Napoleon Bonaparte to answer the question: did Napoleon pervert or preserve the gain of the French Revolution? Discusses the strengths and weaknesses of the course. (CMK)

Ethics & the CEO. Panel discussion.

PubMed

Yuspeh, A; Ryan, M J; Dalton, J E; Tong, D A; Hofmann, P B

1998-01-20

When does a golden parachute become a bribe? How should an imperiled hospital serve both its mission and the interests of good business? H&HN put five executives on the spot with these questions, asking them to respond to a fictitious scenario inspired by today's headlines. Here's what they said.

Ethics in Government.

ERIC Educational Resources Information Center

Update on Law-Related Education, 1990

1990-01-01

Presents a lesson developed by the Center for Civic Education giving secondary students the opportunity to explore ethical issues in government from the perspective of corrective justice. Outlines role plays and other class activities based on a fictitious ethics scandal involving bribery. Identifies specific questions to be asked on issues of…

36 CFR 2.32 - Interfering with agency functions.

Code of Federal Regulations, 2010 CFR

2010-07-01

... and rescue operations, wildlife management operations involving animals that pose a threat to public safety, law enforcement actions, and emergency operations that involve a threat to public safety or park... order and public safety. (3) False information. Knowingly giving a false or fictitious report or other...

36 CFR 1002.32 - Interfering with agency functions.

Code of Federal Regulations, 2010 CFR

2010-07-01

... operations, wildlife management operations involving animals that pose a threat to public safety, law enforcement actions, and emergency operations that involve a threat to public safety or resources of the area... necessary to maintain order and public safety. (3) False information. Knowingly giving a false or fictitious...

Use of Time-Series, ARIMA Designs to Assess Program Efficacy.

ERIC Educational Resources Information Center

Braden, Jeffery P.; And Others

1990-01-01

Illustrates use of time-series designs for determining efficacy of interventions with fictitious data describing drug-abuse prevention program. Discusses problems and procedures associated with time-series data analysis using Auto Regressive Integrated Moving Averages (ARIMA) models. Example illustrates application of ARIMA analysis for…

Beach Street: Student's Book 2.

ERIC Educational Resources Information Center

Delaruelle, Susan

The student's textbook contains lessons in intermediate English based on a fictitious community in Australia and its inhabitants. Lessons focus on two types of interaction: those with an interpersonal motivation (e.g., casual conversations), and those with pragmatic motivation (e.g., buying and selling, seeking help). The casual conversations are…

Scenario design and basic analysis of the National Data Centre Preparedness Exercise 2013

NASA Astrophysics Data System (ADS)

Ross, Ole; Ceranna, Lars; Hartmann, Gernot; Gestermann, Nicolai; Bönneman, Christian

2014-05-01

The Comprehensive Nuclear-Test-Ban Treaty (CTBT) prohibits all kinds of nuclear explosions. For the detection of treaty violations the International Monitoring System (IMS) operates stations observing seismic, hydroacoustic, and infrasound signals as well as radioisotopes in the atmosphere. While the IMS data is collected, processed and technically analyzed in the International Data Center (IDC) of the CTBT-Organization, National Data Centers (NDC) provide interpretation and advice to their government concerning suspicious detections occurring in IMS data. NDC Preparedness Exercises (NPE) are regularly performed dealing with fictitious treaty violations to practice the combined analysis of CTBT verification technologies and for the mutual exchange of information between NDC and also with the IDC. The NPE2010 and NPE2012 trigger scenarios were based on selected seismic events from the Reviewed Event Bulletin (REB) serving as starting point for fictitious Radionuclide dispersion. The main task was the identification of the original REB event and the discrimination between earthquakes and explosions as source. The scenario design of NPE2013 differs from those of previous NPEs. The waveform event selection is not constrained to events in the REB. The exercise trigger is a combination of a tempo-spatial indication pointing to a certain waveform event and simulated radionuclide concentrations generated by forward Atmospheric Transport Modelling based on a fictitious release. For the waveform event the date (4 Sept. 2013) is given and the region is communicated in a map showing the fictitious state of "Frisia" at the Coast of the North Sea in Central Europe. The synthetic radionuclide detections start in Vienna (8 Sept, I-131) and Schauinsland (11 Sept, Xe-133) with rather low activity concentrations and are most prominent in Stockholm and Spitsbergen mid of September 2013. Smaller concentrations in Asia follow later on. The potential connection between the waveform and radionuclide evidence remains unclear. The verification task is to identify the waveform event and to investigate potential sources of the radionuclide findings. Finally the potential conjunction between the sources and the CTBT-relevance of the whole picture has to be evaluated. The overall question is whether requesting an On-Site-Inspection in "Frisia" would be justified. The poster presents the NPE2013 scenario and gives a basic analysis of the initial situation concerning both waveform detections and atmospheric dispersion conditions in Central Europe in early September 2013. The full NPE2013 scenario will be presented at the NDC Workshop mid of May 2014.

The Hoffmeister asteroid family

NASA Astrophysics Data System (ADS)

Carruba, V.; Novaković, B.; Aljbaae, S.

2017-03-01

The Hoffmeister family is a C-type group located in the central main belt. Dynamically, it is important because of its interaction with the ν1C nodal secular resonance with Ceres, which significantly increases the dispersion in inclination of family members at a lower semimajor axis. As an effect, the distribution of inclination values of the Hoffmeister family at a semimajor axis lower than its centre is significantly leptokurtic, and this can be used to set constraints on the terminal ejection velocity field of the family at the time it was produced. By performing an analysis of the time behaviour of the kurtosis of the vW component of the ejection velocity field [γ2(vW)], as obtained from Gauss' equations, for different fictitious Hoffmeister families with different values of the ejection velocity field, we were able to exclude that the Hoffmeister family should be older than 335 Myr. Constraints from the currently observed inclination distribution of the Hoffmeister family suggest that its terminal ejection velocity parameter VEJ should be lower than 25 m s-1. Results of a Yarko-YORP Monte Carlo method to family dating, combined with other constraints from inclinations and γ2(vW), indicate that the Hoffmeister family should be 220^{+60}_{-40} Myr old, with an ejection parameter VEJ = 20 ± 5 m s-1.

Biomolecular Force Field Parameterization via Atoms-in-Molecule Electron Density Partitioning.

PubMed

Cole, Daniel J; Vilseck, Jonah Z; Tirado-Rives, Julian; Payne, Mike C; Jorgensen, William L

2016-05-10

Molecular mechanics force fields, which are commonly used in biomolecular modeling and computer-aided drug design, typically treat nonbonded interactions using a limited library of empirical parameters that are developed for small molecules. This approach does not account for polarization in larger molecules or proteins, and the parametrization process is labor-intensive. Using linear-scaling density functional theory and atoms-in-molecule electron density partitioning, environment-specific charges and Lennard-Jones parameters are derived directly from quantum mechanical calculations for use in biomolecular modeling of organic and biomolecular systems. The proposed methods significantly reduce the number of empirical parameters needed to construct molecular mechanics force fields, naturally include polarization effects in charge and Lennard-Jones parameters, and scale well to systems comprised of thousands of atoms, including proteins. The feasibility and benefits of this approach are demonstrated by computing free energies of hydration, properties of pure liquids, and the relative binding free energies of indole and benzofuran to the L99A mutant of T4 lysozyme.

34 CFR 33.2 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

... statement: (a) Has actual knowledge that the claim or statement is false, fictitious, or fraudulent; (b... administrative enforcement action under this part, and that he or she has the right to representation by counsel or to self-representation. (Authority: 31 U.S.C. 3803(g)(2)(F)) Reviewing official means the General...

34 CFR 33.2 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

... statement: (a) Has actual knowledge that the claim or statement is false, fictitious, or fraudulent; (b... administrative enforcement action under this part, and that he or she has the right to representation by counsel or to self-representation. (Authority: 31 U.S.C. 3803(g)(2)(F)) Reviewing official means the General...

A Critical Evaluation of Academic Internal Audit

ERIC Educational Resources Information Center

Blackmore, Jacqueline Ann

2004-01-01

This account of internal audit is set within the context of higher education in the UK and a fictitiously named Riverbank University. The study evaluates the recent introduction of "Internal Academic Audit" to the University and compares the process with that of the internationally recognized ISO 19011 Guidelines for Auditing Quality…

Classroom Teacher's Idea Notebook.

ERIC Educational Resources Information Center

Blake, Norv; And Others

1988-01-01

Offers activities for high school and middle school classrooms. First activity deals with war crimes by projecting fictitious Soviet fighting in Afghanistan into the story of William Calley in Vietnam. Second activity uses the Underground Railroad during the U.S. Civil War in an interdisciplinary approach. Third activity is a self-discovery…

Lord Kelvin and the Age-of-the-Earth Debate: A Dramatization.

ERIC Educational Resources Information Center

Stinner, Art; Tecihman, Jurgen

2003-01-01

Presents a dramatization of a fictitious debate about the age of the earth that takes place at the Royal Institution, London, England, in the year 1872 among Sir William Thomson, T.H. Huxley, Sir Charles Lyell, and Hermann von Helmholtz. (Contains 17 references.) (Author/YDS)

Processes and Knowledge in Designing Instruction.

ERIC Educational Resources Information Center

Greeno, James G.; And Others

Results from a study of problem solving in the domain of instructional design are presented. Subjects were eight teacher trainees who were recent graduates of or were enrolled in the Stanford Teacher Education Program at Stanford University (California). Subjects studied a computer-based tutorial--the VST2000--about a fictitious vehicle. The…

Artificial Intelligence in a German Adventure Game: Spion in PROLOG.

ERIC Educational Resources Information Center

Molla, Steven R.; And Others

1988-01-01

Spion, an adventure game for intermediate and advanced college German students, requires players to communicate with a fictitious agent in complete, correct German sentences. The spy game was written in PROLOG, runs on an IBM-PC, and is available at no cost for noncommercial purposes. (Author/CB)

The Vocational-Liberal Arts Controversy: Looking Backwards.

ERIC Educational Resources Information Center

Miles, Sue L.

The liberal arts-vocational education controversy is examined in this article through a series of fictitious letters based on historical facts that present the thoughts of key educational personalities regarding the community college's role in providing vocational education and liberal arts education. Part I, which takes the form of a letter and…

Breezy Power: From Wind to Energy

ERIC Educational Resources Information Center

Claymier, Bob

2009-01-01

This lesson combines the science concepts of renewable energy and producing electricity with the technology concepts of design, constraints, and technology's impact on the environment. Over five class periods, sixth-grade students "work" for a fictitious power company as they research wind as an alternative energy source and design and test a…

Murder They Wrote. A Cross-Curricular Cooperative Learning Experience.

ERIC Educational Resources Information Center

Gaither, Linda

This document contains a cross-curricular cooperative learning experience that is designed to give high school students career and technical educational experiences in the areas of forensic sciences and criminalistics by doing the forensic work to "solve" a fictitious murder. The activities included in the cooperative learning experience…

77 FR 65631 - Retrospective Review Under E.O. 13563: Seamen's Claims; Admiralty Extension Act Claims; and...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-30

... and all other penalty provisions for making false, fictitious, or fraudulent claims, statements or...'s knowledge, information, and belief. If the person's signature does not include the first name... the claimant's knowledge, information, and belief. If the person's signature does not include the...

A More Perfect Commodity: Bottled Water, Global Accumulation, and Local Contestation

ERIC Educational Resources Information Center

Jaffee, Daniel; Newman, Soren

2013-01-01

Bottled water sits at the intersection of debates regarding the social and environmental effects of the commodification of nature and the ways neoliberal globalization alters the provision of public services. Utilizing Polanyi's concept of fictitious commodities and Harvey's work on accumulation by dispossession, this article traces bottled…

JPRS Report, Soviet Union: Political Affairs

DTIC Science & Technology

1988-02-23

conflicts and injustices. The system of "artistic coun- cils," "ratings," "authorization of lyrics ," etc., is based exclusively "on a subjective...its court essay , "A Fictitious Marriage and a Funeral Dress," told of this instance: S. Nevya- domskaya, a resident of Ordzhonikidze, having regis

Students' Conceptualisations of Function Revealed through Definitions and Examples

ERIC Educational Resources Information Center

Ayalon, Michal; Watson, Anne; Lerman, Steve

2017-01-01

This study aims to explore the conceptualisations of function that some students express when they are responding to fictitious students' statements about functions. We also asked them what is meant by "function" and many voluntarily used examples in their responses. The task was developed in collaboration with teachers from two…

"ELI"--The Educational Futures Game.

ERIC Educational Resources Information Center

Mahoney, V. L. Mike; Grantham, Lex

This report describes ELI, a computer-based educational game that gives participants, as citizens of fictitious cities, the opportunity to examine a variety of typical community issues relating to education within the context of broader city and regional problems. After a brief introduction, the game structure is described, including the setting…

Transportation Demand Management Planning At Multi-Tenant Buildings, An Example Of Tdm Planning During Project

DOT National Transportation Integrated Search

1988-09-01

THIS GUIDE FOR DEVELOPERS, BUILDING OWNERS AND BUILDING MANAGERS IS ONE IN A SERIES OF SAMPLES OF TDM PLANS THAT ILLUSTRATE THE DESIGN AND PROPOSED APPLICATION OF TDM STRATEGIES. THIS SAMPLE PLAN WAS PREPARED FOR A FICTITIOUS BUILDING MANAGER NEAR DO...

A Communication Skills Program Model. Rural Isolated Schools Program.

ERIC Educational Resources Information Center

Southeastern Education Lab., Atlanta, GA.

Contents of this report on a fictitiously named (Harold County) project, prepared as a guide in applying for Title III ESEA funding consideration, are in five parts. Part I projects basic ESEA statistical information, including budget, school enrollment, project participation, staff members engaged, personnel for administration and implementation…

Los Dos Mundos: Rural Mexican Americans, Another America.

ERIC Educational Resources Information Center

Baker, Richard

This book explores race relations between Mexican Americans and Anglo Americans in "Middlewest," a fictitious name for an actual rural Idaho community with the highest proportion of Mexican Americans in the state. Many Mexican Americans in this predominantly agricultural area are current or former migrant workers. The first chapter…

Are Future Teachers Ready to Embrace Mathematical Inquiry?

ERIC Educational Resources Information Center

Acosta, Daniel

2014-01-01

This article describes a project inspired by Liping Ma's "Exploring New Knowledge" in which future 7-12 grade mathematics teachers enrolled in a fall 2013 capstone course at a typical regional state university were assigned fictitious student conjectures. These future teachers (all current high school mathematics teachers) were…

Beach Street: Teacher's Book 2.

ERIC Educational Resources Information Center

Delaruelle, Susan

The teacher's guide contains lessons in intermediate English based on a fictitious community in Australia and its inhabitants. Lessons focus on two types of interaction: those with an interpersonal motivation (e.g., casual conversations), and those with pragmatic motivation (e.g., buying and selling, seeking help). The teacher's book provides a…

Disability Discrimination in Higher Education: Analyzing the Quality of Counseling Services

ERIC Educational Resources Information Center

Deuchert, Eva; Kauer, Lukas; Liebert, Helge; Wuppermann, Carl

2017-01-01

We conduct a field experiment to analyze barriers disabled students face when entering higher education institutions. Fictitious high-school graduates request information regarding the admission process and special accommodations to ease studying. Potential applicants randomly reveal one of four impairment types. Response rates are similar for all…

7 CFR 795.14 - Changes in farming operations.

Code of Federal Regulations, 2010 CFR

2010-01-01

... existing under law, to divide, sell, transfer, rent, or lease his or her property if such division, sale, transfer, rental arrangement, or lease is legally binding as between the parties thereto. However, any document representing a division, sale, transfer, rental arrangement, or lease which is fictitious or not...

What Does Financial Literacy Training Teach Us?

ERIC Educational Resources Information Center

Carlin, Bruce Ian; Robinson, David T.

2012-01-01

The authors use data from a finance-related theme park to explore how financial education changes investment, financing, and consumer behavior. Students were assigned fictitious life situations and asked to create household budgets. Some students received a 19-hour financial literacy curriculum before going to the park, and some did not. After…

Educating Native Students: Inspiring Future Leaders.

ERIC Educational Resources Information Center

Lee, Tiffany

2003-01-01

A 7-week summer program for college-bound American Indian students prepares them for college and trains them to become leaders. Through role playing a fictitious Native tribe, students encounter realistic dilemmas similar to those facing tribal governments and realize that tribal leaders' decisions involve many social and political issues…

The ALAN Review. Winter 1986.

ERIC Educational Resources Information Center

Reed, Arthea, Ed.

1986-01-01

Intended for junior or senior high school English teachers, articles and features in this journal issue focus on young adult literature and the adolescent audience. The first article, Kevin Major's "The Truth about My Fictitious Friends," describes the genesis of the author's fiction writing for the Newfoundland audience, and is followed…

19 CFR 351.405 - Calculation of normal value based on constructed value.

Code of Federal Regulations, 2010 CFR

2010-04-01

... value. 351.405 Section 351.405 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE... constructed value as the basis for normal value where: neither the home market nor a third country market is... a fictitious market are disregarded; no contemporaneous sales of comparable merchandise are...

Modeling of the phase equilibria of polystyrene in methylcyclohexane with semi-empirical quantum mechanical methods I.

PubMed

Wilczura-Wachnik, Hanna; Jónsdóttir, Svava Osk

2003-04-01

A method for calculating interaction parameters traditionally used in phase-equilibrium computations in low-molecular systems has been extended for the prediction of solvent activities of aromatic polymer solutions (polystyrene+methylcyclohexane). Using ethylbenzene as a model compound for the repeating unit of the polymer, the intermolecular interaction energies between the solvent molecule and the polymer were simulated. The semiempirical quantum chemical method AM1, and a method for sampling relevant internal orientations for a pair of molecules developed previously were used. Interaction energies are determined for three molecular pairs, the solvent and the model molecule, two solvent molecules and two model molecules, and used to calculated UNIQUAC interaction parameters, a(ij) and a(ji). Using these parameters, the solvent activities of the polystyrene 90,000 amu+methylcyclohexane system, and the total vapor pressures of the methylcyclohexane+ethylbenzene system were calculated. The latter system was compared to experimental data, giving qualitative agreement. Figure Solvent activities for the methylcylcohexane(1)+polystyrene(2) system at 316 K. Parameters aij (blue line) obtained with the AM1 method; parameters aij (pink line) from VLE data for the ethylbenzene+methylcyclohexane system. The abscissa is the polymer weight fraction defined as y2(x1)=(1mx1)M2/[x1M1+(1mx1)M2], where x1 is the solvent mole fraction and Mi are the molecular weights of the components.

Multi-parameter phenotypic profiling: using cellular effects to characterize small-molecule compounds.

PubMed

Feng, Yan; Mitchison, Timothy J; Bender, Andreas; Young, Daniel W; Tallarico, John A

2009-07-01

Multi-parameter phenotypic profiling of small molecules provides important insights into their mechanisms of action, as well as a systems level understanding of biological pathways and their responses to small molecule treatments. It therefore deserves more attention at an early step in the drug discovery pipeline. Here, we summarize the technologies that are currently in use for phenotypic profiling--including mRNA-, protein- and imaging-based multi-parameter profiling--in the drug discovery context. We think that an earlier integration of phenotypic profiling technologies, combined with effective experimental and in silico target identification approaches, can improve success rates of lead selection and optimization in the drug discovery process.

77 FR 68181 - Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Notice of Filing...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-11-15

... FINRA rules must be designed to prevent fraudulent and manipulative acts and practices, to promote just... which may be distributed or published by any member or person associated with a member, and the persons... such rules be designed to produce fair and informative quotations, to prevent fictitious or misleading...

Saint Anne: A Multicultural Education Dilemma.

ERIC Educational Resources Information Center

Bruce, Bill; And Others

This 5-hour simulation is designed to give secondary- and college-level students and community persons the opportunity to deal with multicultural issues in a typical organizational and community setting. St. Anne is a fictitious town of 75,000 residents with two major ethnic neighborhoods--one German and the other Swedish. The local paper industry…

Obesity, Attractiveness, and Differential Treatment in Hiring: A Field Experiment

ERIC Educational Resources Information Center

Rooth, Dan-Olof

2009-01-01

This study presents evidence of differential treatment in the hiring of obese individuals in the Swedish labor market. Fictitious applications were sent to real job openings. The applications were sent in pairs, where one facial photo of an otherwise identical applicant was manipulated to show the individual as obese. Applications sent with the…

Financial Responsibilities of Governing Boards of Colleges and Universities.

ERIC Educational Resources Information Center

Association of Governing Boards of Universities and Colleges, 1979

1979-01-01

A reference manual on financial activities of a college or university and the interactive role of the governing board is presented for board members and institutional officers who provide information to the board. Financial data related to a fictitious hybrid university are included. After identifying three broad kinds of financial information…

The Effect of Online College Attendance on Job Obtainment through Social Connections

ERIC Educational Resources Information Center

Taggart, Gabel

2017-01-01

Attending college online has implications for students' ability to make social connections and eventually obtain jobs by means of social capital. Previous academic work has tested employer callback rates to fictitious resumes treated by indications of either online or face-to-face college attendance but such methods overlook the networking aspect…

Debunking Coriolis Force Myths

ERIC Educational Resources Information Center

Shakur, Asif

2014-01-01

Much has been written and debated about the Coriolis force. Unfortunately, this has done little to demystify the paradoxes surrounding this fictitious force invoked by an observer in a rotating frame of reference. It is the purpose of this article to make another valiant attempt to slay the dragon of the Coriolis force! This will be done without…

College Students' Attitudes toward Adoption: A Brief Note

ERIC Educational Resources Information Center

Bonds-Raacke, Jennifer M.

2009-01-01

In the current experiment, college students were presented with a scenario describing a fictitious couple that was adding another child to their family. The specific circumstances under which this addition was occurring, varied yielding a 2 (adoption status) X 2 (number of current children) X 2 (financial status) between subjects design. After…

Effect of Psychopathy on Physical Aggression Toward Gay and Heterosexual Men

ERIC Educational Resources Information Center

Parrott, Dominic J.; Zeichner, Amos

2006-01-01

The purpose of this investigation was to examine the effect of psychopathy on antigay aggression. Participants were 84 heterosexual men who competed in an aggression paradigm in which electric shocks were received from and administered to a randomly determined fictitious opponent (heterosexual male, gay male) during a competitive reaction time…

45 CFR 681.3 - What is the basis for the imposition of civil penalties and assessments?

Code of Federal Regulations, 2010 CFR

2010-10-01

... (Continued) NATIONAL SCIENCE FOUNDATION PROGRAM FRAUD CIVIL REMEDIES ACT REGULATIONS Purpose, Definitions... is supported by any written statement which asserts a material fact which is false, fictitious, or fraudulent; (iii) Includes or is supported by any written statement that— (A) Omits a material fact; (B) Is...

45 CFR 681.3 - What is the basis for the imposition of civil penalties and assessments?

Code of Federal Regulations, 2012 CFR

2012-10-01

... (Continued) NATIONAL SCIENCE FOUNDATION PROGRAM FRAUD CIVIL REMEDIES ACT REGULATIONS Purpose, Definitions... is supported by any written statement which asserts a material fact which is false, fictitious, or fraudulent; (iii) Includes or is supported by any written statement that— (A) Omits a material fact; (B) Is...

45 CFR 681.3 - What is the basis for the imposition of civil penalties and assessments?

Code of Federal Regulations, 2014 CFR

2014-10-01

... (Continued) NATIONAL SCIENCE FOUNDATION PROGRAM FRAUD CIVIL REMEDIES ACT REGULATIONS Purpose, Definitions... is supported by any written statement which asserts a material fact which is false, fictitious, or fraudulent; (iii) Includes or is supported by any written statement that— (A) Omits a material fact; (B) Is...

45 CFR 681.3 - What is the basis for the imposition of civil penalties and assessments?

Code of Federal Regulations, 2011 CFR

2011-10-01

... (Continued) NATIONAL SCIENCE FOUNDATION PROGRAM FRAUD CIVIL REMEDIES ACT REGULATIONS Purpose, Definitions... is supported by any written statement which asserts a material fact which is false, fictitious, or fraudulent; (iii) Includes or is supported by any written statement that— (A) Omits a material fact; (B) Is...

45 CFR 681.3 - What is the basis for the imposition of civil penalties and assessments?

Code of Federal Regulations, 2013 CFR

2013-10-01

... (Continued) NATIONAL SCIENCE FOUNDATION PROGRAM FRAUD CIVIL REMEDIES ACT REGULATIONS Purpose, Definitions... is supported by any written statement which asserts a material fact which is false, fictitious, or fraudulent; (iii) Includes or is supported by any written statement that— (A) Omits a material fact; (B) Is...

Emotion Regulation Strategies in European American and Hong Kong Chinese Middle School Children

ERIC Educational Resources Information Center

Wan, Kayan Phoebe; Savina, Elena

2016-01-01

This study explored emotion regulation strategies in middle school European American (N = 54) and Hong Kong Chinese (N = 89) children. Children were presented with scenarios describing a fictitious girl/boy who encountered situations eliciting sadness, anger, and fear. Based on Gross' theory (1998), the survey of emotion regulation strategies was…

The Wholesale Monkey Business. An Accounting Program. Operator's Manual.

ERIC Educational Resources Information Center

Thompson, Charles D.

Designed to combine a family of related jobs in the accounting field into a realistic learning atmosphere, this simulation revolves around a fictitious company that distributes pet supplies. The simulation has been kept flexible and open-ended to allow for its incorporation into any clerical, bookkeeping, or accounting instructional program.…

Teaching Case: MiHotel--Applicant Processing System Design Case

ERIC Educational Resources Information Center

Miller, Robert E.; Dunn, Paul

2018-01-01

This teaching case describes the functionality of an applicant processing system designed for a fictitious hotel chain. The system detailed in the case includes a webform where applicants complete and submit job applications. The system also includes a desktop application used by hotel managers and Human Resources to track applications and process…

Teaching Negotiation in the Context of Environmental Regulatory Enforcement: An Experiential Learning Approach

ERIC Educational Resources Information Center

Choy, Marisa S.; Johnson, Stephen A.; Ortolano, Leonard

2011-01-01

This article describes a simulation-based teaching approach that helps university students learn about negotiation in the context of environmental regulatory enforcement. The approach centers on negotiation of a penalty between government agencies and a fictitious corporation that has violated provisions of the U.S. Clean Water Act. The exercise…

Common Elements Enhance or Retard Negative Patterning Discrimination Learning Depending on Modality of Stimuli

ERIC Educational Resources Information Center

Redhead, Edward S.; Curtis, Cheryl

2013-01-01

Human contingency learning studies were used to compare the predictions of configural and elemental theories. In two experiments, participants were required to learn which stimuli were associated with an increase in core temperature of a fictitious nuclear plant. Experiments investigated the rate at which a simple negative patterning…

Proffitt, Dorsey & Huff, Inc. An Administrative Assistant Position Simulation. Employee's Manual. Office Occupations.

ERIC Educational Resources Information Center

Pickens Area Vocational-Technical School, Jasper, GA.

This employee's manual, part of a series of publications for use in implementing an administrative assistant simulation designed for students enrolled in a postsecondary-level office applications laboratory, outlines the office rules of a fictitious insurance company, Proffitt, Dorsey & Huff, Inc., that functions as both a sales and a service…

Dealing with a Disagreeing Partner: Relational and Epistemic Conflict Elaboration

ERIC Educational Resources Information Center

Darnon, Celine; Doll, Sebastien; Butera, Fabrizio

2007-01-01

This experiment examined the effects of epistemic vs. relational conflicts on the relationship with a partner. Students participated to a fictitious computer-mediated interaction about a text with a bogus partner who introduced either an epistemic conflict (a conflict that referred to the content of the text), or a relational conflict (a conflict…

Social Networking Website Users and Privacy Concerns: A Mixed Methods Investigation

DTIC Science & Technology

2009-03-01

teen girl that committed suicide after dealing with a fictitious personality on MySpace. As a result, the purpose of this research was to...Facebook from girls getting messages on Facebook of girls doing ridiculous poses and almost naked saying, ‘Hello, I see that you work in Loreal. I just

RUPS: Research Utilizing Problem Solving. Classroom Version. Leader's Manual.

ERIC Educational Resources Information Center

Jung, Charles; And Others

This training manual is for teachers participating in the Research Utilizing Problem Solving (RUPS) workshops. The workshops last for four and one-half days and are designed to improve the school setting and to increase teamwork skills. The teachers participate in simulation exercises in which they help a fictitious teacher or principal solve a…

Learner-Generated Content and Engagement in Second Language Task Performance

ERIC Educational Resources Information Center

Lambert, Craig; Philp, Jenefer; Nakamura, Sachiko

2017-01-01

This study investigates the benefits of designing second language (L2) learning tasks to operate on learner-generated content (related to actual content in their lives and experiences) as opposed to teacher-generated content typical of current approaches to L2 task design (fictitious ideas and events created to provide an opportunity for…

82 FR 58411 - Agency Information Collection Activities; Submission for Office of Management and Budget Review...

Federal Register 2010, 2011, 2012, 2013, 2014

2017-12-12

... be in the form of a web page for a fictitious drug targeted toward consumers who have chronic pain or... prescription drug information in multiple formats--including print, television, web, and other modes--would be... framed items. Moreover, the slider questions referenced by the commenter are semantic differentials...

An Exercise in Paleobiogeographic Similarity for Undergraduate Stratigraphy and Paleontology Courses.

ERIC Educational Resources Information Center

Shea, James Herbert

1987-01-01

Describes an exercise which provides a small data set consisting of the localities where various genera of a fictitious group of fossil "Archaeomorphs" have been found on various continental blocks. The activity can be used to develop hypotheses regarding plate tectonic processes and the present arrangement of fossil localities. (TW)

Writing News Spots about Science: A Way to Promote Scientific Literacy

ERIC Educational Resources Information Center

Marks, Ralf; Otten, Juliane; Eilks, Ingo

2010-01-01

Use of the "Journalist Method" in science education is described, in which pupils are asked to create short news presentations (we call them news spots) for a fictitious television newscast about science-related issues. The writing of such news spots by cooperative teams of pupils is supported by collections of background information…

Episodic Memory and Event Construction in Aging and Amnesia

ERIC Educational Resources Information Center

Romero, Kristoffer; Moscovitch, Morris

2012-01-01

Construction of imaginative or fictitious events requires the flexible recombination of stored information into novel representations. How this process is accomplished is not understood fully. To address this problem, older adults (mean age = 74.2; Experiment 1) and younger patients with MTL lesions (mean age = 54.2; Experiment 2), both of whom…

Standardized Tests and Other Criteria in Admissions Decisions: A Classroom Activity

ERIC Educational Resources Information Center

Pawlow, Laura A.

2010-01-01

This exercise aims to provide a hands-on, role-playing activity that requires students to evaluate the strengths and limitations of standardized tests in making admission decisions. Small groups pretend to be an admissions committee and review fictitious student applications containing both standardized test scores and other information admissions…

They're Why I'm Dead.

ERIC Educational Resources Information Center

Cross, William C.

This tongue-in-cheek paper represents that ideal and fictitious being, "Joe Personnel", as envisioned by critics of regularly-organized student personnel services. They contend that, since people have, for centuries, handled their own problems, they should be capable of doing so today, and that any assistance needed can be provided by a single…

KSC01pp0739

NASA Image and Video Library

2001-04-05

KENNEDY SPACE CENTER, FLA. -- A medevac helicopter assists with transporting “victims” during a staged mass casualty exercise in the Launch Complex 39 area. Employees are playing roles in the fictitious sniper attack that is being staged to validate capabilities of KSC’s fire, medical, helicopter transport and security personnel to respond to such an event.

KSC01pp0737

NASA Image and Video Library

2001-04-05

KENNEDY SPACE CENTER, FLA. -- Medical, paramedic and other personnel attend to role-playing “victims” on the grass in the Launch Complex 39 area. It is the site of a staged mass casualty exercise designed to validate capabilities of KSC’s fire, medical, helicopter transport and security personnel to respond to an event such as this fictitious sniper attack

KSC01pp0740

NASA Image and Video Library

2001-04-05

KENNEDY SPACE CENTER, FLA. -- Rescue personnel place a “victim” in a medevac helicopter during a staged mass casualty exercise in the Launch Complex 39 area. Employees are playing roles in the fictitious sniper attack that is being staged to validate capabilities of KSC’s fire, medical, helicopter transport and security personnel to respond to such an event

Efficient integration method for fictitious domain approaches

NASA Astrophysics Data System (ADS)

Duczek, Sascha; Gabbert, Ulrich

2015-10-01

In the current article, we present an efficient and accurate numerical method for the integration of the system matrices in fictitious domain approaches such as the finite cell method (FCM). In the framework of the FCM, the physical domain is embedded in a geometrically larger domain of simple shape which is discretized using a regular Cartesian grid of cells. Therefore, a spacetree-based adaptive quadrature technique is normally deployed to resolve the geometry of the structure. Depending on the complexity of the structure under investigation this method accounts for most of the computational effort. To reduce the computational costs for computing the system matrices an efficient quadrature scheme based on the divergence theorem (Gauß-Ostrogradsky theorem) is proposed. Using this theorem the dimension of the integral is reduced by one, i.e. instead of solving the integral for the whole domain only its contour needs to be considered. In the current paper, we present the general principles of the integration method and its implementation. The results to several two-dimensional benchmark problems highlight its properties. The efficiency of the proposed method is compared to conventional spacetree-based integration techniques.

A fictitious domain approach for the simulation of dense suspensions

NASA Astrophysics Data System (ADS)

Gallier, Stany; Lemaire, Elisabeth; Lobry, Laurent; Peters, François

2014-01-01

Low Reynolds number concentrated suspensions do exhibit an intricate physics which can be partly unraveled by the use of numerical simulation. To this end, a Lagrange multiplier-free fictitious domain approach is described in this work. Unlike some methods recently proposed, the present approach is fully Eulerian and therefore does not need any transfer between the Eulerian background grid and some Lagrangian nodes attached to particles. Lubrication forces between particles play an important role in the suspension rheology and have been properly accounted for in the model. A robust and effective lubrication scheme is outlined which consists in transposing the classical approach used in Stokesian Dynamics to our present direct numerical simulation. This lubrication model has also been adapted to account for solid boundaries such as walls. Contact forces between particles are modeled using a classical Discrete Element Method (DEM), a widely used method in granular matter physics. Comprehensive validations are presented on various one-particle, two-particle or three-particle configurations in a linear shear flow as well as some O(103) and O(104) particle simulations.

Strategic use of preference confirmation in group decision making: the role of competition and dissent.

PubMed

Toma, Claudia; Gilles, Ingrid; Butera, Fabrizio

2013-03-01

The present research investigates the moderating role of goal interdependence and dissent on individual preference confirmation in hidden-profile tasks. We propose that preference confirmation can be used strategically to deal with competition and dissent likely to arise in group decision making. In two studies, participants first received incomplete information about a car accident investigation, and then read a fictitious discussion with two other participants containing full information. The interaction with the fictitious participants was presented either as cooperative or competitive. We predicted and found preference confirmation to be higher in competition than cooperation, when initial preferences were dissenting (Studies 1 & 2), but to be higher in cooperation than in competition, when initial preferences were consensual (Study 2). Also, the increased versus decreased preference confirmation in competition with, respectively, dissent and no dissent were found to be predicted by self-enhancement strategies (Study 2). These findings contribute to a better understanding of the boundary conditions of preference confirmation in hidden profiles and shed a new light on the role of motivated information processing in these tasks. © 2011 The British Psychological Society.

Effects of Working Memory Capacity and Domain Knowledge on Recall for Grocery Prices.

PubMed

Bermingham, Douglas; Gardner, Michael K; Woltz, Dan J

2016-01-01

Hambrick and Engle (2002) proposed 3 models of how domain knowledge and working memory capacity may work together to influence episodic memory: a "rich-get-richer" model, a "building blocks" model, and a "compensatory" model. Their results supported the rich-get-richer model, although later work by Hambrick and Oswald (2005) found support for a building blocks model. We investigated the effects of domain knowledge and working memory on recall of studied grocery prices. Working memory was measured with 3 simple span tasks. A contrast of realistic versus fictitious foods in the episodic memory task served as our manipulation of domain knowledge, because participants could not have domain knowledge of fictitious food prices. There was a strong effect for domain knowledge (realistic food-price pairs were easier to remember) and a moderate effect for working memory capacity (higher working memory capacity produced better recall). Furthermore, the interaction between domain knowledge and working memory produced a small but significant interaction in 1 measure of price recall. This supported the compensatory model and stands in contrast to previous research.

Antecedent descriptions change brain reactivity to emotional stimuli: a functional magnetic resonance imaging study of an extrinsic and incidental reappraisal strategy.

PubMed

Mocaiber, I; Sanchez, T A; Pereira, M G; Erthal, F S; Joffily, M; Araujo, D B; Volchan, E; de Oliveira, L

2011-10-13

In the present study we investigated whether individuals would take advantage of an extrinsic and incidental reappraisal strategy by giving them precedent descriptions to attenuate the emotional impact of unpleasant pictures. In fact, precedent descriptions have successfully promoted down-regulation of electrocortical activity and physiological responses to unpleasant pictures. However, the neuronal substrate underlying this effect remains unclear. Particularly, we investigated whether amygdala and insula responses, brain regions consistently implicated in emotional processing, would be modulated by this strategy. To achieve this, highly unpleasant pictures were shown in two contexts in which a prior description presented them as taken from movie scenes (fictitious) or real scenes. Results showed that the fictitious condition was characterized by down-regulation of amygdala and insula responses. Thus, the present study provides new evidence on reappraisal strategies to down-regulate emotional reactions and suggest that amygdala and insula responses to emotional stimuli are adaptive and highly flexible. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

Stabilization of time domain acoustic boundary element method for the exterior problem avoiding the nonuniqueness.

PubMed

Jang, Hae-Won; Ih, Jeong-Guon

2013-03-01

The time domain boundary element method (TBEM) to calculate the exterior sound field using the Kirchhoff integral has difficulties in non-uniqueness and exponential divergence. In this work, a method to stabilize TBEM calculation for the exterior problem is suggested. The time domain CHIEF (Combined Helmholtz Integral Equation Formulation) method is newly formulated to suppress low order fictitious internal modes. This method constrains the surface Kirchhoff integral by forcing the pressures at the additional interior points to be zero when the shortest retarded time between boundary nodes and an interior point elapses. However, even after using the CHIEF method, the TBEM calculation suffers the exponential divergence due to the remaining unstable high order fictitious modes at frequencies higher than the frequency limit of the boundary element model. For complete stabilization, such troublesome modes are selectively adjusted by projecting the time response onto the eigenspace. In a test example for a transiently pulsating sphere, the final average error norm of the stabilized response compared to the analytic solution is 2.5%.

L’eggo My Ego: Reducing the Gender Gap in Math by Unlinking the Self from Performance

PubMed Central

Zhang, Shen; Schmader, Toni; Hall, William M.

2012-01-01

Stereotype threat can vary in source, with targets being threatened at the individual and/or group level. This study examines specifically the role of self-reputational threat in women’s underperformance in mathematics. A pilot study shows that women report concerns about experiencing self-reputational threat that are distinct from group threat in the domain of mathematics. In the main study, we manipulated whether performance was linked to the self by asking both men and women to complete a math test using either their real name or a fictitious name. Women who used a fictitious name, and thus had their self unlinked from the math test, showed significantly higher math performance and reported less self-threat and distraction, relative to those who used their real names. Men were unaffected by the manipulation. These findings suggest that women’s impaired math performance is often due to the threat of confirming a negative stereotype as being true of the self. The implications for understanding the different types of threats faced by stereotyped groups, particularly among women in math settings, are discussed. PMID:24223027

Shock-free turbomachinery blade design

NASA Technical Reports Server (NTRS)

Beauchamp, P. P.; Seebass, A. R.

1985-01-01

A computational method for designing shock-free, quasi-three-dimensional, transonic, turbomachinery blades is described. Shock-free designs are found by implementing Sobieczky's fictitious gas principle in the analysis of a baseline shape, resulting in an elliptic solution that is incorrect in the supersonic domain. Shock-free designs are obtained by combining the subsonic portion of this solution with a characteristic calculation of the correct supersonic flow using the sonic line data from the fictitious elliptic solution. This provides a new, shock-free blade design. Examples presented include the removal of shocks from two blades in quasi-three-dimensional flow and the development of a series of shock-free two-dimensional stators. The new designs all include modifications to the upper surface of an experimental stator blade developed at NASA Lewis Research Center. While the designs presented here are for inviscid flow, the same concepts have been successfully applied to the shock-free design of airfoils and three-dimensional wings with viscous effects. The extension of the present method to viscous flows is straightforward given a suitable analysis algorithm for the flow.

Eyeglasses for Children - a Survey of Daily Practice.

PubMed

Hagander, C E; Traber, G; Landau, K; Jaggi, G P

2016-04-01

Glasses for children are recommended and prescribed by different groups of professionals. We set out to compare the prescription practices of ophthalmologists, orthoptists and optometrists/opticians in Switzerland. Online questionnaire on the prescription and recommendation of glasses in fictitious cases of children of different ages, refractive values and symptoms. The questionnaire was sent out to members of the Swiss Ophthalmological Society, Swiss Orthoptics and Schweizerischer Berufsverband für Augenoptik und Optometrie. 307 questionnaires were analysed. Optometrists/opticians recommended glasses with a significantly smaller cycloplegic refraction value (p < 0.005) than did orthoptists and ophthalmologists. In the example of a 14-year-old asymptomatic child, ophthalmologists recommended glasses at + 2.64 [Dpt], orthoptists at + 2.44 [Dpt] and optometrists/opticians at + 1.32 [Dpt]. Optometrists/opticians tended to recommend slightly higher correction values in glasses than did ophthalmologists and orthoptists. In Switzerland, optometrists/opticians recommend glasses with significantly smaller cycloplegic refraction values than do orthoptists and ophthalmologists, regardless of age or symptoms described in these fictitious cases. Georg Thieme Verlag KG Stuttgart · New York.

Observing a fictitious stressful event: haematological changes, including circulating leukocyte activation.

PubMed

Mian, Rubina; Shelton-Rayner, Graham; Harkin, Brendan; Williams, Paul

2003-03-01

The aim of this study was to assess the effect of watching a psychological stressful event on the activation of leukocytes in healthy human volunteers. Blood samples were obtained from 32 healthy male and female subjects aged between 20 and 26 years before, during and after either watching an 83-minute horror film that none of the subjects had previously seen (The Texas Chainsaw Massacre, 1974) or by sitting quietly in a room (control group). Total differential cell counts, leukocyte activation as measured by the nitroblue tetrazolium (NBT) test, heart rate and blood pressure (BP) measurements were taken at defined time points. There were significant increases in peripheral circulating leukocytes, the number of activated circulating leukocytes, haemoglobin (Hb) concentration and haematocrit (Hct) in response to the stressor. These were accompanied by significant increases in heart rate, systolic and diastolic BP (P<0.05 from baseline). This is the first reported study on the effects of observing a psychologically stressful, albeit fictitious event on circulating leukocyte numbers and the state of leukocyte activation as determined by the nitrotetrazolium test.

