Sample records for molecules structures properties

  1. Structure-property relationships: asymmetric alkylphenyl-substituted anthracene molecules for use in small-molecule solar cells.

    PubMed

    Kim, Yu Jin; Ahn, Eun Soo; Jang, Sang Hun; An, Tae Kyu; Kwon, Soon-Ki; Chung, Dae Sung; Kim, Yun-Hi; Park, Chan Eon

    2015-05-11

    Two asymmetric anthracene-based organic molecules, NDHPEA and TNDHPEA, were prepared without or with a thiophene spacer between the anthracene and naphthalene units. These asymmetric oligomers displayed different degrees of coplanarity, as evidenced by differences in the dihedral angles calculated by using DFT. Differential scanning calorimetry and XRD studies were used to probe the crystallization characteristics and molecular packing structures in the active layers. The coplanarity of the molecules in the asymmetric structure significantly affected the crystallization behavior and the formation of crystalline domains in the solid state. The small-molecule crystalline properties were correlated with the device physics by determining the J-V characteristics and hole mobilities of the devices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Structure and hydrodynamic properties of plectin molecules.

    PubMed

    Foisner, R; Wiche, G

    1987-12-05

    Plectin is a cytoskeletal, high molecular weight protein of widespread and abundant occurrence in cultured cells and tissues. To study its molecular structure, the protein was purified from rat glioma C6 cells and subjected to chemical and biophysical analyses. Plectin's polypeptide chains have an apparent molecular weight of 300,000, as shown by one-dimensional sodium dodecyl sulfate/polyacrylamide electrophoresis. Cross-linking of non-denatured plectin in solution with dimethyl suberimidate and electrophoretic analyses on sodium dodecyl sulfate/agarose gels revealed that the predominant soluble plectin species was a molecule of 1200 X 10(3) Mr consisting of four 300 X 10(3) Mr polypeptide chains. Hydrodynamic properties of plectin in solution were obtained by sedimentation velocity centrifugation and high-pressure liquid chromatography analysis yielding a sedimentation coefficient of 10 S and a Stokes radius of 27 nm. The high f/fmin ratio of 4.0 indicated a very elongated shape of plectin molecules and an axial ratio of about 50. Shadowing and negative staining electron microscopy of plectin molecules revealed multiple domains: a rigid rod of 184 nm in length and 2 nm in diameter, and two globular heads of 9 nm diameter at each end of the rod. Circular dichroism spectra suggested a composition of 30% alpha-helix, 9% beta-structure and 61% random coil or aperiodic structure. The rod-like shape, the alpha-helix content as well as the thermal transition within a midpoint of 45 degrees C and the transition enthalpy (168 kJ/mol) of secondary structure suggested a double-stranded, alpha-helical coiled coil rod domain. Based on the available data, we favor a model of native plectin as a dumb-bell-like association of four 300 X 10(3) Mr polypeptide chains. Electron microscopy and turbidity measurements showed that plectin molecules self-associate into various oligomeric states in solutions of nearly physiological ionic strength. These interactions apparently involved

  3. Structure-property relationship of quinuclidinium surfactants--Towards multifunctional biologically active molecules.

    PubMed

    Skočibušić, Mirjana; Odžak, Renata; Štefanić, Zoran; Križić, Ivana; Krišto, Lucija; Jović, Ozren; Hrenar, Tomica; Primožič, Ines; Jurašin, Darija

    2016-04-01

    Motivated by diverse biological and pharmacological activity of quinuclidine and oxime compounds we have synthesized and characterized novel class of surfactants, 3-hydroxyimino quinuclidinium bromides with different alkyl chains lengths (CnQNOH; n=12, 14 and 16). The incorporation of non conventional hydroxyimino quinuclidinium headgroup and variation in alkyl chain length affects hydrophilic-hydrophobic balance of surfactant molecule and thereby physicochemical properties important for its application. Therefore, newly synthesized surfactants were characterized by the combination of different experimental techniques: X-ray analysis, potentiometry, electrical conductivity, surface tension and dynamic light scattering measurements, as well as antimicrobial susceptibility tests. Comprehensive investigation of CnQNOH surfactants enabled insight into structure-property relationship i.e., way in which the arrangement of surfactant molecules in the crystal phase correlates with their solution behavior and biologically activity. The synthesized CnQNOH surfactants exhibited high adsorption efficiency and relatively low critical micelle concentrations. In addition, all investigated compounds showed very potent and promising activity against Gram-positive and clinically relevant Gram-negative bacterial strains compared to conventional antimicrobial agents: tetracycline and gentamicin. The overall results indicate that bicyclic headgroup with oxime moiety, which affects both hydrophilicity and hydrophobicity of CnQNOH molecule in addition to enabling hydrogen bonding, has dominant effect on crystal packing and physicochemical properties. The unique structural features of cationic surfactants with hydroxyimino quinuclidine headgroup along with diverse biological activity have made them promising structures in novel drug discovery. Obtained fundamental understanding how combination of different functionalities in a single surfactant molecule affects its physicochemical

  4. [Strategy of molecular design of drugs: the unification of macro-properties and micro-structures of a molecule].

    PubMed

    Guo, Zong-Ru

    2008-03-01

    The interaction of a drug with the organism involves both the disposition of a drug by the organism and the action of a drug on the organism. The disposition of various exogenous substances, including drugs, complies with general rules. The underlying physical and chemical changes to different drugs in view of time and space, i. e. pharmacokinetics, share common characteristics, that is the tout ensemble of a molecule and its macroscopic properties convey direct effect on the pharmacokinetic behavior as the tendency and consequence of biological evolution. The action of a drug on the organism, on the other hand, implicates the physico-chemical binding of a drug molecule to the target protein, which induces pharmacological and toxicological effects. The biological reactions, no matter beneficial or adverse, are all specific and individual manifestation of the drug molecule and determined by the interactive binding between definitive atoms or groups of the drug molecule and the macromolecular target in three-dimension. Such critical atoms, groups, or fragments responsible for the interaction reflect the microscopic structures of drug molecules and are called pharmacophore. In this context, a drug molecule is presumed as an assembly of macroscopic property and microscopic structure, with the macroscopic properties determining the absorption, distribution, metabolism and elimination of drugs and the microscopic structure coining pharmacological action. The knowledge of the internal relationship between macroscopy/microscopy and PK/PD conduces to comprehension of drug action and guides molecular drug design, because this conception facilitates the identification of structural features necessary for biological response, and the determination of factors modulating the physico-chemical and pharmacokinetic properties. The factors determining macro-properties include molecular weight, solubility, charge, lipophilicity (partition), and polar surface area, etc., which are

  5. Modification in structure, phase transition, and magnetic property of metallic gallium driven by atom-molecule interactions.

    PubMed

    Song, Le Xin; Chen, Jie; Zhu, Lin Hong; Xia, Juan; Yang, Jun

    2011-09-05

    The present work supports a novel paradigm in which the surface structure and stacking behavior of metallic gallium (Ga) were significantly influenced by the preparation process in the presence of organic small molecules (ethanol, acetone, dichloromethane, and diethyl ether). The extent of the effect strongly depends on the polarity of the molecules. Especially, a series of new atom-molecule aggregates consisting of metallic Ga and macrocyclic hosts (cyclodextrins, CDs) were prepared and characterized by various techniques. A comprehensive comparative analysis between free metallic Ga and the Ga samples obtained provides important and at present rare information on the modification in structure, phase transition, and magnetic property of Ga driven by atom-molecule interactions. First, there is a notable difference in microstructure and electronic structure between the different types of Ga samples. Second, differential scanning calorimetry analysis gives us a complete picture (such as the occurrence of a series of metastable phases of Ga in the presence of CDs) that has allowed us to consider that Ga atoms were protected by the shielding effect provided by the cavities of CDs. Third, the metallic Ga distributed in the aggregates exhibits very interesting magnetic property compared to free metallic Ga, such as the uniform zero-field-cooled and field-cooled magnetization processes, the enhanced responses in magnetization to temperature and applied field, and the fundamental change in shape of magnetic hysteresis loops. These significant changes in structural transformation and physical property of Ga provide a novel insight into the understanding of atom-molecule interactions between metallic atoms and organic molecules.

  6. Structure-Property Relationships of Small Organic Molecules as a Prelude to the Teaching of Polymer Science

    ERIC Educational Resources Information Center

    Wnek, Gary E.

    2017-01-01

    Small organic molecules offer a rich opportunity to discuss the interplay of chemical structure with properties such as the melting point and phenomena such as glass formation and can form the basis of fundamental considerations of structure-property relationships in macromolecules. Of particular importance are thermal transitions, specifically…

  7. Chemical structure-nonlinear optical property relationships for a series of two-photon absorbing fluorene molecules

    NASA Astrophysics Data System (ADS)

    Hales, Joel Mccajah

    This dissertation reports on the investigation of two-photon absorption (2PA) in a series of fluorenyl molecules. Several current and emerging technologies exploit this optical nonlinearity including two-photon fluorescence imaging, three-dimensional microfabrication, site-specific photodynamic cancer therapy and biological caging studies. The two key features of this nonlinearity which make it an ideal candidate for the above applications are its quadratic dependence on the incident irradiance and the improved penetration into absorbing media that it affords. As a consequence of the burgeoning field which exploits 2PA, it is a goal to find materials that exhibit strong two-photon absorbing capabilities. Organic materials are promising candidates for 2PA applications because their material properties can be tailored through molecular engineering thereby facilitating optimization of their nonlinear optical properties. Fluorene derivatives are particularly interesting since they possess high photochemical stability for organic molecules and are generally strongly fluorescent. By systematically altering the structural properties in a series of fluorenyl molecules, we have determined how these changes affect their two-photon absorbing capabilities. This was accomplished through characterization of both the strength and location of their 2PA spectra. In order to ensure the validity of these results, three separate nonlinear characterization techniques were employed: two-photon fluorescence spectroscopy, white-light continuum pump-probe spectroscopy, and the Z-scan technique. In addition, full linear spectroscopic characterization was performed on these molecules along with supplementary quantum chemical calculations to obtain certain molecular properties that might impact the nonlinearity. Different designs in chemical architecture allowed investigation of the effects of symmetry, solvism, donor-acceptor strengths, conjugation length, and multi-branched geometries on

  8. Insights into the role of protein molecule size and structure on interfacial properties using designed sequences

    PubMed Central

    Dwyer, Mirjana Dimitrijev; He, Lizhong; James, Michael; Nelson, Andrew; Middelberg, Anton P. J.

    2013-01-01

    Mixtures of a large, structured protein with a smaller, unstructured component are inherently complex and hard to characterize at interfaces, leading to difficulties in understanding their interfacial behaviours and, therefore, formulation optimization. Here, we investigated interfacial properties of such a mixed system. Simplicity was achieved using designed sequences in which chemical differences had been eliminated to isolate the effect of molecular size and structure, namely a short unstructured peptide (DAMP1) and its longer structured protein concatamer (DAMP4). Interfacial tension measurements suggested that the size and bulk structuring of the larger molecule led to much slower adsorption kinetics. Neutron reflectometry at equilibrium revealed that both molecules adsorbed as a monolayer to the air–water interface (indicating unfolding of DAMP4 to give a chain of four connected DAMP1 molecules), with a concentration ratio equal to that in the bulk. This suggests the overall free energy of adsorption is equal despite differences in size and bulk structure. At small interfacial extensional strains, only molecule packing influenced the stress response. At larger strains, the effect of size became apparent, with DAMP4 registering a higher stress response and interfacial elasticity. When both components were present at the interface, most stress-dissipating movement was achieved by DAMP1. This work thus provides insights into the role of proteins' molecular size and structure on their interfacial properties, and the designed sequences introduced here can serve as effective tools for interfacial studies of proteins and polymers. PMID:23303222

  9. Structural, Electronic and Qsar Properties of the Cyfluthrin Molecule:. a Theoretical AM1 and PM3 Treatment

    NASA Astrophysics Data System (ADS)

    Çalişir, Emine Deniz; Erkoç, Şakir

    Cyfluthrin is a synthetic cyano-containing pyrethroid insecticide that has both contact and stomach poison action. It is a nonsystemic chemical used to control cutworms, ants, silverfish, cockroaches, mosquitoes, tobacco budworm and many others. Its primary agricultural uses have been for control of chewing and sucking insects on crops such as cotton, turf, ornamentals, hops, cereal, corn, deciduous fruit, peanuts, potatoes, and other vegetables. Cyfluthrin is also used in public health situations and for structural pest control. The structural, vibrational, electronic and QSAR properties of the cyfluthrin molecule in gas phase have been investigated theoretically by performing molecular mechanics method by using MM+ force field, and semi-empirical molecular orbital AM1 and PM3 calculations. The geometry of the molecule has been optimized, infrared spectrum (vibrational modes and intensities) and the electronic properties of the molecule have been calculated in its ground state. According to PM3 calculation, heat of formation of cyfluthrin molecule is about -48.58 kcal/mol (exothermic), which shows that this molecule thermodynamically be stable. The HOMO energy level for this molecule is found to be -9.701 eV and the LUMO energy level is -0.660 eV giving rise to a gap of 9.041 eV, which also indicates that cyfluthrin is thermodynamically stable.

  10. Viscoelastic properties of model segments of collagen molecules.

    PubMed

    Gautieri, Alfonso; Vesentini, Simone; Redaelli, Alberto; Buehler, Markus J

    2012-03-01

    Collagen is the prime construction material in vertebrate biology, determining the mechanical behavior of connective tissues such as tendon, bone and skin. Despite extensive efforts in the investigation of the origin of collagen unique mechanical properties, a deep understanding of the relationship between molecular structure and mechanical properties remains elusive, hindered by the complex hierarchical structure of collagen-based tissues. In particular, although extensive studies of viscoelastic properties have been pursued at the macroscopic (fiber/tissue) level, fewer investigations have been performed at the smaller scales, including in particular collagen molecules and fibrils. These scales are, however, important for a complete understanding of the role of collagen as an important constituent in the extracellular matrix. Here, using an atomistic modeling approach, we perform in silico creep tests of a collagen-like peptide, monitoring the strain-time response for different values of applied external load. The results show that individual collagen molecules exhibit a nonlinear viscoelastic behavior, with a Young's modulus increasing from 6 to 16GPa (for strains up to 20%), a viscosity of 3.84.±0.38Pa·s, and a relaxation time in the range of 0.24-0.64ns. The single molecule viscosity, for the first time reported here, is several orders of magnitude lower than the viscosity found for larger-scale single collagen fibrils, suggesting that the viscous behavior of collagen fibrils and fibers involves additional mechanisms, such as molecular sliding between collagen molecules within the fibril or the effect of relaxation of larger volumes of solvent. Based on our molecular modeling results we propose a simple structural model that describes collagen tissue as a hierarchical structure, providing a bottom-up description of elastic and viscous properties form the properties of the tissue basic building blocks. Copyright © 2011 International Society of Matrix Biology

  11. The structural, electronic and spectroscopic properties of 4FPBAPE molecule: Experimental and theoretical study

    NASA Astrophysics Data System (ADS)

    Tanış, Emine; Babur Sas, Emine; Kurban, Mustafa; Kurt, Mustafa

    2018-02-01

    The experimental and theoretical study of 4-Formyl Phenyl Boronic Acid Pinacol Ester (4FPBAPE) molecule were performed in this work. 1H, 13C NMR and UV-Vis spectra were tested in dimethyl sulfoxide (DMSO). The structural, spectroscopic properties and energies of 4FPBAPE were obtained for two potential conformers from density functional theory (DFT) with B3LYP/6-311G (d, p) and CAM-B3LYP/6-311G (d, p) basis sets. The optimal geometry of those structures was obtained according to the position of oxygen atom upon determining the scan coordinates for each conformation. The most stable conformer was found as the A2 form. The fundamental vibrations were determined based on optimized structure in terms of total energy distribution. Electronic properties such as oscillator strength, wavelength, excitation energy, HOMO, LUMO and molecular electrostatic potential and structural properties such as radial distribution functions (RDF) and probability density depending on coordination number are presented. Theoretical results of 4-FPBAPE spectra were found to be compatible with observed spectra.

  12. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    PubMed Central

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  13. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory.

    PubMed

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-Ichi; Sugimoto, Naoki

    2015-12-02

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water-water interactions, (ii) ethylene glycol more effectively disrupted water-water interactions around Watson-Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson-Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. The Effect of Water Molecules on Mechanical Properties of Cell Walls

    NASA Astrophysics Data System (ADS)

    Rahbar, Nima; Youssefian, Sina

    The unique properties of bamboo fibers come from their natural composite structures that comprise mainly cellulose nanofibrils in a matrix of intertwined hemicellulose and lignin called lignin-carbohydrate complex (LCC). Here, we have utilized atomistic simulations to investigate the mechanical properties and mechanisms of interactions between these materials, in the presence of water molecules. The role of hemicellulose found to be enhancing the mechanical properties and lignin found to be providing the strength of bamboo fibers. The abundance of Hbonds in hemicellulose chains is responsible for improving the mechanical behavior of LCC. The strong van der Waals forces between lignin molecules and cellulose nanofibrils are responsible for higher adhesion energy between LCC/cellulose nanofibrils. We also found out that the amorphous regions of cellulose nanofibrils is the weakest interface in bamboo Microfibrils. In presence of water, the elastic modulus of lignin increases at low water content and decreases in higher water content, whereas the hemicellulose elastic modulus constantly decreases. The variations of Radial Distribution Function and Free Fractional Volume of these materials with water suggest that water molecules enhance the mechanical properties of lignin by filling voids in the system and creating Hbond bridges between polymer chains. For hemicellulose, however, the effect is always regressive due to the destructive effect of water molecules on the Hbond of its dense structure.

