Sample records for molecules matrix evaluation

  1. Vibrational excitation and dissociative attachment of a triatomic molecule: CO/sub 2/ in the collinear approximation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, C.F.; Light, J.C.

    1986-02-01

    The effective R-matrix model and the R-matrix propagative method applied earlier to elec- tron--diatomic-molecule scattering are extended to treat dissociative attachment of collinear triatomic molecules. To describe the vibrational excitation and dissociative attachment of CO/sub 2/ in the 4-eV region, the nuclear dynamics is solved on a Wall-Porter potential-energy surface. A hybrid approach is developed in which the L/sup 2/ and R-matrix propagation methods are combined to evaluate the global R matrix. Our calculations show that it is easier to excite the symmetric mode vibrations than the asymmetric mode vibrations. Our results also show that the observed structures in themore » energy dependence of the dissociative attachment cross sections are due to the vibrational states of the negative ion (CO/sub 2/ /sup -/) and not to the vibrational states of the CO fragment.« less

  2. Relationship between diffusivity of water molecules inside hydrating tablets and their drug release behavior elucidated by magnetic resonance imaging.

    PubMed

    Kikuchi, Shingo; Onuki, Yoshinori; Kuribayashi, Hideto; Takayama, Kozo

    2012-01-01

    We reported previously that sustained release matrix tablets showed zero-order drug release without being affected by pH change. To understand drug release mechanisms more fully, we monitored the swelling and erosion of hydrating tablets using magnetic resonance imaging (MRI). Three different types of tablets comprised of polyion complex-forming materials and a hydroxypropyl methylcellulose (HPMC) were used. Proton density- and diffusion-weighted images of the hydrating tablets were acquired at intervals. Furthermore, apparent self-diffusion coefficient maps were generated from diffusion-weighted imaging to evaluate the state of hydrating tablets. Our findings indicated that water penetration into polyion complex tablets was faster than that into HPMC matrix tablets. In polyion complex tablets, water molecules were dispersed homogeneously and their diffusivity was relatively high, whereas in HPMC matrix tablets, water molecule movement was tightly restricted within the gel. An optimal tablet formulation determined in a previous study had water molecule penetration and diffusivity properties that appeared intermediate to those of polyion complex and HPMC matrix tablets; water molecules were capable of penetrating throughout the tablets and relatively high diffusivity was similar to that in the polyion complex tablet, whereas like the HPMC matrix tablet, it was well swollen. This study succeeded in characterizing the tablet hydration process. MRI provides profound insight into the state of water molecules in hydrating tablets; thus, it is a useful tool for understanding drug release mechanisms at a molecular level.

  3. CD44 in cancer progression: adhesion, migration and growth regulation.

    PubMed

    Marhaba, R; Zöller, M

    2004-03-01

    It is well established that the large array of functions that a tumour cell has to fulfil to settle as a metastasis in a distant organ requires cooperative activities between the tumour and the surrounding tissue and that several classes of molecules are involved, such as cell-cell and cell-matrix adhesion molecules and matrix degrading enzymes, to name only a few. Furthermore, metastasis formation requires concerted activities between tumour cells and surrounding cells as well as matrix elements and possibly concerted activities between individual molecules of the tumour cell itself. Adhesion molecules have originally been thought to be essential for the formation of multicellular organisms and to tether cells to the extracellular matrix or to neighbouring cells. CD44 transmembrane glycoproteins belong to the families of adhesion molecules and have originally been described to mediate lymphocyte homing to peripheral lymphoid tissues. It was soon recognized that the molecules, under selective conditions, may suffice to initiate metastatic spread of tumour cells. The question remained as to how a single adhesion molecule can fulfil that task. This review outlines that adhesion is by no means a passive task. Rather, ligand binding, as exemplified for CD44 and other similar adhesion molecules, initiates a cascade of events that can be started by adherence to the extracellular matrix. This leads to activation of the molecule itself, binding to additional ligands, such as growth factors and matrix degrading enzymes, complex formation with additional transmembrane molecules and association with cytoskeletal elements and signal transducing molecules. Thus, through the interplay of CD44 with its ligands and associating molecules CD44 modulates adhesiveness, motility, matrix degradation, proliferation and cell survival, features that together may well allow a tumour cell to proceed through all steps of the metastatic cascade.

  4. On the role of hydrogel structure and degradation in controlling the transport of cell-secreted matrix molecules for engineered cartilage.

    PubMed

    Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J; Vernerey, Franck J

    2013-03-01

    Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one's quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. On the role of hydrogel structure and degradation in controlling the transport of cell-secreted matrix molecules for engineered cartilage

    PubMed Central

    Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J.; Vernerey, Franck J.

    2012-01-01

    Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one’s quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. PMID:23276516

  6. DBDA as a Novel Matrix for the Analyses of Small Molecules and Quantification of Fatty Acids by Negative Ion MALDI-TOF MS.

    PubMed

    Ling, Ling; Li, Ying; Wang, Sheng; Guo, Liming; Xiao, Chunsheng; Chen, Xuesi; Guo, Xinhua

    2018-04-01

    Matrix interference ions in low mass range has always been a concern when using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to analyze small molecules (<500 Da). In this work, a novel matrix, N1,N4-dibenzylidenebenzene-1,4-diamine (DBDA) was synthesized for the analyses of small molecules by negative ion MALDI-TOF MS. Notably, only neat ions ([M-H] - ) of fatty acids without matrix interference appeared in the mass spectra and the limit of detection (LOD) reached 0.3 fmol. DBDA also has great performance towards other small molecules such as amino acids, peptides, and nucleotide. Furthermore, with this novel matrix, the free fatty acids in serum were quantitatively analyzed based on the correlation curves with correlation coefficient of 0.99. In addition, UV-Vis experiments and molecular orbital calculations were performed to explore mechanism about DBDA used as matrix in the negative ion mode. The present work shows that the DBDA matrix is a highly sensitive matrix with few interference ions for analysis of small molecules. Meanwhile, DBDA is able to precisely quantify the fatty acids in real biological samples. Graphical Abstract ᅟ.

  7. Classification and identification of molecules through factor analysis method based on terahertz spectroscopy

    NASA Astrophysics Data System (ADS)

    Huang, Jianglou; Liu, Jinsong; Wang, Kejia; Yang, Zhengang; Liu, Xiaming

    2018-06-01

    By means of factor analysis approach, a method of molecule classification is built based on the measured terahertz absorption spectra of the molecules. A data matrix can be obtained by sampling the absorption spectra at different frequency points. The data matrix is then decomposed into the product of two matrices: a weight matrix and a characteristic matrix. By using the K-means clustering to deal with the weight matrix, these molecules can be classified. A group of samples (spirobenzopyran, indole, styrene derivatives and inorganic salts) has been prepared, and measured via a terahertz time-domain spectrometer. These samples are classified with 75% accuracy compared to that directly classified via their molecular formulas.

  8. Fluorescein isothiocyanate-labeled human plasma fibronectin in extracellular matrix remodeling.

    PubMed

    Hoffmann, Celine; Leroy-Dudal, Johanne; Patel, Salima; Gallet, Olivier; Pauthe, Emmanuel

    2008-01-01

    Fluorescein isothiocyanate (FITC) is a well-known probe for labeling biologically relevant proteins. However, the impact of the labeling procedure on protein structure and biological activities remains unclear. In this work, FITC-labeled human plasma fibronectin (Fn) was developed to gain insight into the dynamic relationship between cells and Fn. The similarities and differences concerning the structure and function between Fn-FITC and standard Fn were evaluated using biochemical as well as cellular approaches. By varying the FITC/Fn ratio, we demonstrated that overlabeling (>10 FITC molecules/Fn molecule) induces probe fluorescence quenching, protein aggregation, and cell growth modifications. A correct balance between reliable fluorescence for detection and no significant modifications to structure and biological function compared with standard Fn was obtained with a final ratio of 3 FITC molecules per Fn molecule (Fn-FITC3). Fn-FITC3, similar to standard Fn, is correctly recruited into the cell matrix network. Also, Fn-FITC3 is proposed to be a powerful molecular tool to investigate Fn organization and cellular behavior concomitantly.

  9. DBDA as a Novel Matrix for the Analyses of Small Molecules and Quantification of Fatty Acids by Negative Ion MALDI-TOF MS

    NASA Astrophysics Data System (ADS)

    Ling, Ling; Li, Ying; Wang, Sheng; Guo, Liming; Xiao, Chunsheng; Chen, Xuesi; Guo, Xinhua

    2018-01-01

    Matrix interference ions in low mass range has always been a concern when using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to analyze small molecules (<500 Da). In this work, a novel matrix, N1,N4-dibenzylidenebenzene-1,4-diamine (DBDA) was synthesized for the analyses of small molecules by negative ion MALDI-TOF MS. Notably, only neat ions ([M-H]-) of fatty acids without matrix interference appeared in the mass spectra and the limit of detection (LOD) reached 0.3 fmol. DBDA also has great performance towards other small molecules such as amino acids, peptides, and nucleotide. Furthermore, with this novel matrix, the free fatty acids in serum were quantitatively analyzed based on the correlation curves with correlation coefficient of 0.99. In addition, UV-Vis experiments and molecular orbital calculations were performed to explore mechanism about DBDA used as matrix in the negative ion mode. The present work shows that the DBDA matrix is a highly sensitive matrix with few interference ions for analysis of small molecules. Meanwhile, DBDA is able to precisely quantify the fatty acids in real biological samples. [Figure not available: see fulltext.

  10. Polarizability tensor invariants of H2, HD, and D2

    NASA Astrophysics Data System (ADS)

    Raj, Ankit; Hamaguchi, Hiro-o.; Witek, Henryk A.

    2018-03-01

    We report an exhaustive compilation of wavelength-dependent matrix elements over the mean polarizability (α ¯ ) and polarizability anisotropy (γ) operators for the rovibrational states of the H2, HD, and D2 molecules together with an accompanying computer program for their evaluation. The matrix elements can be readily evaluated using the provided codes for rovibrational states with J = 0-15 and v = 0-4 and for any laser wavelengths in the interval 182.25-1320.6 nm corresponding to popular, commercially available lasers. The presented results substantially extend the scope of the data available in the literature, both in respect of the rovibrational transitions analyzed and the range of covered laser frequencies. The presented detailed tabulation of accurate polarizability tensor invariants is essential for successful realization of our main long-term goal: developing a universal standard for determining absolute Raman cross sections and absolute Raman intensities in experimental Rayleigh and Raman scattering studies of molecules.

  11. Carbon Dots and 9AA as a Binary Matrix for the Detection of Small Molecules by Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Chen, Yongli; Gao, Dan; Bai, Hangrui; Liu, Hongxia; Lin, Shuo; Jiang, Yuyang

    2016-07-01

    Application of matrix-assisted laser-desorption/ionization mass spectrometry (MALDI MS) to analyze small molecules have some limitations, due to the inhomogeneous analyte/matrix co-crystallization and interference of matrix-related peaks in low m/z region. In this work, carbon dots (CDs) were for the first time applied as a binary matrix with 9-Aminoacridine (9AA) in MALDI MS for small molecules analysis. By 9AA/CDs assisted desorption/ionization (D/I) process, a wide range of small molecules, including nucleosides, amino acids, oligosaccharides, peptides, and anticancer drugs with a higher sensitivity were demonstrated in the positive ion mode. A detection limit down to 5 fmol was achieved for cytidine. 9AA/CDs matrix also exhibited excellent reproducibility compared with 9AA matrix. Moreover, by exploring the ionization mechanism of the matrix, the influence factors might be attributed to the four parts: (1) the strong UV absorption of 9AA/CDs due to their π-conjugated network; (2) the carboxyl groups modified on the CDs surface act as protonation sites for proton transfer in positive ion mode; (3) the thin layer crystal of 9AA/CDs could reach a high surface temperature more easily and lower transfer energy for LDI MS; (4) CDs could serve as a matrix additive to suppress 9AA ionization. Furthermore, this matrix was allowed for the analysis of glucose as well as nucleosides in human urine, and the level of cytidine was quantified with a linear range of 0.05-5 mM (R2 > 0.99). Therefore, the 9AA/CDs matrix was proven to be an effective MALDI matrix for the analysis of small molecules with improved sensitivity and reproducibility. This work provides an alternative solution for small molecules detection that can be further used in complex samples analysis.

  12. Physical Selectivity of Molecularly Imprinted polymers evaluated through free volume size distributions derived from Positron Lifetime Spectroscopy

    NASA Astrophysics Data System (ADS)

    Pasang, T.; Ranganathaiah, C.

    2015-06-01

    The technique of imprinting molecules of various sizes in a stable structure of polymer matrix has derived multitudes of applications. Once the template molecule is extracted from the polymer matrix, it leaves behind a cavity which is physically (size and shape) and chemically (functional binding site) compatible to the particular template molecule. Positron Annihilation Lifetime Spectroscopy (PALS) is a well known technique to measure cavity sizes precisely in the nanoscale and is not being used in the field of MIPs effectively. This method is capable of measuring nanopores and hence suitable to understand the physical selectivity of the MIPs better. With this idea in mind, we have prepared molecular imprinted polymers (MIPs) with methacrylicacid (MAA) as monomer and EGDMA as cross linker in different molar ratio for three different size template molecules, viz. 4-Chlorophenol (4CP)(2.29 Å), 2-Nephthol (2NP) (3.36 Å) and Phenolphthalein (PP) (4.47Å). FTIR and the dye chemical reactions are used to confirm the complete extraction of the template molecules from the polymer matrix. The free volume size and its distribution have been derived from the measured o-Ps lifetime spectra. Based on the free volume distribution analysis, the percentage of functional cavities for the three template molecules are determined. Percentage of functional binding cavities for 4-CP molecules has been found out to be 70.2% and the rest are native cavities. Similarly for 2NP it is 81.5% and nearly 100% for PP. Therefore, PALS method proves to be very precise and accurate for determining the physical selectivity of MIPs.

  13. Application of the R-matrix method to photoionization of molecules.

    PubMed

    Tashiro, Motomichi

    2010-04-07

    The R-matrix method has been used for theoretical calculation of electron collision with atoms and molecules for long years. The method was also formulated to treat photoionization process, however, its application has been mostly limited to photoionization of atoms. In this work, we implement the R-matrix method to treat molecular photoionization problem based on the UK R-matrix codes. This method can be used for diatomic as well as polyatomic molecules, with multiconfigurational description for electronic states of both target neutral molecule and product molecular ion. Test calculations were performed for valence electron photoionization of nitrogen (N(2)) as well as nitric oxide (NO) molecules. Calculated photoionization cross sections and asymmetry parameters agree reasonably well with the available experimental results, suggesting usefulness of the method for molecular photoionization.

  14. Methodologies for Studying B. subtilis Biofilms as a Model for Characterizing Small Molecule Biofilm Inhibitors.

    PubMed

    Bucher, Tabitha; Kartvelishvily, Elena; Kolodkin-Gal, Ilana

    2016-10-09

    This work assesses different methodologies to study the impact of small molecule biofilm inhibitors, such as D-amino acids, on the development and resilience of Bacillus subtilis biofilms. First, methods are presented that select for small molecule inhibitors with biofilm-specific targets in order to separate the effect of the small molecule inhibitors on planktonic growth from their effect on biofilm formation. Next, we focus on how inoculation conditions affect the sensitivity of multicellular, floating B. subtilis cultures to small molecule inhibitors. The results suggest that discrepancies in the reported effects of such inhibitors such as D-amino acids are due to inconsistent pre-culture conditions. Furthermore, a recently developed protocol is described for evaluating the contribution of small molecule treatments towards biofilm resistance to antibacterial substances. Lastly, scanning electron microscopy (SEM) techniques are presented to analyze the three-dimensional spatial arrangement of cells and their surrounding extracellular matrix in a B. subtilis biofilm. SEM facilitates insight into the three-dimensional biofilm architecture and the matrix texture. A combination of the methods described here can greatly assist the study of biofilm development in the presence and absence of biofilm inhibitors, and shed light on the mechanism of action of these inhibitors.

  15. The Differential Expression of Adhesion Molecule and Extracellular Matrix Genes in Mesenchymal Stromal Cells after Interaction with Cord Blood Hematopoietic Progenitors.

    PubMed

    Buravkova, L B; Andreeva, E R; Lobanova, M V; Cotnezova, E V; Grigoriev, A I

    2018-03-01

    The dynamics of the expression of genes encoding adhesion molecules, molecules of the connective tissue matrix, and its remodeling enzymes was studied in multipotent mesenchymal stromal cells (MSCs) from human adipose tissue after interaction with cord blood hematopoietic progenitors (HSPCs). An upregulation of ICAM1 and VCAM1, directly proportional to the coculture time (24-72 h), was found. After 72 h of culturing, a downregulation of the genes encoding the majority of matrix molecules (SPP1; COL6A2,7A1; MMP1,3; TIMP1,3; and HAS1) and cell-matrix adhesion molecules (ITGs) was revealed. The detected changes may ensure the realization of the stromal MSC function due to improvement of adhesion and transmigration of HSPCs into the subcellular space.

  16. Dissociative Electron Attachment to Rovibrationally Excited Molecules

    DTIC Science & Technology

    1987-08-31

    obtained in some recent papers.4’ - In Sec. IV of the present L,(0, (00 paper we will obtain some general recursion relations among where these matrix... general five-term From the generating function of Hermite polynomials , recursion relation (32) is obtained which is valid for the matrix elements of...for the generation of the functions for increasing 1. One convenient way to evaluate a Q, function is to write it in terms of Gaussian hypergeometric

  17. Cell adhesion molecules, the extracellular matrix and oral squamous carcinoma.

    PubMed

    Lyons, A J; Jones, J

    2007-08-01

    Carcinomas are characterized by invasion of malignant cells into the underlying connective tissue and migration of malignant cells to form metastases at distant sites. These processes require alterations in cell-cell and cell-extracellular matrix interactions. As cell adhesion molecules play a role in cell-cell and cell-extracellular matrix adhesion and interactions they are involved in the process of tumour invasion and metastases. In epithelial tissues, receptors of the integrin family mediate adhesion to the adjacent matrix whereas cadherins largely mediate intercellular adhesion. These and other cell adhesion molecules such as intercellular adhesion molecule-1, CD44, dystroglycans and selectins, are involved and undergo changes in carcinomas, which provide possible targets for anti-cancer drug treatments. In the extracellular matrix that is associated with tumours, laminin 5, oncofetal fibronectin and tenascin C appear. The degree of expression of some of these moieties indicates prognosis in oral cancer and offer targets for antibody-directed radiotherapy. Metalloproteases which degrade the extracellular matrix are increased in carcinomas, and their activity is necessary for tumour angiogenesis and consequent invasion and metastases. Metalloprotease inhibitors have begun to produce decreases in mortality in clinical trials. This report provides a brief overview of our current understanding of cell adhesion molecules, the extracellular matrix, tumour invasion and metastasis.

  18. Covalent organic framework as efficient desorption/ionization matrix for direct detection of small molecules by laser desorption/ionization mass spectrometry.

    PubMed

    Feng, Dan; Xia, Yan

    2018-07-19

    Covalent organic framework (COF) was explored as a novel matrix with a high desorption/ionization efficiency for direct detection of small molecules by laser desorption/ionization time-of-flight mass spectrometry (LDI-TOF MS). By using COF as an LDI MS matrix, we could detect not only biological micro molecules such as amino acids and fatty acids, but also emerging environmental pollutants like bisphenol S (BPS) and pyrene. With COF as the matrix, higher desorption/ionization efficiency, and less background interference were achieved than the conventional organic matrices. Good salt tolerance (as high as 500 mM NaCl) and repeatability allowed the detection limit of amino acids was 90 fmol. In addition, COF matrix performed well for amino acids analysis in the honey sample. The ionization mechanism was also discussed. These results demonstrate that COF is a powerful matrix for small molecules analysis in real samples by MS. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. In vitro investigation of the effect of matrix molecules on the behavior of colon cancer cells under the effect of geldanamycin derivative.

    PubMed

    Vural, Kamil; Kosova, Funda; Kurt, Feyzan Özdal; Tuğlu, İbrahim

    2017-10-01

    The chaperone-binding drug, 17-allylamino-17-demethoxygeldanamycin, has recently come into clinical use. It is a derivative of geldanamycin, an ansamycin benzoquinone antibiotic with anti-carcinogenic effect. Understanding the effect of this drug on the cancer cells and their niche is important for treatment. We applied 17-allylamino-17-demethoxygeldanamycin to colon cancer cell line (Colo 205) on matrix molecules to investigate the relationship of apoptosis with terminal deoxynucleotidyl transferase dUTP nick end labeling immunocytochemistry and related gene expression. We used laminin and collagen I for matrix molecules and vascular endothelial growth factor for angiogenic structure. We also examined apoptosis-related signaling pathway including mitochondrial proteins, cytochrome c, Bcl-2, caspase-9, Apaf-1 expression using real-time polymerase chain reaction. There was clear effect of 17-allylamino-17-demethoxygeldanamycin that killed more cells on tissue culture plastic compared to matrix molecules. The IC 50 value was 0.58 µg/mL for tissue culture plastic compared with 0.64 µg/mL for laminin and 0.75 µg/mL for collagen I. The analyses showed that more cells on matrix molecules underwent apoptosis compared to that on tissue culture plastic. Apoptosis-related gene expression was similar in which Bcl-2 expression decreased and proapoptotic gene expression of the cells on matrix molecules increased compared to that on tissue culture plastic. However, the application of 17-allylamino-17-demethoxygeldanamycin was more effective for the cells on collagen I compared to the cells on laminin. There was also a decrease in angiogenesis as shown by the vascular endothelial growth factor staining. This was more pronounced by coating of the tissue culture plastic with matrix molecules. Our results supported the anti-cancer effect of 17-allylamino-17-demethoxygeldanamycin, and this effect depended on matrix molecules. This effect occurs through apoptosis, and related genes were also altered. All these genes may serve for novel target under the effect of matrix substrate. However, correct interpretation of the results requires further studies.

  20. Neural cell adhesion molecule-deficient beta-cell tumorigenesis results in diminished extracellular matrix molecule expression and tumour cell-matrix adhesion.

    PubMed

    Håkansson, Joakim; Xian, Xiaojie; He, Liqun; Ståhlberg, Anders; Nelander, Sven; Samuelsson, Tore; Kubista, Mikael; Semb, Henrik

    2005-01-01

    To understand by which mechanism neural cell adhesion molecule (N-CAM) limits beta tumour cell disaggregation and dissemination, we searched for potential downstream genes of N-CAM during beta tumour cell progression by gene expression profiling. Here, we show that N-CAM-deficient beta-cell tumorigenesis is associated with changes in the expression of genes involved in cell-matrix adhesion and cytoskeletal dynamics, biological processes known to affect the invasive and metastatic behaviour of tumour cells. The extracellular matrix (ECM) molecules emerged as the primary target, i.e. N-CAM deficiency resulted in down-regulated mRNA expression of a broad range of ECM molecules. Consistent with this result, deficient deposition of major ECM stromal components, such as fibronectin, laminin 1 and collagen IV, was observed. Moreover, N-CAM-deficient tumour cells displayed defective matrix adhesion. These results offer a potential mechanism for tumour cell disaggregation during N-CAM-deficient beta tumour cell progression. Prospective consequences of these findings for the role of N-CAM in beta tumour cell dissemination are discussed.

  1. Distribution of pericellular matrix molecules in the temporomandibular joint and their chondroprotective effects against inflammation

    PubMed Central

    Chu, Wern Cui; Zhang, Shipin; Sng, Timothy J; Ong, Yu Jie; Tan, Wen-Li; Ang, Vivien Y; Foldager, Casper B; Toh, Wei Seong

    2017-01-01

    The objectives of this study were to (1) determine the distribution and synthesis of pericellular matrix (PCM) molecules (collagen VI, collagen IV and laminin) in rat temporomandibular joint (TMJ) and (2) investigate the effects of PCM molecules on chondrocytes against inflammation in osteoarthritis. Four zones (fibrous, proliferating, mature and hypertrophic) of condylar cartilage and three bands (anterior, intermediate and posterior) of disc were analysed by immunohistochemistry for the presence of PCM molecules in rat TMJs. Isolated chondrocytes were pre-treated with PCM molecules before being subjected to interleukin (IL)-1β treatment to stimulate inflammation. The responses of the chondrocytes were analysed using gene expression, nitric oxide release and matrix metalloproteinase (MMP)-13 production measures. Histomorphometric analyses revealed that the highest areal deposition of collagen VI (67.4%), collagen IV (45.7%) and laminin (52.4%) was in the proliferating zone of TMJ condylar cartilage. No significant difference in the distribution of PCM molecules was noted among the three bands of the TMJ disc. All three PCM molecules were expressed intracellularly by chondrocytes cultured in the monolayer. Among the PCM molecules, pre-treatment with collagen VI enhanced cellular proliferation, ameliorated IL-1β-induced MMP-3, MMP-9, MMP-13 and inducible nitric oxide synthase gene expression, and attenuated the downregulation of cartilage matrix genes, including collagen I, aggrecan and cartilage oligomeric matrix protein (COMP). Concurrently, collagen VI pretreatment inhibited nitric oxide and MMP-13 production. Our study demonstrates for the first time the distribution and role of PCM molecules, particularly collagen VI, in the protection of chondrocytes against inflammation. PMID:28282029

  2. Studies on Relaxation Behavior of Corona Poled Aromatic Dipolar Molecules in a Polymer Matrix

    DTIC Science & Technology

    1990-08-03

    concentration upto 30 weight percent. Orientation As expected optically responsive molecules are randomly oriented in the polymer matrix although a small amount...INSERT Figure 4 The retention of SH intensity of the small molecule such as MNA was found to be very poor in the PMMA matrix while the larger rodlike...Polym. Prepr. Am. Chem. Soc., Div. Polym. Chem. 24(2), 309 (1983). 16.- H. Ringsdorf and H. W. Schmidt. Makromol. Chem. 185, 1327 (1984). 17. S. Musikant

  3. Low-temperature matrix effects on orientational motion of Methyl radical trapped in gas solids: Angular tunneling vs. libration

    NASA Astrophysics Data System (ADS)

    Dmitriev, Yurij A.; Zelenetckii, Ilia A.; Benetis, Nikolas P.

    2018-05-01

    EPR investigation of the lineshape of matrix -isolated methyl radical, CH3, spectra recorded in solid N2O and CO2 was carried out. Reversible temperature-dependent line width anisotropy was observed in both matrices. This effect is a fingerprint of the extra-slow radical rotation about the in-plane C2 axes. The rotation was found to be anisotropic and closely correlated to the orientational dynamics of the matrix molecules. It was suggested that a recently discovered "hoping precession" effect of matrix molecules in solid CO2 is a common feature of matrices of the linear molecules CO, N2O, and CO2. A new low-temperature matrix effect, referred to as "libration trap", was proposed which accounts for the changing CH3 reorientational motion about the radical C3-axis from rotation to libration. Temperature dependence of the intensity of the EPR satellites produced by these nonrotating-but librating methyls was presented. This allowed for a rough estimation of the rotation hindering potential due to correlation mismatch between the radical and the nearest matrix molecules' librations.

  4. Non-covalent interactions of a drug molecule encapsulated in a hybrid silica gel.

    PubMed

    Paul, Geo; Steuernagel, Stefan; Koller, Hubert

    2007-12-28

    The drug molecule Propranolol has been encapsulated by a sol-gel process in an organic-inorganic hybrid matrix by in-situ self-assembly; the 2D HETCOR solid state NMR spectroscopy provides direct proof of the intimate spatial relationship between the host matrix and guest drug molecules.

  5. Multifunctional and biologically active matrices from multicomponent polymeric solutions

    NASA Technical Reports Server (NTRS)

    Kiick, Kristi L. (Inventor); Yamaguchi, Nori (Inventor); Rabolt, John (Inventor); Casper, Cheryl (Inventor)

    2012-01-01

    A functionalized electrospun matrix for the controlled-release of biologically active agents, such as growth factors, is presented. The functionalized matrix comprises a matrix polymer, a compatibilizing polymer and a biomolecule or other small functioning molecule. In certain aspects the electrospun polymer fibers comprise at least one biologically active molecule functionalized with low molecular weight heparin.

  6. Water in the presence of inert Lennard-Jones obstacles

    NASA Astrophysics Data System (ADS)

    Kurtjak, Mario; Urbic, Tomaz

    2014-04-01

    Water confined by the presence of a 'sea' of inert obstacles was examined. In the article, freely mobile two-dimensional Mercedes-Benz (MB) water put to a disordered, but fixed, matrix of Lennard-Jones disks was studied by the Monte Carlo computer simulations. For the MB water molecules in the matrix of Lennard-Jones disks, we explored the structures, hydrogen-bond-network formation and thermodynamics as a function of temperature and size and density of matrix particles. We found that the structure of model water is perturbed by the presence of the obstacles. Density of confined water, which was in equilibrium with the bulk water, was smaller than the density of the bulk water and the temperature dependence of the density of absorbed water did not show the density anomaly in the studied temperature range. The behaviour observed as a consequence of confinement is similar to that of increasing temperature, which can for a matrix lead to a process similar to capillary evaporation. At the same occupancy of space, smaller matrix molecules cause higher destruction effect on the absorbed water molecules than the bigger ones. We have also tested the hypothesis that at low matrix densities the obstacles induce an increased ordering and 'hydrogen bonding' of the MB model molecules, relative to pure fluid, while at high densities the obstacles reduce MB water structuring, as they prevent the fluid to form good 'hydrogen-bonding' networks. However, for the size of matrix molecules similar to that of water, we did not observe this effect.

  7. Matrix elements of vibration kinetic energy operator of tetrahedral molecules in non-orthogonal-dependent coordinates

    NASA Astrophysics Data System (ADS)

    Protasevich, Alexander E.; Nikitin, Andrei V.

    2018-01-01

    In this work, we propose an algorithm for calculating the matrix elements of the kinetic energy operator for tetrahedral molecules. This algorithm uses the dependent six-angle coordinates (6A) and takes into account the full symmetry of molecules. Unlike A.V. Nikitin, M. Rey, and Vl. G. Tyuterev who operate with the kinetic energy operator only in Radau orthogonal coordinates, we consider a general case. The matrix elements are shown to be a sum of products of one-dimensional integrals.

  8. Efficient tree tensor network states (TTNS) for quantum chemistry: Generalizations of the density matrix renormalization group algorithm

    NASA Astrophysics Data System (ADS)

    Nakatani, Naoki; Chan, Garnet Kin-Lic

    2013-04-01

    We investigate tree tensor network states for quantum chemistry. Tree tensor network states represent one of the simplest generalizations of matrix product states and the density matrix renormalization group. While matrix product states encode a one-dimensional entanglement structure, tree tensor network states encode a tree entanglement structure, allowing for a more flexible description of general molecules. We describe an optimal tree tensor network state algorithm for quantum chemistry. We introduce the concept of half-renormalization which greatly improves the efficiency of the calculations. Using our efficient formulation we demonstrate the strengths and weaknesses of tree tensor network states versus matrix product states. We carry out benchmark calculations both on tree systems (hydrogen trees and π-conjugated dendrimers) as well as non-tree molecules (hydrogen chains, nitrogen dimer, and chromium dimer). In general, tree tensor network states require much fewer renormalized states to achieve the same accuracy as matrix product states. In non-tree molecules, whether this translates into a computational savings is system dependent, due to the higher prefactor and computational scaling associated with tree algorithms. In tree like molecules, tree network states are easily superior to matrix product states. As an illustration, our largest dendrimer calculation with tree tensor network states correlates 110 electrons in 110 active orbitals.

  9. Molecular mechanisms of mechanotransduction in integrin-mediated cell-matrix adhesion

    PubMed Central

    Li, Zhenhai; Lee, Hyunjung; Zhu, Cheng

    2016-01-01

    Cell-matrix adhesion complexes are multi-protein structures linking the extracellular matrix (ECM) to the cytoskeleton. They are essential to both cell motility and function by bidirectionally sensing and transmitting mechanical and biochemical stimulations. Several types of cell-matrix adhesions have been identified and they share many key molecular components, such as integrins and actin-integrin linkers. Mechanochemical coupling between ECM molecules and the actin cytoskeleton has been observed from the single cell to the single molecule level and from immune cells to neuronal cells. However, the mechanisms underlying force regulation of integrin-mediated mechanotransduction still need to be elucidated. In this review article, we focus on integrin-mediated adhesions and discuss force regulation of cell-matrix adhesions and key adaptor molecules, three different force-dependent behaviors, and molecular mechanisms for mechanochemical coupling in force regulation. PMID:27720950

  10. Oriented Polar Molecules in a Solid Inert-Gas Matrix: A Proposed Method for Measuring the Electric Dipole Moment of the Electron

    NASA Astrophysics Data System (ADS)

    Vutha, A.; Horbatsch, M.; Hessels, E.

    2018-01-01

    We propose a very sensitive method for measuring the electric dipole moment of the electron using polar molecules embedded in a cryogenic solid matrix of inert-gas atoms. The polar molecules can be oriented in the $\\hat{\\rm{z}}$ direction by an applied electric field, as has recently been demonstrated by Park, et al. [Angewandte Chemie {\\bf 129}, 1066 (2017)]. The trapped molecules are prepared into a state which has its electron spin perpendicular to $\\hat{\\rm{z}}$, and a magnetic field along $\\hat{\\rm{z}}$ causes precession of this spin. An electron electric dipole moment $d_e$ would affect this precession due to the up to 100~GV/cm effective electric field produced by the polar molecule. The large number of polar molecules that can be embedded in a matrix, along with the expected long coherence times for the precession, allows for the possibility of measuring $d_e$ to an accuracy that surpasses current measurements by many orders of magnitude. Because the matrix can inhibit molecular rotations and lock the orientation of the polar molecules, it may not be necessary to have an electric field present during the precession. The proposed technique can be applied using a variety of polar molecules and inert gases, which, along with other experimental variables, should allow for careful study of systematic uncertainties in the measurement.

  11. An intertwined method for making low-rank, sum-of-product basis functions that makes it possible to compute vibrational spectra of molecules with more than 10 atoms

    PubMed Central

    Thomas, Phillip S.

    2017-01-01

    We propose a method for solving the vibrational Schrödinger equation with which one can compute spectra for molecules with more than ten atoms. It uses sum-of-product (SOP) basis functions stored in a canonical polyadic tensor format and generated by evaluating matrix-vector products. By doing a sequence of partial optimizations, in each of which the factors in a SOP basis function for a single coordinate are optimized, the rank of the basis functions is reduced as matrix-vector products are computed. This is better than using an alternating least squares method to reduce the rank, as is done in the reduced-rank block power method. Partial optimization is better because it speeds up the calculation by about an order of magnitude and allows one to significantly reduce the memory cost. We demonstrate the effectiveness of the new method by computing vibrational spectra of two molecules, ethylene oxide (C2H4O) and cyclopentadiene (C5H6), with 7 and 11 atoms, respectively. PMID:28571348

  12. An intertwined method for making low-rank, sum-of-product basis functions that makes it possible to compute vibrational spectra of molecules with more than 10 atoms.

    PubMed

    Thomas, Phillip S; Carrington, Tucker

    2017-05-28

    We propose a method for solving the vibrational Schrödinger equation with which one can compute spectra for molecules with more than ten atoms. It uses sum-of-product (SOP) basis functions stored in a canonical polyadic tensor format and generated by evaluating matrix-vector products. By doing a sequence of partial optimizations, in each of which the factors in a SOP basis function for a single coordinate are optimized, the rank of the basis functions is reduced as matrix-vector products are computed. This is better than using an alternating least squares method to reduce the rank, as is done in the reduced-rank block power method. Partial optimization is better because it speeds up the calculation by about an order of magnitude and allows one to significantly reduce the memory cost. We demonstrate the effectiveness of the new method by computing vibrational spectra of two molecules, ethylene oxide (C 2 H 4 O) and cyclopentadiene (C 5 H 6 ), with 7 and 11 atoms, respectively.

  13. Cobalt coated substrate for matrix-free analysis of small molecules by laser desorption/ionization mass spectrometry

    NASA Astrophysics Data System (ADS)

    Yalcin, Talat; Li, Liang

    2009-12-01

    Small molecule analysis is one of the most challenging issues in matrix-assisted laser desorption/ionization (MALDI) mass spectrometry. We have developed a cobalt coated substrate as a target for matrix-free analysis of small molecules in laser desorption/ionization mass spectrometry. Cobalt coating of 60-70 nm thickness has been characterized by scanning electron microscopy, energy dispersive X-ray analysis, X-ray diffraction, and laser induced breakdown spectroscopy. This target facilitates hundreds of samples to be spotted and analyzed without mixing any matrices, in a very short time. This can save a lot of time and money and can be a very practical approach for the analysis of small molecules by laser desorption/ionization mass spectrometry.

  14. Cyclodextrin-supported organic matrix for application of MALDI-MS for forensics. Soft-ionization to obtain protonated molecules of low molecular weight compounds

    NASA Astrophysics Data System (ADS)

    Yonezawa, Tetsu; Asano, Takashi; Fujino, Tatsuya; Nishihara, Hiroshi

    2013-06-01

    A mass measurement technique for detecting low-molecular-weight drugs with a cyclodextrin-supported organic matrix was investigated. By using cyclodextrin-supported 2,4,6-trihydroxyacetophenone (THAP), the matrix-related peaks of drugs were suppressed. The peaks of protonated molecules of the sample and THAP were mainly observed, and small fragments were detected in a few cases. Despite the Na+ and K+ peaks were observed in the spectrum, Na+ or K+ adduct sample molecules were undetected, owing to the sugar units of cyclodextrin. The advantages of MALDI-MS with cyclodextrin-supported matrices as an analytical tool for forensic samples are discussed. The suppression of alkali adducted molecules and desorption process are also discussed.

  15. Distance descending ordering method: An O(n) algorithm for inverting the mass matrix in simulation of macromolecules with long branches

    NASA Astrophysics Data System (ADS)

    Xu, Xiankun; Li, Peiwen

    2017-11-01

    Fixman's work in 1974 and the follow-up studies have developed a method that can factorize the inverse of mass matrix into an arithmetic combination of three sparse matrices-one of them is positive definite and needs to be further factorized by using the Cholesky decomposition or similar methods. When the molecule subjected to study is of serial chain structure, this method can achieve O (n) time complexity. However, for molecules with long branches, Cholesky decomposition about the corresponding positive definite matrix will introduce massive fill-in due to its nonzero structure. Although there are several methods can be used to reduce the number of fill-in, none of them could strictly guarantee for zero fill-in for all molecules according to our test, and thus cannot obtain O (n) time complexity by using these traditional methods. In this paper we present a new method that can guarantee for no fill-in in doing the Cholesky decomposition, which was developed based on the correlations between the mass matrix and the geometrical structure of molecules. As a result, the inverting of mass matrix will remain the O (n) time complexity, no matter the molecule structure has long branches or not.

  16. A parallel algorithm for Hamiltonian matrix construction in electron-molecule collision calculations: MPI-SCATCI

    NASA Astrophysics Data System (ADS)

    Al-Refaie, Ahmed F.; Tennyson, Jonathan

    2017-12-01

    Construction and diagonalization of the Hamiltonian matrix is the rate-limiting step in most low-energy electron - molecule collision calculations. Tennyson (1996) implemented a novel algorithm for Hamiltonian construction which took advantage of the structure of the wavefunction in such calculations. This algorithm is re-engineered to make use of modern computer architectures and the use of appropriate diagonalizers is considered. Test calculations demonstrate that significant speed-ups can be gained using multiple CPUs. This opens the way to calculations which consider higher collision energies, larger molecules and / or more target states. The methodology, which is implemented as part of the UK molecular R-matrix codes (UKRMol and UKRMol+) can also be used for studies of bound molecular Rydberg states, photoionization and positron-molecule collisions.

  17. Selective small-molecule inhibitors as chemical tools to define the roles of matrix metalloproteinases in disease.

    PubMed

    Meisel, Jayda E; Chang, Mayland

    2017-11-01

    The focus of this article is to highlight novel inhibitors and current examples where the use of selective small-molecule inhibitors has been critical in defining the roles of matrix metalloproteinases (MMPs) in disease. Selective small-molecule inhibitors are surgical chemical tools that can inhibit the targeted enzyme; they are the method of choice to ascertain the roles of MMPs and complement studies with knockout animals. This strategy can identify targets for therapeutic development as exemplified by the use of selective small-molecule MMP inhibitors in diabetic wound healing, spinal cord injury, stroke, traumatic brain injury, cancer metastasis, and viral infection. This article is part of a Special Issue entitled: Matrix Metalloproteinases edited by Rafael Fridman. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Chondroitin sulfates and their binding molecules in the central nervous system.

    PubMed

    Djerbal, L; Lortat-Jacob, H; Kwok, Jcf

    2017-06-01

    Chondroitin sulfate (CS) is the most abundant glycosaminoglycan (GAG) in the central nervous system (CNS) matrix. Its sulfation and epimerization patterns give rise to different forms of CS, which enables it to interact specifically and with a significant affinity with various signalling molecules in the matrix including growth factors, receptors and guidance molecules. These interactions control numerous biological and pathological processes, during development and in adulthood. In this review, we describe the specific interactions of different families of proteins involved in various physiological and cognitive mechanisms with CSs in CNS matrix. A better understanding of these interactions could promote a development of inhibitors to treat neurodegenerative diseases.

  19. Covariance Matrix Estimation for the Cryo-EM Heterogeneity Problem*

    PubMed Central

    Katsevich, E.; Katsevich, A.; Singer, A.

    2015-01-01

    In cryo-electron microscopy (cryo-EM), a microscope generates a top view of a sample of randomly oriented copies of a molecule. The problem of single particle reconstruction (SPR) from cryo-EM is to use the resulting set of noisy two-dimensional projection images taken at unknown directions to reconstruct the three-dimensional (3D) structure of the molecule. In some situations, the molecule under examination exhibits structural variability, which poses a fundamental challenge in SPR. The heterogeneity problem is the task of mapping the space of conformational states of a molecule. It has been previously suggested that the leading eigenvectors of the covariance matrix of the 3D molecules can be used to solve the heterogeneity problem. Estimating the covariance matrix is challenging, since only projections of the molecules are observed, but not the molecules themselves. In this paper, we formulate a general problem of covariance estimation from noisy projections of samples. This problem has intimate connections with matrix completion problems and high-dimensional principal component analysis. We propose an estimator and prove its consistency. When there are finitely many heterogeneity classes, the spectrum of the estimated covariance matrix reveals the number of classes. The estimator can be found as the solution to a certain linear system. In the cryo-EM case, the linear operator to be inverted, which we term the projection covariance transform, is an important object in covariance estimation for tomographic problems involving structural variation. Inverting it involves applying a filter akin to the ramp filter in tomography. We design a basis in which this linear operator is sparse and thus can be tractably inverted despite its large size. We demonstrate via numerical experiments on synthetic datasets the robustness of our algorithm to high levels of noise. PMID:25699132

  20. Evaluation and prevention of the negative matrix effect of terpenoids on pesticides in apples quantification by gas chromatography-tandem mass spectrometry.

    PubMed

    Giacinti, Géraldine; Raynaud, Christine; Capblancq, Sophie; Simon, Valérie

    2016-12-21

    The sample matrix can enhance the gas chromatography signal of pesticide residues relative to that obtained with the same concentration of pesticide in solvent. This paper is related to negative matrix effects observed in coupled gas chromatography-mass spectrometry ion trap (GC/MS 2 ) quantification of pesticides in concentrated extracts of apple peel prepared by the Quick Easy Cheap Effective Rugged and Safe (QuEChERS) method. It is focused on the pesticides most frequently used on the apple varieties studied, throughout the crop cycle, right up to harvest, to combat pests and diseases and to improve fruit storage properties. Extracts from the fleshy receptacle (flesh), the epiderm (peel) and fruit of three apple varieties were studied by high-performance thin-layer chromatography hyphenated with UV-vis light detection (HPTLC/UV visible). The peel extracts had high concentrations of triterpenic acids (oleanolic and ursolic acids), reaching 25mgkg -1 , whereas these compounds were not detected in the flesh extracts (<0.05mgkg -1 ). A significant relationship has been found between the levels of these molecules and negative matrix effects in GC/MS 2 . The differences in the behavior of pesticides with respect to matrix effects can be accounted for by the physicochemical characteristics of the molecules (lone pairs, labile hydrogen, conjugation). The HPTLC/UV visible method developed here for the characterization of QuEChERS extracts acts as a complementary clean-up method, aimed to decrease the negative matrix effects of such extracts. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Evaluation and prevention of the negative matrix effect of terpenoids on pesticides in apples quantification by gas chromatography-tandem mass spectrometry.

    PubMed

    Giacinti, Géraldine; Raynaud, Christine; Capblancq, Sophie; Simon, Valérie

    2017-02-03

    The sample matrix can enhance the gas chromatography signal of pesticide residues relative to that obtained with the same concentration of pesticide in solvent. This paper is related to negative matrix effects observed in coupled gas chromatography-mass spectrometry ion trap (GC/MS 2 ) quantification of pesticides in concentrated extracts of apple peel prepared by the Quick Easy Cheap Effective Rugged and Safe (QuEChERS) method. It is focused on the pesticides most frequently used on the apple varieties studied, throughout the crop cycle, right up to harvest, to combat pests and diseases and to improve fruit storage properties. Extracts from the fleshy receptacle (flesh), the epiderm (peel) and fruit of three apple varieties were studied by high-performance thin-layer chromatography hyphenated with UV-vis light detection (HPTLC/UV visible). The peel extracts had high concentrations of triterpenic acids (oleanolic and ursolic acids), reaching 25mgkg -1 , whereas these compounds were not detected in the flesh extracts (<0.05mgkg -1 ). A significant relationship has been found between the levels of these molecules and negative matrix effects in GC/MS 2 . The differences in the behavior of pesticides with respect to matrix effects can be accounted for by the physicochemical characteristics of the molecules (lone pairs, labile hydrogen, conjugation). The HPTLC/UV visible method developed here for the characterization of QuEChERS extracts acts as a complementary clean-up method, aimed to decrease the negative matrix effects of such extracts. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. UV irradiation study of a tripeptide isolated in an argon matrix: A tautomerism process evidenced by infrared and X-ray photoemission spectroscopies

    NASA Astrophysics Data System (ADS)

    Mateo-Marti, E.; Pradier, C. M.

    2013-05-01

    Matrix isolation is a powerful tool for studying photochemical processes occurring in isolated molecules. In this way, we characterized the chemical modifications occurring within a tri peptide molecule, IGF, when exposed to the influence of Ultraviolet (UV) irradiation. This paper first describes the successful formation of the tripeptide (IGF) argon matrix under vacuum conditions, followed by the in situ UV irradiation and characterization of the molecular matrix reactivity after UV-irradiation. These studies have been performed by combining two complementary spectroscopic techniques, Fourier-Transform Reflexion Absorption Spectroscopy (FT-IRRAS) and X-ray Photoelectron Spectroscopy (XPS). The IR spectra of the isolated peptide-matrix, before and after UV irradiation, revealed significant differences that could be associated either to a partial deprotonation of the molecule or to a tautomeric conversion of some amide bonds to imide ones on some peptide molecules. XPS analyses undoubtedly confirmed the second hypothesis; the combination of IRRAS and XPS results provide evidence that UV irradiation of peptides induces a chemical reaction, namely a shift of the double bond, meaning partial conversion from amide tautomer into an imidic acid tautomer.

  3. The quantum matrix and information from the hydrocarbon oil molecule

    NASA Astrophysics Data System (ADS)

    Seyful-Mulyukov, R. B.

    2016-03-01

    The quantum matrix of the hydrocarbon (HC) molecule is substantiated. On the basis of its properties and behavior, the genesis of oil is explained as a process of self-evolution of oil and preservation of molecules of different composition and generation time. Individual HC molecules are generated in nanoseconds, and the period of the genesis of oil is comparable with that of migration of the HC fluid from the mantle to the deposit. A model of subatomic abiogenic genesis of oil is presented. Hydrocarbon (HC) molecules of various structure and composition are formed due to interaction of the valency electron orbitals of C and H atoms, the elemental particles of which are quantum objects and carriers of information. On the basis of this, the term quantum matrix of the HC molecule, the properties and behavior of which explain the genesis of oil as a process of its self-evolution and preservation of the molecules of various composition and the period of generation of oil, is substantiated. It is proved that individual HC molecules are generated within nanoseconds and the period of origin of the entire assemblage of more than 500 molecules of oil of various types is comparable with the period of migration of the HC fluid from the mantle to the deposit.

  4. Photoactuation behavior of styrene-b-isoprene-b-styrene filled with covalently modified carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Mosnáček, Jaroslav; Ilčíková, Markéta; Chorvát, Dušan; Czaniková, Klaudia; Krupa, Igor

    2012-07-01

    Styrene-b-isoprene-b-styrene (Kraton) was used as polymer matrix for preparation of multiwall carbon nanotubes (MWCNT) based nanocomposites. In order to suppress aggregation of the he carbon nanotubes and to improve the interations with the Kraton matrix, the MWCNT were modified with cholesteryl molecules and/or polystyrene chains. The effect of the modification on the composite materials was evaluated by using DMTA. The nanocomposite materials were thermoformed to achieve Braille text elements and their elastic response to light (photoactuation) was tested by atomic force microscopy in a contact mode.

  5. Variational Calculations of Ro-Vibrational Energy Levels and Transition Intensities for Tetratomic Molecules

    NASA Technical Reports Server (NTRS)

    Schwenke, David W.; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    A description is given of an algorithm for computing ro-vibrational energy levels for tetratomic molecules. The expressions required for evaluating transition intensities are also given. The variational principle is used to determine the energy levels and the kinetic energy operator is simple and evaluated exactly. The computational procedure is split up into the determination of one dimensional radial basis functions, the computation of a contracted rotational-bending basis, followed by a final variational step coupling all degrees of freedom. An angular basis is proposed whereby the rotational-bending contraction takes place in three steps. Angular matrix elements of the potential are evaluated by expansion in terms of a suitable basis and the angular integrals are given in a factorized form which simplifies their evaluation. The basis functions in the final variational step have the full permutation symmetries of the identical particles. Sample results are given for HCCH and BH3.

  6. Addressing matrix effects in ligand-binding assays through the use of new reagents and technology.

    PubMed

    Chilewski, Shannon D; Mora, Johanna R; Gleason, Carol; DeSilva, Binodh

    2014-04-01

    Ligand-binding assays (LBAs) used in the quantification of biotherapeutics for pharmacokinetic determinations rely on interactions between reagents (antibodies or target molecule) and the biotherapeutic. Most LBAs do not employ an analyte extraction procedure and are susceptible to matrix interference. Here, we present a case study on the development of a LBA for the quantification of a PEGylated domain antibody where matrix interference was observed. The assay used to support the single ascending dose study was a plate-based electrochemiluminescent assay with a lower limit of quantification of 80 ng/mL. To meet sensitivity requirements of future studies, new reagents and the Gyrolab™ Workstation were evaluated. Assay sensitivity improved nearly threefold in the final method utilizing new antibody reagents, a buffer containing blockers to human anti-animal antibodies, and the Gyrolab Workstation. Experimental data indicate that all factors changed played a role in overcoming matrix effects.

  7. Development of electrospun bone-mimetic matrices for bone regenerative applications

    NASA Astrophysics Data System (ADS)

    Phipps, Matthew Christopher

    Although bone has a dramatic capacity for regeneration, certain injuries and procedures present defects that are unable to heal properly, requiring surgical intervention to induce and support osteoregeneration. Our research group has hypothesized that the development of a biodegradable material that mimics the natural composition and architecture of bone extracellular matrix has the potential to provide therapeutic benefit to these patients. Utilizing a process known as electrospinning, our lab has developed a bone-mimetic matrix (BMM) consisting of composite nanofibers of the mechanically sta-ble polymer polycaprolactone (PCL), and the natural bone matrix molecules type-I colla-gen and hydroxyapatite nanocrystals (HA). We herein show that BMMs supported great-er adhesion, proliferation, and integrin activation of mesenchymal stem cells (MSCs), the multipotent bone-progenitor cells within bone marrow and the periosteum, in comparison to electrospun PCL alone. These cellular responses, which are essential early steps in the process of bone regeneration, highlight the benefits of presenting cells with natural bone molecules. Subsequently, evaluation of new bone formation in a rat cortical tibia defect showed that BMMs are highly osteoconductive. However, these studies also revealed the inability of endogenous cells to migrate within electrospun matrices due to the inherently small pore sizes. To address this limitation, which will negatively impact the rate of scaf-fold-to-bone turnover and inhibit vascularization, sacrificial fibers were added to the ma-trix. The removal of these fibers after fabrication resulted in BMMs with larger pores, leading to increased infiltration of MSCs and endogenous bone cells. Lastly, we evaluat-ed the potential of our matrices to stimulate the recruitment of MSCs, a vital step in bone healing, through the sustained delivery of platelet derived growth factor-BB (PDGF-BB). BMMs were found to adsorb and subsequently release greater quantities of PDGF-BB, compared to PCL scaffolds, over an 8-week interval. The released PDGF-BB retained its bioactivity, stimulating MSC chemotaxis in two separate assays. Collectively, these re-sults suggest that electrospun matrices incorporating the bone matrix molecules collagen I and HA, with sacrificial fibers, provide a favorable scaffold for MSC survival and infil-tration as well as the ability to sequester PDGF-BB from solution, leading to sustained local delivery and MSC chemotaxis.

  8. Unusual analyte-matrix adduct ions and mechanism of their formation in MALDI TOF MS of benzene-1,3,5-tricarboxamide and urea compounds.

    PubMed

    Lou, Xianwen; Fransen, Michel; Stals, Patrick J M; Mes, Tristan; Bovee, Ralf; van Dongen, Joost J L; Meijer, E W

    2013-09-01

    Analyte-matrix adducts are normally absent under typical matrix assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI TOF MS) conditions. Interestingly, though, in the analysis of several types of organic compounds synthesized in our laboratory, analyte-matrix adduct ion peaks were always recorded when common MALDI matrices such as 4-hydroxy-α-cyanocinnamic acid (CHCA) were used. These compounds are mainly those with a benzene-1,3,5-tricarboxamide (BTA) or urea moiety, which are important building blocks to make new functional supramolecular materials. The possible mechanism of the adduct formation was investigated. A shared feature of the compounds studied is that they can form intermolecular hydrogen bonding with matrices like CHCA. The intermolecular hydrogen bonding will make the association between analyte ions and matrix molecules stronger. As a result, the analyte ions and matrix molecules in MALDI clusters will become more difficult to be separated from each other. Furthermore, it was found that analyte ions were mainly adducted with matrix salts, which is probably due to the much lower volatility of the salts compared with that of their corresponding matrix acids. It seems that the analyte-matrix adduct formation for our compounds are caused by the incomplete evaporation of matrix molecules from the MALDI clusters because of the combined effects of enhanced intermolecular interaction between analyte-matrix and of the low volatility of matrix salts. Based on these findings, strategies to suppress the analyte-matrix adduction are briefly discussed. In return, the positive results of using these strategies support the proposed mechanism of the analyte-matrix adduct formation.

  9. The composition of liquid atmospheric pressure matrix-assisted laser desorption/ionization matrices and its effect on ionization in mass spectrometry.

    PubMed

    Ryumin, Pavel; Cramer, Rainer

    2018-07-12

    New liquid atmospheric pressure (AP) matrix-assisted laser desorption/ionization (MALDI) matrices that produce predominantly multiply charged ions have been developed and evaluated with respect to their performance for peptide and protein analysis by mass spectrometry (MS). Both the chromophore and the viscous support liquid in these matrices were optimized for highest MS signal intensity, S/N values and maximum charge state. The best performance in both protein and peptide analysis was achieved employing light diols as matrix support liquids (e.g. ethylene glycol and propylene glycol). Investigating the influence of the chromophore, it was found that 2,5-dihydroxybenzoic acid resulted in a higher analyte ion signal intensity for the analysis of small peptides; however, larger molecules (>17 kDa) were undetectable. For larger molecules, a sample preparation based on α-cyano-4-hydroxycinnammic acid as the chromophore was developed and multiply protonated analytes with charge states of more than 50 were detected. Thus, for the first time it was possible to detect with MALDI MS proteins as large as ∼80 kDa with a high number of charge states, i.e. m/z values below 2000. Systematic investigations of various matrix support liquids have revealed a linear dependency between laser threshold energy and surface tension of the liquid MALDI sample. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Tissue-engineered cartilaginous constructs for the treatment of caprine cartilage defects, including distribution of laminin and type IV collagen.

    PubMed

    Jeng, Lily; Hsu, Hu-Ping; Spector, Myron

    2013-10-01

    The purpose of this study was the immunohistochemical evaluation of (1) cartilage tissue-engineered constructs; and (2) the tissue filling cartilage defects in a goat model into which the constructs were implanted, particularly for the presence of the basement membrane molecules, laminin and type IV collagen. Basement membrane molecules are localized to the pericellular matrix in normal adult articular cartilage, but have not been examined in tissue-engineered constructs cultured in vitro or in tissue filling cartilage defects into which the constructs were implanted. Cartilaginous constructs were engineered in vitro using caprine chondrocyte-seeded type II collagen scaffolds. Autologous constructs were implanted into 4-mm-diameter defects created to the tidemark in the trochlear groove in the knee joints of skeletally mature goats. Eight weeks after implantation, the animals were sacrificed. Constructs underwent immunohistochemical and histomorphometric evaluation. Widespread staining for the two basement membrane molecules was observed throughout the extracellular matrix of in vitro and in vivo samples in a distribution unlike that previously reported for cartilage. At sacrifice, 70% of the defect site was filled with reparative tissue, which consisted largely of fibrous tissue and some fibrocartilage, with over 70% of the reparative tissue bonded to the adjacent host tissue. A novel finding of this study was the observation of laminin and type IV collagen in in vitro engineered cartilaginous constructs and in vivo cartilage repair samples from defects into which the constructs were implanted, as well as in normal caprine articular cartilage. Future work is needed to elucidate the role of basement membrane molecules during cartilage repair and regeneration.

  11. Tissue-Engineered Cartilaginous Constructs for the Treatment of Caprine Cartilage Defects, Including Distribution of Laminin and Type IV Collagen

    PubMed Central

    Jeng, Lily; Hsu, Hu-Ping

    2013-01-01

    The purpose of this study was the immunohistochemical evaluation of (1) cartilage tissue-engineered constructs; and (2) the tissue filling cartilage defects in a goat model into which the constructs were implanted, particularly for the presence of the basement membrane molecules, laminin and type IV collagen. Basement membrane molecules are localized to the pericellular matrix in normal adult articular cartilage, but have not been examined in tissue-engineered constructs cultured in vitro or in tissue filling cartilage defects into which the constructs were implanted. Cartilaginous constructs were engineered in vitro using caprine chondrocyte-seeded type II collagen scaffolds. Autologous constructs were implanted into 4-mm-diameter defects created to the tidemark in the trochlear groove in the knee joints of skeletally mature goats. Eight weeks after implantation, the animals were sacrificed. Constructs underwent immunohistochemical and histomorphometric evaluation. Widespread staining for the two basement membrane molecules was observed throughout the extracellular matrix of in vitro and in vivo samples in a distribution unlike that previously reported for cartilage. At sacrifice, 70% of the defect site was filled with reparative tissue, which consisted largely of fibrous tissue and some fibrocartilage, with over 70% of the reparative tissue bonded to the adjacent host tissue. A novel finding of this study was the observation of laminin and type IV collagen in in vitro engineered cartilaginous constructs and in vivo cartilage repair samples from defects into which the constructs were implanted, as well as in normal caprine articular cartilage. Future work is needed to elucidate the role of basement membrane molecules during cartilage repair and regeneration. PMID:23672504

  12. Infrared Matrix-Isolation Study of New Noble-Gas Compounds

    NASA Astrophysics Data System (ADS)

    Zhu, Cheng; Räsänen, Markku; Khriachtchev, Leonid

    2016-06-01

    We identify new noble-gas compounds in solid matrices using IR spectroscopy. The compounds under study belong to two types: HNgY and YNgY' where Ng is a noble-gas atom and Y and Y' are electronegative fragments. The experimental assignments are supported by ab initio calculations at the MP2(full) and CCSD(T) levels of theory with the def2-TZVPPD basis set. We have prepared and characterized two new HNgY compounds (noble-gas hydrides): HKrCCCl in a Kr matrix and HXeCCCl in a Xe matrix.I The synthesis of these compounds includes two steps: UV photolysis of HCCCl in a noble-gas matrix to form the H + CCCl fragments and annealing of the matrix to mobilize H atoms and to promote the H + Ng + CCCl = HNgCCCl reaction. An interesting observation in the experiments on HXeCCCl in a Xe matrix is the temperature-induced transformation of the three H-Xe stretching bands. This observation is explained by temperature-induced changes of local matrix morphology around the embedded HXeCCCl molecule. In these experiments, we have also obtained the IR spectrum of the CCCl radical, which is produced by photodecomposition of HCCCl. We have identified three new YNgY' compounds (fluorinated noble-gas cyanides): FKrCN in a Kr matrix and FXeCN and FXeNC in a Xe matrix.II These molecule are formed by photolysis of FCN in a noble-gas matrix due to locality of this process. The amount of these molecules increases upon thermal mobilization of the F atoms in the photolyzed matrix featuring the F + Ng + CN reaction.

  13. Evaluating the feasibility of utilizing the small molecule phenamil as a novel biofactor for bone regenerative engineering.

    PubMed

    Lo, Kevin W-H; Ulery, Bret D; Kan, Ho Man; Ashe, Keshia M; Laurencin, Cato T

    2014-09-01

    Osteoblast cell adhesion and differentiation on biomaterials are important achievements necessary for implants to be useful in bone regenerative engineering. Recombinant bone morphogenetic proteins (BMPs) have been shown to be important for these processes; however, there are many challenges associated with the widespread use of these proteins. A recent report demonstrated that the small molecule phenamil, a diuretic derivative, was able to induce osteoblast differentiation and mineralization in vitro via the canonical BMP signalling cascade (Park et al., 2009). In this study, the feasibility of using phenamil as a novel biofactor in conjunction with a biodegradable poly(lactide-co-glycolide acid) (PLAGA) polymeric scaffold for engineering bone tissue was evaluated. The in vitro cellular behaviour of osteoblast-like MC3T3-E1 cells cultured on PLAGA scaffolds in the presence of phenamil at 10 μM were characterized with regard to initial cell adhesion, proliferation, alkaline phosphatase (ALP) activity and matrix mineralization. The results demonstrate that phenamil supported cell proliferation, promoted ALP activity and facilitated matrix mineralization of osteoblast-like MC3T3-E1 cells. Moreover, in this study, we found that phenamil promoted integrin-mediated cell adhesion on PLAGA scaffolds. It was also shown that phenamil encapsulated within porous, microsphere PLAGA scaffolds retained its osteogenic activity upon release. Based on these findings, the small molecule phenamil has the potential to serve as a novel biofactor for the repair and regeneration of bone tissues. Copyright © 2012 John Wiley & Sons, Ltd.

  14. N-(1-Naphthyl) Ethylenediamine Dinitrate: A New Matrix for Negative Ion MALDI-TOF MS Analysis of Small Molecules

    NASA Astrophysics Data System (ADS)

    Chen, Rui; Chen, Suming; Xiong, Caiqiao; Ding, Xunlei; Wu, Chih-Che; Chang, Huan-Cheng; Xiong, Shaoxiang; Nie, Zongxiu

    2012-09-01

    An organic salt, N-(1-naphthyl) ethylenediamine dinitrate (NEDN), with rationally designed properties of a strong UV absorbing chromophore, hydrogen binding and nitrate anion donors, has been employed as a matrix to analyze small molecules ( m/z < 1000) such as oligosaccharides, peptides, metabolites and explosives using negative ion matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Compared with conventional matrixes such as α-cyano-4-hydroxycinnamic acid (CCA) and 2,5-dihydroxybenzoic acid (DHB), NEDN provides a significant improvement in detection sensitivity and yields very few matrix-associated fragment and cluster ions interfering with MS analysis. For low-molecular-weight saccharides, the lowest detection limit achieved ranges from 500 amol to 5 pmol, depending on the molecular weight and the structure of the analytes. Additionally, the mass spectra in the lower mass range ( m/z < 200) consist of only nitrate and nitric acid cluster ions, making the matrix particularly useful for structural identification of oligosaccharides by post-source decay (PSD) MALDI-MS. Such a characteristic is illustrated by using maltoheptaose as a model system. This work demonstrates that NEDN is a novel negative ion-mode matrix for MALDI-MS analysis of small molecules with nitrate anion attachment.

  15. Consistent force field modeling of matrix isolated molecules. V. Minimum energy path potential to the conformer conversion of 1,2-difluoroethane: Ar 364, ab initio calculation of electric multipole moments and electric polarization contribution to the conversion barrier

    NASA Astrophysics Data System (ADS)

    Gunde, R.; Ha, T.-K.; Günthard, H. H.

    1990-08-01

    In this paper results of consistent force field modeling (CFF) of the potential function to conversion of the gauche (g) to the trans (t) conformer of 1,2-difluoroethane (DFE) isolated in an argon matrix will be reported. Starting point are locally stable configurations gDFE:Ar 364 (defect GH1) and tDFE:Ar 364 (TH1) obtained in previous work from CFF modeling of a cube shaped Ar 364 fragment containing one DFE molecule in its center. Using the dihedral angle of DFE as an independent parameter the minimum energy path of the conversion process gDFE:Ar 364→tDFE:Ar 364 will be determined by CFF energy minimization. Determination of the minimum energy path is found to require large numbers of energy minimization steps and to lead to a rather complicated motion of the molecule with respect to the crystal fragment. Surprisingly the molecule-matrix interactions lead to a reduction of the g-t barrier by ≈500 cal/mol and to a stabilization of the trans species by ≈500 cal/mol. This finding is a consequence of a delicate interplay of matrix-molecule and matrix-matrix interactions. Calculation of the electric polarization energy (induced dipole-first-order polarization approximation) is based on extended ab initio calculations of dipole and quadrupole moments and a bond polarizability estimate of the first-order polarizability of DFE as a function of the internal rotation angle, on Fourier expansion of multipole components and use of symmetry for reduction of the order of the linear system defining the (self-consistent) induced dipole moments of all Ar atoms. Electric polarization is found to alter the potential function of the conversion process in a profound way: the g-t barrier and the t-g energy difference are increased to ≈3000 cal/mol and to ≈1500 cal/mol respectively (≈2500 and ≈530 cal/mol respectively for free DFE). Further applications of the technique developed in this work to related problems of matrix isolated molecules, e.g., vibrational matrix shifts will be discussed.

  16. Engineered matrices for bone regeneration

    NASA Astrophysics Data System (ADS)

    Winn, Shelley R.; Hu, Yunhua; Pugh, Amy; Brown, Leanna; Nguyen, Jesse T.; Hollinger, Jeffrey O.

    2000-06-01

    Traditional therapies of autografts and allogeneic banked bone can promote reasonable clinical outcome to repair damaged bone. However, under certain conditions the success of these traditional approaches plummets, providing the incentive for researchers to develop clinical alternatives. The evolving field of tissue engineering in the musculoskeletal system attempts to mimic many of the components from the intact, healthy subject. Those components consist of a biologic scaffold, cells, extracellular matrix, and signaling molecules. The bone biomimetic, i.e., an engineered matrix, provides a porous structural architecture for the regeneration and ingrowth of osseous tissue at the site of injury. To further enhance the regenerative cascade, our strategy has involved porous biodegradable scaffolds containing and releasing signaling molecules and providing a suitable environment for cell attachment, growth and differentiation. In addition, the inclusion of genetically modified osteogenic precursor cells has brought the technology closer to developing a tissue-engineered equivalent. The presentation will describe various formulations and the methods utilized to evaluate the clinical utility of these biomimetics.

  17. Assembly of the fluorescent acrosomal matrix and its fate in fertilization in the water strider, Aquarius remigis

    PubMed Central

    Miyata, Haruhiko; Noda, Naoki; Fairbairn, Daphne J.; Oldenbourg, Rudolf; Cardullo, Richard A.

    2011-01-01

    Animal sperm show remarkable diversity in both morphology and molecular composition. Here we provide the first report of intense intrinsic fluorescence in an animal sperm. The sperm from a semi-aquatic insect, the water strider, Aquarius remigis, contains an intrinsically fluorescent molecule with properties consistent with those of Flavin Adenine Dinucleotid (FAD) which appears first in the acrosomal vesicle of round spermatids and persists in the acrosome throughout spermiogenesis. Fluorescence recovery after photobleaching reveals that the fluorescent molecule exhibits unrestricted mobility in the acrosomal vesicle of round spermatids, but is completely immobile in the acrosome of mature sperm. Fluorescence polarization microscopy shows a net alignment of the fluorescent molecules in the acrosome of the mature sperm but not in the acrosomal vesicle of round spermatids. These results suggest that acrosomal molecules are rearranged in the elongating acrosome and FAD is incorporated into the acrosomal matrix during its formation. Further, we followed the fate of the acrosomal matrix in fertilization utilizing the intrinsic fluorescence. The fluorescent acrosomal matrix was observed inside the fertilized egg and remained structurally intact even after gastrulation started. This observation suggests that FAD is not released from the acrosomal matrix during the fertilization process or early development and supports an idea that FAD is involved in the formation of the acrosomal matrix. The intrinsic fluorescence of the A. remigis acrosome will be a useful marker for following spermatogenesis and fertilization. PMID:20857404

  18. Matrix isolation infrared and Raman spectra of binary and mixed group II B fluorides

    NASA Astrophysics Data System (ADS)

    Givan, A.; Loewenschuss, A.

    1980-03-01

    Infrared and Raman spectra of all MF2 and MFX molecules (M=Zn, Cd, Hg; X=Cl, Br) and the infrared spectrum of the fluoroidide HgFI isolated in solid krypton at 20 °K are reported. The MFX species were formed in a vapor mixture of the appropriate MF2 and MX2 dihalides, vaporized, at different temperatures, from separate compartments of a double-oven crucible. The spectra are the first experimental evidence for the existence of the molecular fluorohalides. All three fundamentals of the MF2 molecules and the two stretching mode frequencies of the MFX molecules are assigned. Harmonic force constants are evaluated and isotope effects are used to discuss their geometry. Thermodynamic functions are tabulated for the binary difluorides.

  19. Highly ordered molecular rotor matrix on a nanopatterned template: titanyl phthalocyanine molecules on FeO/Pt(111).

    PubMed

    Lu, Shuangzan; Huang, Min; Qin, Zhihui; Yu, Yinghui; Guo, Qinmin; Cao, Gengyu

    2018-08-03

    Molecular rotors, motors and gears play important roles in artificial molecular machines, in which rotor and motor matrices are highly desirable for large-scale bottom-up fabrication of molecular machines. Here we demonstrate the fabrication of a highly ordered molecular rotor matrix by depositing nonplanar dipolar titanyl phthalocyanine (TiOPc, C 32 H 16 N 8 OTi) molecules on a Moiré patterned dipolar FeO/Pt(111) substrate. TiOPc molecules with O atoms pointing outwards from the substrate (upward) or towards the substrate (downward) are alternatively adsorbed on the fcc sites by strong lateral confinement. The adsorbed molecules, i.e. two kinds of molecular rotors, show different scanning tunneling microscopy images, thermal stabilities and rotational characteristics. Density functional theory calculations clarify that TiOPc molecules anchoring upwards with high adsorption energies correspond to low-rotational-rate rotors, while those anchoring downwards with low adsorption energies correspond to high-rotational-rate rotors. A robust rotor matrix fully occupied by low-rate rotors is fabricated by depositing molecules on the substrate at elevated temperature. Such a paradigm opens up a promising route to fabricate functional molecular rotor matrices, driven motor matrices and even gear groups on solid substrates.

  20. Dynamics of VEGF matrix-retention in vascular network patterning

    NASA Astrophysics Data System (ADS)

    Köhn-Luque, A.; de Back, W.; Yamaguchi, Y.; Yoshimura, K.; Herrero, M. A.; Miura, T.

    2013-12-01

    Vascular endothelial growth factor (VEGF) is a central regulator of blood vessel morphogenesis, although its role in patterning of endothelial cells into vascular networks is not fully understood. It has been suggested that binding of soluble VEGF to extracellular matrix components causes spatially restricted cues that guide endothelial cells into network patterns. Yet, current evidence for such a mechanism remains indirect. In this study, we quantitatively analyse the dynamics of VEGF retention in a controlled in vitro situation of human umbilical vascular endothelial cells (HUVECs) in Matrigel. We show that fluorescent VEGF accumulates in pericellular areas and colocalizes with VEGF binding molecules. Analysis of fluorescence recovery after photobleaching reveals that binding/unbinding to matrix molecules dominates VEGF dynamics in the pericellular region. Computational simulations using our experimental measurements of kinetic parameters show that matrix retention of chemotactic signals can lead to the formation of reticular cellular networks on a realistic timescale. Taken together, these results show that VEGF binds to matrix molecules in proximity of HUVECs in Matrigel, and suggest that bound VEGF drives vascular network patterning.

  1. Ab initio R-matrix calculations of e+-molecule scattering

    NASA Technical Reports Server (NTRS)

    Danby, Grahame; Tennyson, Jonathan

    1990-01-01

    The adaptation of the molecular R-matrix method, originally developed for electron-molecule collision studies, to positron scattering is discussed. Ab initio R-matrix calculations are presented for collisions of low energy positrons with a number of diatomic systems including H2, HF and N2. Differential elastic cross sections for positron-H2 show a minimum at about 45 deg for collision energies between 0.3 and 0.5 Ryd. The calculations predict a bound state of positronHF. Calculations on inelastic processes in N2 and O2 are also discussed.

  2. Orientational ordering of a banana-shaped solute molecule in a nematic calamitic solvent by {sup 2}H-NMR spectroscopy: An indication of glasslike behavior

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cinacchi, Giorgio; Domenici, Valentina

    The Saupe ordering matrix of a banana-shaped mesogenic molecule as a solute in a common nematic calamitic solvent has been determined by {sup 2}H-NMR spectroscopy as a function of temperature. The temperature dependence of the Saupe ordering matrix element associated with the principal molecular axis is consistent with a glassy behavior in the reorientational motion of this particular solute molecule. The Haller expression, appropriately modified, provides a good fit to the experimental data.

  3. Laser desorption/ionization mass spectrometry for direct profiling and imaging of small molecules from raw biological materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cha, Sangwon

    2008-01-01

    Matrix-assisted laser desorption/ionization(MALDI) mass spectrometry(MS) has been widely used for analysis of biological molecules, especially macromolecules such as proteins. However, MALDI MS has a problem in small molecule (less than 1 kDa) analysis because of the signal saturation by organic matrixes in the low mass region. In imaging MS (IMS), inhomogeneous surface formation due to the co-crystallization process by organic MALDI matrixes limits the spatial resolution of the mass spectral image. Therefore, to make laser desorption/ionization (LDI) MS more suitable for mass spectral profiling and imaging of small molecules directly from raw biological tissues, LDI MS protocols with various alternativemore » assisting materials were developed and applied to many biological systems of interest. Colloidal graphite was used as a matrix for IMS of small molecules for the first time and methodologies for analyses of small metabolites in rat brain tissues, fruits, and plant tissues were developed. With rat brain tissues, the signal enhancement for cerebroside species by colloidal graphite was observed and images of cerebrosides were successfully generated by IMS. In addition, separation of isobaric lipid ions was performed by imaging tandem MS. Directly from Arabidopsis flowers, flavonoids were successfully profiled and heterogeneous distribution of flavonoids in petals was observed for the first time by graphite-assisted LDI(GALDI) IMS.« less

  4. Multifunctional and biologically active matrices from multicomponent polymeric solutions

    NASA Technical Reports Server (NTRS)

    Kiick, Kristi L. (Inventor); Yamaguchi, Nori (Inventor)

    2010-01-01

    The present invention relates to a biologically active functionalized electrospun matrix to permit immobilization and long-term delivery of biologically active agents. In particular the invention relates to a functionalized polymer matrix comprising a matrix polymer, a compatibilizing polymer and a biomolecule or other small functioning molecule. In certain aspects the electrospun polymer fibers comprise at least one biologically active molecule functionalized with low molecular weight heparin. Examples of active molecules that may be used with the multicomponent polymer of the invention include, for example, a drug, a biopolymer, for example a growth factor, a protein, a peptide, a nucleotide, a polysaccharide, a biological macromolecule or the like. The invention is further directed to the formation of functionalized crosslinked matrices, such as hydrogels, that include at least one functionalized compatibilizing polymer capable of assembly.

  5. Poly(2-ethyl-2-oxazoline) as matrix excipient for drug formulation by hot melt extrusion and injection molding.

    PubMed

    Claeys, Bart; Vervaeck, Anouk; Vervaet, Chris; Remon, Jean Paul; Hoogenboom, Richard; De Geest, Bruno G

    2012-10-15

    Here we evaluate poly(2-ethyl-2-oxazoline)s (PEtOx) as a matrix excipient for the production of oral solid dosage forms by hot melt extrusion (HME) followed by injection molding (IM). Using metoprolol tartrate as a good water-soluble model drug we demonstrate that drug release can be delayed by HME/IM, with the release rate controlled by the molecular weight of the PEtOx. Using fenofibrate as a lipophilic model drug we demonstrate that relative to the pure drug the dissolution rate is strongly enhanced by formulation in HME/IM tablets. For both drug molecules we find that solid solutions, i.e. molecularly dissolved drug in a polymeric matrix, are obtained by HME/IM. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. G W calculations using the spectral decomposition of the dielectric matrix: Verification, validation, and comparison of methods

    DOE PAGES

    Pham, T. Anh; Nguyen, Huy -Viet; Rocca, Dario; ...

    2013-04-26

    Inmore » a recent paper we presented an approach to evaluate quasiparticle energies based on the spectral decomposition of the static dielectric matrix. This method does not require the calculation of unoccupied electronic states or the direct diagonalization of large dielectric matrices, and it avoids the use of plasmon-pole models. The numerical accuracy of the approach is controlled by a single parameter, i.e., the number of eigenvectors used in the spectral decomposition of the dielectric matrix. Here we present a comprehensive validation of the method, encompassing calculations of ionization potentials and electron affinities of various molecules and of band gaps for several crystalline and disordered semiconductors. Lastly, we demonstrate the efficiency of our approach by carrying out G W calculations for systems with several hundred valence electrons.« less

  7. Photooxidation of Trimethyl Phosphite in Nitrogen, Oxygen, and para-Hydrogen Matrixes at Low Temperatures.

    PubMed

    Ramanathan, N; Sundararajan, K; Gopi, R; Sankaran, K

    2017-03-16

    Trimethyl phosphite (TMPhite) was photooxidized to trimethyl phosphate (TMP) in N 2 , O 2 , and para-H 2 matrixes at low temperatures to correlate the conformational landscape of these two molecules. The photooxidation produced the trans (TGG)-rich conformer with respect to the ground state gauche (GGG) conformer of TMP in N 2 and O 2 matrixes, which has diverged from the conformational composition of freshly deposited pure TMP in the low-temperature matrixes. The enrichment of the trans conformer in preference to the gauche conformer of TMP during photooxidation is due to the TMPhite precursor, which exists exclusively in the trans conformer. Interestingly, whereas the photooxidized TMP molecule suffers site effects possibly due to the local asymmetry in N 2 and O 2 matrixes, in the para-H 2 matrix owing to the quantum crystal nature the site effects were observed to be self-repaired.