Relativistic theory of particles in a scattering flow I: basic equations, diffusion and drift.

NASA Astrophysics Data System (ADS)

Achterberg, A.; Norman, C. A.

2018-06-01

We reconsider the theory of particle transport in a scattering medium, allowing for relativistic flow velocities. The theory uses a mixed set of variables, with position and time measured in the Laboratory Frame, and particle energy and momentum measured in the Fluid Rest Frame, the reference frame where scattering is assumed to be elastic. We give a new derivation for the fictitious force terms in the equation of motion that are present if the Fluid Rest Frame is not an inertial frame. By using a 3+1 notation we discuss the physical interpretation of the different terms in the fictitious force. It is shown that different approaches to the problem of particle propagation in a magnetized medium due to Skilling (1975) and Kulsrud (1983) are largely equivalent. We extend known results for non-relativistic flows to include the effects of cross-field diffusion for cosmic rays in a magnetized plasma. We also carefully consider the correct form of the diffusion approximation for scattering, and show that the resulting equations can be cast in conservation form.

Neither real nor fictitious but 'as if real'? A political ontology of the state.

PubMed

Hay, Colin

2014-09-01

The state is one of series of concepts (capitalism, patriarchy and class being others) which pose a particular kind of ontological difficulty and provoke a particular kind of ontological controversy - for it is far from self-evident that the object or entity to which they refer is in any obvious sense 'real'. In this paper I make the case for developing a distinct political ontology of the state which builds from such a reflection. In the process, I argue that the state is neither real nor fictitious, but 'as if real' - a conceptual abstraction whose value is best seen as an open analytical question. Thus understood, the state possesses no agency per se though it serves to define and construct a series of contexts within which political agency is both authorized (in the name of the state) and enacted (by those thereby authorized). The state is thus revealed as a dynamic institutional complex whose unity is at best partial, the constantly evolving outcome of unifying tendencies and dis-unifying counter-tendencies. © London School of Economics and Political Science 2014.

Optical characterization of randomly microrough surfaces covered with very thin overlayers using effective medium approximation and Rayleigh-Rice theory

NASA Astrophysics Data System (ADS)

Ohlídal, Ivan; Vohánka, Jiří; Čermák, Martin; Franta, Daniel

2017-10-01

The modification of the effective medium approximation for randomly microrough surfaces covered by very thin overlayers based on inhomogeneous fictitious layers is formulated. The numerical analysis of this modification is performed using simulated ellipsometric data calculated using the Rayleigh-Rice theory. The system used to perform this numerical analysis consists of a randomly microrough silicon single crystal surface covered with a SiO2 overlayer. A comparison to the effective medium approximation based on homogeneous fictitious layers is carried out within this numerical analysis. For ellipsometry of the system mentioned above the possibilities and limitations of both the effective medium approximation approaches are discussed. The results obtained by means of the numerical analysis are confirmed by the ellipsometric characterization of two randomly microrough silicon single crystal substrates covered with native oxide overlayers. It is shown that the effective medium approximation approaches for this system exhibit strong deficiencies compared to the Rayleigh-Rice theory. The practical consequences implied by these results are presented. The results concerning the random microroughness are verified by means of measurements performed using atomic force microscopy.

Anti AIDS drug design with the help of neural networks

NASA Astrophysics Data System (ADS)

Tetko, I. V.; Tanchuk, V. Yu.; Luik, A. I.

1995-04-01

Artificial neural networks were used to analyze and predict the human immunodefiency virus type 1 reverse transcriptase inhibitors. Training and control set included 44 molecules (most of them are well-known substances such as AZT, TIBO, dde, etc.) The biological activities of molecules were taken from literature and rated for two classes: active and inactive compounds according to their values. We used topological indices as molecular parameters. Four most informative parameters (out of 46) were chosen using cluster analysis and original input parameters' estimation procedure and were used to predict activities of both control and new (synthesized in our institute) molecules. We applied pruning network algorithm and network ensembles to obtain the final classifier and avoid chance correlation. The increasing of neural network generalization of the data from the control set was observed, when using the aforementioned methods. The prognosis of new molecules revealed one molecule as possibly active. It was confirmed by further biological tests. The compound was as active as AZT and in order less toxic. The active compound is currently being evaluated in pre clinical trials as possible drug for anti-AIDS therapy.

The error of L5/S1 joint moment calculation in a body-centered non-inertial reference frame when the fictitious force is ignored.

PubMed

Xu, Xu; Faber, Gert S; Kingma, Idsart; Chang, Chien-Chi; Hsiang, Simon M

2013-07-26

In ergonomics studies, linked segment models are commonly used for estimating dynamic L5/S1 joint moments during lifting tasks. The kinematics data input to these models are with respect to an arbitrary stationary reference frame. However, a body-centered reference frame, which is defined using the position and the orientation of human body segments, is sometimes used to conveniently identify the location of the load relative to the body. When a body-centered reference frame is moving with the body, it is a non-inertial reference frame and fictitious force exists. Directly applying a linked segment model to the kinematics data with respect to a body-centered non-inertial reference frame will ignore the effect of this fictitious force and introduce errors during L5/S1 moment estimation. In the current study, various lifting tasks were performed in the laboratory environment. The L5/S1 joint moments during the lifting tasks were calculated by a linked segment model with respect to a stationary reference frame and to a body-centered non-inertial reference frame. The results indicate that applying a linked segment model with respect to a body-centered non-inertial reference frame will result in overestimating the peak L5/S1 joint moments of the coronal plane, sagittal plane, and transverse plane during lifting tasks by 78%, 2%, and 59% on average, respectively. The instant when the peak moment occurred was delayed by 0.13, 0.03, and 0.09s on average, correspondingly for the three planes. The root-mean-square errors of the L5/S1 joint moment for the three planes are 21Nm, 19Nm, and 9Nm, correspondingly. Copyright © 2013 Elsevier Ltd. All rights reserved.

On the Astrid asteroid family

NASA Astrophysics Data System (ADS)

Carruba, V.

2016-09-01

Among asteroid families, the Astrid family is peculiar because of its unusual inclination distribution. Objects at a ≃ 2.764 au are quite dispersed in this orbital element, giving the family a `crab-like' appearance. Recent works showed that this feature is caused by the interaction of the family with the s - sC nodal secular resonance with Ceres, that spreads the inclination of asteroids near its separatrix. As a consequence, the currently observed distribution of the vW component of terminal ejection velocities obtained from inverting Gauss equation is quite leptokurtic, since this parameter mostly depends on the asteroids inclination. The peculiar orbital configuration of the Astrid family can be used to set constraints on key parameters describing the strength of the Yarkovsky force, such as the bulk and surface density and the thermal conductivity of surface material. By simulating various fictitious families with different values of these parameters, and by demanding that the current value of the kurtosis of the distribution in vW be reached over the estimated lifetime of the family, we obtained that the thermal conductivity of Astrid family members should be ≃0.001 W m-1 K-1, and that the surface and bulk density should be higher than 1000 kg m-3. Monte Carlo methods simulating Yarkovsky and stochastic Yarkovsky-O'Keefe-Radzievskii-Paddack (YORP) evolution of the Astrid family show its age to be T = 140 ± 30 Myr old, in good agreement with estimates from other groups. Its terminal ejection velocity parameter is in the range V_{EJ}= 5^{+17}_{-5} m s-1. Values of VEJ larger than 25 m s-1 are excluded from constraints from the current inclination distribution.

Vibrational spectroscopic and DFT calculation studies of 2-amino-7-bromo-5-oxo-[1]benzopyrano [2,3-b]pyridine-3 carbonitrile

NASA Astrophysics Data System (ADS)

Premkumar, S.; Jawahar, A.; Mathavan, T.; Kumara Dhas, M.; Milton Franklin Benial, A.

2015-03-01

The vibrational spectra of 2-amino-7-bromo-5-oxo-[1]benzopyrano [2,3-b]pyridine-3 carbonitrile were recorded using fourier transform-infrared and fourier transform-Raman spectrometer. The optimized structural parameters, vibrational frequencies, Mulliken atomic charge distribution, frontier molecular orbitals, thermodynamic properties, temperature dependence of thermodynamic parameters, first order hyperpolarizability and natural bond orbital calculations of the molecule were performed using the Gaussian 09 program. The vibrational frequencies were assigned on the basis of potential energy distribution calculation using the VEDA 4.0 program. The calculated first order hyperpolarizability of ABOBPC molecule was obtained as 6.908 × 10-30 issue, which was 10.5 times greater than urea. The nonlinear optical activity of the molecule was also confirmed by the frontier molecular orbitals and natural bond orbital analysis. The frontier molecular orbitals analysis shows that the lower energy gap of the molecule, which leads to the higher value of first order hyperpolarizability. The natural bond orbital analysis indicates that the nonlinear optical activity of the molecule arises due to the π → π∗ transitions. The Mulliken atomic charge distribution confirms the presence of intramolecular charge transfer within the molecule. The reactive site of the molecule was predicted from the molecular electrostatic potential contour map. The values of thermo dynamic parameters were increasing with increasing temperature.

Detecting ordered small molecule drug aggregates in live macrophages: a multi-parameter microscope image data acquisition and analysis strategy

PubMed Central

Rzeczycki, Phillip; Yoon, Gi Sang; Keswani, Rahul K.; Sud, Sudha; Stringer, Kathleen A.; Rosania, Gus R.

2017-01-01

Following prolonged administration, certain orally bioavailable but poorly soluble small molecule drugs are prone to precipitate out and form crystal-like drug inclusions (CLDIs) within the cells of living organisms. In this research, we present a quantitative multi-parameter imaging platform for measuring the fluorescence and polarization diattenuation signals of cells harboring intracellular CLDIs. To validate the imaging system, the FDA-approved drug clofazimine (CFZ) was used as a model compound. Our results demonstrated that a quantitative multi-parameter microscopy image analysis platform can be used to study drug sequestering macrophages, and to detect the formation of ordered molecular aggregates formed by poorly soluble small molecule drugs in animals. PMID:28270989

Detecting ordered small molecule drug aggregates in live macrophages: a multi-parameter microscope image data acquisition and analysis strategy.

PubMed

Rzeczycki, Phillip; Yoon, Gi Sang; Keswani, Rahul K; Sud, Sudha; Stringer, Kathleen A; Rosania, Gus R

2017-02-01

Following prolonged administration, certain orally bioavailable but poorly soluble small molecule drugs are prone to precipitate out and form crystal-like drug inclusions (CLDIs) within the cells of living organisms. In this research, we present a quantitative multi-parameter imaging platform for measuring the fluorescence and polarization diattenuation signals of cells harboring intracellular CLDIs. To validate the imaging system, the FDA-approved drug clofazimine (CFZ) was used as a model compound. Our results demonstrated that a quantitative multi-parameter microscopy image analysis platform can be used to study drug sequestering macrophages, and to detect the formation of ordered molecular aggregates formed by poorly soluble small molecule drugs in animals.

Using Science and Much More to Beat the Flood

ERIC Educational Resources Information Center

Seeley, Claire

2014-01-01

The Beat the Flood challenge involves designing and building a model flood-proof home, which is then tested in "flood" conditions. It is set on the fictitious Watu Island. The children form teams, with each team member being assigned a responsibility for the duration of the task--team leader, chief recorder, and resource manager. This…

Expanding the Lester Hill Experience: A Report on Two 'Branch Office' Simulations

ERIC Educational Resources Information Center

Melvin, Opal B.

1976-01-01

Describes use of the Lester Hill Office Simulation, a program taught at the Tishomingo County Area Vocational-Technical Center in Mississippi. A fictitious company which provides students with the opportunity to gain realistic office experience in a classroom setting. Suggested ideas and optional activities can be used by teachers as a starting…

Analyzing Data and Asking Questions at Shell School, Sea County Florida

ERIC Educational Resources Information Center

Vanover, Charles

2015-01-01

This case discusses early work to implement the Common Core State Standards at a fictitious school in Florida. The case is designed to support students' efforts to use school accountability data for inquiry and to conceptualize change in schools where previous leaders' efforts were not successful. Shell Elementary is an exurban school that serves…

Messages from Space: The Solar System and Beyond. Grades 508. Teacher's Guide. Great Explorations in Science (GEMS).

ERIC Educational Resources Information Center

Beals, Kevin; Erickson, John; Sneider, Cary

Building on collaborative work between the Search for Extraterrestrial Intelligence (SETI) Institute and the Lawrence Hall of Science, this curriculum takes advantage of humans' fascination with extraterrestrials to catalyze the study of the solar system and beyond. The unit begins when students attempt to decode a fictitious message from outer…

Statistical Power in Experimental Audit Studies: Cautions and Calculations for Matched Tests With Nominal Outcomes

ERIC Educational Resources Information Center

Vuolo, Mike; Uggen, Christopher; Lageson, Sarah

2016-01-01

Given their capacity to identify causal relationships, experimental audit studies have grown increasingly popular in the social sciences. Typically, investigators send fictitious auditors who differ by a key factor (e.g., race) to particular experimental units (e.g., employers) and then compare treatment and control groups on a dichotomous outcome…

Library Media Centers: Accessibility Issues in Rural Missouri

ERIC Educational Resources Information Center

Cox, John E.; Lynch, Debra M.

2006-01-01

Based on a study by Cox (2004), this article deals with the needs of students with visual, hearing, and orthopedic impairments in terms of full access to school library media centers. Fictitious vignettes of student concerns as well as possible answers and thought-provoking questions expand Cox's rural Missouri-based study to a much wider audience…

76 FR 34792 - Self-Regulatory Organizations; EDGX Exchange, Inc.; Notice of Filing and Immediate Effectiveness...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-14

... internalization, which occurs when two orders presented to the Exchange from the same Member (i.e., MPID) are... customer internalization. \\4\\ Members are advised to consult Rule 12.2 respecting fictitious trading. In SR... internalization fee is no more favorable than each prevailing maker/taker spread.'' In order to ensure that the...

The Effect of Hippocampal Damage in Children on Recalling the Past and Imagining New Experiences

ERIC Educational Resources Information Center

Cooper, Janine M.; Vargha-Khadem, Faraneh; Gadian, David G.; Maguire, Eleanor A.

2011-01-01

Compared to adults, relatively little is known about autobiographical memory and the ability to imagine fictitious and future scenarios in school-aged children, despite the importance of these functions for development and subsequent independent living. Even less is understood about the effect of early hippocampal damage on children's memory and…

Conjoint Influence of Maps and Auded Prose on Children's Retrieval of Instruction.

ERIC Educational Resources Information Center

Webb, James M.; And Others

1994-01-01

Ninety-six fifth-grade students studied a map of a fictitious island while twice listening to a related narrative with target feature and nonfeature items, cued by varying iconic and verbal stimuli in four map cue conditions. Memory for feature information and pictorial retrieval cues appeared to activate memory for nonfeature information. (SLD)

Teaching Case: IS Security Requirements Identification from Conceptual Models in Systems Analysis and Design: The Fun & Fitness, Inc. Case

ERIC Educational Resources Information Center

Spears, Janine L.; Parrish, James L., Jr.

2013-01-01

This teaching case introduces students to a relatively simple approach to identifying and documenting security requirements within conceptual models that are commonly taught in systems analysis and design courses. An introduction to information security is provided, followed by a classroom example of a fictitious company, "Fun &…

Collaborative Online Inquiry: Exploring Students' Skills in Locating, Reading, and Communicating Information

ERIC Educational Resources Information Center

Sekeres, Diane Carver; Castek, Jill

2016-01-01

This study examines third, fourth, and fifth grade students' reasoning that was captured as they engaged collaboratively in a teacher designed inquiry task. This task focused on choosing eco-friendly toys for a fictitious local toy store. Results indicated that students were more expressive with reasoning when they shared their ideas orally, but…

An Empirical Examination of Inter-Ethnic Stereotypes: Comparing Asian American and African American Employees.

ERIC Educational Resources Information Center

Gilbert, Jackie; Carr-Ruffino, Norma; Ivancevich, John M.; Lownes-Jackson, Millicent

2003-01-01

Undergraduates (n=127) read career histories (including photographs) of fictitious employees in a 2x2x2 design depicting job type (engineer/human resources), ethnicity (Asian or African American), and gender, with the same qualifications and performance information. African-American males were rated most negatively on work characteristics;…

Conceptual Problems in the Foundations of Mechanics

ERIC Educational Resources Information Center

Coelho, Ricardo Lopes

2012-01-01

There has been much research on principles and fundamental concepts of mechanics. Problems concerning the law of inertia, the concepts of force, fictitious force, weight, mass and the distinction between inertial and gravitational mass are addressed in the first part of the present paper. It is argued in the second that the law of inertia is the…

Evolution of a Planetary System. SETI Academy Planet Project.

ERIC Educational Resources Information Center

Search for Extraterrestrial Intelligence Inst., Mountain View, CA.

The SETI Academy Planet Project provides an exciting, informative, and creative series of activities for elementary students (grades 5-6) in these activities each student plays the role of a cadet at the SETI Academy, a fictitious institution. This unit examines the evolution of stars and planets which is an important aspect of the search for…

Eocene Footwear. The Power to Change the World.

ERIC Educational Resources Information Center

Eckert, Doug; Nemes, Mark; Wilson, Ruth; Tanner, Gwendolyn; Christman, Scott; Spiker, Karen; Maser, Bryan

This document is a class simulation that details the work of a fictitious consulting firm that was challenged by a group of 10 doctors (who were each willing to commit $50,000) to study the feasibility of starting a company that would employ the greatest possible number of people from Monongalia and Preston counties in northern West Virginia. The…

Mendel Meets CSI: Forensic Genotyping as a Method to Teach Genetics & DNA Science

ERIC Educational Resources Information Center

Kurowski, Scotia; Reiss, Rebecca

2007-01-01

This article describes a forensic DNA science laboratory exercise for advanced high school and introductory college level biology courses. Students use a commercial genotyping kit and genetic analyzer or gene sequencer to analyze DNA recovered from a fictitious crime scene. DNA profiling and STR genotyping are outlined. DNA extraction, PCR, and…

To Boldly Go...Or Not

ERIC Educational Resources Information Center

Zavrel, Erik

2008-01-01

This public-hearing case study is centered upon the recent decision by President George W. Bush to set NASA's primary goal as a return to the Moon, followed by a mission to Mars. The members on the expert panel are fictitious and the transcript contrived; however, the views expressed in the case study correspond to actual views held by leading…

Effects of Client Bisexuality on Clinical Judgment: When Is Bias Most Likely to Occur?

ERIC Educational Resources Information Center

Mohr, Jonathan J.; Weiner, Jennifer L.; Chopp, Regina M.; Wong, Stephanie J.

2009-01-01

In this study, the authors investigated whether psychotherapist bias related to client bisexuality is most likely to occur with respect to judgments about stereotype-relevant clinical issues. Participants were 108 psychotherapists who read a fictitious intake report about a male client who was portrayed as heterosexual, gay, or bisexual. Client…

"Chromoseratops Meiosus": A Simple, Two-Phase Exercise to Represent the Connection between Meiosis & Increased Genetic Diversity

ERIC Educational Resources Information Center

Eliyahu, Dorit

2014-01-01

I present an activity to help students make the connection between meiosis and genetic variation. The students model meiosis in the first phase of the activity, and by that process they produce gametes of a fictitious reptilobird species, "Chromoseratops meiosus." Later on, they will "mate" their gametes and produce a zygote…

A Posthumous Dialogue with John Nicolis: IERU

NASA Astrophysics Data System (ADS)

Rössler, Otto E.

2014-12-01

The reader is taken into the heart of a fictitious dialogue between two friends who never talked long enough with each other during the lifetime of both. It is the fearlessness of the mind of John that prompted the hopefully not too erratic thoughts that are going to be offered. The central figure is Heraclitus, the Great.

How Knowledge of Extenuating Circumstances Influences Community Reactions toward Suicide Victims and Their Bereaved Families.

ERIC Educational Resources Information Center

Range, Lillian M.; Martin, Stephen K.

1990-01-01

Examined how circumstances of a suicide victim's life may influence people's responses in college students (n=180) who read a fictitious newspaper article about a man who committed suicide following psychological pain, physical pain, or terminal illness. Results indicated that subjects were intolerant of suicide when the victim was suffering from…

Learning Opportunities in a Department-Wide Crisis Simulation: Bridging the International/National Divide

ERIC Educational Resources Information Center

Zaino, Jeanne S.; Mulligan, Tricia

2009-01-01

When designed and executed properly, role-playing simulations go a long way to enhance student learning. Typically, however, simulations are divided along subfields. Most exercises, whether based on real or fictitious events, either place students in various roles within a country or have them represent the international interests of one country…

The Rescue911 Emergency Response Information System (ERIS): A Systems Development Project Case

ERIC Educational Resources Information Center

Cohen, Jason F.; Thiel, Franz H.

2010-01-01

This teaching case presents a systems development project useful for courses in object-oriented analysis and design. The case has a strong focus on the business, methodology, modeling and implementation aspects of systems development. The case is centered on a fictitious ambulance and emergency services company (Rescue911). The case describes that…

11 CFR 9012.4 - Unlawful misrepresentations and falsification of statements, records or other evidence to the...

Code of Federal Regulations, 2012 CFR

2012-01-01

... of statements, records or other evidence to the Commission; refusal to furnish books and records... books and records. It shall be unlawful for any person knowingly and willfully— (a) To furnish any false, fictitious, or fraudulent evidence, books or information to the Commission under 11 CFR parts 9001-9008, or...

Attribution of Conditions for School Performance

ERIC Educational Resources Information Center

Flammer, August; Schmid, David

2003-01-01

210 children (110 girls and 100 boys) were interviewed individually about causes that lead to success or to failure in school tests. They were presented fictitious scenarios about an unknown peer who had either success or failure in a dictation task and a sums task. The free answers were taken as mirroring means-ends beliefs of the interviewed…

He's a Laker; She's a "Looker": The Consequences of Gender- Stereotypical Portrayals of Male and Female Athletes by the Print Media.

ERIC Educational Resources Information Center

Knight, Jennifer L.; Giuliano, Traci A.

2001-01-01

Investigated how gender-consistent and -inconsistent portrayals of athletes would affect people's perceptions. College students read fictitious newspaper articles that focused on either a male or female Olympic athlete's physical attractiveness or athleticism. Respondents had neither favorable impressions of nor liked articles about female and…

Loosely-Bound Diatomic Molecules.

ERIC Educational Resources Information Center

Balfour, W. J.

1979-01-01

Discusses concept of covalent bonding as related to homonuclear diatomic molecules. Article draws attention to the existence of bound rare gas and alkaline earth diatomic molecules. Summarizes their molecular parameters and offers spectroscopic data. Strength and variation with distance of interatomic attractive forces is given. (Author/SA)

Large scale study of multiple-molecule queries

PubMed Central

2009-01-01

Background In ligand-based screening, as well as in other chemoinformatics applications, one seeks to effectively search large repositories of molecules in order to retrieve molecules that are similar typically to a single molecule lead. However, in some case, multiple molecules from the same family are available to seed the query and search for other members of the same family. Multiple-molecule query methods have been less studied than single-molecule query methods. Furthermore, the previous studies have relied on proprietary data and sometimes have not used proper cross-validation methods to assess the results. In contrast, here we develop and compare multiple-molecule query methods using several large publicly available data sets and background. We also create a framework based on a strict cross-validation protocol to allow unbiased benchmarking for direct comparison in future studies across several performance metrics. Results Fourteen different multiple-molecule query methods were defined and benchmarked using: (1) 41 publicly available data sets of related molecules with similar biological activity; and (2) publicly available background data sets consisting of up to 175,000 molecules randomly extracted from the ChemDB database and other sources. Eight of the fourteen methods were parameter free, and six of them fit one or two free parameters to the data using a careful cross-validation protocol. All the methods were assessed and compared for their ability to retrieve members of the same family against the background data set by using several performance metrics including the Area Under the Accumulation Curve (AUAC), Area Under the Curve (AUC), F1-measure, and BEDROC metrics. Consistent with the previous literature, the best parameter-free methods are the MAX-SIM and MIN-RANK methods, which score a molecule to a family by the maximum similarity, or minimum ranking, obtained across the family. One new parameterized method introduced in this study and two previously defined methods, the Exponential Tanimoto Discriminant (ETD), the Tanimoto Power Discriminant (TPD), and the Binary Kernel Discriminant (BKD), outperform most other methods but are more complex, requiring one or two parameters to be fit to the data. Conclusion Fourteen methods for multiple-molecule querying of chemical databases, including novel methods, (ETD) and (TPD), are validated using publicly available data sets, standard cross-validation protocols, and established metrics. The best results are obtained with ETD, TPD, BKD, MAX-SIM, and MIN-RANK. These results can be replicated and compared with the results of future studies using data freely downloadable from http://cdb.ics.uci.edu/. PMID:20298525

A molecular dynamics study of model SI clathrate hydrates: the effect of guest size and guest-water interaction on decomposition kinetics.

PubMed

Das, Subhadip; Baghel, Vikesh Singh; Roy, Sudip; Kumar, Rajnish

2015-04-14

One of the options suggested for methane recovery from natural gas hydrates is molecular replacement of methane by suitable guests like CO2 and N2. This approach has been found to be feasible through many experimental and molecular dynamics simulation studies. However, the long term stability of the resultant hydrate needs to be evaluated; the decomposition rate of these hydrates is expected to depend on the interaction between these guest and water molecules. In this work, molecular dynamics simulation has been performed to illustrate the effect of guest molecules with different sizes and interaction strengths with water on structure I (SI) hydrate decomposition and hence the stability. The van der Waals interaction between water of hydrate cages and guest molecules is defined by Lennard Jones potential parameters. A wide range of parameter spaces has been scanned by changing the guest molecules in the SI hydrate, which acts as a model gas for occupying the small and large cages of the SI hydrate. All atomistic simulation results show that the stability of the hydrate is sensitive to the size and interaction of the guest molecules with hydrate water. The increase in the interaction of guest molecules with water stabilizes the hydrate, which in turn shows a slower rate of hydrate decomposition. Similarly guest molecules with a reasonably small (similar to Helium) or large size increase the decomposition rate. The results were also analyzed by calculating the structural order parameter to understand the dynamics of crystal structure and correlated with the release rate of guest molecules from the solid hydrate phase. The results have been explained based on the calculation of potential energies felt by guest molecules in amorphous water, hydrate bulk and hydrate-water interface regions.

Crystal water dynamics of guanosine dihydrate: analysis of atomic displacement parameters, time profile of hydrogen-bonding probability, and translocation of water by MD simulation.

PubMed

Yoneda, Shigetaka; Sugawara, Yoko; Urabe, Hisako

2005-01-27

The dynamics of crystal water molecules of guanosine dihydrate are investigated in detail by molecular dynamics (MD) simulation. A 2 ns simulation is performed using a periodic boundary box composed of 4 x 5 x 8 crystallographic unit cells and using the particle-mesh Ewald method for calculation of electrostatic energy. The simulated average atomic positions and atomic displacement parameters are remarkably coincident with the experimental values determined by X-ray analysis, confirming the high accuracy of this simulation. The dynamics of crystal water are analyzed in terms of atomic displacement parameters, orientation vectors, order parameters, self-correlation functions of the orientation vectors, time profiles of hydrogen-bonding probability, and translocations. The simulation clarifies that the average structure is composed of various stable and transient structures of the molecules. The simulated guanosine crystal forms a layered structure, with four water sites per asymmetric unit, classified as either interlayer water or intralayer water. From a detailed analysis of the translocations of water molecules in the simulation, columns of intralayer water molecules along the c axis appear to represent a pathway for hydration and dehydration by a kind of molecular valve mechanism.

The domain interface method: a general-purpose non-intrusive technique for non-conforming domain decomposition problems

NASA Astrophysics Data System (ADS)

Cafiero, M.; Lloberas-Valls, O.; Cante, J.; Oliver, J.

2016-04-01

A domain decomposition technique is proposed which is capable of properly connecting arbitrary non-conforming interfaces. The strategy essentially consists in considering a fictitious zero-width interface between the non-matching meshes which is discretized using a Delaunay triangulation. Continuity is satisfied across domains through normal and tangential stresses provided by the discretized interface and inserted in the formulation in the form of Lagrange multipliers. The final structure of the global system of equations resembles the dual assembly of substructures where the Lagrange multipliers are employed to nullify the gap between domains. A new approach to handle floating subdomains is outlined which can be implemented without significantly altering the structure of standard industrial finite element codes. The effectiveness of the developed algorithm is demonstrated through a patch test example and a number of tests that highlight the accuracy of the methodology and independence of the results with respect to the framework parameters. Considering its high degree of flexibility and non-intrusive character, the proposed domain decomposition framework is regarded as an attractive alternative to other established techniques such as the mortar approach.

A simple model for the dependence on local detonation speed of the product entropy

NASA Astrophysics Data System (ADS)

Hetherington, David C.; Whitworth, Nicholas J.

2012-03-01

The generation of a burn time field as a pre-processing step ahead of a hydrocode calculation has been mostly upgraded in the explosives modelling community from the historical model of singlespeed programmed burn to DSD/WBL (Detonation Shock Dynamics / Whitham Bdzil Lambourn). The problem with this advance is that the previously conventional approach to the hydrodynamic stage of the model results in the entropy of the detonation products (s) having the wrong correlation with detonation speed (D). Instead of being higher where D is lower, the conventional method leads to s being lower where D is lower, resulting in a completely fictitious enhancement of available energy where the burn is degraded! A technique is described which removes this deficiency of the historical model when used with a DSD-generated burn time field. By treating the conventional JWL equation as a semi-empirical expression for the local expansion isentrope, and constraining the local parameter set for consistency with D, it is possible to obtain the two desirable outcomes that the model of the detonation wave is internally consistent, and s is realistically correlated with D.

A Simple Model for the Dependence on Local Detonation Speed (D) of the Product Entropy (S)

NASA Astrophysics Data System (ADS)

Hetherington, David

2011-06-01

The generation of a burn time field as a pre-processing step ahead of a hydrocode calculation has been mostly upgraded in the explosives modelling community from the historical model of single-speed programmed burn to DSD. However, with this advance has come the problem that the previously conventional approach to the hydrodynamic stage of the model results in S having the wrong correlation with D. Instead of being higher where the detonation speed is lower, i.e. where reaction occurs at lower compression, the conventional method leads to S being lower where D is lower, resulting in a completely fictitious enhancement of available energy where the burn is degraded! A technique is described which removes this deficiency of the historical model when used with a DSD-generated burn time field. By treating the conventional JWL equation as a semi-empirical expression for the local expansion isentrope, and constraining the local parameter set for consistency with D, it is possible to obtain the two desirable outcomes that the model of the detonation wave is internally consistent, and S is realistically correlated with D.

Vibrational spectroscopic and DFT calculation studies of 2-amino-7-bromo-5-oxo-[1]benzopyrano [2,3-b]pyridine-3 carbonitrile.

PubMed

Premkumar, S; Jawahar, A; Mathavan, T; Kumara Dhas, M; Milton Franklin Benial, A

2015-03-05

The vibrational spectra of 2-amino-7-bromo-5-oxo-[1]benzopyrano [2,3-b]pyridine-3 carbonitrile were recorded using fourier transform-infrared and fourier transform-Raman spectrometer. The optimized structural parameters, vibrational frequencies, Mulliken atomic charge distribution, frontier molecular orbitals, thermodynamic properties, temperature dependence of thermodynamic parameters, first order hyperpolarizability and natural bond orbital calculations of the molecule were performed using the Gaussian 09 program. The vibrational frequencies were assigned on the basis of potential energy distribution calculation using the VEDA 4.0 program. The calculated first order hyperpolarizability of ABOBPC molecule was obtained as 6.908×10(-30) issue, which was 10.5 times greater than urea. The nonlinear optical activity of the molecule was also confirmed by the frontier molecular orbitals and natural bond orbital analysis. The frontier molecular orbitals analysis shows that the lower energy gap of the molecule, which leads to the higher value of first order hyperpolarizability. The natural bond orbital analysis indicates that the nonlinear optical activity of the molecule arises due to the π→π(∗) transitions. The Mulliken atomic charge distribution confirms the presence of intramolecular charge transfer within the molecule. The reactive site of the molecule was predicted from the molecular electrostatic potential contour map. The values of thermo dynamic parameters were increasing with increasing temperature. Copyright © 2014 Elsevier B.V. All rights reserved.

Biaxial order parameter in the homologous series of orthogonal bent-core smectic liquid crystals

NASA Astrophysics Data System (ADS)

Sreenilayam, S.; Panarin, Y. P.; Vij, J. K.; Osipov, M.; Lehmann, A.; Tschierske, C.

2013-07-01

The fundamental parameter of the uniaxial liquid crystalline state that governs nearly all of its physical properties is the primary orientational order parameter (S) for the long axes of molecules with respect to the director. The biaxial liquid crystals (LCs) possess biaxial order parameters depending on the phase symmetry of the system. In this paper we show that in the first approximation a biaxial orthogonal smectic phase can be described by two primary order parameters: S for the long axes and C for the ordering of the short axes of molecules. The temperature dependencies of S and C are obtained by the Haller's extrapolation technique through measurements of the optical birefringence and biaxiality on a nontilted polar antiferroelectric (Sm-APA) phase of a homologous series of LCs built from the bent-core achiral molecules. For such a biaxial smectic phase both S and C, particularly the temperature dependency of the latter, are being experimentally determined. Results show that S in the orthogonal smectic phase composed of bent cores is higher than in Sm-A calamatic LCs and C is also significantly large.

Influence of vehicles used for oral dosing of test molecules on the progression of Mycobacterium tuberculosis infection in mice.

PubMed

Singh, Shubhra; Dwivedi, Richa; Chaturvedi, Vinita

2012-11-01

Preclinical evaluation of drug-like molecules requires their oral administration to experimental animals using suitable vehicles. We studied the effect of oral dosing with corn oil, carboxymethyl cellulose, dimethyl sulfoxide, and polysorbate-80 on the progression of Mycobacterium tuberculosis infection in mice. Infection was monitored by physical (survival time and body weight) and bacteriological (viable counts in lungs) parameters. Compared with water, corn oil significantly improved both sets of parameters, whereas the other vehicles affected only physical parameters.

Influence of Vehicles Used for Oral Dosing of Test Molecules on the Progression of Mycobacterium tuberculosis Infection in Mice

PubMed Central

Singh, Shubhra; Dwivedi, Richa

2012-01-01

Preclinical evaluation of drug-like molecules requires their oral administration to experimental animals using suitable vehicles. We studied the effect of oral dosing with corn oil, carboxymethyl cellulose, dimethyl sulfoxide, and polysorbate-80 on the progression of Mycobacterium tuberculosis infection in mice. Infection was monitored by physical (survival time and body weight) and bacteriological (viable counts in lungs) parameters. Compared with water, corn oil significantly improved both sets of parameters, whereas the other vehicles affected only physical parameters. PMID:22926571

Do Employers Prefer Workers Who Attend For-Profit Colleges? Evidence from a Field Experiment. Working Paper No. WR-1054

ERIC Educational Resources Information Center

Darolia, Rajeev; Koedel, Cory; Martorell, Paco; Wilson, Katie; Perez-Arce, Francisco

2014-01-01

This paper reports results from a resume-based field experiment designed to examine employer preferences for job applicants who attended for-profit colleges. For-profit colleges have seen sharp increases in enrollment in recent years despite alternatives such as public community colleges being much cheaper. We sent almost 9,000 fictitious resumes…

The Effects of Viewing R-Rated Movie Scenes That Objectify Women on Perceptions of Date Rape.

ERIC Educational Resources Information Center

Milburn, Michael A.; Mather, Roxanne; Conrad, Sheree D.

2000-01-01

Tested the effects of viewing R-rated films on perceptions of female responsibility for and enjoyment of date or stranger rape. Participants viewed nonviolent scenes objectifying and degrading women sexually or animated film scenes. They read a fictitious magazine account of a date or stranger rape. The study showed that males who viewed the…

Student Loans and Foreign Schools: Assessing Risks Could Help Education Reduce Program Vulnerability. Report to Congressional Addressees.

ERIC Educational Resources Information Center

Ashby, Cornelia M.

Recent events have increased concerns about the potential for fraud in student loan programs related to loans for U.S. residents attending foreign schools. In 2002 the Office of Special Investigations of the General Accounting Office (GAO) created a fictitious foreign school that the Department of Education subsequently certified as eligible to…

Children's Retrieval of Classroom Materials: A Test of Conjoint Retention.

ERIC Educational Resources Information Center

Stader, Ellen D.; And Others

A total of 90 fifth- and sixth-grade students studied a map of the fictitious island while twice listening to a 1,100-word prose passage describing it. The description included 16 nouns that had been chosen as map features. Map features were identified by labels and icons. Afterwards, students were given a cued recall test with 16 feature-related…

Community Colleges: Open Door or Revolving Door? Intervention Strategies To Reduce the Number of Probationary Students and Increase Student Persistence.

ERIC Educational Resources Information Center

Gonzalez, John Manuel

This doctoral dissertation investigates the Student Success Project (SSP) at the fictitiously named Bay Community College, a single-campus district in Southern California. The project was initiated in response to the high probationary, disqualified and dropout rates among first-time students. Its goal was to implement interventions to help…

"We Understood It More 'Cause We Were Doin' It Ourself": Students' Self-Described Connections between Participation and Learning.

ERIC Educational Resources Information Center

Christie, Mary Ann

The experiences and responses of high school biology students using the GenScope computer program are described. GenScope represents genetic concepts in a linked multilevel fashion to teach students to think like scientists. Many GenScope problems use a fictitious dragon species to illustrate genetics. Students can manipulate the dragons' genes to…

Joint Command Decision Support System

DTIC Science & Technology

2011-06-01

2010 Olympics and Paralympics games , about a hundred agencies and organizations were involved with the safety and security of the games . Accordingly...Joint Task Force Games (JTFG) staff members were augmented with other Command Staff from Canada Command and Canadian Operational Support Command...CANOSCOM) to create an operational HQ. The scenario used for demonstration was based on fictitious Olympic Games (Breton and Guitouni 2008). The scenario

Self-Reported Substance Use among High School Students with and without Learning Difficulties

ERIC Educational Resources Information Center

Carroll, Annemaree; Houghton, Stephen; Bourgeois, Amanda

2014-01-01

A total of 197 Year 9 and 10 students, 74 of whom had learning difficulties (LD), from two high schools in Brisbane, the capital city of Queensland, Australia, self-reported their substance use. Seventeen substances, including two fictitious ones to detect over-reporting, were presented to participants for them to indicate their current usage,…

75 FR 52562 - Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Notice of Filing of...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-26

... NMS (National Market System), 17 CFR 242.600-242.612; FINRA Rule 7400 Series (Order Audit Trail System... 08-80 (December 2008)]; NASD Rule 2400 Series (Commissions, Mark-Ups and Charges); NASD IM-2110-2... as are stated at the time of such offer to buy or sell. Moreover, the use of fictitious transactions...

KSC01pp0738

NASA Image and Video Library

2001-04-05

KENNEDY SPACE CENTER, FLA. -- Within sight of the Vehicle Assembly Building, medical, paramedic and other personnel attend to role-playing “victims” on the grass in the Launch Complex 39 area. It is the site of a staged mass casualty exercise designed to validate capabilities of KSC’s fire, medical, helicopter transport and security personnel to respond to an event such as this fictitious sniper attack

KSC01pp0736

NASA Image and Video Library

2001-04-05

KENNEDY SPACE CENTER, FLA. -- During a staged mass casualty exercise in the Launch Complex 39 area, security and medical personnel take care of a “victim” on the ground by the bleachers. Employees are playing roles in the fictitious sniper attack that is being staged to validate capabilities of KSC’s fire, medical, helicopter transport and security personnel to respond to such an event

Terrorism in South Asia

DTIC Science & Technology

2004-03-08

with Bangladesh . Al Qaeda had reportedly recruited Burmese Muslims, known as the Rohingya , from refugee camps in southeastern Bangladesh to fight in...Dhaka, Bangladesh , June 19, 2003. 77 “ Bangladesh Calls Time Article on Militant Fictitious,” Associated Press, October 16, 2002. The Rohingya ...Solidarity Organization (RSO) is the largest organization representing the over 120,000 Rohingyas in Bangladesh .70 The number of Rohingyas varies depending

In Search of an Audience: "Kid Creole and the Coconuts."

ERIC Educational Resources Information Center

Aiex, Nola Kortner

The hybrid music of the group "Kid Creole and the Coconuts" shows traces of every popular music style that has aroused New York City during the past 40 years--big band swing, Latin dance music, calypso, reggae, disco, funk, soul, rock, and movie pop. The fictitious characters the members of the band assume on stage, together with their…

A Convective Coordinate Approach to Continuum Mechanics with Application to Electrodynamics

DTIC Science & Technology

2013-01-01

7 3. Differential Operators in Curvilinear Spaces 9 3.1 The Covariant...the particles in an arbitrary (perhaps initial or even fictitious) configuration, and a set of spatial coordinates that fixes locations in space (that...of field quantities defined in such spaces . 2.1 The Background Cartesian System Before defining the physical coordinate systems at the heart of this

Case Study: Using Microbe Molecular Biology for Gulf Oil Spill Clean Up

ERIC Educational Resources Information Center

Jones, Daniel R.

2011-01-01

This case has the student actively investigate the regulation of expression of a novel bacterial gene in the context of attempts to solve a real world problem, clean up of the April 2010 Deep Water Horizon oil spill in the Gulf of Mexico. Although the case is fictitious, it is based on factual gene regulatory characteristics of oil-degrading…

WeSaySo Case Study: Designing and Implementing a Case Study for Use in an Instructional Design Class.

ERIC Educational Resources Information Center

Graves, Rick; Barnett, Mardee; Gamble, Yolanda; Kolak, Mike

A case study was used in an instructional design class to facilitate the transfer of conceptual knowledge to concrete concerns and to aid instructional technology graduate students' understanding of the steps involved in designing, analyzing, and implementing an effective needs analysis. The case study involved real events at fictitious company…

Meteor Shower Records: A Reference Table of Observations from Previous Centuries

NASA Astrophysics Data System (ADS)

Koseki, M.

2009-10-01

Meteor history shows the complex nature of meteor showers. The author presents the Comae Berenicids as an example of the difficulties in defining meteor showers for visibility using different observational techniques. It is not useful to give a fixed or coded name to a 'meteor shower' because it may not be real and could lead observers to fictitious results.