  15. [Microspeciation of amphoteric molecules of unusual acid-base properties].

    PubMed

    Kóczián, Kristóf

    2007-01-01

    The phisico-chemical properties of bio- and drug molecules greatly influence their interactions in the body and strongly effect the mechanism of drug action. Among these properties, macroscopic and site-specific protonation constants are of crucial importance. Latter one is the tool to calculate the relative concentration of the various microspecies in the compartments of the body at different pH values, and also, it is the versatile parameter to improve the pharmacokinetic properties of a new molecule in a particular family of drugs. In the present thesis work, the microspeciation of three molecules of great pharmaceutical importance and unusual acid-base properties, were carried out. The microconstants of tenoxicam, the non-steroidal anti-inflammatory drug, were described, introducing a novel deductive method using Hammett constants. For this purpose, a total of 8 tenoxicam and piroxicam derivatives were synthesised. To the best of our knowledge, the log k(N)O microconstant of tenoxicam obtained thus is the lowest enolate basicity value, which, however, can be well explained by the effects of the intramolecular environment. The developed evaluation procedure is suitable for microconstant determination of compounds in other molecule families. Besides, prodrug-type compounds and analogues similar to the structures of selective COX-2 isoenzyme inhibitors were synthesised. The other two molecules studied, the 6-aminopenicillanic acid and 7-cephalosporanic acid, the core molecules of the two most important beta-lactam antibiotic-types were derivatised and investigated by 1D and 2D NMR techniques. The NMR-pH titration on the parent compounds and their ester derivatives, combined with in situ pH-measurements allowed the microspeciation of these easily decomposing molecules. One of the protonation constant of 7-ACA (log kN(O) = 4.12), to the best of our knowledge, is the least non-aromatic basic amino-site among the natural compounds.

  16. Electronic Structure of Small Lanthanide Containing Molecules

    NASA Astrophysics Data System (ADS)

    Kafader, Jared O.; Ray, Manisha; Topolski, Josey E.; Chick Jarrold, Caroline

    2016-06-01

    Lanthanide-based materials have unusual electronic properties because of the high number of electronic degrees of freedom arising from partial occupation of 4f orbitals, which make these materials optimal for their utilization in many applications including electronics and catalysis. Electronic spectroscopy of small lanthanide molecules helps us understand the role of these 4f electrons, which are generally considered core-like because of orbital contraction, but are energetically similar to valence electrons. The spectroscopy of small lanthanide-containing molecules is relatively unexplored and to broaden this understanding we have completed the characterization of small cerium, praseodymium, and europium molecules using photoelectron spectroscopy coupled with DFT calculations. The characterization of PrO, EuH, EuO/EuOH, and CexOy molecules have allowed for the determination of their electron affinity, the assignment of numerous anion to neutral state transitions, modeling of anion/neutral structures and electron orbital occupation.

  17. Electronic and transport properties of Cobalt-based valence tautomeric molecules and polymers

    NASA Astrophysics Data System (ADS)

    Chen, Yifeng; Calzolari, Arrigo; Buongiorno Nardelli, Marco

    2011-03-01

    The advancement of molecular spintronics requires further understandings of the fundamental electronic structures and transport properties of prototypical spintronics molecules and polymers. Here we present a density functional based theoretical study of the electronic structures of Cobalt-based valence tautomeric molecules Co III (SQ)(Cat)L Co II (SQ)2 L and their polymers, where SQ refers to the semiquinone ligand, and Cat the catecholate ligand, while L is a redox innocent backbone ligand. The conversion from low-spin Co III ground state to high-spin Co II excited state is realized by imposing an on-site potential U on the Co atom and elongating the Co-N bond. Transport properties are subsequently calculated by extracting electronic Wannier functions from these systems and computing the charge transport in the ballistic regime using a Non-Equilibrium Green's Function (NEGF) approach. Our transport results show distinct charge transport properties between low-spin ground state and high-spin excited state, hence suggesting potential spintronics devices from these molecules and polymers such as spin valves.

  18. Small Molecule Docking from Theoretical Structural Models

    NASA Astrophysics Data System (ADS)

    Novoa, Eva Maria; de Pouplana, Lluis Ribas; Orozco, Modesto

    Structural approaches to rational drug design rely on the basic assumption that pharmacological activity requires, as necessary but not sufficient condition, the binding of a drug to one or several cellular targets, proteins in most cases. The traditional paradigm assumes that drugs that interact only with a single cellular target are specific and accordingly have little secondary effects, while promiscuous molecules are more likely to generate undesirable side effects. However, current examples indicate that often efficient drugs are able to interact with several biological targets [1] and in fact some dirty drugs, such as chlorpromazine, dextromethorphan, and ibogaine exhibit desired pharmacological properties [2]. These considerations highlight the tremendous difficulty of designing small molecules that both have satisfactory ADME properties and the ability of interacting with a limited set of target proteins with a high affinity, avoiding at the same time undesirable interactions with other proteins. In this complex and challenging scenario, computer simulations emerge as the basic tool to guide medicinal chemists during the drug discovery process.

  19. Thermal properties of adsorbed molecule in external field

    NASA Astrophysics Data System (ADS)

    Devi, Sumana; Vidhani, Bhavna; Prasad, Vinod

    2018-05-01

    Thermodynamic properties such as free energy, internal energy, entropy and specific heat of an adsorbed molecule are systematically investigated in static electric field for four different confinements. The confined potentials taken are suitable for different experimental conditions and are very useful in determining properties of molecules adsorbed under different environments. The time independent Schrödinger equation is solved numerically using accurate 9-point finite difference method. The Energy spectrum thus obtained is used to find thermal properties of the adsorbed molecule. Interesting results are obtained and explained.

  20. Synthesis, Optical and Structural Properties of Copper Sulfide Nanocrystals from Single Molecule Precursors

    PubMed Central

    Ajibade, Peter A.; Botha, Nandipha L.

    2017-01-01

    We report the synthesis and structural studies of copper sulfide nanocrystals from copper (II) dithiocarbamate single molecule precursors. The precursors were thermolysed in hexadecylamine (HDA) to prepare HDA-capped CuS nanocrystals. The optical properties of the nanocrystals studied using UV–visible and photoluminescence spectroscopy showed absorption band edges at 287 nm that are blue shifted, and the photoluminescence spectra show emission curves that are red-shifted with respect to the absorption band edges. These shifts are as a result of the small crystallite sizes of the nanoparticles leading to quantum size effects. The structural studies were carried out using powder X-ray diffraction (XRD), transmission electron microscopy (TEM), scanning electron microscopy (SEM), energy dispersive X-ray spectroscopy (EDS), and atomic force microscopy. The XRD patterns indicates that the CuS nanocrystals are in hexagonal covellite crystalline phases with estimated particles sizes of 17.3–18.6 nm. The TEM images showed particles with almost spherical or rod shapes, with average crystallite sizes of 3–9.8 nm. SEM images showed morphology with ball-like microspheres on the surfaces, and EDS spectra confirmed the presence of CuS nanoparticles. PMID:28336865

  1. Photoelectron diffraction from single oriented molecules: Towards ultrafast structure determination of molecules using x-ray free-electron lasers

    NASA Astrophysics Data System (ADS)

    Kazama, Misato; Fujikawa, Takashi; Kishimoto, Naoki; Mizuno, Tomoya; Adachi, Jun-ichi; Yagishita, Akira

    2013-06-01

    We provide a molecular structure determination method, based on multiple-scattering x-ray photoelectron diffraction (XPD) calculations. This method is applied to our XPD data on several molecules having different equilibrium geometries. Then it is confirmed that, by our method, bond lengths and bond angles can be determined with a resolution of less than 0.1 Å and 10∘, respectively. Differently from any other scenario of ultrafast structure determination, we measure the two- or three-dimensional XPD of aligned or oriented molecules in the energy range from 100 to 200 eV with a 4π detection velocity map imaging spectrometer. Thanks to the intense and ultrashort pulse properties of x-ray free-electron lasers, our approach exhibits the most probable method for obtaining ultrafast real-time structural information on small to medium-sized molecules consisting of light elements, i.e., a “molecular movie.”

  2. Review of Antibiotic and Non-Antibiotic Properties of Beta-lactam Molecules.

    PubMed

    Ochoa-Aguilar, Abraham; Ventura-Martinez, Rosa; Sotomayor-Sobrino, Marco Antonio; Gómez, Claudia; Morales-Espinoza, María del Rosario

    2016-01-01

    Beta-lactam molecules are a family of drugs commonly used for their antibiotic properties; however, recent research has shown that several members of this group present a large number of other effects such as neuroprotective, antioxidant, analgesic or immunomodulatory capabilities. These properties have been used in both preclinical and clinical studies in different diseases such as hypoxic neuronal damage or acute and chronic pain. The present work briefly reviews the antibiotic effect of these molecules, and will then focus specially on the non-antibiotic effects of three beta-lactam subfamilies: penicillins, cephalosporins and beta lactamase inhibitors, each of which have different molecular structure and pharmacokinetics and therefore have several potential clinical applications. A thorough search of bibliographic databases for peer-reviewed research was performed including only classic experiments or high quality reviews for the antibiotic mechanisms of beta-lactam molecules and only experimental research papers where included when the non-antibiotic properties of these molecules were searched. Only published articles from indexed journals were included. Quality of retrieved papers was assessed using standard tools. The characteristics of screened papers were described and findings of included studies were contextualized to either a mechanistic or a clinical framework. Seventy-eight papers were included in the review; the majority (56) were relative to the non-antibiotic properties of beta-lactam molecules. The non-antibiotic effects reviewed were divided accordingly to the amount of information available for each one. Twelve papers outlined the epileptogenic effects induced by beta-lactam molecules administration; these included both clinical and basic research as well as probable mechanistic explanations. Eighteen papers described a potential neuroprotective effect, mostly in basic in vitro and in vivo experiments. Analgesic properties where identified in

  3. Use of Crystal Structure Informatics for Defining the Conformational Space Needed for Predicting Crystal Structures of Pharmaceutical Molecules.

    PubMed

    Iuzzolino, Luca; Reilly, Anthony M; McCabe, Patrick; Price, Sarah L

    2017-10-10

    Determining the range of conformations that a flexible pharmaceutical-like molecule could plausibly adopt in a crystal structure is a key to successful crystal structure prediction (CSP) studies. We aim to use conformational information from the crystal structures in the Cambridge Structural Database (CSD) to facilitate this task. The conformations produced by the CSD Conformer Generator are reduced in number by considering the underlying rotamer distributions, an analysis of changes in molecular shape, and a minimal number of molecular ab initio calculations. This method is tested for five pharmaceutical-like molecules where an extensive CSP study has already been performed. The CSD informatics-derived set of crystal structure searches generates almost all the low-energy crystal structures previously found, including all experimental structures. The workflow effectively combines information on individual torsion angles and then eliminates the combinations that are too high in energy to be found in the solid state, reducing the resources needed to cover the solid-state conformational space of a molecule. This provides insights into how the low-energy solid-state and isolated-molecule conformations are related to the properties of the individual flexible torsion angles.

  4. Structures of water molecules in carbon nanotubes under electric fields

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Winarto,; Takaiwa, Daisuke; Yamamoto, Eiji

    2015-03-28

    Carbon nanotubes (CNTs) are promising for water transport through membranes and for use as nano-pumps. The development of CNT-based nanofluidic devices, however, requires a better understanding of the properties of water molecules in CNTs because they can be very different from those in the bulk. Using all-atom molecular dynamics simulations, we investigate the effect of axial electric fields on the structure of water molecules in CNTs having diameters ranging from (7,7) to (10,10). The water dipole moments were aligned parallel to the electric field, which increases the density of water inside the CNTs and forms ordered ice-like structures. The electricmore » field induces the transition from liquid to ice nanotubes in a wide range of CNT diameters. Moreover, we found an increase in the lifetime of hydrogen bonds for water structures in the CNTs. Fast librational motion breaks some hydrogen bonds, but the molecular pairs do not separate and the hydrogen bonds reform. Thus, hydrogen bonds maintain the water structure in the CNTs, and the water molecules move collectively, decreasing the axial diffusion coefficient and permeation rate.« less

  5. Phenothiazine-anthraquinone donor-acceptor molecules: synthesis, electronic properties and DFT-TDDFT computational study.

    PubMed

    Zhang, Wen-Wei; Mao, Wei-Li; Hu, Yun-Xia; Tian, Zi-Qi; Wang, Zhi-Lin; Meng, Qing-Jin

    2009-09-17

    Two donor-acceptor molecules with different pi-electron conjugative units, 1-((10-methyl-10H-phenothiazin-3-yl)ethynyl)anthracene-9,10-dione (AqMp) and 1,1'-(10-methyl-10H-phenothiazine-3,7-diyl)bis(ethyne-2,1-diyl)dianthracene-9,10-dione (Aq2Mp), have been synthesized and investigated for their photochemical and electrochemical properties. Density functional theory (DFT) calculations provide insights into their molecular geometry, electronic structures, and properties. These studies satisfactorily explain the electrochemistry of the two compounds and indicate that larger conjugative effect leads to smaller HOMO-LUMO gap (Eg) in Aq2Mp. Both compounds show ICT and pi --> pi* transitions in the UV-visible range in solution, and Aq2Mp has a bathochromic shift and shows higher oscillator strength of the absorption, which has been verified by time-dependent DFT (TDDFT) calculations. The differences between AqMp and Aq2Mp indicate that the structural and conjugative effects have great influence on the electronic properties of the molecules.

  6. Single Molecule Stepping and Structural Dynamics of Myosin X

    PubMed Central

    Sun, Yujie; Sato, Osamu; Ruhnow, Felix; Arsenault, Mark E.; Ikebe, Mitsuo; Goldman, Yale E.

    2010-01-01

    Myosin X is an unconventional myosin with puzzling motility properties. We studied the motility of dimerized myosin X using single molecule fluorescence techniques – polTIRF, FIONA, and Parallax to measure rotation angles and 3-dimensional position of the molecule during its walk. It was found that Myosin X steps processively in a hand-over-hand manner following a left-handed helical path along both single actin filaments and bundles. Its step size and velocity are smaller on actin bundles than individual filaments, suggesting myosin X often steps onto neighboring filaments in a bundle. The data suggest that a previously postulated single α-helical domain mechanically extends the 3-IQ motif lever arm and either the neck-tail hinge or the tail is flexible. These structural features, in conjunction with the membrane and microtubule binding domains, enable myosin X to perform multiple functions on varied actin structures in cells. PMID:20364131

  7. Optical and Transport Properties of Organic Molecules: Methods and Applications

    NASA Astrophysics Data System (ADS)

    Strubbe, David Alan

    -harmonic generation with TDDFT with a real-space grid, finding good agreement with calculations using localized bases and with experimental measurements, and that the response is very long-ranged in space. 5. N C 60 is an endohedral fullerene, a sphere of carbon containing a single N atom inside, which is weakly coupled electronically. I show with TDDFT calculations that a laser pulse can excite the vibrational mode of this N atom, transiently turning on and off the system's ability to undergo second-harmonic generation. The calculated susceptibility is as large as some commercially used frequency-doubling materials. 6. A crucial question in understanding experimental measurements of nonlinear optics and their relation to device performance is the effect of the solution environment on the properties of the isolated molecules. I will consider possible explanations for the large enhancement of the hyperpolarizability of chloroform in solution, demonstrate an ab initio method of calculating electrostatic effects with local-field factors, and derive the equations necessary for a full calculation of liquid chloroform. 7. Many-body perturbation theory, in the GW approximation for quasiparticle band-structure and Bethe-Salpeter equation for optical properties, is a powerful method for calculations in solids, nanostructures, and molecules. The BerkeleyGW code is a freely available implementation of this methodology which has been extensively tested and efficiently parallelized for use on large systems. 8. Molecular junctions, in which a single molecule is contacted to two metallic leads, are interesting systems for studying nanoscale transport. I will present a method called DFT+Sigma which approximates many-body perturbation theory to enable accurate and efficient calculations of the conductance of these systems. 9. Azobenzene is a molecule with the unusual property that it can switch reversible between two different geometries, cis and trans, upon absorption of light. I have calculated the

  8. Second and third order nonlinear optical properties of conjugated molecules and polymers

    NASA Technical Reports Server (NTRS)

    Perry, Joseph W.; Stiegman, Albert E.; Marder, Seth R.; Coulter, Daniel R.; Beratan, David N.; Brinza, David E.