  8. Nanomaterials as Assisted Matrix of Laser Desorption/Ionization Time-of-Flight Mass Spectrometry for the Analysis of Small Molecules.

    PubMed

    Lu, Minghua; Yang, Xueqing; Yang, Yixin; Qin, Peige; Wu, Xiuru; Cai, Zongwei

    2017-04-21

    Matrix-assisted laser desorption/ionization (MALDI), a soft ionization method, coupling with time-of-flight mass spectrometry (TOF MS) has become an indispensible tool for analyzing macromolecules, such as peptides, proteins, nucleic acids and polymers. However, the application of MALDI for the analysis of small molecules (<700 Da) has become the great challenge because of the interference from the conventional matrix in low mass region. To overcome this drawback, more attention has been paid to explore interference-free methods in the past decade. The technique of applying nanomaterials as matrix of laser desorption/ionization (LDI), also called nanomaterial-assisted laser desorption/ionization (nanomaterial-assisted LDI), has attracted considerable attention in the analysis of low-molecular weight compounds in TOF MS. This review mainly summarized the applications of different types of nanomaterials including carbon-based, metal-based and metal-organic frameworks as assisted matrices for LDI in the analysis of small biological molecules, environmental pollutants and other low-molecular weight compounds.

  9. Nanomaterials as Assisted Matrix of Laser Desorption/Ionization Time-of-Flight Mass Spectrometry for the Analysis of Small Molecules

    PubMed Central

    Lu, Minghua; Yang, Xueqing; Yang, Yixin; Qin, Peige; Wu, Xiuru; Cai, Zongwei

    2017-01-01

    Matrix-assisted laser desorption/ionization (MALDI), a soft ionization method, coupling with time-of-flight mass spectrometry (TOF MS) has become an indispensible tool for analyzing macromolecules, such as peptides, proteins, nucleic acids and polymers. However, the application of MALDI for the analysis of small molecules (<700 Da) has become the great challenge because of the interference from the conventional matrix in low mass region. To overcome this drawback, more attention has been paid to explore interference-free methods in the past decade. The technique of applying nanomaterials as matrix of laser desorption/ionization (LDI), also called nanomaterial-assisted laser desorption/ionization (nanomaterial-assisted LDI), has attracted considerable attention in the analysis of low-molecular weight compounds in TOF MS. This review mainly summarized the applications of different types of nanomaterials including carbon-based, metal-based and metal-organic frameworks as assisted matrices for LDI in the analysis of small biological molecules, environmental pollutants and other low-molecular weight compounds. PMID:28430138

  10. DNA melting profiles from a matrix method.

    PubMed

    Poland, Douglas

    2004-02-05

    In this article we give a new method for the calculation of DNA melting profiles. Based on the matrix formulation of the DNA partition function, the method relies for its efficiency on the fact that the required matrices are very sparse, essentially reducing matrix multiplication to vector multiplication and thus making the computer time required to treat a DNA molecule containing N base pairs proportional to N(2). A key ingredient in the method is the result that multiplication by the inverse matrix can also be reduced to vector multiplication. The task of calculating the melting profile for the entire genome is further reduced by treating regions of the molecule between helix-plateaus, thus breaking the molecule up into independent parts that can each be treated individually. The method is easily modified to incorporate changes in the assignment of statistical weights to the different structural features of DNA. We illustrate the method using the genome of Haemophilus influenzae. Copyright 2003 Wiley Periodicals, Inc.

  11. Matrix isolation sublimation: An apparatus for producing cryogenic beams of atoms and molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sacramento, R. L.; Alves, B. X.; Silva, B. A.

    2015-07-15

    We describe the apparatus to generate cryogenic beams of atoms and molecules based on matrix isolation sublimation. Isolation matrices of Ne and H{sub 2} are hosts for atomic and molecular species which are sublimated into vacuum at cryogenic temperatures. The resulting cryogenic beams are used for high-resolution laser spectroscopy. The technique also aims at loading atomic and molecular traps.

  12. Efficient parallel linear scaling construction of the density matrix for Born-Oppenheimer molecular dynamics.

    PubMed

    Mniszewski, S M; Cawkwell, M J; Wall, M E; Mohd-Yusof, J; Bock, N; Germann, T C; Niklasson, A M N

    2015-10-13

    We present an algorithm for the calculation of the density matrix that for insulators scales linearly with system size and parallelizes efficiently on multicore, shared memory platforms with small and controllable numerical errors. The algorithm is based on an implementation of the second-order spectral projection (SP2) algorithm [ Niklasson, A. M. N. Phys. Rev. B 2002 , 66 , 155115 ] in sparse matrix algebra with the ELLPACK-R data format. We illustrate the performance of the algorithm within self-consistent tight binding theory by total energy calculations of gas phase poly(ethylene) molecules and periodic liquid water systems containing up to 15,000 atoms on up to 16 CPU cores. We consider algorithm-specific performance aspects, such as local vs nonlocal memory access and the degree of matrix sparsity. Comparisons to sparse matrix algebra implementations using off-the-shelf libraries on multicore CPUs, graphics processing units (GPUs), and the Intel many integrated core (MIC) architecture are also presented. The accuracy and stability of the algorithm are illustrated with long duration Born-Oppenheimer molecular dynamics simulations of 1000 water molecules and a 303 atom Trp cage protein solvated by 2682 water molecules.

  13. Adhesion molecules and receptors

    USDA-ARS?s Scientific Manuscript database

    Adhesion molecules are necessary for leukocyte trafficking and differentiation. They serve to initiate cell-cell interactions under conditions of shear, and they sustain the cell-cell and cell-matrix interactions needed for cellular locomotion. They also can serve directly as signaling molecules act...

  14. Electrophilic properties of common MALDI matrix molecules

    NASA Astrophysics Data System (ADS)

    Lippa, T. P.; Eustis, S. N.; Wang, D.; Bowen, K. H.

    2007-11-01

    The negative ion photoelectron spectra of the following MALDI matrix molecules have been measured: 3-carboxypyridine (nicotinic acid), 2,5-dihydroxybenzoic acid (DHB), 3,5-dimethoxy-4-hydroxycinnamic acid (sinapinic acid), 2,6-dihydroxyacetophenone (DHAP), 3-(4-hydroxy-3-methoxyphenyl)-2-propenoic acid (ferulic acid), 3-hydroxy-2-pyridinecarboxylic acid (3HPA), and 2,6-pyridinedicarboxylic acid (dipicolinic acid). Adiabatic electron affinities and vertical detachment energies were extracted from these spectra and reported. In addition, electron affinities were calculated for DHAP, ferulic acid, dipicolinic acid and sinapinic acid. Photoelectron spectra were also measured for the dimer anions of DHB and nicotinic acid and for the fragment anion in which alpha-cyano-cinnamic acid had lost a CO2 unit. Together, these results augment the database of presently available electrophilic data on common matrix molecules along with some of their dimers and fragments.

  15. Multifunctional curing agents and their use in improving strength of composites containing carbon fibers embedded in a polymeric matrix

    DOEpatents

    Vautard, Frederic; Ozcan, Soydan

    2017-04-11

    A functionalized carbon fiber having covalently bound on its surface a sizing agent containing epoxy groups, at least some of which are engaged in covalent bonds with crosslinking molecules, wherein each of said crosslinking molecules possesses at least two epoxy-reactive groups and at least one free functional group reactive with functional groups of a polymer matrix in which the carbon fiber is to be incorporated, wherein at least a portion of said crosslinking molecules are engaged, via at least two of their epoxy-reactive groups, in crosslinking bonds between at least two epoxy groups of the sizing agent. Composites comprised of these functionalized carbon fibers embedded in a polymeric matrix are also described. Methods for producing the functionalized carbon fibers and composites thereof are also described.

  16. Ab initio quantum chemical calculation of electron transfer matrix elements for large molecules

    NASA Astrophysics Data System (ADS)

    Zhang, Linda Yu; Friesner, Richard A.; Murphy, Robert B.

    1997-07-01

    Using a diabatic state formalism and pseudospectral numerical methods, we have developed an efficient ab initio quantum chemical approach to the calculation of electron transfer matrix elements for large molecules. The theory is developed at the Hartree-Fock level and validated by comparison with results in the literature for small systems. As an example of the power of the method, we calculate the electronic coupling between two bacteriochlorophyll molecules in various intermolecular geometries. Only a single self-consistent field (SCF) calculation on each of the monomers is needed to generate coupling matrix elements for all of the molecular pairs. The largest calculations performed, utilizing 1778 basis functions, required ˜14 h on an IBM 390 workstation. This is considerably less cpu time than would be necessitated with a supermolecule adiabatic state calculation and a conventional electronic structure code.

  17. Connection between the conformation and emission properties of poly[2-methoxy-5-(2'-ethyl-hexyloxy)-1,4-phenylene vinylene] single molecules during thermal annealing

    NASA Astrophysics Data System (ADS)

    Ou, Jiemei; Yang, Yuzhao; Lin, Wensheng; Yuan, Zhongke; Gan, Lin; Lin, Xiaofeng; Chen, Xudong; Chen, Yujie

    2015-03-01

    We investigated the transitions of conformations and their effects on emission properties of poly[2-methoxy-5-(2'-ethyl-hexyloxy)-1,4-phenylene vinylene] (MEH-PPV) single molecules in PMMA matrix during thermal annealing process. Total internal reflection fluorescence microscopy measurements reveal the transformation from collapsed conformations to extended, highly ordered rod-like structures of MEH-PPV single molecules during thermal annealing. The blue shifts in the ensemble single molecule PL spectra support our hypnosis. The transition occurs as the annealing temperature exceeds 100 °C, implying that an annealing temperature near the glass transition temperature Tg of matrix is ideal for the control and optimization of blend polymer films.

  18. The Roles of Water in the Protein Matrix: A Largely Untapped Resource for Drug Discovery.

    PubMed

    Spyrakis, Francesca; Ahmed, Mostafa H; Bayden, Alexander S; Cozzini, Pietro; Mozzarelli, Andrea; Kellogg, Glen E

    2017-08-24

    The value of thoroughly understanding the thermodynamics specific to a drug discovery/design study is well known. Over the past decade, the crucial roles of water molecules in protein structure, function, and dynamics have also become increasingly appreciated. This Perspective explores water in the biological environment by adopting its point of view in such phenomena. The prevailing thermodynamic models of the past, where water was seen largely in terms of an entropic gain after its displacement by a ligand, are now known to be much too simplistic. We adopt a set of terminology that describes water molecules as being "hot" and "cold", which we have defined as being easy and difficult to displace, respectively. The basis of these designations, which involve both enthalpic and entropic water contributions, are explored in several classes of biomolecules and structural motifs. The hallmarks for characterizing water molecules are examined, and computational tools for evaluating water-centric thermodynamics are reviewed. This Perspective's summary features guidelines for exploiting water molecules in drug discovery.

  19. Improving tissue preparation for matrix-assisted laser desorption ionization mass spectrometry imaging. Part 1: using microspotting.

    PubMed

    Franck, Julien; Arafah, Karim; Barnes, Alan; Wisztorski, Maxence; Salzet, Michel; Fournier, Isabelle

    2009-10-01

    Nowadays, matrix-assisted laser desorption ionization mass spectrometry imaging (MALDI MSI) is a powerful technique to obtain the distribution of endogenous and exogenous molecules within tissue sections. It can, thus, be used to study the evolution of molecules across different physiological stages in order to find out markers or get knowledge on signaling pathways. In order to provide valuable information, we must carefully control the sample preparation to avoid any delocalization of molecules of interest inside the tissue during this step. Currently, two strategies can be used to deposit chemicals, such as the MALDI matrix, onto the tissue both involving generation of microdroplets that will be dropped off onto the surface. First strategy involves microspraying of solutions. Here, we have been interested in the development of a microspotting strategy, where nanodroplets of solvent are ejected by a piezoelectric device to generate microspots at the tissue level. Such systems allow one to precisely control sample preparation by creating an array of spots. In terms of matrix crystallization, a microspotting MALDI matrix is hardly compatible with the results by classical (pipetting) methods. We have thus synthesized and studied new solid ionic matrixes in order to obtain high analytical performance using such a deposition system. These developments have enabled optimization of the preparation time because of the high stability of the printing that is generated in these conditions. We have also studied microspotting for performing on-tissue digestion in order to go for identification of proteins or to work from formalin fixed and paraffin embedded (FFPE) tissue samples. We have shown that microspotting is an interesting approach for on tissue digestion. Peptides, proteins, and lipids were studied under this specific preparation strategy to improve imaging performances for this class of molecules.

  20. Strongly contracted canonical transformation theory

    NASA Astrophysics Data System (ADS)

    Neuscamman, Eric; Yanai, Takeshi; Chan, Garnet Kin-Lic

    2010-01-01

    Canonical transformation (CT) theory describes dynamic correlation in multireference systems with large active spaces. Here we discuss CT theory's intruder state problem and why our previous approach of overlap matrix truncation becomes infeasible for sufficiently large active spaces. We propose the use of strongly and weakly contracted excitation operators as alternatives for dealing with intruder states in CT theory. The performance of these operators is evaluated for the H2O, N2, and NiO molecules, with comparisons made to complete active space second order perturbation theory and Davidson-corrected multireference configuration interaction theory. Finally, using a combination of strongly contracted CT theory and orbital-optimized density matrix renormalization group theory, we evaluate the singlet-triplet gap of free base porphin using an active space containing all 24 out-of-plane 2p orbitals. Modeling dynamic correlation with an active space of this size is currently only possible using CT theory.

  1. Laser-induced emission spectroscopy of matrix-isolated carbon molecules: Experimental setup and new results on C3

    NASA Astrophysics Data System (ADS)

    Čermák, Ivo; Förderer, Markus; Čermáková, Iva; Kalhofer, Stefan; Stopka-Ebeler, Helmut; Monninger, Gerold; Krätschmer, Wolfgang

    1998-06-01

    We have studied small carbon molecules using a matrix-isolation technique. Our experimental setup is described in detail. The carbon clusters were produced by evaporating graphite and trapping the carbon-vapor molecules in solid argon, where molecular growth could be induced by controlled matrix annealing. To identify the produced molecules, absorption spectroscopy in the ultraviolet (UV)-visible and infrared (IR) spectral ranges was applied. Additional characterization of the excited and ground states of the molecules was obtained from emission and excitation spectra. The molecules were excited by a pulsed dye laser system and the emission spectra were recorded with a high-sensitivity photodiode-array spectrometer. We present our measurements on linear C3. The à 1Πu excited state of linear C3 was populated by the electronic transition à 1Πu←X˜ 1Σg+, and the corresponding excitation spectra of the C3 fluorescence (à 1Πu→X˜ 1Σg+) and phosphorescence (ã 3Πu→X˜ 1Σg+) were studied. Comparison of excitation and absorption spectra yielded information on site effects due to the matrix environment. Emission bands in the fluorescence and phosphorescence spectra up to vibrational energies of 8500 cm-1 could be observed. The radiation lifetime of the à 1Πu excited state of C3 in solid argon was found to be shorter than 10 ns. The phosphorescence transition ã 3Πu→X˜ 1Σg+ decays in about 10 ms and its rise indicates fast vibrational relaxation within the triplet system. Our data support a linear ground state geometry for C3 also in solid argon.

  2. HGF potentiates extracellular matrix-driven migration of human myoblasts: involvement of matrix metalloproteinases and MAPK/ERK pathway.

    PubMed

    González, Mariela Natacha; de Mello, Wallace; Butler-Browne, Gillian S; Silva-Barbosa, Suse Dayse; Mouly, Vincent; Savino, Wilson; Riederer, Ingo

    2017-10-10

    The hepatocyte growth factor (HGF) is required for the activation of muscle progenitor cells called satellite cells (SC), plays a role in the migration of proliferating SC (myoblasts), and is present as a soluble factor during muscle regeneration, along with extracellular matrix (ECM) molecules. In this study, we aimed at determining whether HGF is able to interact with ECM proteins, particularly laminin 111 and fibronectin, and to modulate human myoblast migration. We evaluated the expression of the HGF-receptor c-Met, laminin, and fibronectin receptors by immunoblotting, flow cytometry, or immunofluorescence and used Transwell assays to analyze myoblast migration on laminin 111 and fibronectin in the absence or presence of HGF. Zymography was used to check whether HGF could modulate the production of matrix metalloproteinases by human myoblasts, and the activation of MAPK/ERK pathways was evaluated by immunoblotting. We demonstrated that human myoblasts express c-Met, together with laminin and fibronectin receptors. We observed that human laminin 111 and fibronectin have a chemotactic effect on myoblast migration, and this was synergistically increased when low doses of HGF were added. We detected an increase in MMP-2 activity in myoblasts treated with HGF. Conversely, MMP-2 inhibition decreased the HGF-associated stimulation of cell migration triggered by laminin or fibronectin. HGF treatment also induced in human myoblasts activation of MAPK/ERK pathways, whose specific inhibition decreased the HGF-associated stimulus of cell migration triggered by laminin 111 or fibronectin. We demonstrate that HGF induces ERK phosphorylation and MMP production, thus stimulating human myoblast migration on ECM molecules. Conceptually, these data state that the mechanisms involved in the migration of human myoblasts comprise both soluble and insoluble moieties. This should be taken into account to optimize the design of therapeutic cell transplantation strategies by improving the migration of donor cells within the host tissue, a main issue regarding this approach.

  3. MAGP1, the extracellular matrix, and metabolism

    PubMed Central

    Craft, Clarissa S

    2014-01-01

    Adipose tissue and the extracellular matrix were once considered passive players in regulating physiological processes. Now, both entities are acknowledged for their capacity to engage signal transduction pathways, and for their involvement in maintaining normal tissue homeostasis. We recently published a series of studies that identified a novel mechanism whereby an extracellular matrix molecule, MAGP1 (microfibril associated glycoprotein 1), can regulate energy metabolism in adipose tissue. MAGP1 is a component of extracellular microfibrils and plays a supportive role in maintaining thermoregulation by indirectly regulating expression of the thermogenic uncoupling proteins (UCPs). The focus of this commentary is to draw attention to the role of the extracellular matrix in regulating the bioavailability of signaling molecules, like transforming growth factor β (TGFβ), and exemplify that a better understanding of the extracellular matrix's biological properties could unveil a new source of therapeutic targets for metabolic diseases. PMID:26167404

  4. MAGP1, the extracellular matrix, and metabolism.

    PubMed

    Craft, Clarissa S

    2015-01-01

    Adipose tissue and the extracellular matrix were once considered passive players in regulating physiological processes. Now, both entities are acknowledged for their capacity to engage signal transduction pathways, and for their involvement in maintaining normal tissue homeostasis. We recently published a series of studies that identified a novel mechanism whereby an extracellular matrix molecule, MAGP1 (microfibril associated glycoprotein 1), can regulate energy metabolism in adipose tissue. MAGP1 is a component of extracellular microfibrils and plays a supportive role in maintaining thermoregulation by indirectly regulating expression of the thermogenic uncoupling proteins (UCPs). The focus of this commentary is to draw attention to the role of the extracellular matrix in regulating the bioavailability of signaling molecules, like transforming growth factor β (TGFβ), and exemplify that a better understanding of the extracellular matrix's biological properties could unveil a new source of therapeutic targets for metabolic diseases.

  5. The mesangial matrix in the normal and sclerotic glomerulus.

    PubMed

    Rosenblum, N D

    1994-02-01

    Mesangial sclerosis is a final common pathway to glomerular destruction in a variety of glomerular diseases. The expression of several classes of extracellular matrix (ECM) molecules has been defined in the normal and diseased mesangial matrix (MM). However, the manner in which these ECM components determine the three dimensional structure and function of the MM remains to be defined. Structural studies of the MM suggest that its constituent molecules are regionally organized into subcompartments with different three dimensional structures. The diversity of matrix molecules expressed within the MM as well as the organization of these components in nonrenal ECM's, such as the cornea, provides further support for this organizational model. The study of the cornea has also revealed that novel short chain collagenous proteins partially determine the three dimensional structure of the matrix. Recently, a novel collagen, type VIII collagen, has been described in mesangial cells and in the intact glomerulus. It is hypothesized that type VIII collagen is expressed both as a polymer and as a monomer within the glomerulus, and depending on its conformation, may serve unique functions. In the chronically diseased MM, normal MM components are overexpressed and fibrillar collagens are expressed de novo in a delayed fashion. Enhanced proteoglycan expression, observed early in disease, may determine increased volume of the mesangium. This, in turn, may stimulate the production of fibrillar collagens by mesangial cells resulting in a fibrillar noncompliant mesangial matrix.

  6. The role of the tunneling matrix element and nuclear reorganization in the design of quantum-dot cellular automata molecules

    NASA Astrophysics Data System (ADS)

    Henry, Jackson; Blair, Enrique P.

    2018-02-01

    Mixed-valence molecules provide an implementation for a high-speed, energy-efficient paradigm for classical computing known as quantum-dot cellular automata (QCA). The primitive device in QCA is a cell, a structure with multiple quantum dots and a few mobile charges. A single mixed-valence molecule can function as a cell, with redox centers providing quantum dots. The charge configuration of a molecule encodes binary information, and device switching occurs via intramolecular electron transfer between dots. Arrays of molecular cells adsorbed onto a substrate form QCA logic. Individual cells in the array are coupled locally via the electrostatic electric field. This device networking enables general-purpose computing. Here, a quantum model of a two-dot molecule is built in which the two-state electronic system is coupled to the dominant nuclear vibrational mode via a reorganization energy. This model is used to explore the effects of the electronic inter-dot tunneling (coupling) matrix element and the reorganization energy on device switching. A semi-classical reduction of the model also is made to investigate the competition between field-driven device switching and the electron-vibrational self-trapping. A strong electron-vibrational coupling (high reorganization energy) gives rise to self-trapping, which inhibits the molecule's ability to switch. Nonetheless, there remains an expansive area in the tunneling-reorganization phase space where molecules can support adequate tunneling. Thus, the relationship between the tunneling matrix element and the reorganization energy affords significant leeway in the design of molecules viable for QCA applications.

  7. Matrix isolation as a tool for studying interstellar chemical reactions

    NASA Technical Reports Server (NTRS)

    Ball, David W.; Ortman, Bryan J.; Hauge, Robert H.; Margrave, John L.

    1989-01-01

    Since the identification of the OH radical as an interstellar species, over 50 molecular species were identified as interstellar denizens. While identification of new species appears straightforward, an explanation for their mechanisms of formation is not. Most astronomers concede that large bodies like interstellar dust grains are necessary for adsorption of molecules and their energies of reactions, but many of the mechanistic steps are unknown and speculative. It is proposed that data from matrix isolation experiments involving the reactions of refractory materials (especially C, Si, and Fe atoms and clusters) with small molecules (mainly H2, H2O, CO, CO2) are particularly applicable to explaining mechanistic details of likely interstellar chemical reactions. In many cases, matrix isolation techniques are the sole method of studying such reactions; also in many cases, complexations and bond rearrangements yield molecules never before observed. The study of these reactions thus provides a logical basis for the mechanisms of interstellar reactions. A list of reactions is presented that would simulate interstellar chemical reactions. These reactions were studied using FTIR-matrix isolation techniques.

  8. The ab-initio density matrix renormalization group in practice.

    PubMed

    Olivares-Amaya, Roberto; Hu, Weifeng; Nakatani, Naoki; Sharma, Sandeep; Yang, Jun; Chan, Garnet Kin-Lic

    2015-01-21

    The ab-initio density matrix renormalization group (DMRG) is a tool that can be applied to a wide variety of interesting problems in quantum chemistry. Here, we examine the density matrix renormalization group from the vantage point of the quantum chemistry user. What kinds of problems is the DMRG well-suited to? What are the largest systems that can be treated at practical cost? What sort of accuracies can be obtained, and how do we reason about the computational difficulty in different molecules? By examining a diverse benchmark set of molecules: π-electron systems, benchmark main-group and transition metal dimers, and the Mn-oxo-salen and Fe-porphine organometallic compounds, we provide some answers to these questions, and show how the density matrix renormalization group is used in practice.

  9. Large scale nanoparticle screening for small molecule analysis in laser desorption ionization mass spectrometry

    DOE PAGES

    Yagnik, Gargey B.; Hansen, Rebecca L.; Korte, Andrew R.; ...

    2016-08-30

    Nanoparticles (NPs) have been suggested as efficient matrixes for small molecule profiling and imaging by laser-desorption ionization mass spectrometry (LDI-MS), but so far there has been no systematic study comparing different NPs in the analysis of various classes of small molecules. Here, we present a large scale screening of 13 NPs for the analysis of two dozen small metabolite molecules. Many NPs showed much higher LDI efficiency than organic matrixes in positive mode and some NPs showed comparable efficiencies for selected analytes in negative mode. Our results suggest that a thermally driven desorption process is a key factor for metalmore » oxide NPs, but chemical interactions are also very important, especially for other NPs. Furthermore, the screening results provide a useful guideline for the selection of NPs in the LDI-MS analysis of small molecules.« less

  10. Large scale nanoparticle screening for small molecule analysis in laser desorption ionization mass spectrometry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yagnik, Gargey B.; Hansen, Rebecca L.; Korte, Andrew R.

    Nanoparticles (NPs) have been suggested as efficient matrixes for small molecule profiling and imaging by laser-desorption ionization mass spectrometry (LDI-MS), but so far there has been no systematic study comparing different NPs in the analysis of various classes of small molecules. Here, we present a large scale screening of 13 NPs for the analysis of two dozen small metabolite molecules. Many NPs showed much higher LDI efficiency than organic matrixes in positive mode and some NPs showed comparable efficiencies for selected analytes in negative mode. Our results suggest that a thermally driven desorption process is a key factor for metalmore » oxide NPs, but chemical interactions are also very important, especially for other NPs. Furthermore, the screening results provide a useful guideline for the selection of NPs in the LDI-MS analysis of small molecules.« less

  11. The cell clone ecology hypothesis and the cell fusion model of cancer progression and metastasis (II): three pathways for spontaneous cell-cell fusion and escape from the intercellular matrix.

    PubMed

    Parris, George

    2006-01-01

    The two-stage initiation-progression model of cancer is widely accepted. Initiation appears to result most often from accumulation of damage to the DNA expressed as multiple mutations in the phenotype. Unsymmetrical chromosome segregation during mitosis of normal or mutated cells produces aneuploid cells and also contributes to the evolution of neoplasia. However, it has been pointed out (Parris GE. Med Hypotheses 2005;65:993-4 and 2006;66:76-83) that DNA damage and loss of chromosomes are much more likely to lead the mutant clones of cells to extinction than to successful expansion (e.g., an example of Muller's Ratchet). It was argued that aneuploid neoplasia represent new parasite species that successfully evolve to devour their hosts by incorporating sex-like redistribution of chromosomes through spontaneous or virus-catalyzed cell-cell fusion into their life-cycle. Spontaneous cell-cell fusion is generally blocked by the intercellular matrix to which the cells are bound via surface adhesion molecules (frequently glycoproteins, e.g., CD44). In order for progression of matrix-contained neoplasia toward clinically significant cancer to occur, the parasite cells must escape from the matrix and fuse. Release from the matrix also allows the parasite cells to invade adjacent tissues and metastasize to remote locations. Both invasion and metastasis likely involve fusion of the migrating parasite cells with fusion-prone blast cells. There are at least three pathways through which parasite cells can be liberated from the confining matrix: (i) Their adhesion molecules may be modified (e.g., by hyper-glycosylation) so that they can no longer grip the matrix. (ii) Their adhesion molecules or matrix may be saturated with other ligands (e.g., polyamines). (iii) Their adhesion molecules may be cleaved from the cell surface or the matrix itself may be cleaved (e.g., by MMPs or ADAMs). It is hypothesized that mobilization of parasite cells and cell-cell fusion go hand-in-hand in the progression of neoplasia to clinically significant cancer through invasion and metastasis. The latency between tumor recognition and exposure to mutagens and the increased incidence of cancer with age can probably be related to slow breakdown of the intercellular matrix that provides a barrier to cell-cell fusion.

  12. Expression of adhesion molecules, chemokines and matrix metallo- proteinases (MMPs) in viable and degenerating stage of Taenia solium metacestode in swine neurocysticercosis.

    PubMed

    Singh, Satyendra K; Singh, Aloukick K; Prasad, Kashi N; Singh, Amrita; Singh, Avinash; Rai, Ravi P; Tripathi, Mukesh; Gupta, Rakesh K; Husain, Nuzhat

    2015-11-30

    Neurocysticercosis (NCC) is a parasitic infection of central nervous system (CNS). Expression of adhesion molecules, chemokines and matrix metalloproteinases (MMPs) were investigated on brain tissues surrounding viable (n=15) and degenerating cysticerci (n=15) of Taenia solium in swine by real-time RT-PCR and ELISA. Gelatin gel zymography was performed for MMPs activity. ICAM-1 (intercellular adhesion molecule-1), E-selectin, MIP-1α (macrophage inflammatory protein-1α), Eotaxin-1 and RANTES (regulated on activation, normal T cell expressed and secreted) were associated with degenerating cysticerci (cysts). However, VCAM-1 (vascular cell adhesion molecule-1), MCP-1 (monocyte chemotactic protein-1), MMP-2 and MMP-9 were associated with both viable and degenerating cysts. In conclusion, viable and degenerating cysticerci have different immune molecule profiles and role of these molecules in disease pathogenesis needs to be investigated. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Evaluation of cultured human dermal- and dermo-epidermal substitutes focusing on extracellular matrix components: Comparison of protein and RNA analysis.

    PubMed

    Oostendorp, Corien; Meyer, Sarah; Sobrio, Monia; van Arendonk, Joyce; Reichmann, Ernst; Daamen, Willeke F; van Kuppevelt, Toin H

    2017-05-01

    Treatment of full-thickness skin defects with split-thickness skin grafts is generally associated with contraction and scar formation and cellular skin substitutes have been developed to improve skin regeneration. The evaluation of cultured skin substitutes is generally based on qualitative parameters focusing on histology. In this study we focused on quantitative evaluation to provide a template for comparison of human bio-engineered skin substitutes between clinical and/or research centers, and to supplement histological data. We focused on extracellular matrix proteins since these components play an important role in skin regeneration. As a model we analyzed the human dermal substitute denovoDerm and the dermo-epidermal skin substitute denovoSkin. The quantification of the extracellular matrix proteins type III collagen and laminin 5 in tissue homogenates using western blotting analysis and ELISA was not successful. The same was true for assaying lysyl oxidase, an enzyme involved in crosslinking of matrix molecules. As an alternative, gene expression levels were measured using qPCR. Various RNA isolation procedures were probed. The gene expression profile for specific dermal and epidermal genes could be measured reliably and reproducibly. Differences caused by changes in the cell culture conditions could easily be detected. The number of cells in the skin substitutes was measured using the PicoGreen dsDNA assay, which was found highly quantitative and reproducible. The (dis) advantages of assays used for quantitative evaluation of skin substitutes are discussed. Copyright © 2016 Elsevier Ltd and ISBI. All rights reserved.

  14. Carbon based sample supports and matrices for laser desorption/ ionization mass spectrometry.

    PubMed

    Rainer, Matthias; Najam-ul-Haq, Muhammad; Huck, Christian W; Vallant, Rainer M; Heigl, Nico; Hahn, Hans; Bakry, Rania; Bonn, Günther K

    2007-01-01

    Laser desorption/ionization mass spectrometry (LDI-MS) is a widespread and powerful technique for mass analysis allowing the soft ionization of molecules such as peptides, proteins and carbohydrates. In many applications, an energy absorbing matrix has to be added to the analytes in order to protect them from being fragmented by direct laser beam. LDI-MS in conjunction with matrix is commonly referred as matrix-assisted LDI (MALDI). One of the striking disadvantages of this method is the desorption of matrix molecules, which causes interferences originating from matrix background ions in lower mass range (< 1000 Da). This has been led to the development of a variety of different carbon based LDI sample supports, which are capable of absorbing laser light and simultaneously transfering energy to the analytes for desorption. Furthermore carbon containing sample supports are used as carrier materials for the specific binding and preconcentration of molecules out of complex samples. Their subsequent analysis with MALDI mass spectrometry allows performing studies in metabolomics and proteomics. Finally a thin layer of carbon significantly improves sensitivity concerning detection limit. Analytes in low femtomole and attomole range can be detected in this regard. In the present article, these aspects are reviewed from patents where nano-based carbon materials are comprehensively utilized.

  15. CO2 in solid para-hydrogen: spectral splitting and the CO2···(o-H2)n clusters.

    PubMed

    Du, Jun-He; Wan, Lei; Wu, Lei; Xu, Gang; Deng, Wen-Ping; Liu, An-Wen; Chen, Yang; Hu, Shui-Ming

    2011-02-17

    Complicated high-resolution spectral structures are often observed for molecules doped in solid molecular hydrogen. The structures can result from miscellaneous effects and are often interpreted differently in references. The spectrum of the ν(3) band of CO(2) in solid para-H(2) presents a model system which exhibits rich spectral structures. With the help of the potential energy simulation of the CO(2) molecule doped in para-hydrogen matrix, and extensive experiments with different CO(2) isotopologues and different ortho-hydrogen concentrations in the matrix, the spectral features observed in p-H(2) matrix are assigned to the CO(2)···(o-H(2))(n) clusters and also to energy level splitting that is due to different alignments of the doped CO(2) molecules in the matrix. The assignments are further supported by the dynamics analysis and also by the spectrum recorded with sample codoped with O(2) which serves as catalyst transferring o-H(2) to p-H(2) in the matrix at 4 K temperature. The observed spectral features of CO(2)/pH(2) can potentially be used as an alternative readout of the temperature and orthohydrogen concentration in the solid para-hydrogen.

  16. Quantitative confocal fluorescence microscopy of dynamic processes by multifocal fluorescence correlation spectroscopy

    NASA Astrophysics Data System (ADS)

    Krmpot, Aleksandar J.; Nikolić, Stanko N.; Vitali, Marco; Papadopoulos, Dimitrios K.; Oasa, Sho; Thyberg, Per; Tisa, Simone; Kinjo, Masataka; Nilsson, Lennart; Gehring, Walter J.; Terenius, Lars; Rigler, Rudolf; Vukojevic, Vladana

    2015-07-01

    Quantitative confocal fluorescence microscopy imaging without scanning is developed for the study of fast dynamical processes. The method relies on the use of massively parallel Fluorescence Correlation Spectroscopy (mpFCS). Simultaneous excitation of fluorescent molecules across the specimen is achieved by passing a single laser beam through a Diffractive Optical Element (DOE) to generate a quadratic illumination matrix of 32×32 light sources. Fluorescence from 1024 illuminated spots is detected in a confocal arrangement by a matching matrix detector consisting of the same number of single-photon avalanche photodiodes (SPADs). Software was developed for data acquisition and fast autoand cross-correlation analysis by parallel signal processing using a Graphic Processing Unit (GPU). Instrumental performance was assessed using a conventional single-beam FCS instrument as a reference. Versatility of the approach for application in biomedical research was evaluated using ex vivo salivary glands from Drosophila third instar larvae expressing a fluorescently-tagged transcription factor Sex Combs Reduced (Scr) and live PC12 cells stably expressing the fluorescently tagged mu-opioid receptor (MOPeGFP). We show that quantitative mapping of local concentration and mobility of transcription factor molecules across the specimen can be achieved using this approach, which paves the way for future quantitative characterization of dynamical reaction-diffusion landscapes across live cells/tissue with a submillisecond temporal resolution (presently 21 μs/frame) and single-molecule sensitivity.

  17. Surface-assisted laser desorption ionization mass spectrometry techniques for application in forensics.

    PubMed

    Guinan, Taryn; Kirkbride, Paul; Pigou, Paul E; Ronci, Maurizio; Kobus, Hilton; Voelcker, Nicolas H

    2015-01-01

    Matrix-assisted laser desorption ionization (MALDI) mass spectrometry (MS) is an excellent analytical technique for the rapid and sensitive analysis of macromolecules (>700 Da), such as peptides, proteins, nucleic acids, and synthetic polymers. However, the detection of smaller organic molecules with masses below 700 Da using MALDI-MS is challenging due to the appearance of matrix adducts and matrix fragment peaks in the same spectral range. Recently, nanostructured substrates have been developed that facilitate matrix-free laser desorption ionization (LDI), contributing to an emerging analytical paradigm referred to as surface-assisted laser desorption ionization (SALDI) MS. Since SALDI enables the detection of small organic molecules, it is rapidly growing in popularity, including in the field of forensics. At the same time, SALDI also holds significant potential as a high throughput analytical tool in roadside, work place and athlete drug testing. In this review, we discuss recent advances in SALDI techniques such as desorption ionization on porous silicon (DIOS), nano-initiator mass spectrometry (NIMS) and nano assisted laser desorption ionization (NALDI™) and compare their strengths and weaknesses with particular focus on forensic applications. These include the detection of illicit drug molecules and their metabolites in biological matrices and small molecule detection from forensic samples including banknotes and fingerprints. Finally, the review highlights recent advances in mass spectrometry imaging (MSI) using SALDI techniques. © 2014 Wiley Periodicals, Inc.

  18. High Matrix Metalloproteinase Activity is a Hallmark of Periapical Granulomas

    PubMed Central

    de Paula e Silva, Francisco Wanderley Garcia; D'Silva, Nisha J.; da Silva, Léa Assed Bezerra; Kapila, Yvonne Lorraine

    2009-01-01

    Introduction Inability to distinguish periapical cysts from granulomas prior to performing root canal treatment leads to uncertainty in treatment outcomes, because cysts have lower healing rates. Searching for differential expression of molecules within cysts or granulomas could provide information with regard to the identity of the lesion or suggest mechanistic differences that may form the basis for future therapeutic intervention. Thus, we investigated whether granulomas and cysts exhibit differential expression of extracellular matrix (ECM) molecules. Methods Human periapical granulomas, periapical cysts, and healthy periodontal ligament tissues were used to investigate the differential expression of ECM molecules by microarray analysis. Since matrix metalloproteinases (MMP) showed the highest differential expression in the microarray analysis, MMPs were further examined by in situ zymography and immunohistochemistry. Data were analyzed using one-way ANOVA followed by Tukey test. Results We observed that cysts and granulomas differentially expressed several ECM molecules, especially those from the matrix metalloproteinase (MMP) family. Compared to cysts, granulomas exhibited higher MMP enzymatic activity in areas stained for MMP-9. These areas were composed of polymorphonuclear cells (PMNs), in contrast to cysts. Similarly, MMP-13 was expressed by a greater number of cells in granulomas compared to cysts. Conclusion Our findings indicate that high enzymatic MMP activity in PMNs together with MMP-9 and MMP-13 stained cells could be a molecular signature of granulomas, unlike periapical cysts. PMID:19720222

  19. Using monomer vibrational wavefunctions to compute numerically exact (12D) rovibrational levels of water dimer

    NASA Astrophysics Data System (ADS)

    Wang, Xiao-Gang; Carrington, Tucker

    2018-02-01

    We compute numerically exact rovibrational levels of water dimer, with 12 vibrational coordinates, on the accurate CCpol-8sf ab initio flexible monomer potential energy surface [C. Leforestier et al., J. Chem. Phys. 137, 014305 (2012)]. It does not have a sum-of-products or multimode form and therefore quadrature in some form must be used. To do the calculation, it is necessary to use an efficient basis set and to develop computational tools, for evaluating the matrix-vector products required to calculate the spectrum, that obviate the need to store the potential on a 12D quadrature grid. The basis functions we use are products of monomer vibrational wavefunctions and standard rigid-monomer basis functions (which involve products of three Wigner functions). Potential matrix-vector products are evaluated using the F matrix idea previously used to compute rovibrational levels of 5-atom and 6-atom molecules. When the coupling between inter- and intra-monomer coordinates is weak, this crude adiabatic type basis is efficient (only a few monomer vibrational wavefunctions are necessary), although the calculation of matrix elements is straightforward. It is much easier to use than an adiabatic basis. The product structure of the basis is compatible with the product structure of the kinetic energy operator and this facilitates computation of matrix-vector products. Compared with the results obtained using a [6 + 6]D adiabatic approach, we find good agreement for the inter-molecular levels and larger differences for the intra-molecular water bend levels.

  20. Using monomer vibrational wavefunctions to compute numerically exact (12D) rovibrational levels of water dimer.

    PubMed

    Wang, Xiao-Gang; Carrington, Tucker

    2018-02-21

    We compute numerically exact rovibrational levels of water dimer, with 12 vibrational coordinates, on the accurate CCpol-8sf ab initio flexible monomer potential energy surface [C. Leforestier et al., J. Chem. Phys. 137, 014305 (2012)]. It does not have a sum-of-products or multimode form and therefore quadrature in some form must be used. To do the calculation, it is necessary to use an efficient basis set and to develop computational tools, for evaluating the matrix-vector products required to calculate the spectrum, that obviate the need to store the potential on a 12D quadrature grid. The basis functions we use are products of monomer vibrational wavefunctions and standard rigid-monomer basis functions (which involve products of three Wigner functions). Potential matrix-vector products are evaluated using the F matrix idea previously used to compute rovibrational levels of 5-atom and 6-atom molecules. When the coupling between inter- and intra-monomer coordinates is weak, this crude adiabatic type basis is efficient (only a few monomer vibrational wavefunctions are necessary), although the calculation of matrix elements is straightforward. It is much easier to use than an adiabatic basis. The product structure of the basis is compatible with the product structure of the kinetic energy operator and this facilitates computation of matrix-vector products. Compared with the results obtained using a [6 + 6]D adiabatic approach, we find good agreement for the inter-molecular levels and larger differences for the intra-molecular water bend levels.

  1. Second rank direction cosine spherical tensor operators and the nuclear electric quadrupole hyperfine structure Hamiltonian of rotating molecules

    NASA Astrophysics Data System (ADS)

    di Lauro, C.

    2018-03-01

    Transformations of vector or tensor properties from a space-fixed to a molecule-fixed axis system are often required in the study of rotating molecules. Spherical components λμ,ν of a first rank irreducible tensor can be obtained from the direction cosines between the two axis systems, and a second rank tensor with spherical components λμ,ν(2) can be built from the direct product λ × λ. It is shown that the treatment of the interaction between molecular rotation and the electric quadrupole of a nucleus is greatly simplified, if the coefficients in the axis-system transformation of the gradient of the electric field of the outer charges at the coupled nucleus are arranged as spherical components λμ,ν(2). Then the reduced matrix elements of the field gradient operators in a symmetric top eigenfunction basis, including their dependence on the molecule-fixed z-angular momentum component k, can be determined from the knowledge of those of λ(2) . The hyperfine structure Hamiltonian Hq is expressed as the sum of terms characterized each by a value of the molecule-fixed index ν, whose matrix elements obey the rule Δk = ν. Some of these terms may vanish because of molecular symmetry, and the specific cases of linear and symmetric top molecules, orthorhombic molecules, and molecules with symmetry lower than orthorhombic are considered. Each ν-term consists of a contraction of the rotational tensor λ(2) and the nuclear quadrupole tensor in the space-fixed frame, and its matrix elements in the rotation-nuclear spin coupled representation can be determined by the standard spherical tensor methods.

  2. New insights into the roles of matrix metalloproteinases in colorectal cancer development and progression.

    PubMed

    Leeman, Matthew F; Curran, Stephanie; Murray, Graeme I

    2003-12-01

    This review outlines new concepts that are emerging for the functions of matrix metalloproteinases in colorectal cancer development and progression. The two main concepts that will be discussed are the role of matrix metalloproteinases in the early stages of colorectal tumour development and the functional mechanisms by which matrix metalloproteinases contribute to colorectal tumour invasion and metastasis. The matrix metalloproteinases are a group of enzymes, which have been best characterized for their ability to degrade extracellular matrix proteins and thus they have been extensively studied in tumour invasion. It is now becoming recognized that the matrix metalloproteinases have key roles in a variety of biological processes that are distinct from their well-defined role in matrix degradation. This group of enzymes has been shown to interact with a broad range of non-matrix proteins including growth factors and their receptors, mediators of apoptosis, and cell adhesion molecules. The elucidation of novel biological roles for the matrix metalloproteinases also challenges the current predominant concept of matrix metalloproteinases as enzymes only involved in matrix degradation. Recent studies have shown that several matrix metalloproteinases, especially matrilysin (MMP-7), interact with the specific molecular genetic and signalling pathways involved in colorectal cancer development. In particular, matrilysin is activated at an early stage of colorectal tumourigenesis by the beta-catenin signalling pathway. Furthermore, studies are now elucidating specific mechanisms by which individual matrix metalloproteinases, especially membrane-type matrix metalloproteinases, interact with specific cell adhesion molecules and cytoskeletal proteins and thus contribute dynamically to colorectal tumour invasion. Copyright 2003 John Wiley & Sons, Ltd.

  3. Applying AFM-based nanofabrication for measuring the thickness of nanopatterns: the role of head groups in the vertical self-assembly of omega-functionalized n-alkanethiols.

    PubMed

    Kelley, Algernon T; Ngunjiri, Johnpeter N; Serem, Wilson K; Lawrence, Steve O; Yu, Jing-Jiang; Crowe, William E; Garno, Jayne C

    2010-03-02

    Molecules of n-alkanethiols with methyl head groups typically form well-ordered monolayers during solution self-assembly for a wide range of experimental conditions. However, we have consistently observed that, for either carboxylic acid or thiol-terminated n-alkanethiols, under certain conditions nanografted patterns are generated with a thickness corresponding precisely to a double layer. To investigate the role of head groups for solution self-assembly, designed patterns of omega-functionalized n-alkanethiols were nanografted with systematic changes in concentration. Nanografting is an in situ approach for writing patterns of thiolated molecules on gold surfaces by scanning with an AFM tip under high force, accomplished in dilute solutions of desired ink molecules. As the tip is scanned across the surface of a self-assembled monolayer under force, the matrix molecules are displaced from the surface and are immediately replaced with fresh molecules from solution to generate nanopatterns. In this report, side-by-side comparison of nanografted patterns is achieved for different matrix molecules using AFM images. The chain length and head groups (i.e., carboxyl, hydroxyl, methyl, thiol) were varied for the nanopatterns and matrix monolayers. Interactions such as head-to-head dimerization affect the vertical self-assembly of omega-functionalized n-alkanethiol molecules within nanografted patterns. At certain threshold concentrations, double layers were observed to form when nanografting with head groups of carboxylic acid and dithiols, whereas single layers were generated exclusively for nanografted patterns with methyl and hydroxyl groups, regardless of changes in concentration.

  4. Penetration of analogues of H2O and CO2 in proteins studied by room temperature phosphorescence of tryptophan.

    PubMed

    Wright, W W; Owen, C S; Vanderkooi, J M

    1992-07-21

    The influence of the protein matrix on the reactivity of external molecules with a species buried within the protein interior is considered in two general ways: (1) there may be structural fluctuations that allow for the diffusive penetration of the small molecules and/or (2) the external molecule may react over a distance. As a means to study the protein matrix, a reactive species within the protein can be formed by exciting tryptophan to the triplet state, and then the reaction of the triplet-state molecule with an external molecule can be monitored by a decrease in phosphorescence. In this work, the quenching ability (i.e., reactivity) was examined for H2S, CS2, and NO2- acting on tryptophan phosphorescence in parvalbumin, azurin, horse liver alcohol dehydrogenase, and alkaline phosphatase. A comparison of charged versus uncharged quenchers (H2S vs SH- and CS2 vs NO2-) reveals that the uncharged molecules are much more effective than charged species in quenching the phosphorescence of fully buried tryptophan, whereas the quenching for exposed tryptophan is relatively independent of the charge of the quencher. This is consistent with the view that uncharged triatomic molecules can penetrate the protein matrix to some extent. The energies of activation of the quenching reaction are low for the charged quenchers and higher for the uncharged CS2. A model is presented in which the quenchability of a buried tryptophan is inversely related to the distance from the surface when diffusion through the protein is the rate-limiting step.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. Chondrogenic properties of collagen type XI, a component of cartilage extracellular matrix.

    PubMed

    Li, Ang; Wei, Yiyong; Hung, Clark; Vunjak-Novakovic, Gordana

    2018-08-01

    Cartilage extracellular matrix (ECM) has been used for promoting tissue engineering. However, the exact effects of ECM on chondrogenesis and the acting mechanisms are not well understood. In this study, we investigated the chondrogenic effects of cartilage ECM on human mesenchymal stem cells (MSCs) and identified the contributing molecular components. To this end, a preparation of articular cartilage ECM was supplemented to pellets of chondrogenically differentiating MSCs, pellets of human chondrocytes, and bovine articular cartilage explants to evaluate the effects on cell proliferation and the production of cartilaginous matrix. Selective enzymatic digestion and screening of ECM components were conducted to identify matrix molecules with chondrogenic properties. Cartilage ECM promoted MSC proliferation, production of cartilaginous matrix, and maturity of chondrogenic differentiation, and inhibited the hypertrophic differentiation of MSC-derived chondrocytes. Selective digestion of ECM components revealed a contributory role of collagens in promoting chondrogenesis. The screening of various collagen subtypes revealed strong chondrogenic effect of collagen type XI. Finally, collagen XI was found to promote production and inhibit degradation of cartilage matrix in human articular chondrocyte pellets and bovine articular cartilage explants. Our results indicate that cartilage ECM promotes chondrogenesis and inhibits hypertrophic differentiation in MSCs. Collagen type XI is the ECM component that has the strongest effects on enhancing the production and inhibiting the degradation of cartilage matrix. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Biomedical application of MALDI mass spectrometry for small-molecule analysis.

    PubMed

    van Kampen, Jeroen J A; Burgers, Peter C; de Groot, Ronald; Gruters, Rob A; Luider, Theo M

    2011-01-01

    Matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) is an emerging analytical tool for the analysis of molecules with molar masses below 1,000 Da; that is, small molecules. This technique offers rapid analysis, high sensitivity, low sample consumption, a relative high tolerance towards salts and buffers, and the possibility to store sample on the target plate. The successful application of the technique is, however, hampered by low molecular weight (LMW) matrix-derived interference signals and by poor reproducibility of signal intensities during quantitative analyses. In this review, we focus on the biomedical application of MALDI-MS for the analysis of small molecules and discuss its favorable properties and its challenges as well as strategies to improve the performance of the technique. Furthermore, practical aspects and applications are presented. © 2010 Wiley Periodicals, Inc.

  7. Electroluminescence from completely horizontally oriented dye molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Komino, Takeshi; Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395; Japan Science and Technology Agency, ERATO, Adachi Molecular Exciton Engineering Project, 744 Motooka, Nishi, Fukuoka 819-0395

    2016-06-13

    A complete horizontal molecular orientation of a linear-shaped thermally activated delayed fluorescent guest emitter 2,6-bis(4-(10Hphenoxazin-10-yl)phenyl)benzo[1,2-d:5,4-d′] bis(oxazole) (cis-BOX2) was obtained in a glassy host matrix by vapor deposition. The orientational order of cis-BOX2 depended on the combination of deposition temperature and the type of host matrix. Complete horizontal orientation was obtained when a thin film with cis-BOX2 doped in a 4,4′-bis(N-carbazolyl)-1,1′-biphenyl (CBP) host matrix was fabricated at 200 K. The ultimate orientation of guest molecules originates from not only the kinetic relaxation but also the kinetic stability of the deposited guest molecules on the film surface during film growth. Utilizing the ultimatemore » orientation, a highly efficient organic light-emitting diode with the external quantum efficiency of 33.4 ± 2.0% was realized. The thermal stability of the horizontal orientation of cis-BOX2 was governed by the glass transition temperature (T{sub g}) of the CBP host matrix; the horizontal orientation was stable unless the film was annealed above T{sub g}.« less

  8. Radiation-induced transformations of isolated CH3CN molecules in noble gas matrices

    NASA Astrophysics Data System (ADS)

    Kameneva, Svetlana V.; Volosatova, Anastasia D.; Feldman, Vladimir I.

    2017-12-01

    The transformations of isolated CH3CN molecules in various solid noble-gas matrices (Ne, Ar, Kr, and Xe) under the action of X-ray irradiation at 5 K were investigated by FTIR spectroscopy. The main products are CH3NC, CH2CNH and CH2NCH molecular isomers as well as CH2CN and CH2NC radicals. The matrix has a strong effect on the distribution of reaction channels. In particular, the highest relative yield of keteneimine (CH2CNH) was found in Ne matrix, whereas the formation of CH3NC predominates in xenon. It was explained by differences in the matrix ionization energy (IE) resulting in different distributions of hot ionic reactions. The reactions of neutral excited states are mainly involved in Xe matrix with low IE, while the isomerization of the primary acetonitrile positive ions may be quite effective in Ne and Ar. Annealing of the irradiated samples results in mobilization of trapped hydrogen atoms followed by their reactions with radicals to yield parent molecule and its isomers. The scheme of the radiation-induced processes and its implications for the acetonitrile chemistry in cosmic ices are discussed.

  9. Organic–inorganic binary mixture matrix for comprehensive laser-desorption ionization mass spectrometric analysis and imaging of medium-size molecules including phospholipids, glycerolipids, and oligosaccharides

    DOE PAGES

    Feenstra, Adam D.; Ames Lab., Ames, IA; O'Neill, Kelly C.; ...

    2016-10-13

    Matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) is a widely adopted, versatile technique, especially in high-throughput analysis and imaging. However, matrix-dependent selectivity of analytes is often a severe limitation. In this work, a mixture of organic 2,5-dihydroxybenzoic acid and inorganic Fe 3O 4 nanoparticles is developed as a binary MALDI matrix to alleviate the well-known issue of triacylglycerol (TG) ion suppression by phosphatidylcholine (PC). In application to lipid standards and maize seed cross-sections, the binary matrix not only dramatically reduced the ion suppression of TG, but also efficiently desorbed and ionized a wide variety of lipids such as cationic PC, anionicmore » phosphatidylethanolamine (PE) and phosphatidylinositol (PI), and neutral digalactosyldiacylglycerol (DGDG). The binary matrix was also very efficient for large polysaccharides, which were not detected by either of the individual matrices. As a result, the usefulness of the binary matrix is demonstrated in MS imaging of maize seed sections, successfully visualizing diverse medium-size molecules and acquiring high-quality MS/MS spectra for these compounds.« less

  10. Pseudomonas biofilm matrix composition and niche biology

    PubMed Central

    Mann, Ethan E.; Wozniak, Daniel J.

    2014-01-01

    Biofilms are a predominant form of growth for bacteria in the environment and in the clinic. Critical for biofilm development are adherence, proliferation, and dispersion phases. Each of these stages includes reinforcement by, or modulation of, the extracellular matrix. Pseudomonas aeruginosa has been a model organism for the study of biofilm formation. Additionally, other Pseudomonas species utilize biofilm formation during plant colonization and environmental persistence. Pseudomonads produce several biofilm matrix molecules, including polysaccharides, nucleic acids, and proteins. Accessory matrix components shown to aid biofilm formation and adaptability under varying conditions are also produced by pseudomonads. Adaptation facilitated by biofilm formation allows for selection of genetic variants with unique and distinguishable colony morphology. Examples include rugose small-colony variants and wrinkly spreaders (WS), which over produce Psl/Pel or cellulose, respectively, and mucoid bacteria that over produce alginate. The well-documented emergence of these variants suggests that pseudomonads take advantage of matrix-building subpopulations conferring specific benefits for the entire population. This review will focus on various polysaccharides as well as additional Pseudomonas biofilm matrix components. Discussions will center on structure–function relationships, regulation, and the role of individual matrix molecules in niche biology. PMID:22212072

  11. Entropic trapping of macromolecules by mesoscopic periodic voids in a polymer hydrogel

    NASA Astrophysics Data System (ADS)

    Liu, Lei; Li, Pusheng; Asher, Sanford A.

    1999-01-01

    The separation of macromolecules such as polymers and DNA by means of electrophoresis, gel permeation chromatography or filtration exploits size-dependent differences in the time it takes for the molecules to migrate through a random porous network. Transport through the gel matrices, which usually consist of full swollen crosslinked polymers, depends on the relative size of the macromolecule compared with the pore radius. Sufficiently small molecules are thought to adopt an approximately spherical conformation when diffusing through the gel matrix, whereas larger ones are forced to migrate in a snake-like fashion. Molecules of intermediate size, however, can get temporarily trapped in the largest pores of the matrix, where the molecule can extend and thus maximize its conformational entropy. This `entropic trapping' is thought to increase the dependence of diffusion rate on molecular size. Here we report the direct experimental verification of this phenomenon. Bragg diffraction from a hydrogel containing a periodic array of monodisperse water voids confirms that polymers of different weights partition between the hydrogel matrix and the water voids according to the predictions of the entropic trapping theory. Our approach might also lead to the design of improved separation media based on entropic trapping.

  12. A novel in vitro bovine cartilage punch model for assessing the regeneration of focal cartilage defects with biocompatible bacterial nanocellulose.

    PubMed

    Pretzel, David; Linss, Stefanie; Ahrem, Hannes; Endres, Michaela; Kaps, Christian; Klemm, Dieter; Kinne, Raimund W

    2013-01-01

    Current therapies for articular cartilage defects fail to achieve qualitatively sufficient tissue regeneration, possibly because of a mismatch between the speed of cartilage rebuilding and the resorption of degradable implant polymers. The present study focused on the self-healing capacity of resident cartilage cells in conjunction with cell-free and biocompatible (but non-resorbable) bacterial nanocellulose (BNC). This was tested in a novel in vitro bovine cartilage punch model. Standardized bovine cartilage discs with a central defect filled with BNC were cultured for up to eight weeks with/without stimulation with transforming growth factor-β1 (TGF-β1. Cartilage formation and integrity were analyzed by histology, immunohistochemistry and electron microscopy. Content, release and neosynthesis of the matrix molecules proteoglycan/aggrecan, collagen II and collagen I were also quantified. Finally, gene expression of these molecules was profiled in resident chondrocytes and chondrocytes migrated onto the cartilage surface or the implant material. Non-stimulated and especially TGF-β1-stimulated cartilage discs displayed a preserved structural and functional integrity of the chondrocytes and surrounding matrix, remained vital in long-term culture (eight weeks) without signs of degeneration and showed substantial synthesis of cartilage-specific molecules at the protein and mRNA level. Whereas mobilization of chondrocytes from the matrix onto the surface of cartilage and implant was pivotal for successful seeding of cell-free BNC, chondrocytes did not immigrate into the central BNC area, possibly due to the relatively small diameter of its pores (2 to 5 μm). Chondrocytes on the BNC surface showed signs of successful redifferentiation over time, including increase of aggrecan/collagen type II mRNA, decrease of collagen type I mRNA and initial deposition of proteoglycan and collagen type II in long-term high-density pellet cultures. Although TGF-β1 stimulation showed protective effects on matrix integrity, effects on other parameters were limited. The present bovine cartilage punch model represents a robust, reproducible and highly suitable tool for the long-term culture of cartilage, maintaining matrix integrity and homoeostasis. As an alternative to animal studies, this model may closely reflect early stages of cartilage regeneration, allowing the evaluation of promising biomaterials with/without chondrogenic factors.

  13. b matrix errors in echo planar diffusion tensor imaging

    PubMed Central

    Boujraf, Saïd; Luypaert, Robert; Osteaux, Michel

    2001-01-01

    Diffusion‐weighted magnetic resonance imaging (DW‐MRI) is a recognized tool for early detection of infarction of the human brain. DW‐MRI uses the signal loss associated with the random thermal motion of water molecules in the presence of magnetic field gradients to derive parameters that reflect the translational mobility of the water molecules in tissues. If diffusion‐weighted images with different values of b matrix are acquired during one individual investigation, it is possible to calculate apparent diffusion coefficient maps that are the elements of the diffusion tensor. The diffusion tensor elements represent the apparent diffusion coefficient of protons of water molecules in each pixel in the corresponding sample. The relation between signal intensity in the diffusion‐weighted images, diffusion tensor, and b matrix is derived from the Bloch equations. Our goal is to establish the magnitude of the error made in the calculation of the elements of the diffusion tensor when the imaging gradients are ignored. PACS number(s): 87.57. –s, 87.61.–c PMID:11602015

  14. Biomaterials and Culture Technologies for Regenerative Therapy of Liver Tissue.

    PubMed

    Perez, Roman A; Jung, Cho-Rok; Kim, Hae-Won

    2017-01-01

    Regenerative approach has emerged to substitute the current extracorporeal technologies for the treatment of diseased and damaged liver tissue. This is based on the use of biomaterials that modulate the responses of hepatic cells through the unique matrix properties tuned to recapitulate regenerative functions. Cells in liver preserve their phenotype or differentiate through the interactions with extracellular matrix molecules. Therefore, the intrinsic properties of the engineered biomaterials, such as stiffness and surface topography, need to be tailored to induce appropriate cellular functions. The matrix physical stimuli can be combined with biochemical cues, such as immobilized functional groups or the delivered actions of signaling molecules. Furthermore, the external modulation of cells, through cocultures with nonparenchymal cells (e.g., endothelial cells) that can signal bioactive molecules, is another promising avenue to regenerate liver tissue. This review disseminates the recent approaches of regenerating liver tissue, with a focus on the development of biomaterials and the related culture technologies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Physical, Spatial, and Molecular Aspects of Extracellular Matrix of In Vivo Niches and Artificial Scaffolds Relevant to Stem Cells Research

    PubMed Central

    Akhmanova, Maria; Osidak, Egor; Domogatsky, Sergey; Rodin, Sergey; Domogatskaya, Anna

    2015-01-01

    Extracellular matrix can influence stem cell choices, such as self-renewal, quiescence, migration, proliferation, phenotype maintenance, differentiation, or apoptosis. Three aspects of extracellular matrix were extensively studied during the last decade: physical properties, spatial presentation of adhesive epitopes, and molecular complexity. Over 15 different parameters have been shown to influence stem cell choices. Physical aspects include stiffness (or elasticity), viscoelasticity, pore size, porosity, amplitude and frequency of static and dynamic deformations applied to the matrix. Spatial aspects include scaffold dimensionality (2D or 3D) and thickness; cell polarity; area, shape, and microscale topography of cell adhesion surface; epitope concentration, epitope clustering characteristics (number of epitopes per cluster, spacing between epitopes within cluster, spacing between separate clusters, cluster patterns, and level of disorder in epitope arrangement), and nanotopography. Biochemical characteristics of natural extracellular matrix molecules regard diversity and structural complexity of matrix molecules, affinity and specificity of epitope interaction with cell receptors, role of non-affinity domains, complexity of supramolecular organization, and co-signaling by growth factors or matrix epitopes. Synergy between several matrix aspects enables stem cells to retain their function in vivo and may be a key to generation of long-term, robust, and effective in vitro stem cell culture systems. PMID:26351461

  16. Block copolymer templated self-assembly of disk-shaped molecules

    NASA Astrophysics Data System (ADS)

    Aragones, J. L.; Alexander-Katz, A.

    2017-08-01

    Stacking of disk-shaped organic molecules is a promising strategy to develop electronic and photovoltaic devices. Here, we investigate the capability of a soft block copolymer matrix that microphase separates into a cylindrical phase to direct the self-assembly of disk-shaped molecules by means of molecular simulations. We show that two disk molecules confined in the cylinder domain experience a depletion force, induced by the polymer chains, which results in the formation of stacks of disks. This entropic interaction and the soft confinement provided by the matrix are both responsible for the structures that can be self-assembled, which include slanted or columnar stacks. In addition, we evidence the transmission of stresses between the different minority domains of the microphase, which results in the establishment of a long-ranged interaction between disk molecules embedded in different domains; this interaction is of the order of the microphase periodicity and may be exploited to direct assembly of disks at larger scales.

  17. Size-extensive QCISDT — implementation and application

    NASA Astrophysics Data System (ADS)

    Cremer, Dieter; He, Zhi

    1994-05-01

    A size-extensive quadratic CI method with single (S), double (D), and triple (T) excitations, QCISDT, has been derived by appropriate cancellation of disconnected terms in the CISDT projection equations. Matrix elements of the new QCI method have been evaluated in terms of two-electron integrals and applied to a number of atoms and small molecules. While QCISDT results are of similar accuracy to CCSDT results, the new method is easier to implement, converges in many cases faster and, thereby, leads to advantages compared to CCSDT.

  18. Laser desorption ionization mass spectrometry: Recent progress in matrix-free and label-assisted techniques.

    PubMed

    Mandal, Arundhoti; Singha, Monisha; Addy, Partha Sarathi; Basak, Amit

    2017-10-13

    The MALDI-based mass spectrometry, over the last three decades, has become an important analytical tool. It is a gentle ionization technique, usually applicable to detect and characterize analytes with high molecular weights like proteins and other macromolecules. The earlier difficulty of detection of analytes with low molecular weights like small organic molecules and metal ion complexes with this technique arose due to the cluster of peaks in the low molecular weight region generated from the matrix. To detect such molecules and metal ion complexes, a four-prong strategy has been developed. These include use of alternate matrix materials, employment of new surface materials that require no matrix, use of metabolites that directly absorb the laser light, and the laser-absorbing label-assisted LDI-MS (popularly known as LALDI-MS). This review will highlight the developments with all these strategies with a special emphasis on LALDI-MS. © 2017 Wiley Periodicals, Inc.

  19. [Clinical and etiopathogenetic role of plasminogen and metaloproteinase systems in the tumor growth. Pericellular proteolysis of extracellular matrix and tumor growth].

    PubMed

    Cosić, Sanda Jelisavac; Kovac, Zdenko

    2011-01-01

    Pericellular proteolysis is a cascade process involved in degradation of extracellular matrix. This process is included in various physiological and pathological processes. Pericellullar proteolysis has major functions like degradation of tissue stroma and weakening of intercellular connections but it also has a function in the synthesis of bioactive molecules (cytokines, growth factors and inhibitory factors). Plasminogen system is involved in fibrinolysis and starts metalloproteinase activation. Activity of proteolytic molecules is controlled by the rate of zymogenic activation, half-life of molecules, and action of inhibitory molecules. Inhibition is achieved through direct binding of inhibitor and enzyme and takes a few steps. Pericellular proteolysis is involved in tumor invasion and metastasis, inflammatory reaction, degenerative diseases and other diseases. Pathophysiological regulation of pericellular proteolysis in mentioned diseases contributes to clinical properties of diseases and has diagnostic and therapeutic importance.

  20. Distribution of extracellular matrix molecules in human uterine tubes during the menstrual cycle: a histological and immunohistochemical analysis.

    PubMed

    Godoy-Guzmán, Carlos; Nuñez, Claudio; Orihuela, Pedro; Campos, Antonio; Carriel, Víctor

    2018-04-16

    The uterine tube (UT) is an important and complex organ of the women's reproductive system. In general, the anatomy and basic histology of this organ are well-known. However, the composition and function of the extracellular matrix (ECM) of the UT is still poorly understood. The ECM is a complex supramolecular material produced by cells which is commonly restricted to the basement membrane and interstitial spaces. ECM molecules play not only a structural role, they are also important for cell growth, survival and differentiation in all tissues. In this context, the aim of this study was to evaluate the deposition and distribution of type I and III collagens and proteoglycans (decorin, biglycan, fibromodulin and versican) in human UT during the follicular and luteal phases by using histochemical and immunohistochemical techniques. Our results showed a broad synthesis of collagens (I and III) in the stroma of the UT. The analysis by regions showed, in the mucosa, a specific distribution of versican and fibromodulin in the epithelial surface, whereas decorin and fibromodulin were observed in the lamina propria. Versican and decorin were found in the stroma of the muscular layer, whereas all studied proteoglycans were identified in the serosa. Curiously, biglycan was restricted to the wall of the blood vessels of the serosa and muscular layers. Furthermore, there was an immunoreaction for collagens, decorin, versican and fibromodulin in the UT peripheral nerves. The differential distribution of these ECM molecules in the different layers of the UT could be related to specific structural and/or biomechanical functions needed for the oviductal transport, successful fertilization and early embryogenesis. However, further molecular studies under physiological and pathological conditions are still needed to elucidate the specific role of each molecule in the human UT. © 2018 Anatomical Society.

  1. Efficient optical nonlinear Langmuir-Blodgett films: roles of matrix molecules

    NASA Astrophysics Data System (ADS)

    Ma, Shihong; Lu, Xingze; Liu, Liying; Han, Kui; Wang, Wencheng; Zhang, Zhi-Ming

    1996-10-01

    A novel bifat-chain amphiphilic molecule nitrogencrown (NC) was adopted as an inert material for fabrication of optical nonlinear Langmuir-Blodgett (LB) multilayers. Structural improvement in the Z-type mixed fullerene derivative (C60-Be)/NC LB multilayers samples was realized by insertion of the C60-Be molecules between two hydrophobic chains of the NC molecules. The relatively large third-order susceptibility (chi) (3)xxxx(- 3(omega) ;(omega) ,(omega) ,(omega) ) equals 2.9 multiplied by 10-19 M2V-2 (or 2.1 multiplied by 10-11 esu) was deduced by measuring third harmonic generation (THG) from the C60-Be samples. The second harmonic generation (SHG) intensity increased quadratically with the bilayer number (up to 116 bilayers) in Y-type hemicyanine (HEM)/NC interleaving LB multilayers due to improvement of the structural properties by insertion of the long hydrophobic tail of HEM molecules between two chains of NC molecules. The second-order susceptibility (chi) (2)zxx(-2(omega) ;(omega) ,(omega) ) equals 18 pM V-1 (or 4.35 multiplied by 10-8 esu) was obtained by measuring SHG from the HEM samples. The NC molecule has attractive features as a matrix material in fabrications of LB multilayers made from optically nonlinear materials with hydrophobic long tails or ball-like molecules.

  2. Recommendations for Quantitative Analysis of Small Molecules by Matrix-assisted laser desorption ionization mass spectrometry

    PubMed Central

    Wang, Poguang; Giese, Roger W.

    2017-01-01

    Matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS) has been used for quantitative analysis of small molecules for many years. It is usually preceded by an LC separation step when complex samples are tested. With the development several years ago of “modern MALDI” (automation, high repetition laser, high resolution peaks), the ease of use and performance of MALDI as a quantitative technique greatly increased. This review focuses on practical aspects of modern MALDI for quantitation of small molecules conducted in an ordinary way (no special reagents, devices or techniques for the spotting step of MALDI), and includes our ordinary, preferred Methods The review is organized as 18 recommendations with accompanying explanations, criticisms and exceptions. PMID:28118972

  3. Density-matrix approach for the electroluminescence of molecules in a scanning tunneling microscope.

    PubMed

    Tian, Guangjun; Liu, Ji-Cai; Luo, Yi

    2011-04-29

    The electroluminescence (EL) of molecules confined inside a nanocavity in the scanning tunneling microscope possesses many intriguing but unexplained features. We present here a general theoretical approach based on the density-matrix formalism to describe the EL from molecules near a metal surface induced by both electron tunneling and localized surface plasmon excitations simultaneously. It reveals the underlying physical mechanism for the external bias dependent EL. The important role played by the localized surface plasmon on the EL is highlighted. Calculations for porphyrin derivatives have reproduced corresponding experimental spectra and nicely explained the observed unusual large variation of emission spectral profiles. This general theoretical approach can find many applications in the design of molecular electronic and photonic devices.

  4. Construction of the Fock Matrix on a Grid-Based Molecular Orbital Basis Using GPGPUs.

    PubMed

    Losilla, Sergio A; Watson, Mark A; Aspuru-Guzik, Alán; Sundholm, Dage

    2015-05-12

    We present a GPGPU implementation of the construction of the Fock matrix in the molecular orbital basis using the fully numerical, grid-based bubbles representation. For a test set of molecules containing up to 90 electrons, the total Hartree-Fock energies obtained from reference GTO-based calculations are reproduced within 10(-4) Eh to 10(-8) Eh for most of the molecules studied. Despite the very large number of arithmetic operations involved, the high performance obtained made the calculations possible on a single Nvidia Tesla K40 GPGPU card.

  5. Controlled release of molecular components of dendrimer/bioactive complexes

    DOEpatents

    Segalman, Daniel J.; Wallace, J. Shield

    1998-01-01

    A method for releasing molecules (guest molecules) from the matrix formed by the structure of another molecule (host molecule) in a controllable manner has been invented. This method has many applications in science and industry. In addition, applications based on such molecular systems may revolutionize significant areas of medicine, in particular the treatment of cancer and of viral infection. Similar effects can also be obtained by controlled fragmentation of a source molecule, where the molecular fragments form the active principle.

  6. Controlled release of molecular components of dendrimer/bioactive complexes

    DOEpatents

    Segalman, D.J.; Wallace, J.S.

    1998-08-18

    A method for releasing molecules (guest molecules) from the matrix formed by the structure of another molecule (host molecule) in a controllable manner has been invented. This method has many applications in science and industry. In addition, applications based on such molecular systems may revolutionize significant areas of medicine, in particular the treatment of cancer and of viral infection. Similar effects can also be obtained by controlled fragmentation of a source molecule, where the molecular fragments form the active principle. 13 figs.

  7. Using an expanding nondirect product harmonic basis with an iterative eigensolver to compute vibrational energy levels with as many as seven atoms.

    PubMed

    Brown, James; Carrington, Tucker

    2016-10-14

    We demonstrate that it is possible to use a variational method to compute 50 vibrational levels of ethylene oxide (a seven-atom molecule) with convergence errors less than 0.01 cm -1 . This is done by beginning with a small basis and expanding it to include product basis functions that are deemed to be important. For ethylene oxide a basis with fewer than 3 × 10 6 functions is large enough. Because the resulting basis has no exploitable structure we use a mapping to evaluate the matrix-vector products required to use an iterative eigensolver. The expanded basis is compared to bases obtained from pre-determined pruning condition. Similar calculations are presented for molecules with 3, 4, 5, and 6 atoms. For the 6-atom molecule, CH 3 CH, the required expanded basis has about 106 000 functions and is about an order of magnitude smaller than bases made with a pre-determined pruning condition.

  8. Atomic spectral-product representations of molecular electronic structure: metric matrices and atomic-product composition of molecular eigenfunctions.

    PubMed

    Ben-Nun, M; Mills, J D; Hinde, R J; Winstead, C L; Boatz, J A; Gallup, G A; Langhoff, P W

    2009-07-02

    Recent progress is reported in development of ab initio computational methods for the electronic structures of molecules employing the many-electron eigenstates of constituent atoms in spectral-product forms. The approach provides a universal atomic-product description of the electronic structure of matter as an alternative to more commonly employed valence-bond- or molecular-orbital-based representations. The Hamiltonian matrix in this representation is seen to comprise a sum over atomic energies and a pairwise sum over Coulombic interaction terms that depend only on the separations of the individual atomic pairs. Overall electron antisymmetry can be enforced by unitary transformation when appropriate, rather than as a possibly encumbering or unnecessary global constraint. The matrix representative of the antisymmetrizer in the spectral-product basis, which is equivalent to the metric matrix of the corresponding explicitly antisymmetric basis, provides the required transformation to antisymmetric or linearly independent states after Hamiltonian evaluation. Particular attention is focused in the present report on properties of the metric matrix and on the atomic-product compositions of molecular eigenstates as described in the spectral-product representations. Illustrative calculations are reported for simple but prototypically important diatomic (H(2), CH) and triatomic (H(3), CH(2)) molecules employing algorithms and computer codes devised recently for this purpose. This particular implementation of the approach combines Slater-orbital-based one- and two-electron integral evaluations, valence-bond constructions of standard tableau functions and matrices, and transformations to atomic eigenstate-product representations. The calculated metric matrices and corresponding potential energy surfaces obtained in this way elucidate a number of aspects of the spectral-product development, including the nature of closure in the representation, the general redundancy or linear dependence of its explicitly antisymmetrized form, the convergence of the apparently disparate atomic-product and explicitly antisymmetrized atomic-product forms to a common invariant subspace, and the nature of a chemical bonding descriptor provided by the atomic-product compositions of molecular eigenstates. Concluding remarks indicate additional studies in progress and the prognosis for performing atomic spectral-product calculations more generally and efficiently.

  9. Electronic and magnetic properties of Ni nanoparticles embedded in various organic semiconductor matrices.

    PubMed

    Bräuer, Björn; Vaynzof, Yana; Zhao, Wei; Kahn, Antoine; Li, Wen; Zahn, Dietrich R T; Fernández, César de Julián; Sangregorio, Claudio; Salvan, Georgeta

    2009-04-09

    Ni nanoparticles with a size distribution from 2 to 6 nm, embedded in various organic matrices, were fabricated in ultrahigh vacuum. For this purpose metal free and Ni phthalocyanine, fullerene C(60), and pentacene were coevaporated with Ni. When coevaporated, Ni and H(2)Pc react, leading to the formation of NiPc and Ni nanoparticles. The molecular structure of the matrix was found to have negligible effect on the size of the nanoparticles but to influence the magnetic anisotropy of the nanoparticles: Ni nanoparticles formed in the buckyball matrix have a cubic symmetry, while nanoparticles formed in matrices consisting of planar molecules exhibit a uniaxial symmetry. After exposure to atmosphere, photoelectron spectroscopy investigations demonstrate the presence of metallic Ni nanoparticles accompanied by Ni oxide and the existence of a charge transfer from the organic matrix to the particles in all investigated systems. The oxidized Ni nanoparticles exhibit a larger magnetic anisotropy compared to the freshly prepared particles which show superparamagnetic properties above 17 K. Moreover, photoelectron spectroscopy was used to probe the oxidation process of the Ni nanoparticles in different organic matrices. It could thus be shown that a matrix consisting of spherical molecules like C(60) prevent the particles much better from oxidation compared to matrices of flat molecules.