19 CFR 111.30 - Notification of change of business address, organization, name, or location of business records...

Code of Federal Regulations, 2014 CFR

2014-04-01

... Notification of change of business address, organization, name, or location of business records; status report... part of the organization, or entry into bankruptcy protection). (c) Change in name. A broker who changes his name, or who proposes to operate under a trade or fictitious name in one or more States within...

19 CFR 111.30 - Notification of change of business address, organization, name, or location of business records...

Code of Federal Regulations, 2013 CFR

2013-04-01

... Notification of change of business address, organization, name, or location of business records; status report... part of the organization, or entry into bankruptcy protection). (c) Change in name. A broker who changes his name, or who proposes to operate under a trade or fictitious name in one or more States within...

19 CFR 111.30 - Notification of change of business address, organization, name, or location of business records...

Code of Federal Regulations, 2011 CFR

2011-04-01

... Notification of change of business address, organization, name, or location of business records; status report... part of the organization, or entry into bankruptcy protection). (c) Change in name. A broker who changes his name, or who proposes to operate under a trade or fictitious name in one or more States within...

19 CFR 111.30 - Notification of change of business address, organization, name, or location of business records...

Code of Federal Regulations, 2012 CFR

2012-04-01

... Notification of change of business address, organization, name, or location of business records; status report... part of the organization, or entry into bankruptcy protection). (c) Change in name. A broker who changes his name, or who proposes to operate under a trade or fictitious name in one or more States within...

The Earl Lee Street Art Campaign

ERIC Educational Resources Information Center

Bubba

2013-01-01

This article describes a catchy phrase with more to its meaning than first view. A slogan "All the girls love Earl Lee," appears in street art around the world. Earl Lee is a lovable, handsome man who owns the fictitious Earl Lube industries. Originally intended to bring a smile to people's faces at a time when there wasn't much to smile…

Race, Color-Blind Racial Attitudes, and Judgments About Mental Health: A Shifting Standards Perspective

ERIC Educational Resources Information Center

Gushue, George V.

2004-01-01

A fictitious counseling center intake report was given to a sample of 158 White graduate students in counseling and clinical psychology to examine the impact of reported client race (Black or White) on perceptions of clients' symptom severity. As predicted by the shifting standards model of social judgment (M. Biernat, M. Manis, & T. E. Nelson,…

Disturbance rejection control for vibration suppression of piezoelectric laminated thin-walled structures

NASA Astrophysics Data System (ADS)

Zhang, S. Q.; Li, H. N.; Schmidt, R.; Müller, P. C.

2014-02-01

Thin-walled piezoelectric integrated smart structures are easily excited to vibrate by unknown disturbances. In order to design and simulate a control strategy, firstly, an electro-mechanically coupled dynamic finite element (FE) model of smart structures is developed based on first-order shear deformation (FOSD) hypothesis. Linear piezoelectric constitutive equations and the assumption of constant electric field through the thickness are considered. Based on the dynamic FE model, a disturbance rejection (DR) control with proportional-integral (PI) observer using step functions as the fictitious model of disturbances is developed for vibration suppression of smart structures. In order to achieve a better dynamic behavior of the fictitious model of disturbances, the PI observer is extended to generalized proportional-integral (GPI) observer, in which sine or polynomial functions can be used to represent disturbances resulting in better dynamics. Therefore the disturbances can be estimated either by PI or GPI observer, and then the estimated signals are fed back to the controller. The DR control is validated by various kinds of unknown disturbances, and compared with linear-quadratic regulator (LQR) control. The results illustrate that the vibrations are better suppressed by the proposed DR control.

First depressed, then discriminated against?

PubMed

Baert, Stijn; De Visschere, Sarah; Schoors, Koen; Vandenberghe, Désirée; Omey, Eddy

2016-12-01

Each year a substantial share of the European population suffers from major depression. This mental illness may affect individuals' later life outcomes indirectly by the stigma it inflicts. The present study assesses hiring discrimination based on disclosed depression. To this end, between May 2015 and July 2015, we sent out 288 trios of job applications from fictitious candidates to real vacancies in Belgium. Within each trio, one candidate claimed to have become unemployed only recently, whereas the other two candidates revealed former depression or no reason at all for their unemployment during a full year. Disclosing a year of inactivity due to former depression decreases the probability of getting a job interview invitation by about 34% when compared with candidates who just became unemployed, but the stigma effect of a year of depression is not significantly higher than the stigma effect of a year of unexplained unemployment. In addition, we found that these stigmas of depression and unemployment were driven by our male trios of fictitious candidates. As a consequence, our results are in favour of further research on gender heterogeneity in the stigma of depression and other health impairments. Copyright © 2016 Elsevier Ltd. All rights reserved.

Modeling the Sedimentation of Red Blood Cells in Flow under Strong External Magnetic Body Force using a Lattice Boltzmann Fictitious Domain Method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Xing; Lin, Guang

To model the sedimentation of the red blood cell (RBC) in a square duct and a circular pipe, the recently developed technique derived from the lattice Boltzmann method and the distributed Lagrange multiplier/fictitious domain method (LBM-DLM/FD) is extended to employ the mesoscopic network model for simulations of the sedimentation of the RBC in flow. The flow is simulated by the lattice Boltzmann method with a strong magnetic body force, while the network model is used for modeling RBC deformation. The fluid-RBC interactions are enforced by the Lagrange multiplier. The sedimentation of the RBC in a square duct and a circularmore » pipe is simulated, revealing the capacity of the current method for modeling the sedimentation of RBC in various flows. Numerical results illustrate that that the terminal setting velocity increases with the increment of the exerted body force. The deformation of the RBC has significant effect on the terminal setting velocity due to the change of the frontal area. The larger the exerted force is, the smaller the frontal area and the larger deformation of the RBC are.« less

A Fictitious Domain Method for Resolving the Interaction of Blood Flow with Clot Growth

NASA Astrophysics Data System (ADS)

Mukherjee, Debanjan; Shadden, Shawn

2016-11-01

Thrombosis and thrombo-embolism cause a range of diseases including heart attack and stroke. Closer understanding of clot and blood flow mechanics provides valuable insights on the etiology, diagnosis, and treatment of thrombotic diseases. Such mechanics are complicated, however, by the discrete and multi-scale phenomena underlying thrombosis, and the complex interactions of unsteady, pulsatile hemodynamics with a clot of arbitrary shape and microstructure. We have developed a computational technique, based on a fictitious domain based finite element method, to study these interactions. The method can resolve arbitrary clot geometries, and dynamically couple fluid flow with static or growing clot boundaries. Macroscopic thrombus-hemodynamics interactions were investigated within idealized vessel geometries representative of the common carotid artery, with realistic unsteady flow profiles as inputs. The method was also employed successfully to resolve micro-scale interactions using a model driven by in-vivo morphology data. The results provide insights into the flow structures and hemodynamic loading around an arbitrarily grown clot at arterial length-scales, as well as flow and transport within the interstices of platelet aggregates composing the clot. The work was supported by AHA Award No: 16POST27500023.

Phononic Crystal Waveguide Transducers for Nonlinear Elastic Wave Sensing.

PubMed

Ciampa, Francesco; Mankar, Akash; Marini, Andrea

2017-11-07

Second harmonic generation is one of the most sensitive and reliable nonlinear elastic signatures for micro-damage assessment. However, its detection requires powerful amplification systems generating fictitious harmonics that are difficult to discern from pure nonlinear elastic effects. Current state-of-the-art nonlinear ultrasonic methods still involve impractical solutions such as cumbersome signal calibration processes and substantial modifications of the test component in order to create material-based tunable harmonic filters. Here we propose and demonstrate a valid and sensible alternative strategy involving the development of an ultrasonic phononic crystal waveguide transducer that exhibits both single and multiple frequency stop-bands filtering out fictitious second harmonic frequencies. Remarkably, such a sensing device can be easily fabricated and integrated on the surface of the test structure without altering its mechanical and geometrical properties. The design of the phononic crystal structure is supported by a perturbative theoretical model predicting the frequency band-gaps of periodic plates with sinusoidal corrugation. We find our theoretical findings in excellent agreement with experimental testing revealing that the proposed phononic crystal waveguide transducer successfully attenuates second harmonics caused by the ultrasonic equipment, thus demonstrating its wide range of potential applications for acousto/ultrasonic material damage inspection.

Reply to ‘No correction for the light propagation within the cube: Comment on Relativistic theory of the falling cube gravimeter’

NASA Astrophysics Data System (ADS)

Ashby, Neil

2018-06-01

The comment (Nagornyi 2018 Metrologia) claims that, notwithstanding the conclusions stated in the paper Relativistic theory of the falling cube gravimeter (Ashby 2008 Metrologia 55 1–10), there is no need to consider the dimensions or refractive index of the cube in fitting data from falling cube absolute gravimeters; additional questions are raised about matching quartic polynomials while determining only three quantities. The comment also suggests errors were made in Ashby (2008 Metrologia 55 1–10) while implementing the fitting routines on which the conclusions were based. The main contention of the comment is shown to be invalid because retarded time was not properly used in constructing a fictitious cube position. Such a fictitious position, fixed relative to the falling cube, is derived and shown to be dependent on cube dimensions and refractive index. An example is given showing how in the present context, polynomials of fourth order can be effectively matched by determining only three quantities, and a new compact characterization of the interference signal arriving at the detector is given. Work of the U.S. government, not subject to copyright.

On the Role of Mentalizing Processes in Aesthetic Appreciation: An ERP Study.

PubMed

Beudt, Susan; Jacobsen, Thomas

2015-01-01

We used event-related brain potentials to explore the impact of mental perspective taking on processes of aesthetic appreciation of visual art. Participants (non-experts) were first presented with information about the life and attitudes of a fictitious artist. Subsequently, they were cued trial-wise to make an aesthetic judgment regarding an image depicting a piece of abstract art either from their own perspective or from the imagined perspective of the fictitious artist [i.e., theory of mind (ToM) condition]. Positive self-referential judgments were made more quickly and negative self-referential judgments were made more slowly than the corresponding judgments from the imagined perspective. Event-related potential analyses revealed significant differences between the two tasks both within the preparation period (i.e., during the cue-stimulus interval) and within the stimulus presentation period. For the ToM condition we observed a relative centro-parietal negativity during the preparation period (700-330 ms preceding picture onset) and a relative centro-parietal positivity during the stimulus presentation period (700-1100 ms after stimulus onset). These findings suggest that different subprocesses are involved in aesthetic appreciation and judgment of visual abstract art from one's own vs. from another person's perspective.

Polarizable atomic multipole-based force field for DOPC and POPE membrane lipids

NASA Astrophysics Data System (ADS)

Chu, Huiying; Peng, Xiangda; Li, Yan; Zhang, Yuebin; Min, Hanyi; Li, Guohui

2018-04-01

A polarizable atomic multipole-based force field for the membrane bilayer models 1,2-dioleoyl-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-phosphatidylethanolamine (POPE) has been developed. The force field adopts the same framework as the Atomic Multipole Optimized Energetics for Biomolecular Applications (AMOEBA) model, in which the charge distribution of each atom is represented by the permanent atomic monopole, dipole and quadrupole moments. Many-body polarization including the inter- and intra-molecular polarization is modelled in a consistent manner with distributed atomic polarizabilities. The van der Waals parameters were first transferred from existing AMOEBA parameters for small organic molecules and then optimised by fitting to ab initio intermolecular interaction energies between models and a water molecule. Molecular dynamics simulations of the two aqueous DOPC and POPE membrane bilayer systems, consisting of 72 model molecules, were then carried out to validate the force field parameters. Membrane width, area per lipid, volume per lipid, deuterium order parameters, electron density profile, etc. were consistent with experimental values.

Physical re-examination of parameters on a molecular collisions-based diffusion model for diffusivity prediction in polymers.

PubMed

Ohashi, Hidenori; Tamaki, Takanori; Yamaguchi, Takeo

2011-12-29

Molecular collisions, which are the microscopic origin of molecular diffusive motion, are affected by both the molecular surface area and the distance between molecules. Their product can be regarded as the free space around a penetrant molecule defined as the "shell-like free volume" and can be taken as a characteristic of molecular collisions. On the basis of this notion, a new diffusion theory has been developed. The model can predict molecular diffusivity in polymeric systems using only well-defined single-component parameters of molecular volume, molecular surface area, free volume, and pre-exponential factors. By consideration of the physical description of the model, the actual body moved and which neighbor molecules are collided with are the volume and the surface area of the penetrant molecular core. In the present study, a semiempirical quantum chemical calculation was used to calculate both of these parameters. The model and the newly developed parameters offer fairly good predictive ability. © 2011 American Chemical Society

Electronegativity equalization method: parameterization and validation for organic molecules using the Merz-Kollman-Singh charge distribution scheme.

PubMed

Jirousková, Zuzana; Vareková, Radka Svobodová; Vanek, Jakub; Koca, Jaroslav

2009-05-01

The electronegativity equalization method (EEM) was developed by Mortier et al. as a semiempirical method based on the density-functional theory. After parameterization, in which EEM parameters A(i), B(i), and adjusting factor kappa are obtained, this approach can be used for calculation of average electronegativity and charge distribution in a molecule. The aim of this work is to perform the EEM parameterization using the Merz-Kollman-Singh (MK) charge distribution scheme obtained from B3LYP/6-31G* and HF/6-31G* calculations. To achieve this goal, we selected a set of 380 organic molecules from the Cambridge Structural Database (CSD) and used the methodology, which was recently successfully applied to EEM parameterization to calculate the HF/STO-3G Mulliken charges on large sets of molecules. In the case of B3LYP/6-31G* MK charges, we have improved the EEM parameters for already parameterized elements, specifically C, H, N, O, and F. Moreover, EEM parameters for S, Br, Cl, and Zn, which have not as yet been parameterized for this level of theory and basis set, we also developed. In the case of HF/6-31G* MK charges, we have developed the EEM parameters for C, H, N, O, S, Br, Cl, F, and Zn that have not been parameterized for this level of theory and basis set so far. The obtained EEM parameters were verified by a previously developed validation procedure and used for the charge calculation on a different set of 116 organic molecules from the CSD. The calculated EEM charges are in a very good agreement with the quantum mechanically obtained ab initio charges. 2008 Wiley Periodicals, Inc.

Fisher information theory for parameter estimation in single molecule microscopy: tutorial

PubMed Central

Chao, Jerry; Ward, E. Sally; Ober, Raimund J.

2016-01-01

Estimation of a parameter of interest from image data represents a task that is commonly carried out in single molecule microscopy data analysis. The determination of the positional coordinates of a molecule from its image, for example, forms the basis of standard applications such as single molecule tracking and localization-based superresolution image reconstruction. Assuming that the estimator used recovers, on average, the true value of the parameter, its accuracy, or standard deviation, is then at best equal to the square root of the Cramér-Rao lower bound. The Cramér-Rao lower bound can therefore be used as a benchmark in the evaluation of the accuracy of an estimator. Additionally, as its value can be computed and assessed for different experimental settings, it is useful as an experimental design tool. This tutorial demonstrates a mathematical framework that has been specifically developed to calculate the Cramér-Rao lower bound for estimation problems in single molecule microscopy and, more broadly, fluorescence microscopy. The material includes a presentation of the photon detection process that underlies all image data, various image data models that describe images acquired with different detector types, and Fisher information expressions that are necessary for the calculation of the lower bound. Throughout the tutorial, examples involving concrete estimation problems are used to illustrate the effects of various factors on the accuracy of parameter estimation, and more generally, to demonstrate the flexibility of the mathematical framework. PMID:27409706

Determination of structure parameters in strong-field tunneling ionization theory of molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao Songfeng; Jin Cheng; College of Physics and Electronic Engineering, Northwest Normal University, Lanzhou, Gansu 730070

2010-03-15

In the strong field molecular tunneling ionization theory of Tong et al. [Phys. Rev. A 66, 033402 (2002)], the ionization rate depends on the asymptotic wave function of the molecular orbital from which the electron is removed. The orbital wave functions obtained from standard quantum chemistry packages in general are not good enough in the asymptotic region. Here we construct a one-electron model potential for several linear molecules using density functional theory. We show that the asymptotic wave function can be improved with an iteration method and after one iteration accurate asymptotic wave functions and structure parameters are determined. Withmore » the new parameters we examine the alignment-dependent tunneling ionization probabilities for several molecules and compare with other calculations and with recent measurements, including ionization from inner molecular orbitals.« less

The HITRAN 2008 Molecular Spectroscopic Database

NASA Technical Reports Server (NTRS)

Rothman, Laurence S.; Gordon, Iouli E.; Barbe, Alain; Benner, D. Chris; Bernath, Peter F.; Birk, Manfred; Boudon, V.; Brown, Linda R.; Campargue, Alain; Champion, J.-P.;

Tunable Holstein model with cold polar molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herrera, Felipe; Krems, Roman V.

2011-11-15

We show that an ensemble of polar molecules trapped in an optical lattice can be considered as a controllable open quantum system. The coupling between collective rotational excitations and the motion of the molecules in the lattice potential can be controlled by varying the strength and orientation of an external dc electric field as well as the intensity of the trapping laser. The system can be described by a generalized Holstein Hamiltonian with tunable parameters and can be used as a quantum simulator of excitation energy transfer and polaron phenomena. We show that the character of excitation energy transfer canmore » be modified by tuning experimental parameters.« less

Four-Wave Mixing Spectroscopy of Quantum Dot Molecules

NASA Astrophysics Data System (ADS)

Sitek, A.; Machnikowski, P.

2007-08-01

We study theoretically the nonlinear four-wave mixing response of an ensemble of coupled pairs of quantum dots (quantum dot molecules). We discuss the shape of the echo signal depending on the parameters of the ensemble: the statistics of transition energies and the degree of size correlations between the dots forming the molecules.

Simulation-based cheminformatic analysis of organelle-targeted molecules: lysosomotropic monobasic amines.

PubMed

Zhang, Xinyuan; Zheng, Nan; Rosania, Gus R

2008-09-01

Cell-based molecular transport simulations are being developed to facilitate exploratory cheminformatic analysis of virtual libraries of small drug-like molecules. For this purpose, mathematical models of single cells are built from equations capturing the transport of small molecules across membranes. In turn, physicochemical properties of small molecules can be used as input to simulate intracellular drug distribution, through time. Here, with mathematical equations and biological parameters adjusted so as to mimic a leukocyte in the blood, simulations were performed to analyze steady state, relative accumulation of small molecules in lysosomes, mitochondria, and cytosol of this target cell, in the presence of a homogenous extracellular drug concentration. Similarly, with equations and parameters set to mimic an intestinal epithelial cell, simulations were also performed to analyze steady state, relative distribution and transcellular permeability in this non-target cell, in the presence of an apical-to-basolateral concentration gradient. With a test set of ninety-nine monobasic amines gathered from the scientific literature, simulation results helped analyze relationships between the chemical diversity of these molecules and their intracellular distributions.

Gaussian process model for extrapolation of scattering observables for complex molecules: From benzene to benzonitrile

NASA Astrophysics Data System (ADS)

Cui, Jie; Li, Zhiying; Krems, Roman V.

2015-10-01

We consider a problem of extrapolating the collision properties of a large polyatomic molecule A-H to make predictions of the dynamical properties for another molecule related to A-H by the substitution of the H atom with a small molecular group X, without explicitly computing the potential energy surface for A-X. We assume that the effect of the -H →-X substitution is embodied in a multidimensional function with unknown parameters characterizing the change of the potential energy surface. We propose to apply the Gaussian Process model to determine the dependence of the dynamical observables on the unknown parameters. This can be used to produce an interval of the observable values which corresponds to physical variations of the potential parameters. We show that the Gaussian Process model combined with classical trajectory calculations can be used to obtain the dependence of the cross sections for collisions of C6H5CN with He on the unknown parameters describing the interaction of the He atom with the CN fragment of the molecule. The unknown parameters are then varied within physically reasonable ranges to produce a prediction uncertainty of the cross sections. The results are normalized to the cross sections for He — C6H6 collisions obtained from quantum scattering calculations in order to provide a prediction interval of the thermally averaged cross sections for collisions of C6H5CN with He.

ParFit: A Python-Based Object-Oriented Program for Fitting Molecular Mechanics Parameters to ab Initio Data

DOE PAGES

Zahariev, Federico; De Silva, Nuwan; Gordon, Mark S.; ...

2017-02-23

Here, a newly created object-oriented program for automating the process of fitting molecular-mechanics parameters to ab initio data, termed ParFit, is presented. ParFit uses a hybrid of deterministic and stochastic genetic algorithms. ParFit can simultaneously handle several molecular-mechanics parameters in multiple molecules and can also apply symmetric and antisymmetric constraints on the optimized parameters. The simultaneous handling of several molecules enhances the transferability of the fitted parameters. ParFit is written in Python, uses a rich set of standard and nonstandard Python libraries, and can be run in parallel on multicore computer systems. As an example, a series of phosphine oxides,more » important for metal extraction chemistry, are parametrized using ParFit.« less

ParFit: A Python-Based Object-Oriented Program for Fitting Molecular Mechanics Parameters to ab Initio Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zahariev, Federico; De Silva, Nuwan; Gordon, Mark S.

Here, a newly created object-oriented program for automating the process of fitting molecular-mechanics parameters to ab initio data, termed ParFit, is presented. ParFit uses a hybrid of deterministic and stochastic genetic algorithms. ParFit can simultaneously handle several molecular-mechanics parameters in multiple molecules and can also apply symmetric and antisymmetric constraints on the optimized parameters. The simultaneous handling of several molecules enhances the transferability of the fitted parameters. ParFit is written in Python, uses a rich set of standard and nonstandard Python libraries, and can be run in parallel on multicore computer systems. As an example, a series of phosphine oxides,more » important for metal extraction chemistry, are parametrized using ParFit.« less

An Ethnographic Portrait of Translingual/Transcultural Navigation among Immigrant Children and Youth: Voices during Sunday School at a Latino Church

ERIC Educational Resources Information Center

Peñalva, Stacy L.

2017-01-01

This ethnographic study aims to foreground the voices of 34 first through twelfth graders who belong to first-generation immigrant families from Mexico and Central America and attend Nueva Vida Church (fictitious name) in a Midwestern US city. They insightfully reflect upon their language, culture and citizenship during Sunday school class focus…

Star of Bethlehem

NASA Astrophysics Data System (ADS)

Hughes, D.; Murdin, P.

2001-07-01

The biblical Star of Bethlehem, which heralded the birth of Jesus Christ, is only mentioned in the Gospel of St Matthew 2. The astrologically significant 7 bc triple conjunction of Jupiter and Saturn in the constellation of Pisces is the most likely candidate, although a comet/nova in 5 bc and a comet in 4 bc cannot be ruled out. There is also the possibility that the star was simply fictitious....

Adding Only One Priority Rule Allows Extending CIP Rules to Supramolecular Systems.

PubMed

Alkorta, Ibon; Elguero, José; Cintas, Pedro

2015-05-01

There are frequent situations both in supramolecular chemistry and in crystallography that result in stereogenic centers, whose absolute configuration needs to be specified. With this aim we propose the inclusion of one simple additional rule to the Cahn-Ingold-Prelog (CIP) system of priority rules stating that noncovalent interactions have a fictitious number between 0 and 1. © 2015 Wiley Periodicals, Inc.

Defense Resource Management Studies: Introduction to Capability and Acquisition Planning Processes

DTIC Science & Technology

2010-08-01

interchangeable and useful in a common contextual framework . Currently, both simulations use a common scenario, the same fictitious country, and...culture, legal framework , and institutions. • Incorporate Principles of Good Governance and Respect for Human Rights: Stress accountability and...Preparing for the assessments requires defining the missions to be analyzed; subdividing the mission definitions to provide a framework for analytic work

The Effects of Previous Success or Failure on a Majority-Minority Confrontation.

ERIC Educational Resources Information Center

Gorman, Michael E.; And Others

In a series of groups, a four-person majority and a two-person minority were trained separately to adopt different rules for predicting the level of drug use in each of a set of fictitious anthropological societies. On the final training trial, the success or failure of each of these two sub groups at guessing the level of drug use was manipulated…

THERMALLY DRIVEN ATMOSPHERIC ESCAPE: TRANSITION FROM HYDRODYNAMIC TO JEANS ESCAPE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Volkov, Alexey N.; Johnson, Robert E.; Tucker, Orenthal J.

2011-03-10

Thermally driven escape from planetary atmospheres changes in nature from an organized outflow (hydrodynamic escape) to escape on a molecule-by-molecule basis (Jeans escape) with increasing Jeans parameter, {lambda}, the ratio of the gravitational to thermal energy of the atmospheric molecules. This change is described here for the first time using the direct simulation Monte Carlo method. When heating is predominantly below the lower boundary of the simulation region, R{sub 0}, and well below the exobase of a single-component atmosphere, the nature of the escape process changes over a surprisingly narrow range of Jeans parameters, {lambda}{sub 0}, evaluated at R{sub 0}.more » For an atomic gas, the transition occurs over {lambda}{sub 0} {approx} 2-3, where the lower bound, {lambda}{sub 0} {approx} 2.1, corresponds to the upper limit for isentropic, supersonic outflow. For {lambda}{sub 0} > 3 escape occurs on a molecule-by-molecule basis and we show that, contrary to earlier suggestions, for {lambda}{sub 0} > {approx}6 the escape rate does not deviate significantly from the familiar Jeans rate. In a gas composed of diatomic molecules, the transition shifts to {lambda}{sub 0} {approx} 2.4-3.6 and at {lambda}{sub 0} > {approx}4 the escape rate increases a few tens of percent over that for the monatomic gas. Scaling by the Jeans parameter and the Knudsen number, these results can be applied to thermally induced escape of the major species from solar and extrasolar planets.« less

A general mixture theory. I. Mixtures of spherical molecules

NASA Astrophysics Data System (ADS)

Hamad, Esam Z.

1996-08-01

We present a new general theory for obtaining mixture properties from the pure species equations of state. The theory addresses the composition and the unlike interactions dependence of mixture equation of state. The density expansion of the mixture equation gives the exact composition dependence of all virial coefficients. The theory introduces multiple-index parameters that can be calculated from binary unlike interaction parameters. In this first part of the work, details are presented for the first and second levels of approximations for spherical molecules. The second order model is simple and very accurate. It predicts the compressibility factor of additive hard spheres within simulation uncertainty (equimolar with size ratio of three). For nonadditive hard spheres, comparison with compressibility factor simulation data over a wide range of density, composition, and nonadditivity parameter, gave an average error of 2%. For mixtures of Lennard-Jones molecules, the model predictions are better than the Weeks-Chandler-Anderson perturbation theory.

Density-Functional Theory with Dispersion-Correcting Potentials for Methane: Bridging the Efficiency and Accuracy Gap between High-Level Wave Function and Classical Molecular Mechanics Methods.

PubMed

Torres, Edmanuel; DiLabio, Gino A

2013-08-13

Large clusters of noncovalently bonded molecules can only be efficiently modeled by classical mechanics simulations. One prominent challenge associated with this approach is obtaining force-field parameters that accurately describe noncovalent interactions. High-level correlated wave function methods, such as CCSD(T), are capable of correctly predicting noncovalent interactions, and are widely used to produce reference data. However, high-level correlated methods are generally too computationally costly to generate the critical reference data required for good force-field parameter development. In this work we present an approach to generate Lennard-Jones force-field parameters to accurately account for noncovalent interactions. We propose the use of a computational step that is intermediate to CCSD(T) and classical molecular mechanics, that can bridge the accuracy and computational efficiency gap between them, and demonstrate the efficacy of our approach with methane clusters. On the basis of CCSD(T)-level binding energy data for a small set of methane clusters, we develop methane-specific, atom-centered, dispersion-correcting potentials (DCPs) for use with the PBE0 density-functional and 6-31+G(d,p) basis sets. We then use the PBE0-DCP approach to compute a detailed map of the interaction forces associated with the removal of a single methane molecule from a cluster of eight methane molecules and use this map to optimize the Lennard-Jones parameters for methane. The quality of the binding energies obtained by the Lennard-Jones parameters we obtained is assessed on a set of methane clusters containing from 2 to 40 molecules. Our Lennard-Jones parameters, used in combination with the intramolecular parameters of the CHARMM force field, are found to closely reproduce the results of our dispersion-corrected density-functional calculations. The approach outlined can be used to develop Lennard-Jones parameters for any kind of molecular system.

MATCH: An Atom- Typing Toolset for Molecular Mechanics Force Fields

PubMed Central

Yesselman, Joseph D.; Price, Daniel J.; Knight, Jennifer L.; Brooks, Charles L.

2011-01-01

We introduce a toolset of program libraries collectively titled MATCH (Multipurpose Atom-Typer for CHARMM) for the automated assignment of atom types and force field parameters for molecular mechanics simulation of organic molecules. The toolset includes utilities for the conversion from multiple chemical structure file formats into a molecular graph. A general chemical pattern-matching engine using this graph has been implemented whereby assignment of molecular mechanics atom types, charges and force field parameters is achieved by comparison against a customizable list of chemical fragments. While initially designed to complement the CHARMM simulation package and force fields by generating the necessary input topology and atom-type data files, MATCH can be expanded to any force field and program, and has core functionality that makes it extendable to other applications such as fragment-based property prediction. In the present work, we demonstrate the accurate construction of atomic parameters of molecules within each force field included in CHARMM36 through exhaustive cross validation studies illustrating that bond increment rules derived from one force field can be transferred to another. In addition, using leave-one-out substitution it is shown that it is also possible to substitute missing intra and intermolecular parameters with ones included in a force field to complete the parameterization of novel molecules. Finally, to demonstrate the robustness of MATCH and the coverage of chemical space offered by the recent CHARMM CGENFF force field (Vanommeslaeghe, et al., JCC., 2010, 31, 671–690), one million molecules from the PubChem database of small molecules are typed, parameterized and minimized. PMID:22042689

[Development of ophthalmologic software for handheld devices].

PubMed

Grottone, Gustavo Teixeira; Pisa, Ivan Torres; Grottone, João Carlos; Debs, Fernando; Schor, Paulo

2006-01-01

The formulas for calculation of intraocular lenses have evolved since the first theoretical formulas by Fyodorov. Among the second generation formulas, the SRK-I formula has a simple calculation, taking into account a calculation that only involved anteroposterior length, IOL constant and average keratometry. With the evolution of those formulas, complexicity increased making the reconfiguration of parameters in special situations impracticable. In this way the production and development of software for such a purpose, can help surgeons to recalculate those values if needed. To idealize, develop and test a Brazilian software for calculation of IOL dioptric power for handheld computers. For the development and programming of software for calculation of IOL, we used PocketC program (OrbWorks Concentrated Software, USA). We compared the results collected from a gold-standard device (Ultrascan/Alcon Labs) with the simulation of 100 fictitious patients, using the same IOL parameters. The results were grouped for ULTRASCAN data and SOFTWARE data. Using SRK/T formula the range of those parameters included a keratometry varying between 35 and 55D, axial length between 20 and 28 mm, IOL constants of 118.7, 118.3 and 115.8. Using Wilcoxon test, it was shown that the groups do not differ (p=0.314). We had a variation in the Ultrascan sample between 11.82 and 27.97. In the tested program sample the variation was practically similar (11.83-27.98). The average of the Ultrascan group was 20.93. The software group had a similar average. The standard deviation of the samples was also similar (4.53). The precision of IOL software for handheld devices was similar to that of the standard devices using the SRK/T formula. The software worked properly, was steady without bugs in tested models of operational system.

Diffusion and mobility of atomic particles in a liquid

NASA Astrophysics Data System (ADS)

Smirnov, B. M.; Son, E. E.; Tereshonok, D. V.

2017-11-01

The diffusion coefficient of a test atom or molecule in a liquid is determined for the mechanism where the displacement of the test molecule results from the vibrations and motion of liquid molecules surrounding the test molecule and of the test particle itself. This leads to a random change in the coordinate of the test molecule, which eventually results in the diffusion motion of the test particle in space. Two models parameters of interaction of a particle and a liquid are used to find the activation energy of the diffusion process under consideration: the gas-kinetic cross section for scattering of test molecules in the parent gas and the Wigner-Seitz radius for test molecules. In the context of this approach, we have calculated the diffusion coefficient of atoms and molecules in water, where based on experimental data, we have constructed the dependence of the activation energy for the diffusion of test molecules in water on the interaction parameter and the temperature dependence for diffusion coefficient of atoms or molecules in water within the models considered. The statistically averaged difference of the activation energies for the diffusion coefficients of different test molecules in water that we have calculated based on each of the presented models does not exceed 10% of the diffusion coefficient itself. We have considered the diffusion of clusters in water and present the dependence of the diffusion coefficient on the cluster size. The accuracy of the presented formulas for the diffusion coefficient of atomic particles in water is estimated to be 50%.

Quantum theory of atoms in molecules charge-charge flux-dipole flux models for the infrared intensities of X(2)CY (X = H, F, Cl; Y = O, S) molecules.

PubMed

Faria, Sergio H D M; da Silva, João Viçozo; Haiduke, Roberto L A; Vidal, Luciano N; Vazquez, Pedro A M; Bruns, Roy E

2007-08-16

The molecular dipole moments, their derivatives, and the fundamental IR intensities of the X2CY (X = H, F, Cl; Y = O, S) molecules are determined from QTAIM atomic charges and dipoles and their fluxes at the MP2/6-311++G(3d,3p) level. Root-mean-square errors of +/-0.03 D and +/-1.4 km mol(-1) are found for the molecular dipole moments and fundamental IR intensities calculated using quantum theory of atoms in molecules (QTAIM) parameters when compared with those obtained directly from the MP2/6-311++G(3d,3p) calculations and +/-0.05 D and 51.2 km mol(-1) when compared with the experimental values. Charge (C), charge flux (CF), and dipole flux (DF) contributions are reported for all the normal vibrations of these molecules. A large negative correlation coefficient of -0.83 is calculated between the charge flux and dipole flux contributions and indicates that electronic charge transfer from one side of the molecule to the other during vibrations is accompanied by a relaxation effect with electron density polarization in the opposite direction. The characteristic substituent effect that has been observed for experimental infrared intensity parameters and core electron ionization energies has been applied to the CCFDF/QTAIM parameters of F2CO, Cl2CO, F2CS, and Cl2CS. The individual atomic charge, atomic charge flux, and atomic dipole flux contributions are seen to obey the characteristic substituent effect equation just as accurately as the total dipole moment derivative. The CH, CF, and CCl stretching normal modes of these molecules are shown to have characteristic sets of charge, charge flux, and dipole flux contributions.

High Resolution Infrared Spectroscopy of Molecules of Terrestrial and Planetary Interest

NASA Technical Reports Server (NTRS)

Freedman, Richard S.

2001-01-01

In collaboration with the laboratory spectroscopy group of the Ames Atmospheric Physics Research Branch (SGP), high resolution infrared spectra of molecules that are of importance for the dynamics of the earth's and other planets' atmospheres were acquired using the SGP high resolution Fourier transform spectrometer and gas handling apparatus. That data, along with data acquired using similar instrumentation at the Kitt Peak National Observatory was analyzed to determine the spectral parameters for each of the rotationally resolved transitions for each molecule. Those parameters were incorporated into existing international databases (e.g. HITRANS and GEISA) so that field measurements could be converted into quantitative information regarding the physical and chemical structures of earth and planetary atmospheres.

Laboratory insights into the chemical and kinetic evolution of several organic molecules under simulated Mars surface UV radiation conditions

NASA Astrophysics Data System (ADS)

Poch, O.; Kaci, S.; Stalport, F.; Szopa, C.; Coll, P.

2014-11-01

The search for organic carbon at the surface of Mars, as clues of past habitability or remnants of life, is a major science goal of Mars' exploration. Understanding the chemical evolution of organic molecules under current martian environmental conditions is essential to support the analyses performed in situ. What molecule can be preserved? What is the timescale of organic evolution at the surface? This paper presents the results of laboratory investigations dedicated to monitor the evolution of organic molecules when submitted to simulated Mars surface ultraviolet radiation (190-400 nm), mean temperature (218 ± 2 K) and pressure (6 ± 1 mbar) conditions. Experiments are done with the MOMIE simulation setup (for Mars Organic Molecules Irradiation and Evolution) allowing both a qualitative and quantitative characterization of the evolution the tested molecules undergo (Poch, O. et al. [2013]. Planet. Space Sci. 85, 188-197). The chemical structures of the solid products and the kinetic parameters of the photoreaction (photolysis rate, half-life and quantum efficiency of photodecomposition) are determined for glycine, urea, adenine and chrysene. Mellitic trianhydride is also studied in order to complete a previous study done with mellitic acid (Stalport, F., Coll, P., Szopa, C., Raulin, F. [2009]. Astrobiology 9, 543-549), by studying the evolution of mellitic trianhydride. The results show that solid layers of the studied molecules have half-lives of 10-103 h at the surface of Mars, when exposed directly to martian UV radiation. However, organic layers having aromatic moieties and reactive chemical groups, as adenine and mellitic acid, lead to the formation of photoresistant solid residues, probably of macromolecular nature, which could exhibit a longer photostability. Such solid organic layers are found in micrometeorites or could have been formed endogenously on Mars. Finally, the quantum efficiencies of photodecomposition at wavelengths from 200 to 250 nm, determined for each of the studied molecules, range from 10-2 to 10-6 molecule photon-1 and apply for isolated molecules exposed at the surface of Mars. These kinetic parameters provide essential inputs for numerical modeling of the evolution of Mars' current reservoir of organic molecules. Organic molecules adsorbed on martian minerals may have different kinetic parameters and lead to different endproducts. The present study paves the way for the interpretation of more complex simulation experiments where organics will be mixed with martian mineral analogs.

Brome isotope selective control of CF3Br molecule clustering by IR laser radiation in gas-dynamic expansion of CF3Br - Ar mixture

NASA Astrophysics Data System (ADS)

Apatin, V. M.; Lokhman, V. N.; Makarov, G. N.; Ogurok, N.-D. D.; Ryabov, E. A.

2018-02-01

We report the results of research on the experimental control of CF3Br molecule clustering under gas-dynamic expansion of the CF3Br - Ar mixture at a nozzle exit by using IR laser radiation. A cw CO2 laser is used for exciting molecules and clusters in the beam and a time-of-flight mass-spectrometer with laser UV ionisation of particles for their detection. The parameters of the gas above the nozzle are determined (compositions and pressure) at which intensive molecule clustering occurs. It is found that in the case of the CF3Br gas without carrier when the pressure P0 above the nozzle does not exceed 4 atm, molecular clusters actually are not generated in the beam. If the gas mixture of CF3Br with argon is used at a pressure ratio 1 : N, where N >= 3, and the total pressure above the nozzle is P0 >= 2 atm, then there occurs molecule clustering. We study the dependences of the efficiency of suppressing the molecule clustering on parameters of the exciting pulse, gas parameters above the nozzle, and on a distance of the molecule irradiation zone from the nozzle exit section. It is shown that in the case of resonant vibrational excitation of gas-dynamically cooled CF3Br molecules at the nozzle exit one can realise isotope-selective suppression of molecule clustering with respect to bromine isotopes. With the CF3Br - Ar mixtures having the pressure ratio 1 : 3 and 1 : 15, the enrichment factors obtained with respect to bromine isotopes are kenr ≈ 1.05 ± 0.005 and kenr ≈ 1.06 ± 0.007, respectively, under jet irradiation by laser emission in the 9R(30) line (1084.635 cm-1). The results obtained let us assume that this method can be used to control clustering of molecules comprising heavy element isotopes, which have a small isotopic shift in IR absorption spectra.

Extended Adaptive Biasing Force Algorithm. An On-the-Fly Implementation for Accurate Free-Energy Calculations.

PubMed

Fu, Haohao; Shao, Xueguang; Chipot, Christophe; Cai, Wensheng

2016-08-09

Proper use of the adaptive biasing force (ABF) algorithm in free-energy calculations needs certain prerequisites to be met, namely, that the Jacobian for the metric transformation and its first derivative be available and the coarse variables be independent and fully decoupled from any holonomic constraint or geometric restraint, thereby limiting singularly the field of application of the approach. The extended ABF (eABF) algorithm circumvents these intrinsic limitations by applying the time-dependent bias onto a fictitious particle coupled to the coarse variable of interest by means of a stiff spring. However, with the current implementation of eABF in the popular molecular dynamics engine NAMD, a trajectory-based post-treatment is necessary to derive the underlying free-energy change. Usually, such a posthoc analysis leads to a decrease in the reliability of the free-energy estimates due to the inevitable loss of information, as well as to a drop in efficiency, which stems from substantial read-write accesses to file systems. We have developed a user-friendly, on-the-fly code for performing eABF simulations within NAMD. In the present contribution, this code is probed in eight illustrative examples. The performance of the algorithm is compared with traditional ABF, on the one hand, and the original eABF implementation combined with a posthoc analysis, on the other hand. Our results indicate that the on-the-fly eABF algorithm (i) supplies the correct free-energy landscape in those critical cases where the coarse variables at play are coupled to either each other or to geometric restraints or holonomic constraints, (ii) greatly improves the reliability of the free-energy change, compared to the outcome of a posthoc analysis, and (iii) represents a negligible additional computational effort compared to regular ABF. Moreover, in the proposed implementation, guidelines for choosing two parameters of the eABF algorithm, namely the stiffness of the spring and the mass of the fictitious particles, are proposed. The present on-the-fly eABF implementation can be viewed as the second generation of the ABF algorithm, expected to be widely utilized in the theoretical investigation of recognition and association phenomena relevant to physics, chemistry, and biology.

A theoretical study of potentially observable chirality-sensitive NMR effects in molecules.

PubMed

Garbacz, Piotr; Cukras, Janusz; Jaszuński, Michał

2015-09-21

Two recently predicted nuclear magnetic resonance effects, the chirality-induced rotating electric polarization and the oscillating magnetization, are examined for several experimentally available chiral molecules. We discuss in detail the requirements for experimental detection of chirality-sensitive NMR effects of the studied molecules. These requirements are related to two parameters: the shielding polarizability and the antisymmetric part of the nuclear magnetic shielding tensor. The dominant second contribution has been computed for small molecules at the coupled cluster and density functional theory levels. It was found that DFT calculations using the KT2 functional and the aug-cc-pCVTZ basis set adequately reproduce the CCSD(T) values obtained with the same basis set. The largest values of parameters, thus most promising from the experimental point of view, were obtained for the fluorine nuclei in 1,3-difluorocyclopropene and 1,3-diphenyl-2-fluoro-3-trifluoromethylcyclopropene.