    1988-01-01

    Second- and third-order nonlinear optical properties of some newly synthesized organic molecules and polymers are reported. Powder second-harmonic-generation efficiencies of up to 200 times urea have been realized for asymmetric donor-acceptor acetylenes. Third harmonic generation chi(3)s have been determined for a series of small conjugated molecules in solution. THG chi(3)s have also been determined for a series of soluble conjugated copolymers prepared using ring-opening metathesis polymerization. The results are discussed in terms of relevant molecular and/or macroscopic structural features of these conjugated organic materials.

  9. Bias-dependent local structure of water molecules at an electrochemical interface

    NASA Astrophysics Data System (ADS)

    Pedroza, Luana; Brandimarte, Pedro; Rocha, Alexandre R.; Fernandez-Serra, Marivi

    2015-03-01

    Following the need for new - and renewable - sources of energy worldwide, fuel cells using electrocatalysts can be thought of as a viable option. Understanding the local structure of water molecules at the interfaces of the metallic electrodes is a key problem. Notably the system is under an external potential bias, which makes the task of simulating this setup difficult. A first principle description of all components of the system is the most appropriate methodology in order to advance understanding of electrochemical processes. There, the metal is usually charged. To correctly compute the effect of an external bias potential applied to electrodes, we combine density functional theory (DFT) and non-equilibrium Green's functions methods (NEGF), with and without van der Waals interactions. In this work, we apply this methodology to study the electronic properties and forces of one water molecule and water monolayer at the interface of gold electrodes. We find that the water molecule has a different torque direction depending on the sign of the bias applied. We also show that it changes the position of the most stable configuration indicating that the external bias plays an important role in the structural properties of the interface. We acknowledge financial support from FAPESP.

  10. The Effect of Water Molecules on Mechanical Properties of Bamboo Microfibrils

    NASA Astrophysics Data System (ADS)

    Rahbar, Nima

    Bamboo fibers have higher strength-to-weight ratios than steel and concrete. The unique properties of bamboo fibers come from their natural composite structures that comprise mainly cellulose nanofibrils in a matrix of intertwined hemicellulose and lignin called lignin-carbohydrate complex (LCC). Here, we have utilized atomistic simulations to investigate the mechanical properties and mechanisms of interactions between these materials, in the presence of water molecules. Our results suggest that hemicellulose exhibits better mechanical properties and lignin shows greater tendency to adhere to cellulose nanofibrils. Consequently, the role of hemicellulose found to be enhancing the mechanical properties and lignin found to be providing the strength of bamboo fibers. The abundance of Hbonds in hemicellulose chains is responsible for improving the mechanical behavior of LCC. The strong van der Waals forces between lignin molecules and cellulose nanofibrils is responsible for higher adhesion energy between LCC/cellulose nanofibrils. We also found out that the amorphous regions of cellulose nanofibrils is the weakest interface in bamboo Microfibrils. In presence of water, the elastic modulus of lignin increases at low water content (less than 10 NSF CAREER Grant No. 1261284.

  11. The structure and properties of a simple model mixture of amphiphilic molecules and ions at a solid surface

    NASA Astrophysics Data System (ADS)

    Pizio, O.; Sokołowski, S.; Sokołowska, Z.

    2014-05-01

    We investigate microscopic structure, adsorption, and electric properties of a mixture that consists of amphiphilic molecules and charged hard spheres in contact with uncharged or charged solid surfaces. The amphiphilic molecules are modeled as spheres composed of attractive and repulsive parts. The electrolyte component of the mixture is considered in the framework of the restricted primitive model (RPM). The system is studied using a density functional theory that combines fundamental measure theory for hard sphere mixtures, weighted density approach for inhomogeneous charged hard spheres, and a mean-field approximation to describe anisotropic interactions. Our principal focus is in exploring the effects brought by the presence of ions on the distribution of amphiphilic particles at the wall, as well as the effects of amphiphilic molecules on the electric double layer formed at solid surface. In particular, we have found that under certain thermodynamic conditions a long-range translational and orientational order can develop. The presence of amphiphiles produces changes of the shape of the differential capacitance from symmetric or non-symmetric bell-like to camel-like. Moreover, for some systems the value of the potential of the zero charge is non-zero, in contrast to the RPM at a charged surface.

  12. Breaking Symmetry in Time-Dependent Electronic Structure Theory to Describe Spectroscopic Properties of Non-Collinear and Chiral Molecules

    NASA Astrophysics Data System (ADS)

    Goings, Joshua James

    Time-dependent electronic structure theory has the power to predict and probe the ways electron dynamics leads to useful phenomena and spectroscopic data. Here we report several advances and extensions of broken-symmetry time-dependent electronic structure theory in order to capture the flexibility required to describe non-equilibrium spin dynamics, as well as electron dynamics for chiroptical properties and vibrational effects. In the first half, we begin by discussing the generalization of self-consistent field methods to the so-called two-component structure in order to capture non-collinear spin states. This means that individual electrons are allowed to take a superposition of spin-1/2 projection states, instead of being constrained to either spin-up or spin-down. The system is no longer a spin eigenfunction, and is known a a spin-symmetry broken wave function. This flexibility to break spin symmetry may lead to variational instabilities in the approximate wave function, and we discuss how these may be overcome. With a stable non-collinear wave function in hand, we then discuss how to obtain electronic excited states from the non-collinear reference, along with associated challenges in their physical interpretation. Finally, we extend the two-component methods to relativistic Hamiltonians, which is the proper setting for describing spin-orbit driven phenomena. We describe the first implementation of the explicit time propagation of relativistic two-component methods and how this may be used to capture spin-forbidden states in electronic absorption spectra. In the second half, we describe the extension of explicitly time-propagated wave functions to the simulation of chiroptical properties, namely circular dichroism (CD) spectra of chiral molecules. Natural circular dichroism, that is, CD in the absence of magnetic fields, originates in the broken parity symmetry of chiral molecules. This proves to be an efficient method for computing circular dichroism spectra

  13. Measurement of the conductance properties of single organic molecules using gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Gordin, Yoav

    conduct more than an order of magnitude less than those that are fully conjugated. A distinct feature of the conjugated molecule is the appearance of pronounced peaks in its conductance at certain voltage values. We have shown that these peaks can be gated randomly by the electrostatic environment, but the peak spectrum is reproducible among the different samples of the same molecular species that we studied. To properly study and understand the peak structure we developed the ability to add gate dependent measurements to our system. Unfortunately the backdrop of this was a drastic reduction in the yield of good samples for measurement. We focused on four different conjugated molecules to attempt to understand the effect of the molecular structure on the properties of the peak spectra. We have been able to measure three of these molecules, and obtained SET diamond plots reminiscent of those seen for the single particles. The molecular diamonds have a larger energy gap than that found in single particles, as can be expected from their smaller size. We do not yet have enough data on this issue to make any definite statements on the influence of the molecular structure on the peak structure. Another topic investigated in this work is the physics of the two gold nanoparticles, giving rise to double quantum dot (DQD) phenomena. This physics is observed in dimers that do not exhibit "molecular" (high energy) features, or at low voltages before the appearance of the molecular peaks. We have used these phenomena to fully characterize the properties of our system and understand better the role the molecule plays in transport at low bias (below the voltage of the first peak). I begin this thesis with an introduction to the field of molecular electronics; I briefly review the theoretical approaches and the experimental methods used. I then describe in detail the dimer method, whose development took up a major part of this work, relaying in detail the relevant issues and

  14. Solid harmonic wavelet scattering for predictions of molecule properties

    NASA Astrophysics Data System (ADS)

    Eickenberg, Michael; Exarchakis, Georgios; Hirn, Matthew; Mallat, Stéphane; Thiry, Louis

    2018-06-01

    We present a machine learning algorithm for the prediction of molecule properties inspired by ideas from density functional theory (DFT). Using Gaussian-type orbital functions, we create surrogate electronic densities of the molecule from which we compute invariant "solid harmonic scattering coefficients" that account for different types of interactions at different scales. Multilinear regressions of various physical properties of molecules are computed from these invariant coefficients. Numerical experiments show that these regressions have near state-of-the-art performance, even with relatively few training examples. Predictions over small sets of scattering coefficients can reach a DFT precision while being interpretable.

  15. Interactions of molecules and the properties of crystals

    NASA Astrophysics Data System (ADS)

    McConnell, Thomas Daniel Leigh

    In this thesis the basic theory of the lattice dynamics of molecular crystals is considered, with particular reference to the specific case of linear molecules. The objective is to carry out a critical investigation of a number of empirical potentials as models for real systems. Suitable coordinates are introduced, in particular vibrational coordinates which are used to describe the translational and rotational modes of the free molecule. The Taylor expansion of the intermolecular potential is introduced and its terms considered, in particular the (first-order) equilibrium conditions for such a system and the (second-order) lattice vibrations. The elastic properties are also considered, in particular with reference to the specific case of rhombohedral crystals. The compressibility and a number of conditions for elastic stability are introduced. The total intermolecular interaction potential is divided into three components using perturbation methods, the electrostatic energy, the repulsion energy and the dispersion energy. A number of models are introduced for these various components. The induction energy is neglected. The electrostatic interaction is represented by atomic multipole and molecular multipole models. The repulsion and dispersion energies are modelled together in a central interaction potential, either the Lennard-Jones atom-atom potential or the anisotropic Berne-Pechukas molecule-molecule potential. In each case, the Taylor expansion coefficients, used to calculate the various molecular properties, are determined. An algorithm is described which provides a relatively simple method for calculating cartesian tensors, which are found in the Taylor expansion coefficients of the multipolar potentials. This proves to be particularly useful from a computational viewpoint, both in terms of programming and calculating efficiency. The model system carbonyl sulphide is introduced and its lattice properties are described. Suitable parameters for potentials used

  16. Study of the growth and pyroelectric properties of TGS crystals doped with aniline-family dipolar molecules

    NASA Astrophysics Data System (ADS)

    Zhang, Kecong; Song, Jiancheng; Wang, Min; Fang, Changshui; Lu, Mengkai

    1987-04-01

    TGS crystals doped with aniline-family dipolar molecules (aniline, 2-aminobenzoic acid, 3-aminobenzoic acid, 3-aminobenzene-sulphonic acid, 4-aminobenzenesulphonic acid and 4-nitroraniline) have been grown by the slow-cooling solution method. The influence of these dopants on the growth habits, crystal morphology pyroelectric properties, and structure parameters of TGS crystals has been systematically investigated. The effects of the domain structure of the seed crystal on the pyroelectric properties of the doped crystals have been studied. It is found that the spontaneous polarization (P), pyroelectric coefficient (lambda), and internal bias field of the doped crystals are slightly higher than those of the pure TGS, and the larger the dipole moment of the dopant molecule, the higher the P and lambda of the doped TGS crystal.

  17. The role played by self-orientational properties in nematics of colloids with molecules axially symmetric.

    PubMed

    Alarcón-Waess, O

    2010-04-14

    The self-orientational structure factor as well as the short-time self-orientational diffusion coefficient is computed for colloids composed by nonspherical molecules. To compute the short-time dynamics the hydrodynamic interactions are not taken into account. The hard molecules with at least one symmetry axis considered are: rods, spherocylinders, and tetragonal parallelepipeds. Because both orientational properties in study are written in terms of the second and fourth order parameters, these automatically hold the features of the order parameters. That is, they present a discontinuity for first order transitions, determining in this way the spinodal line. In order to analyze the nematic phase only, we choose the appropriate values for the representative quantities that characterize the molecules. Different formalisms are used to compute the structural properties: de Gennes-Landau approach, Smoluchowski equation and computer simulations. Some of the necessary inputs are taken from literature. Our results show that the self-orientational properties play an important role in the characterization and the localization of axially symmetric phases. While the self-structure decreases throughout the nematics, the short-time self-diffusion does not decrease but rather increases. We study the evolution of the second and fourth order parameters; we find different responses for axial and biaxial nematics, predicting the possibility of a biaxial nematics in tetragonal parallelepiped molecules. By considering the second order in the axial-biaxial phase transition, with the support of the self-orientational structure factor, we are able to propose the density at which this occurs. The short-time dynamics is able to predict a different value in the axial and the biaxial phases. Because the different behavior of the fourth order parameter, the diffusion coefficient is lower for a biaxial phase than for an axial one. Therefore the self-structure factor is able to localize

  18. Adsorption structures and energetics of molecules on metal surfaces: Bridging experiment and theory

    NASA Astrophysics Data System (ADS)

    Maurer, Reinhard J.; Ruiz, Victor G.; Camarillo-Cisneros, Javier; Liu, Wei; Ferri, Nicola; Reuter, Karsten; Tkatchenko, Alexandre

    2016-05-01

    Adsorption geometry and stability of organic molecules on surfaces are key parameters that determine the observable properties and functions of hybrid inorganic/organic systems (HIOSs). Despite many recent advances in precise experimental characterization and improvements in first-principles electronic structure methods, reliable databases of structures and energetics for large adsorbed molecules are largely amiss. In this review, we present such a database for a range of molecules adsorbed on metal single-crystal surfaces. The systems we analyze include noble-gas atoms, conjugated aromatic molecules, carbon nanostructures, and heteroaromatic compounds adsorbed on five different metal surfaces. The overall objective is to establish a diverse benchmark dataset that enables an assessment of current and future electronic structure methods, and motivates further experimental studies that provide ever more reliable data. Specifically, the benchmark structures and energetics from experiment are here compared with the recently developed van der Waals (vdW) inclusive density-functional theory (DFT) method, DFT + vdWsurf. In comparison to 23 adsorption heights and 17 adsorption energies from experiment we find a mean average deviation of 0.06 Å and 0.16 eV, respectively. This confirms the DFT + vdWsurf method as an accurate and efficient approach to treat HIOSs. A detailed discussion identifies remaining challenges to be addressed in future development of electronic structure methods, for which the here presented benchmark database may serve as an important reference.

  19. Small-molecule photostabilizing agents are modifiers of lipid bilayer properties.

    PubMed

    Alejo, Jose L; Blanchard, Scott C; Andersen, Olaf S

    2013-06-04

    Small-molecule photostabilizing or protective agents (PAs) provide essential support for the stability demands on fluorescent dyes in single-molecule spectroscopy and fluorescence microscopy. These agents are employed also in studies of cell membranes and model systems mimicking lipid bilayer environments, but there is little information about their possible effects on membrane structure and physical properties. Given the impact of amphipathic small molecules on bilayer properties such as elasticity and intrinsic curvature, we investigated the effects of six commonly used PAs--cyclooctatetraene (COT), para-nitrobenzyl alcohol (NBA), Trolox (TX), 1,4-diazabicyclo[2.2.2]octane (DABCO), para-nitrobenzoic acid (pNBA), and n-propyl gallate (nPG)--on bilayer properties using a gramicidin A (gA)-based fluorescence quench assay to probe for PA-induced changes in the gramicidin monomer↔dimer equilibrium. The experiments were done using fluorophore-loaded large unilamellar vesicles that had been doped with gA, and changes in the gA monomer↔dimer equilibrium were assayed using a gA channel-permeable fluorescence quencher (Tl⁺). Changes in bilayer properties caused by, e.g., PA adsorption at the bilayer/solution interface that alter the equilibrium constant for gA channel formation, and thus the number of conducting gA channels in the large unilamellar vesicle membrane, will be detectable as changes in the rate of Tl⁺ influx-the fluorescence quench rate. Over the experimentally relevant millimolar concentration range, TX, NBA, and pNBA, caused comparable increases in gA channel activity. COT, also in the millimolar range, caused a slight decrease in gA channel activity. nPG increased channel activity at submillimolar concentrations. DABCO did not alter gA activity. Five of the six tested PAs thus alter lipid bilayer properties at experimentally relevant concentrations, which becomes important for the design and analysis of fluorescence studies in cells and model

  20. Small-Molecule Photostabilizing Agents are Modifiers of Lipid Bilayer Properties

    PubMed Central

    Alejo, Jose L.; Blanchard, Scott C.; Andersen, Olaf S.