  10. Effects of osmotic pressure in the extracellular matrix on tissue deformation.

    PubMed

    Lu, Y; Parker, K H; Wang, W

    2006-06-15

    In soft tissues, large molecules such as proteoglycans trapped in the extracellular matrix (ECM) generate high levels of osmotic pressure to counter-balance external pressures. The semi-permeable matrix and fixed negative charges on these molecules serve to promote the swelling of tissues when there is an imbalance of molecular concentrations. Structural molecules, such as collagen fibres, form a network of stretch-resistant matrix, which prevents tissue from over-swelling and keeps tissue integrity. However, collagen makes little contribution to load bearing; the osmotic pressure in the ECM is the main contributor balancing external pressures. Although there have been a number of studies on tissue deformation, there is no rigorous analysis focusing on the contribution of the osmotic pressure in the ECM on the viscoelastic behaviour of soft tissues. Furthermore, most previous works were carried out based on the assumption of infinitesimal deformation, whereas tissue deformation is finite under physiological conditions. In the current study, a simplified mathematical model is proposed. Analytic solutions for solute distribution in the ECM and the free-moving boundary were derived by solving integro-differential equations under constant and dynamic loading conditions. Osmotic pressure in the ECM is found to contribute significantly to the viscoelastic characteristics of soft tissues during their deformation.

  11. A generalized graph-theoretical matrix of heterosystems and its application to the VMV procedure.

    PubMed

    Mozrzymas, Anna

    2011-12-14

    The extensions of generalized (molecular) graph-theoretical matrix and vector-matrix-vector procedure are considered. The elements of the generalized matrix are redefined in order to describe molecules containing heteroatoms and multiple bonds. The adjacency, distance, detour and reciprocal distance matrices of heterosystems, and corresponding vectors are derived from newly defined generalized graph matrix. The topological indices, which are most widely used in predicting physicochemical and biological properties/activities of various compounds, can be calculated from the new generalized vector-matrix-vector invariant. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Nano Sponges for Drug Delivery and Medicinal Applications

    NASA Technical Reports Server (NTRS)

    Tour, James M.; Lucente-Schultz, Rebecca; Leonard, Ashley; Kosynkin, Dimitry V.; Price, Brandi Katherine; Hudson, Jared L.; Conyers, Jodie L., Jr.; Moore, Valerie C.; Casscells, S. Ward; Myers, Jeffrey N.; hide

    2012-01-01

    This invention is a means of delivering a drug, or payload, to cells using non-covalent associations of the payload with nano-engineered scaffolds; specifically, functionalized single-walled carbon nanotubes (SWNTs) and their derivatives where the payload is effectively sequestered by the nanotube's addends and then delivered to the site (often interior of a cell) of interest. Polyethylene glycol (PEG) and other water-soluble organic molecules have been shown to greatly enhance the solubility of SWNTs in water. PEG groups and other water-solubilizing addends can act to sequester (sponge) molecules and deliver them into cells. Using PEG that, when attached to the SWNTs, the SWNT/PEG matrix will enter cells has been demonstrated. This was visualized by the addition of fluorescein isothiocyanate (FITC) to the SWNT/PEG matrix. Control studies showed that both FITC alone and FITC/PEG did not enter the cells. These observations suggest that the FITC is highly associated with the SWNT/PEG matrix that brings the FITC into the cells, allowing visualization of SWNTs in cells. The FITC is not covalently attached, because extended dialysis in hot DMF will remove all fluorescence quickly (one week). However, prolonged dialysis in water (1-2 months) will only slowly diminish the fluorescence. This demonstrates that the SWNT/PEG matrix solubilizes the FITC by sequestering it from the surrounding water and into the more solubilizing organic environment of the SWNT/PEG matrix of this type. This can be extended for the sequestering of other molecules such as drugs with PEG and other surfactants.

  13. Semistochastic approach to many electron systems

    NASA Astrophysics Data System (ADS)

    Grossjean, M. K.; Grossjean, M. F.; Schulten, K.; Tavan, P.

    1992-08-01

    A Pariser-Parr-Pople (PPP) Hamiltonian of an 8π electron system of the molecule octatetraene, represented in a configuration-interaction basis (CI basis), is analyzed with respect to the statistical properties of its matrix elements. Based on this analysis we develop an effective Hamiltonian, which represents virtual excitations by a Gaussian orthogonal ensemble (GOE). We also examine numerical approaches which replace the original Hamiltonian by a semistochastically generated CI matrix. In that CI matrix, the matrix elements of high energy excitations are choosen randomly according to distributions reflecting the statistics of the original CI matrix.

  14. Extracellular matrix biomimicry for the creation of investigational and therapeutic devices.

    PubMed

    Pellowe, Amanda S; Gonzalez, Anjelica L

    2016-01-01

    The extracellular matrix (ECM) is a web of fibrous proteins that serves as a scaffold for tissues and organs, and is important for maintaining homeostasis and facilitating cellular adhesion. Integrin transmembrane receptors are the primary adhesion molecules that anchor cells to the ECM, thus integrating cells with their microenvironments. Integrins play a critical role in facilitating cell-matrix interactions and promoting signal transduction, both from the cell to the ECM and vice versa, ultimately mediating cell behavior. For this reason, many advanced biomaterials employ biomimicry by replicating the form and function of fibrous ECM proteins. The ECM also acts as a reservoir for small molecules and growth factors, wherein fibrous proteins directly bind and present these bioactive moieties that facilitate cell activity. Therefore biomimicry can be enhanced by incorporating small molecules into ECM-like substrates. Biomimetic ECM materials have served as invaluable research tools for studying interactions between cells and the surrounding ECM, revealing that cell-matrix signaling is driven by mechanical forces, integrin engagement, and small molecules. Mimicking pathological ECMs has also elucidated disease specific cell behaviors. For example, biomimetic tumor microenvironments have been used to induce metastatic cell behaviors, and have thereby shown promise for in vitro cancer drug testing and targeting. Further, ECM-like substrates have been successfully employed for autologous cell recolonization for tissue engineering and wound healing. As we continue to learn more about the mechanical and biochemical characteristics of the ECM, these properties can be harnessed to develop new biomaterials, biomedical devices, and therapeutics. © 2015 Wiley Periodicals, Inc.

  15. High resolution mass spectrometry method and system for analysis of whole proteins and other large molecules

    DOEpatents

    Reilly, Peter T. A. [Knoxville, TN; Harris, William A [Naperville, IL

    2010-03-02

    A matrix assisted laser desorption/ionization (MALDI) method and related system for analyzing high molecular weight analytes includes the steps of providing at least one matrix-containing particle inside an ion trap, wherein at least one high molecular weight analyte molecule is provided within the matrix-containing particle, and MALDI on the high molecular weight particle while within the ion trap. A laser power used for ionization is sufficient to completely vaporize the particle and form at least one high molecular weight analyte ion, but is low enough to avoid fragmenting the high molecular weight analyte ion. The high molecular weight analyte ion is extracted out from the ion trap, and is then analyzed using a detector. The detector is preferably a pyrolyzing and ionizing detector.

  16. 1,5-Diaminonaphthalene hydrochloride assisted laser desorption/ionization mass spectrometry imaging of small molecules in tissues following focal cerebral ischemia.

    PubMed

    Liu, Huihui; Chen, Rui; Wang, Jiyun; Chen, Suming; Xiong, Caiqiao; Wang, Jianing; Hou, Jian; He, Qing; Zhang, Ning; Nie, Zongxiu; Mao, Lanqun

    2014-10-21

    A sensitive analytical technique for visualizing small endogenous molecules simultaneously is of great significance for clearly elucidating metabolic mechanisms during pathological progression. In the present study, 1,5-naphthalenediamine (1,5-DAN) hydrochloride was prepared for matrix-assisted laser desorption/ionization (MALDI) mass spectrometry imaging (MSI) of small molecules in liver, brain, and kidneys from mice. Furthermore, 1,5-DAN hydrochloride assisted LDI MSI of small molecules in brain tissue of rats subjected to middle cerebral artery occlusion (MCAO) was carried out to investigate the altered metabolic pathways and mechanisms underlying the development of ischemic brain damage. Our results suggested that the newly prepared matrix possessed brilliant features including low cost, strong ultraviolet absorption, high salt tolerance capacity, and fewer background signals especially in the low mass range (typically m/z < 500), which permitted us to visualize the spatial distribution of a broad range of small molecule metabolites including metal ions, amino acids, carboxylic acids, nucleotide derivatives, peptide, and lipids simultaneously. Nineteen endogenous metabolites involved in metabolic networks such as ATP metabolism, tricarboxylic acid (TCA) cycle, glutamate-glutamine cycle, and malate-aspartate shuttle, together with metal ions and phospholipids as well as antioxidants underwent relatively obvious changes after 24 h of MCAO. The results were highly consistent with the data obtained by MRM MS analysis. These findings highlighted the promising potential of the organic salt matrix for application in the field of biomedical research.

  17. Matrix metalloproteinases: their biological functions and clinical implications.

    PubMed

    Hijova, E

    2005-01-01

    Matrix metalloproteinases (MMPs), which are also known as matrixins, are proteinases that participate in extracellular matrix remodelling and degradation. Under normal physiological conditions, the activities of MMPs are precisely regulated at the level of transcription, at that of activation of the pro-MMP precursor zymogenes as well as at that of inhibition by endogenous inhibitors (tissue inhibitors of metalloproteinases, TIMPs). Alterations in the regulation of MMP activity are implicated in diseases such as cancer, fibrosis, arthritis and atherosclerosis. The pathological effects of MMPs and TIMPs in cardiovascular diseases involve vascular remodelling, atherosclerotic plaque instability and cardiac remodelling in congestive heart failure or after myocardial infarction. Since excessive tissue remodelling and increased matrix metalloproteinases activity have been demonstrated during atherosclerotic lesion progression (including plaque disruption), MMPs represent a potential target for therapeutic intervention aimed at the modification of vascular pathology by restoring the physiological balance between MMPs and TIMPs. Recent findings suggest that MMPs are also involved in cancer initiation, invasion and metastasis; MMP inhibitors could be considered for evaluation as cancer chemopreventive molecules. This review describes the members of MMP and TIMP families and discusses the structure, function and regulation of MMP activity. (Tab. 1, Ref: 45.)

  18. Functional Amyloids Keep Quorum-sensing Molecules in Check*

    PubMed Central

    Seviour, Thomas; Hansen, Susan Hove; Yang, Liang; Yau, Yin Hoe; Wang, Victor Bochuan; Stenvang, Marcel R.; Christiansen, Gunna; Marsili, Enrico; Givskov, Michael; Chen, Yicai; Otzen, Daniel E.; Nielsen, Per Halkjær; Geifman-Shochat, Susana; Kjelleberg, Staffan; Dueholm, Morten S.

    2015-01-01

    The mechanism by which extracellular metabolites, including redox mediators and quorum-sensing signaling molecules, traffic through the extracellular matrix of biofilms is poorly explored. We hypothesize that functional amyloids, abundant in natural biofilms and possessing hydrophobic domains, retain these metabolites. Using surface plasmon resonance, we demonstrate that the quorum-sensing (QS) molecules, 2-heptyl-3-hydroxy-4(1H)-quinolone and N-(3-oxododecanoyl)-l-homoserine lactone, and the redox mediator pyocyanin bind with transient affinity to functional amyloids from Pseudomonas (Fap). Their high hydrophobicity predisposes them to signal-amyloid interactions, but specific interactions also play a role. Transient interactions allow for rapid association and dissociation kinetics, which make the QS molecules bioavailable and at the same time secure within the extracellular matrix as a consequence of serial bindings. Retention of the QS molecules was confirmed using Pseudomonas aeruginosa PAO1-based 2-heptyl-3-hydroxy-4(1H)-quinolone and N-(3-oxododecanoyl)-l-homoserine lactone reporter assays, showing that Fap fibrils pretreated with the QS molecules activate the reporters even after sequential washes. Pyocyanin retention was validated by electrochemical analysis of pyocyanin-pretreated Fap fibrils subjected to the same washing process. Results suggest that QS molecule-amyloid interactions are probably important in the turbulent environments commonly encountered in natural habitats. PMID:25586180

  19. Performance of the density matrix functional theory in the quantum theory of atoms in molecules.

    PubMed

    García-Revilla, Marco; Francisco, E; Costales, A; Martín Pendás, A

    2012-02-02

    The generalization to arbitrary molecular geometries of the energetic partitioning provided by the atomic virial theorem of the quantum theory of atoms in molecules (QTAIM) leads to an exact and chemically intuitive energy partitioning scheme, the interacting quantum atoms (IQA) approach, that depends on the availability of second-order reduced density matrices (2-RDMs). This work explores the performance of this approach in particular and of the QTAIM in general with approximate 2-RDMs obtained from the density matrix functional theory (DMFT), which rests on the natural expansion (natural orbitals and their corresponding occupation numbers) of the first-order reduced density matrix (1-RDM). A number of these functionals have been implemented in the promolden code and used to perform QTAIM and IQA analyses on several representative molecules and model chemical reactions. Total energies, covalent intra- and interbasin exchange-correlation interactions, as well as localization and delocalization indices have been determined with these functionals from 1-RDMs obtained at different levels of theory. Results are compared to the values computed from the exact 2-RDMs, whenever possible.

  20. Time-dependent transition density matrix for visualizing charge-transfer excitations in photoexcited organic donor-acceptor systems

    NASA Astrophysics Data System (ADS)

    Li, Yonghui; Ullrich, Carsten

    2013-03-01

    The time-dependent transition density matrix (TDM) is a useful tool to visualize and interpret the induced charges and electron-hole coherences of excitonic processes in large molecules. Combined with time-dependent density functional theory on a real-space grid (as implemented in the octopus code), the TDM is a computationally viable visualization tool for optical excitation processes in molecules. It provides real-time maps of particles and holes which gives information on excitations, in particular those that have charge-transfer character, that cannot be obtained from the density alone. Some illustration of the TDM and comparison with standard density difference plots will be shown for photoexcited organic donor-acceptor molecules. This work is supported by NSF Grant DMR-1005651

  1. Pectins filled with LDH-antimicrobial molecules: preparation, characterization and physical properties.

    PubMed

    Gorrasi, Giuliana; Bugatti, Valeria; Vittoria, Vittoria

    2012-06-05

    Nanohybrids of layered double hydroxide (LDH) with intercalated active molecules: benzoate, 2,4-dichlorobenzoate, para-hydroxybenzoate and ortho-hydroxybenzoate, were incorporated into pectins from apples through high energy ball milling in the presence of water. Cast films were obtained and analysed. X-ray diffraction analysis showed a complete destructuration of all nanohybrids in the pectin matrix. Thermogravimetric analysis showed a better thermal resistance of pectin in the presence of fillers, especially para-hydroxybenzoate and ortho-hydroxybenzoate. Mechanical properties showed an improvement of elastic modulus in particular for LDH-para-hydroxybenzoate nanohybrid, due probably to a better interaction between pectin matrix and nanohybrid layers. Barrier properties (sorption and diffusion) to water vapour showed improvement in the dependence on the intercalated active molecule, the best improvement was achieved for composites containing para-hydroxybenzoate molecules, suggesting that the interaction between the filler phase and the polymer plays an important role in sorption and diffusion phenomena. Incorporation of these active molecules gave antimicrobial properties to the composite films giving opportunities in the field of active packaging. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Matrix isolation infrared spectroscopic studies and density functional theory calculations of the MNN, (MN)2 (M = Y and La), and Y3NN molecules.

    PubMed

    Teng, Yun-Lei; Xu, Qiang

    2008-04-24

    The reactions of yttrium and lanthanum with dinitrogen were reinvestigated. Laser-ablated yttrium and lanthanum atoms were co-deposited at 4 K with dinitrogen in excess argon, and the low-temperature reactions of Y and La with N2 in solid argon were studied using infrared spectroscopy. The reaction products YNN, (YN)2, LaNN, and (LaN)2 were formed in the present experiments and characterized on the basis of 14N/15N isotopic shifts, mixed isotope splitting patterns, stepwise annealing, change of reagent concentration and laser energy, and comparison with theoretical predictions. Some assignments were made based on a previous report. Density functional theory calculations were performed on these systems to identify possible reaction products. The agreement between experimental and calculated vibrational frequencies, relative absorption intensities, and isotopic shifts of the MNN and (MN)2 (M = Y and La) molecules supports the identification of these molecules from the matrix infrared spectra. Plausible reaction mechanisms were proposed for the formation of these molecules along with tentative identification of the Y3NN molecule.

  3. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  4. Mechanically Oriented 3D Collagen Hydrogel for Directing Neurite Growth.

    PubMed

    Antman-Passig, Merav; Levy, Shahar; Gartenberg, Chaim; Schori, Hadas; Shefi, Orit

    2017-05-01

    Recent studies in the field of neuro-tissue engineering have demonstrated the promising effects of aligned contact guidance cue to scaffolds of enhancement and direction of neuronal growth. In vivo, neurons grow and develop neurites in a complex three-dimensional (3D) extracellular matrix (ECM) surrounding. Studies have utilized hydrogel scaffolds derived from ECM molecules to better simulate natural growth. While many efforts have been made to control neuronal growth on 2D surfaces, the development of 3D scaffolds with an elaborate oriented topography to direct neuronal growth still remains a challenge. In this study, we designed a method for growing neurons in an aligned and oriented 3D collagen hydrogel. We aligned collagen fibers by inducing controlled uniaxial strain on gels. To examine the collagen hydrogel as a suitable scaffold for neuronal growth, we evaluated the physical properties of the hydrogel and measured collagen fiber properties. By combining the neuronal culture in 3D collagen hydrogels with strain-induced alignment, we were able to direct neuronal growth in the direction of the aligned collagen matrix. Quantitative evaluation of neurite extension and directionality within aligned gels was performed. The analysis showed neurite growth aligned with collagen matrix orientation, while maintaining the advantageous 3D growth.

  5. UKRmol: a low-energy electron- and positron-molecule scattering suite

    NASA Astrophysics Data System (ADS)

    Carr, J. M.; Galiatsatos, P. G.; Gorfinkiel, J. D.; Harvey, A. G.; Lysaght, M. A.; Madden, D.; Mašín, Z.; Plummer, M.; Tennyson, J.; Varambhia, H. N.

    2012-03-01

    We describe the UK computational implementation of the R-matrix method for the treatment of electron and positron scattering from molecules. Recent developments in the UKRmol suite are detailed together with the collision processes it is enabling us to treat.

  6. A community resource benchmarking predictions of peptide binding to MHC-I molecules.

    PubMed

    Peters, Bjoern; Bui, Huynh-Hoa; Frankild, Sune; Nielson, Morten; Lundegaard, Claus; Kostem, Emrah; Basch, Derek; Lamberth, Kasper; Harndahl, Mikkel; Fleri, Ward; Wilson, Stephen S; Sidney, John; Lund, Ole; Buus, Soren; Sette, Alessandro

    2006-06-09

    Recognition of peptides bound to major histocompatibility complex (MHC) class I molecules by T lymphocytes is an essential part of immune surveillance. Each MHC allele has a characteristic peptide binding preference, which can be captured in prediction algorithms, allowing for the rapid scan of entire pathogen proteomes for peptide likely to bind MHC. Here we make public a large set of 48,828 quantitative peptide-binding affinity measurements relating to 48 different mouse, human, macaque, and chimpanzee MHC class I alleles. We use this data to establish a set of benchmark predictions with one neural network method and two matrix-based prediction methods extensively utilized in our groups. In general, the neural network outperforms the matrix-based predictions mainly due to its ability to generalize even on a small amount of data. We also retrieved predictions from tools publicly available on the internet. While differences in the data used to generate these predictions hamper direct comparisons, we do conclude that tools based on combinatorial peptide libraries perform remarkably well. The transparent prediction evaluation on this dataset provides tool developers with a benchmark for comparison of newly developed prediction methods. In addition, to generate and evaluate our own prediction methods, we have established an easily extensible web-based prediction framework that allows automated side-by-side comparisons of prediction methods implemented by experts. This is an advance over the current practice of tool developers having to generate reference predictions themselves, which can lead to underestimating the performance of prediction methods they are not as familiar with as their own. The overall goal of this effort is to provide a transparent prediction evaluation allowing bioinformaticians to identify promising features of prediction methods and providing guidance to immunologists regarding the reliability of prediction tools.

  7. Versican and its associated molecules: potential diagnostic markers for multiple myeloma.

    PubMed

    Gupta, Nidhi; Khan, Rehan; Kumar, Raman; Kumar, Lalit; Sharma, Alpana

    2015-03-10

    Multiple myeloma (MM) represents a malignancy of B-cells characterized by proliferation of malignant plasma cells in the bone marrow (BM). Versican (VCAN), an extracellular matrix (ECM) protein, appears to be involved in multiple processes in several cancers. Identifying optimum diagnostic markers and delineating its association with disease severity might be important for controlling MM. Expression of VCAN and its associated molecules (β-catenin, β1 integrin and FAK) were investigated in 60 subjects to evaluate their usefulness as diagnostic marker. Circulatory and molecular levels of above molecules were analyzed in their BM and Blood using ELISA, Q-PCR and western blotting along with their ROC curve analysis. Circulatory levels of VCAN, β-catenin and FAK were significantly higher in patients with varying significance in each stage. β-Catenin and FAK intracellular levels were significantly elevated in patients. mRNA levels of all molecules were significantly higher in BMMNCs while VCAN and β-catenin also showed increase in PBMCs. Upregulation of these molecules was also observed at protein level. ROC curve analysis for VCAN showed absolute combination of sensitivity and specificity for diagnosis in serum. Significant elevation of VCAN and its associated molecules imply their role in MM. Optimal sensitivity and specificity of VCAN might utilize its importance as potential marker for active disease. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Matrix-enhanced secondary ion mass spectrometry: The Alchemist's solution?

    NASA Astrophysics Data System (ADS)

    Delcorte, Arnaud

    2006-07-01

    Because of the requirements of large molecule characterization and high-lateral resolution SIMS imaging, the possibility of improving molecular ion yields by the use of specific sample preparation procedures has recently generated a renewed interest in the static SIMS community. In comparison with polyatomic projectiles, however, signal enhancement by a matrix might appear to some as the alchemist's versus the scientist's solution to the current problems of organic SIMS. In this contribution, I would like to discuss critically the pros and cons of matrix-enhanced SIMS procedures, in the new framework that includes polyatomic ion bombardment. This discussion is based on a short review of the experimental and theoretical developments achieved in the last decade with respect to the three following approaches: (i) blending the analyte with a low-molecular weight organic matrix (MALDI-type preparation procedure); (ii) mixing alkali/noble metal salts with the analyte; (iii) evaporating a noble metal layer on the analyte sample surface (organic molecules, polymers).

  9. Analyte-Size-Dependent Ionization and Quantification of Monosaccharides in Human Plasma Using Cation-Exchanged Smectite Layers.

    PubMed

    Ding, Yuqi; Kawakita, Kento; Xu, Jiawei; Akiyama, Kazuhiko; Fujino, Tatsuya

    2015-08-04

    Smectite, a synthetic inorganic polymer with a saponite structure, was subjected to matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS). Typical organic matrix molecules 2,4,6-trihydroxyacetophenone (THAP) and 2,5-dihydroxybenzoic acid (DHBA) were intercalated into the layer spacing of cation-exchanged smectite, and the complex was used as a new matrix for laser desorption/ionization mass spectrometry. Because of layer spacing limitations, only a small analyte that could enter the layer and bind to THAP or DHBA could be ionized. This was confirmed by examining different analyte/matrix preparation methods and by measuring saccharides with different molecular sizes. Because of the homogeneous distribution of THAP molecules in the smectite layer spacing, high reproducibility of the analyte peak intensity was achieved. By using isotope-labeled (13)C6-d-glucose as the internal standard, quantitative analysis of monosaccharides in pretreated human plasma sample was performed, and the value of 8.6 ± 0.3 μg/mg was estimated.

  10. Electronic method for autofluorography of macromolecules on two-D matrices

    DOEpatents

    Davidson, Jackson B.; Case, Arthur L.

    1983-01-01

    A method for detecting, localizing, and quantifying macromolecules contained in a two-dimensional matrix is provided which employs a television-based position sensitive detection system. A molecule-containing matrix may be produced by conventional means to produce spots of light at the molecule locations which are detected by the television system. The matrix, such as a gel matrix, is exposed to an electronic camera system including an image-intensifier and secondary electron conduction camera capable of light integrating times of many minutes. A light image stored in the form of a charge image on the camera tube target is scanned by conventional television techniques, digitized, and stored in a digital memory. Intensity of any point on the image may be determined from the number at the memory address of the point. The entire image may be displayed on a television monitor for inspection and photographing or individual spots may be analyzed through selected readout of the memory locations. Compared to conventional film exposure methods, the exposure time may be reduced 100-1000 times.

  11. Comprehensive mass spectrometric analysis of novel organic semiconductor molecules

    NASA Astrophysics Data System (ADS)

    Prada, Svitlana

    This work presents a comprehensive mass spectrometry (MS) study of novel organic semiconductor molecules including ion mobility/reactivity measurements and trace elemental analysis. The organic molecules investigated here are important semiconductor materials for molecular electronic devices such as Organic Field-Effect Transistors (OFETs) and Light Emitted Diodes (LED). A high-performance orthogonal time-of flight mass spectrometer (TOF-MS) in combination with a matrix assisted laser desorption/ionization (MALDI) source operating at elevated pressure was used to perform MALDI/TOF analyses of pentacene and some of its derivatives with and without an added matrix. The observation of ion-molecule reactions between "cold" analyte ions and neutral analyte molecules in the gas phase has provided some insight into the mechanism of pentacene cluster formation and its functionalized derivatives. Furthermore, some of the matrices employed to assist the desorption/ionization process of these compounds were observed to influence the outcome via ion-molecule reactions of analyte ions and matrix molecules in the gas phase. The stability and reactivity of the compounds and their clusters in the MALDI plume during gas-phase expansion were evaluated; possible structures of the resulting clusters are discussed. The MALDI/TOF technique was also helpful in distinguishing between two isomeric forms of bis-[(triisopropylsilyl)-ethynyl]-pentacene. Furthermore, we reported ion mobility measurements of functionalized pentacene ions with a modified triple quadrupole mass spectrometer fitted with an ion molecule reactor (IMR). The IMR is equipped with a variable axial electrostatic drift field (ADF) and is able to trap ions for a prolong period of time. These capabilities were successfully employed in the measurement of ion mobilities in different modes of the IMR operation. Theoretical modeling of the drift dynamics and the special localization of the large ion packet was successfully implemented. The contribution of the quadrupole RF field to the drift dynamics also was taken into consideration. The IMR was successfully employed in the ion-molecule reactions study of four functionalized pentacene derivatives such as TIPS, o-TIPS, 6,13-bis-[(triisopropylsilyl)-ethynyl]-pentacene-2,3-dicarbonitrile (TIPS(CN)2), and 6,13-bis-[(triisopropylsilyl)-ethynyl]-pentacene-2,3,9,10-tetracarbonitrile (TIPS(CN)4). Details of the IMR operation in this mode are extensively discussed. The purity of the starting material is one of the most important parameters for the fabrication of a molecular electronic device. We report the method of determination of trace elemental impurities (Li, Na, Al, Mg, Be, Pb, Mn, Co, Ti, Sn, Cu, Cr, V, Zn, Fe, Ca, K and Ni) in organic semiconductor materials, such as Tetracene, Anthracene, Pentacene, TIPS and Rubrene, using an inductively coupled plasma quadrupole mass spectrometer (ICP-MS) fitted with a dynamic reaction cell (DRC). The determination of Fe, Ca, K and Ni in the organic semiconductor materials was carried out using NH3 as a reaction gas in the DRC mode to obviate the effect of polyatomic isobaric interferences. The other trace elements such as Li, Na, Al, Mg, Be, Pb, Mn, Co, Ti, Sn, Cu, Cr, V and Zn have been determined under standard operating conditions.

  12. COVARIANCE ESTIMATION USING CONJUGATE GRADIENT FOR 3D CLASSIFICATION IN CRYO-EM.

    PubMed

    Andén, Joakim; Katsevich, Eugene; Singer, Amit

    2015-04-01

    Classifying structural variability in noisy projections of biological macromolecules is a central problem in Cryo-EM. In this work, we build on a previous method for estimating the covariance matrix of the three-dimensional structure present in the molecules being imaged. Our proposed method allows for incorporation of contrast transfer function and non-uniform distribution of viewing angles, making it more suitable for real-world data. We evaluate its performance on a synthetic dataset and an experimental dataset obtained by imaging a 70S ribosome complex.

  13. A binomial stochastic kinetic approach to the Michaelis-Menten mechanism

    NASA Astrophysics Data System (ADS)

    Lente, Gábor

    2013-05-01

    This Letter presents a new method that gives an analytical approximation of the exact solution of the stochastic Michaelis-Menten mechanism without computationally demanding matrix operations. The method is based on solving the deterministic rate equations and then using the results as guiding variables of calculating probability values using binomial distributions. This principle can be generalized to a number of different kinetic schemes and is expected to be very useful in the evaluation of measurements focusing on the catalytic activity of one or a few individual enzyme molecules.

  14. Evaluations of dielectric property and drug release profile of 5-FU patches based on plasma charged electrets

    NASA Astrophysics Data System (ADS)

    Wang, YUAN; Hejuan, LIANG; Ping, HUANG; Xiaoqiang, AN; Jian, JIANG; Lili, CUI

    2018-05-01

    In the present study, the electret 5-fluorouracil patch was developed, the effective surface potential, piezoelectric coefficient d 33, open-circuit thermally stimulated discharge (TSD) current spectra and shear adhesion of the patch were measured. The drug release profile of the patch was determined by using high performance liquid chromatography method. A stable potential difference which was positively dependent on the surface potential of the electret was generated on two sides of the patch. The measurements of d 33 coefficient, TSD current spectra and adhesion performance showed that the electrostatic field of the electret could cause polarization and cohesive strength decreasing of the matrix molecules, change the distribution and interaction of the drug molecules in patch, therefore to increase the release of drug from the transdermal patch.

  15. Matrix metalloproteinase processing of signaling molecules to regulate inflammation.

    PubMed

    Butler, Georgina S; Overall, Christopher M

    2013-10-01

    Inflammation is a complex and highly regulated process that facilitates the clearance of pathogens and mediates tissue repair. Failure to resolve inflammation can lead to chronic inflammatory diseases such as periodontitis. Matrix metalloproteinases are generally thought to be detrimental in disease because degradation of extracellular matrix contributes to pathology. However, proteomic techniques (degradomics) are revealing that matrix metalloproteinases process a diverse array of substrates and therefore have a broad range of functions. Many matrix metalloproteinase substrates modulate inflammation and hence, by processing these proteins, matrix metalloproteinases can orchestrate the inflammatory response. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. The influence of natural deep eutectic solvents on bioactive natural products: studying interactions between a hydrogel model and Schisandra chinensis metabolites.

    PubMed

    Liu, Yang; Zhang, Yu; Chen, Shao-Nong; Friesen, J Brent; Nikolić, Dejan; Choules, Mary P; McAlpine, James B; Lankin, David C; Gemeinhart, Richard A; Pauli, Guido F

    2018-06-01

    Natural Deep Eutectic Solvent (NADES) species can exhibit unexpected solubilizing power for lipophilic molecules despite their simple composition: hydrophilic organic molecules and water. In the present study, the unique properties of NADES species were applied in combination with a model polymer system: a hydrophilic chitosan/alginate hydrogel. Briefly, NADES species (e.g., mannose-dimethylurea-water, 2:5:5, mole/mole) formed matrices to 1) dissolve lipophilic molecules (e.g., curcumin), 2) load lipophilic molecule(s) into the hydrogel, and 3) spontaneously vacate from the system. NADES species ubiquitously occur in natural sources, and a crude extract is a mixture of the NADES species and bioactive metabolites. Based on these ideas, we hypothesized that the crude extract may also allow the loading of natural bioactive molecules from a natural NADES species into (bio)hydrogel systems. To evaluate this hypothesis in vitro, Schisandra chinensis fruit extract was chosen as a representative mixture of lipophilic botanical molecules and hydrophilic NADES species. The results showed that the NADES matrix of S. chinensis was capable of loading at least three bioactive lignans (i.e., gomisin A, gomisin J, and angeloylgomisin H) into the polymer system. The lipophilic metabolites can subsequently be released from the hydrogel. The outcomes suggest that a unique drug delivery mechanism may exist in nature, thereby potentially improving the bioavailability of lipophilic metabolites through physicochemical interactions with the NADES. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Photoionization of Atoms and Molecules using a Configuration-Average Distorted-Wave Method

    NASA Astrophysics Data System (ADS)

    Pindzola, M. S.; Balance, C. P.; Loch, S. D.; Ludlow, J. A.

    2011-05-01

    A configuration-average distorted-wave method is applied to calculate the photoionization cross section for the outer subshells of the C atom and the C2 diatomic molecule. Comparisions are made with previous R-matrix and Hartree- Fock distorted-wave calculations.

  18. The Atom in a Molecule: Implications for Molecular Structure and Properties

    DTIC Science & Technology

    2016-05-23

    unlimited. PA Clearance #16075.” Atomic- Product Representations of Molecules Employ “van der Waals” products of atomic states to represent molecules...representation the electrons “stay home” with each nucleus. Atomic fragment operators are well-defined over product representations. Expectation values of...release; distribution unlimited. PA Clearance #16075.” Hamiltonian Matrix in the Atomic- Product Basis Technical Questions Addressed: J. Chem. Phys

  19. Evolution of the taste of a bitter Camembert cheese during ripening: characterization of a matrix effect.

    PubMed

    Engel, E; Nicklaus, S; Septier, C; Salles, C; Le Quéré, J L

    2001-06-01

    The objective of this study was to characterize the effect of ripening on the taste of a typically bitter Camembert cheese. The first step was to select a typically bitter cheese among several products obtained by different processes supposed to enhance this taste defect. Second, the evolution of cheese taste during ripening was characterized from a sensory point of view. Finally, the relative impact of fat, proteins, and water-soluble molecules on cheese taste was determined by using omission tests performed on a reconstituted cheese. These omission tests showed that cheese taste resulted mainly from the gustatory properties of water-soluble molecules but was modulated by a matrix effect due to fat, proteins, and cheese structure. The evolution of this matrix effect during ripening was discussed for each taste characteristic.

  20. Iminopropadienones RN=C=C=C=O and bisiminopropadienes RN=C=C=C=NR: Matrix infrared spectra and anharmonic frequency calculations

    NASA Astrophysics Data System (ADS)

    Bégué, Didier; Baraille, Isabelle; Andersen, Heidi Gade; Wentrup, Curt

    2013-10-01

    Methyliminopropadienone MeN=C=C=C=O 1a was generated by flash vacuum thermolysis from four different precursors and isolated in solid argon. The matrix-isolation infrared spectrum is dominated by unusually strong anharmonic effects resulting in complex fine structure of the absorptions due to the NCCCO moiety in the 2200 cm-1 region. Doubling and tripling of the corresponding absorption bands are observed for phenyliminopropadienone PhN=C=C=C=O 1b and bis(phenylimino)propadiene PhN=C=C=C=NPh 9, respectively. Anharmonic vibrational frequency calculations allow the identification of a number of overtones and combination bands as the cause of the splittings for each molecule. This method constitutes an important tool for the characterization of reactive intermediates and unusual molecules by matrix-isolation infrared spectroscopy.

  1. Comparative matrix isolation infrared spectroscopy study of 1,3- and 1,4-diene monoterpenes (α-phellandrene and γ-terpinene).

    PubMed

    Marzec, K M; Reva, I; Fausto, R; Proniewicz, L M

    2011-05-05

    In the present work, γ-terpinene (a 1,4-diene derivative) and α-phellandrene (1,3-diene derivative) were isolated in cryogenic argon matrices and their structures, vibrational spectra, and photochemistries were characterized with the aid of FTIR spectroscopy and quantum chemical calculations performed at the DFT/B3LYP/6-311++G(d,p) level of approximation. The molecules bear one conformationally relevant internal rotation axis, corresponding to the rotation of the isopropyl group. The calculations provide evidence of three minima on the potential energy surfaces of the studied molecules, where the isopropyl group assumes the trans, gauche+, and gauche- conformations (T, G+, G-). The signatures of all these conformers were identified in the experimental matrix infrared spectra, with the T forms dominating, in agreement with the theoretical predicted abundances in gas phase at room temperature. In situ UV (λ > 200 nm) irradiation of matrix-isolated α-phellandrene led to its isomerization into an open-ring species. The photoproduct was found to exhibit the ZE configuration of its backbone, which to be formed from the reactant molecule does not require extensive structural rearrangements of both the reagent and matrix. γ-Terpinene was photostable when subjected to irradiation under the same experimental conditions. In addition, the liquid compounds at room temperature were also investigated by FTIR-ATR and FT-Raman spectroscopies.

  2. Intra- and intermolecular H-bond mediated tautomerization and dimerization of 3-methyl-1,2-cyclopentanedione: Infrared spectroscopy in argon matrix and CCl 4 solution

    NASA Astrophysics Data System (ADS)

    Samanta, Amit K.; Pandey, Prasenjit; Bandyopadhyay, Biman; Mukhopadhyay, Anamika; Chakraborty, Tapas

    2011-05-01

    Mid-infrared spectra of 3-methyl-1,2-cyclopentanedione (3-MeCPD) have been recorded by isolating the molecule in a cold argon matrix (8 K) and also in CCl 4 solution at room temperature. The spectral features reveal that in both media, the molecule exists exclusively in an enol tautomeric form, which is stabilized by an intramolecular O sbnd H⋯O hydrogen bond. NBO analysis shows that the preferred conformer is further stabilized because of hyperconjugation interaction between the methyl and vinyl group of the enol tautomer. In CCl 4 solution, the molecule undergoes extensive self association and generates a doubly hydrogen bonded centrosymmetric dimer. The dimerization constant ( K d) is estimated to have a value of ˜9 L mol -1 at room temperature (25 °C) and the thermodynamic parameters, Δ H°, Δ S° and Δ G°, of dimerization are estimated by measuring K d at several temperatures within the range 22-60 °C. The same dimer is also produced when the matrix is annealed at a higher temperature. In addition, a non-centrosymmetric singly hydrogen bonded dimer is also identified in the argon matrix. A comparison between the spectral features of the two dimers indicates that the dimerization effect on doubly H-bonded case is influenced by cooperative interaction between the two H-bonds.

  3. Extracellular matrix and cell shape: potential control points for inhibition of angiogenesis

    NASA Technical Reports Server (NTRS)

    Ingber, D.

    1991-01-01

    Capillary endothelial (CE) cells require two extracellular signals in order to switch from quiescence to growth and back to differentiation during angiogenesis: soluble angiogenic factors and insoluble extracellular matrix (ECM) molecules. Soluble endothelial mitogens, such as basic fibroblast growth factor (FGF), act over large distances to trigger capillary growth, whereas ECM molecules act locally to modulate cell responsiveness to these soluble cues. Recent studies reveal that ECM molecules regulate CE cell growth and differentiation by modulating cell shape and by activating intracellular chemical signaling pathways inside the cell. Recognition of the importance of ECM and cell shape during capillary morphogenesis has led to the identification of a series of new angiogenesis inhibitors. Elucidation of the molecular mechanism of capillary regulation may result in development of even more potent angiogenesis modulators in the future.

  4. Matrix-isolation and ab initio study of HKrCCCl and HXeCCCl

    NASA Astrophysics Data System (ADS)

    Zhu, Cheng; Räsänen, Markku; Khriachtchev, Leonid

    2015-12-01

    We report on two new noble-gas molecules, HKrCCCl and HXeCCCl, prepared in low-temperature Kr and Xe matrices. These molecules are made by UV photolysis of HCCCl in the matrices and subsequent thermal annealing. The HCCCl precursor is produced by microwave discharge of a mixture of a matrix gas with trichloroethylene (HClC=CCl2). The assignments of the new noble-gas molecules are supported by deuteration experiments and quantum chemical calculations at the MP2(full) and CCSD(T) levels of theory with the def2-TZVPPD basis set. No evidence of ClXeCCH, which is computationally reliably stable, is found in the experiments. ClKrCCH as well as the Ar compounds HArCCCl and ClArCCH are not observed either, which is in agreement with the calculations.

  5. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  6. Adhesive interactions of human multiple myeloma cell lines with different extracellular matrix molecules.

    PubMed

    Kibler, C; Schermutzki, F; Waller, H D; Timpl, R; Müller, C A; Klein, G

    1998-06-01

    Multiple myeloma represents a human B cell malignancy which is characterized by a predominant localization of the malignant cell clone within the bone marrow. With the exception of the terminal stage of the disease the myeloma tumor cells do not circulate in the peripheral blood. The bone marrow microenvironment is believed to play an important role in homing, proliferation and terminal differentiation of myeloma cells. Here we have studied the expression of several extracellular matrix (ECM) molecules in the bone marrow of multiple myeloma patients and analyzed their adhesive capacities with four different human myeloma-derived cell lines. All ECM molecules analyzed (tenascin, laminin, fibronectin, collagen types I, III, V and VI) could be detected in bone marrow cryostat sections of multiple myeloma patients. Adhesion assays showed that only laminin, the microfibrillar collagen type VI and fibronectin were strong adhesive components for the myeloma cell lines U266, IM-9, OPM-2 and NCI-H929. Tenascin and collagen type I were only weak adhesive substrates for these myeloma cells. Adhesion to laminin and fibronectin was beta 1-integrin-mediated since addition of anti-beta 1-integrin antibodies could inhibit the binding of the four different cell types to both matrix molecules. In contrast, integrins do not seem to be involved in binding of the myeloma cells to collagen type VI. Instead, inhibition of binding by heparin suggested that membrane-bound heparan sulfate proteoglycans are responsible ligands for binding to collagen type VI. Adhesion assays with several B-cell lines resembling earlier differentiation stages revealed only weak interactions with tenascin and no interactions with collagen type VI, laminin or fibronectin. In summary, the interactions of human myeloma cells with the extracellular matrix may explain the specific retention of the plasma cells within the bone marrow.

  7. Amplified spontaneous emission of pyranyliden derivatives in PVK matrix

    NASA Astrophysics Data System (ADS)

    Vembris, Aivars; Zarinsh, Elmars; Kokars, Valdis

    2016-04-01

    One of the well-known red light emitting laser dyes is 4-(dicyanomethylene)-2-methyl-6-(4-dimethylaminostyryl)-4Hpyran (DCM). Amplified spontaneous emission (ASE) has been widely investigated of DCM molecules or its derivatives in polymer or low molecular weight matrix. The main issue for these molecules is aggregation which limits doping concentration in matrix. Lowest ASE threshold values within concentration range of 2 and 4 wt% were obtained. In this work ASE properties of two original DCM derivatives in poly(N-vinylcarbazole) (PVK) at various concentrations will be discussed. One of the derivatives is the same DCM dye with replaced butyl groups at electron donor part with bulky trytiloxyethyl groups (DWK-1). These groups do not influence electron transitions in the dye but prevent aggregation of the molecules. Second derivative (DWK-2) consists of two equal donor groups with the attached trytiloxyethyl groups. All results were compared with DCM:PVK system. Photoluminescence quantum yield (PLQY) is almost three times larger for DWK-1 concentration up to 20wt% with respect to DCM systems. PLQY was saturated on 0.06 at higher DWK-1 concentrations. Bulky trytiloxyethyl groups prevent aggregation of the molecules thus decreasing interaction between dyes and numbers of non-radiative decays. Red shift of photoluminescence and amplified spontaneous emission at higher concentrations were observed due to the solid state solvation effect. Increases of dye density in matrix with smaller lose in PLQY resulted in low ASE threshold energy. The lowest threshold value was obtained around 29 μJ/cm2 in DWK-1:PVK films.

  8. Role of atypical chemokine receptor ACKR2 in experimental oral squamous cell carcinogenesis.

    PubMed

    da Silva, Janine Mayra; Dos Santos, Tálita Pollyanna Moreira; Saraiva, Adriana Machado; Fernandes de Oliveira, Ana Laura; Garlet, Gustavo Pompermaier; Batista, Aline Carvalho; de Mesquita, Ricardo Alves; Russo, Remo Castro; da Silva, Tarcília Aparecida

    2018-03-14

    Chemokines and chemokine receptors are critical in oral tumourigenesis. The atypical chemokine receptor ACKR2 is a scavenger of CC chemokines controlling the availability of these molecules at tumour sites, but the role of ACKR2 in the context of oral carcinogenesis is unexplored. In this study, wild-type (WT) and ACKR2 deficient mice (ACKR2 -/- ) were treated with chemical carcinogen 4-nitroquinoline-1-oxide (4NQO) for induction of oral carcinogenesis. Tongues were collected for macro and microscopic analysis and to evaluate the expression of ACKRs, CC chemokines and its receptors, inflammatory cytokines, angiogenic factors, adhesion molecules and extracellular matrix components. An increased expression of ACKR2 in squamous cell carcinoma (SCC) lesions of 4NQO-treated WT mice was observed. No significant differences were seen in the ACKR1, ACKR3 and ACKR4 mRNA expression comparing SCC lesions from WT and ACKR2 -/- treated mice. Significantly higher expression of CCL2, IL-6 and IL-17 was detected in ACKR2 -/- treated mice. In contrast, the expression of other CC-chemokines, and receptors, angiogenic factors, adhesion molecules and extracellular matrix components were similarly increased in SCC lesions of both groups. Clinical and histopathological analysis revealed no differences in inflammatory cell recruitment and in the SCC incidence comparing WT and ACKR2 -/- treated mice. The results suggest that ACKR2 expression regulates inflammation in tumour-microenvironment but the absence of ACKR2 does not impact chemically-induced oral carcinogenesis. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. High matrix metalloproteinase activity is a hallmark of periapical granulomas.

    PubMed

    de Paula-Silva, Francisco Wanderley Garcia; D'Silva, Nisha J; da Silva, Léa Assed Bezerra; Kapila, Yvonne Lorraine

    2009-09-01

    The inability to distinguish periapical cysts from granulomas before performing root canal treatment leads to uncertainty in treatment outcomes because cysts have lower healing rates. Searching for differential expression of molecules within cysts or granulomas could provide information with regard to the identity of the lesion or suggest mechanistic differences that may form the basis for future therapeutic intervention. Thus, we investigated whether granulomas and cysts exhibit differential expression of extracellular matrix (ECM) molecules. Human periapical granulomas, periapical cysts, and healthy periodontal ligament tissues were used to investigate the differential expression of ECM molecules by microarray analysis. Because matrix metalloproteinases (MMP) showed the highest differential expression in the microarray analysis, MMPs were further examined by in situ zymography and immunohistochemistry. Data were analyzed by using one-way analysis of variance followed by the Tukey test. We observed that cysts and granulomas differentially expressed several ECM molecules, especially those from the MMP family. Compared with cysts, granulomas exhibited higher MMP enzymatic activity in areas stained for MMP-9. These areas were composed of polymorphonuclear cells (PMNs) in contrast to cysts. Similarly, MMP-13 was expressed by a greater number of cells in granulomas compared with cysts. Our findings indicate that high enzymatic MMP activity in PMNs together with MMP-9 and MMP-13 stained cells could be a molecular signature of granulomas unlike periapical cysts.

  10. Biomimetic/Optical Sensors for Detecting Bacterial Species

    NASA Technical Reports Server (NTRS)

    Homer, Margie; Ksendzov, Alexander; Yen, Shiao-Pin; Ryan, Margaret; Lazazzera, Beth

    2006-01-01

    Biomimetic/optical sensors have been proposed as means of real-time detection of bacteria in liquid samples through real-time detection of compounds secreted by the bacteria. Bacterial species of interest would be identified through detection of signaling compounds unique to those species. The best-characterized examples of quorum-signaling compounds are acyl-homoserine lactones and peptides. Each compound, secreted by each bacterium of an affected species, serves as a signal to other bacteria of the same species to engage in a collective behavior when the population density of that species reaches a threshold level analogous to a quorum. A sensor according to the proposal would include a specially formulated biomimetic film, made of a molecularly imprinted polymer (MIP), that would respond optically to the signaling compound of interest. The MIP film would be integrated directly onto an opticalwaveguide- based ring resonator for optical readout. Optically, the sensor would resemble the one described in Chemical Sensors Based on Optical Ring Resonators (NPO-40601), NASA Tech Briefs, Vol. 29, No. 10 (October 2005), page 32. MIPs have been used before as molecular- recognition compounds, though not in the manner of the present proposal. Molecular imprinting is an approach to making molecularly selective cavities in a polymer matrix. These cavities function much as enzyme receptor sites: the chemical functionality and shape of a cavity in the polymer matrix cause the cavity to bind to specific molecules. An MIP matrix is made by polymerizing monomers in the presence of the compound of interest (template molecule). The polymer forms around the template. After the polymer solidifies, the template molecules are removed from the polymer matrix by decomplexing them from their binding sites and then dissolving them, leaving cavities that are matched to the template molecules in size, shape, and chemical functionality. The cavities thus become molecular-recognition sites that bind only to molecules matched to the sites; other molecules are excluded. In a sensor according to the proposal, the MIP would feature molecular recognition sites that would bind the specific signaling molecules selectively according to their size, shape, and chemical functionality (see figure). As the film took up the signaling molecules in the molecular recognition sites, the index of refraction and thickness of the film would change, causing a wavelength shift of the peak of the resonance spectrum. It has been estimated that by measuring this wavelength shift, it should be possible to detect as little as 10 picomoles of a peptide signaling compound.

  11. Bio-active molecules modified surfaces enhanced mesenchymal stem cell adhesion and proliferation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mobasseri, Rezvan; Center for Nanofibers & Nanotechnology, Department of Mechanical Engineering, National University of Singapore, 117576; Tian, Lingling

    Surface modification of the substrate as a component of in vitro cell culture and tissue engineering, using bio-active molecules including extracellular matrix (ECM) proteins or peptides derived ECM proteins can modulate the surface properties and thereby induce the desired signaling pathways in cells. The aim of this study was to evaluate the behavior of human bone marrow mesenchymal stem cells (hBM-MSCs) on glass substrates modified with fibronectin (Fn), collagen (Coll), RGD peptides (RGD) and designed peptide (R-pept) as bio-active molecules. The glass coverslips were coated with fibronectin, collagen, RGD peptide and R-peptide. Bone marrow mesenchymal stem cells were cultured on differentmore » substrates and the adhesion behavior in early incubation times was investigated using scanning electron microscopy (SEM) and confocal microscopy. The MTT assay was performed to evaluate the effect of different bio-active molecules on MSCs proliferation rate during 24 and 72 h. Formation of filopodia and focal adhesion (FA) complexes, two steps of cell adhesion process, were observed in MSCs cultured on bio-active molecules modified coverslips, specifically in Fn coated and R-pept coated groups. SEM image showed well adhesion pattern for MSCs cultured on Fn and R-pept after 2 h incubation, while the shape of cells cultured on Coll and RGD substrates indicated that they might experience stress condition in early hours of culture. Investigation of adhesion behavior, as well as proliferation pattern, suggests R-peptide as a promising bio-active molecule to be used for surface modification of substrate in supporting and inducing cell adhesion and proliferation. - Highlights: • Bioactive molecules modified surface is a strategy to design biomimicry scaffold. • Bi-functional Tat-derived peptide (R-pept) enhanced MSCs adhesion and proliferation. • R-pept showed similar influences to fibronectin on FA formation and attachment.« less

  12. Carbon nanodots as a matrix for the analysis of low-molecular-weight molecules in both positive- and negative-ion matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and quantification of glucose and uric acid in real samples.

    PubMed

    Chen, Suming; Zheng, Huzhi; Wang, Jianing; Hou, Jian; He, Qing; Liu, Huihui; Xiong, Caiqiao; Kong, Xianglei; Nie, Zongxiu

    2013-07-16

    Carbon nanodots were applied for the first time as a new matrix for the analysis of low-molecular-weight compounds by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) in both positive- and negative-ion modes. A wide range of small molecules including amino acids, peptides, fatty acids, as well as β-agonists and neutral oligosaccharides were analyzed by MALDI MS with carbon nanodots as the matrix, and the lowest 0.2 fmol limits-of-detection were obtained for octadecanoic acid. Clear sodium and potassium adducts and deprotonated signals were produced in positive- and negative-ion modes. Furthermore, the glucose and uric acid in real samples were quantitatively determined by the internal standard method with the linear range of 0.5-9 mM and 0.1-1.8 mM (R(2) > 0.999), respectively. This work gives new insight into the application of carbon nanodots and provides a general approach for rapid analysis of low-molecular-weight compounds.

  13. How bacteria hack the matrix and dodge the bullets of immunity.

    PubMed

    Paulsson, Magnus; Riesbeck, Kristian

    2018-06-30

    Haemophilus influenzae , Moraxella catarrhalis and Pseudomonas aeruginosa are common Gram-negative pathogens associated with an array of pulmonary diseases. All three species have multiple adhesins in their outer membrane, i.e. surface structures that confer the ability to bind to surrounding cells, proteins or tissues. This mini-review focuses on proteins with high affinity for the components of the extracellular matrix such as collagen, laminin, fibronectin and vitronectin. Adhesins are not structurally related and may be lipoproteins, transmembrane porins or large protruding trimeric auto-transporters. They enable bacteria to avoid being cleared together with mucus by attaching to patches of exposed extracellular matrix, or indirectly adhering to epithelial cells using matrix proteins as bridging molecules. As more adhesins are being unravelled, it is apparent that bacterial adhesion is a highly conserved mechanism, and that most adhesins target the same regions on the proteins of the extracellular matrix. The surface exposed adhesins are prime targets for new vaccines and the interactions between proteins are often possible to inhibit with interfering molecules, e.g heparin. In conclusion, this highly interesting research field of microbiology has unravelled host-pathogen interactions with high therapeutic potential. Copyright ©ERS 2018.

  14. The Frequency Detuning Correction and the Asymmetry of Line Shapes: The Far Wings of H2O-H2O

    NASA Technical Reports Server (NTRS)

    Ma, Q.; Tipping, R. H.; Hansen, James E. (Technical Monitor)

    2002-01-01

    A far-wing line shape theory which satisfies the detailed balance principle is applied to the H2O-H2O system. Within this formalism, two line shapes are introduced, corresponding to band-averages over the positive and negative resonance lines, respectively. Using the coordinate representation, the two line shapes can be obtained by evaluating 11-dimensional integrations whose integrands are a product of two factors. One depends on the interaction between the two molecules and is easy to evaluate. The other contains the density matrix of the system and is expressed as a product of two 3-dimensional distributions associated with the density matrices of the absorber and the perturber molecule, respectively. If most of the populated states are included in the averaging process, to obtain these distributions requires extensive computer CPU time, but only have to be computed once for a given temperature. The 11-dimensional integrations are evaluated using the Monte Carlo method, and in order to reduce the variance, the integration variables are chosen such that the sensitivity of the integrands on them is clearly distinguished.

  15. Regional variations in the distribution and colocalization of extracellular matrix proteins in the juvenile bovine meniscus

    PubMed Central

    Vanderploeg, Eric J; Wilson, Christopher G; Imler, Stacy M; Ling, Carrie Hang-Yin; Levenston, Marc E

    2012-01-01

    A deeper understanding of the composition and organization of extracellular matrix molecules in native, healthy meniscus tissue is required to fully appreciate the degeneration that occurs in joint disease and the intricate environment in which an engineered meniscal graft would need to function. In this study, regional variations in the tissue-level and pericellular distributions of collagen types I, II and VI and the proteoglycans aggrecan, biglycan and decorin were examined in the juvenile bovine meniscus. The collagen networks were extensively, but not completely, colocalized, with tissue-level organization that varied with radial position across the meniscus. Type VI collagen exhibited close association with large bundles composed of type I and II collagen and, in contrast to type I and II collagen, was further concentrated in the pericellular matrix. Aggrecan was detected throughout the inner region of the meniscus but was restricted to the pericellular matrix and sheaths of collagen bundles in the middle and outer regions. The small proteoglycans biglycan and decorin exhibited regional variations in staining intensity but were consistently localized in the intra- and/or peri-cellular compartments. These results provide insight into the complex hierarchy of extracellular matrix organization in the meniscus and provide a framework for better understanding meniscal degeneration and disease progression and evaluating potential repair and regeneration strategies. PMID:22703476

  16. Excitation energies from range-separated time-dependent density and density matrix functional theory.

    PubMed

    Pernal, Katarzyna

    2012-05-14

    Time-dependent density functional theory (TD-DFT) in the adiabatic formulation exhibits known failures when applied to predicting excitation energies. One of them is the lack of the doubly excited configurations. On the other hand, the time-dependent theory based on a one-electron reduced density matrix functional (time-dependent density matrix functional theory, TD-DMFT) has proven accurate in determining single and double excitations of H(2) molecule if the exact functional is employed in the adiabatic approximation. We propose a new approach for computing excited state energies that relies on functionals of electron density and one-electron reduced density matrix, where the latter is applied in the long-range region of electron-electron interactions. A similar approach has been recently successfully employed in predicting ground state potential energy curves of diatomic molecules even in the dissociation limit, where static correlation effects are dominating. In the paper, a time-dependent functional theory based on the range-separation of electronic interaction operator is rigorously formulated. To turn the approach into a practical scheme the adiabatic approximation is proposed for the short- and long-range components of the coupling matrix present in the linear response equations. In the end, the problem of finding excitation energies is turned into an eigenproblem for a symmetric matrix. Assignment of obtained excitations is discussed and it is shown how to identify double excitations from the analysis of approximate transition density matrix elements. The proposed method used with the short-range local density approximation (srLDA) and the long-range Buijse-Baerends density matrix functional (lrBB) is applied to H(2) molecule (at equilibrium geometry and in the dissociation limit) and to Be atom. The method accounts for double excitations in the investigated systems but, unfortunately, the accuracy of some of them is poor. The quality of the other excitations is in general much better than that offered by TD-DFT-LDA or TD-DMFT-BB approximations if the range-separation parameter is properly chosen. The latter remains an open problem.

  17. pyJac: Analytical Jacobian generator for chemical kinetics

    NASA Astrophysics Data System (ADS)

    Niemeyer, Kyle E.; Curtis, Nicholas J.; Sung, Chih-Jen

    2017-06-01

    Accurate simulations of combustion phenomena require the use of detailed chemical kinetics in order to capture limit phenomena such as ignition and extinction as well as predict pollutant formation. However, the chemical kinetic models for hydrocarbon fuels of practical interest typically have large numbers of species and reactions and exhibit high levels of mathematical stiffness in the governing differential equations, particularly for larger fuel molecules. In order to integrate the stiff equations governing chemical kinetics, generally reactive-flow simulations rely on implicit algorithms that require frequent Jacobian matrix evaluations. Some in situ and a posteriori computational diagnostics methods also require accurate Jacobian matrices, including computational singular perturbation and chemical explosive mode analysis. Typically, finite differences numerically approximate these, but for larger chemical kinetic models this poses significant computational demands since the number of chemical source term evaluations scales with the square of species count. Furthermore, existing analytical Jacobian tools do not optimize evaluations or support emerging SIMD processors such as GPUs. Here we introduce pyJac, a Python-based open-source program that generates analytical Jacobian matrices for use in chemical kinetics modeling and analysis. In addition to producing the necessary customized source code for evaluating reaction rates (including all modern reaction rate formulations), the chemical source terms, and the Jacobian matrix, pyJac uses an optimized evaluation order to minimize computational and memory operations. As a demonstration, we first establish the correctness of the Jacobian matrices for kinetic models of hydrogen, methane, ethylene, and isopentanol oxidation (number of species ranging 13-360) by showing agreement within 0.001% of matrices obtained via automatic differentiation. We then demonstrate the performance achievable on CPUs and GPUs using pyJac via matrix evaluation timing comparisons; the routines produced by pyJac outperformed first-order finite differences by 3-7.5 times and the existing analytical Jacobian software TChem by 1.1-2.2 times on a single-threaded basis. It is noted that TChem is not thread-safe, while pyJac is easily parallelized, and hence can greatly outperform TChem on multicore CPUs. The Jacobian matrix generator we describe here will be useful for reducing the cost of integrating chemical source terms with implicit algorithms in particular and algorithms that require an accurate Jacobian matrix in general. Furthermore, the open-source release of the program and Python-based implementation will enable wide adoption.

  18. Probing Biomolecular Structures and Dynamics of Single Molecules Using In-Gel Alternating-Laser Excitation

    PubMed Central

    Santoso, Yusdi; Kapanidis, Achillefs N.

    2009-01-01

    Gel electrophoresis is a standard biochemical technique used for separating biomolecules on the basis of size and charge. Despite the use of gels in early single-molecule experiments, gel electrophoresis has not been widely adopted for single-molecule fluorescence spectroscopy. We present a novel method that combines gel electrophoresis and single-molecule fluorescence spectroscopy to simultaneously purify and analyze biomolecules in a gel matrix. Our method, in-gel ALEX, uses non-denaturing gels to purify biomolecular complexes of interest from free components, aggregates, and non-specific complexes. The gel matrix also slows down translational diffusion of molecules, giving rise to long, high-resolution time traces without surface immobilization, which allow extended observations of conformational dynamics in a biologically friendly environment. We demonstrated the compatibility of this method with different types of single molecule spectroscopy techniques, including confocal detection and fluorescence-correlation spectroscopy. We demonstrated that in-gel ALEX can be used to study conformational dynamics at the millisecond timescale; by studying a DNA hairpin in gels, we directly observed fluorescence fluctuations due to conformational interconversion between folded and unfolded states. Our method is amenable to the addition of small molecules that can alter the equilibrium and dynamic properties of the system. In-gel ALEX will be a versatile tool for studying structures and dynamics of complex biomolecules and their assemblies. PMID:19863108

  19. Making molecular balloons in laser-induced explosive boiling of polymer solutions.

    PubMed

    Leveugle, Elodie; Sellinger, Aaron; Fitz-Gerald, James M; Zhigilei, Leonid V

    2007-05-25

    The effect of the dynamic molecular rearrangements leading to compositional segregation is revealed in coarse-grained molecular dynamics simulations of short pulse laser interaction with a polymer solution in a volatile matrix. An internal release of matrix vapor at the onset of the explosive boiling of the overheated liquid is capable of pushing polymer molecules to the outskirts of a transient bubble, forming a polymer-rich surface layer enclosing the volatile matrix material. The results explain unexpected "deflated balloon" structures observed in films deposited by the matrix-assisted pulsed laser evaporation technique.

  20. Spectroscopic studies of clusterization of methanol molecules isolated in a nitrogen matrix

    NASA Astrophysics Data System (ADS)

    Vaskivskyi, Ye.; Doroshenko, I.; Chernolevska, Ye.; Pogorelov, V.; Pitsevich, G.

    2017-12-01

    IR absorption spectra of methanol isolated in a nitrogen matrix are recorded at temperatures ranging from 9 to 34 K. The changes in the spectra with increasing matrix temperature are analyzed. Based on quantum-chemical calculations of the geometric and spectral parameters of different methanol clusters, the observed absorption bands are identified. The cluster composition of the sample is determined at each temperature. It is shown that as the matrix is heated there is a redistribution among the different cluster structures in the sample, from smaller to larger clusters.

  1. Neurotrophins differentially stimulate the growth of cochlear neurites on collagen surfaces and in gels☆

    PubMed Central

    Xie, Joanna; Pak, Kwang; Evans, Amaretta; Kamgar-Parsi, Andy; Fausti, Stephen; Mullen, Lina; Ryan, Allen Frederic

    2013-01-01

    The electrodes of a cochlear implant are located far from the surviving neurons of the spiral ganglion, which results in decreased precision of neural activation compared to the normal ear. If the neurons could be induced to extend neurites toward the implant, it might be possible to stimulate more discrete subpopulations of neurons, and to increase the resolution of the device. However, a major barrier to neurite growth toward a cochlear implant is the fluid filling the scala tympani, which separates the neurons from the electrodes. The goal of this study was to evaluate the growth of cochlear neurites in three-dimensional extracellular matrix molecule gels, and to increase biocompatibility by using fibroblasts stably transfected to produce neurotrophin-3 and brain-derived neurotrophic factor. Spiral ganglion explants from neonatal rats were evaluated in cultures. They were exposed to soluble neurotrophins, cells transfected to secrete neurotrophins, and/or collagen gels. We found that cochlear neurites grew readily on collagen surfaces and in three-dimensional collagen gels. Co-culture with cells producing neurotrophin-3 resulted in increased numbers of neurites, and neurites that were longer than when explants were cultured with control fibroblasts stably transfected with green fluorescent protein. Brain-derived neurotrophic factor-producing cells resulted in a more dramatic increase in the number of neurites, but there was no significant effect on neurite length. It is suggested that extracellular matrix molecule gels and cells transfected to produce neurotrophins offer an opportunity to attract spiral ganglion neurites toward a cochlear implant. PMID:24459465

  2. Monte Carlo study of disorder in HMTA

    NASA Astrophysics Data System (ADS)

    Goossens, D. J.; Welberry, T. R.

    2001-12-01

    We investigate disordered solids by automated fitting of a Monte Carlo simulation of a crystal to observed single-crystal diffuse X-ray scattering. This method has been extended to the study of crystals of relatively large organic molecules by using a z-matrix to describe the molecules. This allows exploration of motions within molecules. We refer to the correlated thermal motion observed in benzil, and to the occupational and thermal disorder in the 1:1 adduct of hexamethylenetetramine and azelaic acid, HMTA. The technique is capable of giving insight into modes of vibration within molecules and correlated motions between molecules.

  3. High Sensitivity and High Detection Specificity of Gold-Nanoparticle-Grafted Nanostructured Silicon Mass Spectrometry for Glucose Analysis.

    PubMed

    Tsao, Chia-Wen; Yang, Zhi-Jie

    2015-10-14

    Desorption/ionization on silicon (DIOS) is a high-performance matrix-free mass spectrometry (MS) analysis method that involves using silicon nanostructures as a matrix for MS desorption/ionization. In this study, gold nanoparticles grafted onto a nanostructured silicon (AuNPs-nSi) surface were demonstrated as a DIOS-MS analysis approach with high sensitivity and high detection specificity for glucose detection. A glucose sample deposited on the AuNPs-nSi surface was directly catalyzed to negatively charged gluconic acid molecules on a single AuNPs-nSi chip for MS analysis. The AuNPs-nSi surface was fabricated using two electroless deposition steps and one electroless etching step. The effects of the electroless fabrication parameters on the glucose detection efficiency were evaluated. Practical application of AuNPs-nSi MS glucose analysis in urine samples was also demonstrated in this study.

  4. Composite Materials

    NASA Technical Reports Server (NTRS)

    1988-01-01

    Langley Research Center researchers invented an advanced polymer, a chemical compound formed by uniting many small molecules to create a complex molecule with different chemical properties. The material is a thermoplastic polyimide that resists solvents. Other polymers of this generic type are soluble in solvents, thus cannot be used where solvents are present. High Technology Services (HTS), Inc. licensed technology and is engaged in development and manufacture of high performance plastics, resins and composite materials. Techimer Materials Division is using technology for composite matrix resins that offer heat resistance and protection from radiation, electrical and chemical degradation. Applications of new polymer include molding resins, adhesives and matrix resins for fiber reinforced composites.

  5. Emission spectrometric arcing procedure with minimal effect of chemical form of sample. [performed on refractory metal matrix composites

    NASA Technical Reports Server (NTRS)

    Gordon, W. A.

    1975-01-01

    Matrix effects related to the chemical form of analyzed materials were studied. An arc in argon was used which was buffered with silver chloride. The effect of chemical form was minimal for a variety of metals, oxides, and carbides representing the most refractory compounds and thermally stable metal-containing molecules. Only four of the most refractory materials known showed significant emission depressions due to incomplete volatilization in the arc system. These results are discussed in terms of vapor pressures of the solid materials placed on the anodes and dissociation reactions of the molecules in the gaseous environment.

  6. Design of 3-D adipospheres for quantitative metabolic study

    PubMed Central

    Akama, Takeshi; Leung, Brendan M.; Labuz, Joseph M.; Takayama, Shuichi; Chun, Tae-Hwa

    2017-01-01

    Quantitative assessment of adipose mitochondrial activity is critical for better understanding of adipose tissue function in obesity and diabetes. While the two-dimensional (2-D) tissue culture method has been sufficient to discover key molecules that regulate adipocyte differentiation and function, the method is insufficient to determine the role of extracellular matrix (ECM) molecules and their modifiers, such as matrix metalloproteinases (MMPs), in regulating adipocyte function in three-dimensional (3-D) in vivo-like microenvironments. By using a 3-D hanging drop tissue culture system, we are able to produce scalable 3-D adipospheres that are suitable for quantitative mitochondrial study in 3-D microenvironment. PMID:28244051

  7. Coagulation of linear carbon molecules into nanoparticles: a molecular dynamics study

    NASA Astrophysics Data System (ADS)

    Yamaguchi, Yasutaka; Wakabayashi, Tomonari

    2004-04-01

    Using molecular dynamics (MD) simulations, the coagulation of carbon chain molecules that occurs on the subliming surface of a carbon-containing rare-gas matrix is investigated. Intermolecular connections with dangling bonds enhance the sublimation of the matrix and that results in the emission of a layer of nested carbon chains into vacuum at a velocity about 100 m/s. The following conversion from carbon sp- to more stable sp 2-type bonds heats up the carbon material above 3000 K. During this process, the nested carbon layer self-anneals via a graphitic mono-layer into a conjunct array of particles with a dimension about 10 nm.

  8. The FEM-R-Matrix Approach: Use of Mixed Finite Element and Gaussian Basis Sets for Electron Molecule Collisions

    NASA Technical Reports Server (NTRS)

    Thuemmel, Helmar T.; Huo, Winifred M.; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    For the calculation of electron molecule collision cross sections R-matrix methods automatically take advantage of the division of configuration space into an inner region (I) bounded by radius tau b, where the scattered electron is within the molecular charge cloud and the system is described by an correlated Configuration Interaction (CI) treatment in close analogy to bound state calculations, and an outer region (II) where the scattered electron moves in the long-range multipole potential of the target and efficient analytic methods can be used for solving the asymptotic Schroedinger equation plus boundary conditions.

  9. Atom and Bond Fukui Functions and Matrices: A Hirshfeld-I Atoms-in-Molecule Approach.

    PubMed

    Oña, Ofelia B; De Clercq, Olivier; Alcoba, Diego R; Torre, Alicia; Lain, Luis; Van Neck, Dimitri; Bultinck, Patrick

    2016-09-19

    The Fukui function is often used in its atom-condensed form by isolating it from the molecular Fukui function using a chosen weight function for the atom in the molecule. Recently, Fukui functions and matrices for both atoms and bonds separately were introduced for semiempirical and ab initio levels of theory using Hückel and Mulliken atoms-in-molecule models. In this work, a double partitioning method of the Fukui matrix is proposed within the Hirshfeld-I atoms-in-molecule framework. Diagonalizing the resulting atomic and bond matrices gives eigenvalues and eigenvectors (Fukui orbitals) describing the reactivity of atoms and bonds. The Fukui function is the diagonal element of the Fukui matrix and may be resolved in atom and bond contributions. The extra information contained in the atom and bond resolution of the Fukui matrices and functions is highlighted. The effect of the choice of weight function arising from the Hirshfeld-I approach to obtain atom- and bond-condensed Fukui functions is studied. A comparison of the results with those generated by using the Mulliken atoms-in-molecule approach shows low correlation between the two partitioning schemes. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. The Identification of Complex Organic Molecules in the Interstellar Medium: Using Lasers and Matrix Isolation Spectroscopy to Simulate the Interstellar Environment

    NASA Technical Reports Server (NTRS)

    Stone, Bradley M.

    1998-01-01

    The Astrochemistry Group at NASA Ames Research Center is interested in the identification of large organic molecules in the interstellar medium Many smaller organic species (e.g. hydrocarbons, alcohols, etc.) have been previously identified by their radiofrequency signature due to molecular rotations. However, this becomes increasingly difficult to observe as the size of the molecule increases. Our group in interested in the identification of the carriers of the Diffuse Interstellar Bands (absorption features observed throughout the visible and near-infrared in the spectra of stars, due to species in the interstellar medium). Polycyclic Aromatic Hydrocarbons (PAHs) and related molecules are thought to be good candidates for these carriers. Laboratory experiments am performed at Ames to simulate the interstellar environment, and to compare spectra obtained from molecules in the laboratory to those derived astronomically. We are also interested in PAHs with respect to their possible connection to the UIR (Unidentified infrared) and ERE (Extended Red Emission) bands - emission features found to emanate from particular regions of our galaxy (e.g. Orion nebula, Red Rectangle, etc.). An old, "tried and proven spectroscopic technique, matrix isolation spectroscopy creates molecular conditions ideal for performing laboratory astrophysics.

  11. MALDI Mass Spectrometry Imaging for Visualizing In Situ Metabolism of Endogenous Metabolites and Dietary Phytochemicals

    PubMed Central

    Fujimura, Yoshinori; Miura, Daisuke

    2014-01-01

    Understanding the spatial distribution of bioactive small molecules is indispensable for elucidating their biological or pharmaceutical roles. Mass spectrometry imaging (MSI) enables determination of the distribution of ionizable molecules present in tissue sections of whole-body or single heterogeneous organ samples by direct ionization and detection. This emerging technique is now widely used for in situ label-free molecular imaging of endogenous or exogenous small molecules. MSI allows the simultaneous visualization of many types of molecules including a parent molecule and its metabolites. Thus, MSI has received much attention as a potential tool for pathological analysis, understanding pharmaceutical mechanisms, and biomarker discovery. On the other hand, several issues regarding the technical limitations of MSI are as of yet still unresolved. In this review, we describe the capabilities of the latest matrix-assisted laser desorption/ionization (MALDI)-MSI technology for visualizing in situ metabolism of endogenous metabolites or dietary phytochemicals (food factors), and also discuss the technical problems and new challenges, including MALDI matrix selection and metabolite identification, that need to be addressed for effective and widespread application of MSI in the diverse fields of biological, biomedical, and nutraceutical (food functionality) research. PMID:24957029

  12. Underlying theory of a model for the Renner-Teller effect in tetra-atomic molecules: X(2)Πu electronic state of C2H2(+).

    PubMed

    Perić, M; Jerosimić, S; Mitić, M; Milovanović, M; Ranković, R

    2015-05-07

    In the present study, we prove the plausibility of a simple model for the Renner-Teller effect in tetra-atomic molecules with linear equilibrium geometry by ab initio calculations of the electronic energy surfaces and non-adiabatic matrix elements for the X(2)Πu state of C2H2 (+). This phenomenon is considered as a combination of the usual Renner-Teller effect, appearing in triatomic species, and a kind of the Jahn-Teller effect, similar to the original one arising in highly symmetric molecules. Only four parameters (plus the spin-orbit constant, if the spin effects are taken into account), which can be extracted from ab initio calculations carried out at five appropriate (planar) molecular geometries, are sufficient for building up the Hamiltonian matrix whose diagonalization results in the complete low-energy (bending) vibronic spectrum. The main result of the present study is the proof that the diabatization scheme, hidden beneath the apparent simplicity of the model, can safely be carried out, at small-amplitude bending vibrations, without cumbersome computation of non-adiabatic matrix elements at large number of molecular geometries.

  13. An accurate and linear-scaling method for calculating charge-transfer excitation energies and diabatic couplings

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pavanello, Michele; Van Voorhis, Troy; Visscher, Lucas

    2013-02-07

    Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlapmore » matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Angstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.« less

  14. An accurate and linear-scaling method for calculating charge-transfer excitation energies and diabatic couplings.

    PubMed

    Pavanello, Michele; Van Voorhis, Troy; Visscher, Lucas; Neugebauer, Johannes

    2013-02-07

    Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlap matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Ångstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.

  15. Matrix Metalloproteinases as Regulators of Periodontal Inflammation.

    PubMed

    Franco, Cavalla; Patricia, Hernández-Ríos; Timo, Sorsa; Claudia, Biguetti; Marcela, Hernández

    2017-02-17

    Periodontitis are infectious diseases characterized by immune-mediated destruction of periodontal supporting tissues and tooth loss. Matrix metalloproteinases (MMPs) are key proteases involved in destructive periodontal diseases. The study and interest in MMP has been fuelled by emerging evidence demonstrating the broad spectrum of molecules that can be cleaved by them and the myriad of biological processes that they can potentially regulate. The huge complexity of MMP functions within the 'protease web' is crucial for many physiologic and pathologic processes, including immunity, inflammation, bone resorption, and wound healing. Evidence points out that MMPs assemble in activation cascades and besides their classical extracellular matrix substrates, they cleave several signalling molecules-such as cytokines, chemokines, and growth factors, among others-regulating their biological functions and/or bioavailability during periodontal diseases. In this review, we provide an overview of emerging evidence of MMPs as regulators of periodontal inflammation.

  16. Advanced polymeric matrix for valvular complications.

    PubMed

    Acharya, Gayathri; Hopkins, Richard A; Lee, Chi H

    2012-05-01

    Poly(L-lactic acid) (PLLA) matrix systems incorporated with poly(lactic-co-glycolic acid) (PLGA) nanoparticles (NPs) containing nitric oxide (NO) donors (DETA NONOate) were developed for prevention of heart valve complications through sustained and controlled release of NO. PLLA matrices were prepared using the salt leaching method and the properties and drug release profiles were characterized. For assessment of the effects of PLLA systems on the pharmacological responses and cytotoxicity, various factors, such as calcium content, alkaline phosphatase (ALP) activity, cyclic guanosine monophosphate (cGMP) expression, intercellular adhesion molecule (ICAM-1) expression and cell viability of porcine aortic valve interstitial cells (PAVICs), were evaluated. PLLA matrices embedded with PLGA- NPs demonstrated its usefulness in alleviating the calcification rate of the VICs. The cGMP levels under osteoblastic conditions significantly increased, supporting that anticalcification activity of NO is mediated through NO-cGMP signaling pathway. The level of ICAM-1 expression in cells exposed to NO was lowered, suggesting that NO has an inhibitory activity against tissue inflammation. NO releases from PLLA matrix embedded with PLGA NPs prevented valvular calcification and inflammation without causing any cytotoxic activities. PLLA matrix system loaded with NPs containing NO donors could provide a new platform for sustained and controlled delivery of NO, significantly reducing valvular complications. Copyright © 2012 Wiley Periodicals, Inc.

  17. Adhesion to the extracellular matrix is positively regulated by retinoic acid in HepG2 cells.

    PubMed

    Massimi, Mara; Devirgiliis, Laura Conti

    2007-02-01

    In this work, we aimed to investigate the possible modulation of cell-matrix interactions by retinoic acid (RA), in view of the well-known role of the extracellular matrix (ECM) and integrins in hepatocyte differentiation and proliferation. For this purpose, we analysed the adhesion ability of HepG2 cells on different substrates in the presence and absence of RA evaluating both the expression and cellular localisation of major proteins involved in focal contacts, using Western blot and confocal microscopy. A positive and substrate-dependent effect of RA on cell-matrix adhesion was observed after long-term culture. The increased adhesiveness in the treated cells was accompanied by an enhanced expression of beta1 and alpha3 integrin subunits, together with a redistribution of beta1 receptors clustered at the basal surface. In contrast, the levels of focal adhesion kinase (FAK), paxillin and alpha-actinin were unchanged, as was the phosphorylation state of FAK. Nonetheless, a stronger association between beta1 integrin and intracytoplasmatic proteins of focal contacts was observed in coimmunoprecipitation experiments after RA treatment, suggesting improved connection with the actin cytoskeleton. These results are consistent with previously described antiproliferative and differentiative effects of RA on transformed hepatocytes, and confirm the hypothesis of a direct influence of RA on specific adhesion molecules.