Gaussian process model for extrapolation of scattering observables for complex molecules: From benzene to benzonitrile

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cui, Jie; Krems, Roman V.; Li, Zhiying

2015-10-21

We consider a problem of extrapolating the collision properties of a large polyatomic molecule A–H to make predictions of the dynamical properties for another molecule related to A–H by the substitution of the H atom with a small molecular group X, without explicitly computing the potential energy surface for A–X. We assume that the effect of the −H →−X substitution is embodied in a multidimensional function with unknown parameters characterizing the change of the potential energy surface. We propose to apply the Gaussian Process model to determine the dependence of the dynamical observables on the unknown parameters. This can bemore » used to produce an interval of the observable values which corresponds to physical variations of the potential parameters. We show that the Gaussian Process model combined with classical trajectory calculations can be used to obtain the dependence of the cross sections for collisions of C{sub 6}H{sub 5}CN with He on the unknown parameters describing the interaction of the He atom with the CN fragment of the molecule. The unknown parameters are then varied within physically reasonable ranges to produce a prediction uncertainty of the cross sections. The results are normalized to the cross sections for He — C{sub 6}H{sub 6} collisions obtained from quantum scattering calculations in order to provide a prediction interval of the thermally averaged cross sections for collisions of C{sub 6}H{sub 5}CN with He.« less

Factitious patients with fictitious disorders: a note on Munchausen's syndrome.

PubMed

Parker, G; Barrett, E

OBJECTIVE OURS: To review historical aspects and note several contemporary manifestations of the Munchausen syndrome, including "Munchausen by proxy" and "pseudo-Munchausen", to offer our respect to the infamous McIIroy (the quintessential example), as well as to encourage interest and assuage irritation by medical attendants. THEIRS: Impatient to be patients, dying to see doctors, hooked on hospitals, and seeking "ill" gotten gains, they thrive on medical investigations.

Fatigue Life Variability in Large Aluminum Forgings with Residual Stress

DTIC Science & Technology

2011-07-01

been conducted. A detailed finite element analysis of the forge/ quench /coldwork/machine process was performed in order to predict the bulk residual...forge/ quench /coldwork/machine process was performed in order to predict the bulk residual stresses in a fictitious aluminum bulkhead. The residual...continues to develop the capability for computational simulation of the forge, quench , cold work and machining processes. In order to handle the

Distributions of Magnetic Field Variations, Differences and Residuals

DTIC Science & Technology

1999-02-01

differences and residuals between two neighbouring sites (1997 data, Monte - cristo area). Each panel displays the results from a specific vector...This means, in effect, counting the number of times the absolute value increased past one of a series of regularly spaced thresholds, and tally the...results. Crossings of the zero level were not counted . Fig. 7 illustrates the binning procedure for a fictitious data set and four bin thresholds on

Of Course It's True...I Found It on the Web!

ERIC Educational Resources Information Center

Descy, Don E.

2008-01-01

How can fictitious websites fool so many people for so long? Most students at some time in their career are taught different flags to look for to try to ascertain the accuracy of a site. If one takes a look at most any list that teachers use to help students check on the credibility of a website, they seem to cover the same attributes. Is the…

Generalization of the Kohn-Sham system that can represent arbitrary one-electron density matrices

DOE PAGES

Hubertus J. J. van Dam

2016-04-27

Density functional theory is currently the most widely applied method in electronic structure theory. The Kohn-Sham method, based on a fictitious system of noninteracting particles, is the workhorse of the theory. The particular form of the Kohn-Sham wave function admits only idempotent one-electron density matrices whereas wave functions of correlated electrons in post-Hartree-Fock methods invariably have fractional occupation numbers. Here we show that by generalizing the orbital concept and introducing a suitable dot product as well as a probability density, a noninteracting system can be chosen that can represent the one-electron density matrix of any system, even one with fractionalmore » occupation numbers. This fictitious system ensures that the exact electron density is accessible within density functional theory. It can also serve as the basis for reduced density matrix functional theory. Moreover, to aid the analysis of the results the orbitals may be assigned energies from a mean-field Hamiltonian. This produces energy levels that are akin to Hartree-Fock orbital energies such that conventional analyses based on Koopmans' theorem are available. Lastly, this system is convenient in formalisms that depend on creation and annihilation operators as they are trivially applied to single-determinant wave functions.« less

Newton-Cartan Gravity in Noninertial Reference Frames

NASA Astrophysics Data System (ADS)

Rodriguez, Leo; St. Germaine-Fuller, James; Wickramasekara, Sujeev

2015-03-01

We study Newton-Cartan gravity under transformations into all noninertial, nonrelativistic reference frames. These transformations form an infinite dimensional Lie group, called the Galilean line group, which contains as a subgroup the Galilei group. The fictitious forces of noninertial reference frames are encoded in the Cartan connection transformed under the Galilean line group. These fictitious forces, which are coordinate effects, do not contribute to the Ricci tensor. Only the 00-component of the Ricci tensor is non-zero and equals (4 π times) the matter density in all reference frames. While the Ricci field equation and Gauss' law are fulfilled by the physical matter density in inertial and linearly accelerating reference frames, in rotating reference frames Gauss' law holds for an effective mass density that differs from the physical matter density. This effective density has its origin in the simulated magnetic field of rotating frames, highlighting a striking difference between linearly and rotationally accelerating frames. The equations governing the simulated fields have the same form as Maxwell's equations, a surprising result given that these equations obey special relativity (and U (1) -gauge symmetry), rather than Galilean symmetry. This work was supported in part by the HHMI Undergraduate Science Education Award 52006298 and the Grinnell College Academic Affairs' CSFS and MAP programs.

Quantum mechanics in noninertial reference frames: Violations of the nonrelativistic equivalence principle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klink, W.H.; Wickramasekara, S., E-mail: wickrama@grinnell.edu; Department of Physics, Grinnell College, Grinnell, IA 50112

2014-01-15

In previous work we have developed a formulation of quantum mechanics in non-inertial reference frames. This formulation is grounded in a class of unitary cocycle representations of what we have called the Galilean line group, the generalization of the Galilei group that includes transformations amongst non-inertial reference frames. These representations show that in quantum mechanics, just as is the case in classical mechanics, the transformations to accelerating reference frames give rise to fictitious forces. A special feature of these previously constructed representations is that they all respect the non-relativistic equivalence principle, wherein the fictitious forces associated with linear acceleration canmore » equivalently be described by gravitational forces. In this paper we exhibit a large class of cocycle representations of the Galilean line group that violate the equivalence principle. Nevertheless the classical mechanics analogue of these cocycle representations all respect the equivalence principle. -- Highlights: •A formulation of Galilean quantum mechanics in non-inertial reference frames is given. •The key concept is the Galilean line group, an infinite dimensional group. •A large class of general cocycle representations of the Galilean line group is constructed. •These representations show violations of the equivalence principle at the quantum level. •At the classical limit, no violations of the equivalence principle are detected.« less

On the Role of Mentalizing Processes in Aesthetic Appreciation: An ERP Study

PubMed Central

Beudt, Susan; Jacobsen, Thomas

2015-01-01

We used event-related brain potentials to explore the impact of mental perspective taking on processes of aesthetic appreciation of visual art. Participants (non-experts) were first presented with information about the life and attitudes of a fictitious artist. Subsequently, they were cued trial-wise to make an aesthetic judgment regarding an image depicting a piece of abstract art either from their own perspective or from the imagined perspective of the fictitious artist [i.e., theory of mind (ToM) condition]. Positive self-referential judgments were made more quickly and negative self-referential judgments were made more slowly than the corresponding judgments from the imagined perspective. Event-related potential analyses revealed significant differences between the two tasks both within the preparation period (i.e., during the cue-stimulus interval) and within the stimulus presentation period. For the ToM condition we observed a relative centro-parietal negativity during the preparation period (700–330 ms preceding picture onset) and a relative centro-parietal positivity during the stimulus presentation period (700–1100 ms after stimulus onset). These findings suggest that different subprocesses are involved in aesthetic appreciation and judgment of visual abstract art from one’s own vs. from another person’s perspective. PMID:26617506

Conceptual Problems in the Foundations of Mechanics

NASA Astrophysics Data System (ADS)

Coelho, Ricardo Lopes

2012-09-01

There has been much research on principles and fundamental concepts of mechanics. Problems concerning the law of inertia, the concepts of force, fictitious force, weight, mass and the distinction between inertial and gravitational mass are addressed in the first part of the present paper. It is argued in the second that the law of inertia is the source of these problems. Consequences drawn from the law explain the metaphysical concept of force, the problematic concept of fictitious force, the nominal definition of weight and the difficulty with defining mass operationally. The core of this connection between the law and these consequences lies in the fact that acceleration is a sufficient condition for force. The experimental basis of the law in the course of its history shows, however, that the law presupposes acceleration necessarily whereas acceleration does not presuppose the law. Therefore, there is no inconvenience in taking acceleration independently of the law. This is enough to bypass those problems. Taking into account how force is measured by force meters and how mass is basically determined, by comparison with the standard mass, a minimal meaning for both concepts of force and mass is established. All this converges with several solutions proposed in the course of history and increases the communicability of mechanics, as outlined in the final part of this paper.

Force-field parametrization and molecular dynamics simulations of Congo red

NASA Astrophysics Data System (ADS)

Król, Marcin; Borowski, Tomasz; Roterman, Irena; Piekarska, Barbara; Stopa, Barbara; Rybarska, Joanna; Konieczny, Leszek

2004-01-01

Congo red, a diazo dye widely used in medical diagnosis, is known to form supramolecular systems in solution. Such a supramolecular system may interact with various proteins. In order to examine the nature of such complexes empirical force field parameters for the Congo red molecule were developed. The parametrization of bonding terms closely followed the methodology used in the development of the charmm22 force field, except for the calculation of charges. Point charges were calculated from a fit to a quantum mechanically derived electrostatic potential using the CHELP-BOW method. Obtained parameters were tested in a series of molecular dynamics simulations of both a single molecule and a micelle composed of Congo red molecules. It is shown that newly developed parameters define a stable minimum on the hypersurface of the potential energy and crystal and ab initio geometries and rotational barriers are well reproduced. Furthermore, rotations around C-N bonds are similar to torsional vibrations observed in crystals of diphenyl-diazene, which confirms that the flexibility of the molecule is correct. Comparison of results obtained from micelles molecular dynamics simulations with experimental data shows that the thermal dependence of micelle creation is well reproduced.

Density Functional Theory Study of Cyanoetheneselenol: A Molecule of Astrobiological Interest

NASA Astrophysics Data System (ADS)

Surajbali, P.; Ramanah, D. Kodi; Rhyman, L.; Alswaidan, I. A.; Fun, H.-K.; Somanah, R.; Ramasami, P.

2015-12-01

The interstellar medium has a rich chemistry which involves a wide variety of molecules. Of particular interest are molecules that have a link to prebiotic chemistry which hold the key to understanding of our origins. On the basis of suggestions that selenium may have been involved in the origin and evolution of life, we have studied the selenium analogue of cyanoethenethiol, namely the novel cyanoetheneselenol. Cyanoetheneselenol exhibits conformational and geometrical isomerism. This theoretical work deals with the study of four forms of cyanoetheneselenol in terms of their structural, spectroscopic and thermodynamic parameters. All computations were performed using density functional theory method with the B3LYP functional and the Pople basis set, 6-311 + G(d,p), for all atoms. The relative stability of the four isomers of cyanoetheneselenol was obtained and interpreted. The infrared spectra were generated and assignment of the normal modes of vibration was performed. Probable regions of detection, proposed on the basis of parameters obtained from this study for the four isomers, include comets, the molecular cloud: Sagittarius B2(N), and planetary atmospheres. The molecular and spectroscopic parameters should be useful for future identification of the astrobiological molecule cyanoetheneselenol and the development of the Square Kilometre Array.

Analysis of the Fourier Spectrum of the ν2 Inversion Band of the 15NHD2 Molecule

NASA Astrophysics Data System (ADS)

Fomchenko, A. L.; Belova, A. S.; Bekhtereva, E. S.; Kwabia Tchana, F.

2018-06-01

To determine high-resolution rovibrational levels of the inversion vibrational (v2 = 1) state of the 15NHD2 molecule, the Fourier spectrum in the range from 650 to 1150 cm-1 is studied. The data obtained are used to determine the parameters of the effective Hamiltonian of the examined molecule.

Fractal analysis of lateral movement in biomembranes.

PubMed

Gmachowski, Lech

2018-04-01

Lateral movement of a molecule in a biomembrane containing small compartments (0.23-μm diameter) and large ones (0.75 μm) is analyzed using a fractal description of its walk. The early time dependence of the mean square displacement varies from linear due to the contribution of ballistic motion. In small compartments, walking molecules do not have sufficient time or space to develop an asymptotic relation and the diffusion coefficient deduced from the experimental records is lower than that measured without restrictions. The model makes it possible to deduce the molecule step parameters, namely the step length and time, from data concerning confined and unrestricted diffusion coefficients. This is also possible using experimental results for sub-diffusive transport. The transition from normal to anomalous diffusion does not affect the molecule step parameters. The experimental literature data on molecular trajectories recorded at a high time resolution appear to confirm the modeled value of the mean free path length of DOPE for Brownian and anomalous diffusion. Although the step length and time give the proper values of diffusion coefficient, the DOPE speed calculated as their quotient is several orders of magnitude lower than the thermal speed. This is interpreted as a result of intermolecular interactions, as confirmed by lateral diffusion of other molecules in different membranes. The molecule step parameters are then utilized to analyze the problem of multiple visits in small compartments. The modeling of the diffusion exponent results in a smooth transition to normal diffusion on entering a large compartment, as observed in experiments.

A new model of physical evolution of Jupiter-family comets

NASA Astrophysics Data System (ADS)

Rickman, H.; Szutowicz, S.; Wójcikowski, K.

2014-07-01

We aim to find the statistical physical lifetimes of Jupiter Family comets. For this purpose, we try to model the processes that govern the dynamical and physical evolution of comets. We pay special attention to physical evolution; attempts at such modelling have been made before, but we propose a more accurate model, which will include more physical effects. The model is tested on a sample of fictitious comets based on real Jupiter Family comets with some orbital elements changed to a state before the capture by Jupiter. We model four different physical effects: erosion by sublimation, dust mantling, rejuvenation (mantle blow-off), and splitting. While for sublimation and splitting there already are some models, like di Sisto et. al. (2009), and we only wish to make them more accurate, dust mantling and rejuvenation have not been included in previous, statistical physical evolution models. Each of these effects depends on one or more tunable parameters, which we establish by choosing the model that best fits the observed comet sample in a way similar to di Sisto et. al. (2009). In contrast to di Sisto et. al., our comparison also involves the observed active fractions vs. nuclear radii.

Model updating in flexible-link multibody systems

NASA Astrophysics Data System (ADS)

Belotti, R.; Caneva, G.; Palomba, I.; Richiedei, D.; Trevisani, A.

2016-09-01

The dynamic response of flexible-link multibody systems (FLMSs) can be predicted through nonlinear models based on finite elements, to describe the coupling between rigid- body and elastic behaviour. Their accuracy should be as high as possible to synthesize controllers and observers. Model updating based on experimental measurements is hence necessary. By taking advantage of the experimental modal analysis, this work proposes a model updating procedure for FLMSs and applies it experimentally to a planar robot. Indeed, several peculiarities of the model of FLMS should be carefully tackled. On the one hand, nonlinear models of a FLMS should be linearized about static equilibrium configurations. On the other, the experimental mode shapes should be corrected to be consistent with the elastic displacements represented in the model, which are defined with respect to a fictitious moving reference (the equivalent rigid link system). Then, since rotational degrees of freedom are also represented in the model, interpolation of the experimental data should be performed to match the model displacement vector. Model updating has been finally cast as an optimization problem in the presence of bounds on the feasible values, by also adopting methods to improve the numerical conditioning and to compute meaningful updated inertial and elastic parameters.

Smoothed Biasing Forces Yield Unbiased Free Energies with the Extended-System Adaptive Biasing Force Method

PubMed Central

2016-01-01

We report a theoretical description and numerical tests of the extended-system adaptive biasing force method (eABF), together with an unbiased estimator of the free energy surface from eABF dynamics. Whereas the original ABF approach uses its running estimate of the free energy gradient as the adaptive biasing force, eABF is built on the idea that the exact free energy gradient is not necessary for efficient exploration, and that it is still possible to recover the exact free energy separately with an appropriate estimator. eABF does not directly bias the collective coordinates of interest, but rather fictitious variables that are harmonically coupled to them; therefore is does not require second derivative estimates, making it easily applicable to a wider range of problems than ABF. Furthermore, the extended variables present a smoother, coarse-grain-like sampling problem on a mollified free energy surface, leading to faster exploration and convergence. We also introduce CZAR, a simple, unbiased free energy estimator from eABF trajectories. eABF/CZAR converges to the physical free energy surface faster than standard ABF for a wide range of parameters. PMID:27959559

Effects of thermal expansion of the crystal lattice on x-ray crystal spectrometers used for fusion research

NASA Astrophysics Data System (ADS)

Delgado-Aparicio, L.; Bitter, M.; Podpaly, Y.; Rice, J.; Burke, W.; Sanchez del Rio, M.; Beiersdorfer, P.; Bell, R.; Feder, R.; Gao, C.; Hill, K.; Johnson, D.; Lee, S. G.; Marmar, E.; Pablant, N.; Reinke, M. L.; Scott, S.; Wilson, R.

2013-12-01

X-ray imaging crystal spectrometers with high spectral and spatial resolution are currently being used on magnetically confined fusion devices to infer the time history profiles of ion and electron temperatures as well as plasma flow velocities. The absolute measurement of flow velocities is important for optimizing various discharge scenarios and evaluating the radial electric field in tokamak and stellarator plasmas. Recent studies indicate that the crystal temperature must be kept constant to within a fraction of a degree to avoid changes of the interplanar 2d-spacing by thermal expansion that cause changes in the Bragg angle, which could be misinterpreted as Doppler shifts. For the instrumental parameters of the x-ray crystal spectrometer on Alcator C-Mod, where those thermal effects were investigated, a change of the crystal temperature by 1 °C causes a change of the lattice spacing of the order of Δd = 1 × 10-5 Å introducing a fictitious velocity drift of the order of ˜3 km s-1. This effect must be considered for x-ray imaging crystals spectrometers installed on LHD, KSTAR, EAST, J-TEXT, NSTX and, in the future, W7-X and ITER.

The series product for gaussian quantum input processes

NASA Astrophysics Data System (ADS)

Gough, John E.; James, Matthew R.

2017-02-01

We present a theory for connecting quantum Markov components into a network with quantum input processes in a Gaussian state (including thermal and squeezed). One would expect on physical grounds that the connection rules should be independent of the state of the input to the network. To compute statistical properties, we use a version of Wicks' theorem involving fictitious vacuum fields (Fock space based representation of the fields) and while this aids computation, and gives a rigorous formulation, the various representations need not be unitarily equivalent. In particular, a naive application of the connection rules would lead to the wrong answer. We establish the correct interconnection rules, and show that while the quantum stochastic differential equations of motion display explicitly the covariances (thermal and squeezing parameters) of the Gaussian input fields we introduce the Wick-Stratonovich form which leads to a way of writing these equations that does not depend on these covariances and so corresponds to the universal equations written in terms of formal quantum input processes. We show that a wholly consistent theory of quantum open systems in series can be developed in this way, and as required physically, is universal and in particular representation-free.

LASER APPLICATIONS AND OTHER TOPICS IN QUANTUM ELECTRONICS: Determination of photophysical parameters of tryptophan molecules by methods of laser fluorimetry

NASA Astrophysics Data System (ADS)

Banishev, A. A.; Shirshin, E. A.; Fadeev, V. V.

2008-01-01

The photophysical parameters of tryptophan molecules at a low concentration in aqueous solution are measured by the methods of nanosecond laser fluorimetry upon excitation by 266-nm laser pulses. Two-step processes (reversible and irreversible photochemical transformations) taking place in this case are described quantitatively and it is shown that they can be neglected at the exciting photon flux density F < 5×1024 cm-2 s-1 in ~10-ns pulses.

Laboratory simulation to support the search for organic molecules at the surface of Mars

NASA Astrophysics Data System (ADS)

Poch, Olivier; Szopa, Cyril; Coll, Patrice; Jaber, Maguy; Georgelin, Thomas; Lambert, Jean-Francois; Stalport, Fabien

The search for organic carbon at the surface of Mars, as clues of past habitability or remnants of life, is a major science goal of Mars’ exploration. Understanding the chemical evolution of organic molecules under current Martian environmental conditions is essential to support the analyses performed in situ. What molecule can be preserved? What is the timescale of organic evolution at the surface? Here we present results of laboratory investigations dedicated to monitor qualitative and quantitative evolutions of several organic molecules under simulated Martian surface ultraviolet incident light, mean ground temperature and pressure, using the Mars Organic Molecules Irradiation and Evolution setup (1) . For each organic molecule studied, the nature of the evolution products (solid or gaseous) and the kinetic parameters (extrapolated half-life at Mars, quantum yields) were experimentally determined. The results show that when exposed to UV radiation, specific organic molecules lead to the formation of solid residues, probably of macromolecular nature, which could reach long term stability. On the other hand, the study of the evolution of molecules in presence of nontronite, a clay mineral detected at the surface of Mars, highlights a strong protective effect of the clay reducing dissociation rates for some molecules, whereas a possible catalytic effect is tentatively observed for one studied molecule. These results are essential to support the analyses performed in situ during the past, current and future exploration missions. Moreover, the experimentally determined kinetic parameters provide new inputs for numerical modeling of current reservoirs of organic molecules on Mars. (1) O. Poch et al., Planetary and Space Science 85, 188-197, http://dx.doi.org/10.1016/j.pss.2013.06.013

Rapid parameterization of small molecules using the Force Field Toolkit.

PubMed

Mayne, Christopher G; Saam, Jan; Schulten, Klaus; Tajkhorshid, Emad; Gumbart, James C

2013-12-15

The inability to rapidly generate accurate and robust parameters for novel chemical matter continues to severely limit the application of molecular dynamics simulations to many biological systems of interest, especially in fields such as drug discovery. Although the release of generalized versions of common classical force fields, for example, General Amber Force Field and CHARMM General Force Field, have posited guidelines for parameterization of small molecules, many technical challenges remain that have hampered their wide-scale extension. The Force Field Toolkit (ffTK), described herein, minimizes common barriers to ligand parameterization through algorithm and method development, automation of tedious and error-prone tasks, and graphical user interface design. Distributed as a VMD plugin, ffTK facilitates the traversal of a clear and organized workflow resulting in a complete set of CHARMM-compatible parameters. A variety of tools are provided to generate quantum mechanical target data, setup multidimensional optimization routines, and analyze parameter performance. Parameters developed for a small test set of molecules using ffTK were comparable to existing CGenFF parameters in their ability to reproduce experimentally measured values for pure-solvent properties (<15% error from experiment) and free energy of solvation (±0.5 kcal/mol from experiment). Copyright © 2013 Wiley Periodicals, Inc.

Electron transmission through a class of anthracene aldehyde molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petreska, Irina, E-mail: irina.petreska@pmf.ukim.mk; Ohanesjan, Vladimir, E-mail: ohanesjan.vladimir@gmail.com; Pejov, Ljupco, E-mail: ljupcop@pmf.ukim.mk

2016-03-25

Transmission of electrons via metal-molecule-metal junctions, involving rotor-stator anthracene aldehyde molecules is investigated. Two model barriers having input parameters evaluated from accurate ab initio calculations are proposed and the transmission coefficients are obtained by using the quasiclassical approximation. Transmission coefficients further enter in the integral for the net current, utilizing Simmons’ method. Conformational dependence of the tunneling processes is evident and the presence of the side groups enhances the functionality of the future single-molecule based electronic devices.

Effects of dielectric inhomogeneity on electrostatic twist rigidity of a helical biomolecule in Debye-Hückel regime

NASA Astrophysics Data System (ADS)

Rezaie-Dereshgi, Amir; Mohammad-Rafiee, Farshid

2018-04-01

The electrostatic interactions play a crucial role in biological systems. Here we consider an impermeable dielectric molecule in the solvent with a different dielectric constant. The electrostatic free energy in the problem is studied in the Debye-Hückel regime using the analytical Green function that is calculated in the paper. Using this electrostatic free energy, we study the electrostatic contribution to the twist rigidity of a double stranded helical molecule such as a DNA and an actin filament. The dependence of the electrostatic twist rigidity of the molecule to the dielectric inhomogeneity, structural parameters, and the salt concentration is studied. It is shown that, depending on the parameters, the electrostatic twist rigidity could be positive or negative.

Computational screening of organic materials towards improved photovoltaic properties

NASA Astrophysics Data System (ADS)

Dai, Shuo; Olivares-Amaya, Roberto; Amador-Bedolla, Carlos; Aspuru-Guzik, Alan; Borunda, Mario

2015-03-01

The world today faces an energy crisis that is an obstruction to the development of the human civilization. One of the most promising solutions is solar energy harvested by economical solar cells. Being the third generation of solar cell materials, organic photovoltaic (OPV) materials is now under active development from both theoretical and experimental points of view. In this study, we constructed a parameter to select the desired molecules based on their optical spectra performance. We applied it to investigate a large collection of potential OPV materials, which were from the CEPDB database set up by the Harvard Clean Energy Project. Time dependent density functional theory (TD-DFT) modeling was used to calculate the absorption spectra of the molecules. Then based on the parameter, we screened out the top performing molecules for their potential OPV usage and suggested experimental efforts toward their synthesis. In addition, from those molecules, we summarized the functional groups that provided molecules certain spectrum capability. It is hoped that useful information could be mined out to provide hints to molecular design of OPV materials.

Multi-Scale Modeling to Improve Single-Molecule, Single-Cell Experiments

NASA Astrophysics Data System (ADS)

Munsky, Brian; Shepherd, Douglas

2014-03-01

Single-cell, single-molecule experiments are producing an unprecedented amount of data to capture the dynamics of biological systems. When integrated with computational models, observations of spatial, temporal and stochastic fluctuations can yield powerful quantitative insight. We concentrate on experiments that localize and count individual molecules of mRNA. These high precision experiments have large imaging and computational processing costs, and we explore how improved computational analyses can dramatically reduce overall data requirements. In particular, we show how analyses of spatial, temporal and stochastic fluctuations can significantly enhance parameter estimation results for small, noisy data sets. We also show how full probability distribution analyses can constrain parameters with far less data than bulk analyses or statistical moment closures. Finally, we discuss how a systematic modeling progression from simple to more complex analyses can reduce total computational costs by orders of magnitude. We illustrate our approach using single-molecule, spatial mRNA measurements of Interleukin 1-alpha mRNA induction in human THP1 cells following stimulation. Our approach could improve the effectiveness of single-molecule gene regulation analyses for many other process.

ParFit: A Python-Based Object-Oriented Program for Fitting Molecular Mechanics Parameters to ab Initio Data.

PubMed

Zahariev, Federico; De Silva, Nuwan; Gordon, Mark S; Windus, Theresa L; Dick-Perez, Marilu

2017-03-27

A newly created object-oriented program for automating the process of fitting molecular-mechanics parameters to ab initio data, termed ParFit, is presented. ParFit uses a hybrid of deterministic and stochastic genetic algorithms. ParFit can simultaneously handle several molecular-mechanics parameters in multiple molecules and can also apply symmetric and antisymmetric constraints on the optimized parameters. The simultaneous handling of several molecules enhances the transferability of the fitted parameters. ParFit is written in Python, uses a rich set of standard and nonstandard Python libraries, and can be run in parallel on multicore computer systems. As an example, a series of phosphine oxides, important for metal extraction chemistry, are parametrized using ParFit. ParFit is in an open source program available for free on GitHub ( https://github.com/fzahari/ParFit ).

Relationship of the Williams-Poulios and Manning-Rosen Potential Energy Models for Diatomic Molecules

NASA Astrophysics Data System (ADS)

Jia, Chun-Sheng; Liang, Guang-Chuan; Peng, Xiao-Long; Tang, Hong-Ming; Zhang, Lie-Hui

2014-06-01

By employing the dissociation energy and the equilibrium bond length for a diatomic molecule as explicit parameters, we generate an improved form of the Williams-Poulios potential energy model. It is found that the negative Williams-Poulios potential model is equivalent to the Manning-Rosen potential model for diatomic molecules. We observe that the Manning-Rosen potential is superior to the Morse potential in reproducing the interaction potential energy curves for the {{a}3 Σu+} state of the 6Li2 molecule and the {{X}1 sum+} state of the SiF+ molecule.

Plasma ion-induced molecular ejection on the Galilean satellites - Energies of ejected molecules

NASA Technical Reports Server (NTRS)

Johnson, R. E.; Boring, J. W.; Reimann, C. T.; Barton, L. A.; Sieveka, E. M.; Garrett, J. W.; Farmer, K. R.; Brown, W. L.; Lanzerotti, L. J.

1983-01-01

First measurements of the energy of ejection of molecules from icy surfaces by fast incident ions are presented. Such results are needed in discussions of the Jovian and Saturnian plasma interactions with the icy satellites. In this letter parameters describing the ion-induced ejection and redistribution of molecules on the Galilean satellites are recalculated in light of the new laboratory data.

Observation of Spectral Diffusion in Crystals Using Single Impurity Molecules

DTIC Science & Technology

1990-10-31

from 12pentacene photophysical parameters including intersystem crossing . Apparently (and not surprisingly), the local pentacene environment this... pentacene molecules inp-terphenyl, both stable as well as spectrally diffusing single molecules can be observed. 20 DISTRIBUTION/AVAILABILITY OF ABSTRACT 121...with ultrathin sublimed crystals have removed this obstacle. For the case of pentacene impurities in crystals of p-terphenyl, we observe two radically

Communicating with the public about risk

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wade, C R; Molony, S T; Durbin, M E

1992-01-01

Risk communication is a growing specialty field in communication that draws from well-established principles of sociology and psychology. It is a new way to communicate with potentially hostile audiences about sensitive environmental, safety, and health issues they face. This paper explains the most important principles of risk communication and discusses audience analyses, perceptions of risk (outrage factors), and risk comparisons. These principles are applied to a risk communication issue in Malhuevo, a fictitious Arizona community.

Regulations and Ethical Considerations for Astronomy Education Research III: A Suggested Code of Ethics

NASA Astrophysics Data System (ADS)

Brogt, Erik; Foster, Tom; Dokter, Erin; Buxner, Sanlyn; Antonellis, Jessie

We present an argument for, and suggested implementation of, a code of ethics for the astronomy education research community. This code of ethics is based on legal and ethical considerations set forth by U.S. federal regulations and the existing code of conduct of the American Educational Research Association. We also provide a fictitious research study as an example for working through the suggested code of ethics.

Self-organization in cold atomic gases: a synchronization perspective.

PubMed

Tesio, E; Robb, G R M; Oppo, G-L; Gomes, P M; Ackemann, T; Labeyrie, G; Kaiser, R; Firth, W J

2014-10-28

We study non-equilibrium spatial self-organization in cold atomic gases, where long-range spatial order spontaneously emerges from fluctuations in the plane transverse to the propagation axis of a single optical beam. The self-organization process can be interpreted as a synchronization transition in a fully connected network of fictitious oscillators, and described in terms of the Kuramoto model. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

Strength design of Zr(x)Ti(x)Hf(x)Nb(x)Mo(x) alloys based on empirical electron theory of solids and molecules

NASA Astrophysics Data System (ADS)

Li, Y. K.; Chen, Y. W.; Cheng, X. W.; Wu, C.; Cheng, B.

2018-05-01

In this paper, the valence electron structure parameters of Zr(x)Ti(x)Hf(x)Nb(x)Mo(x) alloys were calculated based on the empirical electron theory of solids and molecules (EET), and their performance through these parameters were predicted. Subsequently, the alloys with special valence electron structure parameters were prepared byarc melting. The hardness and high-temperature mechanical properties were analyzed to verify the prediction. Research shows that the influence of shared electron number nA on the strongest bond determines the strength of these alloys and the experiments are consistent with the theoretical prediction.

Critical evaluation of dipolar, acid-base and charge interactions I. Electron displacement within and between molecules, liquids and semiconductors.

PubMed

Rosenholm, Jarl B

2017-09-01

Specific dipolar, acid-base and charge interactions involve electron displacements. For atoms, single bonds and molecules electron displacement is characterized by electronic potential, absolute hardness, electronegativity and electron gap. In addition, dissociation, bonding, atomization, formation, ionization, affinity and lattice enthalpies are required to quantify the electron displacement in solids. Semiconductors are characterized by valence and conduction band energies, electron gaps and average Fermi energies which in turn determine Galvani potentials of the bulk, space charge layer and surface states. Electron displacement due to interaction between (probe) molecules, liquids and solids are characterized by parameters such as Hamaker constant, solubility parameter, exchange energy density, surface tension, work of adhesion and immersion. They are determined from permittivity, refractive index, enthalpy of vaporization, molar volume, surface pressure and contact angle. Moreover, acidic and basic probes may form adducts which are adsorbed on target substrates in order to establish an indirect measure of polarity, acidity, basicity or hydrogen bonding. Acidic acceptor numbers (AN), basic donor numbers (DN), acidic and basic "electrostatic" (E) and "covalent" (C) parameters determined by enthalpy of adduct formation are considered as general acid-base scales. However, the formal grounds for assignments as dispersive, Lifshitz-van der Waals, polar, acid, base and hydrogen bond interactions are inconsistent. Although correlations are found no of the parameters are mutually fully compatible and moreover the enthalpies of acid-base interaction do not correspond to free energies. In this review the foundations of different acid-base parameters relating to electron displacement within and between (probe) molecules, liquids and (semiconducting) solids are thoroughly investigated and their mutual relationships are evaluated. Copyright © 2017 Elsevier B.V. All rights reserved.

The electronegativity equalization method and the split charge equilibration applied to organic systems: parametrization, validation, and comparison.

PubMed

Verstraelen, Toon; Van Speybroeck, Veronique; Waroquier, Michel

2009-07-28

An extensive benchmark of the electronegativity equalization method (EEM) and the split charge equilibration (SQE) model on a very diverse set of organic molecules is presented. These models efficiently compute atomic partial charges and are used in the development of polarizable force fields. The predicted partial charges that depend on empirical parameters are calibrated to reproduce results from quantum mechanical calculations. Recently, SQE is presented as an extension of the EEM to obtain the correct size dependence of the molecular polarizability. In this work, 12 parametrization protocols are applied to each model and the optimal parameters are benchmarked systematically. The training data for the empirical parameters comprise of MP2/Aug-CC-pVDZ calculations on 500 organic molecules containing the elements H, C, N, O, F, S, Cl, and Br. These molecules have been selected by an ingenious and autonomous protocol from an initial set of almost 500,000 small organic molecules. It is clear that the SQE model outperforms the EEM in all benchmark assessments. When using Hirshfeld-I charges for the calibration, the SQE model optimally reproduces the molecular electrostatic potential from the ab initio calculations. Applications on chain molecules, i.e., alkanes, alkenes, and alpha alanine helices, confirm that the EEM gives rise to a divergent behavior for the polarizability, while the SQE model shows the correct trends. We conclude that the SQE model is an essential component of a polarizable force field, showing several advantages over the original EEM.

Summary Report for the CONSET Program at AEDC

DTIC Science & Technology

1980-09-01

the Lennard - Jones 12-6 intermolecular potential function, reduced onset pressures (P;) and temperatures (T;) have been determined using (lo) 16 AEDC...different, and this illustrates the inadequacy of the two-parameter Lennard - Jones potential for describing the interaction of polar molecules. As is well...molecules well described by the 12-6 Lennard - Jones potential will have common onset loci depending upon the specific heat ratio. However, polar molecules

Simulation-based cheminformatic analysis of organelle-targeted molecules: lysosomotropic monobasic amines

PubMed Central

Zhang, Xinyuan; Zheng, Nan

2008-01-01

Cell-based molecular transport simulations are being developed to facilitate exploratory cheminformatic analysis of virtual libraries of small drug-like molecules. For this purpose, mathematical models of single cells are built from equations capturing the transport of small molecules across membranes. In turn, physicochemical properties of small molecules can be used as input to simulate intracellular drug distribution, through time. Here, with mathematical equations and biological parameters adjusted so as to mimic a leukocyte in the blood, simulations were performed to analyze steady state, relative accumulation of small molecules in lysosomes, mitochondria, and cytosol of this target cell, in the presence of a homogenous extracellular drug concentration. Similarly, with equations and parameters set to mimic an intestinal epithelial cell, simulations were also performed to analyze steady state, relative distribution and transcellular permeability in this non-target cell, in the presence of an apical-to-basolateral concentration gradient. With a test set of ninety-nine monobasic amines gathered from the scientific literature, simulation results helped analyze relationships between the chemical diversity of these molecules and their intracellular distributions. Electronic supplementary material The online version of this article (doi:10.1007/s10822-008-9194-7) contains supplementary material, which is available to authorized users. PMID:18338229

Robust nonparametric quantification of clustering density of molecules in single-molecule localization microscopy

PubMed Central

Jiang, Shenghang; Park, Seongjin; Challapalli, Sai Divya; Fei, Jingyi; Wang, Yong

2017-01-01

We report a robust nonparametric descriptor, J′(r), for quantifying the density of clustering molecules in single-molecule localization microscopy. J′(r), based on nearest neighbor distribution functions, does not require any parameter as an input for analyzing point patterns. We show that J′(r) displays a valley shape in the presence of clusters of molecules, and the characteristics of the valley reliably report the clustering features in the data. Most importantly, the position of the J′(r) valley (rJm′) depends exclusively on the density of clustering molecules (ρc). Therefore, it is ideal for direct estimation of the clustering density of molecules in single-molecule localization microscopy. As an example, this descriptor was applied to estimate the clustering density of ptsG mRNA in E. coli bacteria. PMID:28636661

Parametrization and Benchmark of Long-Range Corrected DFTB2 for Organic Molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vuong, Van Quan; Akkarapattiakal Kuriappan, Jissy; Kubillus, Maximilian

In this paper, we present the parametrization and benchmark of long-range corrected second-order density functional tight binding (DFTB), LC-DFTB2, for organic and biological molecules. The LC-DFTB2 model not only improves fundamental orbital energy gaps but also ameliorates the DFT self-interaction error and overpolarization problem, and further improves charge-transfer excited states significantly. Electronic parameters for the construction of the DFTB2 Hamiltonian as well as repulsive potentials were optimized for molecules containing C, H, N, and O chemical elements. We use a semiautomatic parametrization scheme based on a genetic algorithm. With the new parameters, LC-DFTB2 describes geometries and vibrational frequencies of organicmore » molecules similarly well as third-order DFTB3/3OB, the de facto standard parametrization based on a GGA functional. Finally, LC-DFTB2 performs well also for atomization and reaction energies, however, slightly less satisfactorily than DFTB3/3OB.« less

Effective intermolecular potential and critical point for C60 molecule

NASA Astrophysics Data System (ADS)

Ramos, J. Eloy

2017-07-01

The approximate nonconformal (ANC) theory is applied to the C60 molecule. A new binary potential function is developed for C60, which has three parameters only and is obtained by averaging the site-site carbon interactions on the surface of two C60 molecules. It is shown that the C60 molecule follows, to a good approximation, the corresponding states principle with n-C8H18, n-C4F10 and n-C5F12. The critical point of C60 is estimated in two ways: first by applying the corresponding states principle under the framework of the ANC theory, and then by using previous computer simulations. The critical parameters obtained by applying the corresponding states principle, although very different from those reported in the literature, are consistent with the previous results of the ANC theory. It is shown that the Girifalco potential does not correspond to an average of the site-site carbon-carbon interaction.

Parametrization and Benchmark of Long-Range Corrected DFTB2 for Organic Molecules

DOE PAGES

Vuong, Van Quan; Akkarapattiakal Kuriappan, Jissy; Kubillus, Maximilian; ...

2017-12-12

In this paper, we present the parametrization and benchmark of long-range corrected second-order density functional tight binding (DFTB), LC-DFTB2, for organic and biological molecules. The LC-DFTB2 model not only improves fundamental orbital energy gaps but also ameliorates the DFT self-interaction error and overpolarization problem, and further improves charge-transfer excited states significantly. Electronic parameters for the construction of the DFTB2 Hamiltonian as well as repulsive potentials were optimized for molecules containing C, H, N, and O chemical elements. We use a semiautomatic parametrization scheme based on a genetic algorithm. With the new parameters, LC-DFTB2 describes geometries and vibrational frequencies of organicmore » molecules similarly well as third-order DFTB3/3OB, the de facto standard parametrization based on a GGA functional. Finally, LC-DFTB2 performs well also for atomization and reaction energies, however, slightly less satisfactorily than DFTB3/3OB.« less

Study of ground state optical transfer for ultracold alkali dimers

NASA Astrophysics Data System (ADS)

Bouloufa-Maafa, Nadia; Londono, Beatriz; Borsalino, Dimitri; Vexiau, Romain; Mahecha, Jorge; Dulieu, Olivier; Luc-Koenig, Eliane

2013-05-01

Control of molecular states by laser pulses offer promising potential applications. The manipulation of molecules by external fields requires precise knowledge of the molecular structure. Our motivation is to perform a detailed analysis of the spectroscopic properties of alkali dimers, with the aim to determine efficient optical paths to form molecules in the absolute ground state and to determine the optimal parameters of the optical lattices where those molecules are manipulated to avoid losses by collisions. To this end, we use state of the art molecular potentials, R-dependent spin-orbit coupling and transition dipole moment to perform our calculations. R-dependent SO coupling are of crucial importance because the transitions occur at internuclear distances where they are affected by this R-dependence. Efficient schemes to transfer RbCs, KRb and KCs to the absolute ground state as well as the optimal parameters of the optical lattices will be presented. This work was supported in part by ``Triangle de la Physique'' under contract 2008-007T-QCCM (Quantum Control of Cold Molecules).

A general nuclear magnetic resonance analysis of hetero-association of aromatic molecules in aqueous solution

NASA Astrophysics Data System (ADS)

Veselkov, Alexei N.; Evstigneev, Maxim P.; Veselkov, Dennis A.; Davies, David B.

2001-08-01

A general nuclear magnetic resonance analysis of a statistical-thermodynamical model of hetero-association of aromatic molecules in solution has been developed to take "edge effects" into consideration, i.e., the dependence of proton chemical shifts on the position of the molecule situated inside or at the edge of the aggregate. This generalized approach is compared with a previously published model, where an average contribution to proton shielding is considered irrespective of the position of the molecule in the stack. Association parameters have been determined from experimental concentration and temperature dependences of 500 MHz proton chemical shifts of the hetero-association of the acridine dye, proflavine, and the phenanthridinium dye, ethidium bromide, in aqueous solution. Differences in the parameters in the range 10%-30% calculated using the basic and generalized approaches have been found to depend substantially on the magnitude of the equilibrium hetero-association constant Khet—the larger the value of Khet, the higher the discrepancy between the two methods.