    2013-01-01

    Small-molecule photostabilizing or protective agents (PAs) provide essential support for the stability demands on fluorescent dyes in single-molecule spectroscopy and fluorescence microscopy. These agents are employed also in studies of cell membranes and model systems mimicking lipid bilayer environments, but there is little information about their possible effects on membrane structure and physical properties. Given the impact of amphipathic small molecules on bilayer properties such as elasticity and intrinsic curvature, we investigated the effects of six commonly used PAs—cyclooctatetraene (COT), para-nitrobenzyl alcohol (NBA), Trolox (TX), 1,4-diazabicyclo[2.2.2]octane (DABCO), para-nitrobenzoic acid (pNBA), and n-propyl gallate (nPG)—on bilayer properties using a gramicidin A (gA)-based fluorescence quench assay to probe for PA-induced changes in the gramicidin monomer↔dimer equilibrium. The experiments were done using fluorophore-loaded large unilamellar vesicles that had been doped with gA, and changes in the gA monomer↔dimer equilibrium were assayed using a gA channel-permeable fluorescence quencher (Tl+). Changes in bilayer properties caused by, e.g., PA adsorption at the bilayer/solution interface that alter the equilibrium constant for gA channel formation, and thus the number of conducting gA channels in the large unilamellar vesicle membrane, will be detectable as changes in the rate of Tl+ influx—the fluorescence quench rate. Over the experimentally relevant millimolar concentration range, TX, NBA, and pNBA, caused comparable increases in gA channel activity. COT, also in the millimolar range, caused a slight decrease in gA channel activity. nPG increased channel activity at submillimolar concentrations. DABCO did not alter gA activity. Five of the six tested PAs thus alter lipid bilayer properties at experimentally relevant concentrations, which becomes important for the design and analysis of fluorescence studies in cells and model

  1. Hierarchical structure and physicochemical properties of plasticized chitosan.

    PubMed

    Meng, Qingkai; Heuzey, Marie-Claude; Carreau, Pierre J

    2014-04-14

    Plasticized chitosan with hierarchical structure, including multiple length scale structural units, was prepared by a "melt"-based method, that is, thermomechanical mixing, as opposed to the usual casting-evaporation procedure. Chitosan was successfully plasticized by thermomechanical mixing in the presence of concentrated lactic acid and glycerol using a batch mixer. Different plasticization formulations were compared in this study, in which concentrated lactic acid was used as protonation agent as well as plasticizer. The microstructure of thermomechanically plasticized chitosan was investigated by X-ray diffraction, scanning electron microscopy, and optical microscopy. With increasing amount of additional plasticizers (glycerol or water), the crystallinity of the plasticized chitosan decreased from 63.7% for the original chitosan powder to almost zero for the sample plasticized with additional water. Salt linkage between lactic acid molecules and amino side chains of chitosan was confirmed by FTIR spectroscopy: the lactic acid molecules expanded the space between the chitosan molecules of the crystalline phase. In the presence of other plasticizers (glycerol and water), various levels of structural units including an amorphous phase, nanofibrils, nanofibril clusters, and microfibers were produced under mechanical shear and thermal energy and identified for the first time. The thermal and thermomechanical properties of the plasticized chitosan were measured by thermogravimetric analysis, differential scanning calorimetric, and DMA. These properties were correlated with the different levels of microstructure, including multiple structural units.

  2. Structure and thermodynamics of asymmetric molecules: Application to linear triatomic dipolar molecules

    NASA Astrophysics Data System (ADS)

    Nichols, Albert L., III; Calef, Daniel F.

    A new method to solve the reference HNC equations is developed to treat systems with both asymmetric short-range and long-range interactions. This method is motivated by the work of Patey and co-workers and uses Lado's free-energy minimizing optimization criteria for the reference HNC approximation. The properties of several fluids composed of linear triatomic molecules with various dipole moments or hard-sphere molecules with different-length dipoles are investigated.

  3. Superconducting selenides intercalated with organic molecules: synthesis, crystal structure, electric and magnetic properties, superconducting properties, and phase separation in iron based-chalcogenides and hybrid organic-inorganic superconductors

    NASA Astrophysics Data System (ADS)

    Krzton-Maziopa, Anna; Pesko, Edyta; Puzniak, Roman

    2018-06-01

    Layered iron-based superconducting chalcogenides intercalated with molecular species are the subject of intensive studies, especially in the field of solid state chemistry and condensed matter physics, because of their intriguing chemistry and tunable electric and magnetic properties. Considerable progress in the research, revealing superconducting inorganic–organic hybrid materials with transition temperatures to superconducting state, T c, up to 46 K, has been brought in recent years. These novel materials are synthesized by low-temperature intercalation of molecular species, such as solvates of alkali metals and nitrogen-containing donor compounds, into layered FeSe-type structure. Both the chemical nature as well as orientation of organic molecules between the layers of inorganic host, play an important role in structural modifications and may be used for fine tuning of superconducting properties. Furthermore, a variety of donor species compatible with alkali metals, as well as the possibility of doping also in the host structure (either on Fe or Se sites), makes this system quite flexible and gives a vast array of new materials with tunable electric and magnetic properties. In this review, the main aspects of intercalation chemistry are discussed with a particular attention paid to the influence of the unique nature of intercalating species on the crystal structure and physical properties of the hybrid inorganic–organic materials. To get a full picture of these materials, a comprehensive description of the most effective chemical and electrochemical methods, utilized for synthesis of intercalated species, with critical evaluation of their strong and weak points, related to feasibility of synthesis, phase purity, crystal size and morphology of final products, is included as well.

  4. A single molecule study of G-quadruplex and short duplex DNA structures

    NASA Astrophysics Data System (ADS)

    Roy, William A., Jr.

    Given that certain conditions are met, a single stranded DNA/RNA (ssDNA/RNA) structure called G-quadruplex (GQ) can form in regions throughout the genome, including at the telomeres and internal regions of the chromosomes. These structures serve various functions depending on the region in which they form which include protecting the chromosome ends, interfering with telomere elongation in cancer cells, and regulating transcription and translation level gene expression. Due to their high stability, various cellular mechanisms, such as GQ destabilizing proteins, are employed to unfold these structures during DNA replication or repair. Yet, their distinct layered structure has made GQs an attractive drug target in cancer treatment as GQ stabilizing molecules could inhibit telomerase dependent telomere elongation, a mechanism occurring in the majority of cancer cells to avoid senescence and apoptosis. However, proteins or small molecules interact with GQ that is under the influence of various cellular tension mechanisms, including the tension applied by other nearby molecules or the tension due to DNA structure within the chromatin context. Therefore, it is important to characterize the stability of various GQs and their response to interacting molecules when subjected to a tensile force. We employed a novel DNA-based nano tension generator that utilizes the elastic properties of circularized short double-stranded DNA (dsDNA) oligonucleotides to apply tension on the GQ. Since this is a completely new approach, the majority of this thesis was dedicated to proof-of-principle studies that demonstrated the feasibility and functionality of the method.

  5. Probing Electronic and Thermoelectric Properties of Single Molecule Junctions

    NASA Astrophysics Data System (ADS)

    Widawsky, Jonathan R.

    In an effort to further understand electronic and thermoelectric phenomenon at the nanometer scale, we have studied the transport properties of single molecule junctions. To carry out these transport measurements, we use the scanning tunneling microscope-break junction (STM-BJ) technique, which involves the repeated formation and breakage of a metal point contact in an environment of the target molecule. Using this technique, we are able to create gaps that can trap the molecules, allowing us to sequentially and reproducibly create a large number of junctions. By applying a small bias across the junction, we can measure its conductance and learn about the transport mechanisms at the nanoscale. The experimental work presented here directly probes the transmission properties of single molecules through the systematic measurement of junction conductance (at low and high bias) and thermopower. We present measurements on a variety of molecular families and study how conductance depends on the character of the linkage (metal-molecule bond) and the nature of the molecular backbone. We start by describing a novel way to construct single molecule junctions by covalently connecting the molecular backbone to the electrodes. This eliminates the use of linking substituents, and as a result, the junction conductance increases substantially. Then, we compare transport across silicon chains (silanes) and saturated carbon chains (alkanes) while keeping the linkers the same and find a stark difference in their electronic transport properties. We extend our studies of molecular junctions by looking at two additional aspects of quantum transport -- molecular thermopower and molecular current-voltage characteristics. Each of these additional parameters gives us further insight into transport properties at the nanoscale. Evaluating the junction thermopower allows us to determine the nature of charge carriers in the system and we demonstrate this by contrasting the measurement of amine

  6. Isolation and structural proof of the large diamond molecule, cyclohexamantane (C26H30)

    USGS Publications Warehouse

    Dahl, J.E.P.; Moldowan, J.M.; Peakman, T.M.; Clardy, J.C.; Lobkovsky, E.; Olmstead, M.M.; May, P.W.; Davis, T.J.; Steeds, J.W.; Peters, K.E.; Pepper, A.; Ekuan, A.; Carlson, R.M.K.

    2003-01-01

    Ace of diamonds: Cyclohexamantane (C26H30), a large diamond-like molecule containing six peri-fused adamantane cages was identified in petroleum and its structure proven by X-ray crystallography (see picture), Never synthesized because of severe mechanistic difficulties, the structure of cyclohexamantane has appeared in theoretical molecular-simulation studies related to diamond; its experimentally determined properties are now discussed.

  7. Communication: Multiple-property-based diabatization for open-shell van der Waals molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karman, Tijs; Avoird, Ad van der; Groenenboom, Gerrit C., E-mail: gerritg@theochem.ru.nl

    2016-03-28

    We derive a new multiple-property-based diabatization algorithm. The transformation between adiabatic and diabatic representations is determined by requiring a set of properties in both representations to be related by a similarity transformation. This set of properties is determined in the adiabatic representation by rigorous electronic structure calculations. In the diabatic representation, the same properties are determined using model diabatic states defined as products of undistorted monomer wave functions. This diabatic model is generally applicable to van der Waals molecules in arbitrary electronic states. Application to locating seams of conical intersections and collisional transfer of electronic excitation energy is demonstrated formore » O{sub 2} − O{sub 2} in low-lying excited states. Property-based diabatization for this test system included all components of the electric quadrupole tensor, orbital angular momentum, and spin-orbit coupling.« less

  8. The study of electronic structure and properties of silicene for gas sensor application

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wella, Sasfan A.; Syaputra, Marhamni; Wungu, Triati D. K., E-mail: triati@fi.itb.ac.id

    2016-03-11

    In this study, we investigated the adsorption of gas molecules (H{sub 2}S, CO) on pristine silicene using first principles calculation. The structure, electronic properties, and adsorption energy of H{sub 2}S,CO/silicene are discussed thoroughly. We found that the pristine silicenewith low buckling structure is the most stable as compared with planar and high buckling structures. Silicene was able to detect a gas molecule which can be observed according tothe density of states analysis. Though a gas molecule adsorbed weakly, the electronic properties of the low buckling pristine silicene changed from semi-metal (zero band gap) to semiconductor. The adsorption energy of H{submore » 2}S and CO on silicene is 0.075 eV and 0.06 eV, respectively.« less

  9. Prediction of RNA secondary structures: from theory to models and real molecules

    NASA Astrophysics Data System (ADS)

    Schuster, Peter

    2006-05-01

    RNA secondary structures are derived from RNA sequences, which are strings built form the natural four letter nucleotide alphabet, {AUGC}. These coarse-grained structures, in turn, are tantamount to constrained strings over a three letter alphabet. Hence, the secondary structures are discrete objects and the number of sequences always exceeds the number of structures. The sequences built from two letter alphabets form perfect structures when the nucleotides can form a base pair, as is the case with {GC} or {AU}, but the relation between the sequences and structures differs strongly from the four letter alphabet. A comprehensive theory of RNA structure is presented, which is based on the concepts of sequence space and shape space, being a space of structures. It sets the stage for modelling processes in ensembles of RNA molecules like evolutionary optimization or kinetic folding as dynamical phenomena guided by mappings between the two spaces. The number of minimum free energy (mfe) structures is always smaller than the number of sequences, even for two letter alphabets. Folding of RNA molecules into mfe energy structures constitutes a non-invertible mapping from sequence space onto shape space. The preimage of a structure in sequence space is defined as its neutral network. Similarly the set of suboptimal structures is the preimage of a sequence in shape space. This set represents the conformation space of a given sequence. The evolutionary optimization of structures in populations is a process taking place in sequence space, whereas kinetic folding occurs in molecular ensembles that optimize free energy in conformation space. Efficient folding algorithms based on dynamic programming are available for the prediction of secondary structures for given sequences. The inverse problem, the computation of sequences for predefined structures, is an important tool for the design of RNA molecules with tailored properties. Simultaneous folding or cofolding of two or more RNA

  10. Alignment of RNA molecules: Binding energy and statistical properties of random sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valba, O. V., E-mail: valbaolga@gmail.com; Nechaev, S. K., E-mail: sergei.nechaev@gmail.com; Tamm, M. V., E-mail: thumm.m@gmail.com

    2012-02-15

    A new statistical approach to the problem of pairwise alignment of RNA sequences is proposed. The problem is analyzed for a pair of interacting polymers forming an RNA-like hierarchical cloverleaf structures. An alignment is characterized by the numbers of matches, mismatches, and gaps. A weight function is assigned to each alignment; this function is interpreted as a free energy taking into account both direct monomer-monomer interactions and a combinatorial contribution due to formation of various cloverleaf secondary structures. The binding free energy is determined for a pair of RNA molecules. Statistical properties are discussed, including fluctuations of the binding energymore » between a pair of RNA molecules and loop length distribution in a complex. Based on an analysis of the free energy per nucleotide pair complexes of random RNAs as a function of the number of nucleotide types c, a hypothesis is put forward about the exclusivity of the alphabet c = 4 used by nature.« less

  11. Evaluation of the Kinetic Property of Single-Molecule Junctions by Tunneling Current Measurements.

    PubMed

    Harashima, Takanori; Hasegawa, Yusuke; Kiguchi, Manabu; Nishino, Tomoaki

    2018-01-01

    We investigated the formation and breaking of single-molecule junctions of two kinds of dithiol molecules by time-resolved tunneling current measurements in a metal nanogap. The resulting current trajectory was statistically analyzed to determine the single-molecule conductance and, more importantly, to reveal the kinetic property of the single-molecular junction. These results suggested that combining a measurement of the single-molecule conductance and statistical analysis is a promising method to uncover the kinetic properties of the single-molecule junction.

  12. Chemical Structure and Properties: A Modified Atoms-First, One-Semester Introductory Chemistry Course

    ERIC Educational Resources Information Center

    Schaller, Chris P.; Graham, Kate J.; Johnson, Brian J.; Jakubowski, Henry V.; McKenna, Anna G.; McIntee, Edward J.; Jones, T. Nicholas; Fazal, M. A.; Peterson, Alicia A.

    2015-01-01

    A one-semester, introductory chemistry course is described that develops a primarily qualitative understanding of structure-property relationships. Starting from an atoms-first approach, the course examines the properties and three-dimensional structure of metallic and ionic solids before expanding into a thorough investigation of molecules. In…

  13. Chemically Aware Model Builder (camb): an R package for property and bioactivity modelling of small molecules.

    PubMed

    Murrell, Daniel S; Cortes-Ciriano, Isidro; van Westen, Gerard J P; Stott, Ian P; Bender, Andreas; Malliavin, Thérèse E; Glen, Robert C

    2015-01-01

    In silico predictive models have proved to be valuable for the optimisation of compound potency, selectivity and safety profiles in the drug discovery process. camb is an R package that provides an environment for the rapid generation of quantitative Structure-Property and Structure-Activity models for small molecules (including QSAR, QSPR, QSAM, PCM) and is aimed at both advanced and beginner R users. camb's capabilities include the standardisation of chemical structure representation, computation of 905 one-dimensional and 14 fingerprint type descriptors for small molecules, 8 types of amino acid descriptors, 13 whole protein sequence descriptors, filtering methods for feature selection, generation of predictive models (using an interface to the R package caret), as well as techniques to create model ensembles using techniques from the R package caretEnsemble). Results can be visualised through high-quality, customisable plots (R package ggplot2). Overall, camb constitutes an open-source framework to perform the following steps: (1) compound standardisation, (2) molecular and protein descriptor calculation, (3) descriptor pre-processing and model training, visualisation and validation, and (4) bioactivity/property prediction for new molecules. camb aims to speed model generation, in order to provide reproducibility and tests of robustness. QSPR and proteochemometric case studies are included which demonstrate camb's application.Graphical abstractFrom compounds and data to models: a complete model building workflow in one package.

  14. Machine learning properties of materials and molecules with entropy-regularized kernels

    NASA Astrophysics Data System (ADS)

    Ceriotti, Michele; Bartók, Albert; CsáNyi, GáBor; de, Sandip

    Application of machine-learning methods to physics, chemistry and materials science is gaining traction as a strategy to obtain accurate predictions of the properties of matter at a fraction of the typical cost of quantum mechanical electronic structure calculations. In this endeavor, one can leverage general-purpose frameworks for supervised-learning. It is however very important that the input data - for instance the positions of atoms in a molecule or solid - is processed into a form that reflects all the underlying physical symmetries of the problem, and that possesses the regularity properties that are required by machine-learning algorithms. Here we introduce a general strategy to build a representation of this kind. We will start from existing approaches to compare local environments (basically, groups of atoms), and combine them using techniques borrowed from optimal transport theory, discussing the relation between this idea and additive energy decompositions. We will present a few examples demonstrating the potential of this approach as a tool to predict molecular and materials' properties with an accuracy on par with state-of-the-art electronic structure methods. MARVEL NCCR (Swiss National Science Foundation) and ERC StG HBMAP (European Research Council, G.A. 677013).