  18. Efficient Enrichment and Analysis of Vicinal-Diol-Containing Flavonoid Molecules Using Boronic-Acid-Functionalized Particles and Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry.

    PubMed

    Kim, Eunjin; Kang, Hyunook; Choi, Insung; Song, Jihyeon; Mok, Hyejung; Jung, Woong; Yeo, Woon-Seok

    2018-05-09

    Detection and quantitation of flavonoids are relatively difficult compared to those of other small-molecule analytes because flavonoids undergo rapid metabolic processes, resulting in their elimination from the body. Here, we report an efficient enrichment method for facilitating the analysis of vicinal-diol-containing flavonoid molecules using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. In our strategy, boronic-acid-functionalized polyacrylamide particles were used, where boronic acids bound to vicinal diols to form boronate monoesters at basic pH. This complex remained intact during the enrichment processes, and the vicinal-diol-containing flavonoids were easily separated by centrifugation and subsequent acidic treatments. The selectivity and limit of detection of our strategy were confirmed by mass spectrometry analysis, and the validity was assessed by performing the detection and quantitation of quercetin in mouse organs.

  19. Diamond nanowires for highly sensitive matrix-free mass spectrometry analysis of small molecules.

    PubMed

    Coffinier, Yannick; Szunerits, Sabine; Drobecq, Hervé; Melnyk, Oleg; Boukherroub, Rabah

    2012-01-07

    This paper reports on the use of boron-doped diamond nanowires (BDD NWs) as an inorganic substrate for matrix-free laser desorption/ionization mass spectrometry (LDI-MS) analysis of small molecules. The diamond nanowires are prepared by reactive ion etching (RIE) with oxygen plasma of highly boron-doped (the boron level is 10(19) B cm(-3)) or undoped nanocrystalline diamond substrates. The resulting diamond nanowires are coated with a thin silicon oxide layer that confers a superhydrophilic character to the surface. To minimize droplet spreading, the nanowires were chemically functionalized with octadecyltrichlorosilane (OTS) and then UV/ozone treated to reach a final water contact angle of 120°. The sub-bandgap absorption under UV laser irradiation and the heat confinement inside the nanowires allowed desorption/ionization, most likely via a thermal mechanism, and mass spectrometry analysis of small molecules. A detection limit of 200 zeptomole for verapamil was demonstrated.

  20. Hierarchical and non-hierarchical mineralisation of collagen

    PubMed Central

    Liu, Yan; Kim, Young-Kyung; Dai, Lin; Li, Nan; Khan, Sara; Pashley, David H.; Tay, Franklin R.

    2010-01-01

    Biomineralisation of collagen involves functional motifs incorporated in extracellular matrix protein molecules to accomplish the objectives of stabilising amorphous calcium phosphate into nanoprecursors and directing the nucleation and growth of apatite within collagen fibrils. Here we report the use of small inorganic polyphosphate molecules to template hierarchical intrafibrillar apatite assembly in reconstituted collagen in the presence of polyacrylic acid to sequester calcium and phosphate into transient amorphous nanophases. The use of polyphosphate without a sequestration analogue resulted only in randomly-oriented extrafibrillar precipitations along the fibrillar surface. Conversely, the use of polyacrylic acid without a templating analogue resulted only in non-hierarchical intrafibrillar mineralisation with continuous apatite strands instead of discrete crystallites. The ability of using simple non-protein molecules to recapitulate different levels of structural hierarchy in mineralised collagen signifies the ultimate simplicity in Nature’s biomineralisation design principles and challenges the need for using more complex recombinant matrix proteins in bioengineering applications. PMID:21040969

  1. Matrix-isolation and ab initio study of HKrCCCl and HXeCCCl

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Cheng; Räsänen, Markku; Khriachtchev, Leonid, E-mail: leonid.khriachtchev@helsinki.fi

    2015-12-28

    We report on two new noble-gas molecules, HKrCCCl and HXeCCCl, prepared in low-temperature Kr and Xe matrices. These molecules are made by UV photolysis of HCCCl in the matrices and subsequent thermal annealing. The HCCCl precursor is produced by microwave discharge of a mixture of a matrix gas with trichloroethylene (HClC=CCl{sub 2}). The assignments of the new noble-gas molecules are supported by deuteration experiments and quantum chemical calculations at the MP2(full) and CCSD(T) levels of theory with the def2-TZVPPD basis set. No evidence of ClXeCCH, which is computationally reliably stable, is found in the experiments. ClKrCCH as well as themore » Ar compounds HArCCCl and ClArCCH are not observed either, which is in agreement with the calculations.« less

  2. Extracellular Matrix and Redox Signaling in Cellular Responses to Stress.

    PubMed

    Roberts, David D

    2017-10-20

    Cells in multicellular organisms communicate extensively with neighboring cells and distant organs using a variety of secreted proteins and small molecules. Cells also reside in a structural extracellular matrix (ECM), and changes in its composition, mechanical properties, and post-translational modifications provide additional layers of communication. This Forum addresses emerging mechanisms by which redox signaling controls and is controlled by changes in the ECM, focusing on the roles of matricellular proteins. These proteins engage specific cell surface signaling receptors, integrins, and proteoglycans to regulate the biosynthesis and catabolism of redox signaling molecules and the activation of their signal transducers. These signaling pathways, in turn, regulate the composition of ECM and its function. Covalent post-translational modifications of ECM by redox molecules further regulate its structure and function. Recent studies of acute injuries and chronic disease have identified important pathophysiological roles for this cross-talk and new therapeutic opportunities. Antioxid. Redox Signal. 27, 771-773.

  3. Identification of Bacteria Using Matrix-Assisted Laser Desorption Ionization Time-of-Flight Mass Spectrometry

    ERIC Educational Resources Information Center

    Kedney, Mollie G.; Strunk, Kevin B.; Giaquinto, Lisa M.; Wagner, Jennifer A.; Pollack, Sidney; Patton, Walter A.

    2007-01-01

    Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS or simply MALDI) has become ubiquitous in the identification and analysis of biomacromolecules. As a technique that allows for the molecular weight determination of otherwise nonvolatile molecules, MALDI has had a profound impact in the molecular…

  4. Matrix isolation infrared spectra and photochemistry of hydantoin.

    PubMed

    Ildiz, Gulce Ogruc; Nunes, Cláudio M; Fausto, Rui

    2013-01-31

    Hydantoin (C(3)H(4)N(2)O(2), 2,4-imidazolidinedione) was isolated in argon matrix at 10 K and its infrared spectrum and unimolecular photochemistry were investigated. The molecular structure of the compound was studied both at the DFT(B3LYP) and MP2 levels of approximation with valence triple- and quadruple-ζ basis sets (6-311++G(d,p); cc-pVQZ). It was concluded that the minima in the potential energy surfaces of the molecule correspond to C(1) symmetry structures. However, the energy barrier separating the two-equivalent-by-symmetry minima stays below their zero-point energy, which makes the C(s) symmetry structure, which separates the two minima, the experimentally relevant one. The electronic structure of the molecule was studied in detail by performing the Natural Bond Orbital analysis of its electronic configuration within the DFT(B3LYP)/cc-pVQZ space. The infrared spectrum of the matrix isolated compound was fully assigned also with help of the theoretically predicted spectrum. Upon irradiation at λ = 230 nm, matrix-isolated hydantoin was found to photofragment into isocyanic acid, CO, and methylenimine.

  5. Curcumin: a potential candidate for matrix metalloproteinase inhibitors.

    PubMed

    Kumar, Dileep; Kumar, Manish; Saravanan, Chinnadurai; Singh, Sushil Kumar

    2012-10-01

    Curcumin, a natural yellow pigment of turmeric, has become focus of interest with regard to its role in regulation of matrix metalloproteinases (MMPs). MMPs are metal-dependent endopeptidases capable of degrading components of the extracellular matrix. MMPs are involved in chronic diseases such as arthritis, Alzheimer's disease, psoriasis, chronic obstructive pulmonary disease, asthma, cancer, neuropathic pain, and atherosclerosis. Curcumin regulates the expression and secretion of various MMPs. This review documents the matrix metalloproteinase inhibitory activity of curcumin on various diseases viz., cancer, arthritis, and ulcer. Finally, the steps to be taken for getting potent curcuminoids have also been discussed in the structure-activity relationship (SAR) section. From this review, readers can get answer to the question: Is curcumin a potential MMPI candidate? Numerous approaches have been taken to beget a molecule with specificity restricted to a particular MMP as well as good oral bioavailability; however, nearly all the molecules lack these criteria. Using quantitative structure-activity relationship (QSAR) modeling and virtual screening, new analogs of curcumin can be designed which will be selectively inhibiting different MMPs.

  6. Identification of carbohydrates by matrix-free material-enhanced laser desorption/ionisation mass spectrometry.

    PubMed

    Hashir, Muhammad Ahsan; Stecher, Guenther; Bakry, Rania; Kasemsook, Saowapak; Blassnig, Bernhard; Feuerstein, Isabel; Abel, Gudrun; Popp, Michael; Bobleter, Ortwin; Bonn, Guenther K

    2007-01-01

    Matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF-MS) is a sensitive mass spectrometric technique which utilises acidic materials as matrices for laser energy absorption, desorption and ionisation of analytes. These matrix materials produce background signals particularly in the low-mass range and make the detection and identification of small molecules difficult and nearly impossible. To overcome this problem this paper introduces matrix-free material-enhanced laser desorption/ionisation mass spectrometry (mf-MELDI-MS) for the screening and analysis of small molecules such as carbohydrates. For this purpose, 4,4'-azo-dianiline was immobilised on silica gel enabling the absorption of laser energy sufficient for successful desorption and ionisation of low molecular weight compounds. The particle and pore sizes, the solvent system for suspension and the sample preparation procedures have been optimised. The newly synthesised MELDI material delivered excellent spectra with regard to signal-to-noise ratio and detection sensitivity. Finally, wheat straw degradation products and Salix alba L. plant extracts were analysed proving the high performance and excellent behaviour of the introduced material. Copyright (c) 2007 John Wiley & Sons, Ltd.

  7. Electronic method for autofluorography of macromolecules on two-D matrices. [Patent application

    DOEpatents

    Davidson, J.B.; Case, A.L.

    1981-12-30

    A method for detecting, localizing, and quantifying macromolecules contained in a two-dimensional matrix is provided which employs a television-based position sensitive detection system. A molecule-containing matrix may be produced by conventional means to produce spots of light at the molecule locations which are detected by the television system. The matrix, such as a gel matrix, is exposed to an electronic camera system including an image-intensifier and secondary electron conduction camera capable of light integrating times of many minutes. A light image stored in the form of a charge image on the camera tube target is scanned by conventional television techniques, digitized, and stored in a digital memory. Intensity of any point on the image may be determined from the number at the memory address of the point. The entire image may be displayed on a television monitor for inspection and photographing or individual spots may be analyzed through selected readout of the memory locations. Compared to conventional film exposure methods, the exposure time may be reduced 100 to 1000 times.

  8. Measuring order in disordered systems and disorder in ordered systems: Random matrix theory for isotropic and nematic liquid crystals and its perspective on pseudo-nematic domains

    NASA Astrophysics Data System (ADS)

    Zhao, Yan; Stratt, Richard M.

    2018-05-01

    Surprisingly long-ranged intermolecular correlations begin to appear in isotropic (orientationally disordered) phases of liquid crystal forming molecules when the temperature or density starts to close in on the boundary with the nematic (ordered) phase. Indeed, the presence of slowly relaxing, strongly orientationally correlated, sets of molecules under putatively disordered conditions ("pseudo-nematic domains") has been apparent for some time from light-scattering and optical-Kerr experiments. Still, a fully microscopic characterization of these domains has been lacking. We illustrate in this paper how pseudo-nematic domains can be studied in even relatively small computer simulations by looking for order-parameter tensor fluctuations much larger than one would expect from random matrix theory. To develop this idea, we show that random matrix theory offers an exact description of how the probability distribution for liquid-crystal order parameter tensors converges to its macroscopic-system limit. We then illustrate how domain properties can be inferred from finite-size-induced deviations from these random matrix predictions. A straightforward generalization of time-independent random matrix theory also allows us to prove that the analogous random matrix predictions for the time dependence of the order-parameter tensor are similarly exact in the macroscopic limit, and that relaxation behavior of the domains can be seen in the breakdown of the finite-size scaling required by that random-matrix theory.

  9. Direct Observation of Quantum Coherence in Single-Molecule Magnets

    NASA Astrophysics Data System (ADS)

    Schlegel, C.; van Slageren, J.; Manoli, M.; Brechin, E. K.; Dressel, M.

    2008-10-01

    Direct evidence of quantum coherence in a single-molecule magnet in a frozen solution is reported with coherence times as long as T2=630±30ns. We can strongly increase the coherence time by modifying the matrix in which the single-molecule magnets are embedded. The electron spins are coupled to the proton nuclear spins of both the molecule itself and, interestingly, also to those of the solvent. The clear observation of Rabi oscillations indicates that we can manipulate the spin coherently, an essential prerequisite for performing quantum computations.

  10. Computational Study of Electron-Molecule Collisions Related to Low-Temperature Plasmas.

    NASA Astrophysics Data System (ADS)

    Huo, Winifred M.

    1997-10-01

    Computational study of electron-molecule collisions not only complements experimental measurements, but can also be used to investigate processes not readily accessible experimentally. A number of ab initio computational methods are available for this type of calculations. Here we describe a recently developed technique, the finite element Z-matrix method. Analogous to the R-matrix method, it partitions the space into regions and employs real matrix elements. However, unlike the implementation of the R-matrix method commonly used in atomic and molecular physics,(C. J. Gillan, J. Tennyson, and P. G. Burke, Chapter 10 in Computational Methods for Electron-Molecule Collisions), W. M. Huo and F. A. Gianturco, Editors, Plenum, New York (1995), p. 239. the Z-matrix method is fully variational.(D. Brown and J. C. Light, J. Chem. Phys. 101), 3723 (1994). In the present implementation, a mixed basis of finite elements and Gaussians is used to represent the continuum electron, thus offering full flexibility without imposing fixed boundary conditions. Numerical examples include the electron-impact dissociation of N2 via the metastable A^3Σ_u^+ state, a process which may be important in the lower thermosphere, and the dissociation of the CF radical, a process of interest to plasma etching. To understand the dissociation pathways, large scale quantum chemical calculations have been carried out for all target states which dissociate to the lowest five limits in the case of N_2, and to the lowest two limits in the case of CF. For N_2, the structural calculations clearly show the preference for predissociation if the initial state is the ground X^1Σ_g^+ state, but direct dissociation appears to be preferable if the initial state is the A^3Σ_u^+ state. Multi-configuration SCF target functions are used in the collisional calculation,

  11. Whitby Mudstone, flow from matrix to fractures

    NASA Astrophysics Data System (ADS)

    Houben, Maartje; Hardebol, Nico; Barnhoorn, Auke; Boersma, Quinten; Peach, Colin; Bertotti, Giovanni; Drury, Martyn

    2016-04-01

    Fluid flow from matrix to well in shales would be faster if we account for the duality of the permeable medium considering a high permeable fracture network together with a tight matrix. To investigate how long and how far a gas molecule would have to travel through the matrix until it reaches an open connected fracture we investigated the permeability of the Whitby Mudstone (UK) matrix in combination with mapping the fracture network present in the current outcrops of the Whitby Mudstone at the Yorkshire coast. Matrix permeability was measured perpendicular to the bedding using a pressure step decay method on core samples and permeability values are in the microdarcy range. The natural fracture network present in the pavement shows a connected network with dominant NS and EW strikes, where the NS fractures are the main fracture set with an orthogonal fracture set EW. Fracture spacing relations in the pavements show that the average distance to the nearest fracture varies between 7 cm (EW) and 14 cm (NS), where 90% of the matrix is 30 cm away from the nearest fracture. By making some assumptions like; fracture network at depth is similar to what is exposed in the current pavements and open to flow, fracture network is at hydrostatic pressure at 3 km depth, overpressure between matrix and fractures is 10% and a matrix permeability perpendicular to the bedding of 0.1 microdarcy, we have calculated the time it takes for a gas molecule to travel to the nearest fracture. These input values give travel times up to 8 days for a distance of 14 cm. If the permeability is changed to 1 nanodarcy or 10 microdarcy travel times change to 2.2 years or 2 hours respectively.

  12. Constant size descriptors for accurate machine learning models of molecular properties

    NASA Astrophysics Data System (ADS)

    Collins, Christopher R.; Gordon, Geoffrey J.; von Lilienfeld, O. Anatole; Yaron, David J.

    2018-06-01

    Two different classes of molecular representations for use in machine learning of thermodynamic and electronic properties are studied. The representations are evaluated by monitoring the performance of linear and kernel ridge regression models on well-studied data sets of small organic molecules. One class of representations studied here counts the occurrence of bonding patterns in the molecule. These require only the connectivity of atoms in the molecule as may be obtained from a line diagram or a SMILES string. The second class utilizes the three-dimensional structure of the molecule. These include the Coulomb matrix and Bag of Bonds, which list the inter-atomic distances present in the molecule, and Encoded Bonds, which encode such lists into a feature vector whose length is independent of molecular size. Encoded Bonds' features introduced here have the advantage of leading to models that may be trained on smaller molecules and then used successfully on larger molecules. A wide range of feature sets are constructed by selecting, at each rank, either a graph or geometry-based feature. Here, rank refers to the number of atoms involved in the feature, e.g., atom counts are rank 1, while Encoded Bonds are rank 2. For atomization energies in the QM7 data set, the best graph-based feature set gives a mean absolute error of 3.4 kcal/mol. Inclusion of 3D geometry substantially enhances the performance, with Encoded Bonds giving 2.4 kcal/mol, when used alone, and 1.19 kcal/mol, when combined with graph features.

  13. Design and characterization of a plastic optical fiber pH sensor

    NASA Astrophysics Data System (ADS)

    Ferreira, Licínio; Simões, Pedro; Carvalho, Rui S.; Lopes, Paulo; Ferreira, Mário

    2013-11-01

    In this paper are present the design and characterization of a pH sensor using plastic optical fiber (POF) technology and a material produced by the sol-gel process with TEOS (tetraethyl orthosilicate) to immobilize universal indicator of pH (comprised of Thymol Blue, Methyl Red, Bromothymol Blue and Phenolphthalein) inside the silica matrix. This matrix is positioned between two extensions of plastic optical fiber tightly positioned at each side with both fibers aligned and sharing a common optical axis. This set will work as a pH sensor since the matrix embedded with indicator and in the presence of a solution (basic or acid solution) will change the optical transmittance properties. The optical source is a superluminescent white LED and the receiver is a photodiode having a good and linear responsivity in the visible spectrum. This pH sensitive matrix has large pores which allow the diffusion of the surrounding fluid molecules into the matrix and thus the close contact of these to the indicator molecules. This contact causes the change of color of the whole matrix allowing proper colorimetric detection by the photodiode. This variation of color associated with the detector wavelength linear response is the base of operation of the proposed device. This pH sensor presents many advantages over the standard and commercial pH meters namely, lightweight, portability and a low cost.

  14. Interleukin-8 is associated with adhesion, migration and invasion in human gastric cancer SCG-7901 cells.

    PubMed

    Ju, Dawei; Sun, Dazhi; Xiu, Lijuan; Meng, Xianze; Zhang, Cian; Wei, Pinkang

    2012-03-01

    Interleukin-8 is known as an important chemokine involved in tumor angiogenesis and progression. Overexpression of interleukin-8 has been detected in a variety of human tumors, including gastric cancer, and is negatively correlated with prognosis. The aim of our study is to determine the effects of interleukin-8 on proliferation, adhesion, migration and invasion abilities and correlated molecular mechanisms in gastric cancer. We made recombinant interleukin-8 ranged from 0 ng/ml to 100 ng/ml interferes in human gastric cancer SCG-7901 cells in vitro. The results shown that interleukin-8 did not change cell proliferation, but promoted cell adhesion to endothelial cell and extracellular matrix components (collagen, laminin and fibronectin) as detected by Cell Counting Kit-8. And it induced migration and invasion ability based on scratch and transwell-chamber assays. Also, interleukin-8 regulated the protein and mRNA expression of matrix metalloproteinase-9, intercellular adhesion molecule-1 and E-cad and there was obviously a dose-dependent relationship, but the protein or mRNA expression of matrix metalloproteinase-2 was not obviously changed under the tested conditions. Our findings indicate that interleukin-8 is associated with adhesion, migration and invasion in gastric cancer and the regulation of matrix metalloproteinase-9, intercellular adhesion molecule-1 and E-cad expression is one of the potential molecule mechanisms. The studies imply interleukin-8 may be an alternative treatment strategy against gastric cancer.

  15. Nectin-like molecule 1 inhibits the migration and invasion of U251 glioma cells by regulating the expression of an extracellular matrix protein osteopontin.

    PubMed

    Yin, Bin; Li, Ke-han; An, Tai; Chen, Tao; Peng, Xiao-zhong

    2010-06-01

    To investigate the molecular mechanism of nectin-like molecule 1 (NECL1) inhibiting the migration and invasion of U251 glioma cells. We infected U251 glioma cells with adeno-nectin-like molecule 1 (Ad-NECL1) or empty adenovirus (Ad). Transwell and wound healing assays were performed to observe the migration of U251 cells incubated with the cell supernatant from Ad-NECL1 or Ad infected U251 cells. DNA microarray was applied to screen the gene expression profile after the restoration of NECL1 in U251 glioma cell lines. The differential expression of osteopontin (OPN), a gene related to migration and invasion, was further analyzed with semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), Western blot, and immunohistochemistry. The restoration of NECL1 inhibited migration of U251 cells significantly (P<0.05). Altogether 195 genes were found differentially expressed by microarray, in which 175 were up-regulated and 20 down-regulated, including 9 extracellular matrix proteins involved in the migration of cells. Both mRNA and protein expressions of OPN, the most markedly reduced extracellular matrix protein, were found decreased in U251 cells after restoration of NECL1. Immunohistochemical assay also detected an increase of OPN in glioma tissues, related with the progressing of malignant grade. A link might exist between NECL1 and the extracellular matrix protein OPN in inhibiting the migration and invasion of U251 glioma cells.

  16. Black phosphorus-assisted laser desorption ionization mass spectrometry for the determination of low-molecular-weight compounds in biofluids.

    PubMed

    He, Xiao-Mei; Ding, Jun; Yu, Lei; Hussain, Dilshad; Feng, Yu-Qi

    2016-09-01

    Quantitative analysis of small molecules by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has been a challenging task due to matrix-derived interferences in low m/z region and poor reproducibility of MS signal response. In this study, we developed an approach by applying black phosphorus (BP) as a matrix-assisted laser desorption ionization (MALDI) matrix for the quantitative analysis of small molecules for the first time. Black phosphorus-assisted laser desorption/ionization mass spectrometry (BP/ALDI-MS) showed clear background and exhibited superior detection sensitivity toward quaternary ammonium compounds compared to carbon-based materials. By combining stable isotope labeling (SIL) strategy with BP/ALDI-MS (SIL-BP/ALDI-MS), a variety of analytes labeled with quaternary ammonium group were sensitively detected. Moreover, the isotope-labeled forms of analytes also served as internal standards, which broadened the analyte coverage of BP/ALDI-MS and improved the reproducibility of MS signals. Based on these advantages, a reliable method for quantitative analysis of aldehydes from complex biological samples (saliva, urine, and serum) was successfully established. Good linearities were obtained for five aldehydes in the range of 0.1-20.0 μM with correlation coefficients (R (2)) larger than 0.9928. The LODs were found to be 20 to 100 nM. Reproducibility of the method was obtained with intra-day and inter-day relative standard deviations (RSDs) less than 10.4 %, and the recoveries in saliva samples ranged from 91.4 to 117.1 %. Taken together, the proposed SIL-BP/ALDI-MS strategy has proved to be a reliable tool for quantitative analysis of aldehydes from complex samples. Graphical Abstract An approach for the determination of small molecules was developed by using black phosphorus (BP) as a matrix-assisted laser desorption ionization (MALDI) matrix.

  17. Material Properties of Matrix Lipids Determine Conformation and Intermolecular Reactivity of a Diacetylenic Phosphatidylcholine in the Lipid Bilayer

    PubMed Central

    Puri, Anu; Jang, Hyunbum; Yavlovich, Amichai; Masood, M. Athar; Veenstra, Timothy D.; Luna, Carlos; Aranda-Espinoza, Helim; Nussinov, Ruth; Blumenthal, Robert

    2011-01-01

    Photopolymerizable phospholipid DC8,9PC (1,2-bis-(tricosa-10,12-diynoyl)-sn-glycero-3-phosphocholine) exhibits unique assembly characteristics in the lipid bilayer. Due to the presence of the diacetylene groups, DC8,9PC undergoes polymerization upon UV (254 nm) exposure and assumes chromogenic properties. DC8,9PC photopolymerization in a gel phase matrix lipid 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) monitored by UV-VIS absorption spectroscopy occurred within 2 minutes after UV treatment, whereas no spectral shifts were observed when DC8,9PC was incorporated in a liquid phase matrix 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC). Liquid chromatography-tandem mass spectrometry analysis showed a decrease in DC8,9PC monomer in both DPPC and POPC environments without any change in matrix lipids in UV-treated samples. Molecular Dynamics (MD) simulations of DPPC/DC8,9PC and POPC/DC8,9PC bilayers indicate that the DC8,9PC molecules adjust to the thickness of the matrix lipid bilayer. Furthermore, motions of DC8,9PC in the gel phase bilayer are more restricted than in the fluid bilayer. The restricted motional flexibility of DC8,9PC (in the gel phase) enables the reactive diacetylenes in individual molecules to align and undergo polymerization, whereas the unrestricted motions in the fluid bilayer restrict polymerization due to the lack of appropriate alignment of the DC8,9PC fatty acyl chains. Fluorescence microscopy data indicates homogenous distribution of the lipid probe 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-lissamine rhodamine B sulfonyl ammonium salt (N-Rh-PE) in POPC/DC8,9PC monolayers, but domain formation in DPPC/DC8,9PC monolayers. These results show that the DC8,9PC molecules cluster and assume the preferred conformation in the gel phase matrix for UV-triggered polymerization reaction. PMID:22053903

  18. Matrix MetalloProteinases (MMPs) andTissue Inhibitors of MetalloProteinases (TIMPs): positive and negative regulators intumor cell adhesion

    PubMed Central

    Bourboulia, Dimitra; Stetler-Stevenson, William G.

    2010-01-01

    Cells adhere to one another and/or to matrices that surround them. Regulation of cell-cell (intercellular) and cell-matrix adhesion is tightly controlled in normal cells, however, defects in cell adhesion are common in the majority of humancancers. Multilateral communication among tumor cells with the extracellular matrix (ECM) and neighbor cells is accomplished through adhesion molecules, ECM components, proteolytic enzymes and their endogenous inhibitors. There is sufficient evidence to suggest that reduced adherence is a tumor cell propertyengaged during tumor progression. Tumor cells acquire the ability to change shape, detach and easily move through spaces disorganizing the normal tissue architecture. This property is due to changes in expression levels of adhesion molecules and/or due to elevated levels of secreted proteolytic enzymes, including matrix metalloproteinases (MMPs). Among other roles, MMPsdegrade the ECMand, therefore, prepare the path for tumor cells to migrate, invade and spread to distant secondary areas, where they form metastasis. Tissue Inhibitors of Metalloproteinases or TIMPs control MMP activities and, therefore, minimize matrix degradation. Both MMPs and TIMPs are involved in tissue remodeling and decisively regulate tumor cell progression including tumor angiogenesis. In this review, we describe and discuss data that support the important role of MMPs and TIMPs in cancer cell adhesion and tumor progression. PMID:20470890

  19. Matrix Metalloproteinases 2 and 9 Are Differentially Expressed in Patients with Indeterminate and Cardiac Clinical Forms of Chagas Disease

    PubMed Central

    Fares, Rafaelle Christine Gomes; Gomes, Juliana de Assis Silva; Garzoni, Luciana Ribeiro; Waghabi, Mariana Caldas; Saraiva, Roberto Magalhães; Medeiros, Nayara Ingrid; Oliveira-Prado, Roberta; Sangenis, Luiz Henrique Conde; Chambela, Mayara da Costa; de Araújo, Fernanda Fortes; Teixeira-Carvalho, Andréa; Damásio, Marcos Paulo; Valente, Vanessa Azevedo; Ferreira, Karine Silvestre; Sousa, Giovane Rodrigo; Rocha, Manoel Otávio da Costa

    2013-01-01

    Dilated chronic cardiomyopathy (DCC) from Chagas disease is associated with myocardial remodeling and interstitial fibrosis, resulting in extracellular matrix (ECM) changes. In this study, we characterized for the first time the serum matrix metalloproteinase 2 (MMP-2) and MMP-9 levels, as well as their main cell sources in peripheral blood mononuclear cells from patients presenting with the indeterminate (IND) or cardiac (CARD) clinical form of Chagas disease. Our results showed that serum levels of MMP-9 are associated with the severity of Chagas disease. The analysis of MMP production by T lymphocytes showed that CD8+ T cells are the main mononuclear leukocyte source of both MMP-2 and MMP-9 molecules. Using a new 3-dimensional model of fibrosis, we observed that sera from patients with Chagas disease induced an increase in the extracellular matrix components in cardiac spheroids. Furthermore, MMP-2 and MMP-9 showed different correlations with matrix proteins and inflammatory cytokines in patients with Chagas disease. Our results suggest that MMP-2 and MMP-9 show distinct activities in Chagas disease pathogenesis. While MMP-9 seems to be involved in the inflammation and cardiac remodeling of Chagas disease, MMP-2 does not correlate with inflammatory molecules. PMID:23856618

  20. Matrix-Isolation Spectroscopy of Reactive Organic Molecules of Relevance to Interstellar Space

    NASA Astrophysics Data System (ADS)

    Kopff, Laura A.; Nolan, Alex M.; Kreifels, Terese A.; Draxler, Thomas W.; Esselman, Brian J.; Burrmann, Nicola J.; McMahon, Robert J.

    2010-11-01

    Matrix isolation, the process of trapping a molecule in an inert gas at low temperature, provides a means for studying highly reactive intermediates, such as carbenes or radicals. Reactive species can be characterized by IR, UV-vis and/or EPR spectroscopy. Comparison of experimental and computed spectral data, as well as chemical reactivity, is used for structural assignment Triplet propynylidene is proposed to exist in the interstellar medium (ISM), due to the detection of a higher-energy isomers via rotational spectroscopy. Currently, we are exploring the structural and photochemical effects of varying substituents on the propynylidne system. A diazo precursor has been synthesized and photolyzed to produce dimethylpropynylidene in an argon matrix. A photochemical hydrogen shift to produce 1-penten-3-yne has been observed through infrared spectroscopy. Cyanocarbons are known to be abundant in the ISM and the atmosphere of Titan, however matrixisolation studies have not yet been carried out for a significant number of these compounds. Photolysis of 3-cyano-3-methyldiazirine should yield methylcyanocarbene, one of the simplest species in this family. Another molecule of interest is l-HC4N, which has been detected in the ISM, but has not yet been matrix-isolated and characterized. The study of arylcarbenes is vital to understanding the chemistry of carbon-rich environments, such as discharges, interstellar clouds, and circumstellar envelopes. The identification of small, sulfur containing molecules, and the identification of aromatics in the ISM make future thiophene and benzothiophene detections a real possibility. Studies on 2- and 3-diazomethyl substituted benzothiophenes are underway to assess their photochemical reactivity and potential for forming benzothiophene carbenes. Macrocylic polyynes are proposed to be involved in carbon condensation via the ring coalescence and annealing model to produce graphitic sheets or fullerenes. To simplify a complex system we are experimentally and computationally studying the series of ethynyl-substituted cyclobutadienes and their possible involvement in the build-up of larger carbon containing molecules in the ISM. The Bergman cyclization of cyclobutadiene has been explored computationally and the photochemical precursor is currently being synthesized.

  1. Immobilized fluid membranes for gas separation

    DOEpatents

    Liu, Wei; Canfield, Nathan L; Zhang, Jian; Li, Xiaohong Shari; Zhang, Jiguang

    2014-03-18

    Provided herein are immobilized liquid membranes for gas separation, methods of preparing such membranes and uses thereof. In one example, the immobilized membrane includes a porous metallic host matrix and an immobilized liquid fluid (such as a silicone oil) that is immobilized within one or more pores included within the porous metallic host matrix. The immobilized liquid membrane is capable of selective permeation of one type of molecule (such as oxygen) over another type of molecule (such as water). In some examples, the selective membrane is incorporated into a device to supply oxygen from ambient air to the device for electrochemical reactions, and at the same time, to block water penetration and electrolyte loss from the device.

  2. Statistical Analysis of Big Data on Pharmacogenomics

    PubMed Central

    Fan, Jianqing; Liu, Han

    2013-01-01

    This paper discusses statistical methods for estimating complex correlation structure from large pharmacogenomic datasets. We selectively review several prominent statistical methods for estimating large covariance matrix for understanding correlation structure, inverse covariance matrix for network modeling, large-scale simultaneous tests for selecting significantly differently expressed genes and proteins and genetic markers for complex diseases, and high dimensional variable selection for identifying important molecules for understanding molecule mechanisms in pharmacogenomics. Their applications to gene network estimation and biomarker selection are used to illustrate the methodological power. Several new challenges of Big data analysis, including complex data distribution, missing data, measurement error, spurious correlation, endogeneity, and the need for robust statistical methods, are also discussed. PMID:23602905

  3. Nanostructured transition metal oxides useful for water oxidation catalysis

    DOEpatents

    Frei, Heinz M; Jiao, Feng

    2013-12-24

    The present invention provides for a composition comprising a nanostructured transition metal oxide capable of oxidizing two H.sub.2O molecules to obtain four protons. In some embodiments of the invention, the composition further comprises a porous matrix wherein the nanocluster of the transition metal oxide is embedded on and/or in the porous matrix.

  4. Nicholas Metropolis Award for Outstanding Doctoral Thesis Work in Computational Physics: Quantum many-body physics of ultracold molecules in optical lattices: models and simulation methods

    NASA Astrophysics Data System (ADS)

    Wall, Michael

    2014-03-01

    Experimental progress in generating and manipulating synthetic quantum systems, such as ultracold atoms and molecules in optical lattices, has revolutionized our understanding of quantum many-body phenomena and posed new challenges for modern numerical techniques. Ultracold molecules, in particular, feature long-range dipole-dipole interactions and a complex and selectively accessible internal structure of rotational and hyperfine states, leading to many-body models with long range interactions and many internal degrees of freedom. Additionally, the many-body physics of ultracold molecules is often probed far from equilibrium, and so algorithms which simulate quantum many-body dynamics are essential. Numerical methods which are to have significant impact in the design and understanding of such synthetic quantum materials must be able to adapt to a variety of different interactions, physical degrees of freedom, and out-of-equilibrium dynamical protocols. Matrix product state (MPS)-based methods, such as the density-matrix renormalization group (DMRG), have become the de facto standard for strongly interacting low-dimensional systems. Moreover, the flexibility of MPS-based methods makes them ideally suited both to generic, open source implementation as well as to studies of the quantum many-body dynamics of ultracold molecules. After introducing MPSs and variational algorithms using MPSs generally, I will discuss my own research using MPSs for many-body dynamics of long-range interacting systems. In addition, I will describe two open source implementations of MPS-based algorithms in which I was involved, as well as educational materials designed to help undergraduates and graduates perform research in computational quantum many-body physics using a variety of numerical methods including exact diagonalization and static and dynamic variational MPS methods. Finally, I will mention present research on ultracold molecules in optical lattices, such as the exploration of many-body physics with polyatomic molecules, and the next generation of open source matrix product state codes. This work was performed in the research group of Prof. Lincoln D. Carr.

  5. Modeling of diatomic molecule using the Morse potential and the Verlet algorithm

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fidiani, Elok

    Performing molecular modeling usually uses special software for Molecular Dynamics (MD) such as: GROMACS, NAMD, JMOL etc. Molecular dynamics is a computational method to calculate the time dependent behavior of a molecular system. In this work, MATLAB was used as numerical method for a simple modeling of some diatomic molecules: HCl, H{sub 2} and O{sub 2}. MATLAB is a matrix based numerical software, in order to do numerical analysis, all the functions and equations describing properties of atoms and molecules must be developed manually in MATLAB. In this work, a Morse potential was generated to describe the bond interaction betweenmore » the two atoms. In order to analyze the simultaneous motion of molecules, the Verlet Algorithm derived from Newton’s Equations of Motion (classical mechanics) was operated. Both the Morse potential and the Verlet algorithm were integrated using MATLAB to derive physical properties and the trajectory of the molecules. The data computed by MATLAB is always in the form of a matrix. To visualize it, Visualized Molecular Dynamics (VMD) was performed. Such method is useful for development and testing some types of interaction on a molecular scale. Besides, this can be very helpful for describing some basic principles of molecular interaction for educational purposes.« less

  6. Measurement Of Molecular Mobilities Of Polymers

    NASA Technical Reports Server (NTRS)

    Kim, Soon Sam; Tsay, Fun-Dow

    1989-01-01

    New molecular-probe technique used to measure molecular mobility of polymer. Method based on use of time-resolved electron-spin resonance (ESR) spectroscopy to monitor decay of transient nutation amplitudes from photoexcited triplet states of probe molecules with which polymer is doped. The higher molecular mobility of polymer matrix, the faster nutation amplitudes of the probe molecules decay.

  7. Experimental evidence for blue-shifted hydrogen bonding in the fluoroform-hydrogen chloride complex: a matrix-isolation infrared and ab initio study.

    PubMed

    Gopi, R; Ramanathan, N; Sundararajan, K

    2014-07-24

    The 1:1 hydrogen-bonded complex of fluoroform and hydrogen chloride was studied using matrix-isolation infrared spectroscopy and ab initio computations. Using B3LYP and MP2 levels of theory with 6-311++G(d,p) and aug-cc-pVDZ basis sets, the structures of the complexes and their energies were computed. For the 1:1 CHF3-HCl complexes, ab initio computations showed two minima, one cyclic and the other acyclic. The cyclic complex was found to have C-H · · · Cl and C-F · · · H interactions, where CHF3 and HCl sub-molecules act as proton donor and proton acceptor, respectively. The second minimum corresponded to an acyclic complex stabilized only by the C-F · · · H interaction, in which CHF3 is the proton acceptor. Experimentally, we could trap the 1:1 CHF3-HCl cyclic complex in an argon matrix, where a blue-shift in the C-H stretching mode of the CHF3 sub-molecule was observed. To understand the nature of the interactions, Atoms in Molecules and Natural Bond Orbital analyses were carried out to unravel the reasons for blue-shifting of the C-H stretching frequency in these complexes.

  8. Matrix Effect Compensation in Small-Molecule Profiling for an LC-TOF Platform Using Multicomponent Postcolumn Infusion.

    PubMed

    González, Oskar; van Vliet, Michael; Damen, Carola W N; van der Kloet, Frans M; Vreeken, Rob J; Hankemeier, Thomas

    2015-06-16

    The possible presence of matrix effect is one of the main concerns in liquid chromatography-mass spectrometry (LC-MS)-driven bioanalysis due to its impact on the reliability of the obtained quantitative results. Here we propose an approach to correct for the matrix effect in LC-MS with electrospray ionization using postcolumn infusion of eight internal standards (PCI-IS). We applied this approach to a generic ultraperformance liquid chromatography-time-of-flight (UHPLC-TOF) platform developed for small-molecule profiling with a main focus on drugs. Different urine samples were spiked with 19 drugs with different physicochemical properties and analyzed in order to study matrix effect (in absolute and relative terms). Furthermore, calibration curves for each analyte were constructed and quality control samples at different concentration levels were analyzed to check the applicability of this approach in quantitative analysis. The matrix effect profiles of the PCI-ISs were different: this confirms that the matrix effect is compound-dependent, and therefore the most suitable PCI-IS has to be chosen for each analyte. Chromatograms were reconstructed using analyte and PCI-IS responses, which were used to develop an optimized method which compensates for variation in ionization efficiency. The approach presented here improved the results in terms of matrix effect dramatically. Furthermore, calibration curves of higher quality are obtained, dynamic range is enhanced, and accuracy and precision of QC samples is increased. The use of PCI-ISs is a very promising step toward an analytical platform free of matrix effect, which can make LC-MS analysis even more successful, adding a higher reliability in quantification to its intrinsic high sensitivity and selectivity.

  9. Methods for the selective detection of alkyne-presenting molecules and related compositions and systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valdez, Carlos A.; Vu, Alexander K.

    Provided herein are methods for selectively detecting an alkyne-presenting molecule in a sample and related detection reagents, compositions, methods and systems. The methods include contacting a detection reagent with the sample for a time and under a condition to allow binding of the detection reagent to the one or more alkyne-presenting molecules possibly present in the matrix to the detection reagent. The detection reagent includes an organic label moiety presenting an azide group. The binding of the azide group to the alkyne-presenting molecules results in emission of a signal from the organic label moiety.

  10. Laser electrospray mass spectrometry of adsorbed molecules at atmospheric pressure

    NASA Astrophysics Data System (ADS)

    Brady, John J.; Judge, Elizabeth J.; Simon, Kuriakose; Levis, Robert J.

    2010-02-01

    Atmospheric pressure mass analysis of solid phase biomolecules is performed using laser electrospray mass spectrometry (LEMS). A non-resonant femtosecond duration laser pulse vaporizes native samples at atmospheric pressure for subsequent electrospray ionization and transfer into a mass spectrometer. LEMS was used to detect a complex molecule (irinotecan HCl), a complex mixture (cold medicine formulation with active ingredients: acetaminophen, dextromethorphan HBr and doxylamine succinate), and a biological building block (deoxyguanosine) deposited on steel surfaces without a matrix molecule.

  11. Single molecule studies of solvent-dependent diffusion and entrapment in poly(dimethylsiloxane) thin films.

    PubMed

    Lange, Jeffrey J; Culbertson, Christopher T; Higgins, Daniel A

    2008-12-15

    Single molecule microscopic and spectroscopic methods are employed to probe the mobility and physical entrapment of dye molecules in dry and solvent-loaded poly(dimethylsiloxane) (PDMS) films. PDMS films of approximately 220 nm thickness are prepared by spin casting dilute solutions of Sylgard 184 onto glass coverslips, followed by low temperature curing. A perylene diimide dye (BPPDI) is used to probe diffusion and molecule-matrix interactions. Two classes of dye-loaded samples are investigated: (i) those incorporating dye dispersed throughout the films ("in film" samples) and (ii) those in which the dye is restricted primarily to the PDMS surface ("on film" samples). Experiments are performed under dry nitrogen and at various levels of isopropyl alcohol (IPA) loading from the vapor phase. A PDMS-coated quartz-crystal microbalance is employed to monitor solvent loading and drying of the PDMS and to ensure equilibrium conditions are achieved. Single molecules are shown to be predominantly immobile under dry conditions and mostly mobile under IPA-saturated conditions. Quantitative methods for counting the fluorescent spots produced by immobile single molecules in optical images of the samples demonstrate that the population of mobile molecules increases nonlinearly with IPA loading. Even under IPA saturated conditions, the population of fixed molecules is found to be greater than zero and is greatest for "in film" samples. Fluorescence correlation spectroscopy is used to measure the apparent diffusion coefficient for the mobile molecules, yielding a mean value of D = 1.4(+/-0.4) x 10(-8) cm(2)/s that is virtually independent of IPA loading and sample class. It is concluded that a nonzero population of dye molecules is physically entrapped within the PDMS matrix under all conditions. The increase in the population of mobile molecules under high IPA conditions is attributed to the filling of film micropores with solvent, rather than by incorporation of molecularly dispersed solvent into the PDMS.

  12. Propolis Modifies Collagen Types I and III Accumulation in the Matrix of Burnt Tissue.

    PubMed

    Olczyk, Pawel; Wisowski, Grzegorz; Komosinska-Vassev, Katarzyna; Stojko, Jerzy; Klimek, Katarzyna; Olczyk, Monika; Kozma, Ewa M

    2013-01-01

    Wound healing represents an interactive process which requires highly organized activity of various cells, synthesizing cytokines, growth factors, and collagen. Collagen types I and III, serving as structural and regulatory molecules, play pivotal roles during wound healing. The aim of this study was to compare the propolis and silver sulfadiazine therapeutic efficacy throughout the quantitative and qualitative assessment of collagen types I and III accumulation in the matrix of burnt tissues. Burn wounds were inflicted on pigs, chosen for the evaluation of wound repair because of many similarities between pig and human skin. Isolated collagen types I and III were estimated by the surface plasmon resonance method with a subsequent collagenous quantification using electrophoretic and densitometric analyses. Propolis burn treatment led to enhanced collagens and its components expression, especially during the initial stage of the study. Less expressed changes were observed after silver sulfadiazine (AgSD) application. AgSD and, with a smaller intensity, propolis stimulated accumulation of collagenous degradation products. The assessed propolis therapeutic efficacy, throughout quantitatively and qualitatively analyses of collagen types I and III expression and degradation in wounds matrix, may indicate that apitherapeutic agent can generate favorable biochemical environment supporting reepithelization.

  13. Introduction to Computational Chemistry: Teaching Hu¨ckel Molecular Orbital Theory Using an Excel Workbook for Matrix Diagonalization

    ERIC Educational Resources Information Center

    Litofsky, Joshua; Viswanathan, Rama

    2015-01-01

    Matrix diagonalization, the key technique at the heart of modern computational chemistry for the numerical solution of the Schrödinger equation, can be easily introduced in the physical chemistry curriculum in a pedagogical context using simple Hückel molecular orbital theory for p bonding in molecules. We present details and results of…

  14. An efficient basis set representation for calculating electrons in molecules

    DOE PAGES

    Jones, Jeremiah R.; Rouet, Francois -Henry; Lawler, Keith V.; ...

    2016-04-27

    The method of McCurdy, Baertschy, and Rescigno, is generalised to obtain a straightforward, surprisingly accurate, and scalable numerical representation for calculating the electronic wave functions of molecules. It uses a basis set of product sinc functions arrayed on a Cartesian grid, and yields 1 kcal/mol precision for valence transition energies with a grid resolution of approximately 0.1 bohr. The Coulomb matrix elements are replaced with matrix elements obtained from the kinetic energy operator. A resolution-of-the-identity approximation renders the primitive one- and two-electron matrix elements diagonal; in other words, the Coulomb operator is local with respect to the grid indices. Themore » calculation of contracted two-electron matrix elements among orbitals requires only O( Nlog (N)) multiplication operations, not O( N 4), where N is the number of basis functions; N = n 3 on cubic grids. The representation not only is numerically expedient, but also produces energies and properties superior to those calculated variationally. Absolute energies, absorption cross sections, transition energies, and ionisation potentials are reported for 1- (He +, H + 2), 2- (H 2, He), 10- (CH 4), and 56-electron (C 8H 8) systems.« less

  15. Paracrine signaling in a bacterium.

    PubMed

    López, Daniel; Vlamakis, Hera; Losick, Richard; Kolter, Roberto

    2009-07-15

    Cellular differentiation is triggered by extracellular signals that cause target cells to adopt a particular fate. Differentiation in bacteria typically involves autocrine signaling in which all cells in the population produce and respond to the same signal. Here we present evidence for paracrine signaling in bacterial populations-some cells produce a signal to which only certain target cells respond. Biofilm formation in Bacillus involves two centrally important signaling molecules, ComX and surfactin. ComX triggers the production of surfactin. In turn, surfactin causes a subpopulation of cells to produce an extracellular matrix. Cells that produced surfactin were themselves unable to respond to it. Likewise, once surfactin-responsive cells commenced matrix production, they no longer responded to ComX and could not become surfactin producers. Insensitivity to ComX was the consequence of the extracellular matrix as mutant cells unable to make matrix responded to both ComX and surfactin. Our results demonstrate that extracellular signaling was unidirectional, with one subpopulation producing a signal and a different subpopulation responding to it. Paracrine signaling in a bacterial population ensures the maintenance, over generations, of particular cell types even in the presence of molecules that would otherwise cause those cells to differentiate into other cell types.

  16. Interaction of tumor and host cells with adhesion and extracellular matrix molecules in the development of multiple myeloma.

    PubMed

    Teoh, G; Anderson, K C

    1997-02-01

    Adhesion molecules play an important role in the growth regulation and migration of multiple myeloma (MM) cells. They mediate homing of MM cells to the bone marrow and MM cell to bone marrow stromal cell adhesion, with resultant interleukin-6 related autocrine and paracine growth and antiapoptotic affects. Their pattern of expression on tumor cells correlates with the development of plasma cell leukemia or extramedullary disease. Clinically, expression of adhesion molecules on tumor cells or in the serum has already shown prognostic utility. Finally, since adhesion molecules are involved at multiple steps in the pathogenesis of MM, therapeutic studies may target these molecules.

  17. Human plasma enhances the expression of Staphylococcal microbial surface components recognizing adhesive matrix molecules promoting biofilm formation and increases antimicrobial tolerance In Vitro.

    PubMed

    Cardile, Anthony P; Sanchez, Carlos J; Samberg, Meghan E; Romano, Desiree R; Hardy, Sharanda K; Wenke, Joseph C; Murray, Clinton K; Akers, Kevin S

    2014-07-17

    Microbial biofilms have been associated with the development of chronic human infections and represent a clinical challenge given their increased antimicrobial tolerance. Staphylococcus aureus is a major human pathogen causing a diverse range of diseases, of which biofilms are often involved. Staphylococcal attachment and the formation of biofilms have been shown to be facilitated by host factors that accumulate on surfaces. To better understand how host factors enhance staphylococcal biofilm formation, we evaluated the effect of whole human plasma on biofilm formation in clinical isolates of S. aureus and the expression of seven microbial surface components recognizing adhesive matrix molecules (MSCRAMMs) known to be involved in biofilm formation by quantitative real-time PCR. We also evaluated whether plasma augmented changes in S. aureus biofilm morphology and antimicrobial resistance. Exposure of clinical isolates of S. aureus to human plasma (10%) within media, and to a lesser extent when coated onto plates, significantly enhanced biofilm formation in all of the clinical isolates tested. Compared to biofilms grown under non-supplemented conditions, plasma-augmented biofilms displayed significant changes in both the biofilm phenotype and cell morphology as determined by confocal scanning laser microscopy (CLSM) and scanning electron microscopy (SEM), respectively. Exposure of bacteria to plasma resulted in a significant fold-increase in MSCRAMM expression in both a time and isolate-dependent manner. Additionally, plasma-augmented biofilms displayed an increased tolerance to vancomycin compared to biofilms grown in non-supplemented media. Collectively, these studies support previous findings demonstrating a role for host factors in biofilm formation and provide further insight into how plasma, a preferred growth medium for staphylococcal biofilm formation enhances as well as augments other intrinsic properties of S. aureus biofilms. Consequently, these findings indicate that incorporation of host factors may be necessary to better replicate in vivo conditions and for the best utility of a clinical biofilm assay to evaluate the process of biofilm formation and treatments.

  18. Calcifying Cystic Odontogenic Tumour: immunohistochemical expression of matrix metalloproteinases, their inhibitors (TIMPs and RECK) and inducer (EMMPRIN).

    PubMed

    Prosdócimi, Fábio C; Rodini, Camila O; Sogayar, Mari C; Sousa, Suzana C O M; Xavier, Flávia C A; Paiva, Katiúcia B S

    2014-08-01

    Calcifying cyst odontogenic tumour (CCOT) is a rare benign cystic neoplasm of odontogenic origin. MMPs are responsible for extracellular matrix remodelling and, together their inhibitors and inducer, determinate the level of its turnover in pathological processes, leading to an auspicious microenvironment for tumour development. Thus, our goal was to evaluate matrix metalloproteinases (MMPs-2, -7, -9 and -14), their inhibitors (TIMPs-2, -3, -4 and RECK) and its inductor (EMMPRIN) expression in CCOT. We used 18 cases of CCOT submitted to immunolocalization of the target proteins and analysed in both neoplastic odontogenic epithelial and stromal compartments. All molecules evaluated were expressed in both compartments in CCOT. In epithelial layer, immunostaining for MMPs, TIMPs, RECK and EMMPRIN was found in basal, suprabasal spindle and stellate cells surrounding ghost cells and ghost cells themselves, except for MMP-9 and TIMP-2 which were only expressed by ghost cells. In stromal compartment, extracellular matrix, mesenchymal (MC) and endothelial cells (EC) were positive for MMP-2, -7, TIMP-3 and -4, while MMP-9, TIMP-2 and RECK were positive only in MC and MMP-14 only in EC. Statistical significance difference was found between both compartments for MMP-9 (P < 0.001), RECK (P = 0.004) and EMMPRIN (P < 0.001), being more expressed in epithelium than in stroma. Positive correlation between both stromal EMMPRIN and RECK expression was found (R = 0.661, P = 0.003). We concluded that these proteins/enzymes are differentially expressed in both epithelium and stroma of CCOT, suggesting an imbalance between MMPs and their inducer/inhibitors may contribute on the tumour behaviour. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Approaches for the analysis of low molecular weight compounds with laser desorption/ionization techniques and mass spectrometry.

    PubMed

    Bergman, Nina; Shevchenko, Denys; Bergquist, Jonas

    2014-01-01

    This review summarizes various approaches for the analysis of low molecular weight (LMW) compounds by different laser desorption/ionization mass spectrometry techniques (LDI-MS). It is common to use an agent to assist the ionization, and small molecules are normally difficult to analyze by, e.g., matrix assisted laser desorption/ionization mass spectrometry (MALDI-MS) using the common matrices available today, because the latter are generally small organic compounds themselves. This often results in severe suppression of analyte peaks, or interference of the matrix and analyte signals in the low mass region. However, intrinsic properties of several LDI techniques such as high sensitivity, low sample consumption, high tolerance towards salts and solid particles, and rapid analysis have stimulated scientists to develop methods to circumvent matrix-related issues in the analysis of LMW molecules. Recent developments within this field as well as historical considerations and future prospects are presented in this review.

  20. Infrared spectra of group III A metal oxides

    NASA Technical Reports Server (NTRS)

    Lynch, D. A., Jr.

    1972-01-01

    The measurement of infrared frequencies of metal-oxygen species which could be formed in the matrix and to investigate with an oxygen-18 enrichment study the controversy on the vibrational assignments for the suboxide. Several new molecules, Al3O2, Ga3O, In3O, In4O2, IntaO, IntaO2, and In2WO4, were found by mass spectrometric sampling to exist in extremely minor concentrations in the vapor phase. The latter three species were formed by reaction with the crucible materials and were unimportant for an infrared analysis. The infrared spectroscopic measurements were obtained by the matrix isolation technique of molecular beam sampling. The MO2 species were formed by direct reaction between metal and O2 in the matrix. A C2v structure and an O-M-O bond angle near 40 deg was favored for these molecules by analogy with a similar investigation of the alkali metals. The vibrational frequencies which were determined are given.

  1. A combinatorial extracellular matrix platform identifies cell-extracellular matrix interactions that correlate with metastasis

    PubMed Central

    Reticker-Flynn, Nathan E.; Braga Malta, David F.; Winslow, Monte M.; Lamar, John M.; Xu, Mary J.; Underhill, Gregory H.; Hynes, Richard O.; Jacks, Tyler E.; Bhatia, Sangeeta N.

    2013-01-01

    Extracellular matrix interactions play essential roles in normal physiology and many pathological processes. While the importance of ECM interactions in metastasis is well documented, systematic approaches to identify their roles in distinct stages of tumorigenesis have not been described. Here we report a novel screening platform capable of measuring phenotypic responses to combinations of ECM molecules. Using a genetic mouse model of lung adenocarcinoma, we measure the ECM-dependent adhesion of tumor-derived cells. Hierarchical clustering of the adhesion profiles differentiates metastatic cell lines from primary tumor lines. Furthermore, we uncovered that metastatic cells selectively associate with fibronectin when in combination with galectin-3, galectin-8, or laminin. We show that these molecules correlate with human disease and that their interactions are mediated in part by α3β1 integrin. Thus, our platform allowed us to interrogate interactions between metastatic cells and their microenvironments, and identified ECM and integrin interactions that could serve as therapeutic targets. PMID:23047680

  2. Quantitative fluorescence measurements performed on typical matrix molecules in matrix-assisted laser desorption/ionisation

    NASA Astrophysics Data System (ADS)

    Allwood, D. A.; Dyer, P. E.

    2000-11-01

    Fundamental photophysical parameters have been determined for several molecules that are commonly used as matrices, e.g. ferulic acid, within matrix-assisted laser desorption/ionization (MALDI) mass spectrometry. Fluorescence quantum efficiencies ( φqe), singlet decay rates ( kl), vibrationless ground-singlet transition energies and average fluorescence wavelengths have been obtained from solid and solution samples by quantitative optical measurements. This new data will assist in modelling calculations of MALDI processes and in highlighting desirable characteristics of MALDI matrices. φqe may be as high as 0.59 whilst the radiative decay rate ( kf) appears to be within the (0.8-4)×10 8 s -1 range. Interestingly, α-cyano-4-hydroxycinnamic acid (α-CHC) has a very low φqe and fast non-radiative decay rate which would imply a rapid and efficient thermalisation of electronic excitation. This is in keeping with observations that α-CHC exhibits low threshold fluences for ion detection and the low fluences at which α-CHC tends to fragment.

  3. MMP inhibition as a potential method to augment the healing of skeletal muscle and tendon extracellular matrix

    PubMed Central

    Davis, Max E.; Gumucio, Jonathan P.; Sugg, Kristoffer B.; Bedi, Asheesh

    2013-01-01

    The extracellular matrix (ECM) of skeletal muscle and tendon is composed of different types of collagen molecules that play important roles in the transmission of forces throughout the body, and in the repair and regeneration of injured tissues. Fibroblasts are the primary cells in muscle and tendon that maintain, repair, and modify the ECM in response to mechanical loading, injury, and inactivity. Matrix metalloproteinases (MMPs) are enzymes that digest collagen and other structural molecules, which are synthesized and excreted by fibroblasts. MMPs are required for baseline ECM homeostasis, but disruption of MMP regulation due to injury or disease can alter the normal ECM architecture and prevent proper force transmission. Chronic injuries and diseases of muscles and tendons can be severely debilitating, and current therapeutic modalities to enhance healing are quite limited. This review will discuss the mechanobiology of MMPs, and the potential use of MMP inhibitors to improve the treatment of injured and diseased skeletal muscle and tendon tissue. PMID:23640595

  4. Assessing the properties of internal standards for quantitative matrix-assisted laser desorption/ionization mass spectrometry of small molecules.

    PubMed

    Sleno, Lekha; Volmer, Dietrich A

    2006-01-01

    Growing interest in the ability to conduct quantitative assays for small molecules by matrix-assisted laser desorption/ionization (MALDI) has been the driving force for several recent studies. This present work includes the investigation of internal standards for these analyses using a high-repetition rate MALDI triple quadrupole instrument. Certain physicochemical properties are assessed for predicting possible matches for internal standards for different small molecules. The importance of similar molecular weight of an internal standard to its analyte is seen through experiments with a series of acylcarnitines, having a fixed charge site and growing alkyl chain length. Both acetyl- and hexanoyl-carnitine were systematically assessed with several other acylcarnitine compounds as internal standards. The results clearly demonstrate that closely matched molecular weights between analyte and internal standard are essential for acceptable quantitation results. Using alpha-cyano-4-hydroxycinnamic acid as the organic matrix, the similarities between analyte and internal standard remain the most important parameter and not necessarily their even distribution within the solid sample spot. Several 4-quinolone antibiotics as well as a diverse group of pharmaceutical drugs were tested as internal standards for the 4-quinolone, ciprofloxacin. Quantitative results were shown using the solution-phase properties, log D and pKa, of these molecules. Their distribution coefficients, log D, are demonstrated as a fundamental parameter for similar crystallization patterns of analyte and internal standard. In the end, it was also possible to quantify ciprofloxacin using a drug from a different compound class, namely quinidine, having a similar log D value as the analyte. Copyright 2006 John Wiley & Sons, Ltd.

  5. Theoretical study of solvent effects on the electronic coupling matrix elements in rigidly linked donor-acceptor systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cave, R.J.; Newton, M.D.; Kumar, K.

    1995-12-07

    The recently developed generalized Mulliken-Hush approach for the calculation of the electronic coupling matrix element for electron-transfer processes is applied to two rigidly linked donor-bridge-acceptor systems having dimethoxyanthracene as the donor and a dicarbomethoxycyclobutene unit as the acceptor. The dependence of the electronic coupling matrix element as a function of bridge type is examined with and without solvent molecules present. For clamp-shaped bridge structures solvent can have a dramatic effect on the electronic coupling matrix element. The behavior with variation of solvent is in good agreement with that observed experimentally for these systems. 23 refs., 2 tabs.

  6. Fiber Development and Matrix Production in Tissue Engineered Menisci using Bovine Mesenchymal Stem Cells and Fibrochondrocytes

    PubMed Central

    McCorry, Mary Clare; Bonassar, Lawrence J.

    2017-01-01

    Mesenchymal stem cells (MSCs) have been investigated with promising results for meniscus healing and tissue engineering. While MSCs are known to contribute to ECM production, less is known about how MSCs produce and align large organized fibers for application to tissue engineering the meniscus. The goal of this study was to investigate the capability of MSCs to produce and organize extracellular matrix molecules compared to meniscal fibrochondrocytes (FCCs). Bovine FCCs and MSCs were encapsulated in an anatomically accurate collagen meniscus using mono-culture and co-culture of each cell type. Each meniscus was mechanically anchored at the horns to mimic the physiological fixation by the meniscal entheses. Mechanical fixation generates a static mechanical boundary condition previously shown to induce formation of oriented fiber by FCCs. Samples were cultured for 4 weeks and then evaluated for biochemical composition and fiber development. MSCs increased the GAG and collagen production in both co-culture and mono-culture groups compared to FCC mono-culture. Collagen organization was greatest in the FCC mono-culture group. While MSCs had increased matrix production they lacked the fiber organization capabilities of FCCs. This study suggests that GAG production and fiber formation are linked. Co-culture can be used as a means of balancing the synthetic properties of MSCs and the matrix remodeling capabilities of FCCs for tissue engineering applications. PMID:27925474

  7. Opposite Effects of the Spinach Food Matrix on Lutein Bioaccessibility and Intestinal Uptake Lead to Unchanged Bioavailability Compared to Pure Lutein.

    PubMed

    Margier, Marielle; Buffière, Caroline; Goupy, Pascale; Remond, Didier; Halimi, Charlotte; Caris-Veyrat, Catherine; Borel, Patrick; Reboul, Emmanuelle

    2018-06-01

    Food matrix is generally believed to alter carotenoid bioavailability, but its effect on xanthophylls is usually limited. This study thus aims to decipher the digestion-absorption process of lutein in the presence or not of a food matrix. Lutein transfer to gastric-like lipid droplets or artificial mixed micelles was assessed when lutein was added to test meals either as a pure molecule ((all-E)-lutein) or in canned spinach ((Z) + (all-E)-lutein). The obtained mixed micelles were delivered to Caco-2 cells to evaluate lutein uptake. Finally postprandial plasma lutein responses were compared in minipigs after the two test meals. Lutein transfer to gastric-like lipid droplets and to mixed micelles was higher when lutein was added in spinach than when it was added as pure lutein (+614% and +147%, respectively, p < 0.05). Conversely, lutein uptake was less effective when micellar lutein was from a meal containing spinach than from a meal containing its pure form (-55%, p < 0.05). In minipigs, postprandial lutein response was delayed with spinach but not significantly different after the two test meals. Opposite effects at the micellarization and intestinal cell uptake steps explain the lack of effect of spinach matrix on lutein bioavailability. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    NASA Astrophysics Data System (ADS)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  9. In Sickness and in Health: Perineuronal Nets and Synaptic Plasticity in Psychiatric Disorders

    PubMed Central

    Pantazopoulos, Harry; Berretta, Sabina

    2016-01-01

    Rapidly emerging evidence implicates perineuronal nets (PNNs) and extracellular matrix (ECM) molecules that compose or interact with PNNs, in the pathophysiology of several psychiatric disorders. Studies on schizophrenia, autism spectrum disorders, mood disorders, Alzheimer's disease, and epilepsy point to the involvement of ECM molecules such as chondroitin sulfate proteoglycans, Reelin, and matrix metalloproteases, as well as their cell surface receptors. In many of these disorders, PNN abnormalities have also been reported. In the context of the “quadripartite” synapse concept, that is, the functional unit composed of the pre- and postsynaptic terminals, glial processes, and ECM, and of the role that PNNs and ECM molecules play in regulating synaptic functions and plasticity, these findings resonate with one of the most well-replicated aspects of the pathology of psychiatric disorders, that is, synaptic abnormalities. Here we review the evidence for PNN/ECM-related pathology in these disorders, with particular emphasis on schizophrenia, and discuss the hypothesis that such pathology may significantly contribute to synaptic dysfunction. PMID:26839720

  10. Efficient geometry optimization by Hellmann-Feynman forces with the anti-Hermitian contracted Schrödinger equation

    NASA Astrophysics Data System (ADS)

    Foley, Jonathan J.; Mazziotti, David A.

    2010-10-01

    An efficient method for geometry optimization based on solving the anti-Hermitian contracted Schrödinger equation (ACSE) is presented. We formulate a reduced version of the Hellmann-Feynman theorem (HFT) in terms of the two-electron reduced Hamiltonian operator and the two-electron reduced density matrix (2-RDM). The HFT offers a considerable reduction in computational cost over methods which rely on numerical derivatives. While previous geometry optimizations with numerical gradients required 2M evaluations of the ACSE where M is the number of nuclear degrees of freedom, the HFT requires only a single ACSE calculation of the 2-RDM per gradient. Synthesizing geometry optimization techniques with recent extensions of the ACSE theory to arbitrary electronic and spin states provides an important suite of tools for accurately determining equilibrium and transition-state structures of ground- and excited-state molecules in closed- and open-shell configurations. The ability of the ACSE to balance single- and multi-reference correlation is particularly advantageous in the determination of excited-state geometries where the electronic configurations differ greatly from the ground-state reference. Applications are made to closed-shell molecules N2, CO, H2O, the open-shell molecules B2 and CH, and the excited state molecules N2, B2, and BH. We also study the HCN ↔ HNC isomerization and the geometry optimization of hydroxyurea, a molecule which has a significant role in the treatment of sickle-cell anaemia.

  11. Synthesis of Dibenzo[hi,st]ovalene and Its Amplified Spontaneous Emission in a Polystyrene Matrix.

    PubMed

    Paternò, Giuseppe M; Chen, Qiang; Wang, Xiao-Ye; Liu, Junzhi; Motti, Silvia G; Petrozza, Annamaria; Feng, Xinliang; Lanzani, Guglielmo; Müllen, Klaus; Narita, Akimitsu; Scotognella, Francesco

    2017-06-06

    A large number of graphene molecules, or large polycyclic aromatic hydrocarbons (PAHs), have been synthesized and display various optoelectronic properties. Nevertheless, their potential for application in photonics has remained largely unexplored. Herein, we describe the synthesis of a highly luminescent and stable graphene molecule, namely a substituted dibenzo[hi,st]ovalene (DBO 1), with zigzag edges and elucidate its promising optical-gain properties by means of ultrafast transient absorption spectroscopy. Upon incorporation of DBO into an inert polystyrene matrix, amplified stimulated emission can be observed with a relatively low power threshold (ca. 60 μJ cm -2 ), thus highlighting its high potential for lasing applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Matrix-Assisted Laser Desorption Ionization Imaging Mass Spectrometry: In Situ Molecular Mapping

    PubMed Central

    Angel, Peggi M.; Caprioli, Richard M.

    2013-01-01

    Matrix-assisted laser desorption ionization imaging mass spectrometry (IMS) is a relatively new imaging modality that allows mapping of a wide range of biomolecules within a thin tissue section. The technology uses a laser beam to directly desorb and ionize molecules from discrete locations on the tissue that are subsequently recorded in a mass spectrometer. IMS is distinguished by the ability to directly measure molecules in situ ranging from small metabolites to proteins, reporting hundreds to thousands of expression patterns from a single imaging experiment. This article reviews recent advances in IMS technology, applications, and experimental strategies that allow it to significantly aid in the discovery and understanding of molecular processes in biological and clinical samples. PMID:23259809

  13. Simultaneous infrared and UV-visible absorption spectra of matrix-isolated carbon vapor

    NASA Technical Reports Server (NTRS)

    Kurtz, Joe; Huffman, Donald R.

    1989-01-01

    Carbon molecules were suggested as possible carriers of the diffuse interstellar bands. In particular, it was proposed that the 443 nm diffuse interstellar band is due to the same molecule which gives rise to the 447 nm absorption feature in argon matrix-isolated carbon vapor. If so, then an associated C-C stretching mode should be seen in the IR. By doing spectroscopy in both the IR and UV-visible regions on the same sample, the present work provides evidence for correlating UV-visible absorption features with those found in the IR. Early data indicates no correlation between the strongest IR feature (1997/cm) and the 447 nm band. Correlation with weaker IR features is being investigated.

  14. Potential Roles of Protease Inhibitors in Cancer Progression.

    PubMed

    Yang, Peng; Li, Zhuo-Yu; Li, Han-Qing

    2015-01-01

    Proteases are important molecules that are involved in many key physiological processes. Protease signaling pathways are strictly controlled, and disorders in protease activity can result in pathological changes such as cardiovascular and inflammatory diseases, cancer and neurological disorders. Many proteases have been associated with increasing tumor metastasis in various human cancers, suggesting important functional roles in the metastatic process because of their ability to degrade the extracellular matrix barrier. Proteases are also capable of cleaving non-extracellular matrix molecules. Inhibitors of proteases to some extent can reduce invasion and metastasis of cancer cells, and slow down cancer progression. In this review, we focus on the role of a few proteases and their inhibitors in tumors as a basis for cancer prognostication and therapy.

  15. Characterization and evaluation of the novel agarose-nickel composite matrix for possible use in expanded bed adsorption of bio-products.

    PubMed

    Rezvani, Azita; Jahanshahi, Mohsen; Najafpour, Ghasem D

    2014-02-28

    Agarose-nickel (Ag-Ni) composite matrix was evaluated for its use in expanded bed adsorption (EBA). Bovine serum albumin (BSA) and lysozyme were used as model proteins in batch and column adsorption studies. Accordingly, Reactive Green 19 (RG19) dye-ligand was covalently immobilized onto the support matrix to prepare affinity adsorbent for protein adsorption. Results were then compared with data obtained from Streamline commercial matrix. In batch experiments RG19 derivatives of Ag-Ni (RG19-Ag-Ni) exhibited high adsorption rate; and also a higher binding capacity of BSA (31.4mg/ml adsorbent) was observed for Ag-Ni compared to the commercial adsorbent. More than 70% of the adsorption capacity was achieved within 30min which is a reasonable contact time for EBA operations. The equilibrium adsorption data well agreed with Langmuir isotherm model. The expanded bed adsorption studies showed a reasonable breakthrough behavior at high flow rates and a higher dynamic binding capacity (DBC) was obtained for novel matrix in compare to streamline at the same fluid velocity. DBC at 10% breakthrough reached 66% of the saturated adsorption capacity at the high flow velocity of 450cm/h which indicates the favorable column efficiency. Additionally, two different Ag-Ni size fractions (75-150 and 150-300μm) were examined to investigate the expanded bed performance dependency on the adsorbent particle size with respect to the hydrodynamic stability and adsorption properties using lysozyme as model protein. Interestingly, the small ones showed less axial dispersion coefficient (<1.0×10(-5)m(2)/s) which resulted in higher bed stability in high fluid viscosities. Overall, the adsorption experiments results demonstrated that small size fraction of Ag-Ni matrices acts more effectively for expanded bed adsorption of bio-molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Insight towards the conserved water mediated recognition of catalytic and structural Zn(+2) ions in human Matrix Metalloproteinase-8 enzyme: A study by MD-simulation methods.

    PubMed

    Chakrabarti, Bornali; Bairagya, Hridoy R; Mishra, Deepak Kr; Chatterjee, Pradip Kumar; Mukhopadhyay, Bishnu P

    2013-01-01

    Human matrix metalloproteinase-8 (hMMP-8) plays a important role in the progression of colorectal cancer, metastasis, multiple sclerosis and rheumetoid arthritis. Extensive MD-simulation of the PDB and solvated structures of hMMP-8 has revealed the presence of few conserved water molecules around the catalytic and structural zinc (ZnC and ZnS) ions. The coordination of two conserved water molecules (W and WS) to ZnS and the H-bonding interaction of WS to S151 have indicated the plausible involvement of that metal ion in the catalytic process. Beside this the coupling of ZnC and ZnS metal ions (ZnC - W(H) (W(1))…..W(2) ….H(162) - ZnS) through two conserved hydrophilic centers (occupied by water molecules) may also provide some rational on the recognition of two zinc ions which were separated by ~13 Å in their X-ray structures. This unique recognition of both the Zn(+2) ions in the enzyme through conserved water molecules may be implemented/ exploited for the design of antiproteolytic agent using water mimic drug design protocol.

  17. A two-step strategy to visually identify molecularly imprinted polymers for tagged proteins.

    PubMed

    Brandis, Alexander; Partouche, Eran; Yechezkel, Tamar; Salitra, Yoseph; Shkoulev, Vladimir; Scherz, Avigdor; Grynszpan, Flavio

    2017-08-01

    A practical and relatively simple method to identify molecularly imprinted polymers capable of binding proteins via the molecular tagging (epitope-like) approach has been developed. In our two-step method, we first challenge a previously obtained anti-tag molecularly imprinted polymer with a small molecule including the said tag of choice (a biotin derivative as shown here or other) connected to a linker bound to a second biotin moiety. An avidin molecule partially decorated with fluorescent labels is then allowed to bind the available biotin derivative associated with the polymer matrix. At the end of this simple process, and after washing off all the low-affinity binding molecules from the polymer matrix, only suitable molecularly imprinted polymers binding avidin through its previously acquired small molecule tag (or epitope-like probe, in a general case) will remain fluorescent. For confirmation, we tested the selective performance of the anti-biotin molecularly imprinted polymer binding it to biotinylated alkaline phosphatase. Residual chemical activity of the enzyme on the molecularly imprinted polymer solid support was observed. In all cases, the corresponding nonimprinted polymer controls were inactive. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Identification and functional analysis of endothelial tip cell-enriched genes.

    PubMed

    del Toro, Raquel; Prahst, Claudia; Mathivet, Thomas; Siegfried, Geraldine; Kaminker, Joshua S; Larrivee, Bruno; Breant, Christiane; Duarte, Antonio; Takakura, Nobuyuki; Fukamizu, Akiyoshi; Penninger, Josef; Eichmann, Anne

    2010-11-11

    Sprouting of developing blood vessels is mediated by specialized motile endothelial cells localized at the tips of growing capillaries. Following behind the tip cells, endothelial stalk cells form the capillary lumen and proliferate. Expression of the Notch ligand Delta-like-4 (Dll4) in tip cells suppresses tip cell fate in neighboring stalk cells via Notch signaling. In DLL4(+/-) mouse mutants, most retinal endothelial cells display morphologic features of tip cells. We hypothesized that these mouse mutants could be used to isolate tip cells and so to determine their genetic repertoire. Using transcriptome analysis of retinal endothelial cells isolated from DLL4(+/-) and wild-type mice, we identified 3 clusters of tip cell-enriched genes, encoding extracellular matrix degrading enzymes, basement membrane components, and secreted molecules. Secreted molecules endothelial-specific molecule 1, angiopoietin 2, and apelin bind to cognate receptors on endothelial stalk cells. Knockout mice and zebrafish morpholino knockdown of apelin showed delayed angiogenesis and reduced proliferation of stalk cells expressing the apelin receptor APJ. Thus, tip cells may regulate angiogenesis via matrix remodeling, production of basement membrane, and release of secreted molecules, some of which regulate stalk cell behavior.

  19. Low energy electron-molecule scattering using the R-matrix method

    NASA Astrophysics Data System (ADS)

    Gorfinkiel, Jimena

    2014-10-01

    The study of electron-molecule collisions continues to attract significant interest stimulated, in no small part, by the need for collisional data to model a number of physical environments and applied processes (e.g. the modelling of focused electron beam induced deposition and the description of the interaction of radiation with biological matter). This need for electron scattering data (cross sections but also information on the temporary negative ions, TNI, that can be formed) has motivated the renewed development of theoretical methodology and their computational implementation. I will present the latest developments in the study of low energy electron scattering from molecules and molecular clusters using the R-matrix method. Recent calculations on electron collisions with biologically relevant molecules have shed light on the formation of core-excited TNI these larger targets. The picture that emerges is much more complex than previously thought. I will discuss some examples as well as current and future developments of the methodology and software in order to provide more accurate collisional data (in particular cross sections) for bigger targets. In collaboration with Zdenek Masin, The Open University. This work was partially supported by EPSRC.

  20. Sorption of small molecules in polymeric media

    NASA Astrophysics Data System (ADS)

    Camboni, Federico; Sokolov, Igor M.

    2016-12-01

    We discuss the sorption of penetrant molecules from the gas phase by a polymeric medium within a model which is very close in spirit to the dual sorption mode model: the penetrant molecules are partly dissolved within the polymeric matrix, partly fill the preexisting voids. The only difference with the initial dual sorption mode situation is the assumption that the two populations of molecules are in equilibrium with each other. Applying basic thermodynamics principles we obtain the dependence of the penetrant concentration on the pressure in the gas phase and find that this is expressed via the Lambert W-function, a different functional form than the one proposed by dual sorption mode model. The Lambert-like isotherms appear universally at low and moderate pressures and originate from the assumption that the internal energy in a polymer-penetrant-void ternary mixture is (in the lowest order) a bilinear form in the concentrations of the three components. Fitting the existing data shows that in the domain of parameters where the dual sorption mode model is typically applied, the Lambert function, which describes the same behavior as the one proposed by the gas-polymer matrix model, fits the data equally well.

  1. N-terminal aliphatic residues dictate the structure, stability, assembly, and small molecule binding of the coiled-coil region of cartilage oligomeric matrix protein.