PHYSICAL FUNDAMENTALS OF QUANTUM ELECTRONICS: Interaction of a sequence of short broad-band radiation pulses with a diatomic molecule

NASA Astrophysics Data System (ADS)

Oraevsky, Anatolii N.; Kozlovskii, Andrei V.; Chichkov, B. N.

1998-07-01

A theoretical analysis is made of the process in which a molecule undergoes a transition between the ground and excited electronic states under the action of a radiation pulse and then, in the interpulse interval, returns to the ground electronic state. Such a periodic process is important in the cooling of molecules by laser radiation. It is shown that the radiation parameters can be selected so that the CO and CN molecules experience over 1000 excitation—relaxation events without dissociation.

Extended solvent-contact model approach to blind SAMPL5 prediction challenge for the distribution coefficients of drug-like molecules

NASA Astrophysics Data System (ADS)

Chung, Kee-Choo; Park, Hwangseo

2016-11-01

The performance of the extended solvent-contact model has been addressed in the SAMPL5 blind prediction challenge for distribution coefficient (LogD) of drug-like molecules with respect to the cyclohexane/water partitioning system. All the atomic parameters defined for 41 atom types in the solvation free energy function were optimized by operating a standard genetic algorithm with respect to water and cyclohexane solvents. In the parameterizations for cyclohexane, the experimental solvation free energy (Δ G sol ) data of 15 molecules for 1-octanol were combined with those of 77 molecules for cyclohexane to construct a training set because Δ G sol values of the former were unavailable for cyclohexane in publicly accessible databases. Using this hybrid training set, we established the LogD prediction model with the correlation coefficient ( R), average error (AE), and root mean square error (RMSE) of 0.55, 1.53, and 3.03, respectively, for the comparison of experimental and computational results for 53 SAMPL5 molecules. The modest accuracy in LogD prediction could be attributed to the incomplete optimization of atomic solvation parameters for cyclohexane. With respect to 31 SAMPL5 molecules containing the atom types for which experimental reference data for Δ G sol were available for both water and cyclohexane, the accuracy in LogD prediction increased remarkably with the R, AE, and RMSE values of 0.82, 0.89, and 1.60, respectively. This significant enhancement in performance stemmed from the better optimization of atomic solvation parameters by limiting the element of training set to the molecules with experimental Δ G sol data for cyclohexane. Due to the simplicity in model building and to low computational cost for parameterizations, the extended solvent-contact model is anticipated to serve as a valuable computational tool for LogD prediction upon the enrichment of experimental Δ G sol data for organic solvents.

Seismological investigation of the National Data Centre Preparedness Exercise 2013

NASA Astrophysics Data System (ADS)

Gestermann, Nicolai; Hartmann, Gernot; Ross, J. Ole; Ceranna, Lars

2015-04-01

The Comprehensive Nuclear-Test-Ban Treaty (CTBT) prohibits all kinds of nuclear explosions conducted on Earth - underground, underwater or in the atmosphere. The verification regime of the CTBT is designed to detect any treaty violation. While the data of the International Monitoring System (IMS) is collected, processed and technically analyzed at the International Data Centre (IDC) of the CTBT-Organization, National Data Centres (NDC) of the member states provide interpretation and advice to their government concerning suspicious detections. The NDC Preparedness Exercises (NPE) are regularly performed dealing with fictitious treaty violations to practice the combined analysis of CTBT verification technologies. These exercises should help to evaluate the effectiveness of analysis procedures applied at NDCs and the quality, completeness and usefulness of IDC products for example. The exercise trigger of NPE2013 is a combination of a tempo-spatial indication pointing to a certain waveform event and simulated radionuclide concentrations generated by forward Atmospheric Transport Modelling based on a fictitious release. For the waveform event the date (4 Sept. 2013) is given and the region is communicated in a map showing the fictitious state of "Frisia" at the Coast of the North Sea in Central Europe. The potential connection between the waveform and radionuclide evidence remains unclear for exercise participants. The verification task was to identify the waveform event and to investigate potential sources of the radionuclide findings. The final question was whether the findings are CTBT relevant and justify a request for On-Site-Inspection in "Frisia". The seismic event was not included in the Reviewed Event Bulletin (REB) of the IDC. The available detections from the closest seismic IMS stations lead to a epicenter accuracy of about 24 km which is not sufficient to specify the 1000 km2 inspection area in case of an OSI. With use of data from local stations and adjusted velocity models the epicenter accuracy could be improved to less than 2 km, which demonstrates the crucial role of national technical means for verification tasks. The seismic NPE2013 event could be identified as induced from natural gas production in the source region. Similar waveforms and comparable spectral characteristic as a set of events in the same region are clear indications. The scenario of a possible treaty violation at the location of the seismic NPE2013 event could be disproved.

Dynamics of fictitious earth's satellites with possible past values of the ecliptic.

NASA Astrophysics Data System (ADS)

Callegari, N., Jr.; Yokoyama, T.; Marinho, E. P.

The dynamics of some fictitious Earth satellites is studied considering initially, the secular perturbations due to Sun and the oblateness of the planet. With only these two disturbers, the problem is shown to be very similar to the case of fictitious satellites of Mars and Venus (already studied by one of us). Then, since the obliquities of the inner planets could have varied in a large interval, the eccentricities of the satellites were strongly disturbed, reaching some high prohibitive values. These values might have caused collision of the satellite with the planet or with some internal orbits. Moreover we can show that, provided that the semi major axis is near a critical value, a chaotic zone may appear and again the eccentricity can suffer very strong variation. However, as shown by Laskar et all (1993) in the case of Earth, large variation of the obliquity occurs only in the absence of the Moon. Although we do not know the origin and the past evolution of the M! oon, we decided to include it as a new disturber. Some information about past inclination of the Moon and the obliquity for several distances from the planet are given in Goldreich (1966), Touma and Wisdom (1993). The integration of the full equations, even for a massless satellite, takes too long computer time. In order to safe time and to get a preliminary idea, we derived the standard averaged equations for the gravitational part in the spatial case. However the present value of the Moon's mass is too much large for this first order averaged system. In spite of this, starting with some smaller masses and convenient ratio of semi major axes, it is shown that the qualitative behaviour of the averaged equations matches well with the results of the exact equation. Then it is easy to search and confirm the existence of some unstable regions where satellites placed on the equator in almost circular orbits can suffer very big increase of the eccentricity in a few hundred years. For the present value of the Moon's mass, only exact differential equations can be used and as expected, the previous region of instability not only persists but is much more pronounced for the present mass. Due to these unstable regions, satellites cannot survive in a large domain of the phase space.

High Temperature Advanced Structural Composites. Volume 3. Mechanics

DTIC Science & Technology

1993-04-02

see Wakashima er aL.. 1974; Takahashi et at., 1985; Takao, 1985; Takao and Taya, 1985) These works base their derivation directly on eigenstrain ...equivalence between our result (4.25) and that obtained by Takao and Taya (I 9385 The approach used by these authors is based on the eigenstrain ...has been used instead of f in Takao and Taya. In that work *e denotes the fictitious strain called " eigenstrain " or -transformation strain" and 11 is

KSC-04PD-2441

NASA Technical Reports Server (NTRS)

2004-01-01

KENNEDY SPACE CENTER, FLA. On Launch Pad 39A, a rescue force climbs into slidewire baskets on the Fixed Service Structure during an emergency egress scenario. The four-hour exercise simulated normal launch countdown operations, with the added challenge of a fictitious event causing an evacuation of the vehicle and launch pad. It tested the teams rescue approaches on the Fixed Service Structure, slidewire basket evacuation, triage care and transportation of injured personnel to hospitals, as well as communications and coordination.

Intranasal administration of oxytocin increases human aggressive behavior.

PubMed

Ne'eman, R; Perach-Barzilay, N; Fischer-Shofty, M; Atias, A; Shamay-Tsoory, S G

2016-04-01

Considering its role in prosocial behaviors, oxytocin (OT) has been suggested to diminish levels of aggression. Nevertheless, recent findings indicate that oxytocin may have a broader influence on increasing the salience of social stimuli and may therefore, under certain circumstances, increase antisocial behaviors such as aggression. This controversy led to the following speculations: If indeed oxytocin promotes primarily prosocial behavior, administration of OT is expected to diminish levels of aggression. However, if oxytocin mainly acts to increase the salience of social stimuli, it is expected to elevate levels of aggression following provocation. In order to test this assumption we used the Social Orientation Paradigm (SOP), a monetary game played against a fictitious partner that allows measuring three types of responses in the context of provocation: an aggressive response - reducing a point from the fictitious partner, an individualistic response - adding a point to oneself, and a collaborative response - adding half a point to the partner and half a point to oneself. In the current double-blind, placebo-controlled, within-subject study design, 45 participants completed the SOP task following the administration of oxytocin or placebo. The results indicated that among subjects naïve to the procedure oxytocin increased aggressive responses in comparison with placebo. These results support the saliency hypothesis of oxytocin and suggest that oxytocin plays a complex role in the modulation of human behavior. Copyright © 2016 Elsevier Inc. All rights reserved.

Four eyes match better than two: Sharing of precise patch-use time among socially foraging domestic chicks.

PubMed

Xin, Qiuhong; Ogura, Yukiko; Matsushima, Toshiya

2017-07-01

To examine how resource competition contributes to patch-use behaviour, we examined domestic chicks foraging in an I-shaped maze equipped with two terminal feeders. In a variable interval schedule, one feeder supplied grains three times more frequently than the other, and the sides were reversed midway through the experiment. The maze was partitioned into two lanes by a transparent wall, so that chicks fictitiously competed without actual interference. Stay time at feeders was compared among three groups. The "single" group contained control chicks; the "pair" group comprised the pairs of chicks tested in the fictitious competition; "mirror" included single chicks accompanied by their respective mirror images. Both "pair" and "mirror" chicks showed facilitated running. In terms of the patch-use ratio, "pair" chicks showed precise matching at approximately 3:1 with significant mutual dependence, whereas "single" and "mirror" chicks showed a comparable under-matching. The facilitated running increased visits to feeders, but failed to predict the patch-use ratio of the subject. At the reversal, quick switching occurred similarly in all groups, but the "pair" chicks revealed a stronger memory-based matching. Perceived competition therefore contributes to precise matching and lasting memory of the better feeder, in a manner dissociated from socially facilitated food search. Copyright © 2017 Elsevier B.V. All rights reserved.

Episodic future thinking and future-based decision-making in a case of retrograde amnesia.

PubMed

De Luca, Flavia; Benuzzi, Francesca; Bertossi, Elena; Braghittoni, Davide; di Pellegrino, Giuseppe; Ciaramelli, Elisa

2018-02-01

We investigated episodic future thinking (EFT) and future-based cognition and decision-making in patient SG, who developed a dense retrograde amnesia following hypoxia due to a cardiac arrest. Despite intact general cognitive and executive functioning, SG was unable to remember events from his entire lifetime. He had, however, relatively spared anterograde memory and general semantic knowledge. Voxel-based morphometry detected a reduction of gray matter in the thalamus, cerebellum and fusiform gyrus bilaterally, and, at a reduced threshold, in several regions of the autobiographical memory network, including the hippocampi. We show that SG is unable to imagine personal future events, but can imagine fictitious events not self-relevant and not located in subjective time. Despite severely impaired EFT, SG shows normal attitudes towards the future time, and normal delay discounting rates. These findings suggest that retrieval of autobiographical information from long-term memory is necessary for EFT. However, relatively spared anterograde memory and general semantic knowledge may be sufficient to allow construction of fictitious experiences. As well, EFT is not necessary to drive future-oriented cognition and choice. These findings highlight the relation between autobiographical memory and EFT, and the fractionation of human temporal consciousness. Moreover, they contribute to our understanding of retrograde amnesia as an impairment of memory as well as future thinking. Copyright © 2017 Elsevier Ltd. All rights reserved.

Investigating the role of the ventromedial prefrontal cortex in the assessment of brands.

PubMed

Santos, José Paulo; Seixas, Daniela; Brandão, Sofia; Moutinho, Luiz

2011-01-01

The ventromedial prefrontal cortex (vmPFC) is believed to be important in everyday preference judgments, processing emotions during decision-making. However, there is still controversy in the literature regarding the participation of the vmPFC. To further elucidate the contribution of the vmPFC in brand preference, we designed a functional magnetic resonance imaging (fMRI) study where 18 subjects assessed positive, indifferent, and fictitious brands. Also, both the period during and after the decision process were analyzed, hoping to unravel temporally the role of the vmPFC, using modeled and model-free fMRI analysis. Considering together the period before and after decision-making, there was activation of the vmPFC when comparing positive with indifferent or fictitious brands. However, when the decision-making period was separated from the moment after the response, and especially for positive brands, the vmPFC was more active after the choice than during the decision process itself, challenging some of the existing literature. The results of the present study support the notion that the vmPFC may be unimportant in the decision stage of brand preference, questioning theories that postulate that the vmPFC is in the origin of such a choice. Further studies are needed to investigate in detail why the vmPFC seems to be involved in brand preference only after the decision process.

Investigating the Role of the Ventromedial Prefrontal Cortex in the Assessment of Brands

PubMed Central

Santos, José Paulo; Seixas, Daniela; Brandão, Sofia; Moutinho, Luiz

2011-01-01

The ventromedial prefrontal cortex (vmPFC) is believed to be important in everyday preference judgments, processing emotions during decision-making. However, there is still controversy in the literature regarding the participation of the vmPFC. To further elucidate the contribution of the vmPFC in brand preference, we designed a functional magnetic resonance imaging (fMRI) study where 18 subjects assessed positive, indifferent, and fictitious brands. Also, both the period during and after the decision process were analyzed, hoping to unravel temporally the role of the vmPFC, using modeled and model-free fMRI analysis. Considering together the period before and after decision-making, there was activation of the vmPFC when comparing positive with indifferent or fictitious brands. However, when the decision-making period was separated from the moment after the response, and especially for positive brands, the vmPFC was more active after the choice than during the decision process itself, challenging some of the existing literature. The results of the present study support the notion that the vmPFC may be unimportant in the decision stage of brand preference, questioning theories that postulate that the vmPFC is in the origin of such a choice. Further studies are needed to investigate in detail why the vmPFC seems to be involved in brand preference only after the decision process. PMID:21687799

The active site of hen egg-white lysozyme: flexibility and chemical bonding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Held, Jeanette, E-mail: jeanette.netzel@uni-bayreuth.de; Smaalen, Sander van

Chemical bonding at the active site of lysozyme is analyzed on the basis of a multipole model employing transferable multipole parameters from a database. Large B factors at low temperatures reflect frozen-in disorder, but therefore prevent a meaningful free refinement of multipole parameters. Chemical bonding at the active site of hen egg-white lysozyme (HEWL) is analyzed on the basis of Bader’s quantum theory of atoms in molecules [QTAIM; Bader (1994 ▶), Atoms in Molecules: A Quantum Theory. Oxford University Press] applied to electron-density maps derived from a multipole model. The observation is made that the atomic displacement parameters (ADPs) ofmore » HEWL at a temperature of 100 K are larger than ADPs in crystals of small biological molecules at 298 K. This feature shows that the ADPs in the cold crystals of HEWL reflect frozen-in disorder rather than thermal vibrations of the atoms. Directly generalizing the results of multipole studies on small-molecule crystals, the important consequence for electron-density analysis of protein crystals is that multipole parameters cannot be independently varied in a meaningful way in structure refinements. Instead, a multipole model for HEWL has been developed by refinement of atomic coordinates and ADPs against the X-ray diffraction data of Wang and coworkers [Wang et al. (2007), Acta Cryst. D63, 1254–1268], while multipole parameters were fixed to the values for transferable multipole parameters from the ELMAM2 database [Domagala et al. (2012), Acta Cryst. A68, 337–351] . Static and dynamic electron densities based on this multipole model are presented. Analysis of their topological properties according to the QTAIM shows that the covalent bonds possess similar properties to the covalent bonds of small molecules. Hydrogen bonds of intermediate strength are identified for the Glu35 and Asp52 residues, which are considered to be essential parts of the active site of HEWL. Furthermore, a series of weak C—H⋯O hydrogen bonds are identified by means of the existence of bond critical points (BCPs) in the multipole electron density. It is proposed that these weak interactions might be important for defining the tertiary structure and activity of HEWL. The deprotonated state of Glu35 prevents a distinction between the Phillips and Koshland mechanisms.« less

Influence of the Structure of Molecules of Derivatives of 1,2,4-Triazole and 1,2,4-Triazine on Chromatographic Retention Under Conditions of Reversed Phase HPLC

NASA Astrophysics Data System (ADS)

Karaseva, I. N.; Karasev, M. O.; Nechaeva, O. N.; Kurbatova, S. V.

2018-07-01

The dependence of the chromatographic retention of 1,2,4-triazine and 1,2,4-triazole derivatives from water-acetonitrile solutions over octadecyl silica on the structure of sorbate molecules is studied. The effect the physicochemical parameters and topology of heterocycle molecules have on the retention characteristics under RP HPLC conditions is analyzed.

Improvements on a non-invasive, parameter-free approach to inverse form finding

NASA Astrophysics Data System (ADS)

Landkammer, P.; Caspari, M.; Steinmann, P.

2017-08-01

Our objective is to determine the optimal undeformed workpiece geometry (material configuration) within forming processes when the prescribed deformed geometry (spatial configuration) is given. For solving the resulting shape optimization problem—also denoted as inverse form finding—we use a novel parameter-free approach, which relocates in each iteration the material nodal positions as design variables. The spatial nodal positions computed by an elasto-plastic finite element (FE) forming simulation are compared with their prescribed values. The objective function expresses a least-squares summation of the differences between the computed and the prescribed nodal positions. Here, a recently developed shape optimization approach (Landkammer and Steinmann in Comput Mech 57(2):169-191, 2016) is investigated with a view to enhance its stability and efficiency. Motivated by nonlinear optimization theory a detailed justification of the algorithm is given. Furthermore, a classification according to shape changing design, fixed and controlled nodal coordinates is introduced. Two examples with large elasto-plastic strains demonstrate that using a superconvergent patch recovery technique instead of a least-squares (L2 )-smoothing improves the efficiency. Updating the interior discretization nodes by solving a fictitious elastic problem also reduces the number of required FE iterations and avoids severe mesh distortions. Furthermore, the impact of the inclusion of the second deformation gradient in the Hessian of the Quasi-Newton approach is analyzed. Inverse form finding is a crucial issue in metal forming applications. As a special feature, the approach is designed to be coupled in a non-invasive fashion to arbitrary FE software.

Improvements on a non-invasive, parameter-free approach to inverse form finding

NASA Astrophysics Data System (ADS)

Landkammer, P.; Caspari, M.; Steinmann, P.

2018-04-01

Our objective is to determine the optimal undeformed workpiece geometry (material configuration) within forming processes when the prescribed deformed geometry (spatial configuration) is given. For solving the resulting shape optimization problem—also denoted as inverse form finding—we use a novel parameter-free approach, which relocates in each iteration the material nodal positions as design variables. The spatial nodal positions computed by an elasto-plastic finite element (FE) forming simulation are compared with their prescribed values. The objective function expresses a least-squares summation of the differences between the computed and the prescribed nodal positions. Here, a recently developed shape optimization approach (Landkammer and Steinmann in Comput Mech 57(2):169-191, 2016) is investigated with a view to enhance its stability and efficiency. Motivated by nonlinear optimization theory a detailed justification of the algorithm is given. Furthermore, a classification according to shape changing design, fixed and controlled nodal coordinates is introduced. Two examples with large elasto-plastic strains demonstrate that using a superconvergent patch recovery technique instead of a least-squares (L2)-smoothing improves the efficiency. Updating the interior discretization nodes by solving a fictitious elastic problem also reduces the number of required FE iterations and avoids severe mesh distortions. Furthermore, the impact of the inclusion of the second deformation gradient in the Hessian of the Quasi-Newton approach is analyzed. Inverse form finding is a crucial issue in metal forming applications. As a special feature, the approach is designed to be coupled in a non-invasive fashion to arbitrary FE software.

Analytical Solution for Reactive Solute Transport Considering Incomplete Mixing

NASA Astrophysics Data System (ADS)

Bellin, A.; Chiogna, G.

2013-12-01

The laboratory experiments of Gramling et al. (2002) showed that incomplete mixing at the pore scale exerts a significant impact on transport of reactive solutes and that assuming complete mixing leads to overestimation of product concentration in bimolecular reactions. We consider here the family of equilibrium reactions for which the concentration of the reactants and the product can be expressed as a function of the mixing ratio, the concentration of a fictitious non reactive solute. For this type of reactions we propose, in agreement with previous studies, to model the effect of incomplete mixing at scales smaller than the Darcy scale assuming that the mixing ratio is distributed within an REV according to a Beta distribution. We compute the parameters of the Beta model by imposing that the mean concentration is equal to the value that the concentration assumes at the continuum Darcy scale, while the variance decays with time as a power law. We show that our model reproduces the concentration profiles of the reaction product measured in the Gramling et al. (2002) experiments using the transport parameters obtained from conservative experiments and an instantaneous reaction kinetic. The results are obtained applying analytical solutions both for conservative and for reactive solute transport, thereby providing a method to handle the effect of incomplete mixing on multispecies reactive solute transport, which is simpler than other previously developed methods. Gramling, C. M., C. F. Harvey, and L. C. Meigs (2002), Reactive transport in porous media: A comparison of model prediction with laboratory visualization, Environ. Sci. Technol., 36(11), 2508-2514.

Conformational effects on circular dichroism in the photoelectron angular distribution.

PubMed

Di Tommaso, Devis; Stener, Mauro; Fronzoni, Giovanna; Decleva, Piero

2006-04-10

The B-spline density-functional method has been applied to the conformers of the (1R, 2R)-1,2-dibromo-1,2-dichloro-1,2-difluoroethane molecule. The cross section, asymmetry, and dichroic parameters relative to core and valence orbitals, which do not change their nature along the conformational curve, have been systematically studied. While the cross section and the asymmetry parameter are weakly affected, the dichroic parameter appears to be rather sensitive to the particular conformer of the molecule, suggesting that this dynamical property could be a useful tool for conformational analysis. The computational method has also been applied to methyl rotation in methyloxirane. Unexpected and dramatic sensitivity of the dichroic-parameter profile to the methyl rotation, both in the core and valence states, has been found. Boltzmann averaging over the conformers reproduces quite closely the profiles previously obtained for the minimum-energy conformation, which is in good agreement with the experimental results.

A special method for analyzing anisotropic nuclear magnetic resonance parameters: Acetonitrile in liquid crystals

NASA Astrophysics Data System (ADS)

Lounila, Juhani; Ala-Korpela, Mika; Jokisaari, Jukka

1990-12-01

A reliable analysis of the nuclear magnetic resonance (NMR) spectral parameters of partially oriented molecules requires the calculation of the effects of the correlation between the molecular vibration and rotation. However, in many cases the information content of the spectral data is not sufficient for an unambiguous determination of all the adjustable parameters involved in such an analysis. The present paper describes a special method to simplify the analysis significantly, so as to make seemingly underdetermined problems solvable. The method is applicable to the molecules which contain segments composed of one or more light bonds attached to a heavier bond. It is applied to the anisotropic couplings Dij of acetonitrile (CH3CN) oriented in various liquid crystals. The analysis leads to the following rα geometry: ∠HCH=109.22°±0.06°, rCH/rCC =0.751±0.002 and rCN/rCC =0.788±0.005. In addition, detailed information on (1) the indirect coupling anisotropies ΔJCC and 2ΔJCN, (2) the 1H and 13C chemical shift anisotropies, (3) the external torques acting on the CH bonds, and (4) the orientational order parameters of the CH3C segment of the acetonitrile molecule is obtained.

Machine Learning of Parameters for Accurate Semiempirical Quantum Chemical Calculations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dral, Pavlo O.; von Lilienfeld, O. Anatole; Thiel, Walter

2015-05-12

We investigate possible improvements in the accuracy of semiempirical quantum chemistry (SQC) methods through the use of machine learning (ML) models for the parameters. For a given class of compounds, ML techniques require sufficiently large training sets to develop ML models that can be used for adapting SQC parameters to reflect changes in molecular composition and geometry. The ML-SQC approach allows the automatic tuning of SQC parameters for individual molecules, thereby improving the accuracy without deteriorating transferability to molecules with molecular descriptors very different from those in the training set. The performance of this approach is demonstrated for the semiempiricalmore » OM2 method using a set of 6095 constitutional isomers C7H10O2, for which accurate ab initio atomization enthalpies are available. The ML-OM2 results show improved average accuracy and a much reduced error range compared with those of standard OM2 results, with mean absolute errors in atomization enthalpies dropping from 6.3 to 1.7 kcal/mol. They are also found to be superior to the results from specific OM2 reparameterizations (rOM2) for the same set of isomers. The ML-SQC approach thus holds promise for fast and reasonably accurate high-throughput screening of materials and molecules.« less

PRince: a web server for structural and physicochemical analysis of protein-RNA interface.

PubMed

Barik, Amita; Mishra, Abhishek; Bahadur, Ranjit Prasad

2012-07-01

We have developed a web server, PRince, which analyzes the structural features and physicochemical properties of the protein-RNA interface. Users need to submit a PDB file containing the atomic coordinates of both the protein and the RNA molecules in complex form (in '.pdb' format). They should also mention the chain identifiers of interacting protein and RNA molecules. The size of the protein-RNA interface is estimated by measuring the solvent accessible surface area buried in contact. For a given protein-RNA complex, PRince calculates structural, physicochemical and hydration properties of the interacting surfaces. All these parameters generated by the server are presented in a tabular format. The interacting surfaces can also be visualized with software plug-in like Jmol. In addition, the output files containing the list of the atomic coordinates of the interacting protein, RNA and interface water molecules can be downloaded. The parameters generated by PRince are novel, and users can correlate them with the experimentally determined biophysical and biochemical parameters for better understanding the specificity of the protein-RNA recognition process. This server will be continuously upgraded to include more parameters. PRince is publicly accessible and free for use. Available at http://www.facweb.iitkgp.ernet.in/~rbahadur/prince/home.html.

Machine learning of parameters for accurate semiempirical quantum chemical calculations

DOE PAGES

Dral, Pavlo O.; von Lilienfeld, O. Anatole; Thiel, Walter

2015-04-14

We investigate possible improvements in the accuracy of semiempirical quantum chemistry (SQC) methods through the use of machine learning (ML) models for the parameters. For a given class of compounds, ML techniques require sufficiently large training sets to develop ML models that can be used for adapting SQC parameters to reflect changes in molecular composition and geometry. The ML-SQC approach allows the automatic tuning of SQC parameters for individual molecules, thereby improving the accuracy without deteriorating transferability to molecules with molecular descriptors very different from those in the training set. The performance of this approach is demonstrated for the semiempiricalmore » OM2 method using a set of 6095 constitutional isomers C 7H 10O 2, for which accurate ab initio atomization enthalpies are available. The ML-OM2 results show improved average accuracy and a much reduced error range compared with those of standard OM2 results, with mean absolute errors in atomization enthalpies dropping from 6.3 to 1.7 kcal/mol. They are also found to be superior to the results from specific OM2 reparameterizations (rOM2) for the same set of isomers. The ML-SQC approach thus holds promise for fast and reasonably accurate high-throughput screening of materials and molecules.« less

Ligandbook: an online repository for small and drug-like molecule force field parameters.

PubMed

Domanski, Jan; Beckstein, Oliver; Iorga, Bogdan I

2017-06-01

Ligandbook is a public database and archive for force field parameters of small and drug-like molecules. It is a repository for parameter sets that are part of published work but are not easily available to the community otherwise. Parameter sets can be downloaded and immediately used in molecular dynamics simulations. The sets of parameters are versioned with full histories and carry unique identifiers to facilitate reproducible research. Text-based search on rich metadata and chemical substructure search allow precise identification of desired compounds or functional groups. Ligandbook enables the rapid set up of reproducible molecular dynamics simulations of ligands and protein-ligand complexes. Ligandbook is available online at https://ligandbook.org and supports all modern browsers. Parameters can be searched and downloaded without registration, including access through a programmatic RESTful API. Deposition of files requires free user registration. Ligandbook is implemented in the PHP Symfony2 framework with TCL scripts using the CACTVS toolkit. oliver.beckstein@asu.edu or bogdan.iorga@cnrs.fr ; contact@ligandbook.org . Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

Stepped MS(All) Relied Transition (SMART): An approach to rapidly determine optimal multiple reaction monitoring mass spectrometry parameters for small molecules.

PubMed

Ye, Hui; Zhu, Lin; Wang, Lin; Liu, Huiying; Zhang, Jun; Wu, Mengqiu; Wang, Guangji; Hao, Haiping

2016-02-11

Multiple reaction monitoring (MRM) is a universal approach for quantitative analysis because of its high specificity and sensitivity. Nevertheless, optimization of MRM parameters remains as a time and labor-intensive task particularly in multiplexed quantitative analysis of small molecules in complex mixtures. In this study, we have developed an approach named Stepped MS(All) Relied Transition (SMART) to predict the optimal MRM parameters of small molecules. SMART requires firstly a rapid and high-throughput analysis of samples using a Stepped MS(All) technique (sMS(All)) on a Q-TOF, which consists of serial MS(All) events acquired from low CE to gradually stepped-up CE values in a cycle. The optimal CE values can then be determined by comparing the extracted ion chromatograms for the ion pairs of interest among serial scans. The SMART-predicted parameters were found to agree well with the parameters optimized on a triple quadrupole from the same vendor using a mixture of standards. The parameters optimized on a triple quadrupole from a different vendor was also employed for comparison, and found to be linearly correlated with the SMART-predicted parameters, suggesting the potential applications of the SMART approach among different instrumental platforms. This approach was further validated by applying to simultaneous quantification of 31 herbal components in the plasma of rats treated with a herbal prescription. Because the sMS(All) acquisition can be accomplished in a single run for multiple components independent of standards, the SMART approach are expected to find its wide application in the multiplexed quantitative analysis of complex mixtures. Copyright © 2015 Elsevier B.V. All rights reserved.

Method of monitoring photoactive organic molecules in-situ during gas-phase deposition of the photoactive organic molecules

DOEpatents

Forrest, Stephen R.; Vartanian, Garen; Rolin, Cedric

2015-06-23

A method for in-situ monitoring of gas-phase photoactive organic molecules in real time while depositing a film of the photoactive organic molecules on a substrate in a processing chamber for depositing the film includes irradiating the gas-phase photoactive organic molecules in the processing chamber with a radiation from a radiation source in-situ while depositing the film of the one or more organic materials and measuring the intensity of the resulting photoluminescence emission from the organic material. One or more processing parameters associated with the deposition process can be determined from the photoluminescence intensity data in real time providing useful feedback on the deposition process.

Adsorbed molecules in external fields: Effect of confining potential

NASA Astrophysics Data System (ADS)

Tyagi, Ashish; Silotia, Poonam; Maan, Anjali; Prasad, Vinod

2016-12-01

We study the rotational excitation of a molecule adsorbed on a surface. As is well known the interaction potential between the surface and the molecule can be modeled in number of ways, depending on the molecular structure and the geometry under which the molecule is being adsorbed by the surface. We explore the effect of change of confining potential on the excitation, which is largely controlled by the static electric fields and continuous wave laser fields. We focus on dipolar molecules and hence we restrict ourselves to the first order interaction in field-molecule interaction potential either through permanent dipole moment or/and the molecular polarizability parameter. It is shown that confining potential shapes, strength of the confinement, strongly affect the excitation. We compare our results for different confining potentials.

And now, from the company that brought you the seven-eyed trout: Risk communication in action

DOE Office of Scientific and Technical Information (OSTI.GOV)

Durbin, M.E.; Klein, S.H.; Molony, S.T.

1992-01-01

Risk communication is a growing specialty field in communication that draws from well-established principles of sociology and psychology. It is a way to communicate with potentially hostile audiences about sensitive environmental, safety, and health issues they face. This paper explains the most important principles of risk communication and discusses audience analyses, perceptions of risk (outrage factors), and risk comparisons. These principles are applied to a risk communication issue in a fictitious community.

Classical statistical mechanics approach to multipartite entanglement

NASA Astrophysics Data System (ADS)

Facchi, P.; Florio, G.; Marzolino, U.; Parisi, G.; Pascazio, S.

2010-06-01

We characterize the multipartite entanglement of a system of n qubits in terms of the distribution function of the bipartite purity over balanced bipartitions. We search for maximally multipartite entangled states, whose average purity is minimal, and recast this optimization problem into a problem of statistical mechanics, by introducing a cost function, a fictitious temperature and a partition function. By investigating the high-temperature expansion, we obtain the first three moments of the distribution. We find that the problem exhibits frustration.

User's Manual for FEM-BEM Method. 1.0

NASA Technical Reports Server (NTRS)

Butler, Theresa; Deshpande, M. D. (Technical Monitor)

2002-01-01

A user's manual for using FORTRAN code to perform electromagnetic analysis of arbitrarily shaped material cylinders using a hybrid method that combines the finite element method (FEM) and the boundary element method (BEM). In this method, the material cylinder is enclosed by a fictitious boundary and the Maxwell's equations are solved by FEM inside the boundary and by BEM outside the boundary. The electromagnetic scattering on several arbitrarily shaped material cylinders using this FORTRAN code is computed to as examples.

Gravity research at Cottrell observatory

NASA Technical Reports Server (NTRS)

Tuman, V. S.; Anderson, J. D.; Lau, E. L.

1977-01-01

The Cottrell gravity research observatory and work in progress are described. Equipment in place and equipment to be installed, the cryogenic gravity meter (CGM), concrete pads to support the vertical seismometer, CGM, and guest experiments, techniques of data analysis, and improvements needed in the CGM are discussed. Harmonic earth eigenvibrations with multipole moments are examined and their compatibility with a fictitious black hole binary system (of which the primary central mass is assigned a value one million solar masses) located 400 light-years away is shown by calculations.

Modeling the History of Astronomy: Ptolemy, Copernicus, and Tycho

NASA Astrophysics Data System (ADS)

Timberlake, Todd K.

This paper describes a series of activities in which students investigate and use the Ptolemaic, Copernican, and Tychonic models of planetary motion. The activities guide students through using open source software to discover important observational facts, learn the necessary vocabulary, understand the fundamental properties of different theoretical models, and relate the theoretical models to observational data. After completing these activities students can make observations of a fictitious solar system and use those observations to construct models for that system.

Damage Accumulation Process in Advanced Metal Matrix Composite Under Thermal Cycling

DTIC Science & Technology

1991-11-20

are calculated using the Eshelby’s equivalent inclusion method, (30) see Appendix A, where the eigenstrain eT is replaced by a °, Eq.(1). Oy - (1-Cm...and (2) e* is the fictitious eigenstrain introduced into the fiber domain (see Appendix A). The dots used in Eqs. (2) and (3) are inner product...Equivalent Inclusion Method Here we consider a composite which consists of aligned ellipsoidal inhomogeneities !a with a prescribed eigenstrain eT (called an

Composite Strengthening.

DTIC Science & Technology

1985-01-01

fictitious eigenstrain (2 2 ) which was introduced to connect the present problem to "inclusion problem" and i is the average ij strain disturbance in the...5) and (6), we obtain eij =- Vw(eij - eij) (8) According to Eshelby, eij is related to the total eigenstrain ekZ as e S e (9) ij ijk2. Id w where...tensors of the matrix (D-Q) and fiber (a) are fA ijkt ,ijk respectively. Following Eshelby, the transformation strain(l I ) or eigenstrain ( 2 2) is given

Shock-Free Configurations in Two- and Three- Dimensional Transonic Flow,

DTIC Science & Technology

1981-05-01

Sobieczky’s brilliant idea of a fictitious gas for finding shock-free airfoils directly in the physical plane. The aerodynamic efficiency of turbojet ...improvements to the Learjet Century series aircraft is given in Ref. 3. The GA(W)-2 airfoil used here is probably already superior to the present Learjet...AD-AIuG 261 ARIZONA UNIV TUCSON ENGINEERING EXPERIMENT STATION F/f 1/3 SH4OCK-FREE CONFIGURATIONS IN TWO- AND THREE- DIMENSIONAL TRANSO--ETC(U) MAY

Evolution of asteroidal orbits with high inclinations

NASA Astrophysics Data System (ADS)

Solovaya, Nina A.; Pittich, Eduard M.

1993-10-01

The 20,000 years orbital evolution of massless fictitious asteroid located at a border of the Hill's gravitational sphere has been investigated. The eleven orbits with the eccentricities from 0.0 to 0.4 in five groups of inclinations from 40 deg to 80 deg were numerically integrated with planetary perturbations of six major planets, using the numerical integration n-body program with the Everhart's integrator RA 15. For each group time evolution of orbital elements of the asteroids is presented.

Effects of spacecraft motions on fluids experiments

NASA Technical Reports Server (NTRS)

Gans, R. F.

1981-01-01

The equations of motion governing an incompressible fluid contained in an orbiting laboratory were examined to isolate various fictitious forces and their relative influence on the fluid. The forces are divided into those arising from the orbital motions and those arising from small local motions of the spacecraft about its center of mass. The latter dominate the nonrotating experiments. Both are important for rotating experiments. A brief discussion of the onset of time-dependence and violent instability in earth-based rotating and processing systems is given.

Multi-disciplinary optimization of aeroservoelastic systems

NASA Technical Reports Server (NTRS)

Karpel, Mordechay

1991-01-01

New methods were developed for efficient aeroservoelastic analysis and optimization. The main target was to develop a method for investigating large structural variations using a single set of modal coordinates. This task was accomplished by basing the structural modal coordinates on normal modes calculated with a set of fictitious masses loading the locations of anticipated structural changes. The following subject areas are covered: (1) modal coordinates for aeroelastic analysis with large local structural variations; and (2) time simulation of flutter with large stiffness changes.

Intelligent cognitive radio jamming - a game-theoretical approach

NASA Astrophysics Data System (ADS)

Dabcevic, Kresimir; Betancourt, Alejandro; Marcenaro, Lucio; Regazzoni, Carlo S.

2014-12-01

Cognitive radio (CR) promises to be a solution for the spectrum underutilization problems. However, security issues pertaining to cognitive radio technology are still an understudied topic. One of the prevailing such issues are intelligent radio frequency (RF) jamming attacks, where adversaries are able to exploit on-the-fly reconfigurability potentials and learning mechanisms of cognitive radios in order to devise and deploy advanced jamming tactics. In this paper, we use a game-theoretical approach to analyze jamming/anti-jamming behavior between cognitive radio systems. A non-zero-sum game with incomplete information on an opponent's strategy and payoff is modelled as an extension of Markov decision process (MDP). Learning algorithms based on adaptive payoff play and fictitious play are considered. A combination of frequency hopping and power alteration is deployed as an anti-jamming scheme. A real-life software-defined radio (SDR) platform is used in order to perform measurements useful for quantifying the jamming impacts, as well as to infer relevant hardware-related properties. Results of these measurements are then used as parameters for the modelled jamming/anti-jamming game and are compared to the Nash equilibrium of the game. Simulation results indicate, among other, the benefit provided to the jammer when it is employed with the spectrum sensing algorithm in proactive frequency hopping and power alteration schemes.

Incorporating uncertainty regarding applicability of evidence from meta-analyses into clinical decision making.

PubMed

Kriston, Levente; Meister, Ramona

2014-03-01

Judging applicability (relevance) of meta-analytical findings to particular clinical decision-making situations remains challenging. We aimed to describe an evidence synthesis method that accounts for possible uncertainty regarding applicability of the evidence. We conceptualized uncertainty regarding applicability of the meta-analytical estimates to a decision-making situation as the result of uncertainty regarding applicability of the findings of the trials that were included in the meta-analysis. This trial-level applicability uncertainty can be directly assessed by the decision maker and allows for the definition of trial inclusion probabilities, which can be used to perform a probabilistic meta-analysis with unequal probability resampling of trials (adaptive meta-analysis). A case study with several fictitious decision-making scenarios was performed to demonstrate the method in practice. We present options to elicit trial inclusion probabilities and perform the calculations. The result of an adaptive meta-analysis is a frequency distribution of the estimated parameters from traditional meta-analysis that provides individually tailored information according to the specific needs and uncertainty of the decision maker. The proposed method offers a direct and formalized combination of research evidence with individual clinical expertise and may aid clinicians in specific decision-making situations. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular studies on di-sodium tartrate molecule

NASA Astrophysics Data System (ADS)

Divya, P.; Jayakumar, S.; George, Preethamary; Shubashree, N. S.; Ahmed. M, Anees

2015-06-01

Structural characterization is important for the development of new material. The acoustical parameters such as Free Length, Internal Pressure have been measured from ultrasonic velocity, density for di sodium tartrate an optically active molecule at different temperatures using ultrasonic interferometer of frequency (2MHZ). The ultrasonic velocity increases with increase in concentration there is an increase in solute-solvent interaction. The stability constant had been calculated. SEM with EDAX studies has been done for Di-sodium tartrate an optically active molecule.

Dielectric response of molecules in empirical tight-binding theory

NASA Astrophysics Data System (ADS)

Boykin, Timothy B.; Vogl, P.

2002-01-01

In this paper we generalize our previous approach to electromagnetic interactions within empirical tight-binding theory to encompass molecular solids and isolated molecules. In order to guarantee physically meaningful results, we rederive the expressions for relevant observables using commutation relations appropriate to the finite tight-binding Hilbert space. In carrying out this generalization, we examine in detail the consequences of various prescriptions for the position and momentum operators in tight binding. We show that attempting to fit parameters of the momentum matrix directly generally results in a momentum operator which is incompatible with the underlying tight-binding model, while adding extra position parameters results in numerous difficulties, including the loss of gauge invariance. We have applied our scheme, which we term the Peierls-coupling tight-binding method, to the optical dielectric function of the molecular solid PPP, showing that this approach successfully predicts its known optical properties even in the limit of isolated molecules.

Interpretation of psychophysics response curves using statistical physics.

PubMed

Knani, S; Khalfaoui, M; Hachicha, M A; Mathlouthi, M; Ben Lamine, A

2014-05-15

Experimental gustatory curves have been fitted for four sugars (sucrose, fructose, glucose and maltitol), using a double layer adsorption model. Three parameters of the model are fitted, namely the number of molecules per site n, the maximum response RM and the concentration at half saturation C1/2. The behaviours of these parameters are discussed in relationship to each molecule's characteristics. Starting from the double layer adsorption model, we determined (in addition) the adsorption energy of each molecule on taste receptor sites. The use of the threshold expression allowed us to gain information about the adsorption occupation rate of a receptor site which fires a minimal response at a gustatory nerve. Finally, by means of this model we could calculate the configurational entropy of the adsorption system, which can describe the order and disorder of the adsorbent surface. Copyright © 2013 Elsevier Ltd. All rights reserved.