  15. A Structural Perspective on the Modulation of Protein-Protein Interactions with Small Molecules.

    PubMed

    Demirel, Habibe Cansu; Dogan, Tunca; Tuncbag, Nurcan

    2018-05-31

    Protein-protein interactions (PPIs) are the key components in many cellular processes including signaling pathways, enzymatic reactions and epigenetic regulation. Abnormal interactions of some proteins may be pathogenic and cause various disorders including cancer and neurodegenerative diseases. Although inhibiting PPIs with small molecules is a challenging task, it gained an increasing interest because of its strong potential for drug discovery and design. The knowledge of the interface as well as the structural and chemical characteristics of the PPIs and their roles in the cellular pathways are necessary for a rational design of small molecules to modulate PPIs. In this study, we review the recent progress in the field and detail the physicochemical properties of PPIs including binding hot spots with a focus on structural methods. Then, we review recent approaches for structural prediction of PPIs. Finally, we revisit the concept of targeting PPIs in a systems biology perspective and we refer to the non-structural approaches, usually employed when the structural information is not present. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  16. Nanoscale Insight and Control of Structural and Electronic Properties of Organic Semiconductor / Metal Interfaces

    NASA Astrophysics Data System (ADS)

    Maughan, Bret

    Organic semiconductor interfaces are promising materials for use in next-generation electronic and optoelectronic devices. Current models for metal-organic interfacial electronic structure and dynamics are inadequate for strongly hybridized systems. This work aims to address this issue by identifying the factors most important for understanding chemisorbed interfaces with an eye towards tuning the interfacial properties. Here, I present the results of my research on chemisorbed interfaces formed between thin-films of phthalocyanine molecules grown on monocrystalline Cu(110). Using atomically-resolved nanoscale imaging in combination with surface-sensitive photoemission techniques, I show that single-molecule level interactions control the structural and electronic properties of the interface. I then demonstrate that surface modifications aimed at controlling interfacial interactions are an effective way to tailor the physical and electronic structure of the interface. This dissertation details a systematic investigation of the effect of molecular and surface functionalization on interfacial interactions. To understand the role of molecular structure, two types of phthalocyanine (Pc) molecules are studied: non-planar, dipolar molecules (TiOPc), and planar, non-polar molecules (H2Pc and CuPc). Multiple adsorption configurations for TiOPc lead to configuration-dependent self-assembly, Kondo screening, and electronic energy-level alignment. To understand the role of surface structure, the Cu(110) surface is textured and passivated by oxygen chemisorption prior to molecular deposition, which gives control over thin-film growth and interfacial electronic structure in H2Pc and CuPc films. Overall, the work presented here demonstrates a method for understanding interfacial electronic structure of strongly hybridized interfaces, an important first step towards developing more robust models for metal-organic interfaces, and reliable, predictive tuning of interfacial

  17. Optical and electronic properties of SO2 molecule adsorbed on Si-doped (8, 0) boron nitride nanotube

    NASA Astrophysics Data System (ADS)

    Guo, Shuang-Shuang; Wei, Xiu-Mei; Zhang, Jian-Min; Zhu, Gang-Qiang; Guo, Wan-Jin

    2016-09-01

    The study of the optical properties of pristine BNNT, Si-doped BNNTs and SO2 molecule adsorption on Si-doped BNNTs is that, to our knowledge, few relevant research have ever been found. In this paper, the adsorption behaviors of Sulfur dioxide (SO2) molecule on Si-doped Boron nitride nanotubes (BNNTs) are investigated applying the first-principles calculations. The main contribution of this paper is that the foremost investigation for the optical properties of the pristine BNNT, Si-doped BNNTs and SO2 adsorption on Si-doped BNNTs. Additionally, the electronic properties and the structural properties are also presented. In our calculations of optical properties, the dielectric constant, the refractive index and the absorption coefficient are obtained. Comparing the pristine BNNT, our results indicate that, the blue-shifts (in the main peaks of the dielectric constant of SiB -BNNT and SO2-SiB -BNNT), and the red-shifts (in the main peaks of the refractive index of SiN -BNNT and SO2-SiN -BNNT) are appeared. Under these conditions, Si-doped BNNT and Si-doped BNNT with SO2 adsorption, the gaps are reduced both for the speculated optical band gaps and the electronic structure band gaps.

  18. Molecular structure and the EPR calculation of the gas phase succinonitrile molecule

    NASA Astrophysics Data System (ADS)

    Kepceoǧlu, A.; Kılıç, H. Ş.; Dereli, Ö.

    2017-02-01

    Succinonitrile (i.e. butanedinitrile) is a colorless nitrile compound that can be used in the gel polymer batteries as a solid-state solvent electrolytes and has a plastic crystal structure. Prior to the molecular structure calculation of the succinonitrile molecule, the conformer analysis were calculated by using semi empirical method PM3 core type Hamiltonian and eight different conformer structures were determined. Molecular structure with energy related properties of these conformers having the lowest energy was calculated by using DFT (B3LYP) methods with 6-311++G(d,p) basis set. Possible radicals, can be formed experimentally, were modeled in this study. EPR parameters of these model radicals were calculated and then compared with that obtained experimentally.

  19. Interrogating the relationship between rat in vivo tissue distribution and drug property data for >200 structurally unrelated molecules

    PubMed Central

    Harrell, Andrew W; Sychterz, Caroline; Ho, May Y; Weber, Andrew; Valko, Klara; Negash, Kitaw

    2015-01-01

    The ability to explain distribution patterns from drug physicochemical properties and binding characteristics has been explored for more than 200 compounds by interrogating data from quantitative whole body autoradiography studies (QWBA). These in vivo outcomes have been compared to in silico and in vitro drug property data to determine the most influential properties governing drug distribution. Consistent with current knowledge, in vivo distribution was most influenced by ionization state and lipophilicity which in turn affected phospholipid and plasma protein binding. Basic and neutral molecules were generally better distributed than acidic counterparts demonstrating weaker plasma protein and stronger phospholipid binding. The influence of phospholipid binding was particularly evident in tissues with high phospholipid content like spleen and lung. Conversely, poorer distribution of acidic drugs was associated with stronger plasma protein and weaker phospholipid binding. The distribution of a proportion of acidic drugs was enhanced, however, in tissues known to express anionic uptake transporters such as the liver and kidney. Greatest distribution was observed into melanin containing tissues of the eye, most likely due to melanin binding. Basic molecules were consistently better distributed into parts of the eye and skin containing melanin than those without. The data, therefore, suggest that drug binding to macromolecules strongly influences the distribution of total drug for a large proportion of molecules in most tissues. Reducing lipophilicity, a strategy often used in discovery to optimize pharmacokinetic properties such as absorption and clearance, also decreased the influence of nonspecific binding on drug distribution. PMID:26516585

  20. Pectins filled with LDH-antimicrobial molecules: preparation, characterization and physical properties.

    PubMed

    Gorrasi, Giuliana; Bugatti, Valeria; Vittoria, Vittoria

    2012-06-05

    Nanohybrids of layered double hydroxide (LDH) with intercalated active molecules: benzoate, 2,4-dichlorobenzoate, para-hydroxybenzoate and ortho-hydroxybenzoate, were incorporated into pectins from apples through high energy ball milling in the presence of water. Cast films were obtained and analysed. X-ray diffraction analysis showed a complete destructuration of all nanohybrids in the pectin matrix. Thermogravimetric analysis showed a better thermal resistance of pectin in the presence of fillers, especially para-hydroxybenzoate and ortho-hydroxybenzoate. Mechanical properties showed an improvement of elastic modulus in particular for LDH-para-hydroxybenzoate nanohybrid, due probably to a better interaction between pectin matrix and nanohybrid layers. Barrier properties (sorption and diffusion) to water vapour showed improvement in the dependence on the intercalated active molecule, the best improvement was achieved for composites containing para-hydroxybenzoate molecules, suggesting that the interaction between the filler phase and the polymer plays an important role in sorption and diffusion phenomena. Incorporation of these active molecules gave antimicrobial properties to the composite films giving opportunities in the field of active packaging. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Data-Driven High-Throughput Prediction of the 3D Structure of Small Molecules: Review and Progress

    PubMed Central

    Andronico, Alessio; Randall, Arlo; Benz, Ryan W.; Baldi, Pierre

    2011-01-01

    Accurate prediction of the 3D structure of small molecules is essential in order to understand their physical, chemical, and biological properties including how they interact with other molecules. Here we survey the field of high-throughput methods for 3D structure prediction and set up new target specifications for the next generation of methods. We then introduce COSMOS, a novel data-driven prediction method that utilizes libraries of fragment and torsion angle parameters. We illustrate COSMOS using parameters extracted from the Cambridge Structural Database (CSD) by analyzing their distribution and then evaluating the system’s performance in terms of speed, coverage, and accuracy. Results show that COSMOS represents a significant improvement when compared to the state-of-the-art, particularly in terms of coverage of complex molecular structures, including metal-organics. COSMOS can predict structures for 96.4% of the molecules in the CSD [99.6% organic, 94.6% metal-organic] whereas the widely used commercial method CORINA predicts structures for 68.5% [98.5% organic, 51.6% metal-organic]. On the common subset of molecules predicted by both methods COSMOS makes predictions with an average speed per molecule of 0.15s [0.10s organic, 0.21s metal-organic], and an average RMSD of 1.57Å [1.26Å organic, 1.90Å metal-organic], and CORINA makes predictions with an average speed per molecule of 0.13s [0.18s organic, 0.08s metal-organic], and an average RMSD of 1.60Å [1.13Å organic, 2.11Å metal-organic]. COSMOS is available through the ChemDB chemoinformatics web portal at: http://cdb.ics.uci.edu/. PMID:21417267

  2. The Atom in a Molecule: Implications for Molecular Structure and Properties

    DTIC Science & Technology

    2016-05-23

    unlimited. PA Clearance #16075.” Atomic- Product Representations of Molecules Employ “van der Waals” products of atomic states to represent molecules...representation the electrons “stay home” with each nucleus. Atomic fragment operators are well-defined over product representations. Expectation values of...release; distribution unlimited. PA Clearance #16075.” Hamiltonian Matrix in the Atomic- Product Basis Technical Questions Addressed: J. Chem. Phys

  3. Structural and electronic properties of L-amino acids

    NASA Astrophysics Data System (ADS)

    Tulip, P. R.; Clark, S. J.

    2005-05-01

    The structural and electronic properties of four L-amino acids alanine, leucine, isoleucine, and valine have been investigated using density functional theory (DFT) and the generalized gradient approximation. Within the crystals, it is found that the constituent molecules adopt zwitterionic configurations, in agreement with experimental work. Lattice constants are found to be in good agreement with experimentally determined values, although certain discrepancies do exist due to the description of van der Waals interactions. We find that these materials possess wide DFT band gaps in the region of 5 eV, with electrons highly localized to the constituent molecules. It is found that the main mechanisms behind crystal formation are dipolar interactions and hydrogen bonding of a primarily electrostatic character, in agreement with current biochemical understanding of these systems. The electronic structure suggests that the amine and carboxy functional groups are dominant in determining band structure.

  4. Molecule database framework: a framework for creating database applications with chemical structure search capability

    PubMed Central

    2013-01-01

    Background Research in organic chemistry generates samples of novel chemicals together with their properties and other related data. The involved scientists must be able to store this data and search it by chemical structure. There are commercial solutions for common needs like chemical registration systems or electronic lab notebooks. However for specific requirements of in-house databases and processes no such solutions exist. Another issue is that commercial solutions have the risk of vendor lock-in and may require an expensive license of a proprietary relational database management system. To speed up and simplify the development for applications that require chemical structure search capabilities, I have developed Molecule Database Framework. The framework abstracts the storing and searching of chemical structures into method calls. Therefore software developers do not require extensive knowledge about chemistry and the underlying database cartridge. This decreases application development time. Results Molecule Database Framework is written in Java and I created it by integrating existing free and open-source tools and frameworks. The core functionality includes: • Support for multi-component compounds (mixtures) • Import and export of SD-files • Optional security (authorization) For chemical structure searching Molecule Database Framework leverages the capabilities of the Bingo Cartridge for PostgreSQL and provides type-safe searching, caching, transactions and optional method level security. Molecule Database Framework supports multi-component chemical compounds (mixtures). Furthermore the design of entity classes and the reasoning behind it are explained. By means of a simple web application I describe how the framework could be used. I then benchmarked this example application to create some basic performance expectations for chemical structure searches and import and export of SD-files. Conclusions By using a simple web application it was

  5. Molecule database framework: a framework for creating database applications with chemical structure search capability.

    PubMed

    Kiener, Joos

    2013-12-11

    Research in organic chemistry generates samples of novel chemicals together with their properties and other related data. The involved scientists must be able to store this data and search it by chemical structure. There are commercial solutions for common needs like chemical registration systems or electronic lab notebooks. However for specific requirements of in-house databases and processes no such solutions exist. Another issue is that commercial solutions have the risk of vendor lock-in and may require an expensive license of a proprietary relational database management system. To speed up and simplify the development for applications that require chemical structure search capabilities, I have developed Molecule Database Framework. The framework abstracts the storing and searching of chemical structures into method calls. Therefore software developers do not require extensive knowledge about chemistry and the underlying database cartridge. This decreases application development time. Molecule Database Framework is written in Java and I created it by integrating existing free and open-source tools and frameworks. The core functionality includes:•Support for multi-component compounds (mixtures)•Import and export of SD-files•Optional security (authorization)For chemical structure searching Molecule Database Framework leverages the capabilities of the Bingo Cartridge for PostgreSQL and provides type-safe searching, caching, transactions and optional method level security. Molecule Database Framework supports multi-component chemical compounds (mixtures).Furthermore the design of entity classes and the reasoning behind it are explained. By means of a simple web application I describe how the framework could be used. I then benchmarked this example application to create some basic performance expectations for chemical structure searches and import and export of SD-files. By using a simple web application it was shown that Molecule Database Framework

  6. Photophysical and redox properties of molecule-like CdSe nanoclusters.

    PubMed

    Dolai, Sukanta; Dass, Amala; Sardar, Rajesh

    2013-05-21

    Advancing our understanding of the photophysical and electrochemical properties of semiconductor nanoclusters with a molecule-like HOMO-LUMO energy level will help lead to their application in photovoltaic devices and photocatalysts. Here we describe an approach to the synthesis and isolation of molecule-like CdSe nanoclusters, which displayed sharp transitions at 347 nm (3.57 eV) and 362 nm (3.43 eV) in the optical spectrum with a lower energy band extinction coefficient of ~121,000 M(-1) cm(-1). Mass spectrometry showed a single nanocluster molecular weight of 8502. From this mass and various spectroscopic analyses, the nanoclusters are determined to be of the single molecular composition Cd34Se20(SPh)28, which is a new nonstiochiometric nanocluster. Their reversible electrochemical band gap determined in Bu4NPF6/CH3CN was found to be 4.0 V. There was a 0.57 eV Coulombic interaction energy of the electron-hole pair involved. The scan rate dependent electrochemistry suggested diffusion-limited transport of nanoclusters to the electrode. The nanocluster diffusion coefficient (D = 5.4 × 10 (-4) cm(2)/s) in acetonitrile solution was determined from cyclic voltammetry, which suggested Cd34Se20(SPh)28 acts as a multielectron donor or acceptor. We also present a working model of the energy level structure of the newly discovered nanocluster based on its photophysical and redox properties.

  7. From Artificial Atoms to Nanocrystal Molecules: Preparation and Properties of More Complex Nanostructures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choi, Charina L; Alivisatos, A Paul

    2009-10-20

    Quantum dots, which have found widespread use in fields such as biomedicine, photovoltaics, and electronics, are often called artificial atoms due to their size-dependent physical properties. Here this analogy is extended to consider artificial nanocrystal molecules, formed from well-defined groupings of plasmonically or electronically coupled single nanocrystals. Just as a hydrogen molecule has properties distinct from two uncoupled hydrogen atoms, a key feature of nanocrystal molecules is that they exhibit properties altered from those of the component nanoparticles due to coupling. The nature of the coupling between nanocrystal atoms and its response to vibrations and deformations of the nanocrystal moleculemore » bonds are of particular interest. We discuss synthetic approaches, predicted and observed physical properties, and prospects and challenges toward this new class of materials.« less

  8. How Water’s Properties Are Encoded in Its Molecular Structure and Energies

    PubMed Central

    2017-01-01

    How are water’s material properties encoded within the structure of the water molecule? This is pertinent to understanding Earth’s living systems, its materials, its geochemistry and geophysics, and a broad spectrum of its industrial chemistry. Water has distinctive liquid and solid properties: It is highly cohesive. It has volumetric anomalies—water’s solid (ice) floats on its liquid; pressure can melt the solid rather than freezing the liquid; heating can shrink the liquid. It has more solid phases than other materials. Its supercooled liquid has divergent thermodynamic response functions. Its glassy state is neither fragile nor strong. Its component ions—hydroxide and protons—diffuse much faster than other ions. Aqueous solvation of ions or oils entails large entropies and heat capacities. We review how these properties are encoded within water’s molecular structure and energies, as understood from theories, simulations, and experiments. Like simpler liquids, water molecules are nearly spherical and interact with each other through van der Waals forces. Unlike simpler liquids, water’s orientation-dependent hydrogen bonding leads to open tetrahedral cage-like structuring that contributes to its remarkable volumetric and thermal properties. PMID:28949513

  9. Atomistic theory of excitonic fine structure in InAs/InP nanowire quantum dot molecules

    NASA Astrophysics Data System (ADS)

    Świderski, M.; Zieliński, M.