    PubMed

    Gunasekar, Susheel K; Asnani, Mukta; Limbad, Chandani; Haghpanah, Jennifer S; Hom, Wendy; Barra, Hanna; Nanda, Soumya; Lu, Min; Montclare, Jin Kim

    2009-09-15

    The coiled-coil domain of cartilage oligomeric matrix protein (COMPcc) assembles into a homopentamer that naturally recognizes the small molecule 1,25-dihydroxyvitamin D(3) (vit D). To identify the residues critical for the structure, stability, oligomerization, and binding to vit D as well as two other small molecules, all-trans-retinol (ATR) and curcumin (CCM), here we perform an alanine scanning mutagenesis study. Ten residues lining the hydrophobic pocket of COMPcc were mutated into alanine; of the mutated residues, the N-terminal aliphatic residues L37, L44, V47, and L51 are responsible for maintaining the structure and function. Furthermore, two polar residues, T40 and Q54, within the N-terminal region when converted into alanine improve the alpha-helical structure, stability, and self-assembly behavior. Helical stability, oligomerization, and binding appear to be linked in a manner in which mutations that abolish helical structure and assembly bind poorly to vit D, ATR, and CCM. These results provide not only insight into COMPcc and its functional role but also useful guidelines for the design of stable, pentameric coiled-coils capable of selectively storing and delivering various small molecules.

  2. Physical and Chemical Study of Minerals and Rocks Containing Low-Z Compounds of Interest to Astrobiology and Origin of Life

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Understanding the origins of Life requires a good understanding of the physics and chemistry of biogenic low-z elements H, C, N, O, P, S in terrestrial environments, on Mars, on extraterrestrial bodies such as meteorite parent bodies and comets, and in interstellar space. In this Proposal five Tasks form a coherent program aimed at elucidating various aspects of low-z element geo- and cosmochemistry with special reference to the origin of Life on Earth and to the search for life on Mars, extant or extinct. (i) Formation of organic molecules, in particular oxygenated H-C-0 molecules or precursors thereof of the composition H(x)C(y)O(z)(n-), inside the hard matrix of structurally dense magmatic minerals; (ii) Formation of organic molecules inside the soft matrix of amorphous and crystalline water ice; (iii) Preservation of organic molecules in cherts and other siliceous rocks formed in hot spring or submarine hydrothermal vent environments; (iv) The nature of the elusive Martian soil oxidant; and (v) Prototype development of an XRD instrument, using a new patented XRD camera concept that utilizes a Charge Coupled Device (CCD) as a camera and as a energy-dispersive analyzer.

  3. Impact of polymers on the crystallization and phase transition kinetics of amorphous nifedipine during dissolution in aqueous media.

    PubMed

    Raina, Shweta A; Alonzo, David E; Zhang, Geoff G Z; Gao, Yi; Taylor, Lynne S

    2014-10-06

    The commercial and clinical success of amorphous solid dispersions (ASD) in overcoming the low bioavailability of poorly soluble molecules has generated momentum among pharmaceutical scientists to advance the fundamental understanding of these complex systems. A major limitation of these formulations stems from the propensity of amorphous solids to crystallize upon exposure to aqueous media. This study was specifically focused on developing analytical techniques to evaluate the impact of polymers on the crystallization behavior during dissolution, which is critical in designing effective amorphous formulations. In the study, the crystallization and polymorphic conversions of a model compound, nifedipine, were explored in the absence and presence of polyvinylpyrrolidone (PVP), hydroxypropylmethyl cellulose (HPMC), and HPMC-acetate succinate (HPMC-AS). A combination of analytical approaches including Raman spectroscopy, polarized light microscopy, and chemometric techniques such as multivariate curve resolution (MCR) were used to evaluate the kinetics of crystallization and polymorphic transitions as well as to identify the primary route of crystallization, i.e., whether crystallization took place in the dissolving solid matrix or from the supersaturated solutions generated during dissolution. Pure amorphous nifedipine, when exposed to aqueous media, was found to crystallize rapidly from the amorphous matrix, even when polymers were present in the dissolution medium. Matrix crystallization was avoided when amorphous solid dispersions were prepared, however, crystallization from the solution phase was rapid. MCR was found to be an excellent data processing technique to deconvolute the complex phase transition behavior of nifedipine.

  4. Matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs): Positive and negative regulators in tumor cell adhesion.

    PubMed

    Bourboulia, Dimitra; Stetler-Stevenson, William G

    2010-06-01

    Cells adhere to one another and/or to matrices that surround them. Regulation of cell-cell (intercellular) and cell-matrix adhesion is tightly controlled in normal cells, however, defects in cell adhesion are common in the majority of human cancers. Multilateral communication among tumor cells with the extracellular matrix (ECM) and neighbor cells is accomplished through adhesion molecules, ECM components, proteolytic enzymes and their endogenous inhibitors. There is sufficient evidence to suggest that reduced adherence is a tumor cell property engaged during tumor progression. Tumor cells acquire the ability to change shape, detach and easily move through spaces disorganizing the normal tissue architecture. This property is due to changes in expression levels of adhesion molecules and/or due to elevated levels of secreted proteolytic enzymes, including matrix metalloproteinases (MMPs). Among other roles, MMPs degrade the ECM and, therefore, prepare the path for tumor cells to migrate, invade and spread to distant secondary areas, where they form metastasis. Tissue inhibitors of metalloproteinases or TIMPs control MMP activities and, therefore, minimize matrix degradation. Both MMPs and TIMPs are involved in tissue remodeling and decisively regulate tumor cell progression including tumor angiogenesis. In this review, we describe and discuss data that support the important role of MMPs and TIMPs in cancer cell adhesion and tumor progression. Published by Elsevier Ltd.

  5. Density-functional expansion methods: evaluation of LDA, GGA, and meta-GGA functionals and different integral approximations.

    PubMed

    Giese, Timothy J; York, Darrin M

    2010-12-28

    We extend the Kohn-Sham potential energy expansion (VE) to include variations of the kinetic energy density and use the VE formulation with a 6-31G* basis to perform a "Jacob's ladder" comparison of small molecule properties using density functionals classified as being either LDA, GGA, or meta-GGA. We show that the VE reproduces standard Kohn-Sham DFT results well if all integrals are performed without further approximation, and there is no substantial improvement in using meta-GGA functionals relative to GGA functionals. The advantages of using GGA versus LDA functionals becomes apparent when modeling hydrogen bonds. We furthermore examine the effect of using integral approximations to compute the zeroth-order energy and first-order matrix elements, and the results suggest that the origin of the short-range repulsive potential within self-consistent charge density-functional tight-binding methods mainly arises from the approximations made to the first-order matrix elements.

  6. Matrix elements of explicitly correlated Gaussian basis functions with arbitrary angular momentum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Joyce, Tennesse; Varga, Kálmán

    2016-05-14

    A new algorithm for calculating the Hamiltonian matrix elements with all-electron explicitly correlated Gaussian functions for quantum-mechanical calculations of atoms with arbitrary angular momentum is presented. The calculations are checked on several excited states of three and four electron systems. The presented formalism can be used as unified framework for high accuracy calculations of properties of small atoms and molecules.

  7. Theoretical Studies of Spectroscopic Line Mixing in Remote Sensing Applications

    NASA Astrophysics Data System (ADS)

    Ma, Q.

    2015-12-01

    The phenomenon of collisional transfer of intensity due to line mixing has an increasing importance for atmospheric monitoring. From a theoretical point of view, all relevant information about the collisional processes is contained in the relaxation matrix where the diagonal elements give half-widths and shifts, and the off-diagonal elements correspond to line interferences. For simple systems such as those consisting of diatom-atom or diatom-diatom, accurate fully quantum calculations based on interaction potentials are feasible. However, fully quantum calculations become unrealistic for more complex systems. On the other hand, the semi-classical Robert-Bonamy (RB) formalism, which has been widely used to calculate half-widths and shifts for decades, fails in calculating the off-diagonal matrix elements. As a result, in order to simulate atmospheric spectra where the effects from line mixing are important, semi-empirical fitting or scaling laws such as the ECS and IOS models are commonly used. Recently, while scrutinizing the development of the RB formalism, we have found that these authors applied the isolated line approximation in their evaluating matrix elements of the Liouville scattering operator given in exponential form. Since the criterion of this assumption is so stringent, it is not valid for many systems of interest in atmospheric applications. Furthermore, it is this assumption that blocks the possibility to calculate the whole relaxation matrix at all. By eliminating this unjustified application, and accurately evaluating matrix elements of the exponential operators, we have developed a more capable formalism. With this new formalism, we are now able not only to reduce uncertainties for calculated half-widths and shifts, but also to remove a once insurmountable obstacle to calculate the whole relaxation matrix. This implies that we can address the line mixing with the semi-classical theory based on interaction potentials between molecular absorber and molecular perturber. We have applied this formalism to address the line mixing for Raman and infrared spectra of molecules such as N2, C2H2, CO2, NH3, and H2O. By carrying out rigorous calculations, our calculated relaxation matrices are in good agreement with both experimental data and results derived from the ECS model.

  8. Simultaneous screening of targeted and non-targeted contaminants using an LC-QTOF-MS system and automated MS/MS library searching.

    PubMed

    Herrera-Lopez, S; Hernando, M D; García-Calvo, E; Fernández-Alba, A R; Ulaszewska, M M

    2014-09-01

    Simultaneous high-resolution full-scan and tandem mass spectrometry (MS/MS) analysis using time of flight mass spectrometry brings an answer for increasing demand of retrospective and non-targeted data analysis. Such analysis combined with spectral library searching is a promising tool for targeted and untargeted screening of small molecules. Despite considerable extension of the panel of compounds of tandem mass spectral libraries, the heterogeneity of spectral data poses a major challenge against the effective usage of spectral libraries. Performance evaluation of available LC-MS/MS libraries will significantly increase credibility in the search results. The present work was aimed to evaluate fluctuation of MS/MS pattern, in the peak intensities distribution together with mass accuracy measurements, and in consequence, performance compliant with ion ratio and mass error criteria as principles in identification processes for targeted and untargeted contaminants at trace levels. Matrix effect and ultra-trace levels of concentration (from 50 ng l(-1) to 1000 ng l(-1) were evaluated as potential source of inaccuracy in the performance of spectral matching. Matrix-matched samples and real samples were screened for proof of applicability. By manual review of data and application of ion ratio and ppm error criteria, false negatives were obtained; this number diminished when in-house library was used, while with on-line MS/MS databases 100% of positive samples were found. In our experience, intensity of peaks across spectra was highly correlated to the concentration effect and matrix complexity. In turn, analysis of spectra acquired at trace concentrations and in different matrices results in better performance in providing correct and reliable identification. Copyright © 2014 John Wiley & Sons, Ltd.

  9. Exendin-4 induces cell adhesion and differentiation and counteracts the invasive potential of human neuroblastoma cells.

    PubMed

    Luciani, Paola; Deledda, Cristiana; Benvenuti, Susanna; Squecco, Roberta; Cellai, Ilaria; Fibbi, Benedetta; Marone, Ilaria Maddalena; Giuliani, Corinna; Modi, Giulia; Francini, Fabio; Vannelli, Gabriella Barbara; Peri, Alessandro

    2013-01-01

    Exendin-4 is a molecule currently used, in its synthetic form exenatide, for the treatment of type 2 diabetes mellitus. Exendin-4 binds and activates the Glucagon-Like Peptide-1 Receptor (GLP-1R), thus inducing insulin release. More recently, additional biological properties have been associated to molecules that belong to the GLP-1 family. For instance, Peptide YY and Vasoactive Intestinal Peptide have been found to affect cell adhesion and migration and our previous data have shown a considerable actin cytoskeleton rearrangement after exendin-4 treatment. However, no data are currently available on the effects of exendin-4 on tumor cell motility. The aim of this study was to investigate the effects of this molecule on cell adhesion, differentiation and migration in two neuroblastoma cell lines, SH-SY5Y and SK-N-AS. We first demonstrated, by Extra Cellular Matrix cell adhesion arrays, that exendin-4 increased cell adhesion, in particular on a vitronectin substrate. Subsequently, we found that this molecule induced a more differentiated phenotype, as assessed by i) the evaluation of neurite-like protrusions in 3D cell cultures, ii) the analysis of the expression of neuronal markers and iii) electrophysiological studies. Furthermore, we demonstrated that exendin-4 reduced cell migration and counteracted anchorage-independent growth in neuroblastoma cells. Overall, these data indicate for the first time that exendin-4 may have anti-tumoral properties.

  10. A revised MRCI-algorithm. I. Efficient combination of spin adaptation with individual configuration selection coupled to an effective valence-shell Hamiltonian

    NASA Astrophysics Data System (ADS)

    Strodel, Paul; Tavan, Paul

    2002-09-01

    We present a revised multi-reference configuration interaction (MRCI) algorithm for balanced and efficient calculation of electronic excitations in molecules. The revision takes up an earlier method, which had been designed for flexible, state-specific, and individual selection (IS) of MRCI expansions, included perturbational corrections (PERT), and used the spin-coupled hole-particle formalism of Tavan and Schulten (1980) for matrix-element evaluation. It removes the deficiencies of this method by introducing tree structures, which code the CI bases and allow us to efficiently exploit the sparseness of the Hamiltonian matrices. The algorithmic complexity is shown to be optimal for IS/MRCI applications. The revised IS/MRCI/PERT module is combined with the effective valence shell Hamiltonian OM2 suggested by Weber and Thiel (2000). This coupling serves the purpose of making excited state surfaces of organic dye molecules accessible to relatively cheap and sufficiently precise descriptions.

  11. On the Noble-Gas Induced Intersystem Crossing for the CUO Molecule: Experimental and Theoretical investigations of CUO(Ng)n (Ng = Ar, Kr, Xe; n = 1, 2, 3, 4) Complexes in Solid Neon

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liang, Binyong; Andrews, Lester S.; Li, Jun

    2004-02-09

    Uranium atoms excited by laser ablation react with CO in excess neon to produce the novel CUO molecule, which forms distinct Ng complexes (Ng = Ar, Kr, Xe) when the heavier noble gases are added. The CUO(Ng) complexes are identified through CO isotopic and Ng substitution on the neon matrix infrared spectra and by comparison to DFT frequency calculations. The U-C and U-O stretching frequencies of CUO(Ng) complexes are slightly red shifted from frequencies for the 1S+ CUO ground state, which identifies singlet ground state CUO(Ng) complexes. In solid neon the CUO molecule is also a complex CUO(Ne)n, and themore » CUO(Ne)n-1(Ng) complexes are likewise specified. The next singlet CUO(Ne)x(Ng)2 complexes in excess neon follow in like manner. However, the higher CUO(Ne)x(Ng)n complex (n = 3, 4) stretching modes approach pure argon matrix CUO(Ar)n values and isotopic behavior, which are characterized as triplet ground state complexes by DFT frequency calculations. This work suggests that the singlet-triplet crossing occurs with 3 Ar, 3 Kr or 4 Xe and a balance of Ne atoms coordinated to CUO in the neon matrix host.« less

  12. Targeting mitochondria with small molecules: the preparation of MitoB and MitoP as exomarkers of mitochondrial hydrogen peroxide.

    PubMed

    Cairns, Andrew G; McQuaker, Stephen J; Murphy, Michael P; Hartley, Richard C

    2015-01-01

    Small molecules can be physicochemically targeted to mitochondria using the lipophilic alkyltriphenylphosphonium (TPP) group. Once in the mitochondria the TPP-conjugate can detect or influence processes within the mitochondrial matrix directly. Alternatively, the conjugate can behave as a prodrug, which is activated by release from the TPP group either using an internal or external instruction. Small molecules can be designed that can be used in any cell line, tissue or whole organism, allow temporal control, and be applied in a reversible dose-dependent fashion. An example is the detection and quantification of hydrogen peroxide in mitochondria of whole living organisms by MitoB. Hydrogen peroxide produced within the mitochondrial matrix is involved in signalling and implicated in the oxidative damage associated with aging and a wide range of age-associated conditions including cardiovascular disease, neurodegeneration, and cancer. MitoB accumulates in mitochondria and is converted into the exomarker, MitoP, by hydrogen peroxide in the mitochondrial matrix. The hydrogen peroxide concentration is determined from the ratio of MitoP to MitoB after a period of incubation, and this ratio is determined by mass spectrometry using d15-MitoP and d15-MitoB as standard. Here we describe the synthesis of MitoB and MitoP and the deuterated standards necessary for this method of quantification.

  13. Power-law-distributed dark states are the main pathway for photobleaching of single organic molecules.

    PubMed

    Hoogenboom, Jacob P; van Dijk, Erik M H P; Hernando, Jordi; van Hulst, Niek F; García-Parajó, María F

    2005-08-26

    We exploit the strong excitonic coupling in a superradiant trimer molecule to distinguish between long-lived collective dark states and photobleaching events. The population and depopulation kinetics of the dark states in a single molecule follow power-law statistics over 5 orders of magnitude in time. This result is consistent with the formation of a radical unit via electron tunneling to a time-varying distribution of trapping sites in the surrounding polymer matrix. We furthermore demonstrate that this radicalization process forms the dominant pathway for molecular photobleaching.

  14. Derivation of the chemical-equilibrium rate coefficient using scattering theory

    NASA Technical Reports Server (NTRS)

    Mickens, R. E.

    1977-01-01

    Scattering theory is applied to derive the equilibrium rate coefficient for a general homogeneous chemical reaction involving ideal gases. The reaction rate is expressed in terms of the product of a number of normalized momentum distribution functions, the product of the number of molecules with a given internal energy state, and the spin-averaged T-matrix elements. An expression for momentum distribution at equilibrium for an arbitrary molecule is presented, and the number of molecules with a given internal-energy state is represented by an expression which includes the partition function.

  15. Regulation of Corneal Stroma Extracellular Matrix Assembly

    PubMed Central

    Chen, Shoujun; Mienaltowski, Michael J.; Birk, David E.

    2014-01-01

    The transparent cornea is the major refractive element of the eye. A finely controlled assembly of the stromal extracellular matrix is critical to corneal function, as well as in establishing the appropriate mechanical stability required to maintain corneal shape and curvature. In the stroma, homogeneous, small diameter collagen fibrils, regularly packed with a highly ordered hierarchical organization, are essential for function. This review focuses on corneal stroma assembly and the regulation of collagen fibrillogenesis. Corneal collagen fibrillogenesis involves multiple molecules interacting in sequential steps, as well as interactions between keratocytes and stroma matrix components. The stroma has the highest collagen V:I ratio in the body. Collagen V regulates the nucleation of protofibril assembly, thus controlling the number of fibrils and assembly of smaller diameter fibrils in the stroma. The corneal stroma is also enriched in small leucine-rich proteoglycans (SLRPs) that cooperate in a temporal and spatial manner to regulate linear and lateral collagen fibril growth. In addition, the fibril-associated collagens (FACITs) such as collagen XII and collagen XIV have roles in the regulation of fibril packing and inter-lamellar interactions. A communicating keratocyte network contributes to the overall and long-range regulation of stromal extracellular matrix assembly, by creating micro-domains where the sequential steps in stromal matrix assembly are controlled. Keratocytes control the synthesis of extracellular matrix components, which interact with the keratocytes dynamically to coordinate the regulatory steps into a cohesive process. Mutations or deficiencies in stromal regulatory molecules result in altered interactions and deficiencies in both transparency and refraction, leading to corneal stroma pathobiology such as stromal dystrophies, cornea plana and keratoconus. PMID:25819456

  16. Bond-based linear indices of the non-stochastic and stochastic edge-adjacency matrix. 1. Theory and modeling of ChemPhys properties of organic molecules.

    PubMed

    Marrero-Ponce, Yovani; Martínez-Albelo, Eugenio R; Casañola-Martín, Gerardo M; Castillo-Garit, Juan A; Echevería-Díaz, Yunaimy; Zaldivar, Vicente Romero; Tygat, Jan; Borges, José E Rodriguez; García-Domenech, Ramón; Torrens, Francisco; Pérez-Giménez, Facundo

    2010-11-01

    Novel bond-level molecular descriptors are proposed, based on linear maps similar to the ones defined in algebra theory. The kth edge-adjacency matrix (E(k)) denotes the matrix of bond linear indices (non-stochastic) with regard to canonical basis set. The kth stochastic edge-adjacency matrix, ES(k), is here proposed as a new molecular representation easily calculated from E(k). Then, the kth stochastic bond linear indices are calculated using ES(k) as operators of linear transformations. In both cases, the bond-type formalism is developed. The kth non-stochastic and stochastic total linear indices are calculated by adding the kth non-stochastic and stochastic bond linear indices, respectively, of all bonds in molecule. First, the new bond-based molecular descriptors (MDs) are tested for suitability, for the QSPRs, by analyzing regressions of novel indices for selected physicochemical properties of octane isomers (first round). General performance of the new descriptors in this QSPR studies is evaluated with regard to the well-known sets of 2D/3D MDs. From the analysis, we can conclude that the non-stochastic and stochastic bond-based linear indices have an overall good modeling capability proving their usefulness in QSPR studies. Later, the novel bond-level MDs are also used for the description and prediction of the boiling point of 28 alkyl-alcohols (second round), and to the modeling of the specific rate constant (log k), partition coefficient (log P), as well as the antibacterial activity of 34 derivatives of 2-furylethylenes (third round). The comparison with other approaches (edge- and vertices-based connectivity indices, total and local spectral moments, and quantum chemical descriptors as well as E-state/biomolecular encounter parameters) exposes a good behavior of our method in this QSPR studies. Finally, the approach described in this study appears to be a very promising structural invariant, useful not only for QSPR studies but also for similarity/diversity analysis and drug discovery protocols.

  17. Many-body theory of electrical, thermal and optical response of molecular heterojunctions

    NASA Astrophysics Data System (ADS)

    Bergfield, Justin Phillip

    In this work, we develop a many-body theory of electronic transport through single molecule junctions based on nonequilibrium Green's functions (NEGFs). The central quantity of this theory is the Coulomb self-energy matrix of the junction SigmaC. SigmaC is evaluated exactly in the sequential-tunneling limit, and the correction due to finite lead-molecule tunneling is evaluated using a conserving approximation based on diagrammatic perturbation theory on the Keldysh contour. In this way, tunneling processes are included to infinite order, meaning that any approximation utilized is a truncation in the physical processes considered rather than in the order of those processes. Our theory reproduces the key features of both the Coulomb blockade and coherent transport regimes simultaneously in a single unified theory. Nonperturbative effects of intramolecular correlations are included, which are necessary to accurately describe the highest occupied molecular orbital (HOMO)-lowest unoccupied molecular orbital (LUMO) gap, essential for a quantitative theory of transport. This work covers four major topics related to transport in single-molecule junctions. First, we use our many-body theory to calculate the nonlinear electrical response of the archetypal Au-1,4-benzenedithiol-Au junction and find irregularly shaped 'molecular diamonds' which have been experimentally observed in some larger molecules but which are inaccessible to existing theoretical approaches. Next, we extend our theory to include heat transport and develop an exact expression for the heat current in an interacting nanostructure. Using this result, we discover that quantum coherence can strongly enhance the thermoelectric response of a device, a result with a number of technological applications. We then develop the formalism to include multi-orbital lead-molecule contacts and multi-channel leads, both of which strongly affect the observable transport. Lastly, we include a dynamic screening correction to Sigma C and investigate the optoelectric response of several molecular junctions.

  18. In vitro inhibition of hyaluronidase by sodium copper chlorophyllin complex and chlorophyllin analogs

    PubMed Central

    McCook, John P; Dorogi, Peter L; Vasily, David B; Cefalo, Dustin R

    2015-01-01

    Background Inhibitors of hyaluronidase are potent agents that maintain hyaluronic acid homeostasis and may serve as anti-aging, anti-inflammatory, and anti-microbial agents. Sodium copper chlorophyllin complex is being used therapeutically as a component in anti-aging cosmeceuticals, and has been shown to have anti-hyaluronidase activity. In this study we evaluated various commercial lots of sodium copper chlorophyllin complex to identify the primary small molecule constituents, and to test various sodium copper chlorophyllin complexes and their small molecule analog compounds for hyaluronidase inhibitory activity in vitro. Ascorbate analogs were tested in combination with copper chlorophyllin complexes for potential additive or synergistic activity. Materials and methods For hyaluronidase activity assays, dilutions of test materials were evaluated for hydrolytic activity of hyaluronidase by precipitation of non-digested hyaluronate by measuring related turbidity at 595 nm. High-performance liquid chromatography and mass spectroscopy was used to analyze and identify the primary small molecule constituents in various old and new commercial lots of sodium copper chlorophyllin complex. Results The most active small molecule component of sodium copper chlorophyllin complex was disodium copper isochlorin e4, followed by oxidized disodium copper isochlorin e4. Sodium copper chlorophyllin complex and copper isochlorin e4 disodium salt had hyaluronidase inhibitory activity down to 10 µg/mL. The oxidized form of copper isochlorin e4 disodium salt had substantial hyaluronidase inhibitory activity at 100 µg/mL but not at 10 µg/mL. Ascorbate derivatives did not enhance the hyaluronidase inhibitory activity of sodium copper chlorophyllin. Copper isochlorin e4 analogs were always the dominant components of the small molecule content of the commercial lots tested; oxidized copper isochlorin e4 was found in increased concentrations in older compared to newer lots tested. Conclusion These results support the concept of using the hyaluronidase inhibitory activity of sodium copper chlorophyllin complex to increase the hyaluronic acid level of the dermal extracellular matrix for the improvement of the appearance of aging facial skin. PMID:26300653

  19. In vitro inhibition of hyaluronidase by sodium copper chlorophyllin complex and chlorophyllin analogs.

    PubMed

    McCook, John P; Dorogi, Peter L; Vasily, David B; Cefalo, Dustin R

    2015-01-01

    Inhibitors of hyaluronidase are potent agents that maintain hyaluronic acid homeostasis and may serve as anti-aging, anti-inflammatory, and anti-microbial agents. Sodium copper chlorophyllin complex is being used therapeutically as a component in anti-aging cosmeceuticals, and has been shown to have anti-hyaluronidase activity. In this study we evaluated various commercial lots of sodium copper chlorophyllin complex to identify the primary small molecule constituents, and to test various sodium copper chlorophyllin complexes and their small molecule analog compounds for hyaluronidase inhibitory activity in vitro. Ascorbate analogs were tested in combination with copper chlorophyllin complexes for potential additive or synergistic activity. For hyaluronidase activity assays, dilutions of test materials were evaluated for hydrolytic activity of hyaluronidase by precipitation of non-digested hyaluronate by measuring related turbidity at 595 nm. High-performance liquid chromatography and mass spectroscopy was used to analyze and identify the primary small molecule constituents in various old and new commercial lots of sodium copper chlorophyllin complex. The most active small molecule component of sodium copper chlorophyllin complex was disodium copper isochlorin e4, followed by oxidized disodium copper isochlorin e4. Sodium copper chlorophyllin complex and copper isochlorin e4 disodium salt had hyaluronidase inhibitory activity down to 10 µg/mL. The oxidized form of copper isochlorin e4 disodium salt had substantial hyaluronidase inhibitory activity at 100 µg/mL but not at 10 µg/mL. Ascorbate derivatives did not enhance the hyaluronidase inhibitory activity of sodium copper chlorophyllin. Copper isochlorin e4 analogs were always the dominant components of the small molecule content of the commercial lots tested; oxidized copper isochlorin e4 was found in increased concentrations in older compared to newer lots tested. These results support the concept of using the hyaluronidase inhibitory activity of sodium copper chlorophyllin complex to increase the hyaluronic acid level of the dermal extracellular matrix for the improvement of the appearance of aging facial skin.

  20. A reformulation of the coupled perturbed self-consistent field equations entirely within a local atomic orbital density matrix-based scheme

    NASA Astrophysics Data System (ADS)

    Ochsenfeld, Christian; Head-Gordon, Martin

    1997-05-01

    To exploit the exponential decay found in numerical studies for the density matrix and its derivative with respect to nuclear displacements, we reformulate the coupled perturbed self-consistent field (CPSCF) equations and a quadratically convergent SCF (QCSCF) method for Hartree-Fock and density functional theory within a local density matrix-based scheme. Our D-CPSCF (density matrix-based CPSCF) and D-QCSCF schemes open the way for exploiting sparsity and to achieve asymptotically linear scaling of computational complexity with molecular size ( M), in case of D-CPSCF for all O( M) derivative densities. Furthermore, these methods are even for small molecules strongly competitive to conventional algorithms.

  1. CD44 Promotes Inflammation and Extracellular Matrix Production During Arteriovenous Fistula Maturation.

    PubMed

    Kuwahara, Go; Hashimoto, Takuya; Tsuneki, Masayuki; Yamamoto, Kota; Assi, Roland; Foster, Trenton R; Hanisch, Jesse J; Bai, Hualong; Hu, Haidi; Protack, Clinton D; Hall, Michael R; Schardt, John S; Jay, Steven M; Madri, Joseph A; Kodama, Shohta; Dardik, Alan

    2017-06-01

    Arteriovenous fistulae (AVF) remain the optimal conduit for hemodialysis access but continue to demonstrate poor patency and poor rates of maturation. We hypothesized that CD44, a widely expressed cellular adhesion molecule that serves as a major receptor for extracellular matrix components, promotes wall thickening and extracellular matrix deposition during AVF maturation. AVF were created via needle puncture in wild-type C57BL/6J and CD44 knockout mice. CD44 mRNA and protein expression was increased in wild-type AVF. CD44 knockout mice showed no increase in AVF wall thickness (8.9 versus 26.8 μm; P =0.0114), collagen density, and hyaluronic acid density, but similar elastin density when compared with control AVF. CD44 knockout mice also showed no increase in vascular cell adhesion molecule-1 expression, intercellular adhesion molecule-1 expression, and monocyte chemoattractant protein-1 expression in the AVF compared with controls; there were also no increased M2 macrophage markers (transglutaminase-2: 81.5-fold, P =0.0015; interleukin-10: 7.6-fold, P =0.0450) in CD44 knockout mice. Delivery of monocyte chemoattractant protein-1 to CD44 knockout mice rescued the phenotype with thicker AVF walls (27.2 versus 14.7 μm; P =0.0306), increased collagen density (2.4-fold; P =0.0432), and increased number of M2 macrophages (2.1-fold; P =0.0335). CD44 promotes accumulation of M2 macrophages, extracellular matrix deposition, and wall thickening during AVF maturation. These data show the association of M2 macrophages with wall thickening during AVF maturation and suggest that enhancing CD44 activity may be a strategy to increase AVF maturation. © 2017 American Heart Association, Inc.

  2. Differential expression of neuroleukin in osseous tissues and its involvement in mineralization during osteoblast differentiation

    NASA Technical Reports Server (NTRS)

    Zhi, J.; Sommerfeldt, D. W.; Rubin, C. T.; Hadjiargyrou, M.

    2001-01-01

    Osteoblast differentiation is a multistep process that involves critical spatial and temporal regulation of cellular processes marked by the presence of a large number of differentially expressed molecules. To identify key functional molecules, we used differential messenger RNA (mRNA) display and compared RNA populations isolated from the defined transition phases (proliferation, matrix formation, and mineralization) of the MC3T3-E1 osteoblast-like cell line. Using this approach, a complementary DNA (cDNA) fragment was isolated and identified as neuroleukin (NLK), a multifunctional cytokine also known as autocrine motility factor (AMF), phosphoglucose isomerase (PGI; phosphohexose isomerase [PHI]), and maturation factor (MF). Northern analysis showed NLK temporal expression during MC3T3-E1 cell differentiation with a 3.5-fold increase during matrix formation and mineralization. Immunocytochemical studies revealed the presence of NLK in MC3T3-E1 cells as well as in the surrounding matrix, consistent with a secreted molecule. In contrast, the NLK receptor protein was detected primarily on the cell membrane. In subsequent studies, a high level of NLK expression was identified in osteoblasts and superficial articular chondrocytes in bone of 1-, 4-, and 8-month-old normal mice, as well as in fibroblasts, proliferating chondrocytes, and osteoblasts within a fracture callus. However, NLK was not evident in hypertrophic chondrocytes or osteocytes. In addition, treatment of MC3T3 cells with 6-phosphogluconic acid (6PGA; a NLK inhibitor) resulted in diminishing alkaline phosphatase (ALP) activity and mineralization in MC3T3-E1 cells, especially during the matrix formation stage of differentiating cells. Taken together, these data show specific expression of NLK in discrete populations of bone and cartilage cells and suggest a possible role for this secreted protein in bone development and regeneration.

  3. A novel intravaginal ring to prevent HIV-1, HSV-2, HPV, and unintended pregnancy.

    PubMed

    Ugaonkar, Shweta R; Wesenberg, Asa; Wilk, Jolanta; Seidor, Samantha; Mizenina, Olga; Kizima, Larisa; Rodriguez, Aixa; Zhang, Shimin; Levendosky, Keith; Kenney, Jessica; Aravantinou, Meropi; Derby, Nina; Grasperge, Brooke; Gettie, Agegnehu; Blanchard, James; Kumar, Narender; Roberts, Kevin; Robbiani, Melissa; Fernández-Romero, José A; Zydowsky, Thomas M

    2015-09-10

    Women urgently need a self-initiated, multipurpose prevention technology (MPT) that simultaneously reduces their risk of acquiring HIV-1, HSV-2, and HPV (latter two associated with increased risk of HIV-1 acquisition) and prevents unintended pregnancy. Here, we describe a novel core-matrix intravaginal ring (IVR), the MZCL IVR, which effectively delivered the MZC combination microbicide and a contraceptive. The MZCL IVR contains four active pharmaceutical ingredients (APIs): MIV-150 (targets HIV-1), zinc acetate (ZA; targets HIV-1 and HSV-2), carrageenan (CG; targets HPV and HSV-2), and levonorgestrel (LNG; targets unintended pregnancy). The elastomeric IVR body (matrix) was produced by hot melt extrusion of the non-water swellable elastomer, ethylene vinyl acetate (EVA-28), containing the hydrophobic small molecules, MIV-150 and LNG. The solid hydrophilic core, embedded within the IVR by compression, contained the small molecule ZA and the macromolecule CG. Hydrated ZA/CG from the core was released by diffusion via a pore on the IVR while the MIV-150/LNG diffused from the matrix continuously for 94 days (d) in vitro and up to 28 d (study period) in macaques. The APIs released in vitro and in vivo were active against HIV-1ADA-M, HSV-2, and HPV16 PsV in cell-based assays. Serum LNG was at levels associated with local contraceptive effects. The results demonstrate proof-of-concept of a novel core-matrix IVR for sustained and simultaneous delivery of diverse molecules for the prevention of HIV, HSV-2 and HPV acquisition, as well as unintended pregnancy. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Surface-assisted laser desorption/ionization time-of-flight mass spectrometry of small drug molecules and high molecular weight synthetic/biological polymers using electrospun composite nanofibers.

    PubMed

    Bian, Juan; Olesik, Susan V

    2017-03-27

    Polyacrylonitrile/Nafion®/carbon nanotube (PAN/Nafion®/CNT) composite nanofibers were prepared using electrospinning. These electrospun nanofibers were studied as possible substrates for surface-assisted laser desorption/ionization (SALDI) and matrix-enhanced surface-assisted laser desorption/ionization time-of-flight mass spectrometry (ME-SALDI/TOF-MS) for the first time in this paper. Electrospinning provides this novel substrate with a uniform morphology and a narrow size distribution, where CNTs were evenly and firmly immobilized on polymeric nanofibers. The results show that PAN/Nafion®/CNT nanofibrous mats are good substrates for the analysis of both small drug molecules and high molecular weight polymers with high sensitivity. Markedly improved reproducibility was observed relative to MALDI. Due to the composite formation between the polymers and the CNTs, no contamination of the carbon nanotubes to the mass spectrometer was observed. Furthermore, electrospun nanofibers used as SALDI substrates greatly extended the duration of ion signals of target analytes compared to the MALDI matrix. The proposed SALDI approach was successfully used to quantify small drug molecules with no interference in the low mass range. The results show that verapamil could be detected with a surface concentration of 220 femtomoles, indicating the high detection sensitivity of this method. Analysis of peptides and proteins with the electrospun composite substrate using matrix assisted-SALDI was improved and a low limit of detection of approximately 6 femtomoles was obtained for IgG. Both SALDI and ME-SALDI analyses displayed high reproducibility with %RSD ≤ 9% for small drug molecules and %RSD ≤ 14% for synthetic polymers and proteins.

  5. Modeling super-resolution SERS using a T-matrix method to elucidate molecule-nanoparticle coupling and the origins of localization errors

    NASA Astrophysics Data System (ADS)

    Heaps, Charles W.; Schatz, George C.

    2017-06-01

    A computational method to model diffraction-limited images from super-resolution surface-enhanced Raman scattering microscopy is introduced. Despite significant experimental progress in plasmon-based super-resolution imaging, theoretical predictions of the diffraction limited images remain a challenge. The method is used to calculate localization errors and image intensities for a single spherical gold nanoparticle-molecule system. The light scattering is calculated using a modification of generalized Mie (T-matrix) theory with a point dipole source and diffraction limited images are calculated using vectorial diffraction theory. The calculation produces the multipole expansion for each emitter and the coherent superposition of all fields. Imaging the constituent fields in addition to the total field provides new insight into the strong coupling between the molecule and the nanoparticle. Regardless of whether the molecular dipole moment is oriented parallel or perpendicular to the nanoparticle surface, the anisotropic excitation distorts the center of the nanoparticle as measured by the point spread function by approximately fifty percent of the particle radius toward to the molecule. Inspection of the nanoparticle multipoles reveals that distortion arises from a weak quadrupole resonance interfering with the dipole field in the nanoparticle. When the nanoparticle-molecule fields are in-phase, the distorted nanoparticle field dominates the observed image. When out-of-phase, the nanoparticle and molecule are of comparable intensity and interference between the two emitters dominates the observed image. The method is also applied to different wavelengths and particle radii. At off-resonant wavelengths, the method predicts images closer to the molecule not because of relative intensities but because of greater distortion in the nanoparticle. The method is a promising approach to improving the understanding of plasmon-enhanced super-resolution experiments.

  6. The molecular mechanism of the cholesterol-lowering effect of dill and kale: The influence of the food matrix components.

    PubMed

    Danesi, Francesca; Govoni, Marco; D'Antuono, Luigi Filippo; Bordoni, Alessandra

    2016-07-01

    Foods are complex matrices containing many different compounds, all of which contribute to the overall effect of the food itself, although they have different mechanisms of action. While evaluating the effect of bioactive compounds, it is important to consider that the use of a single compound can hide the effects of the other molecules that can act synergistically or antagonistically in the same food. The aim of the present study was to evaluate the influence of food matrix components by comparing two edible plants (dill and kale) with cholesterol-lowering potential and similar contents of their most representative bioactive, quercetin. The molecular effects of the extracts were evaluated in HepG2 cells by measuring the expression of sterol-regulatory element-binding proteins (SREBPs), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) and low density lipoprotein receptor (LDLR) at the mRNA and protein level. The results reported here show that both extracts reduced the cellular cholesterol level with a similar trend and magnitude. It is conceivable that the slightly different results are due to the diverse composition of minor bioactive compounds, indicating that only by considering food as a whole is it possible to understand the complex relationship between food, nutrition, and health in a foodomics vision. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Bromo-oxidation reaction in enzyme-entrapped alginate hollow microfibers

    PubMed Central

    Asthana, Amit; Lee, Kwang Ho; Shin, Su-Jung; Perumal, Jayakumar; Butler, Lauren; Lee, Sang-Hoon; Kim, Dong-Pyo

    2011-01-01

    In this article, the authors present the fabrication of an enzyme-entrapped alginate hollow fiber using a microfluidic device. Further use of enzyme-entrapped alginate hollow fibers as a biocatalytic microchemical reactor for chemical synthesis is also deliberated in this article. To ensure that there is no enzyme leaching from the fiber, fiber surfaces were coated with chitosan. To confine the mobility of reactants and products within the porous hollow fibers the entire fibers were embedded into a transparent polydimethylsiloxane (PDMS) matrix which also works as a support matrix. A vanadium-containing bromoperoxidase enzyme isolated from Corallina confusa was used as a model enzyme to demonstrate the use of these alginate hollow-fiber reactors in bromo-oxidation of phenol red to bromophenol blue at different dye flow rates. Stability of the entrapped enzyme at different temperatures and the effect of the chitosan coating on the reaction conversion were also studied. It was observed that molecules as big as 27 kDa can be retained in the matrix after coating with chitosan while molecules with molecular-weight of around 378 Da can still diffuse in and out of the matrix. The kinetic conversion rate in this microfluidic bioreactor was more than 41-fold faster when compared with the standard test-tube procedure. PMID:21799723

  8. Effects of added surfactant on swelling and molecular transport in drug-loaded tablets based on hydrophobically modified poly(acrylic acid).

    PubMed

    Knöös, Patrik; Wahlgren, Marie; Topgaard, Daniel; Ulvenlund, Stefan; Piculell, Lennart

    2014-08-14

    A combination of NMR chemical shift imaging and self-diffusion experiments is shown to give a detailed molecular picture of the events that occur when tablets of hydrophobically modified poly(acrylic acid) loaded with a drug (griseofulvin) swell in water in the presence or absence of surfactant (sodium octylbenzenesulfonate). The hydrophobic substituents on the polymer bind and trap the surfactant molecules in mixed micelles, leading to a slow effective surfactant transport that occurs via a small fraction of individually dissolved surfactant molecules in the water domain. Because of the efficient binding of surfactant, the penetrating water is found to diffuse past the penetrating surfactant into the polymer matrix, pushing the surfactant front outward as the matrix swells. The added surfactant has little effect on the transport of drug because both undissolved solid drug and surfactant-solubilized drug function as reservoirs that essentially follow the polymer as it swells. However, the added surfactant nevertheless has a strong indirect effect on the release of griseofulvin, through the effect of the surfactant on the solubility and erosion of the polymer matrix. The surfactant effectively solubilizes the hydrophobically modified polymer, making it fully miscible with water, leading to a more pronounced swelling and a slower erosion of the polymer matrix.

  9. Bovine serum albumin adsorption on functionalized porous silicon surfaces

    NASA Astrophysics Data System (ADS)

    Tay, Li-Lin; Rowell, Nelson L.; Lockwood, David J.; Boukherroub, Rabah

    2004-10-01

    The large surface area within porous Si (pSi) and its strong room temperature photoluminescence (PL) make it an ideal host for biological sensors. In particular, the development of pSi-based optical sensors for DNA, enzyme and other biochemical molecules have become of great interest. Here, we demonstrate that the in-situ monitoring of the pSi PL behaviour can be used as a positive identification of bovine serum albumin (BSA) protein adsorption inside the porous matrix. Electrochemically prepared pSi films were first functionalized with undecylenic acid to produce an organic monolayer covalently attached to the porous silicon surfaces. The acid terminal group also provided favourable BSA binding sites on the pSi matrix sidewalls. In-situ PL spectra showed a gradual red shift (up to 12 meV) in the PL peak energy due to the protein incorporation into the porous matrix. The PL then exhibited a continuous blue shift after saturation of the protein molecules in the pores. This blue shift of the PL peak frequency and a steady increase in the PL intensity is evidence of surface oxidation. Comparing the specular reflectance obtained by Fourier transform infrared spectroscopy (FTIR) before and after BSA incubation confirmed the adsorption of protein in the pSi matrix.

  10. Access of Hydrogen-Radicals to the Peptide-Backbone as a Measure for Estimating the Flexibility of Proteins Using Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry

    PubMed Central

    Takayama, Mitsuo; Nagoshi, Keishiro; Iimuro, Ryunosuke; Inatomi, Kazuma

    2014-01-01

    A factor for estimating the flexibility of proteins is described that uses a cleavage method of “in-source decay (ISD)” coupled with matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS). The MALDI-ISD spectra of bovine serum albumin (BSA), myoglobin and thioredoxin show discontinuous intense ion peaks originating from one-side preferential cleavage at the N-Cα bond of Xxx-Asp, Xxx-Asn, Xxx-Cys and Gly-Xxx residues. Consistent with these observations, Asp, Asn and Gly residues are also identified by other flexibility measures such as B-factor, turn preference, protection and fluorescence decay factors, while Asp, Asn, Cys and Gly residues are identified by turn preference factor based on X-ray crystallography. The results suggest that protein molecules embedded in/on MALDI matrix crystals partly maintain α-helix and that the reason some of the residues are more susceptible to ISD (Asp, Asn, Cys and Gly) and others less so (Ile and Val) is because of accessibility of the peptide backbone to hydrogen-radicals from matrix molecules. The hydrogen-radical accessibility in MALDI-ISD could therefore be adopted as a factor for measuring protein flexibility. PMID:24828203

  11. Variable tunneling barriers in FEBID based PtC metal-matrix nanocomposites as a transducing element for humidity sensing.

    PubMed

    Kolb, Florian; Schmoltner, Kerstin; Huth, Michael; Hohenau, Andreas; Krenn, Joachim; Klug, Andreas; List, Emil J W; Plank, Harald

    2013-08-02

    The development of simple gas sensing concepts is still of great interest for science and technology. The demands on an ideal device would be a single-step fabrication method providing a device which is sensitive, analyte-selective, quantitative, and reversible without special operating/reformation conditions such as high temperatures or special environments. In this study we demonstrate a new gas sensing concept based on a nanosized PtC metal-matrix system fabricated in a single step via focused electron beam induced deposition (FEBID). The sensors react selectively on polar H2O molecules quantitatively and reversibly without any special reformation conditions after detection events, whereas non-polar species (O2, CO2, N2) produce no response. The key elements are isolated Pt nanograins (2-3 nm) which are embedded in a dielectric carbon matrix. The electrical transport in such materials is based on tunneling effects in the correlated variable range hopping regime, where the dielectric carbon matrix screens the electric field between the particles, which governs the final conductivity. The specific change of these dielectric properties by the physisorption of polar gas molecules (H2O) can change the tunneling probability and thus the overall conductivity, allowing their application as a simple and straightforward sensing concept.

  12. A Versatile Click-Compatible Monolignol Probe to Study Lignin Deposition in Plant Cell Walls

    PubMed Central

    Pandey, Jyotsna L.; Wang, Bo; Diehl, Brett G.; Richard, Tom L.; Chen, Gong; Anderson, Charles T.

    2015-01-01

    Lignin plays important structural and functional roles in plants by forming a hydrophobic matrix in secondary cell walls that enhances mechanical strength and resists microbial decay. While the importance of the lignin matrix is well documented and the biosynthetic pathways for monolignols are known, the process by which lignin precursors or monolignols are transported and polymerized to form this matrix remains a subject of considerable debate. In this study, we have synthesized and tested an analog of coniferyl alcohol that has been modified to contain an ethynyl group at the C-3 position. This modification enables fluorescent tagging and imaging of this molecule after its incorporation into plant tissue by click chemistry-assisted covalent labeling with a fluorescent azide dye, and confers a distinct Raman signature that could be used for Raman imaging. We found that this monolignol analog is incorporated into in vitro-polymerized dehydrogenation polymer (DHP) lignin and into root epidermal cell walls of 4-day-old Arabidopsis seedlings. Incorporation of the analog in stem sections of 6-week-old Arabidopsis thaliana plants and labeling with an Alexa-594 azide dye revealed the precise locations of new lignin polymerization. Results from this study indicate that this molecule can provide high-resolution localization of lignification during plant cell wall maturation and lignin matrix assembly. PMID:25884205

  13. An R-matrix study of electron induced processes in BF3 plasma

    NASA Astrophysics Data System (ADS)

    Gupta, Dhanoj; Chakrabarti, Kalyan; Yoon, Jung-Sik; Song, Mi-Young

    2017-12-01

    An R-matrix formalism is used to study electron collision with the BF3 molecule using Quantemol-N, a computational system for electron molecule collisions which uses the molecular R-matrix method. Several target models are tested for BF3 in its equilibrium geometry, and the results are presented for the best model. Scattering calculations are then performed to yield resonance parameters, elastic, differential, excitation, and momentum transfer cross sections. The results for all the cross sections are compared with the experimental and theoretical data, and a good agreement is obtained. The resonances have been detected at 3.79 and 13.58 eV, with the ionization threshold being 15.7 eV. We have also estimated the absolute dissociative electron attachment (DEA) cross section for the F- ion production from BF3, which is a maiden attempt. The peak of the DEA is at around 13.5 eV, which is well supported by the resonance detected at 13.58 eV. The cross sections reported here find a variety of applications in the plasma technology.

  14. Expression analysis of extracellular matrix components in brush biopsies of oral lesions.

    PubMed

    Driemel, Oliver; Kosmehl, Hartwig; Rosenhahn, Julia; Berndt, Alexander; Reichert, Torsten E; Zardi, Luciano; Dahse, Regine

    2007-01-01

    Oral brush biopsies have proved to be a promising new non-invasive methodology in the diagnosis of oral lesions. The extracellular matrix (ECM) molecules gamma2 chain of laminin-5 (L5gamma2), tenascin-c (Tn-C) and the fibronectin isoform containing EDB (EDB-fn) are involved in matrix remodeling during malignant transformation in oral carcinoma. Expression of L5gamma2, Tn-C and EDB-fn was analysed in brush biopsy-obtained cells of benign inflammatory or hyperproliferative lesions and primary oral squamous cell carcinoma (OSCC) using the Roche LightCycler 2.0 System. Oral carcinoma are detectable with mRNA resynthesis of the ECM molecules L5gamma2 and Tn-C in oral brush biopsies. EDB-fn mRNA was not detected--the stroma myofibroblasts are apparently a preferential source of EDB-fn and sampling by oral brush biopsy harvests epithelial cells and does not reach the cells which do express EDB-fn. The performance of gene expression analysis in brush biopsies is limited by a high RNase activity in the oral cavity.

  15. Infrared Spectroscopy of Matrix-Isolated Neutral and Ionized Anthracoronene in Argon.

    PubMed

    de Barros, A L F; Mattioda, A L; Korsmeyer, J M; Ricca, A

    2018-03-08

    The matrix-isolated mid-IR (MIR) spectrum of neutral and ionized anthracoronene (C 36 H 18 , AnthCor) in argon has been measured experimentally, compared to the spectrum of its parent molecules, coronene and anthracene, and analyzed by comparison to a theoretical spectrum computed using density functional theory (DFT). The experimental and theoretical band positions generally agree within 0-10 cm -1 . Anthracoronene exhibits extremely intense cation and anion bands around 1330 and 1318 cm -1 . The intensity of these two bands approaches what is traditionally observed over the entire 1000-1600 cm -1 range for a typical PAH cation or anion. The matrix-isolated near-IR (NIR) through overlap region (OVR) spectrum of ionized AnthCor in argon has been reported for the first time and compared to the spectrum of its parent molecules, coronene and anthracene. The spectrum of AnthCor contains a very strong electronic transition around 6175 cm -1 , placing it outside the range of the electronic transitions typically observed for PAHs. Anthracoronene is one of the few PAHs studied to date which has exhibited the formation of anions upon UV photolysis.

  16. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  17. Microenvironment Influences Interaction of Signaling Molecules | Center for Cancer Research

    Cancer.gov

    Tumor progression depends not only on events that occur within cancer cells but also on the interaction of cancer cells with their environment, which can regulate tumor growth and metastasis and modulate the formation of new blood vessels to nourish the tumor. All cells communicate with other cells around them, including endothelial cells (the cells that make up blood vessels). They also interact with the extracellular matrix (ECM), a network of sugars and proteins that supports cells. Communication between neighboring cells and molecules often occurs through interaction among and between molecules on the cell surface and molecules of the ECM. Defining these interactions should facilitate the development of novel approaches to limit tumor progression.

  18. Quantum interference in multi-branched molecules: The exact transfer matrix solutions.

    PubMed

    Jiang, Yu

    2017-12-07

    We present a transfer matrix formalism for studying quantum interference in a single molecule electronic system with internal branched structures. Based on the Schrödinger equation with the Bethe ansatz and employing Kirchhoff's rule for quantum wires, we derive a general closed-form expression for the transmission and reflection amplitudes of a two-port quantum network. We show that the transport through a molecule with complex internal structures can be reduced to that of a single two-port scattering unit, which contains all the information of the original composite molecule. Our method allows for the calculation of the transmission coefficient for various types of individual molecular modules giving rise to different resonant transport behaviors such as the Breit-Wigner, Fano, and Mach-Zehnder resonances. As an illustration, we first re-derive the transmittance of the Aharonov-Bohm ring, and then we apply our formulation to N identical parity-time (PT)-symmetric potentials, connected in series as well as in parallel. It is shown that the spectral singularities and PT-symmetric transitions of single scattering cells may be observed in coupled systems. Such transitions may occur at the same or distinct values of the critical parameters, depending on the connection modes under which the scattering objects are coupled.

  19. Altered expression of extracellular matrix molecules and their receptors in chronic pancreatitis and pancreatic adenocarcinoma in comparison with normal pancreas.

    PubMed

    Shimoyama, S; Gansauge, F; Gansauge, S; Oohara, T; Beger, H G

    1995-12-01

    The aim of this study was to elucidate the expression and distribution patterns of both integrins and extracellular matrix (ECM) molecules in chronic pancreatitis (CP) and pancreatic adenocarcinoma (PC) compared with normal pancreas (NP). Expression of nine alpha-subunits (alpha 2-alpha 6, alpha V, alpha L, alpha M, and alpha X), four beta-subunits (beta 1, beta 3-beta 5), and four ECM molecules (type IV collagen, laminin, fibronectin, and vitronectin) was investigated immunohistochemically. In CP, all integrins except alpha V showed nearly the same staining patterns compared with NP. Some acinar cells in CP expressed alpha V. Whereas alpha 2, alpha 3, and alpha 6 expression was stronger and diffuse, no alpha 5 expression was seen in PC. Basement membrane (BM) showed continuous staining in CP, whereas it showed discontinuous/absent staining in PC with antitype IV collagen, laminin, and vitronectin antibodies. Some carcinoma cells showed reverse correlation between alpha 2, alpha 3, and alpha 6 expression and type IV collagen and laminin expression. Fibronectin showed diffuse stromal expression in CP and PC. Some acinar cells or duct cells in CP carcinoma cells in PC showed intracellular VN expression. These results suggest that these integrins and ECM molecules are involved in inflammatory and malignant processes in pancreas.

  20. Structure and sorption properties of CNC reinforced PVA films.

    PubMed

    Popescu, Maria-Cristina

    2017-08-01

    Bio-nanocomposite films based on cellulose nanocrystals reinforced poly(vinyl alcohol) were obtained by solvent casting method. To assess the structural features of the films, different spectral techniques (FTIR, 2D COS and XRD) have been used. Infrared and 2D correlation spectroscopy evidenced the presence of H-bond interactions between the PVA and CNC, and the variation in the conformational rearrangements, while XRD showed that the crystallite size and the crystallinity degree were affected by the incorporation of CNC. At low content of CNC in the PVA matrix, the crystallinity degree decreased to 29.9%, while at higher CNC content increased to 80.6%, comparing to PVA (35.4%). To evaluate the interaction with water, contact angle measurement, water sorption and NIR spectroscopy were used, respectively. The increase of the CNC content induced a reduction in water sorption ability from 93% for PVA to 75% for PVA/CNC films, indicating the involvement of the hydroxyl groups in new hydrogen bonded interactions. By analyzing the variation of the NIR bands from 1930, 1902 and 1985nm, was observed that the water molecules interact with the polymer matrix through moderate hydrogen bond before diffusing into the free volume of the matrix and form stronger hydrogen bonds. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Analysis of cocaine/crack biomarkers in meconium by LC-MS.

    PubMed

    D'Avila, Felipe Bianchini; Ferreira, Pâmela C Lukasewicz; Salazar, Fernanda Rodrigues; Pereira, Andrea Garcia; Santos, Maíra Kerpel Dos; Pechansky, Flavio; Limberger, Renata Pereira; Fröehlich, Pedro Eduardo

    2016-02-15

    Fetal exposure to illicit drugs is a worldwide problem, since many addicted women do not stop using it during pregnancy. Cocaine consumed in powdered (snorted or injected) or smoked (crack cocaine) form are harmful for the baby and its side effects are not completely known. Meconium, the first stool of a newborn, is a precious matrix usually discarded, that may contain amounts of substances consumed in the last two trimesters of pregnancy. Analyzing this biological matrix it is possible to detect the unaltered molecule of cocaine (COC) or its metabolite benzoylecgonine (BZE) and pyrolytic products anhydroecgonine methyl ester (AEME) and anhydroecgonine (AEC). A liquid chromatography mass spectrometry (LC-MS) method was validated for meconium samples after solvent extraction, followed by direct injection of 10μL. Linearity covered a concentration range of 15 to 500ng/mg with a lower limit of quantification (LLOQ) of 15ng/mg for all analytes. Matrix effect was evaluated and showed adequate results. Detection of illicit substances usage can be crucial for the baby, since knowing that can help provide medical care as fast as possible. The method proved to be simple and fast, and was applied to 17 real meconium samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. The Histochemistry and Cell Biology omnium-gatherum: the year 2015 in review.

    PubMed

    Taatjes, Douglas J; Roth, Jürgen

    2016-03-01

    We provide here our annual review/synopsis of all of the articles published in Histochemistry and Cell Biology (HCB) for the preceding year. In 2015, HCB published 102 articles, representing a wide variety of topics and methodologies. For ease of access to these differing topics, we have created categories, as determined by the types of articles presented to provide a quick index representing the general areas covered. This year, these categories include: (1) advances in methodologies; (2) molecules in health and disease; (3) organelles, subcellular structures, and compartments; (4) the nucleus; (5) stem cells and tissue engineering; (6) cell cultures: properties and capabilities; (7) connective tissues and extracellular matrix; (8) developmental biology; (9) nervous system; (10) musculoskeletal system; (11) respiratory and cardiovascular system; (12) liver and gastrointestinal tract; and (13) male and female reproductive systems. Of note, the categories proceed from methods development, to molecules, intracellular compartments, stem cells and cell culture, extracellular matrix, developmental biology, and finishing with various organ systems, hopefully presenting a logical journey from methods to organismal molecules, cells, and whole tissue systems.

  3. A Study on the Rectification Property of Self-Assembled Viologen Single Molecules Using a Scanning Tunneling Microscopy.

    PubMed

    Lee, Nam-Suk; Shin, Hoon-Kyu; Kwon, Young-Soo

    2015-02-01

    An ultrahigh vacuum scanning tunneling microscopy (UHV-STM) and a scanning tunneling spectroscopy (STS) are used measure the rectification property of self-assembled viologen single molecules (VC8SH, VC10SH, HSC8VC8SH, and HSC10VC10SH) in the previous study. Using STM we observe viologen single molecules in the self-assembled octanethiol (OT) SAM matrix. In the OT matrix a mixed phase that includes a c(4 x 2) superlattice of high-density standing up-phase is observed. We indicate high peak current-like rectifications at + 1.68 V(VC8SH), + 1.56 V(VC10SH), + 1.14 V(HSC8VC8SH), and + 1.04 V(HSC10VC10SH) based on the experiment implemented in this study. In addition, transition voltages (Vtrans) from direct tunneling to the Fowler-Nordheim tunneling are presented at 1.08 V(VC8SH), 0.97 V(VC10SH), 0.99 V(HSC8VC8SH), and 0.89 V(HSC1VC1SH).

  4. Emmprin (basigin/CD147): matrix metalloproteinase modulator and multifunctional cell recognition molecule that plays a critical role in cancer progression.

    PubMed

    Nabeshima, Kazuki; Iwasaki, Hiroshi; Koga, Kaori; Hojo, Hironobu; Suzumiya, Junji; Kikuchi, Masahiro

    2006-07-01

    Emmprin (basigin, CD147) is a cell surface glycoprotein that belongs to the immunoglobulin superfamily. It is highly expressed on the surface of tumor cells and stimulates adjacent fibroblasts or tumor cells to produce matrix metalloproteinases. Moreover, it has recently been shown that emmprin also stimulates expression of vascular endothelial growth factor and hyaluronan, which leads to angiogenesis and anchorage-independent growth/multidrug resistance, respectively. These findings have made emmprin an important molecule in tumor progression and, thus, more attractive as a target for antitumor treatment. However, other functions of emmprin, including as an activator of T cells, a chaperone for monocarboxylate transporters, a receptor for cyclophilin A and a neural recognition molecule, are also being identified in physiological and pathological conditions. Therefore, it is essential to develop specific means to control particular functions of emmprin, for which elucidation of each mechanism is crucial. This review will discuss the role of emmprin in tumor progression and recent advances in the molecular mechanisms of diverse phenomena regulated by emmprin.

  5. Titin-based stiffening of muscle fibers in Ehlers-Danlos Syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ottenheijm, Coen A.C.; Voermans, Nicol C.; Hudson, Bryan D.

    Tenascin-X (TNX) is an extracellular matrix glycoprotein whose absence leads to Ehlers-Danlos Syndrome (EDS). TNX-deficient EDS patients present with joint hypermobility and muscle weakness attributable to increased compliance of the extracellular matrix. We hypothesized that in response to the increased compliance of the extracellular matrix in TNX-deficient EDS patients, intracellular adaptations take place in the elastic properties of the giant muscle protein titin. We performed extensive single muscle fiber mechanical studies to determine active and passive properties in TNX-deficient EDS patients. Gel-electrophoresis, Western blotting, and microarray studies were used to evaluate titin expression and phosphorylation. X-ray diffraction was used tomore » measure myofilament lattice spacing. Passive tension of muscle fibers from TNX-deficient EDS patients was markedly increased. Myofilament extraction experiments indicated that the increased passive tension is attributable to changes in the properties of the sarcomeric protein titin. Transcript and protein data indicated no changes in titin isoform expression. Instead, differences in posttranslational modifications within titin's elastic region were found. In patients, active tension was not different at maximal activation level, but at submaximal activation level it was augmented attributable to increased calcium sensitivity. This increased calcium sensitivity might be attributable to stiffer titin molecules. In response to the increased compliance of the extracellular matrix in muscle of TNX-deficient EDS patients, a marked intracellular stiffening occurs of the giant protein titin. The stiffening of titin partly compensates for the muscle weakness in these patients by augmenting submaximal active tension generation.« less

  6. Expression of small leucine-rich extracellular matrix proteoglycans biglycan and lumican reveals oral lichen planus malignant potential.

    PubMed

    Lončar-Brzak, Božana; Klobučar, Marko; Veliki-Dalić, Irena; Sabol, Ivan; Kraljević Pavelić, Sandra; Krušlin, Božo; Mravak-Stipetić, Marinka

    2018-03-01

    The aim of this study was to examine molecular alterations on the protein level in lesions of oral lichen planus (OLP), oral squamous cell carcinoma (OSCC) and healthy mucosa. Global protein profiling methods based on liquid chromatography coupled to mass spectrometry (LC-MS) were used, with a special emphasis on evaluation of deregulated extracellular matrix molecules expression, as well as on analyses of IG2F and IGFR2 expression in healthy mucosa, OLP and OSCC tissues by comparative semi-quantitative immunohistochemistry. Mass spectrometry-based proteomics profiling of healthy mucosa, OLP and OSCC tissues (and accompanied histologically unaltered tissues, respectively) identified 55 extracellular matrix proteins. Twenty among identified proteins were common to all groups of samples. Expression of small leucine-rich extracellular matrix proteoglycans lumican and biglycan was found both in OSCC and OLP and they were validated by Western blot analysis as putative biomarkers. A significant increase (p < 0.05) of biglycan expression in OLP-AT group was determined in comparison with OLP-T group, while lumican showed significant up-regulation (p < 0.05) in OLP-T and OSCC-T groups vs. adjacent and control tissue groups. Biglycan expression was only determined in OSCC-AT group. Immunohistochemical analysis of IGF2 and IG2FR expression revealed no significant difference among groups of samples. Biglycan and lumican were identified as important pathogenesis biomarkers of OLP that point to its malignant potential.

  7. Soluble adhesion molecules in human cancers: sources and fates.

    PubMed

    van Kilsdonk, Jeroen W J; van Kempen, Léon C L T; van Muijen, Goos N P; Ruiter, Dirk J; Swart, Guido W M

    2010-06-01

    Adhesion molecules endow tumor cells with the necessary cell-cell contacts and cell-matrix interactions. As such, adhesion molecules are involved in cell signalling, proliferation and tumor growth. Rearrangements in the adhesion repertoire allow tumor cells to migrate, invade and form metastases. Besides these membrane-bound adhesion molecules several soluble adhesion molecules are detected in the supernatant of tumor cell lines and patient body fluids. Truncated soluble adhesion molecules can be generated by several conventional mechanisms, including alternative splicing of mRNA transcripts, chromosomal translocation, and extracellular proteolytic ectodomain shedding. Secretion of vesicles (ectosomes and exosomes) is an alternative mechanism mediating the release of full-length adhesion molecules. Soluble adhesion molecules function as modulators of cell adhesion, induce proteolytic activity and facilitate cell signalling. Additionally, adhesion molecules present on secreted vesicles might be involved in the vesicle-target cell interaction. Based on currently available data, released soluble adhesion molecules contribute to cancer progression and therefore should not be regarded as unrelated and non-functional side products of tumor progression. 2010 Elsevier GmbH. All rights reserved.

  8. A simple water model in the presence of inert Lennard-Jones obstacles II: the hydrophobic effect

    NASA Astrophysics Data System (ADS)

    Kurtjak, Mario; Urbic, Tomaz

    2015-04-01

    Using Monte Carlo computer simulations, hydrophobic effect for a non-polar particle with the diameter of a water molecule was studied in water, confined within a disordered matrix. Freely mobile two-dimensional Mercedes-Benz water was put in a disordered, but fixed, matrix of Lennard-Jones disks. Influence of temperature and matrix properties on the thermodynamic quantities of a non-polar solute solvation was studied. The hydrophobic effect is changed by the presence of the obstacles. Smaller matrix particles change the solute-water structure and thermodynamics drastically, as it was also observed for the properties of pure confined water. The study is bringing new scientific important observations in understanding the role of hydrophobic forces under confinement.

  9. Matrix Density-induced Mechanoregulation of Breast Cell Phenotype, Signaling, and Gene Expression through a FAK ERK Linkage

    DTIC Science & Technology

    2009-12-10

    sites of integrin-clustering that link the actin cytoskeleton to the extracellular matrix (ECM; (Burridge et al., 1988)). The primary functions of...Hall, 1992). Furthermore, in fibroblasts, focal adhesion kinase (FAK), a key FA signaling molecule, is necessary for mechanosensing (Geiger et al...promotes FAK activation through phosphorylation on Y397 and Y925, followed by FAK- dependent extracellular signal-regulated kinase (ERK) phosphorylation

  10. Three-dimensional culture using a radial flow bioreactor induces matrix metalloprotease 7-mediated EMT-like process in tumor cells via TGFbeta1/Smad pathway.

    PubMed

    Shibata, Shun-Ichi; Marushima, Hideki; Asakura, Tadashi; Matsuura, Tomokazu; Eda, Homare; Aoki, Katsuhiko; Matsudaira, Hiroshi; Ueda, Kazu; Ohkawa, Kiyoshi

    2009-05-01

    To confirm the usefulness of the radial flow type bioreactor (RFB) for a three-dimensional (3D) culture system, which provides a tissue architecture and molecular function mimicking the in vivo environment, molecular expression in the A431 human squamous carcinoma cell line during culture were analyzed under the physically different environments of 3D culture in the RFB, 2D culture in a monolayer as well as in nude mice. Time-dependent accumulation of autocrine transforming growth factor (TGF) beta1 was found in spent culture media obtained only from 3D cultured A431 cancer cells, which grew well with a stratified-sheet morphology. Cells in the RFB overexpressed matrix metalloproteinase 7 (MMP7) and showed an increased release of soluble 80-kDa fragments of E-cadherin into the media time-dependently, resulting in the reduction of E-cadherin protein at the cell surface without down-regulation of the mRNA. beta-Catenin and its nuclear partner, LEF1, were up-regulated and Wnt protein secretion was also accelerated. Additional up-regulation of the transcriptional factors, HMGA2 and down-stream Slug, was noted. TGFbeta1-dependent, MMP7-mediated up-regulation of beta-catenin/LEF1 signaling and TGFbeta1-activated HMGA2 pathways consequently converged with Slug overexpression, due to disassembly and further repression of E-cadherin expression, which was reproducible in the epithelial mesenchymal transition process without any manipulation. Other transcriptional factors, Notch/HEY1 and NF-kappaB, were also up-regulated in 3D-cultured cells. These signals recruited molecules related to extracellular matrix-cell remodeling and angiogenesis. Expression of several representative molecules in the 3D cultured cells was parallel with that in xenotransplanted A431 tumor tissues in nude mice. 3D culture of tumor cells in the RFB is a useful tool for cancer experimental biology and evaluation of cancer therapeutic-like systems in nude mice.

  11. Enhanced hyaline cartilage matrix synthesis in collagen sponge scaffolds by using siRNA to stabilize chondrocytes phenotype cultured with bone morphogenetic protein-2 under hypoxia.

    PubMed

    Legendre, Florence; Ollitrault, David; Hervieu, Magalie; Baugé, Catherine; Maneix, Laure; Goux, Didier; Chajra, Hanane; Mallein-Gerin, Frédéric; Boumediene, Karim; Galera, Philippe; Demoor, Magali

    2013-07-01

    Cartilage healing by tissue engineering is an alternative strategy to reconstitute functional tissue after trauma or age-related degeneration. However, chondrocytes, the major player in cartilage homeostasis, do not self-regenerate efficiently and lose their phenotype during osteoarthritis. This process is called dedifferentiation and also occurs during the first expansion step of autologous chondrocyte implantation (ACI). To ensure successful ACI therapy, chondrocytes must be differentiated and capable of synthesizing hyaline cartilage matrix molecules. We therefore developed a safe procedure for redifferentiating human chondrocytes by combining appropriate physicochemical factors: hypoxic conditions, collagen scaffolds, chondrogenic factors (bone morphogenetic protein-2 [BMP-2], and insulin-like growth factor I [IGF-I]) and RNA interference targeting the COL1A1 gene. Redifferentiation of dedifferentiated chondrocytes was evaluated using gene/protein analyses to identify the chondrocyte phenotypic profile. In our conditions, under BMP-2 treatment, redifferentiated and metabolically active chondrocytes synthesized a hyaline-like cartilage matrix characterized by type IIB collagen and aggrecan molecules without any sign of hypertrophy or osteogenesis. In contrast, IGF-I increased both specific and noncharacteristic markers (collagens I and X) of chondrocytes. The specific increase in COL2A1 gene expression observed in the BMP-2 treatment was shown to involve the specific enhancer region of COL2A1 that binds the trans-activators Sox9/L-Sox5/Sox6 and Sp1, which are associated with a decrease in the trans-inhibitors of COL2A1, c-Krox, and p65 subunit of NF-kappaB. Our procedure in which BMP-2 treatment under hypoxia is associated with a COL1A1 siRNA, significantly increased the differentiation index of chondrocytes, and should offer the opportunity to develop new ACI-based therapies in humans.

  12. Comment on ``Multicritical behavior of a square-lattice-gas model with anisotropic repulsive interactions: A transfer-matrix scaling study''

    NASA Astrophysics Data System (ADS)

    Caflisch, Robert G.

    1988-09-01

    An argument is given that the model of Buda, Florio, and Giaquinta (BFG)[Phys. Rev. B 35, 2021 (1987)] for anisotropic molecules on a square lattice is inappropriate in that context, because it confuses anisotropy of the lattice with the anisotropy of the molecule. The importance of this is made clear by noting the absence (in BFG) of a dilute isotropic phase. Such a phase is unavoidable on very general grounds. Comments are made about an alternative realization of their results and an alternative class of models for anisotropic molecules.

  13. Separated-pair independent particle model and the generalized Brillouin theorem: ab initio calculations on the dissociation of polyatomic molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sundberg, Kenneth Randall

    1976-01-01

    A method is developed to optimize the separated-pair independent particle (SPIP) wave function; it is a special case of the separated-pair theory obtained by using two-term natural expansions of the geminals. The orbitals are optimized by a theory based on the generalized Brillouin theorem and iterative configuration interaction (CI) calculations in the space of the SPIP function and its single excitations. The geminal expansion coefficients are optimized by serial 2 x 2 CI calculations. Formulas are derived for the matrix elements. An algorithm to implement the method is presented, and the work needed to evaluate the molecular integrals is discussed.

  14. The unexpected formation of [M - H]+ species during MALDI and dopant-free APPI MS analysis of novel antineoplastic curcumin analogues.

    PubMed

    Awad, H; Stoudemayer, M J; Usher, L; Amster, I J; Cohen, A; Das, U; Whittal, R M; Dimmock, J; El-Aneed, A

    2014-11-01

    Unusual ionization behavior was observed with novel antineoplastic curcumin analogues during the positive ion mode of matrix-assisted laser desorption ionization (MALDI) and dopant-free atmospheric pressure photoionization (APPI). The tested compounds produced an unusual significant peak designated as [M - H](+) ion along with the expected [M + H](+) species. In contrast, electrospray ionization, atmospheric pressure chemical ionization and the dopant-mediated APPI (dopant-APPI) showed only the expected [M + H](+) peak. The [M - H](+) ion was detected with all evaluated curcumin analogues including phosphoramidates, secondary amines, amides and mixed amines/amides. Our experiments revealed that photon energy triggers the ionization of the curcumin analogues even in the absence of any ionization enhancer such as matrix, solvent or dopant. The possible mechanisms for the formation of both [M - H](+) and [M + H](+) ions are discussed in this paper. In particular, three proposed mechanisms for the formation of [M - H](+) were evaluated. The first mechanism involves the loss of H2 from the protonated [M + H](+) species. The other two mechanisms include hydrogen transfer from the analyte radical cation or hydride abstraction from the neutral analyte molecule. Copyright © 2014 John Wiley & Sons, Ltd.

  15. Regulation of corneal stroma extracellular matrix assembly.

    PubMed

    Chen, Shoujun; Mienaltowski, Michael J; Birk, David E

    2015-04-01

    The transparent cornea is the major refractive element of the eye. A finely controlled assembly of the stromal extracellular matrix is critical to corneal function, as well as in establishing the appropriate mechanical stability required to maintain corneal shape and curvature. In the stroma, homogeneous, small diameter collagen fibrils, regularly packed with a highly ordered hierarchical organization, are essential for function. This review focuses on corneal stroma assembly and the regulation of collagen fibrillogenesis. Corneal collagen fibrillogenesis involves multiple molecules interacting in sequential steps, as well as interactions between keratocytes and stroma matrix components. The stroma has the highest collagen V:I ratio in the body. Collagen V regulates the nucleation of protofibril assembly, thus controlling the number of fibrils and assembly of smaller diameter fibrils in the stroma. The corneal stroma is also enriched in small leucine-rich proteoglycans (SLRPs) that cooperate in a temporal and spatial manner to regulate linear and lateral collagen fibril growth. In addition, the fibril-associated collagens (FACITs) such as collagen XII and collagen XIV have roles in the regulation of fibril packing and inter-lamellar interactions. A communicating keratocyte network contributes to the overall and long-range regulation of stromal extracellular matrix assembly, by creating micro-domains where the sequential steps in stromal matrix assembly are controlled. Keratocytes control the synthesis of extracellular matrix components, which interact with the keratocytes dynamically to coordinate the regulatory steps into a cohesive process. Mutations or deficiencies in stromal regulatory molecules result in altered interactions and deficiencies in both transparency and refraction, leading to corneal stroma pathobiology such as stromal dystrophies, cornea plana and keratoconus. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Biophysical Stimuli: A Review of Electrical and Mechanical Stimulation in Hyaline Cartilage.

    PubMed

    Vaca-González, Juan J; Guevara, Johana M; Moncayo, Miguel A; Castro-Abril, Hector; Hata, Yoshie; Garzón-Alvarado, Diego A

    2017-09-01

    Objective Hyaline cartilage degenerative pathologies induce morphologic and biomechanical changes resulting in cartilage tissue damage. In pursuit of therapeutic options, electrical and mechanical stimulation have been proposed for improving tissue engineering approaches for cartilage repair. The purpose of this review was to highlight the effect of electrical stimulation and mechanical stimuli in chondrocyte behavior. Design Different information sources and the MEDLINE database were systematically revised to summarize the different contributions for the past 40 years. Results It has been shown that electric stimulation may increase cell proliferation and stimulate the synthesis of molecules associated with the extracellular matrix of the articular cartilage, such as collagen type II, aggrecan and glycosaminoglycans, while mechanical loads trigger anabolic and catabolic responses in chondrocytes. Conclusion The biophysical stimuli can increase cell proliferation and stimulate molecules associated with hyaline cartilage extracellular matrix maintenance.

  17. A comparative study of methods for describing non-adiabatic coupling: diabatic representation of the 1Sigma +/1Pi HOH and HHO conical intersections

    NASA Astrophysics Data System (ADS)

    Dobbyn, Abigail J.; Knowles, Peter J.

    A number of established techniques for obtaining diabatic electronic states in small molecules are critically compared for the example of the X and B states in the water molecule, which contribute to the two lowest-energy conical intersections. Integration of the coupling matrix elements and analysis of configuration mixing coefficients both produce reliable diabatic states globally. Methods relying on diagonalization of dipole moment and angular momentum operators are shown to fail in large regions of coordinate space. However, the use of transition angular momentum matrix elements involving the A state, which is degenerate with B at the conical intersections, is successful globally, provided that an appropriate choice of coordinates is made. Long range damping of non-adiabatic coupling to give correct asymptotic mixing angles also is investigated.

  18. The Infrared Spectrum of Matrix Isolated Aminoacetonitrile: A Precursor to the Amino Acid Glycine

    NASA Technical Reports Server (NTRS)

    Bernstein, Max P.; Bauschlicher, Charles W., Jr.; Sandford, Scott A.

    2003-01-01

    We present infrared (IR) spectral data from matrix isolation experiments and density functional theory calculations on the pre-biologically interesting molecule aminoacetonitrile, a precursor to glycine. We find that this nitrile has an unusually weak nitrile (C=N) stretch in the infrared, in contrast to expectations based on measurements and models of other nitriles under astrophysical conditions. The absence of an observable nitrile absorption feature in the infrared will make the IR search for this molecule considerably more difficult, and will raise estimates of upper limits on nitriles in interstellar and outer Solar System ices. This is also of relevance to assessing the formation routes of the amino acid glycine, since aminoacetonitrile is the putative precursor to glycine via the Strecker synthesis, the mechanism postulated to have produced the amino acids in meteorites.

  19. Molecular t-matrices for Low-Energy Electron Diffraction (TMOL v1.1)

    NASA Astrophysics Data System (ADS)

    Blanco-Rey, Maria; de Andres, Pedro; Held, Georg; King, David A.