Inferring subunit stoichiometry from single molecule photobleaching

PubMed Central

2013-01-01

Single molecule photobleaching is a powerful tool for determining the stoichiometry of protein complexes. By attaching fluorophores to proteins of interest, the number of associated subunits in a complex can be deduced by imaging single molecules and counting fluorophore photobleaching steps. Because some bleaching steps might be unobserved, the ensemble of steps will be binomially distributed. In this work, it is shown that inferring the true composition of a complex from such data is nontrivial because binomially distributed observations present an ill-posed inference problem. That is, a unique and optimal estimate of the relevant parameters cannot be extracted from the observations. Because of this, a method has not been firmly established to quantify confidence when using this technique. This paper presents a general inference model for interpreting such data and provides methods for accurately estimating parameter confidence. The formalization and methods presented here provide a rigorous analytical basis for this pervasive experimental tool. PMID:23712552

Adsorption of diclofenac and nimesulide on activated carbon: Statistical physics modeling and effect of adsorbate size

NASA Astrophysics Data System (ADS)

Sellaoui, Lotfi; Mechi, Nesrine; Lima, Éder Cláudio; Dotto, Guilherme Luiz; Ben Lamine, Abdelmottaleb

2017-10-01

Based on statistical physics elements, the equilibrium adsorption of diclofenac (DFC) and nimesulide (NM) on activated carbon was analyzed by a multilayer model with saturation. The paper aimed to describe experimentally and theoretically the adsorption process and study the effect of adsorbate size using the model parameters. From numerical simulation, the number of molecules per site showed that the adsorbate molecules (DFC and NM) were mostly anchored in both sides of the pore walls. The receptor sites density increase suggested that additional sites appeared during the process, to participate in DFC and NM adsorption. The description of the adsorption energy behavior indicated that the process was physisorption. Finally, by a model parameters correlation, the size effect of the adsorbate was deduced indicating that the molecule dimension has a negligible effect on the DFC and NM adsorption.

Ultracold Nonreactive Molecules in an Optical Lattice: Connecting Chemistry to Many-Body Physics.

PubMed

Doçaj, Andris; Wall, Michael L; Mukherjee, Rick; Hazzard, Kaden R A

2016-04-01

We derive effective lattice models for ultracold bosonic or fermionic nonreactive molecules (NRMs) in an optical lattice, analogous to the Hubbard model that describes ultracold atoms in a lattice. In stark contrast to the Hubbard model, which is commonly assumed to accurately describe NRMs, we find that the single on-site interaction parameter U is replaced by a multichannel interaction, whose properties we elucidate. Because this arises from complex short-range collisional physics, it requires no dipolar interactions and thus occurs even in the absence of an electric field or for homonuclear molecules. We find a crossover between coherent few-channel models and fully incoherent single-channel models as the lattice depth is increased. We show that the effective model parameters can be determined in lattice modulation experiments, which, consequently, measure molecular collision dynamics with a vastly sharper energy resolution than experiments in a free-space ultracold gas.

Application of a multivariate normal distribution methodology to the dissociation of doubly ionized molecules: The DMDS (CH3 -SS-CH3 ) case.

PubMed

Varas, Lautaro R; Pontes, F C; Santos, A C F; Coutinho, L H; de Souza, G G B

2015-09-15

The ion-ion-coincidence mass spectroscopy technique brings useful information about the fragmentation dynamics of doubly and multiply charged ionic species. We advocate the use of a matrix-parameter methodology in order to represent and interpret the entire ion-ion spectra associated with the ionic dissociation of doubly charged molecules. This method makes it possible, among other things, to infer fragmentation processes and to extract information about overlapped ion-ion coincidences. This important piece of information is difficult to obtain from other previously described methodologies. A Wiley-McLaren time-of-flight mass spectrometer was used to discriminate the positively charged fragment ions resulting from the sample ionization by a pulsed 800 eV electron beam. We exemplify the application of this methodology by analyzing the fragmentation and ionic dissociation of the dimethyl disulfide (DMDS) molecule as induced by fast electrons. The doubly charged dissociation was analyzed using the Multivariate Normal Distribution. The ion-ion spectrum of the DMDS molecule was obtained at an incident electron energy of 800 eV and was matrix represented using the Multivariate Distribution theory. The proposed methodology allows us to distinguish information among [CH n SH n ] + /[CH 3 ] + (n = 1-3) fragment ions in the ion-ion coincidence spectra using ion-ion coincidence data. Using the momenta balance methodology for the inferred parameters, a secondary decay mechanism is proposed for the [CHS] + ion formation. As an additional check on the methodology, previously published data on the SiF 4 molecule was re-analyzed with the present methodology and the results were shown to be statistically equivalent. The use of a Multivariate Normal Distribution allows for the representation of the whole ion-ion mass spectrum of doubly or multiply ionized molecules as a combination of parameters and the extraction of information among overlapped data. We have successfully applied this methodology to the analysis of the fragmentation of the DMDS molecule. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

Analyzing Single-Molecule Time Series via Nonparametric Bayesian Inference

PubMed Central

Hines, Keegan E.; Bankston, John R.; Aldrich, Richard W.

2015-01-01

The ability to measure the properties of proteins at the single-molecule level offers an unparalleled glimpse into biological systems at the molecular scale. The interpretation of single-molecule time series has often been rooted in statistical mechanics and the theory of Markov processes. While existing analysis methods have been useful, they are not without significant limitations including problems of model selection and parameter nonidentifiability. To address these challenges, we introduce the use of nonparametric Bayesian inference for the analysis of single-molecule time series. These methods provide a flexible way to extract structure from data instead of assuming models beforehand. We demonstrate these methods with applications to several diverse settings in single-molecule biophysics. This approach provides a well-constrained and rigorously grounded method for determining the number of biophysical states underlying single-molecule data. PMID:25650922

Adsorbed molecules in external fields: Effect of confining potential.

PubMed

Tyagi, Ashish; Silotia, Poonam; Maan, Anjali; Prasad, Vinod

2016-12-05

We study the rotational excitation of a molecule adsorbed on a surface. As is well known the interaction potential between the surface and the molecule can be modeled in number of ways, depending on the molecular structure and the geometry under which the molecule is being adsorbed by the surface. We explore the effect of change of confining potential on the excitation, which is largely controlled by the static electric fields and continuous wave laser fields. We focus on dipolar molecules and hence we restrict ourselves to the first order interaction in field-molecule interaction potential either through permanent dipole moment or/and the molecular polarizability parameter. It is shown that confining potential shapes, strength of the confinement, strongly affect the excitation. We compare our results for different confining potentials. Copyright © 2016 Elsevier B.V. All rights reserved.

Ab initio phasing based on topological restraints: automated determination of the space group and the number of molecules in the unit cell.

PubMed

Urzhumtseva, Ludmila; Lunina, Natalia; Fokine, Andrei; Samama, Jean Pierre; Lunin, Vladimir Y; Urzhumtsev, Alexandre

2004-09-01

The connectivity-based phasing method has been demonstrated to be capable of finding molecular packing and envelopes even for difficult cases of structure determination, as well as of identifying, in favorable cases, secondary-structure elements of protein molecules in the crystal. This method uses a single set of structure factor magnitudes and general topological features of a crystallographic image of the macromolecule under study. This information is expressed through a number of parameters. Most of these parameters are easy to estimate, and the results of phasing are practically independent of these parameters when they are chosen within reasonable limits. By contrast, the correct choice for such parameters as the expected number of connected regions in the unit cell is sometimes ambiguous. To study these dependencies, numerous tests were performed with simulated data, experimental data and mixed data sets, where several reflections missed in the experiment were completed by computed data. This paper demonstrates that the procedure is able to control this choice automatically and helps in difficult cases to identify the correct number of molecules in the asymmetric unit. In addition, the procedure behaves abnormally if the space group is defined incorrectly and therefore may distinguish between the rotation and screw axes even when high-resolution data are not available.

Single Nucleobase Identification Using Biophysical Signatures from Nanoelectronic Quantum Tunneling.

PubMed

Korshoj, Lee E; Afsari, Sepideh; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-03-01

Nanoelectronic DNA sequencing can provide an important alternative to sequencing-by-synthesis by reducing sample preparation time, cost, and complexity as a high-throughput next-generation technique with accurate single-molecule identification. However, sample noise and signature overlap continue to prevent high-resolution and accurate sequencing results. Probing the molecular orbitals of chemically distinct DNA nucleobases offers a path for facile sequence identification, but molecular entropy (from nucleotide conformations) makes such identification difficult when relying only on the energies of lowest-unoccupied and highest-occupied molecular orbitals (LUMO and HOMO). Here, nine biophysical parameters are developed to better characterize molecular orbitals of individual nucleobases, intended for single-molecule DNA sequencing using quantum tunneling of charges. For this analysis, theoretical models for quantum tunneling are combined with transition voltage spectroscopy to obtain measurable parameters unique to the molecule within an electronic junction. Scanning tunneling spectroscopy is then used to measure these nine biophysical parameters for DNA nucleotides, and a modified machine learning algorithm identified nucleobases. The new parameters significantly improve base calling over merely using LUMO and HOMO frontier orbital energies. Furthermore, high accuracies for identifying DNA nucleobases were observed at different pH conditions. These results have significant implications for developing a robust and accurate high-throughput nanoelectronic DNA sequencing technique. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Kinetic analysis of single molecule FRET transitions without trajectories

NASA Astrophysics Data System (ADS)

Schrangl, Lukas; Göhring, Janett; Schütz, Gerhard J.

2018-03-01

Single molecule Förster resonance energy transfer (smFRET) is a popular tool to study biological systems that undergo topological transitions on the nanometer scale. smFRET experiments typically require recording of long smFRET trajectories and subsequent statistical analysis to extract parameters such as the states' lifetimes. Alternatively, analysis of probability distributions exploits the shapes of smFRET distributions at well chosen exposure times and hence works without the acquisition of time traces. Here, we describe a variant that utilizes statistical tests to compare experimental datasets with Monte Carlo simulations. For a given model, parameters are varied to cover the full realistic parameter space. As output, the method yields p-values which quantify the likelihood for each parameter setting to be consistent with the experimental data. The method provides suitable results even if the actual lifetimes differ by an order of magnitude. We also demonstrated the robustness of the method to inaccurately determine input parameters. As proof of concept, the new method was applied to the determination of transition rate constants for Holliday junctions.

Linear response and correlation of a self-propelled particle in the presence of external fields

NASA Astrophysics Data System (ADS)

Caprini, Lorenzo; Marini Bettolo Marconi, Umberto; Vulpiani, Angelo

2018-03-01

We study the non-equilibrium properties of non interacting active Ornstein-Uhlenbeck particles (AOUP) subject to an external nonuniform field using a Fokker-Planck approach with a focus on the linear response and time-correlation functions. In particular, we compare different methods to compute these functions including the unified colored noise approximation (UCNA). The AOUP model, described by the position of the particle and the active force acting on it, is usually mapped into a Markovian process, describing the motion of a fictitious passive particle in terms of its position and velocity, where the effect of the activity is transferred into a position-dependent friction. We show that the form of the response function of the AOUP depends on whether we put the perturbation on the position and keep unperturbed the active force in the original variables or perturb the position and maintain unperturbed the velocity in the transformed variables. Indeed, as a result of the change of variables the perturbation on the position becomes a perturbation both on the position and on the fictitious velocity. We test these predictions by considering the response for three types of convex potentials: quadratic, quartic and double-well potential. Moreover, by comparing the response of the AOUP model with the corresponding response of the UCNA model we conclude that although the stationary properties are fairly well approximated by the UCNA, the non equilibrium properties are not, an effect which is not negligible when the persistence time is large.

Global reach of direct-to-consumer advertising using social media for illicit online drug sales.

PubMed

Mackey, Tim Ken; Liang, Bryan A

2013-05-29

Illicit or rogue Internet pharmacies are a recognized global public health threat that have been identified as utilizing various forms of online marketing and promotion, including social media. To assess the accessibility of creating illicit no prescription direct-to-consumer advertising (DTCA) online pharmacy social media marketing (eDTCA2.0) and evaluate its potential global reach. We identified the top 4 social media platforms allowing eDTCA2.0. After determining applicable platforms (ie, Facebook, Twitter, Google+, and MySpace), we created a fictitious advertisement advertising no prescription drugs online and posted it to the identified social media platforms. Each advertisement linked to a unique website URL that consisted of a site error page. Employing Web search analytics, we tracked the number of users visiting these sites and their location. We used commercially available Internet tools and services, including website hosting, domain registration, and website analytic services. Illicit online pharmacy social media content for Facebook, Twitter, and MySpace remained accessible despite highly questionable and potentially illegal content. Fictitious advertisements promoting illicit sale of drugs generated aggregate unique user traffic of 2795 visits over a 10-month period. Further, traffic to our websites originated from a number of countries, including high-income and middle-income countries, and emerging markets. Our results indicate there are few barriers to entry for social media-based illicit online drug marketing. Further, illicit eDTCA2.0 has globalized outside US borders to other countries through unregulated Internet marketing.

Spacecraft formation flying for Earth-crossing object deflections using a power limited laser ablating

NASA Astrophysics Data System (ADS)

Yoo, Sung-Moon; Song, Young-Joo; Park, Sang-Young; Choi, Kyu-Hong

2009-06-01

A formation flying strategy with an Earth-crossing object (ECO) is proposed to avoid the Earth collision. Assuming that a future conceptual spacecraft equipped with a powerful laser ablation tool already rendezvoused with a fictitious Earth collision object, the optimal required laser operating duration and direction histories are accurately derived to miss the Earth. Based on these results, the concept of formation flying between the object and the spacecraft is applied and analyzed as to establish the spacecraft's orbital motion design strategy. A fictitious "Apophis"-like object is established to impact with the Earth and two major deflection scenarios are designed and analyzed. These scenarios include the cases for the both short and long laser operating duration to avoid the Earth impact. Also, requirement of onboard laser tool's for both cases are discussed. As a result, the optimal initial conditions for the spacecraft to maintain its relative trajectory to the object are discovered. Additionally, the discovered optimal initial conditions also satisfied the optimal required laser operating conditions with no additional spacecraft's own fuel expenditure to achieve the spacecraft formation flying with the ECO. The initial conditions founded in the current research can be used as a spacecraft's initial rendezvous points with the ECO when designing the future deflection missions with laser ablation tools. The results with proposed strategy are expected to make more advances in the fields of the conceptual studies, especially for the future deflection missions using powerful laser ablation tools.

Optimisation of solar synoptic observations

NASA Astrophysics Data System (ADS)

Klvaña, Miroslav; Sobotka, Michal; Švanda, Michal

2012-09-01

The development of instrumental and computer technologies is connected with steadily increasing needs for archiving of large data volumes. The current trend to meet this requirement includes the data compression and growth of storage capacities. This approach, however, has technical and practical limits. A further reduction of the archived data volume can be achieved by means of an optimisation of the archiving that consists in data selection without losing the useful information. We describe a method of optimised archiving of solar images, based on the selection of images that contain a new information. The new information content is evaluated by means of the analysis of changes detected in the images. We present characteristics of different kinds of image changes and divide them into fictitious changes with a disturbing effect and real changes that provide a new information. In block diagrams describing the selection and archiving, we demonstrate the influence of clouds, the recording of images during an active event on the Sun, including a period before the event onset, and the archiving of long-term history of solar activity. The described optimisation technique is not suitable for helioseismology, because it does not conserve the uniform time step in the archived sequence and removes the information about solar oscillations. In case of long-term synoptic observations, the optimised archiving can save a large amount of storage capacities. The actual capacity saving will depend on the setting of the change-detection sensitivity and on the capability to exclude the fictitious changes.

Serotonergic contribution to boys' behavioral regulation.

PubMed

Nantel-Vivier, Amélie; Pihl, Robert O; Young, Simon N; Parent, Sophie; Bélanger, Stacey Ageranioti; Sutton, Rachel; Dubois, Marie-Eve; Tremblay, Richard E; Séguin, Jean R

2011-01-01

Animal and human adult studies reveal a contribution of serotonin to behavior regulation. Whether these findings apply to children is unclear. The present study investigated serotonergic functioning in boys with a history of behavior regulation difficulties through a double-blind, acute tryptophan supplementation procedure. Participants were 23 boys (age 10 years) with a history of elevated physical aggression, recruited from a community sample. Eleven were given a chocolate milkshake supplemented with 500 mg tryptophan, and 12 received a chocolate milkshake without tryptophan. Boys engaged in a competitive reaction time game against a fictitious opponent, which assessed response to provocation, impulsivity, perspective taking, and sharing. Impulsivity was further assessed through a Go/No-Go paradigm. A computerized emotion recognition task and a staged instrumental help incident were also administered. Boys, regardless of group, responded similarly to high provocation by the fictitious opponent. However, boys in the tryptophan group adjusted their level of responding optimally as a function of the level of provocation, whereas boys in the control group significantly decreased their level of responding towards the end of the competition. Boys in the tryptophan group tended to show greater perspective taking, tended to better distinguish facial expressions of fear and happiness, and tended to provide greater instrumental help to the experimenter. The present study provides initial evidence for the feasibility of acute tryptophan supplementation in children and some effect of tryptophan supplementation on children's behaviors. Further studies are warranted to explore the potential impact of increased serotonergic functioning on boys' dominant and affiliative behaviors.

Determining the Parameters of the Effective Rovibrational Hamiltonian of the ν7+ν8 Band of the Ethylene-1-13C Molecule

NASA Astrophysics Data System (ADS)

Aslapovskaya, Yu. S.

2018-06-01

The spectrum of the ν7 + ν8 band of the ethylene-1-13C (13C12CH4) molecule is recorded with a Bruker IFS 125 HR Fourier spectrometer in the range from 1500 to 2100 cm-1 with a resolution of 0.0025 cm-1. As a result of analysis of the experimental spectrum, more than 1000 transitions belonging to the ν7 + ν8 band are assigned. Parameters of the Hamiltonian obtained as a result of solving the inverse spectroscopic problem reproduce 400 initial experimental energies with error close to the experimental one.

17O nuclear quadrupole coupling constants of water bound to a metal ion: A gadolinium(III) case study

NASA Astrophysics Data System (ADS)

Yazyev, Oleg V.; Helm, Lothar

2006-08-01

Rotational correlation times of metal ion aqua complexes can be determined from O17 NMR relaxation rates if the quadrupole coupling constant of the bound water oxygen-17 nucleus is known. The rotational correlation time is an important parameter for the efficiency of Gd3+ complexes as magnetic resonance imaging contrast agents. Using a combination of density functional theory with classical and Car-Parrinello molecular dynamics simulations we performed a computational study of the O17 quadrupole coupling constants in model aqua ions and the [Gd(DOTA)(H2O)]- complex used in clinical diagnostics. For the inner sphere water molecule in the [Gd(DOTA)(H2O)]- complex the determined quadrupole coupling parameter χ√1+η2/3 of 8.7MHz is very similar to that of the liquid water (9.0MHz ). Very close values were also predicted for the the homoleptic aqua ions of Gd3+ and Ca2+. We conclude that the O17 quadrupole coupling parameters of water molecules coordinated to closed shell and lanthanide metal ions are similar to water molecules in the liquid state.

A theoretical-electron-density databank using a model of real and virtual spherical atoms.

PubMed

Nassour, Ayoub; Domagala, Slawomir; Guillot, Benoit; Leduc, Theo; Lecomte, Claude; Jelsch, Christian

2017-08-01

A database describing the electron density of common chemical groups using combinations of real and virtual spherical atoms is proposed, as an alternative to the multipolar atom modelling of the molecular charge density. Theoretical structure factors were computed from periodic density functional theory calculations on 38 crystal structures of small molecules and the charge density was subsequently refined using a density model based on real spherical atoms and additional dummy charges on the covalent bonds and on electron lone-pair sites. The electron-density parameters of real and dummy atoms present in a similar chemical environment were averaged on all the molecules studied to build a database of transferable spherical atoms. Compared with the now-popular databases of transferable multipolar parameters, the spherical charge modelling needs fewer parameters to describe the molecular electron density and can be more easily incorporated in molecular modelling software for the computation of electrostatic properties. The construction method of the database is described. In order to analyse to what extent this modelling method can be used to derive meaningful molecular properties, it has been applied to the urea molecule and to biotin/streptavidin, a protein/ligand complex.

Relaxation of structural parameters and potential coefficients of nonrigid molecules. General symmetry properties and application to ab initio study of 1,2-difluoroethane

NASA Astrophysics Data System (ADS)

Ha, T.-K.; Günthard, H. H.

1989-07-01

Structural parameters like bond length, bond angles, etc. and harmonic and anharmonic potential coefficients of molecules with internal rotation, inversion or puckering modes are generally assumed to vary with the large amplitude internal coordinates in a concerted manner (relaxation). Taking the coordinate vectors of the nuclear configuration of semirigid molecules with relaxation (SRMRs) as functions of relaxing structural parameters and finite amplitude internal coordinate, the isometric group of SRMRs is discussed and the irreducible representations of the latter are shown to classify into engendered and nonengendered ones. On this basis a concept of equivalent sets of nuclei SRMRs is introduced and an analytical expression is derived which defines the most general functional form of relaxation increments of all common types of structural parameters compatible with isometric symmetry. This formula is shown to be a close analog of an analytical expression defining the transformations induced by the isometric group of infinitesimal internal coordinates associated with typical structural parameters. Furthermore analogous formulae are given for the most general form of the relaxation of harmonic potential coefficients as a function of finite internal coordinates. The general relations are illustrated by ab initio calculations for 1,2-difluoroethane at the MP4/DZP//HF/4-31G* level for twelve values of the dihedral angle including complete structure optimization. The potential to internal rotation is found to be in essential agreement with experimentally derived data. For a complete set of ab initio structural parameters the associated relaxation increments are represented as Fourier series, which are shown to confirm the form predicted by the general formula and the isometric group of 1,2-difluoroethane. Depending on type of the structural parameters (bond length, bond angles, etc.), the associated relaxation increments appear to follow some simple rules. Similarly a complete set of harmonic potential coefficients derived from the ab initio calculations will be analyzed in terms of Fourier series and shown to conform to the symmetry requirements of the symmetry group. Relaxation of potential coefficients is found to amount to up to ≈5% for some types of diagonal and nondiagonal terms and to reflect certain "topological" rules similar to regularities of harmonic potential constants of quasi-rigid molecules found in empirical determinations of valence force fields.

The rotational spectrum of the CH radical in its a 4Sigma(-) state, studied by far-infrared laser magnetic resonance

NASA Technical Reports Server (NTRS)

Nelis, Thomas; Brown, John M.; Evenson, Kenneth M.

1990-01-01

The CH radical has been detected in its a 4Sigma(-) state by the technique of laser magnetic resonance at far-infrared wavelengths. Spectra relating to different spin components of the first three rotational transitions have been recorded. The molecule was generated either by the reaction of F atoms with CH4, with a trace of added oxygen or by the reaction of O atoms with C2H2. The observed resonances have been analyzed and fitted to determine the parameters of an effective Hamiltonian for a molecule in a 4Sigma state. The principal quantities determined are the rotational constant B0 = 451 138.434(94) MHz and the spin-spin parameter lambda(0) = 2785.83(18) MHz. Proton hyperfine parameters have also been determined.

Search for clues of life or habitability at Mars: laboratory simulation of the evolution of organic molecules at the surface of Mars

NASA Astrophysics Data System (ADS)

Poch, Olivier; Szopa, Cyril; Coll, Patrice; Jaber, Maguy; Georgelin, Thomas; Lambert, Jean-Francois; Stalport, Fabien

Several lines of evidence suggest that early Mars offered favorable conditions for long-term sustaining water. As a consequence, we can assume that in those days, endogenous chemical processes, or even primitive life, may have produced organic matter on Mars. Moreover, exogenous delivery from small bodies or dust particles is likely to have brought fresh organic molecules to the surface of Mars until now. Organic matter is therefore expected to be present at the surface/subsurface of the planet. The search for these organic relics is one of the main objectives of Mars exploration missions. But current environmental conditions at the surface - UV radiation, oxidants and energetic particles - can generate physico-chemical processes that may induce organic molecules evolution. Here we present results of laboratory investigations dedicated to monitor qualitative and quantitative evolutions of several organic molecules under simulated Martian surface ultraviolet incident light, mean ground temperature and pressure, using the Mars Organic Molecules Irradiation and Evolution setup (1) . For each organic molecule studied, the nature of the evolution products (solid or gaseous) and the kinetic parameters (extrapolated half-life at Mars, quantum yields) were experimentally determined. The results show that when exposed to UV radiation, specific organic molecules lead to the formation of solid residues, probably of macromolecular nature, which could reach long term stability. On the other hand, the study of the evolution of molecules in presence of nontronite, a clay mineral detected at the surface of Mars, highlights a strong protective effect of the clay reducing dissociation rates for some molecules, whereas a possible catalytic effect is tentatively observed for one studied molecule. These results are essential to support the analyses performed in situ during the past, current and future exploration missions. Moreover, the experimentally determined kinetic parameters provide new inputs for numerical modeling of current reservoirs of organic molecules on Mars. (1) O. Poch et al., Planetary and Space Science 85, 188-197, http://dx.doi.org/10.1016/j.pss.2013.06.013

Nuclear magnetic and nuclear quadrupole resonance parameters of β-carboline derivatives calculated using density functional theory

NASA Astrophysics Data System (ADS)

Ahmadinejad, Neda; Tari, Mostafa Talebi

2017-04-01

A density functional theory (DFT) calculations using B3LYP/6-311++G( d,p) method were carried out to investigate the relative stability of the molecules of β-carboline derivatives such as harmaline, harmine, harmalol, harmane and norharmane. Calculated nuclear quadrupole resonance (NQR) parameters were used to determine the 14N nuclear quadrupole coupling constant χ, asymmetry parameter η and EFG tensor ( q zz ). For better understanding of the electronic structure of β-carboline derivatives, natural bond orbital (NBO) analysis, isotropic and anisotropic NMR chemical shieldings were calculated for 14N nuclei using GIAO method for the optimized structures. The NBO analysis shows that pyrrole ring nitrogen (N9) atom has greater tendency than pyridine ring nitrogen (N2) atom to participate in resonance interactions and aromaticity development in the all of these structures. The NMR and NQR parameters were studied in order to find the correlations between electronic structure and the structural stability of the studied molecules.

A group contribution method for associating chain molecules based on the statistical associating fluid theory (SAFT-γ)

NASA Astrophysics Data System (ADS)

Lymperiadis, Alexandros; Adjiman, Claire S.; Galindo, Amparo; Jackson, George

2007-12-01

A predictive group-contribution statistical associating fluid theory (SAFT-γ) is developed by extending the molecular-based SAFT-VR equation of state [A. Gil-Villegas et al. J. Chem. Phys. 106, 4168 (1997)] to treat heteronuclear molecules which are formed from fused segments of different types. Our models are thus a heteronuclear generalization of the standard models used within SAFT, comparable to the optimized potentials for the liquid state OPLS models commonly used in molecular simulation; an advantage of our SAFT-γ over simulation is that an algebraic description for the thermodynamic properties of the model molecules can be developed. In our SAFT-γ approach, each functional group in the molecule is modeled as a united-atom spherical (square-well) segment. The different groups are thus characterized by size (diameter), energy (well depth) and range parameters representing the dispersive interaction, and by shape factor parameters (which denote the extent to which each group contributes to the overall molecular properties). For associating groups a number of bonding sites are included on the segment: in this case the site types, the number of sites of each type, and the appropriate association energy and range parameters also have to be specified. A number of chemical families (n-alkanes, branched alkanes, n-alkylbenzenes, mono- and diunsaturated hydrocarbons, and n-alkan-1-ols) are treated in order to assess the quality of the SAFT-γ description of the vapor-liquid equilibria and to estimate the parameters of various functional groups. The group parameters for the functional groups present in these compounds (CH3, CH2, CH3CH, ACH, ACCH2, CH2, CH , and OH) together with the unlike energy parameters between groups of different types are obtained from an optimal description of the pure component phase equilibria. The approach is found to describe accurately the vapor-liquid equilibria with an overall %AAD of 3.60% for the vapor pressure and 0.86% for the saturated liquid density. The fluid phase equilibria of some larger compounds comprising these groups, which are not included in the optimization database and some binary mixtures are examined to confirm the predictive capability of the SAFT-γ approach. A key advantage of our method is that the binary interaction parameters between groups can be estimated directly from an examination of pure components alone. This means that as a first approximation the fluid-phase equilibria of mixtures of compounds comprising the groups considered can be predicted without the need for any adjustment of the binary interaction parameters (which is common in other approaches). The special case of molecular models comprising tangentially bonded (all-atom and united-atom) segments is considered separately; we comment on the adequacy of such models in representing the properties of real molecules.

A group contribution method for associating chain molecules based on the statistical associating fluid theory (SAFT-gamma).

PubMed

Lymperiadis, Alexandros; Adjiman, Claire S; Galindo, Amparo; Jackson, George

2007-12-21

A predictive group-contribution statistical associating fluid theory (SAFT-gamma) is developed by extending the molecular-based SAFT-VR equation of state [A. Gil-Villegas et al. J. Chem. Phys. 106, 4168 (1997)] to treat heteronuclear molecules which are formed from fused segments of different types. Our models are thus a heteronuclear generalization of the standard models used within SAFT, comparable to the optimized potentials for the liquid state OPLS models commonly used in molecular simulation; an advantage of our SAFT-gamma over simulation is that an algebraic description for the thermodynamic properties of the model molecules can be developed. In our SAFT-gamma approach, each functional group in the molecule is modeled as a united-atom spherical (square-well) segment. The different groups are thus characterized by size (diameter), energy (well depth) and range parameters representing the dispersive interaction, and by shape factor parameters (which denote the extent to which each group contributes to the overall molecular properties). For associating groups a number of bonding sites are included on the segment: in this case the site types, the number of sites of each type, and the appropriate association energy and range parameters also have to be specified. A number of chemical families (n-alkanes, branched alkanes, n-alkylbenzenes, mono- and diunsaturated hydrocarbons, and n-alkan-1-ols) are treated in order to assess the quality of the SAFT-gamma description of the vapor-liquid equilibria and to estimate the parameters of various functional groups. The group parameters for the functional groups present in these compounds (CH(3), CH(2), CH(3)CH, ACH, ACCH(2), CH(2)=, CH=, and OH) together with the unlike energy parameters between groups of different types are obtained from an optimal description of the pure component phase equilibria. The approach is found to describe accurately the vapor-liquid equilibria with an overall %AAD of 3.60% for the vapor pressure and 0.86% for the saturated liquid density. The fluid phase equilibria of some larger compounds comprising these groups, which are not included in the optimization database and some binary mixtures are examined to confirm the predictive capability of the SAFT-gamma approach. A key advantage of our method is that the binary interaction parameters between groups can be estimated directly from an examination of pure components alone. This means that as a first approximation the fluid-phase equilibria of mixtures of compounds comprising the groups considered can be predicted without the need for any adjustment of the binary interaction parameters (which is common in other approaches). The special case of molecular models comprising tangentially bonded (all-atom and united-atom) segments is considered separately; we comment on the adequacy of such models in representing the properties of real molecules.

No variations in transit times for Qatar-1 b

NASA Astrophysics Data System (ADS)

Maciejewski, G.; Fernández, M.; Aceituno, F. J.; Ohlert, J.; Puchalski, D.; Dimitrov, D.; Seeliger, M.; Kitze, M.; Raetz, St.; Errmann, R.; Gilbert, H.; Pannicke, A.; Schmidt, J.-G.; Neuhäuser, R.

2015-05-01

Aims: The transiting hot-Jupiter planet Qatar-1 b exhibits variations in transit times that could be perturbative. A hot Jupiter with a planetary companion on a nearby orbit would constitute an unprecedented planetary configuration, which is important for theories of the formation and evolution of planetary systems. We performed a photometric follow-up campaign to confirm or refute transit timing variations. Methods: We extend the baseline of transit observations by acquiring 18 new transit light curves acquired with 0.6-2.0 m telescopes. These photometric time series, together with data available in the literature, were analyzed in a homogenous way to derive reliable transit parameters and their uncertainties. Results: We show that the dataset of transit times is consistent with a linear ephemeris leaving no hint of any periodic variations with a range of 1 min. We find no compelling evidence of a close-in planetary companion to Qatar-1 b. This finding is in line with a paradigm that hot Jupiters are not components of compact multiplanetary systems. Based on dynamical simulations, we place tighter constraints on the mass of any fictitious nearby planet in the system. Furthermore, new transit light curves allowed us to redetermine system parameters with better precision than reported in previous studies. Our values generally agree with previous determinations. Partly based on (1) data collected with telescopes at the Rozhen National Astronomical Observatory and (2) observations obtained with telescopes of the University Observatory Jena, which is operated by the Astrophysical Institute of the Friedrich-Schiller-University.Tables of light curve data are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (ftp://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/577/A109

Elimination of secular terms from the differential equations for the elements of perturbed two-body motion

NASA Technical Reports Server (NTRS)

Bond, Victor R.; Fraietta, Michael F.

1991-01-01

In 1961, Sperling linearized and regularized the differential equations of motion of the two-body problem by changing the independent variable from time to fictitious time by Sundman's transformation (r = dt/ds) and by embedding the two-body energy integral and the Laplace vector. In 1968, Burdet developed a perturbation theory which was uniformly valid for all types of orbits using a variation of parameters approach on the elements which appeared in Sperling's equations for the two-body solution. In 1973, Bond and Hanssen improved Burdet's set of differential equations by embedding the total energy (which is a constant when the potential function is explicitly dependent upon time.) The Jacobian constant was used as an element to replace the total energy in a reformulation of the differential equations of motion. In the process, another element which is proportional to a component of the angular momentum was introduced. Recently trajectories computed during numerical studies of atmospheric entry from circular orbits and low thrust beginning in near-circular orbits exhibited numerical instability when solved by the method of Bond and Gottlieb (1989) for long time intervals. It was found that this instability was due to secular terms which appear on the righthand sides of the differential equations of some of the elements. In this paper, this instability is removed by the introduction of another vector integral called the delta integral (which replaces the Laplace Vector) and another scalar integral which removes the secular terms. The introduction of these integrals requires a new derivation of the differential equations for most of the elements. For this rederivation, the Lagrange method of variation of parameters is used, making the development more concise. Numerical examples of this improvement are presented.

Application of the R-matrix method to photoionization of molecules.

PubMed

Tashiro, Motomichi

2010-04-07

The R-matrix method has been used for theoretical calculation of electron collision with atoms and molecules for long years. The method was also formulated to treat photoionization process, however, its application has been mostly limited to photoionization of atoms. In this work, we implement the R-matrix method to treat molecular photoionization problem based on the UK R-matrix codes. This method can be used for diatomic as well as polyatomic molecules, with multiconfigurational description for electronic states of both target neutral molecule and product molecular ion. Test calculations were performed for valence electron photoionization of nitrogen (N(2)) as well as nitric oxide (NO) molecules. Calculated photoionization cross sections and asymmetry parameters agree reasonably well with the available experimental results, suggesting usefulness of the method for molecular photoionization.

The role played by self-orientational properties in nematics of colloids with molecules axially symmetric.

PubMed

Alarcón-Waess, O

2010-04-14

The self-orientational structure factor as well as the short-time self-orientational diffusion coefficient is computed for colloids composed by nonspherical molecules. To compute the short-time dynamics the hydrodynamic interactions are not taken into account. The hard molecules with at least one symmetry axis considered are: rods, spherocylinders, and tetragonal parallelepipeds. Because both orientational properties in study are written in terms of the second and fourth order parameters, these automatically hold the features of the order parameters. That is, they present a discontinuity for first order transitions, determining in this way the spinodal line. In order to analyze the nematic phase only, we choose the appropriate values for the representative quantities that characterize the molecules. Different formalisms are used to compute the structural properties: de Gennes-Landau approach, Smoluchowski equation and computer simulations. Some of the necessary inputs are taken from literature. Our results show that the self-orientational properties play an important role in the characterization and the localization of axially symmetric phases. While the self-structure decreases throughout the nematics, the short-time self-diffusion does not decrease but rather increases. We study the evolution of the second and fourth order parameters; we find different responses for axial and biaxial nematics, predicting the possibility of a biaxial nematics in tetragonal parallelepiped molecules. By considering the second order in the axial-biaxial phase transition, with the support of the self-orientational structure factor, we are able to propose the density at which this occurs. The short-time dynamics is able to predict a different value in the axial and the biaxial phases. Because the different behavior of the fourth order parameter, the diffusion coefficient is lower for a biaxial phase than for an axial one. Therefore the self-structure factor is able to localize continuous phase transitions involving axially symmetric phases and the short-time self-orientational diffusion is able to distinguish the ordered phase by considering the degree of alignment, that is, axial or biaxial.

Ga metal nanoparticle-GaAs quantum molecule complexes for Terahertz generation.

PubMed

Bietti, Sergio; Basso Basset, Francesco; Scarpellini, David; Fedorov, Alexey; Ballabio, Andrea; Esposito, Luca; Elborg, Martin; Kuroda, Takashi; Nemcsics, Akos; Toth, Lajos; Manzoni, Cristian; Vozzi, Caterina; Sanguinetti, Stefano

2018-06-18

A hybrid metal-semiconductor nanosystem for the generation of THz radiation, based on the fabrication of GaAs quantum molecules-Ga metal nanoparticles complexes through a self assembly approach, is proposed. The role of the growth parameters, the substrate temperature, the Ga and As flux during the quantum dot molecule fabrication and the metal nanoparticle alignment is discussed. The tuning of the relative positioning of quantum dot molecules and metal nanoparticles is obtained through the careful control of Ga droplet nucleation sites via Ga surface diffusion. The electronic structure of a typical quantum dot molecule was evaluated on the base of the morphological characterizations performed by Atomic Force Microscopy and cross sectional Scanning Electron Microscopy, and the predicted results confirmed by micro-photoluminescence experiments, showing that the Ga metal nanoparticle-GaAs quantum molecule complexes are suitable for terahertz generation from intraband transition. . © 2018 IOP Publishing Ltd.

Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading.

PubMed

Cabrita, Marisa; Pereira, Carlos F; Rodrigues, Pedro; Cardoso, Elsa M; Arosa, Fernando A

2005-01-01

Iron overload in the liver may occur in clinical conditions such as hemochromatosis and nonalcoholic steatohepatitis, and may lead to the deterioration of the normal liver architecture by mechanisms not well understood. Although a relationship between the expression of ICAM-1, and classical major histocompatibility complex (MHC) class I molecules, and iron overload has been reported, no relationship has been identified between iron overload and the expression of unconventional MHC class I molecules. Herein, we report that parameters of iron metabolism were regulated in a coordinated-fashion in a human hepatoma cell line (HepG2 cells) after iron loading, leading to increased cellular oxidative stress and growth retardation. Iron loading of HepG2 cells resulted in increased expression of Nor3.2-reactive CD1d molecules at the plasma membrane. Expression of classical MHC class I and II molecules, ICAM-1 and the epithelial CD8 ligand, gp180 was not significantly affected by iron. Considering that intracellular lipids regulate expression of CD1d at the cell surface, we examined parameters of lipid metabolism in iron-loaded HepG2 cells. Interestingly, increased expression of CD1d molecules by iron-loaded HepG2 cells was associated with increased phosphatidylserine expression in the outer leaflet of the plasma membrane and the presence of many intracellular lipid droplets. These data describe a new relationship between iron loading, lipid accumulation and altered expression of CD1d, an unconventional MHC class I molecule reported to monitor intracellular and plasma membrane lipid metabolism, in the human hepatoma cell line HepG2.

Insight into the molecular mechanism of water evaporation via the finite temperature string method.

PubMed

Musolino, Nicholas; Trout, Bernhardt L

2013-04-07

The process of water's evaporation at its liquid/air interface has proven challenging to study experimentally and, because it constitutes a rare event on molecular time scales, presents a challenge for computer simulations as well. In this work, we simulated water's evaporation using the classical extended simple point charge model water model, and identified a minimum free energy path for this process in terms of 10 descriptive order parameters. The measured free energy change was 7.4 kcal/mol at 298 K, in reasonable agreement with the experimental value of 6.3 kcal/mol, and the mean first-passage time was 1375 ns for a single molecule, corresponding to an evaporation coefficient of 0.25. In the observed minimum free energy process, the water molecule diffuses to the surface, and tends to rotate so that its dipole and one O-H bond are oriented outward as it crosses the Gibbs dividing surface. As the water molecule moves further outward through the interfacial region, its local density is higher than the time-averaged density, indicating a local solvation shell that protrudes from the interface. The water molecule loses donor and acceptor hydrogen bonds, and then, with its dipole nearly normal to the interface, stops donating its remaining hydrogen bond. At that point, when the final, accepted hydrogen bond is broken, the water molecule is free. We also analyzed which order parameters are most important in the process and in reactive trajectories, and found that the relative orientation of water molecules near the evaporating molecule, and the number of accepted hydrogen bonds, were important variables in reactive trajectories and in kinetic descriptions of the process.

On the role of hydrogel structure and degradation in controlling the transport of cell-secreted matrix molecules for engineered cartilage.

PubMed

Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J; Vernerey, Franck J

2013-03-01

Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one's quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. Copyright © 2012 Elsevier Ltd. All rights reserved.

On the role of hydrogel structure and degradation in controlling the transport of cell-secreted matrix molecules for engineered cartilage

PubMed Central

Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J.; Vernerey, Franck J.

2012-01-01

Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one’s quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. PMID:23276516

Data-Driven High-Throughput Prediction of the 3D Structure of Small Molecules: Review and Progress

PubMed Central

Andronico, Alessio; Randall, Arlo; Benz, Ryan W.; Baldi, Pierre

2011-01-01

Accurate prediction of the 3D structure of small molecules is essential in order to understand their physical, chemical, and biological properties including how they interact with other molecules. Here we survey the field of high-throughput methods for 3D structure prediction and set up new target specifications for the next generation of methods. We then introduce COSMOS, a novel data-driven prediction method that utilizes libraries of fragment and torsion angle parameters. We illustrate COSMOS using parameters extracted from the Cambridge Structural Database (CSD) by analyzing their distribution and then evaluating the system’s performance in terms of speed, coverage, and accuracy. Results show that COSMOS represents a significant improvement when compared to the state-of-the-art, particularly in terms of coverage of complex molecular structures, including metal-organics. COSMOS can predict structures for 96.4% of the molecules in the CSD [99.6% organic, 94.6% metal-organic] whereas the widely used commercial method CORINA predicts structures for 68.5% [98.5% organic, 51.6% metal-organic]. On the common subset of molecules predicted by both methods COSMOS makes predictions with an average speed per molecule of 0.15s [0.10s organic, 0.21s metal-organic], and an average RMSD of 1.57Å [1.26Å organic, 1.90Å metal-organic], and CORINA makes predictions with an average speed per molecule of 0.13s [0.18s organic, 0.08s metal-organic], and an average RMSD of 1.60Å [1.13Å organic, 2.11Å metal-organic]. COSMOS is available through the ChemDB chemoinformatics web portal at: http://cdb.ics.uci.edu/. PMID:21417267

Passing from Mesoscopy to Macroscopy. The Mesoscopic Parameter \\bar k

NASA Astrophysics Data System (ADS)

Maslov, V. P.