    2017-03-01

    Nanowire quantum dots have peculiar electronic and optical properties. In this work we use atomistic tight binding to study excitonic spectra of artificial molecules formed by a double nanowire quantum dot. We demonstrate a key role of atomistic symmetry and nanowire substrate orientation rather than cylindrical shape symmetry of a nanowire and a molecule. In particular for [001 ] nanowire orientation we observe a nonvanishing bright exciton splitting for a quasimolecule formed by two cylindrical quantum dots of different heights. This effect is due to interdot coupling that effectively reduces the overall symmetry, whereas single uncoupled [001 ] quantum dots have zero fine structure splitting. We found that the same double quantum dot system grown on [111 ] nanowire reveals no excitonic fine structure for all considered quantum dot distances and individual quantum dot heights. Further we demonstrate a pronounced, by several orders of magnitude, increase of the dark exciton optical activity in a quantum dot molecule as compared to a single quantum dot. For [111 ] systems we also show spontaneous localization of single particle states in one of nominally identical quantum dots forming a molecule, which is mediated by strain and origins from the lack of the vertical inversion symmetry in [111 ] nanostructures of overall C3 v symmetry. Finally, we study lowering of symmetry due to alloy randomness that triggers nonzero excitonic fine structure and the dark exciton optical activity in realistic nanowire quantum dot molecules of intermixed composition.

  10. Integrated magnetic tweezers and single-molecule FRET for investigating the mechanical properties of nucleic acid

    PubMed Central

    Long, Xi; Parks, Joseph W.; Stone, Michael D.

    2017-01-01

    Many enzymes promote structural changes in their nucleic acid substrates via application of piconewton forces over nanometer length scales. Magnetic tweezers (MT) is a single molecule force spectroscopy method widely used for studying the energetics of such mechanical processes. MT permits stable application of a wide range of forces and torques over long time scales with nanometer spatial resolution. However, in any force spectroscopy experiment, the ability to monitor structural changes in nucleic acids with nanometer sensitivity requires the system of interest to be held under high degrees of tension to improve signal to noise. This limitation prohibits measurement of structural changes within nucleic acids under physiologically relevant conditions of low stretching forces. To overcome this challenge, researchers have integrated a spatially sensitive fluorescence spectroscopy method, single molecule-FRET, with MT to allow simultaneous observation and manipulation of nanoscale structural transitions over a wide range of forces. Here, we describe a method for using this hybrid instrument to analyze the mechanical properties of nucleic acids. We expect that this method for analysis of nucleic acid structure will be easily adapted for experiments aiming to interrogate the mechanical responses of other biological macromolecules. PMID:27320203

  11. Structural similarity based kriging for quantitative structure activity and property relationship modeling.

    PubMed

    Teixeira, Ana L; Falcao, Andre O

    2014-07-28

    Structurally similar molecules tend to have similar properties, i.e. closer molecules in the molecular space are more likely to yield similar property values while distant molecules are more likely to yield different values. Based on this principle, we propose the use of a new method that takes into account the high dimensionality of the molecular space, predicting chemical, physical, or biological properties based on the most similar compounds with measured properties. This methodology uses ordinary kriging coupled with three different molecular similarity approaches (based on molecular descriptors, fingerprints, and atom matching) which creates an interpolation map over the molecular space that is capable of predicting properties/activities for diverse chemical data sets. The proposed method was tested in two data sets of diverse chemical compounds collected from the literature and preprocessed. One of the data sets contained dihydrofolate reductase inhibition activity data, and the second molecules for which aqueous solubility was known. The overall predictive results using kriging for both data sets comply with the results obtained in the literature using typical QSPR/QSAR approaches. However, the procedure did not involve any type of descriptor selection or even minimal information about each problem, suggesting that this approach is directly applicable to a large spectrum of problems in QSAR/QSPR. Furthermore, the predictive results improve significantly with the similarity threshold between the training and testing compounds, allowing the definition of a confidence threshold of similarity and error estimation for each case inferred. The use of kriging for interpolation over the molecular metric space is independent of the training data set size, and no reparametrizations are necessary when more compounds are added or removed from the set, and increasing the size of the database will consequentially improve the quality of the estimations. Finally it is shown

  12. Fast electron transfer through a single molecule natively structured redox protein

    NASA Astrophysics Data System (ADS)

    Della Pia, Eduardo Antonio; Chi, Qijin; MacDonald, J. Emyr; Ulstrup, Jens; Jones, D. Dafydd; Elliott, Martin

    2012-10-01

    The electron transfer properties of proteins are normally measured as molecularly averaged ensembles. Through these and related measurements, proteins are widely regarded as macroscopically insulating materials. Using scanning tunnelling microscopy (STM), we present new measurements of the conductance through single-molecules of the electron transfer protein cytochrome b562 in its native conformation, under pseudo-physiological conditions. This is achieved by thiol (SH) linker pairs at opposite ends of the molecule through protein engineering, resulting in defined covalent contact between a gold surface and a platinum-iridium STM tip. Two different orientations of the linkers were examined: a long-axis configuration (SH-LA) and a short-axis configuration (SH-SA). In each case, the molecular conductance could be `gated' through electrochemical control of the heme redox state. Reproducible and remarkably high conductance was observed in this relatively complex electron transfer system, with single-molecule conductance values peaking around 18 nS and 12 nS for the SH-SA and SH-LA cytochrome b562 molecules near zero electrochemical overpotential. This strongly points to the important role of the heme co-factor bound to the natively structured protein. We suggest that the two-step model of protein electron transfer in the STM geometry requires a multi-electron transfer to explain such a high conductance. The model also yields a low value for the reorganisation energy, implying that solvent reorganisation is largely absent.The electron transfer properties of proteins are normally measured as molecularly averaged ensembles. Through these and related measurements, proteins are widely regarded as macroscopically insulating materials. Using scanning tunnelling microscopy (STM), we present new measurements of the conductance through single-molecules of the electron transfer protein cytochrome b562 in its native conformation, under pseudo-physiological conditions. This is

  13. Structure factors for tunneling ionization rates of molecules: General Hartree-Fock-based integral representation

    NASA Astrophysics Data System (ADS)

    Madsen, Lars Bojer; Jensen, Frank; Dnestryan, Andrey I.; Tolstikhin, Oleg I.

    2017-07-01

    In the leading-order approximation of the weak-field asymptotic theory (WFAT), the dependence of the tunneling ionization rate of a molecule in an electric field on its orientation with respect to the field is determined by the structure factor of the ionizing molecular orbital. The WFAT yields an expression for the structure factor in terms of a local property of the orbital in the asymptotic region. However, in general quantum chemistry approaches molecular orbitals are expanded in a Gaussian basis which does not reproduce their asymptotic behavior correctly. This hinders the application of the WFAT to polyatomic molecules, which are attracting increasing interest in strong-field physics. Recently, an integral-equation approach to the WFAT for tunneling ionization of one electron from an arbitrary potential has been developed. The structure factor is expressed in an integral form as a matrix element involving the ionizing orbital. The integral is not sensitive to the asymptotic behavior of the orbital, which resolves the difficulty mentioned above. Here, we extend the integral representation for the structure factor to many-electron systems treated within the Hartree-Fock method and show how it can be implemented on the basis of standard quantum chemistry software packages. We validate the methodology by considering noble-gas atoms and the CO molecule, for which accurate structure factors exist in the literature. We also present benchmark results for CO2 and for NH3 in the pyramidal and planar geometries.

  14. Electron-density descriptors as predictors in quantitative structure--activity/property relationships and drug design.

    PubMed

    Matta, Chérif F; Arabi, Alya A

    2011-06-01

    The use of electron density-based molecular descriptors in drug research, particularly in quantitative structure--activity relationships/quantitative structure--property relationships studies, is reviewed. The exposition starts by a discussion of molecular similarity and transferability in terms of the underlying electron density, which leads to a qualitative introduction to the quantum theory of atoms in molecules (QTAIM). The starting point of QTAIM is the topological analysis of the molecular electron-density distributions to extract atomic and bond properties that characterize every atom and bond in the molecule. These atomic and bond properties have considerable potential as bases for the construction of robust quantitative structure--activity/property relationships models as shown by selected examples in this review. QTAIM is applicable to the electron density calculated from quantum-chemical calculations and/or that obtained from ultra-high resolution x-ray diffraction experiments followed by nonspherical refinement. Atomic and bond properties are introduced followed by examples of application of each of these two families of descriptors. The review ends with a study whereby the molecular electrostatic potential, uniquely determined by the density, is used in conjunction with atomic properties to elucidate the reasons for the biological similarity of bioisosteres.

  15. Synchrotron-based soft X-ray spectroscopic studies of the electronic structure of organic semiconducting molecules

    NASA Astrophysics Data System (ADS)

    Demasi, Alexander

    Organic molecules have been the subject of many scientific studies due to their potential for use in a new generation of optoelectronic and semiconducting devices, such as organic photovoltaics and organic light emitting diodes. These studies are motivated by the fact that organic semiconductor devices have several advantages over traditional inorganic semiconductor devices. Unlike inorganic semiconductors, where the electronic properties are a result of the deliberate introduction of dopants to the material, the properties of organic semiconductors are often intrinsic to the molecules themselves. As a result, organic semiconductor devices are frequently less susceptible to contamination by impurities than their inorganic counterparts, which results in the relatively lower cost of producing such devices. Accurate experimental determination of the bulk and surface electronic structure of organic semiconductors is a prerequisite in developing a comprehensive understanding of such materials. The organic materials studied in this thesis were N,N-Ethylene-bis(1,1,1trifluoropentane-2,4-dioneiminato)-copper(ii) (abbreviated Cu-TFAC), aluminum tris-8hydroxyquinoline (A1g3), lithium quinolate (Liq), tetracyanoquinodimethane (TCNQ), and tetrafluorotetracyanoquinodimethane (F4TCNQ). The electronic structures of these materials were measured with several synchrotron-based x-ray spectroscopies. X-ray photoemission spectroscopy was used to measure the occupied total density of states and the core-level states of the aforementioned materials. X-ray absorption spectroscopy (XAS) was used to probe the element-specific unoccupied partial density of states (PDOS); its angle-resolved variant was used to measure the orientation of the molecules in a film and, in some circumstances, to gauge the extent of an organic film's crystallinity. Most notably, x-ray emission spectroscopy (XES) measures the element- specific occupied PDOS and, when aided by XAS, resonant XES can additionally be

  16. Organic molecules as tools to control the growth, surface structure, and redox activity of colloidal quantum dots.

    PubMed

    Weiss, Emily A

    2013-11-19

    In order to achieve efficient and reliable technology that can harness solar energy, the behavior of electrons and energy at interfaces between different types or phases of materials must be understood. Conversion of light to chemical or electrical potential in condensed phase systems requires gradients in free energy that allow the movement of energy or charge carriers and facilitate redox reactions and dissociation of photoexcited states (excitons) into free charge carriers. Such free energy gradients are present at interfaces between solid and liquid phases or between inorganic and organic materials. Nanostructured materials have a higher density of these interfaces than bulk materials. Nanostructured materials, however, have a structural and chemical complexity that does not exist in bulk materials, which presents a difficult challenge: to lower or eliminate energy barriers to electron and energy flux that inevitably result from forcing different materials to meet in a spatial region of atomic dimensions. Chemical functionalization of nanostructured materials is perhaps the most versatile and powerful strategy for controlling the potential energy landscape of their interfaces and for minimizing losses in energy conversion efficiency due to interfacial structural and electronic defects. Colloidal quantum dots are semiconductor nanocrystals synthesized with wet-chemical methods and coated in organic molecules. Chemists can use these model systems to study the effects of chemical functionalization of nanoscale organic/inorganic interfaces on the optical and electronic properties of a nanostructured material, and the behavior of electrons and energy at interfaces. The optical and electronic properties of colloidal quantum dots have an intense sensitivity to their surface chemistry, and their organic adlayers make them dispersible in solvent. This allows researchers to use high signal-to-noise solution-phase spectroscopy to study processes at interfaces. In this

  17. First-principles study on the structure and electronic property of gas molecules adsorption on Ge2Li2 monolayer

    NASA Astrophysics Data System (ADS)

    Hu, Yiwei; Long, Linbo; Mao, Yuliang; Zhong, Jianxin

    2018-06-01

    Using first-principles methods, we have studied the adsorption of gas molecules (CO2, CH4, H2S, H2 and NH3) on two dimensional Ge2Li2 monolayer. The adsorption geometries, adsorption energies, charge transfer, and band structures of above mentioned gas molecules adsorption on Ge2Li2 monolayer are analyzed. It is found that the adsorption of CO2 on Ge2Li2 monolayer is a kind of strong chemisorption, while other gas molecules such as CH4, H2S, H2 and NH3 are physisorption. The strong covalent binding is formed between the CO2 molecule and the nearest Ge atom in Ge2Li2 monolayer. This adsorption of CO2 molecule on Ge2Li2 monolayer leads to a direct energy gap of 0.304 eV. Other gas molecules exhibit mainly ionic binding to the nearest Li atoms in Ge2Li2 monolayer, which leads to indirect energy gap after adsorptions. Furthermore, it is found that the work function of Ge2Li2 monolayer is sensitive with the variation of adsorbents. Our results reveal that the Ge2Li2 monolayer can be used as a kind of nano device for gas molecules sensor.

  18. Determining the elastic properties of aptamer-ricin single molecule multiple pathways

    USDA-ARS?s Scientific Manuscript database

    Ricin and an anti-ricin aptamer showed three stable binding conformations with their special chemomechanical properties. The elastic properties of the ricin-aptamer single-molecule interactions were investigated by the dynamic force spectroscopy (DFS). The worm-like-chain model and Hook’s law were ...

  19. Ferrocene-isocoumarin conjugated molecules: synthesis, structural characterization, electronic properties, and DFT-TDDFT computational study.

    PubMed

    Peng, Ye-Dong; Zhou, Lin-Sen; Chen, Li-Li; Ma, Lu; Zhao, Yue; Zhang, Wen-Wei; Zuo, Jing-Lin

    2015-08-28

    Two ferrocene-isocoumarin conjugated molecules, methyl 3-ferrocenyl-1-oxo-1H-isochromene-6-carboxylate () and 3,8-bisferrocenylpyrano[3,4-g]isochromene-1,6-dione (), have been synthesized through the acid-prompted regioselective oxidative cyclization from dimethyl 2-(ferrocenylethynyl)terephthalate () and dimethyl 2,5-bis(ferrocenylethynyl)terephthalate (), respectively. Single-crystal X-ray diffraction, together with the density functional theory (DFT) calculations, shows that the ferrocene-isocoumarin conjugated compounds display better coplanarity than the corresponding ferrocenylethynyl terephthalates. All the compounds exhibit characteristic MLCT, ICT and π-π* transitions in the UV-visible range in solution, and and show higher oscillator strength of the absorption than and , which are verified by time-dependent DFT (TDDFT) theoretical calculations. The electrochemical properties are studied by cyclic voltammetry (CV), which are also in accord with the theoretical calculations.

  20. Integrated magnetic tweezers and single-molecule FRET for investigating the mechanical properties of nucleic acid.

    PubMed

    Long, Xi; Parks, Joseph W; Stone, Michael D

    2016-08-01

    Many enzymes promote structural changes in their nucleic acid substrates via application of piconewton forces over nanometer length scales. Magnetic tweezers (MT) is a single molecule force spectroscopy method widely used for studying the energetics of such mechanical processes. MT permits stable application of a wide range of forces and torques over long time scales with nanometer spatial resolution. However, in any force spectroscopy experiment, the ability to monitor structural changes in nucleic acids with nanometer sensitivity requires the system of interest to be held under high degrees of tension to improve signal to noise. This limitation prohibits measurement of structural changes within nucleic acids under physiologically relevant conditions of low stretching forces. To overcome this challenge, researchers have integrated a spatially sensitive fluorescence spectroscopy method, single molecule-FRET, with MT to allow simultaneous observation and manipulation of nanoscale structural transitions over a wide range of forces. Here, we describe a method for using this hybrid instrument to analyze the mechanical properties of nucleic acids. We expect that this method for analysis of nucleic acid structure will be easily adapted for experiments aiming to interrogate the mechanical responses of other biological macromolecules. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. [Ortho/para spin-isomers of H2O molecules as a factor responsible for formation of two structural motifs in water].

    PubMed

    Zakharov, S D

    2013-01-01

    According to the last results obtained by small-angle X-ray scattering and X-ray spectroscopy it was suggested that water within the nanometer scale represents a fluctuating mixture of clusters with tetrahedral structure and a subphase with partially broken hydrogen bonds whereas the nuclear configuration of the H20 molecule corresponds to single tetrahedral coordination. The basic reason of such structural partition is not clear until now. Here we show that it can be associated with the existence of two nuclear H2O spin-isomers which have different probability to be in one or another subphase. The para-molecule can transfer an excess of its rotational energy to the environment up to the complete stopping of rotation because its rotational quantum number J = 0 in the basic state. This property is favorable for the formation of clusters with closed H-bonds. Ortho-molecules with odd-numbered J states lack for this property and thus should be predominantly present in the surrounding with distorted bonds.