    2004-08-01

    We describe a FORTRAN-90 program that computes scattering t-matrices for a molecule. These can be used in a Low-Energy Electron Diffraction program to solve the molecular structural problem very efficiently. The intramolecular multiple scattering is computed within a Dyson-like approach, using free space Green propagators in a basis of spherical waves. The advantage of this approach is related to exploiting the chemical identity of the molecule, and to the simplicity to translate and rotate these t-matrices without performing a new multiple-scattering calculation for each configuration. FORTRAN-90 routines for rotating the resulting t-matrices using Wigner matrices are also provided. Program summaryTitle of program: TMOL Catalogue number: ADUF Program summary URL:http://cpc.cs.qub.ac.uk/summaries/ADUF Program obtainable from: CPC Program Library, Queen's University of Belfast, N. Ireland. Computers: Alpha ev6-21264 (700 MHz) and Pentium-IV. Operating systems: Digital UNIX V5.0 and Linux (Red Hat 8.0). Programming language: FORTRAN-90/95 (Compaq True64 compiler, and Intel Fortran Compiler 7.0 for Linux). High-speed storage required for the test run: minimum 64 Mbytes, it can grow to more depending on the system considered. Disk storage required: None. No. of bits in a word: 64 and 32. No. of lines in distributed program, including test data etc.: 5404 No. of bytes in distributed program, including test data etc.: 59 856 Distribution format: tar.gz Nature of problem: We describe the FORTRAN-90 program TMOL (v1.1) for the computation of non-diagonal scattering t-matrices for molecules or any other poly-atomic sub-unit of surface structures. These matrices can be used in an standard Low-Energy Electron Diffraction program, such as LEED90 or CLEED. Method of solution: A general non-diagonal t-matrix is assumed for the atoms or more general scatterers forming the molecule. The molecular t-matrix is solved adding the possible intramolecular multiple scattering events using Green's propagator formalism. The resulting t-matrix is referred to the mass centre of the molecule and can be easily translated with these propagators and rotated applying Wigner matrices. Typical running time: Calculating the t-matrix for a single energy takes a few seconds. Time depends on the maximum angular momentum quantum number, lmax, and the number of scatterers in the molecule, N. Running time scales as lmax6 and N3. References: [1] S. Andersson, J.B. Pendry, J. Phys. C: Solid St. Phys. 13 (1980) 3547. [2] A. Gonis, W.H. Butler, Multiple Scattering in Solids, Springer-Verlag, Berlin/New York, 2000.

  20. Dynamic interactions between cells and their extracellular matrix mediate embryonic development.

    PubMed

    Goody, Michelle F; Henry, Clarissa A

    2010-06-01

    Cells and their surrounding extracellular matrix microenvironment interact throughout all stages of life. Understanding the continuously changing scope of cell-matrix interactions in vivo is crucial to garner insights into both congenital birth defects and disease progression. A current challenge in the field of developmental biology is to adapt in vitro tools and rapidly evolving imaging technology to study cell-matrix interactions in a complex 4-D environment. In this review, we highlight the dynamic modulation of cell-matrix interactions during development. We propose that individual cell-matrix adhesion proteins are best considered as complex proteins that can play multiple, often seemingly contradictory roles, depending upon the context of the microenvironment. In addition, cell-matrix proteins can also exert different short versus long term effects. It is thus important to consider cell behavior in light of the microenvironment because of the constant and dynamic reciprocal interactions occurring between them. Finally, we suggest that analysis of cell-matrix interactions at multiple levels (molecules, cells, tissues) in vivo is critical for an integrated understanding because different information can be acquired from all size scales. Copyright 2010 Wiley-Liss, Inc.

  1. The In Vivo PDGF Response During Remyelination in Mouse Spinal Cord Following Murine Hepatitis Virus Strain AS9-Induced Transient Demyelination

    DTIC Science & Technology

    1998-09-14

    repopulation. These and other growth factors interacting with cell adhesion molecules andlor matrix molecules would be expected to mediate oligodendrocyte...oligodendrocyte lineage, along with a closely related CCHC zinc finger, is expressed in developing neurons in the mammalian central nervous system. J...repopulate and remyelinate demyelinated lesions. In vitro studies have shown that platelet- derived growth factor (PDGF) induces proliferation

  2. Vibrational spectra (FT-IR, Raman and MI-IR) of α- and β-alanine

    NASA Astrophysics Data System (ADS)

    Rosado, Mário Túlio S.; Duarte, Maria Leonor R. S.; Fausto, Rui

    1997-06-01

    The vibrational spectra of α- and β-alaine molecules in both their zwitterionic and neutral forms are studied by FT-IR, Raman and MI-IR spectroscopy. Together with results from theoretical SCF-MO ab initio calculations, the spectroscopic data obtained under the various experimental conditions used in this study (crystalline phase; low temperature matrix isolated molecules) enable to undertake a detailed assignment of the vibrational spectra of the studied compounds.

  3. Water-based preparation of spider silk films as drug delivery matrices.

    PubMed

    Agostini, Elisa; Winter, Gerhard; Engert, Julia

    2015-09-10

    The main focus of this work was to obtain a drug delivery matrix characterized by biocompatibility, water insolubility and good mechanical properties. Moreover the preparation process has to be compatible with protein encapsulation and the obtained matrix should be able to sustain release a model protein. Spider silk proteins represent exceptional natural polymers due to their mechanical properties in combination with biocompatibility. As both hydrophobic and slowly biodegrading biopolymers, recombinant spider silk proteins fulfill the required properties for a drug delivery system. In this work, we present the preparation of eADF4(C16) films as drug delivery matrices without the use of any organic solvent. Water-based spider silk films were characterized in terms of protein secondary structure, thermal stability, zeta-potential, solubility, mechanical properties, and water absorption and desorption. Additionally, this study includes an evaluation of their application as a drug delivery system for both small molecular weight drugs and high molecular weight molecules such as proteins. Our investigation focused on possible improvements in the film's mechanical properties including plasticizers in the film matrix. Furthermore, different film designs were prepared, such as: monolayer, coated monolayer, multilayer (sandwich), and coated multilayer. The release of the model protein BSA from these new systems was studied. Results indicated that spider silk films are a promising protein drug delivery matrix, capable of releasing the model protein over 90 days with a release profile close to zero order kinetic. Such films could be used for several pharmaceutical and medical purposes, especially when mechanical strength of a drug eluting matrix is of high importance. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Z-sinapinic acid: the change of the stereochemistry of cinnamic acids as rational synthesis of a new matrix for carbohydrate MALDI-MS analysis.

    PubMed

    Salum, María L; Itovich, Lucia M; Erra-Balsells, Rosa

    2013-11-01

    Successful application of matrix-assisted laser desorption/ionization (MALDI) MS started with the introduction of efficient matrices such as cinnamic acid derivatives (i.e. 3,5-dimethoxy-4-hydroxycinnamic acid, SA; α-cyano-4-hydroxycinnamic acid). Since the empirical founding of these matrices, other commercial available cinnamic acids with different nature and location of substituents at benzene ring were attempted. Rational design and synthesis of new cinnamic acids have been recently described too. Because the presence of a rigid double bond in its molecule structure, cinnamic acids can exist as two different geometric isomers, the E-form and Z-form. Commercial available cinnamic acids currently used as matrices are the geometric isomers trans or E (E-cinnamic and trans-cinnamic acids). As a new rational design of MALDI matrices, Z-cinnamic acids were synthesized, and their properties as matrices were studied. Their performance was compared with that of the corresponding E-isomer and classical crystalline matrices (3,5-dihydroxybenzoic acid; norharmane) in the analysis of neutral/sulfated carbohydrates. Herein, we demonstrate the outstanding performance for Z-SA. Sulfated oligosaccharides were detected in negative ion mode, and the dissociation of sulfate groups was almost suppressed. Additionally, to better understand the quite different performance of each geometric isomer as matrix, the physical and morphological properties as well as the photochemical stability in solid state were studied. The influence of the E/Z photoisomerization of the matrix during MALDI was evaluated. Finally, molecular modeling (density functional theory study) of the optimized geometry and stereochemistry of E-cinnamic and Z-cinnamic acids revealed some factors governing the analyte-matrix interaction. Copyright © 2013 John Wiley & Sons, Ltd.

  5. Hydrogel Droplet Microfluidics for High-Throughput Single Molecule/Cell Analysis.

    PubMed

    Zhu, Zhi; Yang, Chaoyong James

    2017-01-17

    Heterogeneity among individual molecules and cells has posed significant challenges to traditional bulk assays, due to the assumption of average behavior, which would lose important biological information in heterogeneity and result in a misleading interpretation. Single molecule/cell analysis has become an important and emerging field in biological and biomedical research for insights into heterogeneity between large populations at high resolution. Compared with the ensemble bulk method, single molecule/cell analysis explores the information on time trajectories, conformational states, and interactions of individual molecules/cells, all key factors in the study of chemical and biological reaction pathways. Various powerful techniques have been developed for single molecule/cell analysis, including flow cytometry, atomic force microscopy, optical and magnetic tweezers, single-molecule fluorescence spectroscopy, and so forth. However, some of them have the low-throughput issue that has to analyze single molecules/cells one by one. Flow cytometry is a widely used high-throughput technique for single cell analysis but lacks the ability for intercellular interaction study and local environment control. Droplet microfluidics becomes attractive for single molecule/cell manipulation because single molecules/cells can be individually encased in monodisperse microdroplets, allowing high-throughput analysis and manipulation with precise control of the local environment. Moreover, hydrogels, cross-linked polymer networks that swell in the presence of water, have been introduced into droplet microfluidic systems as hydrogel droplet microfluidics. By replacing an aqueous phase with a monomer or polymer solution, hydrogel droplets can be generated on microfluidic chips for encapsulation of single molecules/cells according to the Poisson distribution. The sol-gel transition property endows the hydrogel droplets with new functionalities and diversified applications in single molecule/cell analysis. The hydrogel can act as a 3D cell culture matrix to mimic the extracellular environment for long-term single cell culture, which allows further heterogeneity study in proliferation, drug screening, and metastasis at the single-cell level. The sol-gel transition allows reactions in solution to be performed rapidly and efficiently with product storage in the gel for flexible downstream manipulation and analysis. More importantly, controllable sol-gel regulation provides a new way to maintain phenotype-genotype linkages in the hydrogel matrix for high throughput molecular evolution. In this Account, we will review the hydrogel droplet generation on microfluidics, single molecule/cell encapsulation in hydrogel droplets, as well as the progress made by our group and others in the application of hydrogel droplet microfluidics for single molecule/cell analysis, including single cell culture, single molecule/cell detection, single cell sequencing, and molecular evolution.

  6. Addressing individual metal ion centers in supramolecules by STS

    NASA Astrophysics Data System (ADS)

    Alam, M. S.; Ako, A. M.; Ruben, M.; Thompson, L. K.; Lehn, J.-M.

    2005-03-01

    As the information of STM measurements arises from electronic structure, separating information on the topography is not straightforward for complex molecules. Scanning tunneling spectroscopy (STS) measurements give information about the molecular energy levels, which are next to the molecules Fermi level. Using a home built STM working under ambient conditions, we succeeded to combine high resolution topography mapping with simultaneous current-voltage characteristics (STS) measurements on single molecules deposited on highly oriented pyrolytic graphite surfaces. We present our recent results on grid-type molecules [Co4L4] (L=4,6-bis(2',2''-bipyridyl-6-yl)pyrimidine) and [Mn9L6] (L=2POAP-2H) as well as on ring-shaped Fe ion chains [Fe6Cl6L6] (L=1-Ecosyliminodiethanol). Small, regular molecule clusters as well as separated single molecules were observed. We found a rather large contrast at the expected location of the metal centers in our molecules, i.e. the location of the individual metal ions in their organic matrix is directly addressable by STS.

  7. The roles of cell adhesion molecules in tumor suppression and cell migration: a new paradox.

    PubMed

    Moh, Mei Chung; Shen, Shali

    2009-01-01

    In addition to mediating cell adhesion, many cell adhesion molecules act as tumor suppressors. These proteins are capable of restricting cell growth mainly through contact inhibition. Alterations of these cell adhesion molecules are a common event in cancer. The resulting loss of cell-cell and/or cell-extracellular matrix adhesion promotes cell growth as well as tumor dissemination. Therefore, it is conventionally accepted that cell adhesion molecules that function as tumor suppressors are also involved in limiting tumor cell migration. Paradoxically, in 2005, we identified an immunoglobulin superfamily cell adhesion molecule hepaCAM that is able to suppress cancer cell growth and yet induce migration. Almost concurrently, CEACAM1 was verified to co-function as a tumor suppressor and invasion promoter. To date, the reason and mechanism responsible for this exceptional phenomenon remain unclear. Nevertheless, the emergence of these intriguing cell adhesion molecules with conflicting roles may open a new chapter to the biological significance of cell adhesion molecules.

  8. Extracellular Matrix and Dermal Fibroblast Function in the Healing Wound

    PubMed Central

    Tracy, Lauren E.; Minasian, Raquel A.; Caterson, E.J.

    2016-01-01

    Significance: Fibroblasts play a critical role in normal wound healing. Various extracellular matrix (ECM) components, including collagens, fibrin, fibronectin, proteoglycans, glycosaminoglycans, and matricellular proteins, can be considered potent protagonists of fibroblast survival, migration, and metabolism. Recent Advances: Advances in tissue culture, tissue engineering, and ex vivo models have made the examination and precise measurements of ECM components in wound healing possible. Likewise, the development of specific transgenic animal models has created the opportunity to characterize the role of various ECM molecules in healing wounds. In addition, the recent characterization of new ECM molecules, including matricellular proteins, dermatopontin, and FACIT collagens (Fibril-Associated Collagens with Interrupted Triple helices), further demonstrates our cursory knowledge of the ECM in coordinated wound healing. Critical Issues: The manipulation and augmentation of ECM components in the healing wound is emerging in patient care, as demonstrated by the use of acellular dermal matrices, tissue scaffolds, and wound dressings or topical products bearing ECM proteins such as collagen, hyaluronan (HA), or elastin. Once thought of as neutral structural proteins, these molecules are now known to directly influence many aspects of cellular wound healing. Future Directions: The role that ECM molecules, such as CCN2, osteopontin, and secreted protein, acidic and rich in cysteine, play in signaling homing of fibroblast progenitor cells to sites of injury invites future research as we continue investigating the heterotopic origin of certain populations of fibroblasts in a healing wound. Likewise, research into differently sized fragments of the same polymeric ECM molecule is warranted as we learn that fragments of molecules such as HA and tenascin-C can have opposing effects on dermal fibroblasts. PMID:26989578

  9. The time-dependent density matrix renormalisation group method

    NASA Astrophysics Data System (ADS)

    Ma, Haibo; Luo, Zhen; Yao, Yao

    2018-04-01

    Substantial progress of the time-dependent density matrix renormalisation group (t-DMRG) method in the recent 15 years is reviewed in this paper. By integrating the time evolution with the sweep procedures in density matrix renormalisation group (DMRG), t-DMRG provides an efficient tool for real-time simulations of the quantum dynamics for one-dimensional (1D) or quasi-1D strongly correlated systems with a large number of degrees of freedom. In the illustrative applications, the t-DMRG approach is applied to investigate the nonadiabatic processes in realistic chemical systems, including exciton dissociation and triplet fission in polymers and molecular aggregates as well as internal conversion in pyrazine molecule.

  10. Immunoassay

    USDA-ARS?s Scientific Manuscript database

    Immunoassays are analytical methods that employ antibodies or molecules derived from antibodies for the essential binding reactions. The choice of immunoassay system for food safety analysis depends on the analyte, the matrix, and the requirements of the analysis (speed, throughput, sensitivity, spe...

  11. Extracellular matrix protein 1, a direct targeting molecule of parathyroid hormone-related peptide, negatively regulates chondrogenesis and endochondral ossification via associating with progranulin growth factor.

    PubMed

    Kong, Li; Zhao, Yun-Peng; Tian, Qing-Yun; Feng, Jian-Quan; Kobayashi, Tatsuya; Merregaert, Joseph; Liu, Chuan-Ju

    2016-08-01

    Chondrogenesis and endochondral ossification are precisely controlled by cellular interactions with surrounding matrix proteins and growth factors that mediate cellular signaling pathways. Here, we report that extracellular matrix protein 1 (ECM1) is a previously unrecognized regulator of chondrogenesis. ECM1 is induced in the course of chondrogenesis and its expression in chondrocytes strictly depends on parathyroid hormone-related peptide (PTHrP) signaling pathway. Overexpression of ECM1 suppresses, whereas suppression of ECM1 enhances, chondrocyte differentiation and hypertrophy in vitro and ex vivo In addition, target transgene of ECM1 in chondrocytes or osteoblasts in mice leads to striking defects in cartilage development and endochondral bone formation. Of importance, ECM1 seems to be critical for PTHrP action in chondrogenesis, as blockage of ECM1 nearly abolishes PTHrP regulation of chondrocyte hypertrophy, and overexpression of ECM1 rescues disorganized growth plates of PTHrP-null mice. Furthermore, ECM1 and progranulin chondrogenic growth factor constitute an interaction network and act in concert in the regulation of chondrogenesis.-Kong, L., Zhao, Y.-P., Tian, Q.-Y., Feng, J.-Q., Kobayashi, T., Merregaert, J., Liu, C.-J. Extracellular matrix protein 1, a direct targeting molecule of parathyroid hormone-related peptide, negatively regulates chondrogenesis and endochondral ossification via associating with progranulin growth factor. © FASEB.

  12. Generation and use of high power 213 nm and 266 nm laser radiation and tunable 210-400 nm laser radiation with BBO crystal matrix array

    DOEpatents

    Gruen, Dieter M.

    2000-01-01

    A 213 nm laser beam is capable of single photon ablative photodecomposition for the removal of a polymer or biological material substrate. Breaking the molecular bonds and displacing the molecules away from the substrate in a very short time period results in most of the laser photon energy being carried away by the displaced molecules, thus minimizing thermal damage to the substrate. The incident laser beam may be unfocussed and is preferably produced by quintupling the 1064 nm radiation from a Nd:YAG solid state laser, i.e., at 213 nm. In one application, the 213 nm laser beam is expanded in cross section and directed through a plurality of small beta barium borate (BBO) crystals for increasing the energy per photon of the laser radiation directed onto the substrate. The BBO crystals are arranged in a crystal matrix array to provide a large laser beam transmission area capable of accommodating high energy laser radiation without damaging the BBO crystals. The BBO crystal matrix array may also be used with 266 nm laser radiation for carrying out single or multi photon ablative photodecomposition. The BBO crystal matrix array may also be used in an optical parametric oscillator mode to generate high power tunable laser radiation in the range of 210-400 nm.

  13. Poly(ethylene glycol) layered silicate nanocomposites for retarded drug release prepared by hot-melt extrusion.

    PubMed

    Campbell, Kayleen; Craig, Duncan Q M; McNally, Tony

    2008-11-03

    Composites of paracetamol loaded poly(ethylene glycol) (PEG) with a naturally derived and partially synthetic layered silicate (nanoclay) were prepared using hot-melt extrusion. The extent of dispersion and distribution of the paracetamol and nanoclay in the PEG matrix was examined using a combination of field emission scanning electron microscopy (FESEM), high resolution transmission electron microscopy (HRTEM) and wide-angle X-ray diffraction (WAXD). The paracetamol polymorph was shown to be well dispersed in the PEG matrix and the nanocomposite to have a predominately intercalated and partially exfoliated morphology. The form 1 monoclinic polymorph of the paracetamol was unaltered after the melt mixing process. The crystalline behaviour of the PEG on addition of both paracetamol and nanoclay was investigated using differential scanning calorimetry (DSC) and polarised hot-stage optical microscopy. The crystalline content of PEG decreased by up to 20% when both drug and nanoclay were melt blended with PEG, but the average PEG spherulite size increased by a factor of 4. The time taken for 100% release of paracetamol from the PEG matrix and corresponding diffusion coefficients were significantly retarded on addition of low loadings of both naturally occurring and partially synthetic nanoclays. The dispersed layered silicate platelets encase the paracetamol molecules, retarding diffusion and altering the dissolution behaviour of the drug molecule in the PEG matrix.

  14. Extracellular matrix protein 1, a direct targeting molecule of parathyroid hormone–related peptide, negatively regulates chondrogenesis and endochondral ossification via associating with progranulin growth factor

    PubMed Central

    Kong, Li; Zhao, Yun-Peng; Tian, Qing-Yun; Feng, Jian-Quan; Kobayashi, Tatsuya; Merregaert, Joseph; Liu, Chuan-Ju

    2016-01-01

    Chondrogenesis and endochondral ossification are precisely controlled by cellular interactions with surrounding matrix proteins and growth factors that mediate cellular signaling pathways. Here, we report that extracellular matrix protein 1 (ECM1) is a previously unrecognized regulator of chondrogenesis. ECM1 is induced in the course of chondrogenesis and its expression in chondrocytes strictly depends on parathyroid hormone–related peptide (PTHrP) signaling pathway. Overexpression of ECM1 suppresses, whereas suppression of ECM1 enhances, chondrocyte differentiation and hypertrophy in vitro and ex vivo. In addition, target transgene of ECM1 in chondrocytes or osteoblasts in mice leads to striking defects in cartilage development and endochondral bone formation. Of importance, ECM1 seems to be critical for PTHrP action in chondrogenesis, as blockage of ECM1 nearly abolishes PTHrP regulation of chondrocyte hypertrophy, and overexpression of ECM1 rescues disorganized growth plates of PTHrP-null mice. Furthermore, ECM1 and progranulin chondrogenic growth factor constitute an interaction network and act in concert in the regulation of chondrogenesis.—Kong, L., Zhao, Y.-P., Tian, Q.-Y., Feng, J.-Q., Kobayashi, T., Merregaert, J., Liu, C.-J. Extracellular matrix protein 1, a direct targeting molecule of parathyroid hormone–related peptide, negatively regulates chondrogenesis and endochondral ossification via associating with progranulin growth factor. PMID:27075243

  15. Cell and matrix modulation in prenatal and postnatal equine growth cartilage, zones of Ranvier and articular cartilage

    PubMed Central

    Löfgren, Maria; Ekman, Stina; Svala, Emilia; Lindahl, Anders; Ley, Cecilia; Skiöldebrand, Eva

    2014-01-01

    Formation of synovial joints includes phenotypic changes of the chondrocytes and the organisation of their extracellular matrix is regulated by different factors and signalling pathways. Increased knowledge of the normal processes involved in joint development may be used to identify similar regulatory mechanisms during pathological conditions in the joint. Samples of the distal radius were collected from prenatal and postnatal equine growth plates, zones of Ranvier and articular cartilage with the aim of identifying Notch signalling components and cells with stem cell-like characteristics and to follow changes in matrix protein localisation during joint development. The localisation of the Notch signalling components Notch1, Delta4, Hes1, Notch dysregulating protein epidermal growth factor-like domain 7 (EGFL7), the stem cell-indicating factor Stro-1 and the matrix molecules cartilage oligomeric matrix protein (COMP), fibromodulin, matrilin-1 and chondroadherin were studied using immunohistochemistry. Spatial changes in protein localisations during cartilage maturation were observed for Notch signalling components and matrix molecules, with increased pericellular localisation indicating new synthesis and involvement of these proteins in the formation of the joint. However, it was not possible to characterise the phenotype of the chondrocytes based on their surrounding matrix during normal chondrogenesis. The zone of Ranvier was identified in all horses and characterised as an area expressing Stro-1, EGFL7 and chondroadherin with an absence of COMP and Notch signalling. Stro-1 was also present in cells close to the perichondrium, in the articular cartilage and in the fetal resting zone, indicating stem cell-like characteristics of these cells. The presence of stem cells in the articular cartilage will be of importance for the repair of damaged cartilage. Perivascular chondrocytes and hypertrophic cells of the cartilage bone interface displayed positive staining for EGFL7, which is a novel finding and suggests a role of EGFL7 in the vascular infiltration of growth cartilage. PMID:25175365

  16. Copper Import into the Mitochondrial Matrix in Saccharomyces cerevisiae Is Mediated by Pic2, a Mitochondrial Carrier Family Protein*

    PubMed Central

    Vest, Katherine E.; Leary, Scot C.; Winge, Dennis R.; Cobine, Paul A.

    2013-01-01

    Saccharomyces cerevisiae must import copper into the mitochondrial matrix for eventual assembly of cytochrome c oxidase. This copper is bound to an anionic fluorescent molecule known as the copper ligand (CuL). Here, we identify for the first time a mitochondrial carrier family protein capable of importing copper into the matrix. In vitro transport of the CuL into the mitochondrial matrix was saturable and temperature-dependent. Strains with a deletion of PIC2 grew poorly on copper-deficient non-fermentable medium supplemented with silver and under respiratory conditions when challenged with a matrix-targeted copper competitor. Mitochondria from pic2Δ cells had lower total mitochondrial copper and exhibited a decreased capacity for copper uptake. Heterologous expression of Pic2 in Lactococcus lactis significantly enhanced CuL transport into these cells. Therefore, we propose a novel role for Pic2 in copper import into mitochondria. PMID:23846699

  17. Copper import into the mitochondrial matrix in Saccharomyces cerevisiae is mediated by Pic2, a mitochondrial carrier family protein.

    PubMed

    Vest, Katherine E; Leary, Scot C; Winge, Dennis R; Cobine, Paul A

    2013-08-16

    Saccharomyces cerevisiae must import copper into the mitochondrial matrix for eventual assembly of cytochrome c oxidase. This copper is bound to an anionic fluorescent molecule known as the copper ligand (CuL). Here, we identify for the first time a mitochondrial carrier family protein capable of importing copper into the matrix. In vitro transport of the CuL into the mitochondrial matrix was saturable and temperature-dependent. Strains with a deletion of PIC2 grew poorly on copper-deficient non-fermentable medium supplemented with silver and under respiratory conditions when challenged with a matrix-targeted copper competitor. Mitochondria from pic2Δ cells had lower total mitochondrial copper and exhibited a decreased capacity for copper uptake. Heterologous expression of Pic2 in Lactococcus lactis significantly enhanced CuL transport into these cells. Therefore, we propose a novel role for Pic2 in copper import into mitochondria.

  18. Electroless plating of silver nanoparticles on porous silicon for laser desorption/ionization mass spectrometry

    NASA Astrophysics Data System (ADS)

    Yan, Hong; Xu, Ning; Huang, Wen-Yi; Han, Huan-Mei; Xiao, Shou-Jun

    2009-03-01

    An improved DIOS (desorption ionization on porous silicon) method for laser desorption/ionization mass spectrometry (LDI MS) by electroless plating of silver nanoparticles (AgNPs) on porous silicon (PSi) was developed. By addition of 4-aminothiophenol (4-ATP) into the AgNO3 plating solution, the plating speed can be slowed down and simultaneously 4-ATP self-assembled monolayers (SAMs) on AgNPs (4-ATP/AgNPs) were formed. Both AgNPs and 4-ATP/AgNPs coated PSi substrates present much higher stability, sensitivity and reproducibility for LDI MS than the un-treated porous silicon ones. Their shelf life in air was tested for several weeks to a month and their mass spectra still displayed the same high quality and sensitivity as the freshly prepared ones. And more 4-ATP SAMs partly play a role of matrix to increase the ionization efficiency. A small organic molecule of tetrapyridinporphyrin (TPyP), oligomers of polyethylene glycol (PEG 400 and 2300), and a peptide of oxytocin were used as examples to demonstrate the feasibility of the silver-plated PSi as a matrix-free-like method for LDI MS. This approach can obtain limits of detection to femtomoles for TPyP, subpicomoles for oxytocin, and picomoles for PEG 400 and 2300, comparable to the traditional matrix method and much better than the DIOS method. It simplifies the sample preparation as a matrix-free-like method without addition of matrix molecules and homogenizes the sample spread over the spot for better and more even mass signals.

  19. Catalytic reduction of organic dyes at gold nanoparticles impregnated silica materials: influence of functional groups and surfactants

    NASA Astrophysics Data System (ADS)

    Azad, Uday Pratap; Ganesan, Vellaichamy; Pal, Manas

    2011-09-01

    Gold nanoparticles (Au NPs) in three different silica based sol-gel matrixes with and without surfactants are prepared. They are characterized by UV-vis absorbance and transmission electron microscopic (TEM) studies. The size and shape of Au NPs varied with the organo-functional group present in the sol-gel matrix. In the presence of mercaptopropyl functionalized organo-silica, large sized (200-280 nm) spherical Au NPs are formed whereas in the presence of aminopropyl functionalized organo-silica small sized (5-15 nm) Au NPs are formed inside the tube like organo-silica. Further, it is found that Au NPs act as efficient catalyst for the reduction of organic dyes. The catalytic rate constant is evaluated from the decrease in absorbance of the dye molecules. Presence of cationic or anionic surfactants greatly influences the catalytic reaction. The other factors like hydrophobicity of the organic dyes, complex formation of the dyes with anionic surfactants, repulsion between dyes and cationic surfactant, adsorption of dyes on the Au NPs also play important role on the reaction rate.

  20. The dual personalities of matrix metalloproteinases in inflammation.

    PubMed

    Le, Nghia T V; Xue, Meilang; Castelnoble, Laura A; Jackson, Christopher J

    2007-01-01

    Collagen, gelatin, elastin, fibronectin, proteoglycans and vitronectin are just a few proteins which form the "mesh" that holds a multicellular organism together. The matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade the extracellular matrix. Over several decades it has been clearly established that MMPs are the key molecules associated with matrix remodeling. The remodeling of this matrix is important for physiological and pathological processes such as pregnancy, wound repair, cancer and arthritis. The identification of new non-matrix MMP substrates involved in inflammation, highlights the diverse role of MMPs. These enzymes can enhance leukocyte invasion and regulate the inflammatory activity of serine proteases, cytokines and chemokines. Interestingly, the MMP family appears to have a "dual personality" in that several MMPs such as MMP-2 and -9 can favour either anti- or pro-inflammatory action, respectively. The extent of this dual functionality of MMPs is yet to be realized. Elucidating these processes may assist in the development of drugs for the treatment of inflammatory diseases such as arthritis, cancer and chronic wounds.

  1. Anion photoelectron spectroscopy of acid-base systems, solvated molecules and MALDI matrix molecules

    NASA Astrophysics Data System (ADS)

    Eustis, Soren Newman

    Gas phase, mass-selected, anion photoelectron spectroscopic studies were performed on a variety of molecular systems. These studies can be grouped into three main themes: acid-base interactions, solvation, and ions of analytical interest. Acid-base interactions represent some of the most fundamental processes in chemistry. The study of these processes elucidates elementary principles such as inner and outer sphere complexes, hard and soft ions, and salt formation---to name a few. Apart from their appeal from a pedagogical standpoint, the ubiquity of chemical reactions which involve acids, bases or the resulting salts makes the study of their fundamental interactions both necessary and fruitful. With this in mind, the neutral and anionic series (NH3···HX) (X= F, Cl, Br, I) were examined experimentally and theoretically. The relatively small size of these systems, combined with the advances in computational methods, allowed our experimental results to be compared with very high level ab initio theoretical results. The synergy between theory and experiment yielded an understanding of the nature of the complexes that could not be achieved with either method in isolation. The second theme present in this body or work is molecular solvation. Solvation is a phenomenon which is present in biology, chemistry and physics. Many biological molecules do not become 'active' until they are solvated by water. Thus, the study of biologically relevant species solvated by water is one step in a bottom up approach to studying the biochemical interactions in living organisms. Furthermore, the hydration of acidic molecules in the atmosphere is what drives the formation of 'free' protons or hydronium ions which are the key players in acid driven chemistry. Here are presented two unique solvation studies, Adenine(H2O)-n and C6F6(H2O)-n, these systems are very distinct, but show somewhat similar responses to hydration. The last theme presented in this work is the electronic properties of molecules relevant to analytical chemistry, or more specifically, Matrix Assisted Laser Desorption Interaction (MALDI) chemistry. For the first time electron affinities are presented for many of the common MALDI matrix compounds.

  2. Chondrogenic potential of physically treated bovine cartilage matrix derived porous scaffolds on human dermal fibroblast cells.

    PubMed

    Moradi, Ali; Ataollahi, Forough; Sayar, Katayoun; Pramanik, Sumit; Chong, Pan-Pan; Khalil, Alizan Abdul; Kamarul, Tunku; Pingguan-Murphy, Belinda

    2016-01-01

    Extracellular matrices have drawn attention in tissue engineering as potential biomaterials for scaffold fabrication because of their bioactive components. Noninvasive techniques of scaffold fabrication and cross-linking treatments are believed to maintain the integrity of bioactive molecules while providing proper architectural and mechanical properties. Cartilage matrix derived scaffolds are designed to support the maintenance of chondrocytes and provide proper signals for differentiation of chondroinducible cells. Chondroinductive potential of bovine articular cartilage matrix derived porous scaffolds on human dermal fibroblasts and the effect of scaffold shrinkage on chondrogenesis were investigated. An increase in sulfated glycosaminoglycans production along with upregulation of chondrogenic genes confirmed that physically treated cartilage matrix derived scaffolds have chondrogenic potential on human dermal fibroblasts. © 2015 Wiley Periodicals, Inc.

  3. Analysis of gene expression profiles in tympanic membrane following perforation using PCR Array in rats--preliminary investigation.

    PubMed

    Hassmann-Poznańska, Elżbieta; Taranta, Andrzej; Bialuk, Izabela; Poznańska, Maria; Zajączkiewicz, Hanna; Winnicka, Maria Małgorzata

    2013-10-01

    The goal of this work was to identify genes, known to be involved in the skin wound healing, that express differentially in the healthy and injured tympanic membrane (TM), and designate the molecules potentially beneficial for treatment of TM perforation. The molecular mechanisms controlling the course of TM regeneration are far from being elucidated. Twenty rats had their tympanic membranes perforated, while four served as a control. Animals were sacrificed on either days 1, 2, 3, 5 and 10 post injury, and TMs were immediately dissected and frozen in liquid nitrogen. Total TM RNA was isolated and reversely transcribed. qPCR was performed using Rat Wound Healing RT(2) Profiler PCR Array (QIAGEN) containing primers for 84 genes. Statistically significant changes in the expression of 42 genes were found in various stages of TM healing. The increased expression of genes taking part in the inflammatory reaction (interleukin 6, granulocyte and macrophage chemotactic proteins) was observed from day 2. The expression of several genes of extracellular matrix components and their remodeling enzymes was also changed. Among growth factor genes: Vegfa, Igf1 and Hbegf showed increased expression at the beginning of the healing process, while Hgf expression was highest on day 3. Several changes in the expression of genes involved in remodeling of extracellular matrix point to important role of connective tissue in TM healing. The molecules accelerating this process, like HbEGF and HGF, seem to be good candidates for further evaluation of their possible use in clinical treatment. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  4. In vitro mineralization and bone osteogenesis in poly(ε-caprolactone)/gelatin nanofibers.

    PubMed

    Alvarez Perez, Marco A; Guarino, Vincenzo; Cirillo, Valentina; Ambrosio, Luigi

    2012-11-01

    The implementation of bio-inspired strategies in developing scaffolds for the reconstruction of oral, craniofacial and bone skeletal tissues after injury or resection remains a challenge. Currently, advanced scaffolds comprising nanofibers endowed with biochemical/biophysical signaling capability offer great advantages in bone regeneration, because of their faithful mimesis of the characteristic size scales encountered in the fibrous network of the native extracellular matrix (ECM). In this study, we investigate the biological potential of nanofibers made of polycaprolactone and gelatin on guiding the regenerative mechanisms of bone. Contact angle measurements and environmental SEM investigations indicate a weak linkage of gelatin molecules to PCL chains, facilitating an efficient adhesion signal to cells up to 3 days of culture. In vitro studies performed on human mesenchymal stem cells (hMSC) until 3 weeks in culture medium with osteogenic supplementation, clearly showing the effectiveness of PCL/Gelatin electrospun scaffolds in promoting bone osteogenesis and mineralization. The increase of alkaline phosphatase activity (ALP) and gene expression of bone-related molecules (bone sialoprotein, osteopontin and osteocalcin), indicated by immunodetection and upregulation level of mRNA, confirm that proposed nanofibers promote the osteogenic differentiation of hMSC, preferentially in osteogenic medium. Moreover, the evidence of newly formed collagen fibers synthesis by SIRCOL and their mineralization evaluated by Alizarin Red staining and EDS mapping of the elements Ca, P and Mg corroborate the idea that native osteoid matrix is ultimately deposited. All these data suggest that PCL and gelatin electrospun nanofibers have great potential as osteogenesis promoting scaffolds for successful application in bone surgery. Copyright © 2012 Wiley Periodicals, Inc.

  5. Osseointegration--communication of cells.

    PubMed

    Terheyden, Hendrik; Lang, Niklaus P; Bierbaum, Susanne; Stadlinger, Bernd

    2012-10-01

    The article provides the scientific documentation for the 3D animated film - "Osseointegration - Communication of cells". The aim of this article and of the film is to visualise the molecular and cellular events during the healing of an osseous wound after installation of a dental implant with special emphasis on the process of osseointegration. In this review article for didactic reasons the concept of the four phases of a healing soft tissue wound was transferred to a bone wound after insertion of a dental implant: haemostasis, inflammatory phase, proliferative phase and remodelling phase. Wound healing throughout these phases is the result of a coordinated action of different cell types which communicate with each other by their interaction using signalling molecules like cytokines, extracellular matrix proteins and small molecules. A regular sequence of cell types controlled by adequate concentrations of signalling molecules results in undisturbed healing. Disturbed healing is associated with a continuation of the early inflammatory phase and the development of a toxic wound environment. The latter is characterized by high counts of polymorphnuclear cells, high concentrations of toxic radicals and proteolytic enzymes and low concentrations of growth factors and extracellular matrix molecules. Clinically the development of a toxic wound environment should be avoided, e.g. by antibacterial measures. Experiencing implant osseointegration as a biological process may provide the clinician new targets to improve the therapy with dental implants. © 2011 John Wiley & Sons A/S.

  6. Exploiting the spatial locality of electron correlation within the parametric two-electron reduced-density-matrix method

    NASA Astrophysics Data System (ADS)

    DePrince, A. Eugene; Mazziotti, David A.

    2010-01-01

    The parametric variational two-electron reduced-density-matrix (2-RDM) method is applied to computing electronic correlation energies of medium-to-large molecular systems by exploiting the spatial locality of electron correlation within the framework of the cluster-in-molecule (CIM) approximation [S. Li et al., J. Comput. Chem. 23, 238 (2002); J. Chem. Phys. 125, 074109 (2006)]. The 2-RDMs of individual molecular fragments within a molecule are determined, and selected portions of these 2-RDMs are recombined to yield an accurate approximation to the correlation energy of the entire molecule. In addition to extending CIM to the parametric 2-RDM method, we (i) suggest a more systematic selection of atomic-orbital domains than that presented in previous CIM studies and (ii) generalize the CIM method for open-shell quantum systems. The resulting method is tested with a series of polyacetylene molecules, water clusters, and diazobenzene derivatives in minimal and nonminimal basis sets. Calculations show that the computational cost of the method scales linearly with system size. We also compute hydrogen-abstraction energies for a series of hydroxyurea derivatives. Abstraction of hydrogen from hydroxyurea is thought to be a key step in its treatment of sickle cell anemia; the design of hydroxyurea derivatives that oxidize more rapidly is one approach to devising more effective treatments.

  7. Electrophoresis of DNA in agarose gels, polyacrylamide gels and in free solution

    PubMed Central

    Stellwagen, Nancy C.

    2009-01-01

    This review describes the electrophoresis of curved and normal DNA molecules in agarose gels, polyacrylamide gels and in free solution. These studies were undertaken to clarify why curved DNA molecules migrate anomalously slowly in polyacrylamide gels but not in agarose gels. Two milestone papers are cited, in which Ferguson plots were used to estimate the effective pore size of agarose and polyacrylamide gels. Subsequent studies on the effect of the electric field on agarose and polyacrylamide gel matrices, DNA interactions with the two gel matrices, and the effect of curvature on the free solution mobility of DNA are also described. The combined results suggest that the anomalously slow mobilities observed for curved DNA molecules in polyacrylamide gels are due primarily to preferential interactions of curved DNAs with the polyacrylamide gel matrix; the restrictive pore size of the matrix is of lesser importance. In free solution, DNA mobilities increase with increasing molecular mass until leveling off at a plateau value of (3.17 ± 0.01) × 10-4 cm2/Vs in 40 mM Tris-acetate-EDTA buffer at 20°C. Curved DNA molecules migrate anomalously slowly in free solution as well as in polyacrylamide gels, explaining why the Ferguson plots of curved and normal DNAs containing the same number of base pairs extrapolate to different mobilities at zero gel concentration. PMID:19517510

  8. Structure and photochemistry of a saccharyl thiotetrazole.

    PubMed

    Ismael, A; Borba, A; Henriques, M S C; Paixão, J A; Fausto, R; Cristiano, M L S

    2015-01-02

    The molecular structure and photochemistry of 5-thiosaccharyl-1-methyltetrazole (TSMT) were studied by means of matrix-isolation FTIR spectroscopy, X-ray crystallography, and theoretical calculations. The calculations predicted two conformers of TSMT that differ in energy by more than 15 kJ mol(-1). The infrared spectrum of TSMT isolated in solid argon was fully assigned on the basis of the spectrum calculated (O3LYP/6-311++G(3df,3pd)) for the most stable conformer. In the crystal, TSMT molecules were found to assume the same conformation as for the isolated molecule, with each molecule forming four hydrogen bonds with three neighboring molecules, leading to a network of TSMT oligomers. Upon UV (λ = 265 nm) irradiation of the matrix-isolated TSMT, two photodegradation pathways were observed, both arising from cleavage of the tetrazolyl ring. Pathway a involves cleavage of the N1-N2 and N3-N4 bonds with extrusion of N2, leading to photostable diazirine and thiocarbodiimide derivatives. The photostability of the photoproduced diazirine under the conditions used precluded its rearrangement to the nitrile imine, as reported for 5-phenyltetrazole by Bégué et al. ( J. Am. Chem. Soc. 2012 , 134 , 5339 ). Pathway b involves cleavage of the C5-N1 and N4-N3 bonds, leading to a thiocyanate and methyl azide, the latter undergoing subsequent fragmentation to give CNH.

  9. Theoretical Studies of Spectroscopic Line Mixing in Remote Sensing Applications

    NASA Technical Reports Server (NTRS)

    Ma, Q.; Boulet, C.; Tipping, R. H.

    2015-01-01

    The phenomenon of collisional transfer of intensity due to line mixing has an increasing importance for atmospheric monitoring. From a theoretical point of view, all relevant information about the collisional processes is contained in the relaxation matrix where the diagonal elements give half-widths and shifts, and the off-diagonal elements correspond to line interferences. For simple systems such as those consisting of diatom-atom or diatom-diatom, accurate fully quantum calculations based on interaction potentials are feasible. However, fully quantum calculations become unrealistic for more complex systems. On the other hand, the semi-classical Robert-Bonamy (RB) formalism, which has been widely used to calculate half-widths and shifts for decades, fails in calculating the off-diagonal matrix elements. As a result, in order to simulate atmospheric spectra where the effects from line mixing are important, semi-empirical fitting or scaling laws such as the ECS (Energy-Corrected Sudden) and IOS (Infinite-Order Sudden) models are commonly used. Recently, while scrutinizing the development of the RB formalism, we have found that these authors applied the isolated line approximation in their evaluating matrix elements of the Liouville scattering operator given in exponential form. Since the criterion of this assumption is so stringent, it is not valid for many systems of interest in atmospheric applications. Furthermore, it is this assumption that blocks the possibility to calculate the whole relaxation matrix at all. By eliminating this unjustified application, and accurately evaluating matrix elements of the exponential operators, we have developed a more capable formalism. With this new formalism, we are now able not only to reduce uncertainties for calculated half-widths and shifts, but also to remove a once insurmountable obstacle to calculate the whole relaxation matrix. This implies that we can address the line mixing with the semi-classical theory based on interaction potentials between molecular absorber and molecular perturber. We have applied this formalism to address the line mixing for Raman and infrared spectra of molecules such as N2, C2H2, CO2, NH3, and H2O. By carrying out rigorous calculations, our calculated relaxation matrices are in good agreement with both experimental data and results derived from the ECS model.

  10. Exploiting the Bioactive Properties of the Dentin-Pulp Complex in Regenerative Endodontics.

    PubMed

    Smith, Anthony J; Duncan, Henry F; Diogenes, Anibal; Simon, Stephane; Cooper, Paul R

    2016-01-01

    The development of regenerative endodontic therapies offers exciting opportunities for future improvements in treatment outcomes. Advances in our understanding of regenerative events at the molecular and cellular levels are helping to underpin development of these therapies, although the various strategies differ in the translational challenges they pose. The identification of a variety of bioactive molecules, including growth factors, cytokines, chemokines, and matrix molecules, sequestered within dentin and dental pulp provides the opportunity to present key signaling molecules promoting reparative and regenerative events after injury. The protection of the biological activity of these molecules by mineral in dentin before their release allows a continuing supply of these molecules, while avoiding the short half-life and the non-human origin of exogenous molecules. The ready release of these bioactive molecules by the various tissue preparation agents, medicaments, and materials commonly used in endodontics highlights the opportunities for translational regenerative strategies exploiting these molecules with little change to existing clinical practice. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  11. Method and Apparatus for Detecting and Quantifying Bacterial Spores on a Surface

    NASA Technical Reports Server (NTRS)

    Ponce, Adrian (Inventor)

    2017-01-01

    A method and an apparatus for detecting and quantifying bacterial spores on a surface. In accordance with the method: a matrix including lanthanide ions is provided on the surface containing the bacterial spores; functionalized aromatic molecules are released from the bacterial spores on the surface; a complex of the lanthanide ion and the aromatic molecule is formed on the surface; the complex of the lanthanide ion and the aromatic molecule is excited to generate a characteristic luminescence of the complex on the surface; and the bacterial spores exhibiting the luminescence of the complex on the surface are detected and quantified.

  12. Method and apparatus for detecting and quantifying bacterial spores on a surface

    NASA Technical Reports Server (NTRS)

    Ponce, Adrian (Inventor)

    2009-01-01

    A method and an apparatus for detecting and quantifying bacterial spores on a surface. In accordance with the method: a matrix including lanthanide ions is provided on the surface containing the bacterial spores; functionalized aromatic molecules are released from the bacterial spores on the surface; a complex of the lanthanide ion and the aromatic molecule is formed on the surface; the complex of the lanthanide ion and the aromatic molecule is excited to generate a characteristic luminescence of the complex on the surface; and the bacterial spores exhibiting the luminescence of the complex on the surface are detected and quantified.

  13. Self-healing of optical functions by molecular metabolism in a swollen elastomer

    NASA Astrophysics Data System (ADS)

    Saito, Mitsunori; Nishimura, Tatsuya; Sakiyama, Kohei; Inagaki, Sota

    2012-12-01

    Optical functions of organic dyes, e.g., fluorescence or photochromism, tend to degrade by light irradiation, which causes a short lifetime of photonic devices. Self-healing of optical functions is attainable by metabolizing bleached molecules with nonirradiated ones. A polydimethylsiloxane elastomer provides a useful matrix for dye molecules, since its flexible structure with nano-sized intermolecular spaces allows dye diffusion from a reservoir to an operation region. Swelling the elastomer with a suitable solvent promotes both dissolution and diffusion of dye molecules. This self-healing function was demonstrated by an experiment in which a photochromic elastomer exhibited improved durability against a repeated coloring-decoloring process.

  14. Pulsed radiolysis of model aromatic polymers and epoxy based matrix materials

    NASA Technical Reports Server (NTRS)

    Gupta, A.; Moacanin, J.; Liang, R.; Coulter, D.

    1982-01-01

    Models of primary processes leading to deactivation of energy deposited by a pulse of high energy electrons were derived for epoxy matrix materials and polyl-vinyl naphthalene. The basic conclusion is that recombination of initially formed charged states is complete within 1 nanosecond, and subsequent degradation chemistry is controlled by the reactivity of these excited states. Excited states in both systems form complexes with ground state molecules. These excimers or exciplexes have their characteristics emissive and absorptive properties and may decay to form separated pairs of ground state molecules, cross over to the triplet manifold or emit fluorescence. ESR studies and chemical analyses subsequent to pulse radiolysis were performed in order to estimate bond cleavage probabilities and net reaction rates. The energy deactivation models which were proposed to interpret these data have led to the development of radiation stabilization criteria for these systems.

  15. Determining partial differential cross sections for low-energy electron photodetachment involving conical intersections using the solution of a Lippmann-Schwinger equation constructed with standard electronic structure techniques.

    PubMed

    Han, Seungsuk; Yarkony, David R

    2011-05-07

    A method for obtaining partial differential cross sections for low energy electron photodetachment in which the electronic states of the residual molecule are strongly coupled by conical intersections is reported. The method is based on the iterative solution to a Lippmann-Schwinger equation, using a zeroth order Hamiltonian consisting of the bound nonadiabatically coupled residual molecule and a free electron. The solution to the Lippmann-Schwinger equation involves only standard electronic structure techniques and a standard three-dimensional free particle Green's function quadrature for which fast techniques exist. The transition dipole moment for electron photodetachment, is a sum of matrix elements each involving one nonorthogonal orbital obtained from the solution to the Lippmann-Schwinger equation. An expression for the electron photodetachment transition dipole matrix element in terms of Dyson orbitals, which does not make the usual orthogonality assumptions, is derived.

  16. In silico modelling of apoptosis induced by photodynamic therapy.

    PubMed

    López-Marín, N; Mulet, R

    2018-01-07

    Photodynamic therapy (PDT) is an emergent technique used for the treatment of several diseases. After PDT, cells die by necrosis, apoptosis or autophagy. Necrosis is produced immediately during photodynamic therapy by high concentration of reactive oxygen species, apoptosis and autophagy are triggered by mild or low doses of light and photosensitizer. In this work we model the cell response to low doses of PDT assuming a bi-dimensional matrix of interacting cells. For each cell of the matrix we simulate in detail, with the help of the Gillespie's algorithm, the two main chemical pathways leading to apoptosis. We unveil the role of both pathways in the cell death rate of the tumor, as well as the relevance of several molecules in the process. Our model suggests values of concentrations for several species of molecules to enhance the effectiveness of PDT. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Calculation of the vibration-rotational transition intensities of water molecules trapped in an argon matrix: stretching O-H vibrations spectral region

    NASA Astrophysics Data System (ADS)

    Pitsevich, George; Shalamberidze, Elena; Malevich, Alex; Sablinskas, Valdas; Balevicius, Vytautas; Pettersson, Lars G. M.

    2017-10-01

    The frequencies and intensities of vibration-rotational transitions of water molecules in an argon matrix were calculated for temperatures of 6 and 30 K. The rigid asymmetric top approximation was used with available literature values of the effective rotational constants in the ground and excited vibrational states. The calculations were carried out by taking into account the existence of a non-equilibrium population distribution between the rotational levels of ortho- and para-water isomers. It was assumed that the temperature relaxation of the population of rotational levels is independent of the ortho- and para-isomers. Comparison of the results of the theoretical calculations with experimental literature data shows good agreement for the majority of the rotational structure lines for symmetric and antisymmetric stretching vibrations both in the frequency values and in the values of the relative intensities.

  18. Extracellular matrix as a solid-state regulator in angiogenesis: identification of new targets for anti-cancer therapy

    NASA Technical Reports Server (NTRS)

    Ingber, D. E.

    1992-01-01

    Angiogenesis, the growth of blood capillaries, is regulated by soluble growth factors and insoluble extracellular matrix (ECM) molecules. Soluble angiogenic mitogens act over large distances to initiate capillary growth whereas changes in ECM govern whether individual cells will grow, differentiate, or involute in response to these stimuli in the local tissue microenvironment. Analysis of this local control mechanism has revealed that ECM molecules switch capillary endothelial cells between differentiation and growth by both binding specific transmembrane integrin receptors and physically resisting cell-generated mechanical loads that are applied to these receptors. Control of capillary endothelial cell form and function therefore may be exerted by altering the mechanical properties of the ECM as well as its chemical composition. Understanding of this mechanochemical control mechanism has led to the development of new angiogenesis inhibitors that may be useful for the treatment of cancer.

  19. Robust validation of approximate 1-matrix functionals with few-electron harmonium atoms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cioslowski, Jerzy, E-mail: jerzy@wmf.univ.szczecin.pl; Piris, Mario; Matito, Eduard

    2015-12-07

    A simple comparison between the exact and approximate correlation components U of the electron-electron repulsion energy of several states of few-electron harmonium atoms with varying confinement strengths provides a stringent validation tool for 1-matrix functionals. The robustness of this tool is clearly demonstrated in a survey of 14 known functionals, which reveals their substandard performance within different electron correlation regimes. Unlike spot-testing that employs dissociation curves of diatomic molecules or more extensive benchmarking against experimental atomization energies of molecules comprising some standard set, the present approach not only uncovers the flaws and patent failures of the functionals but, even moremore » importantly, also allows for pinpointing their root causes. Since the approximate values of U are computed at exact 1-densities, the testing requires minimal programming and thus is particularly suitable for rapid screening of new functionals.« less

  20. Recruitment of dental pulp cells by dentine and pulp extracellular matrix components.

    PubMed

    Smith, J G; Smith, A J; Shelton, R M; Cooper, P R

    2012-11-01

    The present study aimed to determine whether dentine tissue and preparations of extracellular matrix (ECM) from pulp (pECM) and dentine (dECM), and breakdown products, influenced pulp cell migration. Chemotaxis transwell and agarose spot assays demonstrated that both dentine and pulp ECM molecules acted as chemoattractants for primary pulp cells. Chemoattractant activities of dECM and pECM were enhanced when subjected to acid and enzymatic breakdown, respectively. This enhanced activity following physiologically relevant breakdown may be pertinent to the disease environment. Pulp cell migration in response to dental ECMs was dependent on an active rho pathway. Recruited cells exhibited increased stem cell marker expression indicating that dental ECMs and their breakdown products selectively attract progenitor cells that contribute to repair processes. In conclusion, combined these results indicate that ECM molecules contribute to cell recruitment necessary for regeneration of the dentine-pulp complex after injury. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Efficient photochemistry of coronene:water complexes

    NASA Astrophysics Data System (ADS)

    Noble, J. A.; Jouvet, C.; Aupetit, C.; Moudens, A.; Mascetti, J.

    2017-03-01

    The photochemistry of ices with polycyclic aromatic hydrocarbons (PAHs) has been extensively studied, but to date no investigation has been made of PAHs in interaction with low numbers (n< 4) of molecules of water. We performed photochemical matrix isolation studies of coronene:water complexes, probing the argon matrix with FTIR spectroscopy. We find that coronene readily reacts with water upon irradiation with a mercury vapour lamp to produce oxygenated PAH photoproducts, and we postulate a reaction mechanism via a charge transfer Rydberg state. This result suggests that oxygenated PAHs should be widely observed in regions of the ISM with sufficiently high water abundances, for example near the edges of molecular clouds where water molecules begin to form, but before icy layers are observed, that is at AV< 3. In order to explain the low derived observational abundances of oxygenated PAHs, additional destruction routes must be invoked.

  2. Mixed quantum/classical theory of rotationally and vibrationally inelastic scattering in space-fixed and body-fixed reference frames

    NASA Astrophysics Data System (ADS)

    Semenov, Alexander; Babikov, Dmitri

    2013-11-01

    We formulated the mixed quantum/classical theory for rotationally and vibrationally inelastic scattering process in the diatomic molecule + atom system. Two versions of theory are presented, first in the space-fixed and second in the body-fixed reference frame. First version is easy to derive and the resultant equations of motion are transparent, but the state-to-state transition matrix is complex-valued and dense. Such calculations may be computationally demanding for heavier molecules and/or higher temperatures, when the number of accessible channels becomes large. In contrast, the second version of theory requires some tedious derivations and the final equations of motion are rather complicated (not particularly intuitive). However, the state-to-state transitions are driven by real-valued sparse matrixes of much smaller size. Thus, this formulation is the method of choice from the computational point of view, while the space-fixed formulation can serve as a test of the body-fixed equations of motion, and the code. Rigorous numerical tests were carried out for a model system to ensure that all equations, matrixes, and computer codes in both formulations are correct.

  3. PEGylation of a Maltose Biosensor Promotes Enhanced Signal Response

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dattelbaum, Andrew; Baker, Gary A; Fox, John M

    2009-01-01

    A robust method to immobilize a maltose biosensor is described using an engineered maltose periplasmic binding protein (PBP) covalently coupled to NBDamide, an environmentally sensitive fluorophore. A mesoporous silica sol-gel derived from diglycerylsilane (DGS) was constructed to embed the maltose biosensor, and the ligand reporting fluorescence properties were meas red. When sequestered in the DGS-derived silica matrix, the biosensor retained maltose-dependent fluorescence sensing capability with micromolar affinity, which is consistent with the protein free in solution. The MBP-NBD conjugate was further modified by covalent conjugation with poly(ethylene glycol)-5000 (PEG) to promote the retention of water molecules around the protein andmore » to reduce possible steric effects between the silica matrix and protein. Bioconjugation with PEG molecules does not significantly affect the signaling response of the protein in solution. When immobilized in the DGS polymer, a consistent increase in fluorescence intensity was observed as compared to the protein not functionalized with PEG. To our knowledge, this report presents the first successful method to embed a PBP biosensor in a polymerized matrix and retain signaling response using an environmentally sensitive probe. The immobilization method presented here should be easily adaptable to all conformation-dependent biosensors.« less

  4. The Dimer Interface of the Membrane Type 1 Matrix Metalloproteinase Hemopexin Domain

    PubMed Central

    Tochowicz, Anna; Goettig, Peter; Evans, Richard; Visse, Robert; Shitomi, Yasuyuki; Palmisano, Ralf; Ito, Noriko; Richter, Klaus; Maskos, Klaus; Franke, Daniel; Svergun, Dmitri; Nagase, Hideaki; Bode, Wolfram; Itoh, Yoshifumi

    2011-01-01

    Homodimerization is an essential step for membrane type 1 matrix metalloproteinase (MT1-MMP) to activate proMMP-2 and to degrade collagen on the cell surface. To uncover the molecular basis of the hemopexin (Hpx) domain-driven dimerization of MT1-MMP, a crystal structure of the Hpx domain was solved at 1.7 Å resolution. Two interactions were identified as potential biological dimer interfaces in the crystal structure, and mutagenesis studies revealed that the biological dimer possesses a symmetrical interaction where blades II and III of molecule A interact with blades III and II of molecule B. The mutations of amino acids involved in the interaction weakened the dimer interaction of Hpx domains in solution, and incorporation of these mutations into the full-length enzyme significantly inhibited dimer-dependent functions on the cell surface, including proMMP-2 activation, collagen degradation, and invasion into the three-dimensional collagen matrix, whereas dimer-independent functions, including gelatin film degradation and two-dimensional cell migration, were not affected. These results shed light on the structural basis of MT1-MMP dimerization that is crucial to promote cellular invasion. PMID:21193411

  5. Imaging of Endogenous Metabolites of Plant Leaves by Mass Spectrometry Based on Laser Activated Electron Tunneling.

    PubMed

    Huang, Lulu; Tang, Xuemei; Zhang, Wenyang; Jiang, Ruowei; Chen, Disong; Zhang, Juan; Zhong, Hongying

    2016-04-07

    A new mass spectrometric imaging approach based on laser activated electron tunneling (LAET) was described and applied to analysis of endogenous metabolites of plant leaves. LAET is an electron-directed soft ionization technique. Compressed thin films of semiconductor nanoparticles of bismuth cobalt zinc oxide were placed on the sample plate for proof-of-principle demonstration because they can not only absorb ultraviolet laser but also have high electron mobility. Upon laser irradiation, electrons are excited from valence bands to conduction bands. With appropriate kinetic energies, photoexcited electrons can tunnel away from the barrier and eventually be captured by charge deficient atoms present in neutral molecules. Resultant unpaired electron subsequently initiates specific chemical bond cleavage and generates ions that can be detected in negative ion mode of the mass spectrometer. LAET avoids the co-crystallization process of routinely used organic matrix materials with analyzes in MALDI (matrix assisted-laser desorption ionization) analysis. Thus uneven distribution of crystals with different sizes and shapes as well as background peaks in the low mass range resulting from matrix molecules is eliminated. Advantages of LAET imaging technique include not only improved spatial resolution but also photoelectron capture dissociation which produces predictable fragment ions.

  6. The dimer interface of the membrane type 1 matrix metalloproteinase hemopexin domain: crystal structure and biological functions.

    PubMed

    Tochowicz, Anna; Goettig, Peter; Evans, Richard; Visse, Robert; Shitomi, Yasuyuki; Palmisano, Ralf; Ito, Noriko; Richter, Klaus; Maskos, Klaus; Franke, Daniel; Svergun, Dmitri; Nagase, Hideaki; Bode, Wolfram; Itoh, Yoshifumi

    2011-03-04

    Homodimerization is an essential step for membrane type 1 matrix metalloproteinase (MT1-MMP) to activate proMMP-2 and to degrade collagen on the cell surface. To uncover the molecular basis of the hemopexin (Hpx) domain-driven dimerization of MT1-MMP, a crystal structure of the Hpx domain was solved at 1.7 Å resolution. Two interactions were identified as potential biological dimer interfaces in the crystal structure, and mutagenesis studies revealed that the biological dimer possesses a symmetrical interaction where blades II and III of molecule A interact with blades III and II of molecule B. The mutations of amino acids involved in the interaction weakened the dimer interaction of Hpx domains in solution, and incorporation of these mutations into the full-length enzyme significantly inhibited dimer-dependent functions on the cell surface, including proMMP-2 activation, collagen degradation, and invasion into the three-dimensional collagen matrix, whereas dimer-independent functions, including gelatin film degradation and two-dimensional cell migration, were not affected. These results shed light on the structural basis of MT1-MMP dimerization that is crucial to promote cellular invasion.

  7. Role of tumor–host interactions in interstitial diffusion of macromolecules: Cranial vs. subcutaneous tumors

    PubMed Central

    Pluen, Alain; Boucher, Yves; Ramanujan, Saroja; McKee, Trevor D.; Gohongi, Takeshi; di Tomaso, Emmanuelle; Brown, Edward B.; Izumi, Yotaro; Campbell, Robert B.; Berk, David A.; Jain, Rakesh K.

    2001-01-01

    The large size of many novel therapeutics impairs their transport through the tumor extracellular matrix and thus limits their therapeutic effectiveness. We propose that extracellular matrix composition, structure, and distribution determine the transport properties in tumors. Furthermore, because the characteristics of the extracellular matrix largely depend on the tumor–host interactions, we postulate that diffusion of macromolecules will vary with tumor type as well as anatomical location. Diffusion coefficients of macromolecules and liposomes in tumors growing in cranial windows (CWs) and dorsal chambers (DCs) were measured by fluorescence recovery after photobleaching. For the same tumor types, diffusion of large molecules was significantly faster in CW than in DC tumors. The greater diffusional hindrance in DC tumors was correlated with higher levels of collagen type I and its organization into fibrils. For molecules with diameters comparable to the interfibrillar space the diffusion was 5- to 10-fold slower in DC than in CW tumors. The slower diffusion in DC tumors was associated with a higher density of host stromal cells that synthesize and organize collagen type I. Our results point to the necessity of developing site-specific drug carriers to improve the delivery of molecular medicine to solid tumors. PMID:11274375

  8. Enzyme-coupled nanoparticles-assisted laser desorption ionization mass spectrometry for searching for low-mass inhibitors of enzymes in complex mixtures.

    PubMed

    Salwiński, Aleksander; Da Silva, David; Delépée, Raphaël; Maunit, Benoît

    2014-04-01

    In this report, enzyme-coupled magnetic nanoparticles (EMPs) were shown to be an effective affinity-based tool for finding specific interactions between enzymatic targets and the low-mass molecules in complex mixtures using classic MALDI-TOF apparatus. EMPs used in this work act as nonorganic matrix enabling ionization of small molecules without any interference in the low-mass range (enzyme-coupled nanoparticles-assisted laser desorption ionization MS, ENALDI MS) and simultaneously carry the superficial specific binding sites to capture inhibitors present in a studied mixture. We evaluated ENALDI approach in two complementary variations: 'ion fading' (IF-ENALDI), based on superficial adsorption of inhibitors and 'ion hunting' (IH-ENALDI), based on selective pre-concentration of inhibitors. IF-ENALDI was applied for two sets of enzyme-inhibitor pairs: tyrosinase-glabridin and trypsin-leupeptin and for the real plant sample: Sparrmannia discolor leaf and stem methanol extract. The efficacy of IH-ENALDI was shown for the pair of trypsin-leupeptin. Both ENALDI approaches pose an alternative for bioassay-guided fractionation, the common method for finding inhibitors in the complex mixtures.

  9. Fish skin as a model membrane: structure and characteristics.

    PubMed

    Konrádsdóttir, Fífa; Loftsson, Thorsteinn; Sigfússon, Sigurdur Dadi

    2009-01-01

    Synthetic and cell-based membranes are frequently used during drug formulation development for the assessment of drug availability. However, most of the currently used membranes do not mimic mucosal membranes well, especially the aqueous mucous layer of the membranes. In this study we evaluated catfish (Anarichas lupus L) skin as a model membrane. Permeation of hydrocortisone, lidocaine hydrochloride, benzocaine, diethylstilbestrol, naproxen, picric acid and sodium nitrate through skin from a freshly caught catfish was determined in Franz diffusion cells. Both lipophilic and hydrophilic molecules permeate through catfish skin via hydrated channels or aqueous pores. No correlation was observed between the octanol/water partition coefficient of the permeating molecules and their permeability coefficient through the skin. Permeation through catfish skin was found to be diffusion controlled. The results suggest that permeation through the fish skin proceeds via a diffusion-controlled process, a process that is similar to drug permeation through the aqueous mucous layer of a mucosal membrane. In addition, the fish skin, with its collagen matrix structure, appears to possess similar properties to the eye sclera.

  10. Neutral Mass Spectrometry of Mega-Dalton Particles with Single-Particle Resolution using a Nano-Electromechanical System

    NASA Astrophysics Data System (ADS)

    Kelber, Scott; Hanay, Mehmet; Naik, Akshay; Chi, Derrick; Hentz, Sebastien; Bullard, Caryn; Collinet, Eric; Duraffourg, Laurent; Roukes, Michael

    2012-02-01

    Nanoelectromechanical systems (NEMS) enable mass sensing with unprecedented sensitivity and mass dynamic range. Previous works have relied on statistical analysis of multiple landing events to assemble mass spectra. Here we demonstrate the utility of using multiple modes of the NEMS device in determining the mass of individual molecules landing on the NEMS. Analyte particles in vapor form are produced using matrix assisted laser desorption ionization. Resonant frequencies of the first two modes of a single NEMS device, placed in close proximity to the analyte source, are tracked using parallel phase locked loops. Each analyte molecule landing on the NEMS generates a distinct frequency shift in the two modes. These time correlated frequency jumps are used to evaluate the mass of each analyte particle landing on the NEMS and thus generate mass spectra. We present the latest experimental results using this scheme and also demonstrate the utility for mass spectrometry of large biomolecules. This NEMS-Mass Spec. system offers a new tool for structural biology and pathology for the analysis of large proteins, protein complexes, and viruses.

  11. Non-traditional applications of laser desorption/ionization mass spectrometry

    NASA Astrophysics Data System (ADS)

    McAlpin, Casey R.

    Seven studies were carried out using laser desorption/ionization mass spectrometry (LDI MS) to develop enhanced methodologies for a variety of analyte systems by investigating analyte chemistries, ionization processes, and elimination of spectral interferences. Applications of LDI and matrix assisted laser/desorption/ionization (MALDI) have been previously limited by poorly understood ionization phenomena, and spectral interferences from matrices. Matrix assisted laser desorption ionization MS is well suited to the analysis of proteins. However, the proteins associated with bacteriophages often form complexes which are too massive for detection with a standard MALDI mass spectrometer. As such, methodologies for pretreatment of these samples are discussed in detail in the first chapter. Pretreatment of bacteriophage samples with reducing agents disrupted disulfide linkages and allowed enhanced detection of bacteriophage proteins. The second chapter focuses on the use of MALDI MS for lipid compounds whose molecular mass is significantly less than the proteins for which MALDI is most often applied. The use of MALDI MS for lipid analysis presented unique challenges such as matrix interference and differential ionization efficiencies. It was observed that optimization of the matrix system, and addition of cationization reagents mitigated these challenges and resulted in an enhanced methodology for MALDI MS of lipids. One of the challenges commonly encountered in efforts to expand MALDI MS applications is as previously mentioned interferences introduced by organic matrix molecules. The third chapter focuses on the development of a novel inorganic matrix replacement system called metal oxide laser ionization mass spectrometry (MOLI MS). In contrast to other matrix replacements, considerable effort was devoted to elucidating the ionization mechanism. It was shown that chemisorption of analytes to the metal oxide surface produced acidic adsorbed species which then protonated free analyte molecules. Expanded applications of MOLI MS were developed following description of the ionization mechanism. A series of experiments were carried out involving treatment of metal oxide surfaces with reagent molecules to expand MOLI MS and develop enhanced MOLI MS methodologies. It was found that treatment of the metal oxide surface with a small molecule to act as a proton source expanded MOLI MS to analytes which did not form acidic adsorbed species. Proton-source pretreated MOLI MS was then used for the analysis of oils obtained from the fast, anoxic pyrolysis of biomass (py-oil). These samples are complex and produce MOLI mass spectra with many peaks. In this experiment, methods of data reduction including Kendrick mass defects and nominal mass z*-scores, which are commonly used for the study of petroleum fractions, were used to interpret these spectra and identify the major constituencies of py-oils. Through data reduction and collision induced dissociation (CID), homologous series of compounds were rapidly identified. The final chapter involves using metal oxides to catalytically cleave the ester linkage on lipids containing fatty acids in addition to ionization. The cleavage process results in the production of spectra similar to those observed with saponification/methylation. Fatty acid profiles were generated for a variety of micro-organisms to differentiate between bacterial species. (Abstract shortened by UMI.)

  12. Short-term administration of small molecule phenamil induced a protracted osteogenic effect on osteoblast-like MC3T3-E1 cells.

    PubMed

    Lo, Kevin W-H; Kan, Ho Man; Laurencin, Cato T

    2016-06-01

    Sustained administration (21-day treatment) of the small molecule phenamil has been proposed as an alternative osteogenic factor when used in conjunction with a biodegradable scaffold for in vitro osteogenesis. While promising, the major issue associated with small molecules is non-specific cytotoxicity. The aim of this study was to minimize the side-effects from small-molecule drugs by reducing the frequency of administration. Toward this goal, we investigated whether a shorter phenamil treatment is sufficient to induce in vitro osteogenesis. We compared the effects of short-term (12 h) and continuous treatments of phenamil on osteoblastic differentiation and mineralization. Alkaline phosphatase (ALP) and osteopontin (OPN) activity were used as markers for osteoblastic differentiation. Measurement of the calcium content of the extracellular matrix was used as the hallmark for in vitro bone formation after 21 days of culture. Our findings revealed that both short and continuous phenamil treatment triggers osteoblastic differentiation and mineralization of MC3T3-E1 cells on a biodegradable polymeric scaffold composed of polylactic-co-glycolic acid (PLAGA) at the same time points. In addition, in order to fabricate a phenamil-loaded PLAGA scaffold, the small molecule phenamil was physically absorbed onto the surface of scaffolds and the bioactivity of the loaded scaffolds was evaluated. Furthermore, biochemical analysis indicated that short phenamil treatment of cells was accompanied by upregulation in protein expression of integrin α5, p125(FAK) and phosphorylation of CREB. These effects may contribute to the downstream signalling cascade necessary for osteogenesis, and such responses may account for our observed protracted osteogenic differentiation in vitro. Copyright © 2013 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  13. Aggrecan-Like Biomimetic Proteoglycans (BPGs) Composed of Natural Chondroitin Sulfate Bristles Grafted onto Poly(acrylic acid) Core for Molecular Engineering of the Extracellular Matrix.

    PubMed

    Prudnikova, K; Lightfoot Vidal, S E; Sarkar, S; Yu, T; Yucha, R W; Ganesh, N; Penn, L S; Han, L; Schauer, C L; Vresilovic, E J; Marcolongo, M S

    2018-05-10

    Biomimetic proteoglycans (BPGs) were designed to mimic the three-dimensional (3D) bottlebrush architecture of natural extracellular matrix (ECM) proteoglycans, such as aggrecan. BPGs were synthesized by grafting native chondroitin sulfate bristles onto a synthetic poly(acrylic acid) core to form BPGs at a molecular weight of approximately ∼1.6 MDa. The aggrecan mimics were characterized chemically, physically, and structurally, confirming the 3D bottlebrush architecture as well as a level of water uptake, which is greater than that of the natural proteoglycan, aggrecan. Aggrecan mimics were cytocompatible at physiological concentrations. Fluorescently labeled BPGs were injected into the nucleus pulposus of the intervertebral disc ex vivo and were retained in tissue before and after static loading and equilibrium conditioning. BPGs infiltrated the tissue, distributed and integrated with the ECM on a molecular scale, in the absence of a bolus, thus demonstrating a new molecular approach to tissue repair: molecular matrix engineering. Molecular matrix engineering may compliment or offer an acellular alternative to current regenerative medicine strategies. Aggrecan is a natural biomolecule that is essential for connective tissue hydration and mechanics. Aggrecan is composed of negatively charged chondroitin sulfate bristles attached to a protein core in a bottlebrush configuration. With age and degeneration, enzymatic degradation of aggrecan outpaces cellular synthesis resulting in a loss of this important molecule. We demonstrate a novel biomimetic molecule composed of natural chondroitin sulfate bristles grafted onto an enzymatically-resistant synthetic core. Our molecule mimics a 3D architecture and charge density of the natural aggrecan, can be delivered via a simple injection and is retained in tissue after equilibrium conditioning and loading. This novel material can serve as a platform for molecular repair, drug delivery and tissue engineering in regenerative medicine approaches. Copyright © 2018. Published by Elsevier Ltd.

  14. A potential application to the study of microscopic energy deposition in a solid by means of heavy charged-particle induced photochromic alterations in a tissue-equivalent matrix

    NASA Astrophysics Data System (ADS)

    Emfietzoglou, D.; Moscovitch, M.

    1999-01-01

    A theoretical study was carried out to investigate the feasibility of using the radiation-induced colour decay of photochromic molecules embedded in a polymer matrix as a probe for studying the microscopic energy deposition of heavy charged particles (HCPs) in a tissue-equivalent solid. The theoretical treatment makes use of the radial dose distribution function as derived from gas-phase physics, together with the effects of the increase in temperature and of matrix degradation on the colour-decay kinetics of the photochromic molecules, according to empirical models derived for the solid state. Bearing in mind the non-stochastic nature of the model, the use of gas-phase physics at the level of radiation interaction, and the fact that some empirical quantities used have been established macroscopically, all factors which signify that extra caution is required in the interpretation of the results, it is shown that when the optimum information retrieval time (after track formation) is considered the technique may be able to resolve differences in the energy deposition pattern by different HCPs in the nanometre range (1-10 nm; material's mass density ) from the track axis. Most importantly, though, the present study aims to erect a theoretical framework for the possible application of the technique and to highlight those aspects which are likely to be critical to its practical usage, such as particle type and energy range, and spatial scale and magnitude of the expected effect together with its dependence on time, the physical characteristics of the matrix, and the kinetic behaviour of the type of photochromic molecule studied. Furthermore, it establishes a rationale for interpreting the experimentally observed (if available) colour changes in the HCP track in terms of the microscopic distribution of energy deposition in it.

  15. Matrix photochemistry of small molecules: Influencing reaction dynamics on electronically excited hypersurfaces

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Laursen, S.L.

    Investigations of chemical reactions on electronically excited reaction surfaces are presented. The role of excited-surface multiplicity is of particular interest, as are chemical reactivity and energy transfer in systems in which photochemistry is initiated through a metal atom sensitizer.'' Two approaches are employed: A heavy-atom matrix affords access to forbidden triplet reaction surfaces, eliminating the need for a potentially reactive sensitizer. Later, the role of the metal atom in the photosensitization process is examined directly.

  16. Atmospheric trace gas analysis using matrix isolation-Fourier Transform Infrared Spectroscopy

    NASA Astrophysics Data System (ADS)

    Griffith, David W. T.; Schuster, Gerhard

    1987-03-01

    A novel cryogenic sampling method combining the matrix isolation technique with FTIR spectroscopy has been developed for atmospheric trace gas analysis. It is applicable to a wide range of molecules with detection limits typically in the 10-50 ppt range. The method is described along with some measurements of N2O, CFCl3, CF2Cl2, OCS, CS2, SO2 and PAN from samples collected at ground level and from an aircraft between 9 and 14 km.

  17. Adinkras from ordered quartets of BC4 Coxeter group elements and regarding 1,358,954,496 matrix elements of the Gadget

    NASA Astrophysics Data System (ADS)

    Gates, S. James; Guyton, Forrest; Harmalkar, Siddhartha; Kessler, David S.; Korotkikh, Vadim; Meszaros, Victor A.

    2017-06-01

    We examine values of the Adinkra Holoraumy-induced Gadget representation space metric over all possible four-color, four-open node, and four-closed node adinkras. Of the 1,358,954,496 gadget matrix elements, only 226,492,416 are non-vanishing and take on one of three values: -1/3, 1/3, or 1 and thus a subspace isomorphic to a description of a body-centered tetrahedral molecule emerges.

  18. MALDI matrices for low molecular weight compounds: an endless story?

    PubMed

    Calvano, Cosima Damiana; Monopoli, Antonio; Cataldi, Tommaso R I; Palmisano, Francesco

    2018-04-23

    Since its introduction in the 1980s, matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS) has gained a prominent role in the analysis of high molecular weight biomolecules such as proteins, peptides, oligonucleotides, and polysaccharides. Its application to low molecular weight compounds has remained for long time challenging due to the spectral interferences produced by conventional organic matrices in the low m/z window. To overcome this problem, specific sample preparation such as analyte/matrix derivatization, addition of dopants, or sophisticated deposition technique especially useful for imaging experiments, have been proposed. Alternative approaches based on second generation (rationally designed) organic matrices, ionic liquids, and inorganic matrices, including metallic nanoparticles, have been the object of intense and continuous research efforts. Definite evidences are now provided that MALDI MS represents a powerful and invaluable analytical tool also for small molecules, including their quantification, thus opening new, exciting applications in metabolomics and imaging mass spectrometry. This review is intended to offer a concise critical overview of the most recent achievements about MALDI matrices capable of specifically address the challenging issue of small molecules analysis. Graphical abstract An ideal Book of matrices for MALDI MS of small molecules.