2018-01-01

In previous papers of the author it was shown that, depending on the hidden parameter, purely quantum problems behave like classical ones. In the present paper, it is shown that the Bose-Einstein and the Fermi-Dirac distributions, which until now were regarded as dealing with quantum particles, describe, for the appropriate values of the hidden parameter, the macroscopic thermodynamics of classical molecules.

Model systems for single molecule polymer dynamics

PubMed Central

Latinwo, Folarin

2012-01-01

Double stranded DNA (dsDNA) has long served as a model system for single molecule polymer dynamics. However, dsDNA is a semiflexible polymer, and the structural rigidity of the DNA double helix gives rise to local molecular properties and chain dynamics that differ from flexible chains, including synthetic organic polymers. Recently, we developed single stranded DNA (ssDNA) as a new model system for single molecule studies of flexible polymer chains. In this work, we discuss model polymer systems in the context of “ideal” and “real” chain behavior considering thermal blobs, tension blobs, hydrodynamic drag and force–extension relations. In addition, we present monomer aspect ratio as a key parameter describing chain conformation and dynamics, and we derive dynamical scaling relations in terms of this molecular-level parameter. We show that asymmetric Kuhn segments can suppress monomer–monomer interactions, thereby altering global chain dynamics. Finally, we discuss ssDNA in the context of a new model system for single molecule polymer dynamics. Overall, we anticipate that future single polymer studies of flexible chains will reveal new insight into the dynamic behavior of “real” polymers, which will highlight the importance of molecular individualism and the prevalence of non-linear phenomena. PMID:22956980

Critical lines for an unequal size of molecules in a binary gas-liquid mixture around the van Laar point using the combination of the Tompa model and the van der Waals equation.

PubMed

Gençaslan, Mustafa; Keskin, Mustafa

2012-02-14

We combine the modified Tompa model with the van der Waals equation to study critical lines for an unequal size of molecules in a binary gas-liquid mixture around the van Laar point. The van Laar point is coined by Meijer and it is the only point at which the mathematical double point curve is stable. It is the intersection of the tricritical point and the double critical end point. We calculate the critical lines as a function of χ(1) and χ(2), the density of type I molecules and the density of type II molecules for various values of the system parameters; hence the global phase diagrams are presented and discussed in the density-density plane. We also investigate the connectivity of critical lines at the van Laar point and its vicinity and discuss these connections according to the Scott and van Konynenburg classifications. It is also found that the critical lines and phase behavior are extremely sensitive to small modifications in the system parameters. © 2012 American Institute of Physics

LIAD-fs scheme for studies of ultrafast laser interactions with gas phase biomolecules.

PubMed

Calvert, C R; Belshaw, L; Duffy, M J; Kelly, O; King, R B; Smyth, A G; Kelly, T J; Costello, J T; Timson, D J; Bryan, W A; Kierspel, T; Rice, P; Turcu, I C E; Cacho, C M; Springate, E; Williams, I D; Greenwood, J B

2012-05-14

Laser induced acoustic desorption (LIAD) has been used for the first time to study the parent ion production and fragmentation mechanisms of a biological molecule in an intense femtosecond (fs) laser field. The photoacoustic shock wave generated in the analyte substrate (thin Ta foil) has been simulated using the hydrodynamic HYADES code, and the full LIAD process has been experimentally characterised as a function of the desorption UV-laser pulse parameters. Observed neutral plumes of densities >10(9) cm(-3) which are free from solvent or matrix contamination demonstrate the suitability and potential of the source for studying ultrafast dynamics in the gas phase using fs laser pulses. Results obtained with phenylalanine show that through manipulation of fundamental femtosecond laser parameters (such as pulse length, intensity and wavelength), energy deposition within the molecule can be controlled to allow enhancement of parent ion production or generation of characteristic fragmentation patterns. In particular by reducing the pulse length to a timescale equivalent to the fastest vibrational periods in the molecule, we demonstrate how fragmentation of the molecule can be minimised whilst maintaining a high ionisation efficiency. This journal is © the Owner Societies 2012

Single-molecule diffusion and conformational dynamics by spatial integration of temporal fluctuations

PubMed Central

Serag, Maged F.; Abadi, Maram; Habuchi, Satoshi

2014-01-01

Single-molecule localization and tracking has been used to translate spatiotemporal information of individual molecules to map their diffusion behaviours. However, accurate analysis of diffusion behaviours and including other parameters, such as the conformation and size of molecules, remain as limitations to the method. Here, we report a method that addresses the limitations of existing single-molecular localization methods. The method is based on temporal tracking of the cumulative area occupied by molecules. These temporal fluctuations are tied to molecular size, rates of diffusion and conformational changes. By analysing fluorescent nanospheres and double-stranded DNA molecules of different lengths and topological forms, we demonstrate that our cumulative-area method surpasses the conventional single-molecule localization method in terms of the accuracy of determined diffusion coefficients. Furthermore, the cumulative-area method provides conformational relaxation times of structurally flexible chains along with diffusion coefficients, which together are relevant to work in a wide spectrum of scientific fields. PMID:25283876

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

SRS in the single molecule limit (Conference Presentation)

NASA Astrophysics Data System (ADS)

Potma, Eric O.; Crampton, Kevin T.; Fast, Alexander; Apkarian, Vartkess A.

2017-02-01

We present combined surface-enhanced stimulated Raman scattering (SE-SRS) and surface-enhanced coherent anti-Stokes Raman scattering (SE-CARS) measurements on individual plasmonic antennas dressed with bipyridyl-ethylene molecules. By carefully optimizing the conditions for performing SE-SRS experiments, we have obtained stable and reproducible molecular surface-enhanced SRS spectra from single nano-antennas. Using surface-enhanced Raman scattering (SERS) and transmission electron microscopy of the same antennas, we confirm that the observed SE-SRS signals originate from only one or a few molecules. We highlight the physics of surface enhancement in the context of coherent Raman scattering and derive sensitivity parameters under the relevant conditions. The implications of single molecule SRS measurements are discussed.

Involvement of leucocyte/endothelial cell interactions in anorexia nervosa.

PubMed

Víctor, Víctor M; Rovira-Llopis, Susana; Saiz-Alarcón, Vanessa; Sangüesa, Maria C; Rojo-Bofill, Luis; Bañuls, Celia; de Pablo, Carmen; Álvarez, Ángeles; Rojo, Luis; Rocha, Milagros; Hernández-Mijares, Antonio

2015-07-01

Anorexia nervosa is a common psychiatric disorder in adolescence and is related to cardiovascular complications. Our aim was to study the effect of anorexia nervosa on metabolic parameters, leucocyte-endothelium interactions, adhesion molecules and proinflammatory cytokines. This multicentre, cross-sectional, case-control study employed a population of 24 anorexic female patients and 36 controls. We evaluated anthropometric and metabolic parameters, interactions between leucocytes polymorphonuclear neutrophils (PMN) and human umbilical vein endothelial cells (HUVEC), proinflammatory cytokines such as tumour necrosis factor alpha (TNF-α) and interleukin-6 (IL-6) and soluble cellular adhesion molecules (CAMs) including E-selectin, vascular cell adhesion molecule-1 (VCAM-1) and intercellular adhesion molecule-1 (ICAM-1). Anorexia nervosa was related to a decrease in weight, body mass index, waist circumference, systolic blood pressure, glucose, insulin and HOMA-IR, and an increase in HDL cholesterol. These effects disappeared after adjusting for BMI. Anorexia nervosa induced a decrease in PMN rolling velocity and an increase in PMN rolling flux and PMN adhesion. Increases in IL-6 and TNF-α and adhesion molecule VCAM-1 were also observed. This study supports the hypothesis of an association between anorexia nervosa, inflammation and the induction of leucocyte-endothelium interactions. These findings may explain, in part at least, the increased risk of vascular disease among patients with anorexia nervosa. © 2015 Stichting European Society for Clinical Investigation Journal Foundation.

Twisting short dsDNA with applied tension

NASA Astrophysics Data System (ADS)

Zoli, Marco

2018-02-01

The twisting deformation of mechanically stretched DNA molecules is studied by a coarse grained Hamiltonian model incorporating the fundamental interactions that stabilize the double helix and accounting for the radial and angular base pair fluctuations. The latter are all the more important at short length scales in which DNA fragments maintain an intrinsic flexibility. The presented computational method simulates a broad ensemble of possible molecule conformations characterized by a specific average twist and determines the energetically most convenient helical twist by free energy minimization. As this is done for any external load, the method yields the characteristic twist-stretch profile of the molecule and also computes the changes in the macroscopic helix parameters i.e. average diameter and rise distance. It is predicted that short molecules under stretching should first over-twist and then untwist by increasing the external load. Moreover, applying a constant load and simulating a torsional strain which over-twists the helix, it is found that the average helix diameter shrinks while the molecule elongates, in agreement with the experimental trend observed in kilo-base long sequences. The quantitative relation between percent relative elongation and superhelical density at fixed load is derived. The proposed theoretical model and computational method offer a general approach to characterize specific DNA fragments and predict their macroscopic elastic response as a function of the effective potential parameters of the mesoscopic Hamiltonian.

Clinicopathologic significance of HLA-G and HLA-E molecules in Tunisian patients with ovarian carcinoma.

PubMed

Babay, Wafa; Ben Yahia, Hamza; Boujelbene, Nadia; Zidi, Nour; Laaribi, Ahmed Baligh; Kacem, Dhikra; Ben Ghorbel, Radhia; Boudabous, Abdellatif; Ouzari, Hadda-Imene; Rizzo, Roberta; Rebmann, Vera; Mrad, Karima; Zidi, Inès

2018-06-01

The human leukocyte antigen (HLA)-G and HLA-E, non classical HLA class I molecules, have been highly implicated in immune tolerance. HLA-G and HLA-E molecules were proposed as putative markers of several advanced cancers. As a step towards a better understanding of ovarian carcinoma, we evaluated the expression of both HLA-G and HLA-E molecules and explored their prognostic implication. HLA-G and HLA-E expression were studied by immunohistochemistry on ovarian carcinoma tissues. This expression was semi-quantitatively scored into four expression groups and correlated to clinicopathological parameters and patients' survival. HLA-G and HLA-E have been found to be highly expressed in ovarian carcinoma tissues (Respectively, 72.4% and 96.8%). They are frequently co-expressed. Univariate and multivariate analysis revealed that a positive HLA-G expression status in tumor tissue is a promising candidate parameter to predict disease recurrence in addition to the disease status in Tunisian patients with ovarian carcinoma. Moreover, the elevated HLA-E expression was associated with serous ovarian carcinoma subtype as well as with advanced stages of ovarian carcinoma. HLA-G and HLA-E are highly represented in ovarian carcinoma suggesting a potential association with progressive disease mechanism. HLA-G and HLA-E molecules might be new candidates' markers for ovarian carcinoma progression. Copyright © 2018 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Continuous diffraction of molecules and disordered molecular crystals

PubMed Central

Yefanov, Oleksandr M.; Ayyer, Kartik; White, Thomas A.; Barty, Anton; Morgan, Andrew; Mariani, Valerio; Oberthuer, Dominik; Pande, Kanupriya

2017-01-01

The intensities of far-field diffraction patterns of orientationally aligned molecules obey Wilson statistics, whether those molecules are in isolation (giving rise to a continuous diffraction pattern) or arranged in a crystal (giving rise to Bragg peaks). Ensembles of molecules in several orientations, but uncorrelated in position, give rise to the incoherent sum of the diffraction from those objects, modifying the statistics in a similar way as crystal twinning modifies the distribution of Bragg intensities. This situation arises in the continuous diffraction of laser-aligned molecules or translationally disordered molecular crystals. This paper develops the analysis of the intensity statistics of such continuous diffraction to obtain parameters such as scaling, beam coherence and the number of contributing independent object orientations. When measured, continuous molecular diffraction is generally weak and accompanied by a background that far exceeds the strength of the signal. Instead of just relying upon the smallest measured intensities or their mean value to guide the subtraction of the background, it is shown how all measured values can be utilized to estimate the background, noise and signal, by employing a modified ‘noisy Wilson’ distribution that explicitly includes the background. Parameters relating to the background and signal quantities can be estimated from the moments of the measured intensities. The analysis method is demonstrated on previously published continuous diffraction data measured from crystals of photosystem II [Ayyer et al. (2016 ▸), Nature, 530, 202–206]. PMID:28808434

Evaluating and minimizing noise impact due to aircraft flyover

NASA Technical Reports Server (NTRS)

Jacobson, I. D.; Cook, G.

1979-01-01

Existing techniques were used to assess the noise impact on a community due to aircraft operation and to optimize the flight paths of an approaching aircraft with respect to the annoyance produced. Major achievements are: (1) the development of a population model suitable for determining the noise impact, (2) generation of a numerical computer code which uses this population model along with the steepest descent algorithm to optimize approach/landing trajectories, (3) implementation of this optimization code in several fictitious cases as well as for the community surrounding Patrick Henry International Airport, Virginia.

Dynamical polarizability of atoms in arbitrary light fields: general theory and application to cesium

NASA Astrophysics Data System (ADS)

Le Kien, Fam; Schneeweiss, Philipp; Rauschenbeutel, Arno

2013-05-01

We present a systematic derivation of the dynamical polarizability and the ac Stark shift of the ground and excited states of atoms interacting with a far-off-resonance light field of arbitrary polarization. We calculate the scalar, vector, and tensor polarizabilities of atomic cesium using resonance wavelengths and reduced matrix elements for a large number of transitions. We analyze the properties of the fictitious magnetic field produced by the vector polarizability in conjunction with the ellipticity of the polarization of the light field.

KSC-04PD-2447

NASA Technical Reports Server (NTRS)

2004-01-01

KENNEDY SPACE CENTER, FLA. During a simulated launch countdown/emergency simulation on Launch Pad 39A, the rescue team helps astronaut-suited workers climb into an M-113 armored personnel carrier for transport away from the pad. The four-hour exercise simulated normal launch countdown operations, with the added challenge of a fictitious event causing an evacuation of the vehicle and launch pad. It tested the teams rescue approaches on the Fixed Service Structure, slidewire basket evacuation, triage care and transportation of injured personnel to hospitals, as well as communications and coordination.

KSC-04PD-2445

NASA Technical Reports Server (NTRS)

2004-01-01

KENNEDY SPACE CENTER, FLA. During a simulated launch countdown/emergency simulation on Launch Pad 39A, the rescue team carries injured astronaut-suited workers into an M-113 armored personnel carrier for transport away from the pad. The four-hour exercise simulated normal launch countdown operations, with the added challenge of a fictitious event causing an evacuation of the vehicle and launch pad. It tested the teams rescue approaches on the Fixed Service Structure, slidewire basket evacuation, triage care and transportation of injured personnel to hospitals, as well as communications and coordination.

Integrated Methodology for Adhesive Bonded Joint Life Predictions.

DTIC Science & Technology

1982-11-01

holography with fictitious fringe-moire’, as pioneered and perfected over the last few years by Prof. Sciammarella and his students albeit on relatively... Sciammarella et al. have very recently solved this problem by using the holographic moire’ technique in rIAI ime combined with closed circuit TV (Ref. 74... Sciammarella et al. The in-plane (x) displacements are given by a moire’ 129 -- ~ -- ~ --.- ~4-4 00 e’J 00 00 wI 4. *~:1 r. .00 0 0 0 d u0 02( 1 0 r4

Simulated families: A test for different methods of family identification

NASA Technical Reports Server (NTRS)

Bendjoya, Philippe; Cellino, Alberto; Froeschle, Claude; Zappala, Vincenzo

1992-01-01

A set of families generated in fictitious impact events (leading to a wide range of 'structure' in the orbital element space have been superimposed to various backgrounds of different densities in order to investigate the efficiency and the limitations of the methods used by Zappala et al. (1990) and by Bendjoya et al. (1990) for identifying asteroid families. In addition, an evaluation of the expected interlopers at different significance levels and the possibility of improving the definition of the level of maximum significant of a given family were analyzed.

Munchausen syndrome by proxy: an experience from Nigeria.

PubMed

Ifere, O A; Yakubu, A M; Aikhionbare, H A; Quaitey, G E; Taqi, A M

1993-01-01

We report here on a child who over a period of 8 years was admitted several times to hospitals in different states of Nigeria based on fictitious illnesses described by his mother. The child had various unnecessary, expensive and invasive investigations followed by treatment with harmful drugs. The evolution of this case of Munchausen syndrome by proxy is described in order to alert paediatricians in developing countries to a problem which is described frequently in more affluent societies. We believe this is the first such case to be recorded in West Africa.

Theoretical analysis of ozone generation by pulsed dielectric barrier discharge in oxygen

NASA Astrophysics Data System (ADS)

Wei, L. S.; Zhou, J. H.; Wang, Z. H.; Cen, K. F.

2007-08-01

The use of very short high-voltage pulses combined with a dielectric layer results in high-energy electrons that dissociate oxygen molecules into atoms, which are a prerequisite for the subsequent production of ozone by collisions with oxygen molecules and third particles. The production of ozone depends on both the electrical and the physical parameters. For ozone generation by pulsed dielectric barrier discharge in oxygen, a mathematical model, which describes the relation between ozone concentration and these parameters that are of importance in its design, is developed according to dimensional analysis theory. A formula considering the ozone destruction factor is derived for predicting the characteristics of the ozone generation, within the range of the corona inception voltage to the gap breakdown voltage. The trend showing the dependence of the concentration of ozone in oxygen on these parameters generally agrees with the experimental results, thus confirming the validity of the mathematical model.

rPM6 parameters for phosphorous and sulphur-containing open-shell molecules

NASA Astrophysics Data System (ADS)

Saito, Toru; Takano, Yu

2018-03-01

In this article, we have introduced a reparameterisation of PM6 (rPM6) for phosphorus and sulphur to achieve a better description of open-shell species containing the two elements. Two sets of the parameters have been optimised separately using our training sets. The performance of the spin-unrestricted rPM6 (UrPM6) method with the optimised parameters is evaluated against 14 radical species, which contain either phosphorus or sulphur atom, comparing with the original UPM6 and the spin-unrestricted density functional theory (UDFT) methods. The standard UPM6 calculations fail to describe the adiabatic singlet-triplet energy gaps correctly, and may cause significant structural mismatches with UDFT-optimised geometries. Leaving aside three difficult cases, tests on 11 open-shell molecules strongly indicate the superior performance of UrPM6, which provides much better agreement with the results of UDFT methods for geometric and electronic properties.

Physicochemical Profiling of α-Lipoic Acid and Related Compounds.

PubMed

Mirzahosseini, Arash; Szilvay, András; Noszál, Béla

2016-07-01

Lipoic acid, the biomolecule of vital importance following glycolysis, shows diversity in its thiol/disulfide equilibria and also in its eight different protonation forms of the reduced molecule. In this paper, lipoic acid, lipoamide, and their dihydro derivatives were studied to quantify their solubility, acid-base, and lipophilicity properties at a submolecular level. The acid-base properties are characterized in terms of six macroscopic, 12 microscopic protonation constants, and three interactivity parameters. The species-specific basicities, the pH-dependent distribution of the microspecies, and lipophilicity parameters are interpreted by various intramolecular effects, and contribute to understanding the antioxidant, chelate-forming, and enzyme cofactor behavior of the molecules observed. © 2016 Wiley-VHCA AG, Zürich.

Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

PubMed

Yadav, Hemendra; Sharma, Pulkit

2017-11-01

Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

9.73% Efficiency Nonfullerene All Organic Small Molecule Solar Cells with Absorption-Complementary Donor and Acceptor.

PubMed

Bin, Haijun; Yang, Yankang; Zhang, Zhi-Guo; Ye, Long; Ghasemi, Masoud; Chen, Shanshan; Zhang, Yindong; Zhang, Chunfeng; Sun, Chenkai; Xue, Lingwei; Yang, Changduk; Ade, Harald; Li, Yongfang

2017-03-29

In the last two years, polymer solar cells (PSCs) developed quickly with n-type organic semiconductor (n-OSs) as acceptor. In contrast, the research progress of nonfullerene organic solar cells (OSCs) with organic small molecule as donor and the n-OS as acceptor lags behind. Here, we synthesized a D-A structured medium bandgap organic small molecule H11 with bithienyl-benzodithiophene (BDTT) as central donor unit and fluorobenzotriazole as acceptor unit, and achieved a power conversion efficiency (PCE) of 9.73% for the all organic small molecules OSCs with H11 as donor and a low bandgap n-OS IDIC as acceptor. A control molecule H12 without thiophene conjugated side chains on the BDT unit was also synthesized for investigating the effect of the thiophene conjugated side chains on the photovoltaic performance of the p-type organic semiconductors (p-OSs). Compared with H12, the 2D-conjugated H11 with thiophene conjugated side chains shows intense absorption, low-lying HOMO energy level, higher hole mobility and ordered bimodal crystallite packing in the blend films. Moreover, a larger interaction parameter (χ) was observed in the H11 blends calculated from Hansen solubility parameters and differential scanning calorimetry measurements. These special features combined with the complementary absorption of H11 donor and IDIC acceptor resulted in the best PCE of 9.73% for nonfullerene all small molecule OSCs up to date. Our results indicate that fluorobenzotriazole based 2D conjugated p-OSs are promising medium bandgap donors in the nonfullerene OSCs.

Laser control of reactions of photoswitching functional molecules.

PubMed

Tamura, Hiroyuki; Nanbu, Shinkoh; Ishida, Toshimasa; Nakamura, Hiroki

2006-07-21

Laser control schemes of reactions of photoswitching functional molecules are proposed based on the quantum mechanical wave-packet dynamics and the design of laser parameters. The appropriately designed quadratically chirped laser pulses can achieve nearly complete transitions of wave packet among electronic states. The laser parameters can be optimized by using the Zhu-Nakamura theory of nonadiabatic transition. This method is effective not only for the initial photoexcitation process but also for the pump and dump scheme in the middle of the overall photoswitching process. The effects of momentum of the wave packet crossing a conical intersection on the branching ratio of products have also been clarified. These control schemes mentioned above are successfully applied to the cyclohexadiene/hexatriene photoisomerization (ring-opening) process which is the reaction center of practical photoswitching molecules such as diarylethenes. The overall efficiency of the ring opening can be appreciably increased by using the appropriately designed laser pulses compared to that of the natural photoisomerization without any control schemes.

Adsorption of asymmetric rigid rods or heteronuclear diatomic moleculeson homogeneous surfaces

NASA Astrophysics Data System (ADS)

Engl, W.; Courbin, L.; Panizza, P.

2004-10-01

We treat the adsorption on homogeneous surfaces of asymmetric rigid rods (like for instance heteronuclear diatomic molecules). We show that the n→0 vector spin formalism is well suited to describe such a problem. We establish an isomorphism between the coupling constants of the magnetic Hamiltonian and the adsorption parameters of the rigid rods. By solving this Hamiltonian within a mean-field approximation, we obtain analytical expressions for the densities of the different rod’s configurations, both isotherm and isobar adsorptions curves. The most probable configurations of the molecules (normal or parallel to the surface) which depends on temperature and energy parameters are summarized in a diagram. We derive that the variation of Qv , the heat of adsorption at constant volume, with the temperature is a direct signature of the adsorbed molecules configuration change. We show that this formalism can be generalized to more complicated problems such as for instance the adsorption of symmetric and asymmetric rigid rods mixtures in the presence or not of interactions.

Changes in type I collagen following laser welding.

PubMed

Bass, L S; Moazami, N; Pocsidio, J; Oz, M C; LoGerfo, P; Treat, M R

1992-01-01

Selection of ideal laser parameters for tissue welding is inhibited by poor understanding of the mechanism. We investigated structural changes in collagen molecules extracted from rat tail tendon (> 90% type I collagen) after tissue welding using an 808 nm diode laser and indocyanine green dye applied to the weld site. Mobility patterns on SDS-PAGE were identical in the lasered and untreated tendon extracts with urea or acetic acid. Pepsin incubation after acetic acid extraction revealed a reduction of collagen alpha and beta bands in lasered compared with untreated specimens. Circular dichroism studies of rat tail tendon showed absence of helical structure in collagen from lasered tendon. No evidence for covalent bonding was present in laser-treated tissues. Collagen molecules are denatured by the laser wavelength and parameters used in this study. No significant amount of helical structure is regenerated on cooling. We conclude that non-covalent interactions between denatured collagen molecules may be responsible for the creation of tissue welding.

The methods of optical physics as a mean of the objects’ molecular structure identification (on the base of the research of dophamine and adrenaline molecules)

NASA Astrophysics Data System (ADS)

Elkin, M. D.; Alykova, O. M.; Smirnov, V. V.; Stefanova, G. P.

2017-01-01

Structural and dynamic models of dopamine and adrenaline are proposed on the basis of ab initio quantum calculations of the geometric and electronic structure. The parameters of the adiabatic potential are determined, a vibrational states interpretation of the test compound is proposed in this work. The analysis of the molecules conformational structure of the substance is made. A method for calculating the shifts of vibrational excitation frequencies in 1,2,4-threesubstituted of benzole is presented. It is based on second order perturbation theory. A choice of method and basis for calculation of a fundamental vibrations frequencies and intensities of the bands in the IR and Raman spectra is justified. The technique for evaluation of anharmonicity with cubic and quartic force constants is described. The paper presents the results of numerical experiments, geometric parameters of molecules, such as the valence bond lengths and angles between them. We obtain the frequency of the vibrational states and values of their integrated intensities. The interpretation of vibration of conformers is given. The results are in good agreement with experimental values. Proposed frequency can be used to identify the compounds of the vibrational spectra of molecules. The calculation was performed quantum density functional method DFT/B3LYP. It is shown that this method can be used to modeling the geometrical parameters molecular and electronic structure of various substituted of benzole. It allows us to construct the structural-dynamic models of this class of compounds by numerical calculations.

Effects of uniaxial pressure on the quantum tunneling of magnetization in a high-symmetry Mn12 single-molecule magnet

NASA Astrophysics Data System (ADS)

Atkinson, James H.; Fournet, Adeline D.; Bhaskaran, Lakshmi; Myasoedov, Yuri; Zeldov, Eli; del Barco, Enrique; Hill, Stephen; Christou, George; Friedman, Jonathan R.

2017-05-01

The symmetry of single-molecule magnets dictates their spin quantum dynamics, influencing how such systems relax via quantum tunneling of magnetization (QTM). By reducing a system's symmetry, through the application of a magnetic field or uniaxial pressure, these dynamics can be modified. We report measurements of the magnetization dynamics of a crystalline sample of the high-symmetry [M n12O12(O2CMe) 16(Me OH ) 4].M e OH single-molecule magnet as a function of uniaxial pressure applied either parallel or perpendicular to the sample's "easy" magnetization axis. At temperatures between 1.8 and 3.3 K, magnetic hysteresis loops exhibit the characteristic steplike features that signal the occurrence of QTM. After applying uniaxial pressure to the sample in situ, both the magnitude and field position of the QTM steps changed. The step magnitudes were observed to grow as a function of pressure in both arrangements of pressure, while pressure applied along (perpendicular to) the sample's easy axis caused the resonant-tunneling fields to increase (decrease). These observations were compared with simulations in which the system's Hamiltonian parameters were changed. From these comparisons, we determined that parallel pressure induces changes to the second-order axial anisotropy parameter as well as either the fourth-order axial or fourth-order transverse parameter, or to both. In addition, we find that pressure applied perpendicular to the easy axis induces a rhombic anisotropy E ≈D /2000 per kbar that can be understood as deriving from a symmetry-breaking distortion of the molecule.

On the Failure of Correlating Partitioned Electrostatic Surface Potentials Using Bader’s Atoms-in-Molecules Theory to Impact Sensitivities

DTIC Science & Technology

2013-04-01

atoms labeled. ......................................................................................25 Figure A-15. Picric acid with atoms labeled...217 Table A-47. DATB atom specific Politzer parameters using PBE/6-31G**..............................218 Table A-48. Picric acid atom specific...weighted atom specific Politzer parameters using PBE/6-31G**. .....272 Table A-96. Picric acid area weighted atom specific Politzer parameters using PBE

Curcumin and kaempferol prevent lysozyme fibril formation by modulating aggregation kinetic parameters.

PubMed

Borana, Mohanish S; Mishra, Pushpa; Pissurlenkar, Raghuvir R S; Hosur, Ramakrishna V; Ahmad, Basir

2014-03-01

Interaction of small molecule inhibitors with protein aggregates has been studied extensively, but how these inhibitors modulate aggregation kinetic parameters is little understood. In this work, we investigated the ability of two potential aggregation inhibiting drugs, curcumin and kaempferol, to control the kinetic parameters of aggregation reaction. Using thioflavin T fluorescence and static light scattering, the kinetic parameters such as amplitude, elongation rate constant and lag time of guanidine hydrochloride-induced aggregation reactions of hen egg white lysozyme were studied. We observed a contrasting effect of inhibitors on the kinetic parameters when aggregation reactions were measured by these two probes. The interactions of these inhibitors with hen egg white lysozyme were investigated using fluorescence quench titration method and molecular dynamics simulations coupled with binding free energy calculations. We conclude that both the inhibitors prolong nucleation of amyloid aggregation through binding to region of the protein which is known to form the core of the protein fibril, but once the nucleus is formed the rate of elongation is not affected by the inhibitors. This work would provide insight into the mechanism of aggregation inhibition by these potential drug molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

Radiative Cooling of Warm Molecular Gas

NASA Technical Reports Server (NTRS)

Neufeld, David A.; Kaufman, Michael J.

1993-01-01

We consider the radiative cooling of warm (T >= 100 K), fully molecular astrophysical gas by rotational and vibrational transitions of the molecules H2O, CO, and H2. Using an escape probability method to solve for the molecular level populations, we have obtained the cooling rate for each molecule as a function of temperature, density, and an optical depth parameter. A four-parameter expression proves useful in fitting the run of cooling rate with density for any fixed values of the temperature and optical depth parameter. We identify the various cooling mechanisms which are dominant in different regions of the astrophysically relevant parameter space. Given the assumption that water is very abundant in warm regions of the interstellar medium, H2O rotational transitions are found to dominate the cooling of warm interstellar gas over a wide portion of the parameter space considered. While chemical models for the interstellar medium make the strong prediction that water will be produced copiously at temperatures above a few hundred degrees, our assumption of a high water abundance has yet to be tested observationally. The Infrared Space Observatory and the Submillimeter Wave Astronomy Satellite will prove ideal instruments for testing whether water is indeed an important coolant of interstellar and circumstellar gas.

Line-by-line spectroscopic parameters of HFC-32 ro-vibrational transitions within the atmospheric window around 8.2 μm

NASA Astrophysics Data System (ADS)

Tasinato, Nicola; Ceselin, Giorgia; Pietropolli Charmet, Andrea; Stoppa, Paolo; Giorgianni, Santi

2018-06-01

Difluoromethane (CH2F2,HFC-32) presents strong ro-vibrational bands within the 8-12 μm atmospheric window and hence it represents a greenhouse gas able of contributing to global warming. Numerous spectroscopic studies have been devoted to this molecule, however, much information on line-by-line parameters, like line intensities and broadening parameters, is still lacking. In this work, line-by-line spectroscopic parameters are retrieved for several CH2F2 ro-vibrational transitions belonging to the ν7 band located around 8.5 μm. Self-broadening as well N2- and O2- broadening experiments are carried out at room temperature by using a tunable diode laser (TDL) spectrometer. The line shape analysis of CH2F2 self-broadened spectra leads to the determination of resonant frequencies, integrated absorption coefficients and self-broadening parameters, while CH2F2-N2 and CH2F2-O2 broadening coefficients are obtained from foreign-broadening measurements. In addition, the broadening parameters of CH2F2 in air are derived from the N2- and O2- broadening coefficients. The results of the present work provide fundamental information to measure the concentration profiles of this molecule in the atmosphere through remote sensing spectroscopic techniques.

Non-Markovian full counting statistics in quantum dot molecules

PubMed Central

Xue, Hai-Bin; Jiao, Hu-Jun; Liang, Jiu-Qing; Liu, Wu-Ming

2015-01-01

Full counting statistics of electron transport is a powerful diagnostic tool for probing the nature of quantum transport beyond what is obtainable from the average current or conductance measurement alone. In particular, the non-Markovian dynamics of quantum dot molecule plays an important role in the nonequilibrium electron tunneling processes. It is thus necessary to understand the non-Markovian full counting statistics in a quantum dot molecule. Here we study the non-Markovian full counting statistics in two typical quantum dot molecules, namely, serially coupled and side-coupled double quantum dots with high quantum coherence in a certain parameter regime. We demonstrate that the non-Markovian effect manifests itself through the quantum coherence of the quantum dot molecule system, and has a significant impact on the full counting statistics in the high quantum-coherent quantum dot molecule system, which depends on the coupling of the quantum dot molecule system with the source and drain electrodes. The results indicated that the influence of the non-Markovian effect on the full counting statistics of electron transport, which should be considered in a high quantum-coherent quantum dot molecule system, can provide a better understanding of electron transport through quantum dot molecules. PMID:25752245

Quantum mechanical computations and spectroscopy: from small rigid molecules in the gas phase to large flexible molecules in solution.

PubMed

Barone, Vincenzo; Improta, Roberto; Rega, Nadia

2008-05-01

Interpretation of structural properties and dynamic behavior of molecules in solution is of fundamental importance to understand their stability, chemical reactivity, and catalytic action. While information can be gained, in principle, by a variety of spectroscopic techniques, the interpretation of the rich indirect information that can be inferred from the analysis of experimental spectra is seldom straightforward because of the subtle interplay of several different effects, whose specific role is not easy to separate and evaluate. In such a complex scenario, theoretical studies can be very helpful at two different levels: (i) supporting and complementing experimental results to determine the structure of the target molecule starting from its spectral properties; (ii) dissecting and evaluating the role of different effects in determining the observed spectroscopic properties. This is the reason why computational spectroscopy is rapidly evolving from a highly specialized research field into a versatile and widespread tool for the assignment of experimental spectra and their interpretation in terms of chemical physical effects. In such a situation, it becomes important that both computationally and experimentally oriented chemists are aware that new methodological advances and integrated computational strategies are available, providing reliable estimates of fundamental spectral parameters not only for relatively small molecules in the gas phase but also for large and flexible molecules in condensed phases. In this Account, we review the most significant methodological contributions from our research group in this field, and by exploiting some recent results of their application to the computation of IR, UV-vis, NMR, and EPR spectral parameters, we discuss the microscopic mechanisms underlying solvent and vibrational effects on the spectral parameters. After reporting some recent achievements for the study of excited states by first principle quantum mechanical approaches, we focus on the treatment of environmental effects by means of mixed discrete-continuum solvent models and on effective methods for computing vibronic contributions to the spectra. We then discuss some new developments, mainly based on time-dependent approaches, allowing us to go beyond the determination of spectroscopic parameters toward the simulation of line widths and shapes. Although further developments are surely needed to improve the accuracy and effectiveness of several items in the proposed approach, we try to show that the first important steps toward a direct comparison between the results obtained in vitro and those obtained in silico have been made, making easier fruitful crossovers among experiments, computations and theoretical models, which would be decisive for a deeper understanding of the spectral behavior associated with complex systems and processes.

Benchmarking the pseudopotential and fixed-node approximations in diffusion Monte Carlo calculations of molecules and solids

DOE PAGES

Nazarov, Roman; Shulenburger, Luke; Morales, Miguel A.; ...

2016-03-28

We performed diffusion Monte Carlo (DMC) calculations of the spectroscopic properties of a large set of molecules, assessing the effect of different approximations. In systems containing elements with large atomic numbers, we show that the errors associated with the use of nonlocal mean-field-based pseudopotentials in DMC calculations can be significant and may surpass the fixed-node error. In conclusion, we suggest practical guidelines for reducing these pseudopotential errors, which allow us to obtain DMC-computed spectroscopic parameters of molecules and equation of state properties of solids in excellent agreement with experiment.

Benchmarking the pseudopotential and fixed-node approximations in diffusion Monte Carlo calculations of molecules and solids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nazarov, Roman; Shulenburger, Luke; Morales, Miguel A.

We performed diffusion Monte Carlo (DMC) calculations of the spectroscopic properties of a large set of molecules, assessing the effect of different approximations. In systems containing elements with large atomic numbers, we show that the errors associated with the use of nonlocal mean-field-based pseudopotentials in DMC calculations can be significant and may surpass the fixed-node error. In conclusion, we suggest practical guidelines for reducing these pseudopotential errors, which allow us to obtain DMC-computed spectroscopic parameters of molecules and equation of state properties of solids in excellent agreement with experiment.

Monitoring structural transformations in crystals. 7. 1-Chloroanthracene and its photodimer.

PubMed

Turowska-Tyrk, Ilona; Grześniak, Karolina

2004-02-01

Crystals of the 1-chloroanthracene photodimer, viz. trans-bi(1-chloro-9,10-dihydro-9,10-anthracenediyl), C(28)H(18)Cl(2), were obtained from the solid-state [4+4]-photodimerization of the monomer, C(14)H(9)Cl, followed by recrystallization. The symmetry of the product molecules is defined by the orientation of the reactant molecules in the crystal. The mutual orientation parameters calculated for adjacent monomers explain the reactivity of the compound. The molecules in the crystal of the monomer and the recrystallized photodimer pack differently and the photodimer has crystallographically imposed inversion symmetry.

Calixarene-Mediated Liquid-Membrane Transport of Choline Conjugates.

PubMed

Adhikari, Birendra Babu; Fujii, Ayu; Schramm, Michael P

2014-05-01

A series of supramolecular calixarenes efficiently transport distinct molecular species through a liquid membrane when attached to a receptor-complementary choline handle. Calix-[6]arene hexacarboxylic acid was highly effective at transporting different target molecules against a pH gradient. Both carboxylic- and phosphonic-acid-functionalized calix[4]arenes effect transport without requiring a pH or ion gradient. NMR binding studies, two-phase solvent extraction, and three-phase transport experiments reveal the necessary and subtle parameters to effect the transport of molecules attached to a choline "handle". On the other hand, rescorin[4]arene cavitands, which have similar guest recognition profiles, did not transport guest molecules. These developments reveal new approaches towards attempting synthetic-receptor-mediated selective small-molecule transport in vesicular and cellular systems.

Precision analysis for standard deviation measurements of immobile single fluorescent molecule images.

PubMed

DeSantis, Michael C; DeCenzo, Shawn H; Li, Je-Luen; Wang, Y M

2010-03-29

Standard deviation measurements of intensity profiles of stationary single fluorescent molecules are useful for studying axial localization, molecular orientation, and a fluorescence imaging system's spatial resolution. Here we report on the analysis of the precision of standard deviation measurements of intensity profiles of single fluorescent molecules imaged using an EMCCD camera.We have developed an analytical expression for the standard deviation measurement error of a single image which is a function of the total number of detected photons, the background photon noise, and the camera pixel size. The theoretical results agree well with the experimental, simulation, and numerical integration results. Using this expression, we show that single-molecule standard deviation measurements offer nanometer precision for a large range of experimental parameters.

Visualizing Chemical Interaction Dynamics of Confined DNA Molecules

NASA Astrophysics Data System (ADS)

Henkin, Gilead; Berard, Daniel; Stabile, Frank; Leslie, Sabrina

We present a novel nanofluidic approach to controllably introducing reagent molecules to interact with confined biopolymers and visualizing the reaction dynamics in real time. By dynamically deforming a flow cell using CLiC (Convex Lens-induced Confinement) microscopy, we are able to tune reaction chamber dimensions from micrometer to nanometer scales. We apply this gentle deformation to load and extend DNA polymers within embedded nanotopographies and visualize their interactions with other molecules in solution. Quantifying the change in configuration of polymers within embedded nanotopographies in response to binding/unbinding of reagent molecules provides new insights into their consequent change in physical properties. CLiC technology enables an ultra sensitive, massively parallel biochemical analysis platform which can acces a broader range of interaction parameters than existing devices.

Detection of Single Molecules Illuminated by a Light-Emitting Diode

PubMed Central

Gerhardt, Ilja; Mai, Lijian; Lamas-Linares, Antía; Kurtsiefer, Christian

2011-01-01

Optical detection and spectroscopy of single molecules has become an indispensable tool in biological imaging and sensing. Its success is based on fluorescence of organic dye molecules under carefully engineered laser illumination. In this paper we demonstrate optical detection of single molecules on a wide-field microscope with an illumination based on a commercially available, green light-emitting diode. The results are directly compared with laser illumination in the same experimental configuration. The setup and the limiting factors, such as light transfer to the sample, spectral filtering and the resulting signal-to-noise ratio are discussed. A theoretical and an experimental approach to estimate these parameters are presented. The results can be adapted to other single emitter and illumination schemes. PMID:22346610

A fictitious domain method for lithosphere-asthenosphere interaction: Application to periodic slab folding in the upper mantle

NASA Astrophysics Data System (ADS)

Cerpa, Nestor G.; Hassani, Riad; Gerbault, Muriel; Prévost, Jean-Herve

2014-05-01

We present a new approach for the lithosphere-asthenosphere interaction in subduction zones. The lithosphere is modeled as a Maxwell viscoelastic body sinking in the viscous asthenosphere. Both domains are discretized by the finite element method, and we use a staggered coupling method. The interaction is provided by a nonmatching interface method called the fictitious domain method. We describe a simplified formulation of this numerical technique and present 2-D examples and benchmarks. We aim at studying the effect of mantle viscosity on the cyclicity of slab folding at the 660 km depth transition zone. Such cyclicity has previously been shown to occur depending on the kinematics of both the overriding and subducting plates, in analog and numerical models that approximate the 660 km depth transition zone as an impenetrable barrier. Here we applied far-field plate velocities corresponding to those of the South-American and Nazca plates at present. Our models show that the viscosity of the asthenosphere impacts on folding cyclicity and consequently on the slab's dip as well as the stress regime of the overriding plate. Values of the mantle viscosity between 3 and 5 × 1020 Pa s are found to produce cycles similar to those reported for the Andes, which are of the order of 30-40 Myr (based on magmatism and sedimentological records). Moreover, we discuss the episodic development of horizontal subduction induced by cyclic folding and, hence, propose a new explanation for episodes of flat subduction under the South-American plate.