  2. Synthesis of Large Molecules in Cometary Ice Analogs: Physical Properties

    NASA Astrophysics Data System (ADS)

    Dworkin, Jason; Sandford, S. A.; Allamandola, L. J.; Deamer, D. W.; Gillette, S. J.; Zare, R. N.

    Comets and carbonaceous micrometeorites may have been important sources of volatiles on the early Earth; their organic composition may therefore be related to the origin of life. Ices on grains in molecular clouds contain a variety of simple molecules. Within the cloud and especially the presolar nebula, these icy grains would have been photoprocessed by ultraviolet light to produce more complex molecules. We are investigating the molecules that could have been generated in precometary ices. Experiments were conducted by forming a realistic interstellar ice (H_2^O, CH_3H, NH_3 and CO) at ~10 K under high vacuum irradiated UV by a hydrogen plasma lamp. The residue remaining after warming to room temperature was analyzed by HPLC and by several mass spectrometric methods. This material contains a variety of complex compounds with MS profiles resembling those found in IDPs and meteorites. Surface tension measurements show that an amphiphilic component is also present. These species do not appear in various controls or in unphotolyzed samples. In other experiments, the residues were dispersed in aqueous media for microscopy. The organic material forms 10-40 micrometer droplets that fluoresce (300-450 nm) under UV excitation and appear strikingly similar to those produced by extracts of the Murchison meteorite. Together, these results suggest a link between organic material synthesized on cold grains photochemically and compounds that may have contributed to the organic inventory of the primitive Earth. The amphiphilic properties of such compounds permit self-assembly into the membranous boundary structures required for the first forms of cellular life.

  3. Spin fine structure of optically excited quantum dot molecules

    NASA Astrophysics Data System (ADS)

    Scheibner, M.; Doty, M. F.; Ponomarev, I. V.; Bracker, A. S.; Stinaff, E. A.; Korenev, V. L.; Reinecke, T. L.; Gammon, D.

    2007-06-01

    The interaction between spins in coupled quantum dots is revealed in distinct fine structure patterns in the measured optical spectra of InAs/GaAs double quantum dot molecules containing zero, one, or two excess holes. The fine structure is explained well in terms of a uniquely molecular interplay of spin-exchange interactions, Pauli exclusion, and orbital tunneling. This knowledge is critical for converting quantum dot molecule tunneling into a means of optically coupling not just orbitals but also spins.

  4. Synthetic study on the relationship between structure and sweet taste properties of steviol glycosides.

    PubMed

    Upreti, Mani; Dubois, Grant; Prakash, Indra

    2012-04-05

    The structure activity relationship between the C₁₆-C₁₇ methylene double bond on the aglycone of steviol glycosides and the corresponding impact on their sweet taste has been reported here for the first time. It has been observed that converting stevioside and rebaudioside A to their corresponding ketones by switching the doubly bonded methylene on C-17 for a ketone group actually removes the sweet taste properties of these molecules completely. Regenerating the original molecules tends to restore the sweet taste of both the steviol glycosides. Thus this C₁₆-C₁₇ methylene double bond in rebaudioside A and stevioside can be regarded as a pharmacophore essential for the sweetness property of these molecules.

  5. Fibrin Formation, Structure and Properties

    PubMed Central

    Weisel, John W.; Litvinov, Rustem I.

    2017-01-01

    Fibrinogen and fibrin are essential for hemostasis and are major factors in thrombosis, wound healing, and several other biological functions and pathological conditions. The X-ray crystallographic structure of major parts of fibrin(ogen), together with computational reconstructions of missing portions and numerous biochemical and biophysical studies, have provided a wealth of data to interpret molecular mechanisms of fibrin formation, its organization, and properties. On cleavage of fibrinopeptides by thrombin, fibrinogen is converted to fibrin monomers, which interact via knobs exposed by fibrinopeptide removal in the central region, with holes always exposed at the ends of the molecules. The resulting half-staggered, double-stranded oligomers lengthen into protofibrils, which aggregate laterally to make fibers, which then branch to yield a three-dimensional network. Much is now known about the structural origins of clot mechanical properties, including changes in fiber orientation, stretching and buckling, and forced unfolding of molecular domains. Studies of congenital fibrinogen variants and post-translational modifications have increased our understanding of the structure and functions of fibrin(ogen). The fibrinolytic system, with the zymogen plasminogen binding to fibrin together with tissue-type plasminogen activator to promote activation to the active proteolytic enzyme, plasmin, results in digestion of fibrin at specific lysine residues. In spite of a great increase in our knowledge of all these interconnected processes, much about the molecular mechanisms of the biological functions of fibrin(ogen) remains unknown, including some basic aspects of clotting, fibrinolysis, and molecular origins of fibrin mechanical properties. Even less is known concerning more complex (patho)physiological implications of fibrinogen and fibrin. PMID:28101869

  6. Investigation of multi-state charge-storage properties of redox-active organic molecules in silicon-molecular hybrid devices for DRAM and Flash applications

    NASA Astrophysics Data System (ADS)

    Gowda, Srivardhan Shivappa

    Molecular electronics has recently spawned a considerable amount of interest with several molecules possessing charge-conduction and charge-storage properties proposed for use in electronic devices. Hybrid silicon-molecular technology has the promise of augmenting the current silicon technology and provide for a transitional path to future molecule-only technology. The focus of this dissertation work has been on developing a class of hybrid silicon-molecular electronic devices for DRAM and Flash memory applications utilizing redox-active molecules. This work exploits the ability of molecules to store charges with single-electron precision at room temperature. The hybrid devices are fabricated by forming self-assembled monolayers of redox-active molecules on Si and oxide (SiO2 and HfO2) surfaces via formation of covalent linkages. The molecules possess discrete quantum states from which electrons can tunnel to the Si substrate at discrete applied voltages (oxidation process, cell write), leaving behind a positively charged layer of molecules. The reduction (erase) process, which is the process of electrons tunneling back from Si to the molecules, neutralizes the positively charged molecular monolayer. Hybrid silicon-molecular capacitor test structures were electrically characterized with an electrolyte gate using cyclic voltammetry (CyV) and impedance spectroscopy (CV) techniques. The redox voltages, kinetics (write/erase speeds) and charge-retention characteristics were found to be strongly dependent on the Si doping type and densities, and ambient light. It was also determined that the redox energy states in the molecules communicate with the valence band of the Si substrate. This allows tuning of write and read states by modulating minority carriers in n- and p-Si substrates. Ultra-thin dielectric tunnel barriers (SiO2, HfO2) were placed between the molecules and the Si substrate to augment charge-retention for Flash memory applications. The redox response was

  7. Structural, spectroscopic and electronic properties of hydrogen-bonded water molecules in crystals. Ab initio calculations and experimental data of MC1 2· n(H,D) 2O, M = Sr or Ba

    NASA Astrophysics Data System (ADS)

    Möller, H.; Niu, J. E.; Lutz, H. D.; Schwarz, W. H. E.

    1997-12-01

    Structural, spectroscopic and electronic properties of (more or less deuterated) water molecules in the crystal fields of SrCl 2·2H 2O, SrCl 2·H 2O and BaCl 2·H 2O, previously investigated by experimental techniques, were calculated by ab initio SCF-MP methods. The H 2O molecules of each compound are asymmetrically surrounded by three adjacent chloride ions, one hydrogen atom being attached to a nearby Cl -, the other less perturbed hydrogen atom bridging the two less near Cl -. The diversity of structural and spectroscopic features found experimentally, for instance the trends from free H 2O to H 2O in BaCl 2·H 2OSrCl 2·H 2OSrCl 2·2H 2O, are well reproduced by the model calculations, which provide the correct assignment and physical interpretation. The differences between the compounds and the asymmetry of the hydrate water molecules can be rationalized with the help of crystal fields. The crystal environment expands the internuclear distances of H 2O by up to 3 pm. The change of vibrational frequencies can be explained qualitatively by only taking the coupling and anharmonicity of the free water molecule and its modified structure in the crystals into account. The infra-red intensities, however, are strongly influenced by the electronic polarization.

  8. Strategy to discover diverse optimal molecules in the small molecule universe.

    PubMed

    Rupakheti, Chetan; Virshup, Aaron; Yang, Weitao; Beratan, David N

    2015-03-23

    The small molecule universe (SMU) is defined as a set of over 10(60) synthetically feasible organic molecules with molecular weight less than ∼500 Da. Exhaustive enumerations and evaluation of all SMU molecules for the purpose of discovering favorable structures is impossible. We take a stochastic approach and extend the ACSESS framework ( Virshup et al. J. Am. Chem. Soc. 2013 , 135 , 7296 - 7303 ) to develop diversity oriented molecular libraries that can generate a set of compounds that is representative of the small molecule universe and that also biases the library toward favorable physical property values. We show that the approach is efficient compared to exhaustive enumeration and to existing evolutionary algorithms for generating such libraries by testing in the NKp fitness landscape model and in the fully enumerated GDB-9 chemical universe containing 3 × 10(5) molecules.

  9. Strategy To Discover Diverse Optimal Molecules in the Small Molecule Universe

    PubMed Central

    2015-01-01

    The small molecule universe (SMU) is defined as a set of over 1060 synthetically feasible organic molecules with molecular weight less than ∼500 Da. Exhaustive enumerations and evaluation of all SMU molecules for the purpose of discovering favorable structures is impossible. We take a stochastic approach and extend the ACSESS framework (Virshup et al. J. Am. Chem. Soc.2013, 135, 7296–730323548177) to develop diversity oriented molecular libraries that can generate a set of compounds that is representative of the small molecule universe and that also biases the library toward favorable physical property values. We show that the approach is efficient compared to exhaustive enumeration and to existing evolutionary algorithms for generating such libraries by testing in the NKp fitness landscape model and in the fully enumerated GDB-9 chemical universe containing 3 × 105 molecules. PMID:25594586

  10. First principles study of the structural, electronic, and transport properties of triarylamine-based nanowires

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akande, Akinlolu, E-mail: akandea@tcd.ie; Bhattacharya, Sandip; Cathcart, Thomas

    2014-02-21

    We investigate with state of the art density functional theory the structural, electronic, and transport properties of a class of recently synthesized nanostructures based on triarylamine derivatives. First, we consider the single molecule precursors in the gas phase and calculate their static properties, namely (i) the geometrical structure of the neutral and cationic ions, (ii) the electronic structure of the frontier molecular orbitals, and (iii) the ionization potential, hole extraction potential, and internal reorganization energy. This initial study does not evidence any direct correlation between the properties of the individual molecules and their tendency to self-assembly. Subsequently, we investigate themore » charge transport characteristics of the triarylamine derivatives nanowires, by using Marcus theory. For one derivative we further construct an effective Hamiltonian including intermolecular vibrations and evaluate the mobility from the Kubo formula implemented with Monte Carlo sampling. These two methods, valid respectively in the sequential hopping and polaronic band limit, give us values for the room-temperature mobility in the range 0.1–12 cm{sup 2}/Vs. Such estimate confirms the superior transport properties of triarylamine-based nanowires, and make them an attracting materials platform for organic electronics.« less

  11. Deformation of DNA molecules by hydrodynamic focusing

    NASA Astrophysics Data System (ADS)

    Wong, Pak Kin; Lee, Yi-Kuen; Ho, Chih-Ming

    2003-12-01

    The motion of a DNA molecule in a solvent flow reflects the deformation of a nano/microscale flexible mass spring structure by the forces exerted by the fluid molecules. The dynamics of individual molecules can reveal both fundamental properties of the DNA and basic understanding of the complex rheological properties of long-chain molecules. In this study, we report the dynamics of isolated DNA molecules under homogeneous extensional flow. Hydrodynamic focusing generates homogeneous extensional flow with uniform velocity in the transverse direction. The deformation of individual DNA molecules in the flow was visualized with video fluorescence microscopy. A coil stretch transition was observed when the Deborah number (De) is larger than 0.8. With a sudden stopping of the flow, the DNA molecule relaxes and recoils. The longest relaxation time of T2 DNA was determined to be 0.63 s when scaling viscosity to 0.9 cP.

  12. Probing Biomolecular Structures and Dynamics of Single Molecules Using In-Gel Alternating-Laser Excitation

    PubMed Central

    Santoso, Yusdi; Kapanidis, Achillefs N.

    2009-01-01

    Gel electrophoresis is a standard biochemical technique used for separating biomolecules on the basis of size and charge. Despite the use of gels in early single-molecule experiments, gel electrophoresis has not been widely adopted for single-molecule fluorescence spectroscopy. We present a novel method that combines gel electrophoresis and single-molecule fluorescence spectroscopy to simultaneously purify and analyze biomolecules in a gel matrix. Our method, in-gel ALEX, uses non-denaturing gels to purify biomolecular complexes of interest from free components, aggregates, and non-specific complexes. The gel matrix also slows down translational diffusion of molecules, giving rise to long, high-resolution time traces without surface immobilization, which allow extended observations of conformational dynamics in a biologically friendly environment. We demonstrated the compatibility of this method with different types of single molecule spectroscopy techniques, including confocal detection and fluorescence-correlation spectroscopy. We demonstrated that in-gel ALEX can be used to study conformational dynamics at the millisecond timescale; by studying a DNA hairpin in gels, we directly observed fluorescence fluctuations due to conformational interconversion between folded and unfolded states. Our method is amenable to the addition of small molecules that can alter the equilibrium and dynamic properties of the system. In-gel ALEX will be a versatile tool for studying structures and dynamics of complex biomolecules and their assemblies. PMID:19863108

  13. Substitution Structures of Large Molecules and Medium Range Correlations in Quantum Chemistry Calculations

    NASA Astrophysics Data System (ADS)

    Evangelisti, Luca; Pate, Brooks

    2017-06-01

    A study of the minimally exciting topic of agreement between experimental and measured rotational constants of molecules was performed on a set of large molecules with 16-18 heavy atoms (carbon and oxygen). The molecules are: nootkatone (C_{15}H_{22}O), cedrol (C_{15}H_{26}O), ambroxide (C_{16}H_{28}O), sclareolide (C_{16}H_{22}O_{2}), and dihydroartemisinic acid (C_{15}H_{24}O_{2}). For this set of molecules we obtained 13C-subsitution structures for six molecules (this includes two conformers of nootkatone). A comparison of theoretical structures and experimental substitution structures was performed in the spirit of the recent work of Grimme and Steinmetz.[1] Our analysis focused the center-of-mass distance of the carbon atoms in the molecules. Four different computational methods were studied: standard DFT (B3LYP), dispersion corrected DFT (B3LYP-D3BJ), hybrid DFT with dispersion correction (B2PLYP-D3), and MP2. A significant difference in these theories is how they handle medium range correlation of electrons that produce dispersion forces. For larger molecules, these dispersion forces produce an overall contraction of the molecule around the center-of-mass. DFT poorly treats this effect and produces structures that are too expanded. MP2 calculations overestimate the correction and produce structures that are too compact. Both dispersion corrected DFT methods produce structures in excellent agreement with experiment. The analysis shows that the difference in computational methods can be described by a linear error in the center-of-mass distance. This makes it possible to correct poorer performing calculations with a single scale factor. We also reexamine the issue of the "Costain error" in substitution structures and show that it is significantly larger in these systems than in the smaller molecules used by Costain to establish the error limits. [1] Stefan Grimme and Marc Steinmetz, "Effects of London dispersion correction in density functional theory on

  14. Co(II)-doped MOF-5 nano/microcrystals: Solvatochromic behaviour, sensing solvent molecules and gas sorption property

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Ji-Min; School of Chemistry and Chemical Engineering, Linyi University, Linyi 276005; Liu, Qing

    2014-10-15

    Co(II)-doped MOF-5 nano/microcrystals with controllable morphology and size were successfully obtained by solvothermal method. The products were characterized by powder X-ray diffraction (PXRD), energy dispersive spectrometry (EDS), field emission scanning electron microscopy (FESEM), thermogravimetric analysis (TGA), inductively coupled plasma optical emission spectrometer (ICP-OES), elemental analysis, UV–vis and infrared (IR) spectroscopy. The factors influencing the crystal morphology and size were investigated. The gas sorption measurements reveal that highly crystalline particles have large Langmuir surface area. It was found that the Co(II)-doped MOF-5 shows enhanced hydrostability and the sorption profiles of the Co(II)-doped MOF-5 nano/microcrystals are dependent on the morphology and sizemore » of the particles. Porous Co(II)-doped MOF-5 is stable upon the removal of guest molecules and exhibits different colour with accommodating different solvent molecule, which means that it can act as solvatochromic sensing materials for recognition of solvent molecules. - Graphical abstract: Co(II)-doped MOF-5 nano/microcrystals with different shapes and sizes were synthesized by a facile hydrothermal method, which not only enhance gas sorption properties and structural stability of MOFs towards moisture, but also act as new sensing materials for sensing small molecules. - Highlights: • Co(II)-doped MOF-5 nano/microcrystals with controllable morphology and size were obtained. • Co(II)-doped MOF-5 nano/microcrystals enhance the structural stability towards moisture. • Co(II)-doped MOF-5 can act as new sensing material for sensing small molecules.« less

  15. Organizing and addressing magnetic molecules.

    PubMed

    Gatteschi, Dante; Cornia, Andrea; Mannini, Matteo; Sessoli, Roberta

    2009-04-20

    Magnetic molecules ranging from simple organic radicals to single-molecule magnets (SMMs) are intensively investigated for their potential applications in molecule-based information storage and processing. The goal of this Article is to review recent achievements in the organization of magnetic molecules on surfaces and in their individual probing and manipulation. We stress that the inherent fragility and redox sensitivity of most SMM complexes, combined with the noninnocent role played by the substrate, ask for a careful evaluation of the structural and electronic properties of deposited molecules going beyond routine methods for surface analysis. Detailed magnetic information can be directly obtained using X-ray magnetic circular dichroism or newly emerging scanning probe techniques with magnetic detection capabilities.