  19. Mesoscopic Rigid Body Modelling of the Extracellular Matrix Self-Assembly.

    PubMed

    Wong, Hua; Prévoteau-Jonquet, Jessica; Baud, Stéphanie; Dauchez, Manuel; Belloy, Nicolas

    2018-06-11

    The extracellular matrix (ECM) plays an important role in supporting tissues and organs. It even has a functional role in morphogenesis and differentiation by acting as a source of active molecules (matrikines). Many diseases are linked to dysfunction of ECM components and fragments or changes in their structures. As such it is a prime target for drugs. Because of technological limitations for observations at mesoscopic scales, the precise structural organisation of the ECM is not well-known, with sparse or fuzzy experimental observables. Based on the Unity3D game and physics engines, along with rigid body dynamics, we propose a virtual sandbox to model large biological molecules as dynamic chains of rigid bodies interacting together to gain insight into ECM components behaviour in the mesoscopic range. We have preliminary results showing how parameters such as fibre flexibility or the nature and number of interactions between molecules can induce different structures in the basement membrane. Using the Unity3D game engine and virtual reality headset coupled with haptic controllers, we immerse the user inside the corresponding simulation. Untrained users are able to navigate a complex virtual sandbox crowded with large biomolecules models in a matter of seconds.

  20. Chapter 4. Cytomechanics of hair basics of the mechanical stability.

    PubMed

    Popescu, Crisan; Höcker, Hartwig

    2009-01-01

    Hair is a complex "cornified" multicellular tissue composed of cuticle and cortex cells mechanically acting as a whole. The cuticle cells overlap and cortex cells interdigitate, all cells being composed of different morphological elements and separated by the cell membrane complex (CMC). The CMC and the morphological elements of the cortex cells, the macrofibrils, composed of microfibrils or intermediate filaments (IFs), and the intermacrofibrillar and intermicrofibrillar cement or the amorphous matrix material determine the mechanical properties of hair. The IFs consist of alpha-keratin molecules being arranged in a sophisticated way of two parallel monomers and antiparallel and shifted dimers rationalized by the amino acid composition and sequence. The mechanical properties of hair result from mechanical interlocking effects, hydrophobic effects, hydrogen bridges, Coulombic interactions, and (covalent) isodipeptide and, in particular, disulfide bridges on a molecular level. The mechanical models applied to hair are based on a simple two-component system, the microfibril/matrix structure. An important regime of the stress-strain curve is the transition of the molecules of the microfibrils from the alpha-helical to the beta-sheet structure. Due to the longitudinal orientation of the IF molecules the longitudinal swelling of the fibers in water is negligible, the radial swelling, however, is substantial.

  1. Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

    PubMed Central

    Cankar, Katarina; Štebih, Dejan; Dreo, Tanja; Žel, Jana; Gruden, Kristina

    2006-01-01

    Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary criterion by which to evaluate the quality and performance on different matrixes and extraction techniques. The effect of PCR efficiency on the resulting GMO content is demonstrated. Conclusion The crucial influence of extraction technique and sample matrix properties on the results of GMO quantification is demonstrated. Appropriate extraction techniques for each matrix need to be determined to achieve accurate DNA quantification. Nevertheless, as it is shown that in the area of food and feed testing matrix with certain specificities is impossible to define strict quality controls need to be introduced to monitor PCR. The results of our study are also applicable to other fields of quantitative testing by real-time PCR. PMID:16907967

  2. Circulating matrix modulators (MMP-9 and TIMP-1) and their association with severity of diabetic retinopathy.

    PubMed

    Jayashree, Kuppuswami; Yasir, Md; Senthilkumar, Gandhipuram Periyasamy; Ramesh Babu, K; Mehalingam, Vadivelan; Mohanraj, Palani Selvam

    2018-05-05

    Diabetic Retinopathy (DR) is the leading cause of vision loss in the working age population. Matrix metalloproteinase-9 (MMP-9) and tissue inhibitor of metalloproteinase-1 (TIMP-1), are molecules involved in extracellular tissue matrix remodelling. They are implicated in the loss of retinal tissue integrity, a major cause of DR, that leads to retinal tissue degradation and apoptosis. This study is therefore, conducted to compare the serum levels of MMP-9 and TIMP-1 in T2DM patients without and with retinopathy, and to evaluate their association with the severity of DR. Our study comprised of 2 groups of 41 each. Group A (cases) included T2DM patients with retinopathy and Group B (controls) included T2DM patients without retinopathy. Routine parameters, mainly, fasting blood glucose, and lipid profile were measured using autoanalyzer. Serum MMP-9, TIMP-1, and insulin levels were assessed using ELISA method. Statistically significant increase in the levels of MMP-9, insulin, fasting blood glucose and lipid profile were observed in the serum of T2DM patients with retinopathy, as compared with those without retinopathy. These results help to conclude that rise in MMP-9, and associated serum markers promote disease progress in DR. These findings suggest that the elevations of our study markers in the serum of the type 2 diabetic patients with retinopathy, as compared to those without retinopathy, play important roles in aggravating tissue matrix degradation, supporting DR disease progression. Copyright © 2018. Published by Elsevier Ltd.

  3. Structure and component dynamics in binary mixtures of poly(2-(dimethylamino)ethyl methacrylate) with water and tetrahydrofuran: A diffraction, calorimetric, and dielectric spectroscopy study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goracci, G., E-mail: sckgorag@ehu.es; Arbe, A.; Alegría, A.

    2016-04-21

    We have combined X-ray diffraction, neutron diffraction with polarization analysis, small angle neutron scattering, differential scanning calorimetry, and broad band dielectric spectroscopy to investigate the structure and dynamics of binary mixtures of poly (2-(dimethylamino)ethyl methacrylate) with either water or tetrahydrofuran (THF) at different concentrations. Aqueous mixtures are characterized by a highly heterogeneous structure where water clusters coexist with an underlying nano-segregation of main chains and side groups of the polymeric matrix. THF molecules are homogeneously distributed among the polymeric nano-domains for concentrations of one THF molecule/monomer or lower. A more heterogeneous situation is found for higher THF amounts, but withoutmore » evidences for solvent clusters. In THF-mixtures, we observe a remarkable reduction of the glass-transition temperature which is enhanced with increasing amount of solvent but seems to reach saturation at high THF concentrations. Adding THF markedly reduces the activation energy of the polymer β-relaxation. The presence of THF molecules seemingly hinders a slow component of this process which is active in the dry state. The aqueous mixtures present a strikingly broad glass-transition feature, revealing a highly heterogeneous behavior in agreement with the structural study. Regarding the solvent dynamics, deep in the glassy state all data can be described by an Arrhenius temperature dependence with a rather similar activation energy. However, the values of the characteristic times are about three orders of magnitude smaller for THF than for water. Water dynamics display a crossover toward increasingly higher apparent activation energies in the region of the onset of the glass transition, supporting its interpretation as a consequence of the freezing of the structural relaxation of the surrounding matrix. The absence of such a crossover (at least in the wide dynamic window here accessed) in THF is attributed to the lack of cooperativity effects in the relaxation of these molecules within the polymeric matrix.« less

  4. Coherent Bichromatic Force Deflection of Molecules

    NASA Astrophysics Data System (ADS)

    Kozyryev, Ivan; Baum, Louis; Aldridge, Leland; Yu, Phelan; Eyler, Edward E.; Doyle, John M.

    2018-02-01

    We demonstrate the effect of the coherent optical bichromatic force on a molecule, the polar free radical strontium monohydroxide (SrOH). A dual-frequency retroreflected laser beam addressing the X˜2Σ+↔A˜2Π1 /2 electronic transition coherently imparts momentum onto a cryogenic beam of SrOH. This directional photon exchange creates a bichromatic force that transversely deflects the molecules. By adjusting the relative phase between the forward and counterpropagating laser beams we reverse the direction of the applied force. A momentum transfer of 70 ℏk is achieved with minimal loss of molecules to dark states. Modeling of the bichromatic force is performed via direct numerical solution of the time-dependent density matrix and is compared with experimental observations. Our results open the door to further coherent manipulation of molecular motion, including the efficient optical deceleration of diatomic and polyatomic molecules with complex level structures.

  5. Biofilm inhibitors that target amyloid proteins.

    PubMed

    Romero, Diego; Sanabria-Valentín, Edgardo; Vlamakis, Hera; Kolter, Roberto

    2013-01-24

    Bacteria establish stable communities, known as biofilms, that are resistant to antimicrobials. Biofilm robustness is due to the presence of an extracellular matrix, which for several species-among them Bacillus subtilis-includes amyloid-like protein fibers. In this work, we show that B. subtilis biofilms can be a simple and reliable tool for screening of molecules with antiamyloid activity. We identified two molecules, AA-861 and parthenolide, which efficiently inhibited biofilms by preventing the formation of amyloid-like fibers. Parthenolide also disrupted pre-established biofilms. These molecules also impeded the formation of biofilms of other bacterial species that secrete amyloid proteins, such as Bacillus cereus and Escherichia coli. Furthermore, the identified molecules decreased the conversion of the yeast protein New1 to the prion state in a heterologous host, indicating the broad range of activity of the molecules. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Quantum-chemical calculations and IR spectra of the (F2)MF2 molecules (M = B, Al, Ga, In, Tl) in solid matrices: a new class of very high electron affinity neutral molecules.

    PubMed

    Wang, Xuefeng; Andrews, Lester

    2011-03-23

    Electron-deficient group 13 metals react with F(2) to give the compounds MF(2) (M = B, Al, Ga, In, Tl), which combine with F(2) to form a new class of very high electron affinity neutral molecules, (F(2))MF(2), in solid argon and neon. These (F(2))MF(2) fluorine metal difluoride molecules were identified through matrix IR spectra containing new antisymmetric and symmetric M-F stretching modes. The assignments were confirmed through close comparisons with frequency calculations using DFT methods, which were calibrated against the MF(3) molecules observed in all of the spectra. Electron affinities calculated at the CCSD(T) level fall between 7.0 and 7.8 eV, which are in the range of the highest known electron affinities.

  7. Modulation of keratinocyte motility. Correlation with production of extracellular matrix molecules in response to growth promoting and antiproliferative factors.

    PubMed Central

    Nickoloff, B. J.; Mitra, R. S.; Riser, B. L.; Dixit, V. M.; Varani, J.

    1988-01-01

    Normal human epidermal keratinocytes (KC) grown under conditions that maintain the undifferentiated state are highly motile. Migration of these cells as measured in two different assays (migration out of an agarose drop explant, and into micropore filters in a modified Boyden chamber), is stimulated by fibronectin (FN) and to a lesser extent by thrombospondin (TSP). In contrast, laminin (LN) inhibits KC migration. Cultivation of the cells for 1 day under conditions that induce differentiation (ie, in the presence of 1.4 mM Ca2+) suppresses KC motility. A number of soluble growth modulating polypeptide factors also influence KC migration. Transforming growth factor-beta (TGF-beta) and epidermal growth factor (EGF) stimulate KC motility. These factors simultaneously induce KC production of FN and a significant portion of the stimulated motility can be inhibited with antibodies to FN. EGF and somatomedin-C (SM-C), but not TGF-beta, also stimulate TSP production while EGF and SM-C (but not TGF-beta) induce KC proliferation. In contrast to these factors, interferon-gamma (INF-gamma) inhibits KC production of both FN and TSP and concomitantly inhibits both motility and proliferation. These data suggest that KC properties essential for normal wound healing (ie, motility and proliferation) are regulated by both extracellular matrix molecules and soluble peptide factors. Finally, these effects of various growth promoting and antiproliferative factors on KCs may, in part, be mediated through alteration in the endogenous production of extracellular matrix molecules by KCs. Images Figure 2 PMID:2458044

  8. Brain Extracellular Space: The Final Frontier of Neuroscience.

    PubMed

    Nicholson, Charles; Hrabětová, Sabina

    2017-11-21

    Brain extracellular space is the narrow microenvironment that surrounds every cell of the central nervous system. It contains a solution that closely resembles cerebrospinal fluid with the addition of extracellular matrix molecules. The space provides a reservoir for ions essential to the electrical activity of neurons and forms an intercellular chemical communication channel. Attempts to reveal the size and structure of the extracellular space using electron microscopy have had limited success; however, a biophysical approach based on diffusion of selected probe molecules has proved useful. A point-source paradigm, realized in the real-time iontophoresis method using tetramethylammonium, as well as earlier radiotracer methods, have shown that the extracellular space occupies ∼20% of brain tissue and small molecules have an effective diffusion coefficient that is two-fifths that in a free solution. Monte Carlo modeling indicates that geometrical constraints, including dead-space microdomains, contribute to the hindrance to diffusion. Imaging the spread of macromolecules shows them increasingly hindered as a function of size and suggests that the gaps between cells are predominantly ∼40 nm with wider local expansions that may represent dead-spaces. Diffusion measurements also characterize interactions of ions and proteins with the chondroitin and heparan sulfate components of the extracellular matrix; however, the many roles of the matrix are only starting to become apparent. The existence and magnitude of bulk flow and the so-called glymphatic system are topics of current interest and controversy. The extracellular space is an exciting area for research that will be propelled by emerging technologies. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  9. The role of endothelial cell attachment to elastic fibre molecules in the enhancement of monolayer formation and retention, and the inhibition of smooth muscle cell recruitment.

    PubMed

    Williamson, Matthew R; Shuttleworth, Adrian; Canfield, Ann E; Black, Richard A; Kielty, Cay M

    2007-12-01

    The endothelium is an essential modulator of vascular tone and thrombogenicity and a critical barrier between the vessel wall and blood components. In tissue-engineered small-diameter vascular constructs, endothelial cell detachment in flow can lead to thrombosis and graft failure. The subendothelial extracellular matrix provides stable endothelial cell anchorage through interactions with cell surface receptors, and influences the proliferation, migration, and survival of both endothelial cells and smooth muscle cells. We have tested the hypothesis that these desired physiological characteristics can be conferred by surface coatings of natural vascular matrix components, focusing on the elastic fiber molecules, fibrillin-1, fibulin-5 and tropoelastin. On fibrillin-1 or fibulin-5-coated surfaces, endothelial cells exhibited strong integrin-mediated attachment in static conditions (82% and 76% attachment, respectively) and flow conditions (67% and 78% cell retention on fibrillin-1 or fibulin-5, respectively, at 25 dynes/cm2), confluent monolayer formation, and stable functional characteristics. Adhesion to these two molecules also strongly inhibited smooth muscle cell migration to the endothelial monolayer. In contrast, on elastin, endothelial cells attached poorly, did not spread, and had markedly impaired functional properties. Thus, fibrillin-1 and fibulin-5, but not elastin, can be exploited to enhance endothelial stability, and to inhibit SMC migration within vascular graft scaffolds. These findings have important implications for the design of vascular graft scaffolds, the clinical performance of which may be enhanced by exploiting natural cell-matrix biology to regulate cell attachment and function.

  10. Immunohistochemical Study of Laminin-332 γ2 Chain and MMP-9 in High Risk of Malignant Transformation Oral Lesions and OSCC.

    PubMed

    Silva, Eline Manhães Reid; Freitas, Vanessa Morais; Bautz, Willian Grassi; de Barros, Liliana Aparecida Pimenta; da Gama de Souza, Letícia Nogueira

    2018-01-01

    Oral squamous cell carcinoma is associated with alterations in basement membrane. Laminin-332 is present in basal lamina and performs multiple biologic effects by γ2 chain. Matrix metalloproteinase acts disrupting extracellular components and was related to poor prognosis in cancer. Here, molecular profile of laminin-332 γ2 chain and matrix metalloproteinase-9 was assessed in oral lesions. The expression of laminin-332 γ2 chain and matrix metalloproteinase-9 (MMP-9) was examined by immunohistochemistry in 10 patients with high risk of malignant transformation oral lesions and 26 cases of oral squamous cell carcinoma (OSCC). Associations between microscopic and clinicopathologic features were established. Immunostaining of laminin-332 γ2 chain in high risk oral lesions was most detected in basement membrane which is continuous, while the majority of OSCC cases showed a discontinuous membrane (P = 0.001). It was observed a positive reaction for γ2 chain in invasive fronts and a higher expression in epithelial compartment of smoking patients with OSCC (P < 0.0001). In epithelium, MMP-9 expression was presented in all layers with no difference between lesions. However, an elevated immunostaining in stromal cells was associated with male patients (P = 0.0054), older than 60 years (P = 0.0101) and with OSCC. Present study results support the hypothesis of changes in molecules expression in high risk oral lesions and oral squamous cell carcinoma. A relation between clinical and molecule profile was observed. Those molecules may represent a useful tool to predict oral cancer behaviour.

  11. Biochemical properties of a keratan sulphate/chondroitin sulphate proteoglycan expressed in primate pluripotent stem cells*

    PubMed Central

    Cooper, Susan; Bennett, William; Andrade, Jessica; Reubinoff, Benjamin E; Thomson, James; Pera, Martin F

    2002-01-01

    We previously identified a pericellular matrix keratan sulphate/chondroitin sulphate proteoglycan present on the surface of human embryonal carcinoma stem cells, cells whose differentiation mimics early development. Antibodies reactive with various epitopes on this molecule define a cluster of differentiation markers for primate pluripotent stem cells. We describe the purification of a form of this molecule which is secreted or shed into the culture medium. Biochemical analysis of the secreted form of this molecule shows that the monomeric form, whilst containing keratan sulphate, resembles mucins in its structure and its modification with O-linked carbohydrate. Immunofluorescence and immunoblotting data show that monkey and human pluripotent stem cells react with antibodies directed against epitopes on either carbohydrate side chains or the protein core of the molecule. PMID:12033730

  12. Evidence of low molecular weight components in the organic matrix of the reef building coral, Stylophora pistillata.

    PubMed

    Puverel, S; Houlbrèque, F; Tambutté, E; Zoccola, D; Payan, P; Caminiti, N; Tambutté, S; Allemand, D

    2007-08-01

    Biominerals contain both inorganic and organic components. Organic components are collectively termed the organic matrix, and this matrix has been reported to play a crucial role in mineralization. Several matrix proteins have been characterized in vertebrates, but only a few in invertebrates, primarily in Molluscs and Echinoderms. Methods classically used to extract organic matrix proteins eliminate potential low molecular weight matrix components, since cut-offs ranging from 3.5 to 10 kDa are used to desalt matrix extracts. Consequently, the presence of such components remains unknown and these are never subjected to further analyses. In the present study, we have used microcolonies from the Scleractinian coral Stylophora pistillata to study newly synthesized matrix components by labelling them with 14C-labelled amino acids. Radioactive matrix components were investigated by a method in which both total organic matrix and fractions of matrix below and above 5 kDa were analyzed. Using this method and SDS-PAGE analyses, we were able to detect the presence of low molecular mass matrix components (<3.5 kDa), but no free amino acids in the skeletal organic matrix. Since more than 98% of the 14C-labelled amino acids were incorporated into low molecular weight molecules, these probably form the bulk of newly synthesized organic matrix components. Our results suggest that these low molecular weight components may be peptides, which can be involved in the regulation of coral skeleton mineralization.

  13. Pectin-based oral drug delivery to the colon.

    PubMed

    Sande, Sverre Arne

    2005-05-01

    This review presents an overview of studies concerning oral formulations intended for site-specific drug delivery to the colon with pectin as the main excipient. The biological aspects covered include gastrointestinal transit and the enzymatic degradation of pectin. Scintigraphic methods demonstrating the functionality of pectin formulations are discussed. The main focus is on the various formulations reported, including matrix tablets, multiparticulate formulations as pellets and hydrogel beads, and pectin-based coatings. Also included is an evaluation of common excipients employed to improve colon specificity by crosslinking or increasing the hydrophobicity. Finally, properties of the pectin molecules that are important for successful formulations are examined. The conclusion is that the studies found in the literature provide an excellent platform for the development of pectin-based colon delivery systems.

  14. Interplay between Matrix Metalloproteinase-9, Matrix Metalloproteinase-2, and Interleukins in Multiple Sclerosis Patients

    PubMed Central

    Tamborino, Carmine; Baldi, Eleonora; Kostic, Vladimir; Drulovic, Jelena; Dujmovic, Irena

    2016-01-01

    Matrix Metalloproteases (MMPs) and cytokines have been involved in the pathogenesis of multiple sclerosis (MS). However, no studies have still explored the possible associations between the two families of molecules. The present study aimed to evaluate the contribution of active MMP-9, active MMP-2, interleukin- (IL-) 17, IL-18, IL-23, and monocyte chemotactic proteins-3 to the pathogenesis of MS and the possible interconnections between MMPs and cytokines. The proteins were determined in the serum and cerebrospinal fluid (CSF) of 89 MS patients and 92 other neurological disorders (OND) controls. Serum active MMP-9 was increased in MS patients and OND controls compared to healthy subjects (p < 0.001 and p < 0.01, resp.), whereas active MMP-2 and ILs did not change. CSF MMP-9, but not MMP-2 or ILs, was selectively elevated in MS compared to OND (p < 0.01). Regarding the MMPs and cytokines intercorrelations, we found a significant association between CSF active MMP-2 and IL-18 (r = 0.3, p < 0.05), while MMP-9 did not show any associations with the cytokines examined. Collectively, our results suggest that active MMP-9, but not ILs, might be a surrogate marker for MS. In addition, interleukins and MMPs might synergistically cooperate in MS, indicating them as potential partners in the disease process. PMID:27555667

  15. Interplay between Matrix Metalloproteinase-9, Matrix Metalloproteinase-2, and Interleukins in Multiple Sclerosis Patients.

    PubMed

    Trentini, Alessandro; Castellazzi, Massimiliano; Cervellati, Carlo; Manfrinato, Maria Cristina; Tamborino, Carmine; Hanau, Stefania; Volta, Carlo Alberto; Baldi, Eleonora; Kostic, Vladimir; Drulovic, Jelena; Granieri, Enrico; Dallocchio, Franco; Bellini, Tiziana; Dujmovic, Irena; Fainardi, Enrico

    2016-01-01

    Matrix Metalloproteases (MMPs) and cytokines have been involved in the pathogenesis of multiple sclerosis (MS). However, no studies have still explored the possible associations between the two families of molecules. The present study aimed to evaluate the contribution of active MMP-9, active MMP-2, interleukin- (IL-) 17, IL-18, IL-23, and monocyte chemotactic proteins-3 to the pathogenesis of MS and the possible interconnections between MMPs and cytokines. The proteins were determined in the serum and cerebrospinal fluid (CSF) of 89 MS patients and 92 other neurological disorders (OND) controls. Serum active MMP-9 was increased in MS patients and OND controls compared to healthy subjects (p < 0.001 and p < 0.01, resp.), whereas active MMP-2 and ILs did not change. CSF MMP-9, but not MMP-2 or ILs, was selectively elevated in MS compared to OND (p < 0.01). Regarding the MMPs and cytokines intercorrelations, we found a significant association between CSF active MMP-2 and IL-18 (r = 0.3, p < 0.05), while MMP-9 did not show any associations with the cytokines examined. Collectively, our results suggest that active MMP-9, but not ILs, might be a surrogate marker for MS. In addition, interleukins and MMPs might synergistically cooperate in MS, indicating them as potential partners in the disease process.

  16. Biomimetic soluble collagen purified from bones.

    PubMed

    Ferreira, Ana Marina; Gentile, Piergiorgio; Sartori, Susanna; Pagliano, Cristina; Cabrele, Chiara; Chiono, Valeria; Ciardelli, Gianluca

    2012-11-01

    Type I collagen has been extensively exploited as a biomaterial for biomedical applications and drug delivery; however, small molecular alterations occurring during the isolation procedure and its interaction with residual bone extracellular matrix molecules or proteins might affect the overall material biocompatibility and performance. The aim of the current work is to study the potential alterations in collagen properties and organization associated with the absence of proteoglycans, which mimic pathological conditions associated with age-related diseases. A new approach for evaluating the effect of proteoglycans on the properties of isolated type I collagen from the bone matrix is described. Additional treatment with guanidine hydrochloride was introduced to remove residual proteoglycans from the collagen matrix. The properties of the isolated collagen with/without guanidine hydrochloride treatment were investigated and compared with a commercial rabbit collagen as control. We demonstrate that the absence of proteoglycans in the isolated type I collagen affects its thermal properties, the extraction into its native structure, and its ability to hydrate and self-assemble into fibers. The fine control and tuning of all these features, linked to the absence of non-collagenous proteins as proteoglycans, offer the possibility of designing new strategies and biomaterials with advanced biomimetic properties aimed at regenerating bone tissue in the case of fragility and/or defects. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. The Hygroscopic Nature of Wood,

    DTIC Science & Technology

    The cell walls of wood are organized as a structural system involving filamentous microfibrils , oriented essentially in the direction of the...longitudinal axis embedded in an amorphous matrix of noncrystalline cellulose , hemicelluloses, and lignin. The molecules in the amorphous regions, primarily

  18. Metal ion attachment to the matrix meso-tetrakis(pentafluorophenyl)porphyrin, related matrices and analytes: an experimental and theoretical study.

    PubMed

    van Kampen, Jeroen J A; Luider, Theo M; Ruttink, Paul J A; Burgers, Peter C

    2009-11-01

    In a previous study [van Kampen et al. Analytical Chemistry 2006; 78: 5403], we found that meso-tetrakis (pentafluorophenyl)porphyrin (F20TPP), in combination with lithium salts, provides an efficient matrix to cationize small molecules by Li+ attachment and that this combination can be successfully applied to the quantitative analysis of drugs, such as antiretroviral compounds using matrix-assisted laser desorption ionization in conjunction with a time-of-flight analyzer (MALDI-TOF). In the present study, we further explore the mechanism of metal ion attachment to F20TPP and analytes by MALDI-FTMS(/MS). To this end, we have studied the interaction of F20TPP and analytes with various mono-, di- and trivalent metal ions (Li+, Na+, K+, Rb+, Cs+, Co2+, Cu2+, Zn2+, Fe2+, Fe3+ and Ga3+). For the alkali cations, we find that F20TPP forms complexes only with Li+ and Na+; in addition, model analyte molecules such as poly(ethyleneglycol)s, mixed with F20TPP and the alkali cations, also only form Li+ and Na+ adducts. This contrasts sharply with the commonly used matrix 2,5-dihydroxybenzoic acid, where analytes are most efficiently cationized by Na+ or K+. Reasons for this difference are delineated. Ab initio calculations on porphyrin itself reveal that even the smallest alkali cation, Li+, does not fit in the porphyrin cavity, but lies on top of it, pushing the 21H and 23 H hydrogen atoms out of and below the plane with concomitant bending of the porphyrin skeleton in the opposite direction, i.e. toward the cation. Thus, the Li+ ion is not effectively sequestered and is in fact exposed and thus accessible for donation to analyte molecules. Interaction of F20TPP with di- and trivalent metal ions leads to protoporphyrin-metal ions, where the metal ion is captured within the protoporphyrin dianion cavity. The most intense signal is obtained when F20TPP is reacted with CuCl2 and then subjected to laser ablation. This method presents an easy general route to study the metal containing protoporphyrin molecules, which could all act as potential MALDI matrices. Copyright 2009 John Wiley & Sons, Ltd.

  19. Visualization of yeast chromosomal DNA

    NASA Technical Reports Server (NTRS)

    Lubega, Seth

    1990-01-01

    The DNA molecule is the most significant life molecule since it codes the blue print for other structural and functional molecules of all living organisms. Agarose gel electrophoresis is now being widely used to separate DNA of virus, bacteria, and lower eukaryotes. The task was undertaken of reviewing the existing methods of DNA fractionation and microscopic visualization of individual chromosonal DNA molecules by gel electrophoresis as a basis for a proposed study to investigate the feasibility of separating DNA molecules in free fluids as an alternative to gel electrophoresis. Various techniques were studied. On the molecular level, agarose gel electrophoresis is being widely used to separate chromosomal DNA according to molecular weight. Carl and Olson separate and characterized the entire karyotype of a lab strain of Saccharomyces cerevisiae. Smith et al. and Schwartz and Koval independently reported the visualization of individual DNA molecules migrating through agarose gel matrix during electrophoresis. The techniques used by these researchers are being reviewed in the lab as a basis for the proposed studies.

  20. A Strategy for the Development of Macromolecular Nonlinear Optical Materials

    DTIC Science & Technology

    1990-01-01

    oriented in the polymer matrix although a small amount of residual anisotropy is sometimes seen as the asymmetric molecules are spin coated onto the...the pores of the polymer network after curing. Our investigation using small and large active molecules and a curable epoxy polymer has established a...Lett., 49(5), 248 (1986) 12. R. D. Small , K. D. Singer, J. E. Sohin, M. G. Kuzyk and S. J. Lalama, SPIE, 682, 160 (1987) 13. M. A. Mortazavi, A

  1. Progress Toward Sequestering Carbon Nanotubes in PmPV

    NASA Technical Reports Server (NTRS)

    Bley, Richard A.

    2009-01-01

    Sequestration of single-walled carbon nanotubes (SWNTs) in molecules of poly(m-phenylenevinylene-co-2,5-diocty-loxy-p-phenylenevinylene) [PmPV] is a candidate means of promoting dissolution of single-walled carbon nanotubes (SWNTs) into epoxies for making strong, lightweight epoxy-matrix/carbon-fiber composite materials. Bare SWNTs cannot be incorporated because they are not soluble in epoxies. In the present approach, one exploits the tendency of PmPV molecules to wrap themselves around SWNTs without chemically bonding to them.

  2. Does the Loss of Stromal Caveolin-1 Remodel the Tumor Microenvironment by Activating Src-Mediated PEAK1 and PI3K Pathways

    DTIC Science & Technology

    2016-09-01

    Inhibition of MAP kinase pathway prevents plasma protrusions Next we used a selective inhibitor of MAP kinases , PD98059, to address whether we can...from human patients harbor AKT1 and that AKT1 kinase activity is sustained in these particles, nominating them as active signaling platforms...with the extracellular matrix (ECM) and extracellular molecules (2). Though many classic extracellular signaling molecules (e.g., hormones, peptide

  3. Self-assembly and reactive molding techniques for controlling the interface and dispersion of the particulate phase in nanocomposites

    NASA Astrophysics Data System (ADS)

    Pranger, Lawrence A.

    This research explored the processing and properties of PNCs using a polyfurfural alcohol (PFA) matrix. The precursor for PFA, furfuryl alcohol (FA) is sourced from feedstocks rich in hemicellulose, such as corn cobs, oat hulls and wood. To exploit FA as a polymerizable solvent, cellulose whiskers (CW) and montmorillonite clay (MMT) were used as the nanoparticle phase. Results from PNC processing show that CW and MMT can be dispersed in the PFA matrix by means of insitu polymerization, without the use of surfactants or dilution in solvents. Both CW and MMT nanoparticles catalyze the polymerization of furfuryl alcohol (FA). Moreover, the insitu intercalative polymerization of FA in the interlayer galleries of MMT leads to the complete exfoliation of the MMT in the PFA matrix. CW and MMT both function as effective matrix modifiers, increasing the thermal stability of PFA nanocomposites compared to pure PFA polymer. The increased thermal stability is seen as significant increases in the onset of degradation and in residual weight at high temperature. This research also explored the surface functionalization of Cu, Ni and Pt substrates by self-assembly of a range of difunctional linker molecules. Characterization by XPS and PM-IRRAS indicate that diisocyanides and dicarboxylic acids both form chemically "sticky" surfaces after self-assembly on Cu and Ni. Sticky surfaces may provide a means of increasing nanoparticle dispersion in metal nanocluster filled PNCs, by increasing their interaction with the matrix polymer. Another potential application for sticky surfaces on Cu is in the ongoing miniaturization of circuit boards. The functionalization of Cu bond pad substrates with linker molecules may provide an alternate means of bonding components to their bond pads, with higher placement accuracy compared to solder bumps.

  4. Humic acids as both matrix for matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and adsorbent for magnetic solid phase extraction.

    PubMed

    Zhao, Qin; Xu, Jing; Yin, Jia; Feng, Yu-Qi

    2015-08-19

    In the present study, humic acids (HAs) were applied as both a matrix for matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) and an adsorbent of magnetic solid phase extraction (MSPE) for the first time. As natural macromolecule compounds, HAs are inherently highly functionalized and contain laser energy absorbing-transferring aromatic structures. This special molecular structure made HAs a good candidate for use as a MALDI matrix in small molecule analysis. At the same time, due to its good adsorption ability, HAs was prepared as MSPE adsorbent via a simple co-mixing method, in which the commercially available HAs were directly mixed with Fe3O4 magnetic nanoparticles (MNPs) in a mortar and grinded evenly and completely. In this process, MNPs were physically wrapped and adhered to tiny HAs leading to the formation of magnetic HAs (MHAs). To verify the bi-function of the MHAs, Rhodamine B (RdB) was chosen as model compound. Our results show that the combination of MHAs-based MSPE and MALDI-TOF-MS can provide a rapid and sensitive method for the determination of RdB in chili oil. The whole analytical procedure could be completed within 30 min for simultaneous determination of more than 20 samples, and the limit of quantitation for RdB was found to be 0.02 μg/g. The recoveries in chili oil were in the range 73.8-81.5% with the RSDs less than 21.3% (intraday) and 20.3% (interday). The proposed strategy has potential applications for high-throughput analysis of small molecules in complex samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Evaluation of the resistance of a geopolymer-based drug delivery system to tampering.

    PubMed

    Cai, Bing; Engqvist, Håkan; Bredenberg, Susanne

    2014-04-25

    Tamper-resistance is an important property of controlled-release formulations of opioid drugs. Tamper-resistant formulations aim to increase the degree of effort required to override the controlled release of the drug molecules from extended-release formulations for the purpose of non-medical use. In this study, the resistance of a geopolymer-based formulation to tampering was evaluated by comparing it with a commercial controlled-release tablet using several methods commonly used by drug abusers. Because of its high compressive strength and resistance to heat, much more effort and time was required to extract the drug from the geopolymer-based formulation. Moreover, in the drug-release test, the geopolymer-based formulation maintained its controlled-release characteristics after milling, while the drug was released immediately from the milled commercial tablets, potentially resulting in dose dumping. Although the tampering methods used in this study does not cover all methods that abuser could access, the results obtained by the described methods showed that the geopolymer matrix increased the degree of effort required to override the controlled release of the drug, suggesting that the formulation has improved resistance to some common drug-abuse tampering methods. The geopolymer matrix has the potential to make the opioid product less accessible and attractive to non-medical users. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Quantitative Aspects of Single Molecule Microscopy

    PubMed Central

    Ober, Raimund J.; Tahmasbi, Amir; Ram, Sripad; Lin, Zhiping; Ward, E. Sally

    2015-01-01

    Single molecule microscopy is a relatively new optical microscopy technique that allows the detection of individual molecules such as proteins in a cellular context. This technique has generated significant interest among biologists, biophysicists and biochemists, as it holds the promise to provide novel insights into subcellular processes and structures that otherwise cannot be gained through traditional experimental approaches. Single molecule experiments place stringent demands on experimental and algorithmic tools due to the low signal levels and the presence of significant extraneous noise sources. Consequently, this has necessitated the use of advanced statistical signal and image processing techniques for the design and analysis of single molecule experiments. In this tutorial paper, we provide an overview of single molecule microscopy from early works to current applications and challenges. Specific emphasis will be on the quantitative aspects of this imaging modality, in particular single molecule localization and resolvability, which will be discussed from an information theoretic perspective. We review the stochastic framework for image formation, different types of estimation techniques and expressions for the Fisher information matrix. We also discuss several open problems in the field that demand highly non-trivial signal processing algorithms. PMID:26167102

  7. Statistical Mechanical Theory of Coupled Slow Dynamics in Glassy Polymer-Molecule Mixtures

    NASA Astrophysics Data System (ADS)

    Zhang, Rui; Schweizer, Kenneth

    The microscopic Elastically Collective Nonlinear Langevin Equation theory of activated relaxation in one-component supercooled liquids and glasses is generalized to polymer-molecule mixtures. The key idea is to account for dynamic coupling between molecule and polymer segment motion. For describing the molecule hopping event, a temporal casuality condition is formulated to self-consistently determine a dimensionless degree of matrix distortion relative to the molecule jump distance based on the concept of coupled dynamic free energies. Implementation for real materials employs an established Kuhn sphere model of the polymer liquid and a quantitative mapping to a hard particle reference system guided by the experimental equation-of-state. The theory makes predictions for the mixture dynamic shear modulus, activated relaxation time and diffusivity of both species, and mixture glass transition temperature as a function of molecule-Kuhn segment size ratio and attraction strength, composition and temperature. Model calculations illustrate the dynamical behavior in three distinct mixture regimes (fully miscible, bridging, clustering) controlled by the molecule-polymer interaction or chi-parameter. Applications to specific experimental systems will be discussed.

  8. Triblock copolymer matrix-based capillary electrophoretic microdevice for high-resolution multiplex pathogen detection.

    PubMed

    Kim, Se Jin; Shin, Gi Won; Choi, Seok Jin; Hwang, Hee Sung; Jung, Gyoo Yeol; Seo, Tae Seok

    2010-03-01

    Rapid and simple analysis for the multiple target pathogens is critical for patient management. CE-SSCP analysis on a microchip provides high speed, high sensitivity, and a portable genetic analysis platform in molecular diagnostic fields. The capability of separating ssDNA molecules in a capillary electrophoretic microchannel with high resolution is a critical issue to perform the precise interpretation in the electropherogram. In this study, we explored the potential of poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) (PEO-PPO-PEO) triblock copolymer as a sieving matrix for CE-SSCP analysis on a microdevice. To demonstrate the superior resolving power of PEO-PPO-PEO copolymers, 255-bp PCR amplicons obtained from 16S ribosomal RNA genes of four bacterial species, namely Proteus mirabilis, Haemophilus ducreyi, Pseudomonas aeruginosa, and Neisseria meningitidis, were analyzed in the PEO-PPO-PEO matrix in comparison with 5% linear polyacrylamide and commercial GeneScan gel. Due to enhanced dynamic coating and sieving ability, PEO-PPO-PEO copolymer displayed fourfold enhancement of resolving power in the CE-SSCP to separate same-sized DNA molecules. Fivefold input of genomic DNA of P. aeruginosa and/or N. meningitidis produced proportionally increased corresponding amplicon peaks, enabling correct quantitative analysis in the pathogen detection. Besides the high-resolution sieving capability, a facile loading and replenishment of gel in the microchannel due to thermally reversible gelation property makes PEO-PPO-PEO triblock copolymer an excellent matrix in the CE-SSCP analysis on the microdevice.

  9. Raman Spectroscopy.

    ERIC Educational Resources Information Center

    Gerrard, Donald L.

    1984-01-01

    Reviews literature on Raman spectroscopy from late 1981 to late 1983. Topic areas include: instrumentation and sampling; liquids and solutions; gases and matrix isolation; biological molecules; polymers; high-temperature and high-pressure studies; Raman microscopy; thin films and surfaces; resonance-enhanced and surface-enhanced spectroscopy; and…

  10. Introduction of β-cyclodextrin into poly(aspartic acid) matrix for adsorption and time-release of ibuprofen.

    PubMed

    Sun, Zhao-Yang; Shen, Ming-Xing; Yang, An-Wen; Liang, Cong-Qiang; Wang, Nan; Cao, Gui-Ping

    2011-01-21

    Biodegradable copolymers with molecule inclusion ability was prepared by introduction of β-cyclodextrin into poly(aspartic acid) matrices. The ibuprofen loading and dissolution properties of poly(aspartic acid)-β-cyclodextrin were investigated.

  11. Visualization of DNA molecules in time during electrophoresis

    NASA Technical Reports Server (NTRS)

    Lubega, Seth

    1991-01-01

    For several years individual DNA molecules have been observed and photographed during agarose gel electrophoresis. The DNA molecule is clearly the largest molecule known. Nevertheless, the largest molecule is still too small to be seen using a microscope. A technique developed by Morikawa and Yanagida has made it possible to visualize individual DNA molecules. When these long molecules are labeled with appropriate fluorescence dyes and observed under a fluorescence microscope, although it is not possible to directly visualize the local ultrastructure of the molecules, yet because they are long light emitting chains, their microscopic dynamical behavior can be observed. This visualization works in the same principle that enables one to observe a star through a telescope because it emits light against a dark background. The dynamics of individual DNA molecules migrating through agarose matrix during electrophoresis have been described by Smith et al. (1989), Schwartz and Koval (1989), and Bustamante et al. (1990). DNA molecules during agarose gel electrophoresis advance lengthwise thorough the gel in an extended configuration. They display an extension-contraction motion and tend to bunch up in their leading ends as the 'heads' find new pores through the gel. From time to time they get hooked on obstacles in the gel to form U-shaped configurations before they resume their linear configuration.

  12. FEL-FTIR spectroscopy of matrix-isolated formic acid

    NASA Astrophysics Data System (ADS)

    Henderson, Don O.; Mu, Richard; Silberman, Enrique; Berryman, Kenneth W.; Rella, Chris W.

    1994-07-01

    Infrared spectral hole burning studies have provided a wealth of information concerning site reorientation of defects in solids and vibrational relaxation dynamics. The most investigated systems appear to be impurities trapped in alkali halides. Limited studies on molecules trapped in noble gas matrices have demonstrated that these systems are good candidates for investigating persistent spectral holes. However, most infrared spectral hole burning studies have been limited by the tunability of commercially available infrared lasers which in turn restricts the spectral feature which can be burned. On the other hand, the tunability of Infrared Free Electron Lasers (IR-FELs) allows for targeting radiation into vibrational of the molecular system under study. We have used the Free Electron Laser-Fourier Transform Infrared Spectroscopy to investigate infrared hole burning of formic acid (HCOOD) isolated in an Ar matrix at a matrix/sample ratio of 4000/1. The results of the FEL radiation tuned to v2 mode of HCOOD are discussed together with matrix induced frequency shifts and matrix induced band splittings.

  13. Dense fibrillar collagen is a potent inducer of invadopodia via a specific signaling network

    PubMed Central

    Swatkoski, Stephen; Matsumoto, Kazue; Campbell, Catherine B.; Petrie, Ryan J.; Dimitriadis, Emilios K.; Li, Xin; Mueller, Susette C.; Bugge, Thomas H.; Gucek, Marjan

    2015-01-01

    Cell interactions with the extracellular matrix (ECM) can regulate multiple cellular activities and the matrix itself in dynamic, bidirectional processes. One such process is local proteolytic modification of the ECM. Invadopodia of tumor cells are actin-rich proteolytic protrusions that locally degrade matrix molecules and mediate invasion. We report that a novel high-density fibrillar collagen (HDFC) matrix is a potent inducer of invadopodia, both in carcinoma cell lines and in primary human fibroblasts. In carcinoma cells, HDFC matrix induced formation of invadopodia via a specific integrin signaling pathway that did not require growth factors or even altered gene and protein expression. In contrast, phosphoproteomics identified major changes in a complex phosphosignaling network with kindlin2 serine phosphorylation as a key regulatory element. This kindlin2-dependent signal transduction network was required for efficient induction of invadopodia on dense fibrillar collagen and for local degradation of collagen. This novel phosphosignaling mechanism regulates cell surface invadopodia via kindlin2 for local proteolytic remodeling of the ECM. PMID:25646088

  14. Cannibalism enhances biofilm development in Bacillus subtilis.

    PubMed

    López, Daniel; Vlamakis, Hera; Losick, Richard; Kolter, Roberto

    2009-11-01

    Cannibalism is a mechanism to delay sporulation in Bacillus subtilis. Cannibal cells express the skf and sdp toxin systems to lyse a fraction of their sensitive siblings. The lysed cells release nutrients that serve to feed the community, effectively delaying spore formation. Here we provide evidence that the subpopulation of cells that differentiates into cannibals is the same subpopulation that produces the extracellular matrix that holds cells together in biofilms. Cannibalism and matrix formation are both triggered in response to the signalling molecule surfactin. Nutrients released by the cannibalized cells are preferentially used by matrix-producing cells, as they are the only cells expressing resistance to the Skf and Sdp toxins. As a result this subpopulation increases in number and matrix production is enhanced when cannibalism toxins are produced. The cannibal/matrix-producing subpopulation is also generated in response to antimicrobials produced by other microorganisms and may thus constitute a defense mechanism to protect B. subtilis from the action of antibiotics in natural settings.

  15. Structure and dynamics of spin-labeled insulin entrapped in a silica matrix by the sol-gel method.

    PubMed

    Vanea, E; Gruian, C; Rickert, C; Steinhoff, H-J; Simon, V

    2013-08-12

    The structure and conformational dynamics of insulin entrapped into a silica matrix was monitored during the sol to maturated-gel transition by electron paramagnetic resonance (EPR) spectroscopy. Insulin was successfully spin-labeled with iodoacetamide and the bifunctional nitroxide reagent HO-1944. Room temperature continuous wave (cw) EPR spectra of insulin were recorded to assess the mobility of the attached spin labels. Insulin conformation and its distribution within the silica matrix were studied using double electron-electron resonance (DEER) and low-temperature cw-EPR. A porous oxide matrix seems to form around insulin molecules with pore diameters in the order of a few nanometers. Secondary structure of the encapsulated insulin investigated by Fourier transform infrared spectroscopy proved a high structural integrity of insulin even in the dried silica matrix. The results show that silica encapsulation can be used as a powerful tool to effectively isolate and functionally preserve biomolecules during preparation, storage, and release.

  16. Polyfluorides and Neat Fluorine as Host Material in Matrix-Isolation Experiments.

    PubMed

    Brosi, Felix; Vent-Schmidt, Thomas; Kieninger, Stefanie; Schlöder, Tobias; Beckers, Helmut; Riedel, Sebastian

    2015-11-09

    The use of neat fluorine in matrix isolation is reported, as well as the formation of polyfluoride monoanions under cryogenic conditions. Purification procedures and spectroscopic data of fluorine are described, and matrix shifts of selected molecules and impurities in solid fluorine are compared to those of common matrix gases (Ar, Kr, N2 , Ne). The reaction of neat fluorine and IR-laser ablated metal atoms to yield fluorides of chromium (CrF5 ), palladium (PdF2 ), gold (AuF5 ), and praseodymium (PrF4 ) has been investigated. The fluorides have been characterized in solid fluorine by IR spectroscopy at 5 K. Also the fluorination of Kr and the photo-dismutation of XeO4 have been studied by using IR spectroscopy in neat fluorine. Formation of the [F5 ](-) ion was obtained by IR-laser ablation of platinum in the presence of fluorine and proven in a Ne matrix at 5 K by two characteristic vibrational bands of [F5 ](-) at $\\tilde \

  17. New biochemical insight of conserved water molecules at catalytic and structural Zn2+ ions in human matrix metalloproteinase-I: a study by MD-simulation.

    PubMed

    Chakrabarti, Bornali; Bairagya, Hridoy R; Mukhopadhyay, Bishnu P; Sekar, K

    2017-02-01

    Human matrix metalloproteinase (MMP)-1 or collagenase-1 plays a significant role in embryonic development, tissue remodeling, and is also involved in several diseases like arthritis, metastasis, etc. Molecular dynamics simulation studies on hMMP-1 X-ray structures (PDB Id. 1CGE, 1CGF, 1CGL, 1HFC, and 2TCL) suggest that the three conserved water molecules (W H/1 , W I , W S ) are coordinated with catalytic zinc (Zn C ), and one water molecule (W) is associated at structural zinc ion (Zn S ). Transition of the coordination geometry around Zn C from tetrahedral to octahedral and tetrahedral to trigonal bipyramidal at Zn S are also observed during the dynamics. Recognition of two zinc ions through water mediated bridges (Zn C - W H (W 1 )…W 2 ….H 183 - Zn S ) and stabilization of secondary coordination zone around the metal ions indicates the possibility of Zn C …Zn S coupled catalytic mechanism in hMMP-I. This study not only reveals a functionally important role of conserved water molecules in hMMP-I but also highlights the involvement of other non catalytic residues, such as S172 and D170 in the catalytic mechanism. The results obtained in this study could be relevant for importance of conserved water mediated recognition site of the sequence residue id. 202(RWTNNFREY)210, interaction of W(tryptophan)203 to zinc bound histidine, their influence on the water molecules that are involved in bridging between Zn C and Zn S , and structure-based design of specific hMMP inhibitors. Graphical abstract Water mediated recognition of structural and catalytic zinc ions of hMMP-1 structure (MD simulatated conformation).

  18. Adhesion molecules, chemokines and matrix metallo-proteinases response after albendazole and albendazole plus steroid therapy in swine neurocysticercosis.

    PubMed

    Singh, Satyendra K; Prasad, Kashi N; Singh, Aloukick K; Gupta, Kamlesh K; Singh, Amrita; Tripathi, Mukesh; Gupta, Rakesh K

    2017-11-01

    The treatment of neurocysticercosis (NCC) varies with location, number and stage of the Taenia solium cysticerci (cysts). Albendazole (ABZ) effectively kills cysticerci, and subsequently induces neuro-inflammation facilitated by leukocyte infiltration. We hypothesize that immune response varies around drug responder (degenerating/dying) and non-responder (viable) cysts after ABZ and ABZ plus steroid (ABZS) therapy, which may determine the disease pathogenesis. Twenty cysticercotic swine were treated with ABZ (n = 10; group1) and ABZS (n = 10; group2). Expression of adhesion molecules, chemokines and matrix metallo-proteinases (MMPs) was measured by qRT-PCR (quantitative reverse transcriptase-polymerase chain reaction) and ELISA. Gelatin gel zymography was performed to detect the activity of MMP-2 and -9. In group1, ABZ therapy induced higher expressions of ICAM-1 (intercellular adhesion molecule-1), VCAM-1 (vascular cell adhesion molecule-1), E-selectin, MCP-1 (monocyte chemotactic protein-1), Eotaxin-1, MIP-1α (macrophage inflammatory protein-1α), RANTES (regulated on activation, normal T cell expressed and secreted), MMP-2 and MMP-9 around ABZ responder (AR) cysts. Three pigs with cyst burdens ≥10 died following ABZ therapy. However, in group2, moderate expressions of ICAM-1, VCAM-1, E-selectin, RANTES and MMP-9 were associated with ABZS responder (ASR), whereas low expressions of these molecules were associated with ABZS non-responder (ASNR) cysts. In conclusion, ABZ alone therapy is not safe since it causes death of pigs due to higher inflammatory immune response around dying cysts. However, combination therapy is an effective treatment regimen even with the high cyst burden. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Gene evolution and functions of extracellular matrix proteins in teeth

    PubMed Central

    Yoshizaki, Keigo; Yamada, Yoshihiko

    2013-01-01

    The extracellular matrix (ECM) not only provides physical support for tissues, but it is also critical for tissue development, homeostasis and disease. Over 300 ECM molecules have been defined as comprising the “core matrisome” in mammals through the analysis of whole genome sequences. During tooth development, the structure and functions of the ECM dynamically change. In the early stages, basement membranes (BMs) separate two cell layers of the dental epithelium and the mesenchyme. Later in the differentiation stages, the BM layer is replaced with the enamel matrix and the dentin matrix, which are secreted by ameloblasts and odontoblasts, respectively. The enamel matrix genes and the dentin matrix genes are each clustered in two closed regions located on human chromosome 4 (mouse chromosome 5), except for the gene coded for amelogenin, the major enamel matrix protein, which is located on the sex chromosomes. These genes for enamel and dentin matrix proteins are derived from a common ancestral gene, but as a result of evolution, they diverged in terms of their specific functions. These matrix proteins play important roles in cell adhesion, polarity, and differentiation and mineralization of enamel and dentin matrices. Mutations of these genes cause diseases such as odontogenesis imperfect (OI) and amelogenesis imperfect (AI). In this review, we discuss the recently defined terms matrisome and matrixome for ECMs, as well as focus on genes and functions of enamel and dentin matrix proteins. PMID:23539364

  20. Chemical Selectivity and Sensitivity of a 16-Channel Electronic Nose for Trace Vapour Detection

    PubMed Central

    Strle, Drago; Trifkovič, Mario; Van Miden, Marion; Kvasić, Ivan; Zupanič, Erik; Muševič, Igor

    2017-01-01

    Good chemical selectivity of sensors for detecting vapour traces of targeted molecules is vital to reliable detection systems for explosives and other harmful materials. We present the design, construction and measurements of the electronic response of a 16 channel electronic nose based on 16 differential microcapacitors, which were surface-functionalized by different silanes. The e-nose detects less than 1 molecule of TNT out of 10+12 N2 molecules in a carrier gas in 1 s. Differently silanized sensors give different responses to different molecules. Electronic responses are presented for TNT, RDX, DNT, H2S, HCN, FeS, NH3, propane, methanol, acetone, ethanol, methane, toluene and water. We consider the number density of these molecules and find that silane surfaces show extreme affinity for attracting molecules of TNT, DNT and RDX. The probability to bind these molecules and form a surface-adsorbate is typically 10+7 times larger than the probability to bind water molecules, for example. We present a matrix of responses of differently functionalized microcapacitors and we propose that chemical selectivity of multichannel e-nose could be enhanced by using artificial intelligence deep learning methods. PMID:29292764

  1. [Imaging Mass Spectrometry in Histopathologic Analysis].

    PubMed

    Yamazaki, Fumiyoshi; Seto, Mitsutoshi

    2015-04-01

    Matrix-assisted laser desorption/ionization (MALDI)-imaging mass spectrometry (IMS) enables visualization of the distribution of a range of biomolecules by integrating biochemical information from mass spectrometry with positional information from microscopy. IMS identifies a target molecule. In addition, IMS enables global analysis of biomolecules containing unknown molecules by detecting the ratio of the molecular weight to electric charge without any target, which makes it possible to identify novel molecules. IMS generates data on the distribution of lipids and small molecules in tissues, which is difficult to visualize with either conventional counter-staining or immunohistochemistry. In this review, we firstly introduce the principle of imaging mass spectrometry and recent advances in the sample preparation method. Secondly, we present findings regarding biological samples, especially pathological ones. Finally, we discuss the limitations and problems of the IMS technique and clinical application, such as in drug development.

  2. Imaging single spin probes embedded in a conductive diamagnetic layer.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Messina, P.; Fradin, F.

    2009-01-01

    The detection of spin noise by means of scanning tunneling microscopy (STM) has recently been substantially improved by the work presented by Komeda and Manassen (Komeda, T.; Manassen, Y. Appl. Phys. Lett. 2008, 92, 212506). The application of this technique to molecular paramagnets requires the positioning and anchoring of paramagnetic molecules at surfaces. It also requires the possibility of tunneling high current densities into the STM-molecule-substrate tunneling junction. In this letter, we exploit the self-assembly of 1,10-phenantroline on the Au(111) surface to form a diamagnetic matrix that hosts individual molecules and dimers of diphenyl-2-picryl-hydrazyl (DPPH). STM measurements are used tomore » characterize the molecular layer. Electron spin resonance (ESR) measurements elucidate the role of thermal annealing in the preservation of the paramagnetic nature of the DPPH molecules.« less

  3. Efficient Algorithms for Estimating the Absorption Spectrum within Linear Response TDDFT

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brabec, Jiri; Lin, Lin; Shao, Meiyue

    We present two iterative algorithms for approximating the absorption spectrum of molecules within linear response of time-dependent density functional theory (TDDFT) framework. These methods do not attempt to compute eigenvalues or eigenvectors of the linear response matrix. They are designed to approximate the absorption spectrum as a function directly. They take advantage of the special structure of the linear response matrix. Neither method requires the linear response matrix to be constructed explicitly. They only require a procedure that performs the multiplication of the linear response matrix with a vector. These methods can also be easily modified to efficiently estimate themore » density of states (DOS) of the linear response matrix without computing the eigenvalues of this matrix. We show by computational experiments that the methods proposed in this paper can be much more efficient than methods that are based on the exact diagonalization of the linear response matrix. We show that they can also be more efficient than real-time TDDFT simulations. We compare the pros and cons of these methods in terms of their accuracy as well as their computational and storage cost.« less

  4. Dielectric Property Enhancement in Polymer Composites with Engineered Interfaces

    NASA Astrophysics Data System (ADS)

    Krentz, Timothy Michael

    This thesis reports studies into the dielectric behavior of polymer composites filled with silica nanoparticles. The permittivity and dielectric breakdown strength (DBS) of these materials are critical to their performance in insulating applications such as high voltage power transmission. Until now, the mechanisms which lead to improvements in DBS in these systems have been poorly understood, in part because the effects of dispersion of the filler and the filler's surface electronic characteristics have been confused. The new surface modifications created in this thesis permit these two parameters to be addressed independently, leading to the hypothesis that nanocomposite dielectric materials exhibit DBS enhancement when electron avalanches are prevented from proceeding to reach a critical size capable of causing failure. The same control of dispersion and surface properties also lead to changes in the permittivity of the composite based upon the polarizability and trapping behavior of the filler. In this work, the dispersion and surface states of silica nanoparticles were independently controlled with two separate populations of surface molecules. Two matrix materials were studied, and in each system, a different, matrix-compatible long chain polymer is required to control dispersion. Conversely, a second population of short molecules is shown to be capable of creating electronic traps associated with the silica nanoparticle surface which lead to DBS enhancements largely independent of the matrix, indicating that the same failure mechanism is operating in both epoxy and polypropylene. Progressive variation in dispersion quality is attained with this surface modification scheme. This creates progressively smaller volumes of matrix polymer unaffected by the filler. This work shows that when these volumes approach and become smaller than the same scale as predicted for electron avalanches, the greatest changes in DBS are seen. Likewise, the plateau behavior of this data implicates that the DBS improvements occur as avalanches are halted in their early phases by the filler, before sufficiently energy can be gathered to damage the matrix. These data indicate that avalanche sizes on the order of 150 nm are sufficient to lead to failure. Furthermore, the depths of the traps induced by small molecules on the silica surface are shown to relate to the DBS enhancement obtained for well dispersed fillers based upon the ability of these localized traps to absorb the energy gathered by growing avalanches.

  5. Discretized torsional dynamics and the folding of an RNA chain.

    PubMed

    Fernández, A; Salthú, R; Cendra, H

    1999-08-01

    The aim of this work is to implement a discrete coarse codification of local torsional states of the RNA chain backbone in order to explore the long-time limit dynamics and ultimately obtain a coarse solution to the RNA folding problem. A discrete representation of the soft-mode dynamics is turned into an algorithm for a rough structure prediction. The algorithm itself is inherently parallel, as it evaluates concurrent folding possibilities by pattern recognition, but it may be implemented in a personal computer as a chain of perturbation-translation-renormalization cycles performed on a binary matrix of local topological constraints. This requires suitable representational tools and a periodic quenching of the dynamics for system renormalization. A binary coding of local topological constraints associated with each structural motif is introduced, with each local topological constraint corresponding to a local torsional state. This treatment enables us to adopt a computation time step far larger than hydrodynamic drag time scales. Accordingly, the solvent is no longer treated as a hydrodynamic drag medium. Instead we incorporate its capacity for forming local conformation-dependent dielectric domains. Each translation of the matrix of local topological constraints (LTM's) depends on the conformation-dependent local dielectric created by a confined solvent. Folding pathways are resolved as transitions between patterns of locally encoded structural signals which change within the 1 ns-100 ms time scale range. These coarse folding pathways are generated by a search at regular intervals for structural patterns in the LTM. Each pattern is recorded as a base-pairing pattern (BPP) matrix, a consensus-evaluation operation subject to a renormalization feedback loop. Since several mutually conflicting consensus evaluations might occur at a given time, the need arises for a probabilistic approach appropriate for an ensemble of RNA molecules. Thus, a statistical dynamics of consensus formation is determined by the time evolution of the base pairing probability matrix. These dynamics are generated for a functional RNA molecule, a representative of the so-called group I ribozymes, in order to test the model. The resulting ensemble of conformations is sharply peaked and the most probable structure features the predominance of all phylogenetically conserved intrachain helices tantamount to ribozyme function. Furthermore, the magnesium-aided cooperativity that leads to the shaping of the catalytic core is elucidated. Once the predictive folding algorithm has been implemented, the validity of the so-called "adiabatic approximation" is tested. This approximation requires that conformational microstates be lumped up into BPP's which are treated as quasiequilibrium states, while folding pathways are coarsely represented as sequences of BPP transitions. To test the validity of this adiabatic ansatz, a computation of the coarse Shannon information entropy sigma associated to the specific partition of conformation space into BPP's is performed taking into account the LTM evolution and contrasted with the adiabatic computation. The results reveal a subordination of torsional microstate dynamics to BPP transitions within time scales relevant to folding. This adiabatic entrainment in the long-time limit is thus identified as responsible for the expediency of the folding process.

  6. The evaluation of p,p'-DDT exposure on cell adhesion of hepatocellular carcinoma.

    PubMed

    Jin, Xiaoting; Chen, Meilan; Song, Li; Li, Hanqing; Li, Zhuoyu

    2014-08-01

    Many studies have found a positive association between the progression of hepatocellular carcinoma and DDT exposure. These studies mainly focus on the effect of DDT exposure on cell proliferation and epithelial to mesenchymal transition (EMT) promotion. However, the influence of DDT on cell adhesion of hepatocellular carcinoma remains to be unclear. The aim of our study was to determine the effect of p,p'-DDT on cell adhesion of hepatocellular carcinoma in vitro and in vivo. The data showed that p,p'-DDT, exposing HepG2 cells for 6 days, decreased cell-cell adhesion and elevated cell-matrix adhesion. Strikingly, p,p'-DDT increased reactive oxygen species (ROS) content, and this was accompanied by the activation of JAK/STAT3 pathway. Moreover, ROS inhibitor supplement reversed these effects significantly. However, the addition of ER inhibitor, ICI, had no effect on the p,p'-DDT-induced effects. p,p'-DDT altered the mRNA levels of related adhesion molecules, including inhibition of E-cadherin and promotion of N-cadherin along with CD29. Interestingly, the p,p'-DDT-altered adhesion molecules could be reversed with JAK inhibitor or STAT3 inhibitor. Likewise, p,p'-DDT stimulated the JAK/STAT3 pathway in nude mice, as well as altered the mRNA levels of E-cadherin, N-cadherin, and CD29. Taken together, these results indicate that p,p'-DDT profoundly promotes the adhesion process by decreasing cell-cell adhesion and inducing cell-matrix adhesion via the ROS-mediated JAK/STAT3 pathway. All these events account for the carcinogenic potential of p,p'-DDT in liver. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  7. Premature Osteoblast Clustering by Enamel Matrix Proteins Induces Osteoblast Differentiation through Up-Regulation of Connexin 43 and N-Cadherin

    PubMed Central

    Miron, Richard J.; Hedbom, Erik; Ruggiero, Sabrina; Bosshardt, Dieter D.; Zhang, Yufeng; Mauth, Corinna; Gemperli, Anja C.; Iizuka, Tateyuki; Buser, Daniel; Sculean, Anton

    2011-01-01

    In recent years, enamel matrix derivative (EMD) has garnered much interest in the dental field for its apparent bioactivity that stimulates regeneration of periodontal tissues including periodontal ligament, cementum and alveolar bone. Despite its widespread use, the underlying cellular mechanisms remain unclear and an understanding of its biological interactions could identify new strategies for tissue engineering. Previous in vitro research has demonstrated that EMD promotes premature osteoblast clustering at early time points. The aim of the present study was to evaluate the influence of cell clustering on vital osteoblast cell-cell communication and adhesion molecules, connexin 43 (cx43) and N-cadherin (N-cad) as assessed by immunofluorescence imaging, real-time PCR and Western blot analysis. In addition, differentiation markers of osteoblasts were quantified using alkaline phosphatase, osteocalcin and von Kossa staining. EMD significantly increased the expression of connexin 43 and N-cadherin at early time points ranging from 2 to 5 days. Protein expression was localized to cell membranes when compared to control groups. Alkaline phosphatase activity was also significantly increased on EMD-coated samples at 3, 5 and 7 days post seeding. Interestingly, higher activity was localized to cell cluster regions. There was a 3 fold increase in osteocalcin and bone sialoprotein mRNA levels for osteoblasts cultured on EMD-coated culture dishes. Moreover, EMD significantly increased extracellular mineral deposition in cell clusters as assessed through von Kossa staining at 5, 7, 10 and 14 days post seeding. We conclude that EMD up-regulates the expression of vital osteoblast cell-cell communication and adhesion molecules, which enhances the differentiation and mineralization activity of osteoblasts. These findings provide further support for the clinical evidence that EMD increases the speed and quality of new bone formation in vivo. PMID:21858092

  8. Conventional Matrices Loaded Onto a Graphene Layer Enhances MALDI-TOF/TOF Signal: Its Application to Improve Detection of Phosphorylated Peptides

    NASA Astrophysics Data System (ADS)

    Rodríguez, Carlos E.; Palacios, Javier; Fajardo, Ignacio; Urdiales, José Luis; Le Guével, Xavier; Lozano, José; Sánchez-Jiménez, Francisca

    2016-02-01

    This is the first study where graphene is used as a MALDI adjuvant in combination with the traditional matrix α-cyano-4-hydroxycinnamic acid (CHCA) to improve the signal intensity of peptide samples. Use of this amended matrix not only leads to increased signals but also to a higher number of peaks detected in complex samples. Additionally, the use of graphene has a stabilizing effect that can also be exploited to improve the detection of easily cleavable molecules.

  9. Density matrix approach to the hot-electron stimulated photodesorption

    NASA Astrophysics Data System (ADS)

    Kühn, Oliver; May, Volkhard

    1996-07-01

    The dissipative dynamics of the laser-induced nonthermal desorption of small molecules from a metal surface is investigated here. Based on the density matrix formalism a multi-state model is introduced which explicitly takes into account the continuum of electronic states in the metal. Various relaxation mechanisms for the electronic degrees of freedom are shown to govern the desorption dynamics and hence the desorption probability. Particular attention is paid to the modeling of the time dependence of the electron energy distribution in the metal which reflects different excitation conditions.

  10. The semantic architecture of the World-Wide Molecular Matrix (WWMM)

    PubMed Central

    2011-01-01

    The World-Wide Molecular Matrix (WWMM) is a ten year project to create a peer-to-peer (P2P) system for the publication and collection of chemical objects, including over 250, 000 molecules. It has now been instantiated in a number of repositories which include data encoded in Chemical Markup Language (CML) and linked by URIs and RDF. The technical specification and implementation is now complete. We discuss the types of architecture required to implement nodes in the WWMM and consider the social issues involved in adoption. PMID:21999475

  11. The semantic architecture of the World-Wide Molecular Matrix (WWMM).

    PubMed

    Murray-Rust, Peter; Adams, Sam E; Downing, Jim; Townsend, Joe A; Zhang, Yong

    2011-10-14

    The World-Wide Molecular Matrix (WWMM) is a ten year project to create a peer-to-peer (P2P) system for the publication and collection of chemical objects, including over 250, 000 molecules. It has now been instantiated in a number of repositories which include data encoded in Chemical Markup Language (CML) and linked by URIs and RDF. The technical specification and implementation is now complete. We discuss the types of architecture required to implement nodes in the WWMM and consider the social issues involved in adoption.

  12. Detection of biological molecules using chemical amplification and optical sensors

    DOEpatents

    Van Antwerp, William Peter; Mastrototaro, John Joseph

    2001-01-01

    Methods are provided for the determination of the concentration of biological levels of polyhydroxylated compounds, particularly glucose. The methods utilize an amplification system that is an analyte transducer immobilized in a polymeric matrix, where the system is implantable and biocompatible. Upon interrogation by an optical system, the amplification system produces a signal capable of detection external to the skin of the patient. Quantitation of the analyte of interest is achieved by measurement of the emitted signal. Specifically, the analyte transducer immobilized in a polymeric matrix can be a boronic acid moiety.

  13. Design of UV laser pulses for the preparation of matrix isolated homonuclear diatomic molecules in selective vibrational superposition states.

    PubMed

    Korolkov, M V; Manz, J

    2007-05-07

    The preparation of matrix isolated homonuclear diatomic molecules in a vibrational superposition state c0Phie=1,v=0+cjPhie=1,v=j, with large (|c0|2 approximately 1) plus small contributions (|cj|2<1) of the ground v=0 and specific v=j low excited vibrational eigenstates, respectively, in the electronic ground (e=1) state, and without any net population transfer to electronic excited (e>1) states, is an important challenge; it serves as a prerequisite for coherent spin control. For this purpose, the authors investigate two scenarios of laser pulse control, involving sequential or intrapulse pump- and dump-type transitions via excited vibronic states Phiex,k with a dominant singlet or triplet character. The mechanisms are demonstrated by means of quantum simulations for representative nuclear wave packets on coupled potential energy surfaces, using as an example a one-dimensional model for Cl2 in an Ar matrix. A simple three-state model (including Phi1,0, Phi1,j and Phiex,k) allows illuminating analyses and efficient determinations of the parameters of the laser pulses based on the values of the transition energies and dipole couplings of the transient state which are derived from the absorption spectra.

  14. Learning from Synthetic Models of Extracellular Matrix; Differential Binding of Wild Type and Amyloidogenic Human Apolipoprotein A-I to Hydrogels Formed from Molecules Having Charges Similar to Those Found in Natural GAGs.

    PubMed

    Rosú, Silvana A; Toledo, Leandro; Urbano, Bruno F; Sanchez, Susana A; Calabrese, Graciela C; Tricerri, M Alejandra

    2017-08-01

    Among other components of the extracellular matrix (ECM), glycoproteins and glycosaminoglycans (GAGs) have been strongly associated to the retention or misfolding of different proteins inducing the formation of deposits in amyloid diseases. The composition of these molecules is highly diverse and a key issue seems to be the equilibrium between physiological and pathological events. In order to have a model in which the composition of the matrix could be finely controlled, we designed and synthesized crosslinked hydrophilic polymers, the so-called hydrogels varying the amounts of negative charges and hydroxyl groups that are prevalent in GAGs. We checked and compared by fluorescence techniques the binding of human apolipoprotein A-I and a natural mutant involved in amyloidosis to the hydrogel scaffolds. Our results indicate that both proteins are highly retained as long as the negative charge increases, and in addition it was shown that the mutant is more retained than the Wt, indicating that the retention of specific proteins in the ECM could be part of the pathogenicity. These results show the importance of the use of these polymers as a model to get deep insight into the studies of proteins within macromolecules.

  15. Impacts of compression on crystallization behavior of freeze-dried amorphous sucrose.

    PubMed

    Imamura, Koreyoshi; Nomura, Mayo; Tanaka, Kazuhiro; Kataoka, Nobuhide; Oshitani, Jun; Imanaka, Hiroyuki; Nakanishi, Kazuhiro

    2010-03-01

    An amorphous matrix comprised of sugar molecules is used as excipient and stabilizing agent for labile ingredients in the pharmaceutical industry. The amorphous sugar matrix is often compressed into a tablet form to reduce the volume and improve handling. Herein, the effect of compression on the crystallization behavior of an amorphous sucrose matrix was investigated. Amorphous sucrose samples were prepared by freeze-drying and compressed under different conditions, followed by analyses by differential scanning calorimetry, isothermal crystallization tests, X-ray powder diffractometry, Fourier transform infrared spectroscopy (FTIR), and gas pycnometry. The compressed sample had a lower crystallization temperature and a shorter induction period for isothermal crystallization, indicating that compression facilitates the formation of the critical nucleus of a sucrose crystal. Based on FTIR and molecular dynamics simulation results, the conformational distortion of sucrose molecules due to the compression appears to contribute to the increase in the free energy of the system, which leads to the facilitation of critical nucleus formation. An isothermal crystallization test indicated an increase in the growth rate of sucrose crystals by the compression. This can be attributed to the transformation of the microstructure from porous to nonporous, as the result of compression. 2009 Wiley-Liss, Inc. and the American Pharmacists Association

  16. Accelerated 2D magnetic resonance spectroscopy of single spins using matrix completion

    NASA Astrophysics Data System (ADS)

    Scheuer, Jochen; Stark, Alexander; Kost, Matthias; Plenio, Martin B.; Naydenov, Boris; Jelezko, Fedor

    2015-12-01

    Two dimensional nuclear magnetic resonance (NMR) spectroscopy is one of the major tools for analysing the chemical structure of organic molecules and proteins. Despite its power, this technique requires long measurement times, which, particularly in the recently emerging diamond based single molecule NMR, limits its application to stable samples. Here we demonstrate a method which allows to obtain the spectrum by collecting only a small fraction of the experimental data. Our method is based on matrix completion which can recover the full spectral information from randomly sampled data points. We confirm experimentally the applicability of this technique by performing two dimensional electron spin echo envelope modulation (ESEEM) experiments on a two spin system consisting of a single nitrogen vacancy (NV) centre in diamond coupled to a single 13C nuclear spin. The signal to noise ratio of the recovered 2D spectrum is compared to the Fourier transform of randomly subsampled data, where we observe a strong suppression of the noise when the matrix completion algorithm is applied. We show that the peaks in the spectrum can be obtained with only 10% of the total number of the data points. We believe that our results reported here can find an application in all types of two dimensional spectroscopy, as long as the measured matrices have a low rank.

  17. Molecular deformation mechanisms of the wood cell wall material.

    PubMed

    Jin, Kai; Qin, Zhao; Buehler, Markus J

    2015-02-01

    Wood is a biological material with outstanding mechanical properties resulting from its hierarchical structure across different scales. Although earlier work has shown that the cellular structure of wood is a key factor that renders it excellent mechanical properties at light weight, the mechanical properties of the wood cell wall material itself still needs to be understood comprehensively. The wood cell wall material features a fiber reinforced composite structure, where cellulose fibrils act as stiff fibers, and hemicellulose and lignin molecules act as soft matrix. The angle between the fiber direction and the loading direction has been found to be the key factor controlling the mechanical properties. However, how the interactions between theses constitutive molecules contribute to the overall properties is still unclear, although the shearing between fibers has been proposed as a primary deformation mechanism. Here we report a molecular model of the wood cell wall material with atomistic resolution, used to assess the mechanical behavior under shear loading in order to understand the deformation mechanisms at the molecular level. The model includes an explicit description of cellulose crystals, hemicellulose, as well as lignin molecules arranged in a layered nanocomposite. The results obtained using this model show that the wood cell wall material under shear loading deforms in an elastic and then plastic manner. The plastic regime can be divided into two parts according to the different deformation mechanisms: yielding of the matrix and sliding of matrix along the cellulose surface. Our molecular dynamics study provides insights of the mechanical behavior of wood cell wall material at the molecular level, and paves a way for the multi-scale understanding of the mechanical properties of wood. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues.

    PubMed

    Foldager, Casper Bindzus; Toh, Wei Seong; Gomoll, Andreas H; Olsen, Bjørn Reino; Spector, Myron

    2014-04-01

    The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti-collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM.

  19. Multifunctional effect of epigallocatechin-3-gallate (EGCG) in downregulation of gelatinase-A (MMP-2) in human breast cancer cell line MCF-7.

    PubMed

    Sen, Triparna; Moulik, Shuvojit; Dutta, Anindita; Choudhury, Paromita Roy; Banerji, Aniruddha; Das, Shamik; Roy, Madhumita; Chatterjee, Amitava

    2009-02-13

    The tumor inhibiting property of green tea polyphenol epigallocatechin-3-gallate (EGCG) is well documented. Studies reveal that matrix-metalloproteinases (MMPs) play pivotal roles in tumor invasion through degradation of basement membranes and extracellular matrix (ECM). We studied the effect of EGCG on matrixmetalloproteinases-2 (MMP-2), the factors involved in activation, secretion and signaling molecules that might be involved in the regulation of MMP-2 in human breast cancer cell line, MCF-7. MCF-7 was treated with EGCG (20 muM, 24 h), the effect of EGCG on MMP-2 expression, activity and its regulatory molecules were studied by gelatin zymography, Western blot, quantitative and semi-quantitative real time RT-PCR, immunoflourescence and cell adhesion assay. EGCG treatment reduced the activity, protein expression and mRNA expression level of MMP-2. EGCG treatment reduced the expression of focal adhesion kinase (FAK), membrane type-1-matrix metalloproteinase (MT1-MMP), nuclear factor-kappa B (NF-kB), vascular endothelial growth factor (VEGF) and reduced the adhesion of MCF-7 cells to ECM, fibronectin and vitronectin. Real time RT-PCR revealed a reduced expression of integrin receptors alpha5, beta1, alphav and beta3 due to EGCG treatment. Down regulation of expression of MT1-MMP, NF-kB, VEGF and disruption of functional status of integrin receptors may indicate decreased MMP-2 activation; low levels of FAK expression might indicate disruption in FAK-induced MMP-2 secretion and decrease in activation of phosphatidyl-inositol-3-kinase (PI-3K), extracellular regulated kinase (ERK) indicates probable hindrance in MMP-2 regulation and induction. We propose EGCG as potential inhibitor of expression and activity of pro-MMP-2 by a process involving multiple regulatory molecules in MCF-7.

  20. Matrix effect on vibrational frequencies: Experiments and simulations for HCl and HNgCl (Ng = Kr and Xe)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kalinowski, Jaroslaw; Räsänen, Markku; Lignell, Antti

    2014-03-07

    We study the environmental effect on molecules embedded in noble-gas (Ng) matrices. The experimental data on HXeCl and HKrCl in Ng matrices is enriched. As a result, the H−Xe stretching bands of HXeCl are now known in four Ng matrices (Ne, Ar, Kr, and Xe), and HKrCl is now known in Ar and Kr matrices. The order of the H−Xe stretching frequencies of HXeCl in different matrices is ν(Ne) < ν(Xe) < ν(Kr) < ν(Ar), which is a non-monotonous function of the dielectric constant, in contrast to the “classical” order observed for HCl: ν(Xe) < ν(Kr) < ν(Ar) < ν(Ne).more » The order of the H−Kr stretching frequencies of HKrCl is consistently ν(Kr) < ν(Ar). These matrix effects are analyzed theoretically by using a number of quantum chemical methods. The calculations on these molecules (HCl, HXeCl, and HKrCl) embedded in single Ng{sup ′} layer cages lead to very satisfactory results with respect to the relative matrix shifts in the case of the MP4(SDQ) method whereas the B3LYP-D and MP2 methods fail to fully reproduce these experimental results. The obtained order of frequencies is discussed in terms of the size available for the Ng hydrides in the cages, probably leading to different stresses on the embedded molecule. Taking into account vibrational anharmonicity produces a good agreement of the MP4(SDQ) frequencies of HCl and HXeCl with the experimental values in different matrices. This work also highlights a number of open questions in the field.« less

  1. Presynaptic neurones may contribute a unique glycoprotein to the extracellular matrix at the synapse

    NASA Astrophysics Data System (ADS)

    Caroni, Pico; Carlson, Steven S.; Schweitzer, Erik; Kelly, Regis B.