Giga-year evolution of Jupiter Trojans and the asymmetry problem

NASA Astrophysics Data System (ADS)

Di Sisto, Romina P.; Ramos, Ximena S.; Beaugé, Cristián

2014-11-01

We present a series of numerical integrations of observed and fictitious Jupiter Trojan asteroids, under the gravitational effects of the four outer planets, for time-spans comparable with the age of the Solar System. From these results we calculate the escape rate from each Lagrange point, and construct dynamical maps of ;permanence; time in different regions of the phase space. Fictitious asteroids in L4 and L5 show no significant difference, showing almost identical dynamical maps and escape rates. For real Trojans, however, we found that approximately 23% of the members of the leading swarm escaped after 4.5 Gyrs, while this number increased to 28.3% for L5 . This implies that the asymmetry between the two populations increases with time, indicating that it may have been smaller at the time of formation/capture of these asteroids. Nevertheless, the difference in chaotic diffusion cannot, in itself, account for the current observed asymmetry (∼40%), and must be primarily primordial and characteristic of the capture mechanism of the Trojans. Finally, we calculate new proper elements for all the numbered Trojans using the semi-analytical approach of Beaugé and Roig (Beaugé, C., Roig, F.V. [2001]. Icarus, 153, 391-415), and compare the results with the numerical estimations by Brož and Rosehnal (Brož, M., Rosehnal, J. [2011]. Mon. Not. R. Astron. Soc. 414, 565-574). For asteroids that were already numbered in 2011, both methods yield very similar results, while significant differences were found for those bodies that became numbered after 2011.

Episodic Memory and Episodic Future Thinking Impairments in High-Functioning Autism Spectrum Disorder: An Underlying Difficulty With Scene Construction or Self-Projection?

PubMed Central

2013-01-01

Objective: There appears to be a common network of brain regions that underlie the ability to recall past personal experiences (episodic memory) and the ability to imagine possible future personal experiences (episodic future thinking). At the cognitive level, these abilities are thought to rely on “scene construction” (the ability to bind together multimodal elements of a scene in mind—dependent on hippocampal functioning) and temporal “self-projection” (the ability to mentally project oneself through time—dependent on prefrontal cortex functioning). Although autism spectrum disorder (ASD) is characterized by diminished episodic memory, it is unclear whether episodic future thinking is correspondingly impaired. Moreover, the underlying basis of such impairments (difficulties with scene construction, self-projection, or both) is yet to be established. The current study therefore aimed to elucidate these issues. Method: Twenty-seven intellectually high-functioning adults with ASD and 29 age- and IQ-matched neurotypical comparison adults were asked to describe (a) imagined atemporal, non-self-relevant fictitious scenes (assessing scene construction), (b) imagined plausible self-relevant future episodes (assessing episodic future thinking), and (c) recalled personally experienced past episodes (assessing episodic memory). Tests of narrative ability and theory of mind were also completed. Results: Performances of participants with ASD were significantly and equally diminished in each condition and, crucially, this diminution was independent of general narrative ability. Conclusions: Given that participants with ASD were impaired in the fictitious scene condition, which does not involve self-projection, we suggest the underlying difficulty with episodic memory/future thinking is one of scene construction. PMID:24015827

Episodic memory and episodic future thinking impairments in high-functioning autism spectrum disorder: an underlying difficulty with scene construction or self-projection?

PubMed

Lind, Sophie E; Williams, David M; Bowler, Dermot M; Peel, Anna

2014-01-01

There appears to be a common network of brain regions that underlie the ability to recall past personal experiences (episodic memory) and the ability to imagine possible future personal experiences (episodic future thinking). At the cognitive level, these abilities are thought to rely on "scene construction" (the ability to bind together multimodal elements of a scene in mind--dependent on hippocampal functioning) and temporal "self-projection" (the ability to mentally project oneself through time--dependent on prefrontal cortex functioning). Although autism spectrum disorder (ASD) is characterized by diminished episodic memory, it is unclear whether episodic future thinking is correspondingly impaired. Moreover, the underlying basis of such impairments (difficulties with scene construction, self-projection, or both) is yet to be established. The current study therefore aimed to elucidate these issues. Twenty-seven intellectually high-functioning adults with ASD and 29 age- and IQ-matched neurotypical comparison adults were asked to describe (a) imagined atemporal, non-self-relevant fictitious scenes (assessing scene construction), (b) imagined plausible self-relevant future episodes (assessing episodic future thinking), and (c) recalled personally experienced past episodes (assessing episodic memory). Tests of narrative ability and theory of mind were also completed. Performances of participants with ASD were significantly and equally diminished in each condition and, crucially, this diminution was independent of general narrative ability. Given that participants with ASD were impaired in the fictitious scene condition, which does not involve self-projection, we suggest the underlying difficulty with episodic memory/future thinking is one of scene construction.

Serotonergic Contribution to Boys' Behavioral Regulation

PubMed Central

Nantel-Vivier, Amélie; Young, Simon N.; Parent, Sophie; Bélanger, Stacey Ageranioti; Sutton, Rachel; Dubois, Marie-Eve

2011-01-01

Objectives Animal and human adult studies reveal a contribution of serotonin to behavior regulation. Whether these findings apply to children is unclear. The present study investigated serotonergic functioning in boys with a history of behavior regulation difficulties through a double-blind, acute tryptophan supplementation procedure. Method Participants were 23 boys (age 10 years) with a history of elevated physical aggression, recruited from a community sample. Eleven were given a chocolate milkshake supplemented with 500mg tryptophan, and 12 received a chocolate milkshake without tryptophan. Boys engaged in a competitive reaction time game against a fictitious opponent, which assessed response to provocation, impulsivity, perspective taking, and sharing. Impulsivity was further assessed through a Go/No-Go paradigm. A computerized emotion recognition task and a staged instrumental help incident were also administered. Results Boys, regardless of group, responded similarly to high provocation by the fictitious opponent. However, boys in the tryptophan group adjusted their level of responding optimally as a function of the level of provocation, whereas boys in the control group significantly decreased their level of responding towards the end of the competition. Boys in the tryptophan group tended to show greater perspective taking, tended to better distinguish facial expressions of fear and happiness, and tended to provide greater instrumental help to the experimenter. Conclusions The present study provides initial evidence for the feasibility of acute tryptophan supplementation in children and some effect of tryptophan supplementation on children's behaviors. Further studies are warranted to explore the potential impact of increased serotonergic functioning on boys' dominant and affiliative behaviors. PMID:21673801

Problems and risks of unsolicited e-mails in patient-physician encounters in travel medicine settings.

PubMed

Sing, A; Salzman, J; Sing, D

2001-01-01

International travel and use of modern information technology are expressions of modern life style. Seeking on-line travel health advice via E-mail for preventive (teleprevention) or diagnostic reasons may become increasingly popular among patients with financial resources and Internet access. This study was undertaken to compare the behavior of travel clinic or tropical medicine physicians and other providers of travel-related medical information services toward unsolicited E-mails from fictitious patients in pretravel and post-travel scenarios. We also wanted to test the potential of E-mail advice for preventive medicine (teleprevention), and to find out how the "Good Samaritan Law" is observed. Two different E-mails were posted to E-mail addresses of 171 physicians (members of travel health and/or tropical medicine societies) and services offering advice on travel health issues identified by an AltaVista search. These E-mails, from two different fictitious travelers, were asking for advice regarding malaria prophylaxis in a pretravel scenario and describing symptoms suggesting acute malaria. Of the contacted addresses 43.3% and 49.7% respectively, replied to the pre- and post-travel E-mail. Of those suggesting antimalarial chemoprophylaxis in the pretravel scenario, 13.2% proposed inadequate regimens, and at least 3.5% of the post-travel replies were inappropriate. The "Good Samaritan Law" was observed by a significant number of physicians. Both patients and physicians have to be aware of the limitations of E-mail communication. Guidelines protecting physicians against legal and ethical consequences of this new communication technology are urgently needed.

Assessment of Genetics Understanding. Under What Conditions Do Situational Features Have an Impact on Measures?

NASA Astrophysics Data System (ADS)

Schmiemann, Philipp; Nehm, Ross H.; Tornabene, Robyn E.

2017-12-01

Understanding how situational features of assessment tasks impact reasoning is important for many educational pursuits, notably the selection of curricular examples to illustrate phenomena, the design of formative and summative assessment items, and determination of whether instruction has fostered the development of abstract schemas divorced from particular instances. The goal of our study was to employ an experimental research design to quantify the degree to which situational features impact inferences about participants' understanding of Mendelian genetics. Two participant samples from different educational levels and cultural backgrounds (high school, n = 480; university, n = 444; Germany and USA) were used to test for context effects. A multi-matrix test design was employed, and item packets differing in situational features (e.g., plant, animal, human, fictitious) were randomly distributed to participants in the two samples. Rasch analyses of participant scores from both samples produced good item fit, person reliability, and item reliability and indicated that the university sample displayed stronger performance on the items compared to the high school sample. We found, surprisingly, that in both samples, no significant differences in performance occurred among the animal, plant, and human item contexts, or between the fictitious and "real" item contexts. In the university sample, we were also able to test for differences in performance between genders, among ethnic groups, and by prior biology coursework. None of these factors had a meaningful impact upon performance or context effects. Thus some, but not all, types of genetics problem solving or item formats are impacted by situational features.

Global Reach of Direct-to-Consumer Advertising Using Social Media for Illicit Online Drug Sales

PubMed Central

Liang, Bryan A

2013-01-01

Background Illicit or rogue Internet pharmacies are a recognized global public health threat that have been identified as utilizing various forms of online marketing and promotion, including social media. Objective To assess the accessibility of creating illicit no prescription direct-to-consumer advertising (DTCA) online pharmacy social media marketing (eDTCA2.0) and evaluate its potential global reach. Methods We identified the top 4 social media platforms allowing eDTCA2.0. After determining applicable platforms (ie, Facebook, Twitter, Google+, and MySpace), we created a fictitious advertisement advertising no prescription drugs online and posted it to the identified social media platforms. Each advertisement linked to a unique website URL that consisted of a site error page. Employing Web search analytics, we tracked the number of users visiting these sites and their location. We used commercially available Internet tools and services, including website hosting, domain registration, and website analytic services. Results Illicit online pharmacy social media content for Facebook, Twitter, and MySpace remained accessible despite highly questionable and potentially illegal content. Fictitious advertisements promoting illicit sale of drugs generated aggregate unique user traffic of 2795 visits over a 10-month period. Further, traffic to our websites originated from a number of countries, including high-income and middle-income countries, and emerging markets. Conclusions Our results indicate there are few barriers to entry for social media–based illicit online drug marketing. Further, illicit eDTCA2.0 has globalized outside US borders to other countries through unregulated Internet marketing. PMID:23718965

Nodal weighting factor method for ex-core fast neutron fluence evaluation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiang, R. T.

The nodal weighting factor method is developed for evaluating ex-core fast neutron flux in a nuclear reactor by utilizing adjoint neutron flux, a fictitious unit detector cross section for neutron energy above 1 or 0.1 MeV, the unit fission source, and relative assembly nodal powers. The method determines each nodal weighting factor for ex-core neutron fast flux evaluation by solving the steady-state adjoint neutron transport equation with a fictitious unit detector cross section for neutron energy above 1 or 0.1 MeV as the adjoint source, by integrating the unit fission source with a typical fission spectrum to the solved adjointmore » flux over all energies, all angles and given nodal volume, and by dividing it with the sum of all nodal weighting factors, which is a normalization factor. Then, the fast neutron flux can be obtained by summing the various relative nodal powers times the corresponding nodal weighting factors of the adjacent significantly contributed peripheral assembly nodes and times a proper fast neutron attenuation coefficient over an operating period. A generic set of nodal weighting factors can be used to evaluate neutron fluence at the same location for similar core design and fuel cycles, but the set of nodal weighting factors needs to be re-calibrated for a transition-fuel-cycle. This newly developed nodal weighting factor method should be a useful and simplified tool for evaluating fast neutron fluence at selected locations of interest in ex-core components of contemporary nuclear power reactors. (authors)« less

Hydration shell parameters of aqueous alcohols: THz excess absorption and packing density.

PubMed

Matvejev, V; Zizi, M; Stiens, J

2012-12-06

Solvation in water requires minimizing the perturbations in its hydrogen bonded network. Hence solutes distort water molecular motions in a surrounding domain, forming a molecule-specific hydration shell. The properties of those hydration shells impact the structure and function of the solubilized molecules, both at the single molecule and at higher order levels. The size of the hydration shell and the picoseconds time-scale water dynamics retardation are revealed by terahertz (THz) absorption coefficient measurements. Room-temperature absorption coefficient at f = 0.28 [THz] is measured as a function of alcohol concentration in aqueous methanol, ethanol, 1,2-propanol, and 1-butanol solutions. Highly diluted alcohol measurements and enhanced overall measurement accuracy are achieved with a THz absorption measurement technique of nL-volume liquids in a capillary tube. In the absorption analysis, bulk and interfacial molecular domains of water and alcohol are considered. THz ideal and excess absorption coefficients are defined in accordance with thermodynamics mixing formulations. The parameter extraction method is developed based on a THz excess absorption model and hydrated solute molecule packing density representation. First, the hydration shell size is deduced from the hydrated solute packing densities at two specific THz excess absorption nonlinearity points: at infinite alcohol dilution (IAD) and at the THz excess absorption extremum (EAE). Consequently, interfacial water and alcohol molecular domain absorptions are deduced from the THz excess absorption model. The hydration shell sizes obtained at the THz excess absorption extremum are in excellent agreement with other reports. The hydration shells of methanol, ethanol, 1- and 2-propanol consist of 13.97, 22.94, 22.99, and 31.10 water molecules, respectively. The hydration shell water absorption is on average 0.774 ± 0.028 times the bulk water absorption. The hydration shell parameters might shed light on hydration dynamics of biomolecules.

Analysis of virtual passive controllers for flexible space structures

NASA Technical Reports Server (NTRS)

Williams, Trevor W.

1992-01-01

The dynamics of flexible spacecraft are not usually well known before launch. This makes it important to develop controllers for such systems that can never be destabilized by perturbations in the structural model. Virtual passive controllers, or active vibration absorbers, possess this guaranteed stability property; they mimic a fictitious flexible structure attached to the true physical one. This report analyzes the properties of such controllers, and shows that disturbance absorption behavior can be naturally described in terms of a set of virtual zeros that they introduce into the closed-loop dynamics of the system. Based on this analysis, techniques are then derived for selecting the active vibration absorber internal parameters, i.e., the gain matrices of such controllers, so as to achieve specified control objectives. Finally, the effects on closed-loop stability of small delays in the feedback loop are investigated. Such delays would typically be introduced by a digital implementation of an active vibration absorber. It is shown that these delays only affect the real parts of the eigenvalues of a lightly-damped structure. Furthermore, it is only the high-frequency modes that are destabilized by delays; low-frequency modes are actually made more heavily damped. Eigenvalue perturbation methods are used to obtain accurate predictions of the critical delay at which a given system will become unstable; these methods also determine which mode is critical.

Fracture Properties of Polystyrene Aggregate Concrete after Exposure to High Temperatures

PubMed Central

Tang, Waiching; Cui, Hongzhi; Tahmasbi, Soheil

2016-01-01

This paper mainly reports an experimental investigation on the residual mechanical and fracture properties of polystyrene aggregate concrete (PAC) after exposure to high temperatures up to 800 degrees Celsius. The fracture properties namely, the critical stress intensity factor (KICS), the critical crack tip opening displacement (CTODC) for the Two-Parameter Model, and the fracture energy (GF) for the Fictitious Crack Model were examined using the three-point bending notched beam test, according to the RILEM recommendations. The effects of polystyrene aggregate (PA) content and temperature levels on the fracture and mechanical properties of concrete were investigated. The results showed that the mechanical properties of PAC significantly decreased with increase in temperature level and the extent of which depended on the PA content in the mixture. However, at a very high temperature of 800 °C, all samples showed 80 percent reduction in modulus of elasticity compared to room temperature, regardless of the level of PA content. Fracture properties of control concrete (C) and PAC were influenced by temperature in a similar manner. Increasing temperature from 25 °C to 500 °C caused almost 50% reduction of the fracture energy for all samples while 30% increase in fracture energy was occurred when the temperature increased from 500 °C to 800 °C. It was found that adding more PA content in the mixture lead to a more ductile behaviour of concrete. PMID:28773752

On a fast calculation of structure factors at a subatomic resolution.

PubMed

Afonine, P V; Urzhumtsev, A

2004-01-01

In the last decade, the progress of protein crystallography allowed several protein structures to be solved at a resolution higher than 0.9 A. Such studies provide researchers with important new information reflecting very fine structural details. The signal from these details is very weak with respect to that corresponding to the whole structure. Its analysis requires high-quality data, which previously were available only for crystals of small molecules, and a high accuracy of calculations. The calculation of structure factors using direct formulae, traditional for 'small-molecule' crystallography, allows a relatively simple accuracy control. For macromolecular crystals, diffraction data sets at a subatomic resolution contain hundreds of thousands of reflections, and the number of parameters used to describe the corresponding models may reach the same order. Therefore, the direct way of calculating structure factors becomes very time expensive when applied to large molecules. These problems of high accuracy and computational efficiency require a re-examination of computer tools and algorithms. The calculation of model structure factors through an intermediate generation of an electron density [Sayre (1951). Acta Cryst. 4, 362-367; Ten Eyck (1977). Acta Cryst. A33, 486-492] may be much more computationally efficient, but contains some parameters (grid step, 'effective' atom radii etc.) whose influence on the accuracy of the calculation is not straightforward. At the same time, the choice of parameters within safety margins that largely ensure a sufficient accuracy may result in a significant loss of the CPU time, making it close to the time for the direct-formulae calculations. The impact of the different parameters on the computer efficiency of structure-factor calculation is studied. It is shown that an appropriate choice of these parameters allows the structure factors to be obtained with a high accuracy and in a significantly shorter time than that required when using the direct formulae. Practical algorithms for the optimal choice of the parameters are suggested.

A Biochemical Oscillator Using Excitatory Molecules for Nanonetworks.

PubMed

Shitiri, Ethungshan; Cho, Ho-Shin

2016-10-01

For nanonetworks to be able to achieve large-scale functionality, such as to respond collectively to a trigger, synchrony between nanomachines is essential. However, to facilitate synchronization, some sort of physical clocking mechanism is required, such as the oscillators driven by auto-inhibitory molecules or by auto-inducing molecules. In this study, taking inspiration from the widely studied biological oscillatory phenomena called Calcium (Ca 2+ ) oscillations, we undertake a different approach to design an oscillator. Our model employs three different types of excitatory molecules that work in tandem to generate oscillatory phenomenon in the concentration levels of the molecule of interest. The main objective of the study is to model a high frequency biochemical oscillator, along with the investigations to identify and determine the parameters that affect the period of the oscillations. The investigations entail and highlight the design of the reserve unit, a reservoir of the molecule of interest, as a key factor in realizing a high frequency stable biochemical oscillator.

A low-temperature polymorph of m-quinquephenyl.

PubMed

Gomes, Ligia R; Howie, R Alan; Low, John Nicolson; Rodrigues, Ana S M C; Santos, Luís M N B F

2012-12-01

A low-temperature polymorph of 1,1':3',1'':3'',1''':3''',1''''-quinquephenyl (m-quinquephenyl), C(30)H(22), crystallizes in the space group P2(1)/c with two molecules in the asymmetric unit. The crystal is a three-component nonmerohedral twin. A previously reported room-temperature polymorph [Rabideau, Sygula, Dhar & Fronczek (1993). Chem. Commun. pp. 1795-1797] also crystallizes with two molecules in the asymmetric unit in the space group P-1. The unit-cell volume for the low-temperature polymorph is 4120.5 (4) Å(3), almost twice that of the room-temperature polymorph which is 2102.3 (6) Å(3). The molecules in both structures adopt a U-shaped conformation with similar geometric parameters. The structural packing is similar in both compounds, with the molecules lying in layers which stack perpendicular to the longest unit-cell axis. The molecules pack alternately in the layers and in the stacked columns. In both polymorphs, the only interactions between the molecules which can stabilize the packing are very weak C-H...π interactions.

Impact of higher order diagrams on phase equilibrium calculations for small molecules using lattice cluster theory

NASA Astrophysics Data System (ADS)

Zimmermann, Patrick; Walowski, Christoph; Enders, Sabine

2018-03-01

The Lattice Cluster Theory (LCT) provides a powerful tool to predict thermodynamic properties of large molecules (e.g., polymers) of different molecular architectures. When the pure-component parameters of a certain compound have been derived by adjustment to experimental data and the number of atoms is held constant within the molecule so that only the architecture is changed, the LCT is capable of predicting the properties of isomers without further parameter adjustment just based on the incorporation of molecular architecture. Trying to predict the thermodynamic properties of smaller molecules, one might face some challenges, which are addressed in this contribution. After factoring out the mean field term of the partition function, the LCT poses an expression that involves corrections to the mean field depending on molecular architecture, resulting in the free energy formally being expressed as a double series expansion in lattice coordination number z and interaction energy ɛ ˜ . In the process of deriving all contributing sub-structures within a molecule, some parts have been neglected to this point due to the double series expansion being truncated after the order ɛ˜ 2z-2. We consider the neglected parts that are of the order z-3 and reformulate the expression for the free energy within the LCT to achieve a higher predictive capability of the theory when it comes to small isomers and compressible systems. The modified version was successfully applied for phase equilibrium calculations of binary mixtures composed of linear and branched alkanes.

Zwitterionization of glycine in water environment: Stabilization mechanism and NMR spectral signatures

NASA Astrophysics Data System (ADS)

Valverde, Danillo; da Costa Ludwig, Zélia Maria; da Costa, Célia Regina; Ludwig, Valdemir; Georg, Herbert C.

2018-01-01

At physiological conditions, myriads of biomolecules (e.g., amino acids, peptides, and proteins) exist predominantly in the zwitterionic structural form and their biological functions will result in these conditions. However these geometrical structures are inaccessible energetically in the gas phase, and at this point, stabilization of amino-acids in physiological conditions is still under debate. In this paper, the electronic properties of a glycine molecule in the liquid environment were studied by performing a relaxation of the glycine geometry in liquid water using the free energy gradient method combined with a sequential quantum mechanics/molecular mechanics approach. A series of Monte Carlo Metropolis simulations of the glycine molecule embedded in liquid water, followed by only a quantum mechanical calculation in each of them were carried out. Both the local and global liquid environments were emphasized to obtain nuclear magnetic resonance (NMR) parameters for the glycine molecule in liquid water. The results of the equilibrium structure in solution and the systematic study of the hydrogen bonds were used to discard the direct proton transfer from the carboxyl group to the ammonium group of the glycine molecule in water solution. The calculations of the Density Functional Theory (DFT) were performed to study the polarization of the solvent in the parameters of nuclear magnetic resonance of the glycine molecule in liquid water. DFT calculations predicted isotropic chemical changes on the H, C, N, and O atoms of glycine in liquid water solution which agree with the available experimental data.

Statistical Mechanical Theory of Coupled Slow Dynamics in Glassy Polymer-Molecule Mixtures

NASA Astrophysics Data System (ADS)

Zhang, Rui; Schweizer, Kenneth

The microscopic Elastically Collective Nonlinear Langevin Equation theory of activated relaxation in one-component supercooled liquids and glasses is generalized to polymer-molecule mixtures. The key idea is to account for dynamic coupling between molecule and polymer segment motion. For describing the molecule hopping event, a temporal casuality condition is formulated to self-consistently determine a dimensionless degree of matrix distortion relative to the molecule jump distance based on the concept of coupled dynamic free energies. Implementation for real materials employs an established Kuhn sphere model of the polymer liquid and a quantitative mapping to a hard particle reference system guided by the experimental equation-of-state. The theory makes predictions for the mixture dynamic shear modulus, activated relaxation time and diffusivity of both species, and mixture glass transition temperature as a function of molecule-Kuhn segment size ratio and attraction strength, composition and temperature. Model calculations illustrate the dynamical behavior in three distinct mixture regimes (fully miscible, bridging, clustering) controlled by the molecule-polymer interaction or chi-parameter. Applications to specific experimental systems will be discussed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Öner, Nazmiye, E-mail: fizikcinaz@gmail.com; Tamer, Ömer, E-mail: omertamer@sakarya.edu.tr; Avci, Davut, E-mail: davci@sakarya.edu.tr

Quantum mechanical calculations on cis-2, 6-bis (2-chlorophenyl)-3, 3-dimethylpiperidin-4-one were performed by using HSEH1PBE level of density functional theory (DFT) with 6-311++G (d, p) basis set. Geometric parameters of the title molecule in the ground state were found to be in good agreement with experimental data. The frontier molecular orbitals (HOMO and LUMO) were simulated by the same level. Small energy gap between the HOMO and LUMO is an indicator molecular charge transfer within the title molecule. The electronegativity, chemical hardness and softness were also calculated by using HOMO and LUMO energies. Dipole moment, polarizability and hyperpolarizability parameters were also calculatedmore » by using HSEH1PBE level. All calculations were carried out with the GAUSSIAN 09 package program.« less

Spectroscopic database

NASA Technical Reports Server (NTRS)

Husson, N.; Barbe, A.; Brown, L. R.; Carli, B.; Goldman, A.; Pickett, H. M.; Roche, A. E.; Rothman, L. S.; Smith, M. A. H.

1985-01-01

Several aspects of quantitative atmospheric spectroscopy are considered, using a classification of the molecules according to the gas amounts in the stratosphere and upper troposphere, and reviews of quantitative atmospheric high-resolution spectroscopic measurements and field measurements systems are given. Laboratory spectroscopy and spectral analysis and prediction are presented with a summary of current laboratory spectroscopy capabilities. Spectroscopic data requirements for accurate derivation of atmospheric composition are discussed, where examples are given for space-based remote sensing experiments of the atmosphere: the ATMOS (Atmospheric Trace Molecule) and UARS (Upper Atmosphere Research Satellite) experiment. A review of the basic parameters involved in the data compilations; a summary of information on line parameter compilations already in existence; and a summary of current laboratory spectroscopy studies are used to assess the data base.

A new fitting law of rovibrationally inelastic rate constants for rapidly rotating molecules

NASA Astrophysics Data System (ADS)

Strekalov, M. L.

2005-04-01

Semiclassical scattering of a particle from a three-dimensional ellipsoid with internal structure is used to model vibration-rotation-translation (VRT) collisional transfer between atoms and diatomic molecules. The result is a very simple analytical expression containing two variable parameters that have a clear physical meaning. Predictions of the model for the Li 2 + Ne system are in reasonably good agreement with experimental results.

Detecting level crossings without solving the Hamiltonian. II. Applications to atoms and molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhattacharya, M.; Raman, C.

2007-03-15

A number of interesting phenomena occur at points where the energy levels of an atom or a molecule (anti) cross as a function of some parameter such as an external field. In a previous paper [M. Bhattacharya and C. Raman, Phys. Rev. Lett. 97, 140405 (2006)] we have outlined powerful mathematical techniques useful in identifying the parameter values at which such (avoided) crossings occur. In the accompanying article [M. Bhattacharya and C. Raman, Phys. Rev A 75, 033405 (2007)] we have developed the mathematical basis of these algebraic techniques in some detail. In this article we apply these level-crossing methodsmore » to the spectra of atoms and molecules in a magnetic field. In the case of atoms the final result is the derivation of a class of invariants of the Breit-Rabi Hamiltonian of magnetic resonance. These invariants completely describe the parametric symmetries of the Hamiltonian. In the case of molecules we present an indicator which can tell when the Born-Oppenheimer approximation breaks down without using any information about the molecular potentials other than the fact that they are real. We frame our discussion in the context of Feshbach resonances in the atom-pair {sup 23}Na-{sup 85}Rb which are of current interest.« less

A combined numerical and experimental framework for determining permeability properties of the arterial media.

PubMed

Comerford, A; Chooi, K Y; Nowak, M; Weinberg, P D; Sherwin, S J

2015-04-01

The medial layer of the arterial wall may play an important role in the regulation of water and solute transport across the wall. In particular, a high medial resistance to transport could cause accumulation of lipid-carrying molecules in the inner wall. In this study, the water transport properties of medial tissue were characterised in a numerical model, utilising experimentally obtained data for the medial microstructure and the relative permeability of different constituents. For the model, a new solver for flow in porous materials, based on a high-order splitting scheme, was implemented in the spectral/hp element library nektar++ and validated. The data were obtained by immersing excised aortic bifurcations in a solution of fluorescent protein tracer and subsequently imaging them with a confocal microscope. Cuboidal regions of interest were selected in which the microstructure and relative permeability of different structures were transformed to a computational mesh. Impermeable objects were treated fictitiously in the numerical scheme. On this cube, a pressure drop was applied in the three coordinate directions and the principal components of the permeability tensor were determined. The reconstructed images demonstrated the arrangement of elastic lamellae and interspersed smooth muscle cells in rat aortic media; the distribution and alignment of the smooth muscle cells varied spatially within the extracellular matrix. The numerical simulations highlighted that the heterogeneity of the medial structure is important in determining local water transport properties of the tissue, resulting in regional and directional variation of the permeability tensor. A major factor in this variation is the alignment and density of smooth muscle cells in the media, particularly adjacent to the adventitial layer.

The Navier-Stokes Stress Principle for Viscous Fluids

NASA Technical Reports Server (NTRS)

Mohr, Ernst

1942-01-01

The Navier-Stokes stress principle is checked in the light of Maxwell's mechanism of friction and in connection herewith the possibility of another theorem is indicated. The Navier-Stokes stress principle is in general predicated upon the conception of the plastic body. Hence the process is a purely phenomenological one, which Newton himself followed with his special theorem for one-dimensional flows. It remained for Maxwell to discover the physical mechanism by which the shear inflow direction is developed: According to it, this shear is only 'fictitious' as it merely represents the substitute for a certain transport on macroscopic motion quantity, as conditioned by Brown's moiecular motion and the diffusion, respectively. It is clear that this mechanism is not bound to the special case of the one-dimensioilal flows, but holds for any flow as expression of the diffusion, by which a fluid differs sharply from a plastic body. If it is remembered, on the other hand, that the cause of the stresses on the plastic body lies in a certain cohesion of the molecules, it appears by no means self evident that this difference in the mechanism of friction between fluid and plastic body should not prevail in the stress principle as well, although it certainly is desirable in any case, at least subsequently, to establish the general theorem in the sense of Maxwell. Actually, a different theorem is suggested which, in contrast to that by Navier-Stokes, has the form of an unsymmetrical matrix. Without anticipating a final decision several reasons are advanced by way of a special flow which seem to affirm this new theorem. To make it clear that the problem involved here still awaits its final solution, is the real purpose behind the present article.

Structural Information from Single-molecule FRET Experiments Using the Fast Nano-positioning System

PubMed Central

Röcker, Carlheinz; Nagy, Julia; Michaelis, Jens

2017-01-01

Single-molecule Förster Resonance Energy Transfer (smFRET) can be used to obtain structural information on biomolecular complexes in real-time. Thereby, multiple smFRET measurements are used to localize an unknown dye position inside a protein complex by means of trilateration. In order to obtain quantitative information, the Nano-Positioning System (NPS) uses probabilistic data analysis to combine structural information from X-ray crystallography with single-molecule fluorescence data to calculate not only the most probable position but the complete three-dimensional probability distribution, termed posterior, which indicates the experimental uncertainty. The concept was generalized for the analysis of smFRET networks containing numerous dye molecules. The latest version of NPS, Fast-NPS, features a new algorithm using Bayesian parameter estimation based on Markov Chain Monte Carlo sampling and parallel tempering that allows for the analysis of large smFRET networks in a comparably short time. Moreover, Fast-NPS allows the calculation of the posterior by choosing one of five different models for each dye, that account for the different spatial and orientational behavior exhibited by the dye molecules due to their local environment. Here we present a detailed protocol for obtaining smFRET data and applying the Fast-NPS. We provide detailed instructions for the acquisition of the three input parameters of Fast-NPS: the smFRET values, as well as the quantum yield and anisotropy of the dye molecules. Recently, the NPS has been used to elucidate the architecture of an archaeal open promotor complex. This data is used to demonstrate the influence of the five different dye models on the posterior distribution. PMID:28287526

Structural Information from Single-molecule FRET Experiments Using the Fast Nano-positioning System.

PubMed

Dörfler, Thilo; Eilert, Tobias; Röcker, Carlheinz; Nagy, Julia; Michaelis, Jens

2017-02-09

Single-molecule Förster Resonance Energy Transfer (smFRET) can be used to obtain structural information on biomolecular complexes in real-time. Thereby, multiple smFRET measurements are used to localize an unknown dye position inside a protein complex by means of trilateration. In order to obtain quantitative information, the Nano-Positioning System (NPS) uses probabilistic data analysis to combine structural information from X-ray crystallography with single-molecule fluorescence data to calculate not only the most probable position but the complete three-dimensional probability distribution, termed posterior, which indicates the experimental uncertainty. The concept was generalized for the analysis of smFRET networks containing numerous dye molecules. The latest version of NPS, Fast-NPS, features a new algorithm using Bayesian parameter estimation based on Markov Chain Monte Carlo sampling and parallel tempering that allows for the analysis of large smFRET networks in a comparably short time. Moreover, Fast-NPS allows the calculation of the posterior by choosing one of five different models for each dye, that account for the different spatial and orientational behavior exhibited by the dye molecules due to their local environment. Here we present a detailed protocol for obtaining smFRET data and applying the Fast-NPS. We provide detailed instructions for the acquisition of the three input parameters of Fast-NPS: the smFRET values, as well as the quantum yield and anisotropy of the dye molecules. Recently, the NPS has been used to elucidate the architecture of an archaeal open promotor complex. This data is used to demonstrate the influence of the five different dye models on the posterior distribution.

Enantioresolution in electrokinetic chromatography-complete filling technique using sulfated gamma-cyclodextrin. Software-free topological anticipation.

PubMed

Escuder-Gilabert, Laura; Martín-Biosca, Yolanda; Medina-Hernández, María José; Sagrado, Salvador

2016-10-07

Few papers have tried to predict the resolution ability of chiral selectors in capillary electrophoresis for the separation of the enantiomers of chiral compounds. In a previous work, we have used molecular information available on-line to establish enantioresolution levels of basic compounds using highly sulfated β-CD (HS-β-CD) as chiral selector in electrokinetic chromatography-complete filling technique (EKC-CFT). The present study is a continuation of this previous work, introducing some novelties. In this work, the ability of sulfated γ-cyclodextrin (S-γ-CD) as chiral selector in EKC-CFT is modelled for the first time. Thirty-three structurally unrelated cationic and neutral compounds (drugs and pesticides) are studied. Categorical enantioresolution levels (RsC, 0 or 1) are assigned from experimental enantioresolution values obtained at different S-γ-CD concentrations. Novel topological parameters connected to the chiral carbon (C * -parameters) are introduced. Four C * -parameters and a topological parameter of the whole molecule (aromatic atom count) are the most important variables according to a discriminant partial least squares-variable selection process. It suggests the preponderance of the topology adjacent to the chiral carbon to anticipate the RsC levels. A software-free anticipation protocol for new molecules is proposed. Over the current set of molecules evaluated, 100% of correct anticipations (resolved and non-resolved compounds) are obtained, while anticipation of some compounds remains undetermined. A criterion is introduced to alert on compounds which should not be anticipated. Copyright © 2016 Elsevier B.V. All rights reserved.

Exact solutions for kinetic models of macromolecular dynamics.

PubMed

Chemla, Yann R; Moffitt, Jeffrey R; Bustamante, Carlos

2008-05-15

Dynamic biological processes such as enzyme catalysis, molecular motor translocation, and protein and nucleic acid conformational dynamics are inherently stochastic processes. However, when such processes are studied on a nonsynchronized ensemble, the inherent fluctuations are lost, and only the average rate of the process can be measured. With the recent development of methods of single-molecule manipulation and detection, it is now possible to follow the progress of an individual molecule, measuring not just the average rate but the fluctuations in this rate as well. These fluctuations can provide a great deal of detail about the underlying kinetic cycle that governs the dynamical behavior of the system. However, extracting this information from experiments requires the ability to calculate the general properties of arbitrarily complex theoretical kinetic schemes. We present here a general technique that determines the exact analytical solution for the mean velocity and for measures of the fluctuations. We adopt a formalism based on the master equation and show how the probability density for the position of a molecular motor at a given time can be solved exactly in Fourier-Laplace space. With this analytic solution, we can then calculate the mean velocity and fluctuation-related parameters, such as the randomness parameter (a dimensionless ratio of the diffusion constant and the velocity) and the dwell time distributions, which fully characterize the fluctuations of the system, both commonly used kinetic parameters in single-molecule measurements. Furthermore, we show that this formalism allows calculation of these parameters for a much wider class of general kinetic models than demonstrated with previous methods.

Trihydroxybenzoic acid glucoside as a global skin color modulator and photo-protectant

PubMed Central

Chajra, Hanane; Redziniak, Gérard; Auriol, Daniel; Schweikert, Kuno; Lefevre, Fabrice

2015-01-01

Background 3,4,5-Trihydroxybenzoic acid glucoside (THBG), a molecule produced by an original biocatalysis-based technology, was assessed in this study with respect to its skin photoprotective capacity and its skin color control property on Asian-type skin at a clinical level and on skin explant culture models. Methods The double-blinded clinical study was done in comparison to a vehicle by the determination of objective color parameters thanks to recognized quantitative and qualitative analysis tools, including Chroma-Meter, VISIA-CR™, and SIAscope™. Determination of L* (brightness), a* and b* (green–red and blue–yellow chromaticity coordinates), individual typology angle, and C* (chroma) and h* (hue angle) parameters using a Chroma-Meter demonstrated that THBG is able to modify skin color while quantification of ultraviolet (UV) spots by VISIA-CR™ confirmed its photoprotective effect. The mechanism of action of THBG molecule was determined using explant skin culture model coupled to histological analysis (epidermis melanin content staining). Results We have demonstrated that THBG was able to modulate significantly several critical parameters involved in skin color control such as L* (brightness), a* (redness), individual typology angle (pigmentation), and hue angle (yellowness in this study), whereas no modification occurs on b* and C* parameters. We have demonstrated using histological staining that THBG decrease epidermis melanin content under unirradiated and irradiated condition. We also confirmed that THBG molecule is not a sunscreen agent. Conclusion This study demonstrated that THBG controls skin tone via the inhibition of melanin synthesis as well as the modulation of skin brightness, yellowness, and redness. PMID:26648748

Development of non-bonded interaction parameters between graphene and water using particle swarm optimization.

PubMed

Bejagam, Karteek K; Singh, Samrendra; Deshmukh, Sanket A

2018-05-05

New Lennard-Jones parameters have been developed to describe the interactions between atomistic model of graphene, represented by REBO potential, and five commonly used all-atom water models, namely SPC, SPC/E, SPC/Fw, SPC/Fd, and TIP3P/Fs by employing particle swarm optimization (PSO) method. These new parameters were optimized to reproduce the macroscopic contact angle of water on a graphene sheet. The calculated line tension was in the order of 10 -11 J/m for the droplets of all water models. Our molecular dynamics simulations indicate the preferential orientation of water molecules near graphene-water interface with one OH bond pointing toward the graphene surface. Detailed analysis of simulation trajectories reveals the presence of water molecules with ≤∼1, ∼2, and ∼4 hydrogen bonds at the surface of air-water interface, graphene-water interface, and bulk region of the water droplet, respectively. Presence of water molecules with ≤∼1 and ∼2 hydrogen bonds suggest the existence of water clusters of different sizes at these interfaces. The trends observed in the libration, bending, and stretching bands of the vibrational spectra are closely associated with these structural features of water. The inhomogeneity in hydrogen bond network of water at the air-water and graphene-water interface is manifested by broadening of the peaks in the libration band for water present at these interfaces. The stretching band for the molecules in water droplet shows a blue shift as compared to the pure bulk water, which conjecture the presence of weaker hydrogen bond network in a droplet. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Tuned range separated hybrid functionals for solvated low bandgap oligomers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Queiroz, Thiago B. de, E-mail: thiago.branquinho-de-queiroz@uni-bayreuth.de; Kümmel, Stephan

2015-07-21

The description of charge transfer excitations has long been a challenge to time dependent density functional theory. The recently developed concept of “optimally tuned range separated hybrid (OT-RSH) functionals” has proven to describe charge transfer excitations accurately in many cases. However, describing solvated or embedded systems is yet a challenge. This challenge is not only computational but also conceptual, because the tuning requires identifying a specific orbital, typically the highest occupied one of the molecule under study. For solvated molecules, this orbital may be delocalized over the solvent. We here demonstrate that one way of overcoming this problem is tomore » use a locally projected self-consistent field diagonalization on an absolutely localized molecular orbital expansion. We employ this approach to determine ionization energies and the optical gap of solvated oligothiophenes, i.e., paradigm low gap systems that are of relevance in organic electronics. Dioxane solvent molecules are explicitly represented in our calculations, and the ambiguities of straightforward parameter tuning in solution are elucidated. We show that a consistent estimate of the optimal range separated parameter (ω) at the limit of bulk solvation can be obtained by gradually extending the solvated system. In particular, ω is influenced by the solvent beyond the first coordination sphere. For determining ionization energies, a considerable number of solvent molecules on the first solvation shell must be taken into account. We demonstrate that accurately calculating optical gaps of solvated systems using OT-RSH can be done in three steps: (i) including the chemical environment when determining the range-separation parameter, (ii) taking into account the screening due to the solvent, and (iii) using realistic molecular geometries.« less

Wigner tomography of multispin quantum states

NASA Astrophysics Data System (ADS)

Leiner, David; Zeier, Robert; Glaser, Steffen J.

2017-12-01

We study the tomography of multispin quantum states in the context of finite-dimensional Wigner representations. An arbitrary operator can be completely characterized and visualized using multiple shapes assembled from linear combinations of spherical harmonics [A. Garon, R. Zeier, and S. J. Glaser, Phys. Rev. A 91, 042122 (2015), 10.1103/PhysRevA.91.042122]. We develop a general methodology to experimentally recover these shapes by measuring expectation values of rotated axial spherical tensor operators and provide an interpretation in terms of fictitious multipole potentials. Our approach is experimentally demonstrated for quantum systems consisting of up to three spins using nuclear magnetic resonance spectroscopy.

Optimization of multicast optical networks with genetic algorithm

NASA Astrophysics Data System (ADS)

Lv, Bo; Mao, Xiangqiao; Zhang, Feng; Qin, Xi; Lu, Dan; Chen, Ming; Chen, Yong; Cao, Jihong; Jian, Shuisheng

2007-11-01

In this letter, aiming to obtain the best multicast performance of optical network in which the video conference information is carried by specified wavelength, we extend the solutions of matrix games with the network coding theory and devise a new method to solve the complex problems of multicast network switching. In addition, an experimental optical network has been testified with best switching strategies by employing the novel numerical solution designed with an effective way of genetic algorithm. The result shows that optimal solutions with genetic algorithm are accordance with the ones with the traditional fictitious play method.