    1985-04-01

    As the extracellular matrix at the original site of a neuromuscular junction seems to play a major part in the specificity of synaptic regeneration1-5, considerable attention has been paid to unique molecules localized to this region6-11. Here we describe an extracellular matrix glycoprotein of the elasmobranch electric organ that is localized near the nerve endings. By immunological criteria, it is synthesized in the cell bodies, transported down the axons and is related to a glycoprotein in the synaptic vesicles of the neurones that innervate the electric organ. It is apparently specific for these neurones, as it cannot be detected elsewhere in the nervous system of the fish. Therefore, neurones seem to contribute unique extracellular matrix glycoproteins to the synaptic region. Synaptic vesicles could be involved in transporting these glycoproteins to or from the nerve terminal surface.

  2. Two-dimensional enzyme diffusion in laterally confined DNA monolayers.

    PubMed

    Castronovo, Matteo; Lucesoli, Agnese; Parisse, Pietro; Kurnikova, Anastasia; Malhotra, Aseem; Grassi, Mario; Grassi, Gabriele; Scaggiante, Bruna; Casalis, Loredana; Scoles, Giacinto

    2011-01-01

    Addressing the effects of confinement and crowding on biomolecular function may provide insight into molecular mechanisms within living organisms, and may promote the development of novel biotechnology tools. Here, using molecular manipulation methods, we investigate restriction enzyme reactions with double-stranded (ds)DNA oligomers confined in relatively large (and flat) brushy matrices of monolayer patches of controlled, variable density. We show that enzymes from the contacting solution cannot access the dsDNAs from the top-matrix interface, and instead enter at the matrix sides to diffuse two-dimensionally in the gap between top- and bottom-matrix interfaces. This is achieved by limiting lateral access with a barrier made of high-density molecules that arrest enzyme diffusion. We put forward, as a possible explanation, a simple and general model that relates these data to the steric hindrance in the matrix, and we briefly discuss the implications and applications of this strikingly new phenomenon.

  3. Matrix Assisted Ionization Vacuum (MAIV), a New Ionization Method for Biological Materials Analysis Using Mass Spectrometry*

    PubMed Central

    Inutan, Ellen D.; Trimpin, Sarah

    2013-01-01

    The introduction of electrospray ionization (ESI) and matrix-assisted laser desorption/ionization (MALDI) for the mass spectrometric analysis of peptides and proteins had a dramatic impact on biological science. We now report that a wide variety of compounds, including peptides, proteins, and protein complexes, are transported directly from a solid-state small molecule matrix to gas-phase ions when placed into the vacuum of a mass spectrometer without the use of high voltage, a laser, or added heat. This ionization process produces ions having charge states similar to ESI, making the method applicable for high performance mass spectrometers designed for atmospheric pressure ionization. We demonstrate highly sensitive ionization using intermediate pressure MALDI and modified ESI sources. This matrix and vacuum assisted soft ionization method is suitable for the direct surface analysis of biological materials, including tissue, via mass spectrometry. PMID:23242551

  4. Soft-landing ion mobility of silver clusters for small-molecule matrix-assisted laser desorption ionization mass spectrometry and imaging of latent fingerprints.

    PubMed

    Walton, Barbara L; Verbeck, Guido F

    2014-08-19

    Matrix-assisted laser desorption ionization (MALDI) imaging is gaining popularity, but matrix effects such as mass spectral interference and damage to the sample limit its applications. Replacing traditional matrices with silver particles capable of equivalent or increased photon energy absorption from the incoming laser has proven to be beneficial for low mass analysis. Not only can silver clusters be advantageous for low mass compound detection, but they can be used for imaging as well. Conventional matrix application methods can obstruct samples, such as fingerprints, rendering them useless after mass analysis. The ability to image latent fingerprints without causing damage to the ridge pattern is important as it allows for further characterization of the print. The application of silver clusters by soft-landing ion mobility allows for enhanced MALDI and preservation of fingerprint integrity.

  5. Provisional matrix: A role for versican and hyaluronan.

    PubMed

    Wight, Thomas N

    2017-07-01

    Hyaluronan and versican are extracellular matrix (ECM) components that are enriched in the provisional matrices that form during the early stages of development and disease. These two molecules interact to create pericellular "coats" and "open space" that facilitate cell sorting, proliferation, migration, and survival. Such complexes also impact the recruitment of leukocytes during development and in the early stages of disease. Once thought to be inert components of the ECM that help hold cells together, it is now quite clear that they play important roles in controlling cell phenotype, shaping tissue response to injury and maintaining tissue homeostasis. Conversion of hyaluronan-/versican-enriched provisional matrix to collagen-rich matrix is a "hallmark" of tissue fibrosis. Targeting the hyaluronan and versican content of provisional matrices in a variety of diseases including, cardiovascular disease and cancer, is becoming an attractive strategy for intervention. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Matrix-assisted relaxation in Fe(phen)2(NCS)2 spin-crossover microparticles, experimental and theoretical investigations

    NASA Astrophysics Data System (ADS)

    Enachescu, Cristian; Tanasa, Radu; Stancu, Alexandru; Tissot, Antoine; Laisney, Jérôme; Boillot, Marie-Laure

    2016-07-01

    In this study, we present the influence of the embedding matrix on the relaxation of Fe(phen)2(NCS)2 (phen = 1,10-phenanthroline) spin-transition microparticles as revealed by experiments and provide an explanation within the framework of an elastic model based on a Monte-Carlo method. Experiments show that the shape of the high-spin → low-spin relaxation curves is drastically changed when the particles are dispersed in glycerol. This effect was considered in the model by means of interactions between the microparticles and the matrix. A faster start of the relaxation for microparticles embedded in glycerol is due to an initial positive local pressure acting on the edge spin-crossover molecules from the matrix side. This local pressure diminishes and eventually becomes negative during relaxation, as an effect of the decrease of the volume of spin-crossover microparticles from high-spin to low-spin.

  7. Area laser crystallized LTPS TFTs with implanted contacts for active matrix OLED displays

    NASA Astrophysics Data System (ADS)

    Persidis, Efstathios; Baur, Holger; Pieralisi, Fabio; Schalberger, Patrick; Fruehauf, Norbert

    2008-03-01

    We have developed a four mask low temperature poly-Si (LTPS) TFT process for p- and n-channel devices. Our PECVD deposited amorphous silicon is recrystallized to polycrystalline silicon with single area excimer laser crystallization while formation of drain and source is carried out with self aligned ion beam implantation. We have investigated implantation parameters, suitability of various metallizations as well as laser activation and annealing procedures. To prove the potential capability of our devices, which are suitable for conventional and inverted OLEDs alike, we have produced several functional active matrix backplanes implementing different pixel circuits. Our active matrix backplane process has been customized to drive small molecules as well as polymers, regardless if top or bottom emitting.

  8. Immunological detection of small organic molecules in the presence of perchlorates: relevance to the life marker chip and life detection on Mars.

    PubMed

    Rix, Catherine S; Sims, Mark R; Cullen, David C

    2011-11-01

    The proposed ExoMars mission, due to launch in 2018, aims to look for evidence of extant and extinct life in martian rocks and regolith. Previous attempts to detect organic molecules of biological or abiotic origin on Mars have been unsuccessful, which may be attributable to destruction of these molecules by perchlorate salts during pyrolysis sample extraction techniques. Organic molecules can also be extracted and measured with solvent-based systems. The ExoMars payload includes the Life Marker Chip (LMC) instrument, capable of detecting biomarker molecules of extant and extinct Earth-like life in liquid extracts of martian samples with an antibody microarray assay. The aim of the work reported here was to investigate whether the presence of perchlorate salts, at levels similar to those at the NASA Phoenix landing site, would compromise the LMC extraction and detection method. To test this, we implemented an LMC-representative sample extraction process with an LMC-representative antibody assay and used these to extract and analyze a model sample that consisted of a Mars analog sample matrix (JSC Mars-1) spiked with a representative organic molecular target (pyrene, an example of abiotic meteoritic infall targets) in the presence of perchlorate salts. We found no significant change in immunoassay function when using pyrene standards with added perchlorate salts. When model samples spiked with perchlorate salts were subjected to an LMC-representative liquid extraction, immunoassays functioned in a liquid extract and detected extracted pyrene. For the same model sample matrix without perchlorate salts, we observed anomalous assay signals that coincided with yellow coloration of the extracts. This unexpected observation is being studied further. This initial study indicates that the presence of perchlorate salts, at levels similar to those detected at the NASA Phoenix landing site, is unlikely to prevent the LMC from extracting and detecting organic molecules from martian samples.

  9. Matrix-free and material-enhanced laser desorption/ionization mass spectrometry for the analysis of low molecular weight compounds.

    PubMed

    Rainer, Matthias; Qureshi, Muhammad Nasimullah; Bonn, Günther Karl

    2011-06-01

    The application of matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) for the analysis of low molecular weight (LMW) compounds, such as pharmacologically active constituents or metabolites, is usually hampered by employing conventional MALDI matrices owing to interferences caused by matrix molecules below 700 Da. As a consequence, interpretation of mass spectra remains challenging, although matrix suppression can be achieved under certain conditions. Unlike the conventional MALDI methods which usually suffer from background signals, matrix-free techniques have become more and more popular for the analysis of LMW compounds. In this review we describe recently introduced materials for laser desorption/ionization (LDI) as alternatives to conventionally applied MALDI matrices. In particular, we want to highlight a new method for LDI which is referred to as matrix-free material-enhanced LDI (MELDI). In matrix-free MELDI it could be clearly shown, that besides chemical functionalities, the material's morphology plays a crucial role regarding energy-transfer capabilities. Therefore, it is of great interest to also investigate parameters such as particle size and porosity to study their impact on the LDI process. Especially nanomaterials such as diamond-like carbon, C(60) fullerenes and nanoparticulate silica beads were found to be excellent energy-absorbing materials in matrix-free MELDI.

  10. Graphene as a Novel Matrix for the Analysis of Small Molecules by MALDI-TOF MS

    PubMed Central

    Dong, Xiaoli; Cheng, Jinsheng; Li, Jinghong; Wang, Yinsheng

    2010-01-01

    Graphene was utilized for the first time as matrix for the analysis of low-molecular weight compounds using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Polar compounds including amino acids, polyamines, anticancer drugs and nucleosides could be successfully analyzed. Additionally, nonpolar compounds including steroids could be detected with high resolution and sensitivity. Compared with conventional matrix, graphene exhibited high desorption/ionization efficiency for nonpolar compounds. The graphene matrix functions as substrate to trap analytes, and it transfers energy to the analytes upon laser irradiation, which allowed for the analytes to be readily desorbed/ionized and interference of intrinsic matrix ions to be eliminated. The use of graphene as matrix avoided the fragmentation of analytes and provided good reproducibility and high salt tolerance, underscoring the potential application of graphene as matrix for MALDI-MS analysis of practical samples in complex sample matrices. We also demonstrated that the use of graphene as adsorbent for the solid-phase extraction of squalene could improve greatly the detection limit. This work not only opens a new field for applications of graphene, but also offers a new technique for high-speed analysis of low-molecular weight compounds in areas such as metabolism research and natural products characterization. PMID:20565059

  11. Automated MALDI matrix deposition method with inkjet printing for imaging mass spectrometry.

    PubMed

    Baluya, Dodge L; Garrett, Timothy J; Yost, Richard A

    2007-09-01

    Careful matrix deposition on tissue samples for matrix-assisted laser desorption/ionization (MALDI) is critical for producing reproducible analyte ion signals. Traditional methods for matrix deposition are often considered an art rather than a science, with significant sample-to-sample variability. Here we report an automated method for matrix deposition, employing a desktop inkjet printer (<$200) with 5760 x 1440 dpi resolution and a six-channel piezoelectric head that delivers 3 pL/drop. The inkjet printer tray, designed to hold CDs and DVDs, was modified to hold microscope slides. Empty ink cartridges were filled with MALDI matrix solutions, including DHB in methanol/water (70:30) at concentrations up to 40 mg/mL. Various samples (including rat brain tissue sections and standards of small drug molecules) were prepared using three deposition methods (electrospray, airbrush, inkjet). A linear ion trap equipped with an intermediate-pressure MALDI source was used for analyses. Optical microscopic examination showed that matrix crystals were formed evenly across the sample. There was minimal background signal after storing the matrix in the cartridges over a 6-month period. Overall, the mass spectral images gathered from inkjet-printed tissue specimens were of better quality and more reproducible than from specimens prepared by the electrospray and airbrush methods.

  12. Incorporation of zero valent iron nanoparticles in the matrix of cationic resin beads for the remediation of Cr(VI) contaminated waters.

    PubMed

    Toli, Aikaterini; Chalastara, Konstantina; Mystrioti, Christiana; Xenidis, Anthimos; Papassiopi, Nymphodora

    2016-07-01

    The objective of present study was to obtain the fixation of nano zero valent iron (nZVI) particles on a permeable matrix and evaluate the performance of this composite material for the removal of Cr(VI) from contaminated waters. The experiments were carried out using the cationic resin Dowex 50WX2 as porous support of the iron nanoparticles. The work was carried out in two phases. The first phase involved the fixation of nZVI on the resin matrix. The resin granules were initially mixed with a FeCl3 solution to obtain the adsorption of Fe(III). Then the Fe(III) loaded resin (RFe) was treated with polyphenol solutions to obtain the reduction of Fe(III) to the elemental state. Two polyphenol solutions were tested as reductants, i.e. green tea extract and gallic acid. Green tea was found to be inefficient, probably due to the relatively big size of the contained polyphenol molecules, but gallic acid molecules were able to reach adsorbed Fe(III) and reduce the cations to the elemental state. The second phase was focused on the investigation of Cr(VI) reduction kinetics using the nanoiron loaded resins (R-nFe). It was found that the reduction follows a kinetic law of first order with respect to Cr(VI) and to the embedded nanoiron. Compared to other similar products, this composite material was found to have comparable performance regarding reaction rates and higher degree of iron utilization. Namely the rate constant for the reduction of Cr(VI), in the presence of 1 mM nZVI, was equivalent to 1.4 h of half-life time at pH 3.2 and increased to 24 h at pH 8.5. The degree of iron utilization was as high as 0.8 mol of reduced Cr(VI) per mole of iron. It was also found that this composite material can be easily regenerated and reused for Cr(VI) reduction without significant loss of efficiency. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Shortwave-infrared Raman spectroscopic classification of water fractions in articular cartilage ex vivo

    NASA Astrophysics Data System (ADS)

    Unal, Mustafa; Akkus, Ozan

    2018-01-01

    Water loss is an early onset indicator of osteoarthritis. Although Raman spectroscopy (RS) holds the potential for measurement of cartilage hydration, the knowledge of Raman OH-stretch bands of biological tissue is very limited. We assesed here the sensitivity of RS to identify and classify water types in the cartilage. Raman spectrum measurements over the high wavenumber range were employed to identify different water fractions in articular cartilage. Raman spectra were collected from wet and sequentially dehydrated cartilage along with pure collagen type II and chondroitin sulfate standards. OH-stretch band of cartilage is dominated by mobile water, up to 95% of total intensities. We identified six peaks in cartilage spectrum using second-derivative analysis: peaks at 3200 and 3650 cm-1 are associated with organic matrix (both collagen and proteglycan) and matrix-bound water molecules. Peaks at 3250, 3453, and 3630 cm-1 are associated with collagen and collagen-related water molecules, whereas the peak at 3520 cm-1 is associated with proteoglycan (PG) and PG-related water molecules. The current work is the first thorough analysis of the Raman OH-stretch band of the cartilage and with the knowledge generated by this study, it may now be possible to study on cartilage hydration by RS.

  14. Proteoglycans and neuronal migration in the cerebral cortex during development and disease

    PubMed Central

    Maeda, Nobuaki

    2015-01-01

    Chondroitin sulfate proteoglycans and heparan sulfate proteoglycans are major constituents of the extracellular matrix and the cell surface in the brain. Proteoglycans bind with many proteins including growth factors, chemokines, axon guidance molecules, and cell adhesion molecules through both the glycosaminoglycan and the core protein portions. The functions of proteoglycans are flexibly regulated due to the structural variability of glycosaminoglycans, which are generated by multiple glycosaminoglycan synthesis and modifying enzymes. Neuronal cell surface proteoglycans such as PTPζ, neuroglycan C and syndecan-3 function as direct receptors for heparin-binding growth factors that induce neuronal migration. The lectican family, secreted chondroitin sulfate proteoglycans, forms large aggregates with hyaluronic acid and tenascins, in which many signaling molecules and enzymes including matrix proteases are preserved. In the developing cerebrum, secreted chondroitin sulfate proteoglycans such as neurocan, versican and phosphacan are richly expressed in the areas that are strategically important for neuronal migration such as the striatum, marginal zone, subplate and subventricular zone in the neocortex. These proteoglycans may anchor various attractive and/or repulsive cues, regulating the migration routes of inhibitory neurons. Recent studies demonstrated that the genes encoding proteoglycan core proteins and glycosaminoglycan synthesis and modifying enzymes are associated with various psychiatric and intellectual disorders, which may be related to the defects of neuronal migration. PMID:25852466

  15. Coffee-ring effects in laser desorption/ionization mass spectrometry.

    PubMed

    Hu, Jie-Bi; Chen, Yu-Chie; Urban, Pawel L

    2013-03-05

    This report focuses on the heterogeneous distribution of small molecules (e.g. metabolites) within dry deposits of suspensions and solutions of inorganic and organic compounds with implications for chemical analysis of small molecules by laser desorption/ionization (LDI) mass spectrometry (MS). Taking advantage of the imaging capabilities of a modern mass spectrometer, we have investigated the occurrence of "coffee rings" in matrix-assisted laser desorption/ionization (MALDI) and surface-assisted laser desorption/ionization (SALDI) sample spots. It is seen that the "coffee-ring effect" in MALDI/SALDI samples can be both beneficial and disadvantageous. For example, formation of the coffee rings gives rise to heterogeneous distribution of analytes and matrices, thus compromising analytical performance and reproducibility of the mass spectrometric analysis. On the other hand, the coffee-ring effect can also be advantageous because it enables partial separation of analytes from some of the interfering molecules present in the sample. We report a "hidden coffee-ring effect" where under certain conditions the sample/matrix deposit appears relatively homogeneous when inspected by optical microscopy. Even in such cases, hidden coffee rings can still be found by implementing the MALDI-MS imaging technique. We have also found that to some extent, the coffee-ring effect can be suppressed during SALDI sample preparation. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Mechanistic evaluation of alginate-HEC gelisphere compacts for controlled intrastriatal nicotine release in Parkinson's disease.

    PubMed

    Choonara, Yahya E; Pillay, Viness; Khan, Riaz A; Singh, Neha; du Toit, Lisa C

    2009-06-01

    This study focused on elucidating a mechanistic understanding in support of the multiple mechanisms which govern the formation of crosslinked alginate-hydroxyethylcellulose (Alg-HEC) gelispheres intended for the controlled intrastriatal release of nicotine as a neuroprotectant in Parkinson's Disease. HEC was incorporated as a reinforcing "protective" colloidal polymer to induce interactions between the free carboxyl groups of alginate with hydroxylated HEC monomers. Gelispheres were compressed within an external poly(lactic-co-glycolic acid) (PLGA) matrix to further prolong the release of nicotine. Sol-gel interconversion mechanisms, matrix deformability moduli, matrix fracture energies and chemometric models of the associated energy paradigms were analyzed for their influence on the mechanism and extent of nicotine release. Textural profiling demonstrated higher fracture energies (7.94-26.69 x 10(-4) J) and lower deformability moduli (12.24-58.36 N/mm) when gelispheres were cured in 2 M HCl as a postcuring step. Ba(2+) crosslinked gelispheres resulted in superiorly compact matrices with an increase in volume of 201-329% as compared to the Ca(2+) and Zn(2+) crosslinked matrices. The order of matrix compactness was as follows: Zn(2+) < Ca(2+) < Ba(2+). Molecular mechanisms of formation, interaction, conversion, and stability of sol-gel transitions depended on the type of crosslinker, crosslinking time, energy transactions, and interactions with molecules of the hydration medium. Ba(2+) crosslinked gelispheres released nicotine slower than Ca(2+) and Zn(2+) crosslinked gelispheres due to the higher energy requirement for interconversion to sol while the energy requirements for Ca(2+) and Zn(2+) was at a lower demand. Ba(2+) crosslinked gelispheres within PLGA matrices therefore retarded nicotine release in a pseudo-zero-order manner over 21 days. (c) 2008 Wiley-Liss, Inc.

  17. Contribution of thermal energy to initial ion production in matrix-assisted laser desorption/ionization observed with 2,4,6-trihydroxyacetophenone.

    PubMed

    Lai, Yin-Hung; Chen, Bo-Gaun; Lee, Yuan Tseh; Wang, Yi-Sheng; Lin, Sheng Hsien

    2014-08-15

    Although several reaction models have been proposed in the literature to explain matrix-assisted laser desorption/ionization (MALDI), further study is still necessary to explore the important ionization pathways that occur under the high-temperature environment of MALDI. 2,4,6-Trihydroxyacetophenone (THAP) is an ideal compound for evaluating the contribution of thermal energy to an initial reaction with minimum side reactions. Desorbed neutral THAP and ions were measured using a crossed-molecular beam machine and commercial MALDI-TOF instrument, respectively. A quantitative model incorporating an Arrhenius-type desorption rate derived from transition state theory was proposed. Reaction enthalpy was calculated using GAUSSIAN 03 software with dielectric effect. Additional evidence of thermal-induced proton disproportionation was given by the indirect ionization of THAP embedded in excess fullerene molecules excited by a 450 nm laser. The quantitative model predicted that proton disproportionation of THAP would be achieved by thermal energy converted from a commonly used single UV laser photon. The dielectric effect reduced the reaction Gibbs free energy considerably even when the dielectric constant was reduced under high-temperature MALDI conditions. With minimum fitting parameters, observations of pure THAP and THAP mixed with fullerene both agreed with predictions. Proton disproportionation of solid THAP was energetically favorable with a single UV laser photon. The quantitative model revealed an important initial ionization pathway induced by the abrupt heating of matrix crystals. In the matrix crystals, the dielectric effect reduced reaction Gibbs free energy under typical MALDI conditions. The result suggested that thermal energy plays an important role in the initial ionization reaction of THAP. Copyright © 2014 John Wiley & Sons, Ltd.

  18. Self-energy matrices for electron transport calculations within the real-space finite-difference formalism

    NASA Astrophysics Data System (ADS)

    Tsukamoto, Shigeru; Ono, Tomoya; Hirose, Kikuji; Blügel, Stefan

    2017-03-01

    The self-energy term used in transport calculations, which describes the coupling between electrode and transition regions, is able to be evaluated only from a limited number of the propagating and evanescent waves of a bulk electrode. This obviously contributes toward the reduction of the computational expenses in transport calculations. In this paper, we present a mathematical formula for reducing the computational expenses further without using any approximation and without losing accuracy. So far, the self-energy term has been handled as a matrix with the same dimension as the Hamiltonian submatrix representing the interaction between an electrode and a transition region. In this work, through the singular-value decomposition of the submatrix, the self-energy matrix is handled as a smaller matrix, whose dimension is the rank number of the Hamiltonian submatrix. This procedure is practical in the case of using the pseudopotentials in a separable form, and the computational expenses for determining the self-energy matrix are reduced by 90% when employing a code based on the real-space finite-difference formalism and projector-augmented wave method. In addition, this technique is applicable to the transport calculations using atomic or localized basis sets. Adopting the self-energy matrices obtained from this procedure, we present the calculation of the electron transport properties of C20 molecular junctions. The application demonstrates that the electron transmissions are sensitive to the orientation of the molecule with respect to the electrode surface. In addition, channel decomposition of the scattering wave functions reveals that some unoccupied C20 molecular orbitals mainly contribute to the electron conduction through the molecular junction.

  19. Protein expression and purification of integrin I domains and IgSF ligands for crystallography.

    PubMed

    Zhang, Hongmin; Wang, Jia-Huai

    2012-01-01

    Cell adhesion depends on combinational expression and interactions of a large number of adhesion molecules at cell-to-cell or cell-to-matrix contact sites. Integrins and their immunoglobulin superfamily (IgSF) ligands represent foremost classes of cell adhesion molecules in immune system. Structural study is critical for a better understanding of the interactions between integrins and their IgSF ligands. Here we describe protocols for protein expression of integrin αL I domain and its IgSF ligand ICAM-5 D1D2 fragment for crystallography.

  20. Distance dependence in photo-induced intramolecular electron transfer

    NASA Astrophysics Data System (ADS)

    Larsson, Sven; Volosov, Andrey

    1986-09-01

    The distance dependence of the rate of photo-induced electron transfer reactions is studied. A quantum mechanical method CNDO/S is applied to a series of molecules recently investigated by Hush et al. experimentally. The calculations show a large interaction through the saturated bridge which connects the two chromophores. The electronic matrix element HAB decreases a factor 10 in about 4 Å. There is also a decrease of the rate due to less exothermicity for the longer molecule. The results are in fair agreement with the experimental results.

  1. Fundamental characteristics of degradation-recoverable solid-state DFB polymer laser.

    PubMed

    Yoshioka, Hiroaki; Yang, Yu; Watanabe, Hirofumi; Oki, Yuji

    2012-02-13

    A novel solid-state dye laser with degradation recovery was proposed and demonstrated. Polydimethylsiloxane was used as a nanoporous solid matrix to enable the internal circulation of dye molecules in the solid state. An internal circulation model for the dye molecules was also proposed and verified numerically by assuming molecular mobility and using a proposed diffusion equation. The durability of the laser was increased 20.5-fold compared with that of a conventional polymethylmethacrylate laser. This novel laser solves the low-durability problem of dye-doped polymer lasers.

  2. Toward an alternative hardness kernel matrix structure in the Electronegativity Equalization Method (EEM).

    PubMed

    Chaves, J; Barroso, J M; Bultinck, P; Carbó-Dorca, R

    2006-01-01

    This study presents an alternative of the Electronegativity Equalization Method (EEM), where the usual Coulomb kernel has been transformed into a smooth function. The new framework, as the classical EEM, permits fast calculations of atomic charges in a given molecule for a small computational cost. The original EEM procedure needs to previously calibrate the different implied atomic hardness and electronegativity, using a chosen set of molecules. In the new EEM algorithm half the number of parameters needs to be calibrated, since a relationship between electronegativities and hardnesses has been found.

  3. Smart hydrogels from laterally-grafted peptide assembly.

    PubMed

    Li, Wen; Park, Il-soo; Kang, Seong-Kyun; Lee, Myongsoo

    2012-09-11

    Small peptides carrying laterally-grafted azobenzene units self-assemble into photo-responsive hydrogels which are applied as a smart matrix for controlling the dye molecules release. We demonstrate that a delicate balance among peptides interactions plays a pivotal role in the photo-responsive gel-sol transition.

  4. Organogelator-Cellulose Composite for Practical and Eco-Friendly Marine Oil-Spill Recovery.

    PubMed

    Prathap, Annamalai; Sureshan, Kana M

    2017-08-01

    Marine oil spills pose serious threats to the ecosystem and economy. There is much interest in developing sorbents that can tackle such spills. We have developed a novel sorbent by impregnating cellulose pulp with a sugar-derived oleogelator, 1,2:5,6-di-O-cyclohexylidene-mannitol. The gelator molecules mask the surface-exposed hydroxyl groups of cellulose fibrils by engaging them in H-bonding and expose their hydrophobic parts making the fibers temporarily hydrophobic (water contact angle 110°). This sorbent absorbs oil effectively, selectively and instantly from oil-water mixtures due to its hydrophobicity. Then the gelator molecules get released uniformly in the oil and later self-assemble to fibers, as evident from SEM analysis, congealing the oil within the matrix. This hierarchical entrapment of the oil by non-covalent polymeric fibers within a covalent polymer matrix makes the gel very strong (230-fold increase in the yield stress) and rigid, making it suitable for practical use. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. PAH Spectroscopy: Past, Present and Future

    NASA Technical Reports Server (NTRS)

    Mattioda, Andrew

    2016-01-01

    Since their discovery in the 1970's, astronomers, astrophysicists and astrochemists have been intrigued by the nearly ubiquitous unidentified infrared emission (UIR) bands. In the 1980's, investigators determined the most probably source of these emissions was a family of molecules known as Polycyclic Aromatic Hydrocarbons or simply PAHs. In order to better understand these interstellar IR features and utilize them as chemical probes of the cosmos, laboratory spectroscopists have spent the last three decades investigating the spectroscopy of PAHs under astrophysically relevant conditions. This presentation will discuss the similarities and differences in the spectroscopic properties of PAHs as one goes from the Far to Mid to Near infrared wavelength regions and probe the changes observed in PAH spectra as they go from neutral to ionized molecules suspended in an inert gas matrix, to PAHs in a water ice matrix and as a thin film. In selected instances, the experimental results will be compared to theoretical values. The presentation will conclude with a discussion on the future directions of PAH spectroscopy.

  6. Interstellar matrices: the chemical composition and evolution of interstellar ices as observed by ISO.

    PubMed

    d'Hendecourt, L; Dartois, E

    2001-03-15

    Matrix isolation techniques have been developed in the early sixties as a tool for studying the spectroscopic properties of out of equilibrium species (atoms, radicals, ions, reactive molecules), embedded in rare gas inert matrices at low temperatures. Cold interstellar grains surfaces are able to condense out gas phase molecules, routinely observed by radioastronomy. These grain 'mantles' can be considered as 'interstellar matrices'. However, these matrices are not clean and unreactive. They are made principally of dirty ices whose composition must be determined carefully to assess the importance of the solid state chemistry that takes place in the Interstellar Medium. Infrared spectroscopy, both in astronomy and in the laboratory, is the unique tool to determine the chemical composition of these ices. Astronomical spectra can directly be compared with laboratory ones obtained using classical matrix isolation techniques. Furthermore, dedicated experiments may be undertaken to further improve the understanding of the basic physico-chemical processes that take place in cosmic ices.

  7. Room temperature triplet state spectroscopy of organic semiconductors.

    PubMed

    Reineke, Sebastian; Baldo, Marc A

    2014-01-21

    Organic light-emitting devices and solar cells are devices that create, manipulate, and convert excited states in organic semiconductors. It is crucial to characterize these excited states, or excitons, to optimize device performance in applications like displays and solar energy harvesting. This is complicated if the excited state is a triplet because the electronic transition is 'dark' with a vanishing oscillator strength. As a consequence, triplet state spectroscopy must usually be performed at cryogenic temperatures to reduce competition from non-radiative rates. Here, we control non-radiative rates by engineering a solid-state host matrix containing the target molecule, allowing the observation of phosphorescence at room temperature and alleviating constraints of cryogenic experiments. We test these techniques on a wide range of materials with functionalities spanning multi-exciton generation (singlet exciton fission), organic light emitting device host materials, and thermally activated delayed fluorescence type emitters. Control of non-radiative modes in the matrix surrounding a target molecule may also have broader applications in light-emitting and photovoltaic devices.

  8. Efficient calculation of beyond RPA correlation energies in the dielectric matrix formalism

    NASA Astrophysics Data System (ADS)

    Beuerle, Matthias; Graf, Daniel; Schurkus, Henry F.; Ochsenfeld, Christian

    2018-05-01

    We present efficient methods to calculate beyond random phase approximation (RPA) correlation energies for molecular systems with up to 500 atoms. To reduce the computational cost, we employ the resolution-of-the-identity and a double-Laplace transform of the non-interacting polarization propagator in conjunction with an atomic orbital formalism. Further improvements are achieved using integral screening and the introduction of Cholesky decomposed densities. Our methods are applicable to the dielectric matrix formalism of RPA including second-order screened exchange (RPA-SOSEX), the RPA electron-hole time-dependent Hartree-Fock (RPA-eh-TDHF) approximation, and RPA renormalized perturbation theory using an approximate exchange kernel (RPA-AXK). We give an application of our methodology by presenting RPA-SOSEX benchmark results for the L7 test set of large, dispersion dominated molecules, yielding a mean absolute error below 1 kcal/mol. The present work enables calculating beyond RPA correlation energies for significantly larger molecules than possible to date, thereby extending the applicability of these methods to a wider range of chemical systems.

  9. Study of the sodium phenytoin effect on the formation of sol-gel SiO 2 nanotubes by TEM

    NASA Astrophysics Data System (ADS)

    López, T.; Asomoza, M.; Picquart, M.; Castillo-Ocampo, P.; Manjarrez, J.; Vázquez, A.; Ascencio, J. A.

    2005-04-01

    Microencapsulation is a versatile technology that allows controlling the release of different active molecules. Recently the sol-gel process has emerged like a promising method to immobilization and stabilization of biologically active compounds like enzymes, antigens, microorganisms and drugs. Porous silica and titanium dioxide materials made by low temperature sol-gel processes are promising host matrixes for encapsulation of biological molecules. The preparation of a low-temperature silica sol followed by gelation to neutral pH with water for injection containing the antiepileptic drug is reported here. The structure is very important so the analysis of the new developed material is also reported. Particularly interesting is the presence of nanotubes and microtubes, produced in the inorganic matrix in the presence of the sodium phenytoin. The use of transmission electron microscopy and quantum mechanics molecular simulation allows determining a micelle-like effect during the synthesis of these materials, which controls the size, structure and stability of them.

  10. Nitrogen: A New Class of π-Bonding Partner in Hetero π-Stacking Interaction.

    PubMed

    Ramanathan, N; Sankaran, K; Sundararajan, K

    2017-11-30

    Spectroscopy under isolated conditions at low temperatures is an excellent tool to characterize the aggregates stabilized through weak interactions. Within the framework of weak interactions, the π-stacking interactions are considered unconventional with the limited experimental proofs, wherein the bonding associates are either aromatic and heterocyclic compounds or their combinations. Besides aromatic compounds, π-stacking networks can even be realized with molecules possessing electron rich π-clouds. In this work, the N 2 molecule as a possible π-bonding partner is explored for the first time in which hetero π-stacking was achieved between pyrrole and N 2 precursors. The matrix isolation experiments performed by seeding pyrrole and N 2 mixtures in an Ar matrix at low temperatures with subsequent infrared spectral characterization revealed the generation of adducts stabilized through a π(pyrrole)···π(N 2 ) interaction. Under identical conditions with the likelihood of two competing π-stacking and hydrogen-bonding interactions in pyrrole-N 2 associates, π-stacking dominates energetically over hydrogen-bonding interaction.

  11. Fibronectin domains of extracellular matrix molecule tenascin-C modulate hippocampal learning and synaptic plasticity.

    PubMed

    Strekalova, Tatyana; Sun, Mu; Sibbe, Mirjam; Evers, Matthias; Dityatev, Alexander; Gass, Peter; Schachner, Melitta

    2002-09-01

    The extracellular matrix molecule tenascin-C (TN-C) has been shown to be involved in hippocampal synaptic plasticity in vitro. Here, we describe a deficit in hippocampus-dependent contextual memory in TN-C-deficient mice using the step-down avoidance paradigm. We further show that a fragment of TN-C containing the fibronectin type-III repeats 6-8 (FN6-8), but not a fragment containing repeats 3-5, bound to pyramidal and granule cell somata in the hippocampal formation of C57BL/6J mice and repelled axons of pyramidal neurons when presented as a border in vitro. Injection of the FN6-8 fragment into the hippocampus inhibited retention of memory in the step-down paradigm and reduced levels of long-term potentiation in the CA1 region of the hippocampus. In summary, our data show that TN-C is involved in hippocampus-dependent contextual memory and synaptic plasticity and identify the FN6-8 domain as one of molecular determinants mediating these functions.

  12. Three-dimensional Hessian matrix-based quantitative vascular imaging of rat iris with optical-resolution photoacoustic microscopy in vivo

    NASA Astrophysics Data System (ADS)

    Zhao, Huangxuan; Wang, Guangsong; Lin, Riqiang; Gong, Xiaojing; Song, Liang; Li, Tan; Wang, Wenjia; Zhang, Kunya; Qian, Xiuqing; Zhang, Haixia; Li, Lin; Liu, Zhicheng; Liu, Chengbo

    2018-04-01

    For the diagnosis and evaluation of ophthalmic diseases, imaging and quantitative characterization of vasculature in the iris are very important. The recently developed photoacoustic imaging, which is ultrasensitive in imaging endogenous hemoglobin molecules, provides a highly efficient label-free method for imaging blood vasculature in the iris. However, the development of advanced vascular quantification algorithms is still needed to enable accurate characterization of the underlying vasculature. We have developed a vascular information quantification algorithm by adopting a three-dimensional (3-D) Hessian matrix and applied for processing iris vasculature images obtained with a custom-built optical-resolution photoacoustic imaging system (OR-PAM). For the first time, we demonstrate in vivo 3-D vascular structures of a rat iris with a the label-free imaging method and also accurately extract quantitative vascular information, such as vessel diameter, vascular density, and vascular tortuosity. Our results indicate that the developed algorithm is capable of quantifying the vasculature in the 3-D photoacoustic images of the iris in-vivo, thus enhancing the diagnostic capability of the OR-PAM system for vascular-related ophthalmic diseases in vivo.

  13. Response of human rheumatoid arthritis osteoblasts and osteoclasts to adiponectin.

    PubMed

    Krumbholz, Grit; Junker, Susann; Meier, Florian M P; Rickert, Markus; Steinmeyer, Jürgen; Rehart, Stefan; Lange, Uwe; Frommer, Klaus W; Schett, Georg; Müller-Ladner, Ulf; Neumann, Elena

    2017-01-01

    Adiponectin is an effector molecule in the pathophysiology of rheumatoid arthritis, e.g. by inducing cytokines and matrix degrading enzymes in synovial fibroblasts. There is growing evidence that adiponectin affects osteoblasts and osteoclasts although the contribution to the aberrant bone metabolism in rheumatoid arthritis is unclear. Therefore, the adiponectin effects on rheumatoid arthritis-derived osteoblasts and osteoclasts were evaluated. Adiponectin and its receptors were examined in bone tissue. Primary human osteoblasts and osteoclasts were stimulated with adiponectin and analysed using realtime polymerase chain-reaction and immunoassays. Effects on matrix-production by osteoblasts and differentiation and resorptive activity of osteoclasts were examined. Immunohistochemistry of rheumatoid arthritis bone tissue showed adiponectin expression in key cells of bone remodelling. Adiponectin altered gene expression and cytokine release in osteoblasts and increased IL-8 secretion by osteoclasts. Adiponectin inhibited osterix and induced osteoprotegerin mRNA in osteoblasts. In osteoclasts, MMP-9 and tartrate resistant acid phosphatase expression was increased. Accordingly, mineralisation capacity of osteoblasts decreased whereas resorptive activity of osteoclasts increased. The results confirm the proinflammatory potential of adiponectin and support the idea that adiponectin influences rheumatoid arthritis bone remodelling through alterations in osteoblast and osteoclast.

  14. Synthesis of a Stereochemically Diverse Library of Medium-Sized Lactams and Sultams via SNAr Cycloetherification

    PubMed Central

    Gerard, Baudouin; Duvall, Jeremy R.; Lowe, Jason T.; Murillo, Tiffanie; Wei, Jingqiang; Akella, Lakshmi B.; Marcaurelle, Lisa A.

    2011-01-01

    We have implemented an aldol-based ‘build/couple/pair’ (B/C/P) strategy for the synthesis of stereochemically diverse 8-membered lactam and sultam scaffolds via SNAr cycloetherification. Each scaffold contains two handles, an amine and aryl bromide, for solid-phase diversification via N-capping and Pd-mediated cross coupling. A sparse matrix design strategy that achieves the dual objective of controlling physicochemical properties and selecting diverse library members was implemented. The production of two 8000-membered libraries is discussed including a full analysis of library purity and property distribution. Library diversity was evaluated in comparison to the Molecular Library Small Molecule Repository (MLSMR) through the use of a multi-fusion similarity (MFS) map and principal component analysis (PCA). PMID:21526820

  15. Influence of Molecular Oxygen on Ortho-Para Conversion of Water Molecules

    NASA Astrophysics Data System (ADS)

    Valiev, R. R.; Minaev, B. F.

    2017-07-01

    The mechanism of influence of molecular oxygen on the probability of ortho-para conversion of water molecules and its relation to water magnetization are considered within the framework of the concept of paramagnetic spin catalysis. Matrix elements of the hyperfine ortho-para interaction via the Fermi contact mechanism are calculated, as well as the Maliken spin densities on water protons in H2O and O2 collisional complexes. The mechanism of penetration of the electron spin density into the water molecule due to partial spin transfer from paramagnetic oxygen is considered. The probability of ortho-para conversion of the water molecules is estimated by the quantum chemistry methods. The results obtained show that effective ortho-para conversion of the water molecules is possible during the existence of water-oxygen dimers. An external magnetic field affects the ortho-para conversion rate given that the wave functions of nuclear spin sublevels of the water protons are mixed in the complex with oxygen.

  16. Phase properties of elastic waves in systems constituted of adsorbed diatomic molecules on the (001) surface of a simple cubic crystal

    NASA Astrophysics Data System (ADS)

    Deymier, P. A.; Runge, K.

    2018-03-01

    A Green's function-based numerical method is developed to calculate the phase of scattered elastic waves in a harmonic model of diatomic molecules adsorbed on the (001) surface of a simple cubic crystal. The phase properties of scattered waves depend on the configuration of the molecules. The configurations of adsorbed molecules on the crystal surface such as parallel chain-like arrays coupled via kinks are used to demonstrate not only linear but also non-linear dependency of the phase on the number of kinks along the chains. Non-linear behavior arises for scattered waves with frequencies in the vicinity of a diatomic molecule resonance. In the non-linear regime, the variation in phase with the number of kinks is formulated mathematically as unitary matrix operations leading to an analogy between phase-based elastic unitary operations and quantum gates. The advantage of elastic based unitary operations is that they are easily realizable physically and measurable.

  17. Application of a multivariate normal distribution methodology to the dissociation of doubly ionized molecules: The DMDS (CH3 -SS-CH3 ) case.

    PubMed

    Varas, Lautaro R; Pontes, F C; Santos, A C F; Coutinho, L H; de Souza, G G B

    2015-09-15

    The ion-ion-coincidence mass spectroscopy technique brings useful information about the fragmentation dynamics of doubly and multiply charged ionic species. We advocate the use of a matrix-parameter methodology in order to represent and interpret the entire ion-ion spectra associated with the ionic dissociation of doubly charged molecules. This method makes it possible, among other things, to infer fragmentation processes and to extract information about overlapped ion-ion coincidences. This important piece of information is difficult to obtain from other previously described methodologies. A Wiley-McLaren time-of-flight mass spectrometer was used to discriminate the positively charged fragment ions resulting from the sample ionization by a pulsed 800 eV electron beam. We exemplify the application of this methodology by analyzing the fragmentation and ionic dissociation of the dimethyl disulfide (DMDS) molecule as induced by fast electrons. The doubly charged dissociation was analyzed using the Multivariate Normal Distribution. The ion-ion spectrum of the DMDS molecule was obtained at an incident electron energy of 800 eV and was matrix represented using the Multivariate Distribution theory. The proposed methodology allows us to distinguish information among [CH n SH n ] + /[CH 3 ] + (n = 1-3) fragment ions in the ion-ion coincidence spectra using ion-ion coincidence data. Using the momenta balance methodology for the inferred parameters, a secondary decay mechanism is proposed for the [CHS] + ion formation. As an additional check on the methodology, previously published data on the SiF 4 molecule was re-analyzed with the present methodology and the results were shown to be statistically equivalent. The use of a Multivariate Normal Distribution allows for the representation of the whole ion-ion mass spectrum of doubly or multiply ionized molecules as a combination of parameters and the extraction of information among overlapped data. We have successfully applied this methodology to the analysis of the fragmentation of the DMDS molecule. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  18. Dystroglycan and muscular dystrophies related to the dystrophin-glycoprotein complex.

    PubMed

    Sciandra, Francesca; Bozzi, Manuela; Bianchi, Marzia; Pavoni, Ernesto; Giardina, Bruno; Brancaccio, Andrea

    2003-01-01

    Dystroglycan (DG) is an adhesion molecule composed of two subunits, alpha and beta, that are produced by the post-translational cleavage of a single precursor molecule. DG is a pivotal component of the dystrophin-glycoprotein complex (DGC), which connects the extracellular matrix to the cytoskeleton in skeletal muscle and many other tissues. Some muscular dystrophies are caused by mutations of DGC components, such as dystrophin, sarcoglycan or laminin-2, or also of DGC-associated molecules, such as caveolin-3. DG-null mice died during early embriogenesis and no neuromuscular diseases directly associated to genetic abnormalities of DG were identified so far. However, DG plays a crucial role for muscle integrity since its targeting at the sarcolemma is often perturbed in DGC-related neuromuscular disorders.

  19. Iron hydrides formation in interstellar clouds

    NASA Astrophysics Data System (ADS)

    Bar-Nun, A.; Pasternak, M.; Barrett, P. H.

    1980-07-01

    A recent Moessbauer study with Fe-57 in a solid hydrogen or hydrogen-argon matrix demonstrated the formation of an iron hydride molecule (FeH2) at 2.5-5 K. Following this and other studies, the possible existence of iron hydride molecules in interstellar clouds is proposed. In clouds, the iron hydrides FeH and FeH2 would be formed only on grains, by encounters of H atoms or H2 molecules with Fe atoms which are adsorbed on the grains. The other transition metals, Sc, Ti, V, Cr, Mn, Co, N, Cd and also Cu and Ca form hydrides of the type M-H, which could be responsible, at least in part, for the depletion of these metals in clouds.

  20. Sputtering and detection of large organic molecules from Europa

    NASA Astrophysics Data System (ADS)

    Johnson, R. E.; Sundqvist, B. U. R.

    2018-07-01

    Mass spectroscopy of bio-molecules by heavy ion induced sputtering, which became a practical laboratory procedure, was also suggested as a potential tool for spacecraft studies of targets of interest in astrobiology. With the planning of new missions to Europa, there is renewed interest in the possibility of detecting organic molecules that might have originated in its subsurface ocean and can be sputtered from its surface often intact by impacting energetic heavy ions trapped in Jupiter's magnetosphere. Here we review the laboratory data and modeling bearing on this issue. We then give estimates of the ejection into the gas-phase of trace organic species embedded in an ice matrix on Europa's surface and their possible detection during a flyby mission.

  1. Reaction-diffusion basis of retroviral infectivity

    NASA Astrophysics Data System (ADS)

    Sadiq, S. Kashif

    2016-11-01

    Retrovirus particle (virion) infectivity requires diffusion and clustering of multiple transmembrane envelope proteins (Env3) on the virion exterior, yet is triggered by protease-dependent degradation of a partially occluding, membrane-bound Gag polyprotein lattice on the virion interior. The physical mechanism underlying such coupling is unclear and only indirectly accessible via experiment. Modelling stands to provide insight but the required spatio-temporal range far exceeds current accessibility by all-atom or even coarse-grained molecular dynamics simulations. Nor do such approaches account for chemical reactions, while conversely, reaction kinetics approaches handle neither diffusion nor clustering. Here, a recently developed multiscale approach is considered that applies an ultra-coarse-graining scheme to treat entire proteins at near-single particle resolution, but which also couples chemical reactions with diffusion and interactions. A model is developed of Env3 molecules embedded in a truncated Gag lattice composed of membrane-bound matrix proteins linked to capsid subunits, with freely diffusing protease molecules. Simulations suggest that in the presence of Gag but in the absence of lateral lattice-forming interactions, Env3 diffuses comparably to Gag-absent Env3. Initial immobility of Env3 is conferred through lateral caging by matrix trimers vertically coupled to the underlying hexameric capsid layer. Gag cleavage by protease vertically decouples the matrix and capsid layers, induces both matrix and Env3 diffusion, and permits Env3 clustering. Spreading across the entire membrane surface reduces crowding, in turn, enhancing the effect and promoting infectivity. This article is part of the themed issue 'Multiscale modelling at the physics-chemistry-biology interface'.

  2. Nuclear localization of matrix metalloproteinases.

    PubMed

    Mannello, Ferdinando; Medda, Virginia

    2012-03-01

    Matrix metalloproteinases (MMPs) were originally identified as matrixin proteases that act in the extracellular matrix. Recent works have uncovered nontraditional roles for MMPs in the extracellular space as well as in the cytosol and nucleus. There is strong evidence that subspecialized and compartmentalized matrixins participate in many physiological and pathological cellular processes, in which they can act as both degradative and regulatory proteases. In this review, we discuss the transcriptional and translational control of matrixin expression, their regulation of intracellular sorting, and the structural basis of activation and inhibition. In particular, we highlight the emerging roles of various matrixin forms in diseases. The activity of matrix metalloproteinases is regulated at several levels, including enzyme activation, inhibition, complex formation and compartmentalization. Most MMPs are secreted and have their function in the extracellular environment. MMPs are also found inside cells, both in the nucleus, cytosol and organelles. The role of intracellular located MMPs is still poorly understood, although recent studies have unraveled some of their functions. The localization, activation and activity of MMPs are regulated by their interactions with other proteins, proteoglycan core proteins and / or their glycosaminoglycan chains, as well as other molecules. Complexes formed between MMPs and various molecules may also include interactions with noncatalytic sites. Such exosites are regions involved in substrate processing, localized outside the active site, and are potential binding sites of specific MMP inhibitors. Knowledge about regulation of MMP activity is essential for understanding various physiological processes and pathogenesis of diseases, as well as for the development of new MMP targeting drugs. Copyright © 2011 Elsevier GmbH. All rights reserved.

  3. In vitro comparison of new bisphosphonic acids and zoledronate effects on human gingival fibroblasts viability, inflammation and matrix turnover.

    PubMed

    De Colli, Marianna; Tortorella, Paolo; Marconi, Guya Diletta; Agamennone, Mariangela; Campestre, Cristina; Tauro, Marilena; Cataldi, Amelia; Zara, Susi

    2016-11-01

    Bisphosphonates (BPs) are drugs clinically used in resorptive diseases. It was already proved that some clinically relevant BPs can inhibit a class of enzymes called matrix metalloproteinases (MMPs), required during tissue remodelling. Combining the arylsulfonamide function with the bisphosphonic group, several compounds were synthesized to obtain selective inhibitors of MMPs. The aim of the present study was to compare the effect of zoledronic acid (ZA), the most potent bisphosphonate available as therapy, with new sulfonamide containing BPs in an in vitro model of human gingival fibroblasts (HGFs). Western blot was used to measure procollagen I, β1 integrin MMP-8 and MMP-9, phase contrast and MTT for cell viability; L-lactate-dehydrogenase (LDH) measurement was performed for toxicity evaluation and ELISA for prostaglandin E 2 (PGE 2 ) secretion assessment. When compared with ZA, the treatment with the newly synthesized compounds shows increasing viability, procollagen I expression and decreased expression of β1 integrin in HGFs. Higher levels of released LDH, PGE 2 and MMP-9 expression are recorded in ZA-treated HGFs. Increased levels of MMP-8 are recorded in newly synthesized compounds-treated samples. These findings allowed to conclude that new tested BPs did not affect HGFs viability and adhesion, did not induce cellular toxicity, were not responsible for inflammatory event induction and could preserve the physiological matrix turnover. It could be hypothesized that the new molecules were better tolerated by soft tissues, resulting in lesser side effects.

  4. Therapeutic Potential of Matrix Metalloproteinase Inhibition in Breast Cancer

    PubMed Central

    Raeeszadeh‐Sarmazdeh, Maryam; Radisky, Derek C.

    2017-01-01

    ABSTRACT Matrix metalloproteinases (MMPs) are a family of zinc endopeptidases that cleave nearly all components of the extracellular matrix as well as many other soluble and cell‐associated proteins. MMPs have been implicated in normal physiological processes, including development, and in the acquisition and progression of the malignant phenotype. Disappointing results from a series of clinical trials testing small molecule, broad spectrum MMP inhibitors as cancer therapeutics led to a re‐evaluation of how MMPs function in the tumor microenvironment, and ongoing research continues to reveal that these proteins play complex roles in cancer development and progression. It is now clear that effective targeting of MMPs for therapeutic benefit will require selective inhibition of specific MMPs. Here, we provide an overview of the MMP family and its biological regulators, the tissue inhibitors of metalloproteinases (TIMPs). We then summarize recent research from model systems that elucidate how specific MMPs drive the malignant phenotype of breast cancer cells, including acquisition of cancer stem cell features and induction of the epithelial–mesenchymal transition, and we also outline clinical studies that implicate specific MMPs in breast cancer outcomes. We conclude by discussing ongoing strategies for development of inhibitors with therapeutic potential that are capable of selectively targeting the MMPs most responsible for tumor promotion, with special consideration of the potential of biologics including antibodies and engineered proteins based on the TIMP scaffold. J. Cell. Biochem. 118: 3531–3548, 2017. © 2017 The Authors. Journal of Cellular Biochemistry Published by Wiley Periodicals, Inc. PMID:28585723

  5. Acute glomerular upregulation of ornithine decarboxylase is not essential for mesangial cell proliferation and matrix expansion in anti-Thy-1-nephritis.

    PubMed

    Ketteler, M; Westenfeld, R; Gawlik, A; de Heer, E; Distler, A

    2000-01-01

    Pathways of L-arginine metabolism including nitric oxide, agmatine and polyamine synthesis are upregulated during glomerular inflammation in experimental glomerulonephritis. In anti-Thy-1-glomerulonephritis L-arginine-deficient diets ameliorate the disease course in this model. However, it is unclear which metabolic pathway is affected by this substrate depletion. Since polyamines are important proproliferative molecules, we studied the effect of specific polyamine synthesis blockade in vivo on mesangial cell proliferation and glomerular fibrosis in this model. Anti-Thy-1-glomerulonephritis was induced in male Sprague-Dawley rats by single-bolus injection of monoclonal ER4-antibodies. Rats were treated with difluoromethylornithine (0.5-2% in the drinking water), a selective inhibitor of the rate-limiting enzyme of polyamine synthesis, ornithine decarboxylase (ODC). Mesangial cell proliferation and matrix expansion were evaluated in PAS-stained kidney tissues. Glomerular TGF-beta and biglycan-mRNA-expression were determined by Northern blot analysis and albuminuria was measured using a competitive ELISA. Data were compared to untreated controls. Though complete inhibition of ODC activity was achieved at any time point, difluoromethlornithine treatment had no significant effect on albuminuria, glomerular matrix protein expression and mesangial cell count in this model. The acute upregulation of glomerular ODC activity above baseline in anti-Thy1-glomerulonephritis is not pathophysiologically important for disease development however, biological effects of available polyamine pools cannot be excluded by our study.

  6. Dynamic expression patterns of ECM molecules in the developing mouse olfactory pathway

    PubMed Central

    Shay, Elaine L.; Greer, Charles A.; Treloar, Helen B.

    2009-01-01

    Olfactory sensory neuron (OSN) axons follow stereotypic spatio-temporal paths in the establishment of the olfactory pathway. Extracellular matrix (ECM) molecules are expressed early in the developing pathway and are proposed to have a role in its initial establishment. During later embryonic development, OSNs sort out and target specific glomeruli to form precise, complex topographic projections. We hypothesized that ECM cues may help to establish this complex topography. The aim of this study was to characterize expression of ECM molecules during the period of glomerulogenesis, when synaptic contacts are forming. We examined expression of laminin-1, perlecan, tenascin-C and CSPGs and found a coordinated pattern of expression of these cues in the pathway. These appear to restrict axons to the pathway while promoting axon outgrowth within. Thus, ECM molecules are present in dynamic spatio-temporal positions to affect OSN axons as they navigate to the olfactory bulb and establish synapses. PMID:18570250

  7. Matrix infrared spectroscopy and quantum-chemical calculations for the coinage-metal fluorides: comparisons of Ar-AuF, Ne-AuF, and Molecules MF2 and MF3.

    PubMed

    Wang, Xuefeng; Andrews, Lester; Brosi, Felix; Riedel, Sebastian

    2013-01-21

    The reactions of laser-ablated Au, Ag, and Cu atoms with F(2) in excess argon and neon gave new absorptions in the M-F stretching region of their IR spectra, which were assigned to metal-fluoride species. For gold, a Ng-AuF bond was identified in mixed neon/argon samples. However, this bonding was much weaker with AgF and CuF. Molecules MF(2) and MF(3) (M=Au, Ag, Cu) were identified from the isotopic distribution of the Cu and Ag atoms, comparison of the frequencies for three metal fluorides, and theoretical frequency calculations. The AuF(5) molecule was characterized by its strongest stretching mode and theoretical frequency calculations. Additional evidence was observed for the formation of the Au(2) F(6) molecule. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. The role of the JAK/STAT signal pathway in rheumatoid arthritis

    PubMed Central

    Malemud, Charles J.

    2018-01-01

    Proinflammatory cytokine activation of the Janus kinase/signal transducers and activators of transcription (JAK/STAT) signal transduction pathway is a critical event in the pathogenesis and progression of rheumatoid arthritis. Under normal conditions, JAK/STAT signaling reflects the influence of negative regulators of JAK/STAT, exemplified by the suppressor of cytokine signaling and protein inhibitor of activated STAT. However, in rheumatoid arthritis (RA) both of these regulators are dysfunctional. Thus, continuous activation of JAK/STAT signaling in RA synovial joints results in the elevated level of matrix metalloproteinase gene expression, increased frequency of apoptotic chondrocytes and most prominently ‘apoptosis resistance’ in the inflamed synovial tissue. Tofacitinib, a JAK small molecule inhibitor, with selectivity for JAK2/JAK3 was approved by the United States Food and Drug Administration (US FDA) for the therapy of RA. Importantly, tofacitinib has demonstrated significant clinical efficacy for RA in the post-US FDA-approval surveillance period. Of note, the success of tofacitinib has spurred the development of JAK1, JAK2 and other JAK3-selective small molecule inhibitors, some of which have also entered the clinical setting, whereas other JAK inhibitors are currently being evaluated in RA clinical trials. PMID:29942363

  9. Computational modeling of chemical reactions and interstitial growth and remodeling involving charged solutes and solid-bound molecules

    PubMed Central

    Nims, Robert J.; Maas, Steve; Weiss, Jeffrey A.

    2014-01-01

    Mechanobiological processes are rooted in mechanics and chemistry, and such processes may be modeled in a framework that couples their governing equations starting from fundamental principles. In many biological applications, the reactants and products of chemical reactions may be electrically charged, and these charge effects may produce driving forces and constraints that significantly influence outcomes. In this study, a novel formulation and computational implementation are presented for modeling chemical reactions in biological tissues that involve charged solutes and solid-bound molecules within a deformable porous hydrated solid matrix, coupling mechanics with chemistry while accounting for electric charges. The deposition or removal of solid-bound molecules contributes to the growth and remodeling of the solid matrix; in particular, volumetric growth may be driven by Donnan osmotic swelling, resulting from charged molecular species fixed to the solid matrix. This formulation incorporates the state of strain as a state variable in the production rate of chemical reactions, explicitly tying chemistry with mechanics for the purpose of modeling mechanobiology. To achieve these objectives, this treatment identifies the specific theoretical and computational challenges faced in modeling complex systems of interacting neutral and charged constituents while accommodating any number of simultaneous reactions where reactants and products may be modeled explicitly or implicitly. Several finite element verification problems are shown to agree with closed-form analytical solutions. An illustrative tissue engineering analysis demonstrates tissue growth and swelling resulting from the deposition of chondroitin sulfate, a charged solid-bound molecular species. This implementation is released in the open-source program FEBio (www.febio.org). The availability of this framework may be particularly beneficial to optimizing tissue engineering culture systems by examining the influence of nutrient availability on the evolution of inhomogeneous tissue composition and mechanical properties, the evolution of construct dimensions with growth, the influence of solute and solid matrix electric charge on the transport of cytokines, the influence of binding kinetics on transport, the influence of loading on binding kinetics, and the differential growth response to dynamically loaded versus free-swelling culture conditions. PMID:24558059

  10. Computational modeling of chemical reactions and interstitial growth and remodeling involving charged solutes and solid-bound molecules.

    PubMed

    Ateshian, Gerard A; Nims, Robert J; Maas, Steve; Weiss, Jeffrey A

    2014-10-01

    Mechanobiological processes are rooted in mechanics and chemistry, and such processes may be modeled in a framework that couples their governing equations starting from fundamental principles. In many biological applications, the reactants and products of chemical reactions may be electrically charged, and these charge effects may produce driving forces and constraints that significantly influence outcomes. In this study, a novel formulation and computational implementation are presented for modeling chemical reactions in biological tissues that involve charged solutes and solid-bound molecules within a deformable porous hydrated solid matrix, coupling mechanics with chemistry while accounting for electric charges. The deposition or removal of solid-bound molecules contributes to the growth and remodeling of the solid matrix; in particular, volumetric growth may be driven by Donnan osmotic swelling, resulting from charged molecular species fixed to the solid matrix. This formulation incorporates the state of strain as a state variable in the production rate of chemical reactions, explicitly tying chemistry with mechanics for the purpose of modeling mechanobiology. To achieve these objectives, this treatment identifies the specific theoretical and computational challenges faced in modeling complex systems of interacting neutral and charged constituents while accommodating any number of simultaneous reactions where reactants and products may be modeled explicitly or implicitly. Several finite element verification problems are shown to agree with closed-form analytical solutions. An illustrative tissue engineering analysis demonstrates tissue growth and swelling resulting from the deposition of chondroitin sulfate, a charged solid-bound molecular species. This implementation is released in the open-source program FEBio ( www.febio.org ). The availability of this framework may be particularly beneficial to optimizing tissue engineering culture systems by examining the influence of nutrient availability on the evolution of inhomogeneous tissue composition and mechanical properties, the evolution of construct dimensions with growth, the influence of solute and solid matrix electric charge on the transport of cytokines, the influence of binding kinetics on transport, the influence of loading on binding kinetics, and the differential growth response to dynamically loaded versus free-swelling culture conditions.

  11. Determination of the effective diffusivity of water in a poly (methyl methacrylate) membrane containing carbon nanotubes using kinetic Monte Carlo simulations.

    PubMed

    Mermigkis, Panagiotis G; Tsalikis, Dimitrios G; Mavrantzas, Vlasis G

    2015-10-28

    A kinetic Monte Carlo (kMC) simulation algorithm is developed for computing the effective diffusivity of water molecules in a poly(methyl methacrylate) (PMMA) matrix containing carbon nanotubes (CNTs) at several loadings. The simulations are conducted on a cubic lattice to the bonds of which rate constants are assigned governing the elementary jump events of water molecules from one lattice site to another. Lattice sites belonging to PMMA domains of the membrane are assigned different rates than lattice sites belonging to CNT domains. Values of these two rate constants are extracted from available numerical data for water diffusivity within a PMMA matrix and a CNT pre-computed on the basis of independent atomistic molecular dynamics simulations, which show that water diffusivity in CNTs is 3 orders of magnitude faster than in PMMA. Our discrete-space, continuum-time kMC simulation results for several PMMA-CNT nanocomposite membranes (characterized by different values of CNT length L and diameter D and by different loadings of the matrix in CNTs) demonstrate that the overall or effective diffusivity, D(eff), of water in the entire polymeric membrane is of the same order of magnitude as its diffusivity in PMMA domains and increases only linearly with the concentration C (vol. %) in nanotubes. For a constant value of the concentration C, D(eff) is found to vary practically linearly also with the CNT aspect ratio L/D. The kMC data allow us to propose a simple bilinear expression for D(eff) as a function of C and L/D that can describe the numerical data for water mobility in the membrane extremely accurately. Additional simulations with two different CNT configurations (completely random versus aligned) show that CNT orientation in the polymeric matrix has only a minor effect on D(eff) (as long as CNTs do not fully penetrate the membrane). We have also extensively analyzed and quantified sublinear (anomalous) diffusive phenomena over small to moderate times and correlated them with the time needed for penetrant water molecules to explore the available large, fast-diffusing CNT pores before Fickian diffusion is reached.

  12. Determination of the effective diffusivity of water in a poly (methyl methacrylate) membrane containing carbon nanotubes using kinetic Monte Carlo simulations

    NASA Astrophysics Data System (ADS)

    Mermigkis, Panagiotis G.; Tsalikis, Dimitrios G.; Mavrantzas, Vlasis G.

    2015-10-01

    A kinetic Monte Carlo (kMC) simulation algorithm is developed for computing the effective diffusivity of water molecules in a poly(methyl methacrylate) (PMMA) matrix containing carbon nanotubes (CNTs) at several loadings. The simulations are conducted on a cubic lattice to the bonds of which rate constants are assigned governing the elementary jump events of water molecules from one lattice site to another. Lattice sites belonging to PMMA domains of the membrane are assigned different rates than lattice sites belonging to CNT domains. Values of these two rate constants are extracted from available numerical data for water diffusivity within a PMMA matrix and a CNT pre-computed on the basis of independent atomistic molecular dynamics simulations, which show that water diffusivity in CNTs is 3 orders of magnitude faster than in PMMA. Our discrete-space, continuum-time kMC simulation results for several PMMA-CNT nanocomposite membranes (characterized by different values of CNT length L and diameter D and by different loadings of the matrix in CNTs) demonstrate that the overall or effective diffusivity, Deff, of water in the entire polymeric membrane is of the same order of magnitude as its diffusivity in PMMA domains and increases only linearly with the concentration C (vol. %) in nanotubes. For a constant value of the concentration C, Deff is found to vary practically linearly also with the CNT aspect ratio L/D. The kMC data allow us to propose a simple bilinear expression for Deff as a function of C and L/D that can describe the numerical data for water mobility in the membrane extremely accurately. Additional simulations with two different CNT configurations (completely random versus aligned) show that CNT orientation in the polymeric matrix has only a minor effect on Deff (as long as CNTs do not fully penetrate the membrane). We have also extensively analyzed and quantified sublinear (anomalous) diffusive phenomena over small to moderate times and correlated them with the time needed for penetrant water molecules to explore the available large, fast-diffusing CNT pores before Fickian diffusion is reached.

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Cheng; Tsuge, Masashi; Khriachtchev, Leonid, E-mail: leonid.khriachtchev@helsinki.fi

    Experimental and theoretical studies of HXeI and HXeH molecules in Ar, Kr, and Xe matrices are presented. HXeI exhibits the H–Xe stretching bands at 1238.0 and 1239.0 cm{sup −1} in Ar and Kr matrices, respectively, that are blue-shifted from the HXeI band observed in a Xe matrix (1193 cm{sup −1}) by 45 and 46 cm{sup −1}. These shifts are larger than those observed previously for HXeCl (27 and 16 cm{sup −1}) and HXeBr (37 and 23 cm{sup −1}); thus, the matrix effect is stronger for less stable molecules. The results for HXeI are qualitatively different from all previous results onmore » noble-gas hydrides with respect to the frequency order between Ar and Kr matrices. For previously studied HXeCl, HXeBr, and HXeCCH, the H–Xe stretching frequency is reliably (by >10 cm{sup −1}) higher in an Ar matrix than in a Kr matrix. In contrast, the H–Xe stretching frequency of HXeI in an Ar matrix is slightly lower than that in a Kr matrix. HXeH absorbs in Ar and Kr matrices at 1203.2 and 1192.1 cm{sup −1} (the stronger band for a Kr matrix), respectively. These bands are blue-shifted from the stronger band of HXeH in a Xe matrix (1166 cm{sup −1}) by 37 and 26 cm{sup −1}, and this frequency order is the same as observed for HXeCl, HXeBr, and HXeCCH but different from HXeI. The present hybrid quantum-classical simulations successfully describe the main experimental findings. For HXeI in the 〈110〉 (double substitution) site, the order of the H–Xe stretching frequencies (ν(Xe) < ν(Ar) < ν(Kr)) is in accord with the experimental observations, and also the frequency shifts in Ar and Kr matrices from a Xe matrix are well predicted (30 and 34 cm{sup −1}). Both in the theory and experiment, the order of the H–Xe stretching frequencies differs from the case of HXeCl, which suggests the adequate theoretical description of the matrix effect. For HXeH in the 〈100〉 (single substitution) site, the order of the frequencies is ν(Xe) < ν(Kr) < ν(Ar), which also agrees with the experiments. The calculated frequency shifts for HXeH in Ar and Kr matrices with respect to a Xe matrix (36 and 23 cm{sup −1}) are in a good agreement with the experiments. The present calculations predict an increase of the H–Xe stretching frequencies in the noble-gas matrices with respect to vacuum.« less

  14. Matrix modulation and heart failure: new concepts question old beliefs.

    PubMed

    Deschamps, Anne M; Spinale, Francis G

    2005-05-01

    Myocardial remodeling is a complex process involving several molecular and cellular factors. Extracellular matrix has been implicated in the remodeling process. Historically, the myocardial extracellular matrix was thought to serve solely as a means to align cells and provide structure to the tissue. Although this is one of its important functions, evidence suggests that the extracellular matrix plays a complex and divergent role in influencing cell behavior. This paper characterizes some of the notable studies on this dynamic entity and on adverse myocardial remodeling that have been published over the past year, which further question the belief that the extracellular matrix is a static structure. Progress has been made in understanding how the extracellular matrix is operative in the three major conditions (myocardial infarction, left ventricular hypertrophy due to overload, and dilated cardiomyopathy) that involve myocardial remodeling. Several studies have examined plasma profiles of matrix metalloproteinases and tissue inhibitors of matrix metalloproteinases following myocardial infarction and during left ventricular hypertrophy as surrogate markers of remodeling/remodeled myocardium. It has been demonstrated that bioactive signaling molecules and growth factors, proteases, and structural proteins influence cell-matrix interactions in the context of left ventricular hypertrophy. Finally, studies that either removed or added tissue inhibitor of metalloproteinases species in the myocardium demonstrated the importance of this regulatory protein in the remodeling process. Understanding the cellular and molecular triggers that in turn give rise to changes in the extracellular matrix could provide opportunities to modify the remodeling process.

  15. Water linked 3D coordination polymers: Syntheses, structures and applications

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, Suryabhan, E-mail: sbs.bhu@gmail.com; Bhim, Anupam

    2016-12-15

    Three new coordination polymers (CPs) based on Cd and Pb, [Cd(OBA)(μ-H{sub 2}O)(H{sub 2}O)]{sub n}1, [Pb(OBA)(μ-H{sub 2}O)]{sub n}2 [where OBA=4,4’-Oxybis(benzoate)] and [Pb(SDBA)(H{sub 2}O)]{sub n}.1/4DMF 3 (SDBA=4,4’-Sulfonyldibenzoate), have been synthesized and characterized. The single crystal structural studies reveal that CPs 1 and 2 have three dimensional structure. A water molecule bridges two metal centres which appears to the responsible for the dimensionality increase from 2D to 3D. Compound 3 has a supramolecular 3D structure involving water molecule and hydrogen bonds. A structural transformation is observed when 3 was heated at 100 °C or kept in methanol, forming [Pb(SDBA)]{sub n}4. Compound 4 ismore » used as supporting matrix for palladium nanoparticles, PdNPs@4. The PdNPs@4 exhibits good catalytic activity toward the reduction of 4-nitrophenol (4-NP) to 4-aminophenol (4-AP) in the presence of NaBH{sub 4} at room temperature. Luminescence studies revealed that all CPs could be an effective sensor for nitroaromatic explosives. - Graphical abstract: Three new CPs based on Cd and Pb, have been synthesized and characterized. A water molecule bridges two metal centres which appears to the responsible for the dimensionality increase from 2D to 3D. One of the CP is used as supporting matrix for palladium nanoparticles, PdNPs@4. The PdNPs@4 exhibits good catalytic activity toward the reduction of 4-nitrophenol. Luminescence studies shown that all CPs could be an effective sensor for nitroaromatic explosives. - Highlights: • Three new CPs based on Cd and Pb, have been synthesized and characterized. • A water molecule bridges two metal centres which appears to the responsible for the dimensionality increase from 2D to 3D. • One of the CP is used as supporting matrix for palladium nanoparticles, PdNPs@4. • Luminescence studies shown that all CPs could be an effective sensor for nitroaromatic explosives.« less

  16. A novel device to stretch multiple tissue samples with variable patterns: application for mRNA regulation in tissue-engineered constructs.

    PubMed

    Imsirovic, Jasmin; Derricks, Kelsey; Buczek-Thomas, Jo Ann; Rich, Celeste B; Nugent, Matthew A; Suki, Béla

    2013-01-01

    A broad range of cells are subjected to irregular time varying mechanical stimuli within the body, particularly in the respiratory and circulatory systems. Mechanical stretch is an important factor in determining cell function; however, the effects of variable stretch remain unexplored. In order to investigate the effects of variable stretch, we designed, built and tested a uniaxial stretching device that can stretch three-dimensional tissue constructs while varying the strain amplitude from cycle to cycle. The device is the first to apply variable stretching signals to cells in tissues or three dimensional tissue constructs. Following device validation, we applied 20% uniaxial strain to Gelfoam samples seeded with neonatal rat lung fibroblasts with different levels of variability (0%, 25%, 50% and 75%). RT-PCR was then performed to measure the effects of variable stretch on key molecules involved in cell-matrix interactions including: collagen 1α, lysyl oxidase, α-actin, β1 integrin, β3 integrin, syndecan-4, and vascular endothelial growth factor-A. Adding variability to the stretching signal upregulated, downregulated or had no effect on mRNA production depending on the molecule and the amount of variability. In particular, syndecan-4 showed a statistically significant peak at 25% variability, suggesting that an optimal variability of strain may exist for production of this molecule. We conclude that cycle-by-cycle variability in strain influences the expression of molecules related to cell-matrix interactions and hence may be used to selectively tune the composition of tissue constructs.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hinks, Mallory L.; Brady, Monica V.; Lignell, Hanna

    This work explores the effect of environmental conditions on the photodegradation rates of atmospherically relevant, photolabilie, organic molecules embedded in a film of secondary organic material (SOM). Three types of SOM were studied: a-pinene/O3 SOM (PSOM), limonene/O3 SOM (LSOM), and aged limonene/O3 obtained by exposure of LSOM to ammonia (brown LSOM). PSOM and LSOM were impregnated with 2,4-dinitrophenol (2,4-DNP), an atmospherically relevant molecule that photodegrades faster than either PSOM or LSOM alone, to serve as a probe of SOM matrix effects on photochemistry. Brown LSOM contains an unidentified chromophore that absorbs strongly at 510 nm and photobleaches upon irradiation. Thismore » chromophore served as a probe molecule for the brown LSOM experiments. In all experiments, the temperature and relative humidity (RH) surrounding the SOM films were varied. The extent of photochemical reaction in the samples was monitored using UV-Vis absorption spectroscopy. For all three model systems examined, the observed photodegradation rates were slower at lower temperatures and lower RH, under conditions that make SOM more viscous. Additionally, the activation energies for photodegradation of each system were positively correlated with the viscosity of the SOM matrix as measured in poke-flow experiments. These activation energies were calculated to be 50, 24, and 17 kJ/mol for 2,4-DNP in PSOM, 2,4-DNP in LSOM, and brown LSOM, respectively and PSOM was found to be the most viscous of the three. These results suggest that the increased viscosity is hindering the motion of the molecules in SOM and is slowing down photochemical reactions in which they participate.« less

  18. Unconfined lateral diffusion and an estimate of pericellular matrix viscosity revealed by measuring the mobility of gold-tagged lipids

    PubMed Central

    1993-01-01

    Nanovid (video-enhanced) microscopy was used to determine whether lateral diffusion in the plasma membrane of colloidal gold-tagged lipid molecules is confined or is unrestricted. Confinement could be produced by domains within the plane of the plasma membrane or by filamentous barriers within the pericellular matrix. Fluorescein- phosphatidylethanolamine (F1-PE), incorporated into the plasma membranes of cultured fibroblasts, epithelial cells and keratocytes, was labeled with 30-nm colloidal gold conjugated to anti-fluorescein (anti-F1). The trajectories of the gold-labeled lipids were used to compute diffusion coefficients (DG) and to test for restricted motion. On the cell lamella, the gold-labeled lipids diffused freely in the plasma membrane. Since the gold must move through the pericellular matrix as the attached lipid diffuses in the plasma membrane, this result suggests that any extensive filamentous barriers in the pericellular matrix are at least 40 nm from the plasma membrane surface. The average diffusion coefficients ranged from 1.1 to 1.7 x 10(-9) cm2/s. These values were lower than the average diffusion coefficients (DF) (5.4 to 9.5 x 10(-9) cm2/s) obtained by FRAP. The lower DG is partially due to the pericellular matrix as demonstrated by the result that heparinase treatment of keratocytes significantly increased DG to 2.8 x 10(-9) cm2/s, but did not affect DF. Pericellular matrix viscosity was estimated from the frictional coefficients computed from DG and DF and ranged from 0.5 to 0.9 poise for untreated cells. Heparinase treatment of keratocytes decreased the apparent viscosity to approximately 0.1 poise. To evaluate the presence of domains or barriers, the trajectories and corresponding mean square displacement (MSD) plots of gold-labeled lipids were compared to the trajectories and MSD plots resulting from computer simulations of random walks within corrals. Based on these comparisons, we conclude that, if there are domains limiting the diffusion of F1-PE, most are larger than 5 microns in diameter. PMID:8416991

  19. The performance evaluation model of mining project founded on the weight optimization entropy value method

    NASA Astrophysics Data System (ADS)

    Mao, Chao; Chen, Shou

    2017-01-01

    According to the traditional entropy value method still have low evaluation accuracy when evaluating the performance of mining projects, a performance evaluation model of mineral project founded on improved entropy is proposed. First establish a new weight assignment model founded on compatible matrix analysis of analytic hierarchy process (AHP) and entropy value method, when the compatibility matrix analysis to achieve consistency requirements, if it has differences between subjective weights and objective weights, moderately adjust both proportions, then on this basis, the fuzzy evaluation matrix for performance evaluation. The simulation experiments show that, compared with traditional entropy and compatible matrix analysis method, the proposed performance evaluation model of mining project based on improved entropy value method has higher accuracy assessment.

  20. Variational second order density matrix study of F3-: importance of subspace constraints for size-consistency.

    PubMed

    van Aggelen, Helen; Verstichel, Brecht; Bultinck, Patrick; Van Neck, Dimitri; Ayers, Paul W; Cooper, David L

    2011-02-07

    Variational second order density matrix theory under "two-positivity" constraints tends to dissociate molecules into unphysical fractionally charged products with too low energies. We aim to construct a qualitatively correct potential energy surface for F(3)(-) by applying subspace energy constraints on mono- and diatomic subspaces of the molecular basis space. Monoatomic subspace constraints do not guarantee correct dissociation: the constraints are thus geometry dependent. Furthermore, the number of subspace constraints needed for correct dissociation does not grow linearly with the number of atoms. The subspace constraints do impose correct chemical properties in the dissociation limit and size-consistency, but the structure of the resulting second order density matrix method does not exactly correspond to a system of noninteracting units.

Top