  16. Crystal Engineering; How molecules build solids

    NASA Astrophysics Data System (ADS)

    Williams, Jeffrey H.

    2017-09-01

    There are more than 20 million chemicals in the literature, with new materials being synthesized each week. Most of these molecules are stable, and the 3-dimensional arrangement of the atoms in the molecules, in the various solids may be determined by routine x-ray crystallography. When this is done, it is found that this vast range of molecules, with varying sizes and shapes can be accommodated by only a handful of solid structures. This limited number of architectures for the packing of molecules of all shapes and sizes, to maximize attractive intermolecular forces and minimizing repulsive intermolecular forces, allows us to develop simple models of what holds the molecules together in the solid. In this volume we look at the origin of the molecular architecture of crystals; a topic that is becoming increasingly important and is often termed, crystal engineering. Such studies are a means of predicting crystal structures, and of designing crystals with particular properties by manipulating the structure and interaction of large molecules. That is, creating new crystal architectures with desired physical characteristics in which the molecules pack together in particular architectures; a subject of particular interest to the pharmaceutical industry.

  17. Density Functional Theory Investigations of D-A-D' Structural Molecules as Donor Materials in Organic Solar Cell.

    PubMed

    Chen, Junxian; Liu, Qingyu; Li, Hao; Zhao, Zhigang; Lu, Zhiyun; Huang, Yan; Xu, Dingguo

    2018-01-01

    Squaraine core based small molecules in bulk heterojunction organic solar cells have received extensive attentions due to their distinguished photochemical properties in far red and infrared domain. In this paper, combining theoretical simulations and experimental syntheses and characterizations, three major factors (fill factor, short circuit and open-cirvuit voltage) have been carried out together to achieve improvement of power conversion efficiencies of solar cells. As model material systems with D-A-D' framework, two asymmetric squaraines (CNSQ and CCSQ-Tol) as donor materials in bulk heterojunction organic solar cell were synthesized and characterized. Intensive density functional theory computations were applied to identify some direct connections between three factors and corresponding molecular structural properties. It then helps us to predict one new molecule of CCSQ'-Ox that matches all the requirements to improve the power conversion efficiency.

  18. Theoretical study on the molecular structure and vibrational properties, NBO and HOMO-LUMO analysis of the POX3 (X = F, Cl, Br, I) series of molecules

    NASA Astrophysics Data System (ADS)

    Galván, Jorge E.; Gil, Diego M.; Lanús, Hernán E.; Altabef, Aida Ben

    2015-02-01

    The fourth member of the series of compounds of the type POX3 with X = I was synthesized and characterized by infrared spectroscopy. The geometrical parameters and vibrational properties of POX3 (X = F, Cl, Br, I) molecules were investigated theoretically by means DFT and ab initio methods. Available geometrical and vibrational data were used together with theoretical calculations in order to obtain a set of scaled force constants. The observed trends in geometrical parameters are analyzed and compared with those obtained in a previous work for the VOX3 (X = F, Cl, Br, I) series of compounds. NBO analysis was performed in order to know the hyper-conjugative interactions that favor one structure over another. The molecular properties such as ionization potential, electron affinity, electronegativity, chemical potential, chemical hardness, softness and global electrophilicity index have been deduced from HOMO-LUMO analysis.

  19. Zero-mode waveguide nanophotonic structures for single molecule characterization

    NASA Astrophysics Data System (ADS)

    Crouch, Garrison M.; Han, Donghoon; Bohn, Paul W.

    2018-05-01

    Single-molecule characterization has become a crucial research tool in the chemical and life sciences, but limitations, such as limited concentration range, inability to control molecular distributions in space, and intrinsic phenomena, such as photobleaching, present significant challenges. Recent developments in non-classical optics and nanophotonics offer promising routes to mitigating these restrictions, such that even low affinity (K D ~ mM) biomolecular interactions can be studied. Here we introduce and review specific nanophotonic devices used to support single molecule studies. Optical nanostructures, such as zero-mode waveguides (ZMWs), are usually fabricated in thin gold or aluminum films and serve to confine the observation volume of optical microspectroscopy to attoliter to zeptoliter volumes. These simple nanostructures allow individual molecules to be isolated for optical and electrochemical analysis, even when the molecules of interest are present at high concentration (µM–mM) in bulk solution. Arrays of ZMWs may be combined with optical probes such as single molecule fluorescence, single molecule fluorescence resonance energy transfer, and fluorescence correlation spectroscopy for distributed analysis of large numbers of single-molecule reactions or binding events in parallel. Furthermore, ZMWs may be used as multifunctional devices, for example by combining optical and electrochemical functions in a single discrete architecture to achieve electrochemical ZMWs. In this review, we will describe the optical properties, fabrication, and applications of ZMWs for single-molecule studies, as well as the integration of ZMWs into systems for chemical and biochemical analysis.

  20. Effects of Electron Beam Irradiation and Thiol Molecule Treatment on the Properties of MoS2 Field Effect Transistors

    NASA Astrophysics Data System (ADS)

    Choi, Barbara Yuri; Cho, Kyungjune; Pak, Jinsu; Kim, Tae-Young; Kim, Jae-Keun; Shin, Jiwon; Seo, Junseok; Chung, Seungjun; Lee, Takhee

    2018-05-01

    We investigated the effects of the structural defects intentionally created by electron-beam irradiation with an energy of 30 keV on the electrical properties of monolayer MoS2 field effect transistors (FETs). We observed that the created defects by electron beam irradiation on the MoS2 surface working as trap sites deteriorated the carrier mobility and carrier concentration with increasing the subthreshold swing value and shifting the threshold voltage in MoS2 FETs. The electrical properties of electron-beam irradiated MoS2 FETs were slightly improved by treating the devices with thiol-terminated molecules which presumably passivated the structural defects of MoS2. The results of this study may enhance the understanding of the electrical properties of MoS2 FETs in terms of creating and passivating defect sites.

  1. Influence of lecithin-lipid composition on physico-chemical properties of nanoliposomes loaded with a hydrophobic molecule.

    PubMed

    Bouarab, Lynda; Maherani, Behnoush; Kheirolomoom, Azadeh; Hasan, Mahmoud; Aliakbarian, Bahar; Linder, Michel; Arab-Tehrany, Elmira

    2014-03-01

    In this work, we studied the effect of nanoliposome composition based on phospholipids of docosahexaenoic acid (PL-DHA), salmon and soya lecithin, on physico-chemical characterization of vector. Cinnamic acid was encapsulated as a hydrophobic molecule in nanoliposomes made of three different lipid sources. The aim was to evaluate the influence of membrane lipid structure and composition on entrapment efficiency and membrane permeability of cinnamic acid. These properties are important for active molecule delivery. In addition, size, electrophoretic mobility, phase transition temperature, elasticity and membrane fluidity were measured before and after encapsulation. The results showed a correlation between the size of the nanoliposome and the entrapment. The entrapment efficiency of cinnamic acid was found to be the highest in liposomes prepared from salmon lecithin. The nanoliposomes composed of salmon lecithin presented higher capabilities as a carrier for cinnamic acid encapsulation. These vesicles also showed a high stability which in turn increases the membrane rigidity of nanoliposome as evaluated by their elastic properties, membrane fluidity and phase transition temperature. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Fibrin mechanical properties and their structural origins.

    PubMed

    Litvinov, Rustem I; Weisel, John W

    2017-07-01

    Fibrin is a protein polymer that is essential for hemostasis and thrombosis, wound healing, and several other biological functions and pathological conditions that involve extracellular matrix. In addition to molecular and cellular interactions, fibrin mechanics has been recently shown to underlie clot behavior in the highly dynamic intra- and extravascular environments. Fibrin has both elastic and viscous properties. Perhaps the most remarkable rheological feature of the fibrin network is an extremely high elasticity and stability despite very low protein content. Another important mechanical property that is common to many filamentous protein polymers but not other polymers is stiffening occurring in response to shear, tension, or compression. New data has begun to provide a structural basis for the unique mechanical behavior of fibrin that originates from its complex multi-scale hierarchical structure. The mechanical behavior of the whole fibrin gel is governed largely by the properties of single fibers and their ensembles, including changes in fiber orientation, stretching, bending, and buckling. The properties of individual fibrin fibers are determined by the number and packing arrangements of double-stranded half-staggered protofibrils, which still remain poorly understood. It has also been proposed that forced unfolding of sub-molecular structures, including elongation of flexible and relatively unstructured portions of fibrin molecules, can contribute to fibrin deformations. In spite of a great increase in our knowledge of the structural mechanics of fibrin, much about the mechanisms of fibrin's biological functions remains unknown. Fibrin deformability is not only an essential part of the biomechanics of hemostasis and thrombosis, but also a rapidly developing field of bioengineering that uses fibrin as a versatile biomaterial with exceptional and tunable biochemical and mechanical properties. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Hierarchical Structure Controls Nanomechanical Properties of Vimentin Intermediate Filaments

    PubMed Central

    Qin, Zhao; Kreplak, Laurent; Buehler, Markus J.

    2009-01-01

    Intermediate filaments (IFs), in addition to microtubules and microfilaments, are one of the three major components of the cytoskeleton in eukaryotic cells, playing a vital role in mechanotransduction and in providing mechanical stability to cells. Despite the importance of IF mechanics for cell biology and cell mechanics, the structural basis for their mechanical properties remains unknown. Specifically, our understanding of fundamental filament properties, such as the basis for their great extensibility, stiffening properties, and their exceptional mechanical resilience remains limited. This has prevented us from answering fundamental structure-function relationship questions related to the biomechanical role of intermediate filaments, which is crucial to link structure and function in the protein material's biological context. Here we utilize an atomistic-level model of the human vimentin dimer and tetramer to study their response to mechanical tensile stress, and describe a detailed analysis of the mechanical properties and associated deformation mechanisms. We observe a transition from alpha-helices to beta-sheets with subsequent interdimer sliding under mechanical deformation, which has been inferred previously from experimental results. By upscaling our results we report, for the first time, a quantitative comparison to experimental results of IF nanomechanics, showing good agreement. Through the identification of links between structures and deformation mechanisms at distinct hierarchical levels, we show that the multi-scale structure of IFs is crucial for their characteristic mechanical properties, in particular their ability to undergo severe deformation of ≈300% strain without breaking, facilitated by a cascaded activation of a distinct deformation mechanisms operating at different levels. This process enables IFs to combine disparate properties such as mechanosensitivity, strength and deformability. Our results enable a new paradigm in studying

  4. Hierarchical structure controls nanomechanical properties of vimentin intermediate filaments.

    PubMed

    Qin, Zhao; Kreplak, Laurent; Buehler, Markus J

    2009-10-06

    Intermediate filaments (IFs), in addition to microtubules and microfilaments, are one of the three major components of the cytoskeleton in eukaryotic cells, playing a vital role in mechanotransduction and in providing mechanical stability to cells. Despite the importance of IF mechanics for cell biology and cell mechanics, the structural basis for their mechanical properties remains unknown. Specifically, our understanding of fundamental filament properties, such as the basis for their great extensibility, stiffening properties, and their exceptional mechanical resilience remains limited. This has prevented us from answering fundamental structure-function relationship questions related to the biomechanical role of intermediate filaments, which is crucial to link structure and function in the protein material's biological context. Here we utilize an atomistic-level model of the human vimentin dimer and tetramer to study their response to mechanical tensile stress, and describe a detailed analysis of the mechanical properties and associated deformation mechanisms. We observe a transition from alpha-helices to beta-sheets with subsequent interdimer sliding under mechanical deformation, which has been inferred previously from experimental results. By upscaling our results we report, for the first time, a quantitative comparison to experimental results of IF nanomechanics, showing good agreement. Through the identification of links between structures and deformation mechanisms at distinct hierarchical levels, we show that the multi-scale structure of IFs is crucial for their characteristic mechanical properties, in particular their ability to undergo severe deformation of approximately 300% strain without breaking, facilitated by a cascaded activation of a distinct deformation mechanisms operating at different levels. This process enables IFs to combine disparate properties such as mechanosensitivity, strength and deformability. Our results enable a new paradigm in

  5. Relativistic (SR-ZORA) quantum theory of atoms in molecules properties.

    PubMed

    Anderson, James S M; Rodríguez, Juan I; Ayers, Paul W; Götz, Andreas W

    2017-01-15

    The Quantum Theory of Atoms in Molecules (QTAIM) is used to elucidate the effects of relativity on chemical systems. To do this, molecules are studied using density-functional theory at both the nonrelativistic level and using the scalar relativistic zeroth-order regular approximation. Relativistic effects on the QTAIM properties and topology of the electron density can be significant for chemical systems with heavy atoms. It is important, therefore, to use the appropriate relativistic treatment of QTAIM (Anderson and Ayers, J. Phys. Chem. 2009, 115, 13001) when treating systems with heavy atoms. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  6. The adsorption, stability and properties of Mn6Cr Single-Molecule-Magnets studied by means of nc-AFM, STM, XAS and Spin-resolved Photoelectron Spectroscopy

    NASA Astrophysics Data System (ADS)

    Heinzmann, U.; Gryzia, A.; Helmstedt, A.; Dohmeier, N.; Predatsch, H.; Brechling, A.; Müller, N.; Sacher, M.; Hoeke, V.; Krickemeyer, E.; Glaser, T.; Bouvron, S.; Fonin, M.; Neumann, M.

    2012-11-01

    The ionic single-molecule-magnet [MnIII6CrIII]3 with corresponding three counterions has been deposited on different surfaces and studied with respect to its structure and its electronic and magnetic properties. This is the first time that spin polarization of photoelectrons ejected by means of circularly polarized synchrotron radiation has been measured in a single-molecule-magnet.

  7. Tailoring the structures and photonic properties of low-dimensional organic materials by crystal engineering.

    PubMed

    Li, Qing; Jin, Wang; Chu, Manman; Zhang, Wei; Gu, Jianmin; Shahid, Bilal; Chen, Aibing; Yu, Yifeng; Qiao, Shanlin; Zhao, Yong Sheng

    2018-03-08

    Low-dimensional organic materials have given rise to tremendous interest in optoelectronic applications, owing to their controllable photonic properties. However, the controlled-synthesis approaches for organic nano-/micro-architectures are very difficult to attain, because the weak interaction (van der Waals force) between the organic molecules cannot dominate the kinetic process of crystal growth. We report a simple method, which involves selective adhesion to the organic crystal plane by hydrogen-bonding interaction for modulating the crystal growth process, which leads either to the self-assembly of one organic molecule into two-dimensional (2D) microsheets with an obvious asymmetric light propagation or one-dimensional (1D) microrods with low propagation loss. The method of tailoring the structures and photonic properties for fabricating different micro-structures would provide enlightenment for the development of tailor-made mini-sized devices for photonic integrated circuits.

  8. Alcohol molecules adsorption on graphane nanosheets - A first-principles investigation

    NASA Astrophysics Data System (ADS)

    Nagarajan, V.; Chandiramouli, R.

    2018-05-01

    The geometric structure, electronic and adsorption properties of methanol, ethanol and 1-propanol molecules on hydrogenated graphene (graphane) were investigated using first-principles calculations. The stability of graphane base material is confirmed using formation energy and phonon band structures. The adsorption of alcohol molecules on bare graphane and hydrogen vacant graphane nanosheet is found to be prominent and the selectivity of alcohol molecules can be achieved using bare or hydrogen vacant graphane nanosheet. Moreover, the interaction of alcohol molecules on bare and hydrogen vacant graphane nanosheets is studied using the adsorption energy, energy band gap variation, Bader charge transfer and average energy band gap variation. The adsorption energy ranges from -0.149 to -0.383 eV upon alcohol adsorption. The energy gap varies from 4.71 to 2.62 eV for bare graphane and from 4.02 to 3.60 eV for hydrogen vacant graphane nanosheets upon adsorption of alcohol molecules. The adsorption properties of alcohol molecules provide useful information for the possible application of graphane nanosheet as a base material for the detection of alcohol molecules.

  9. Electronic structure and optical properties of metal doped tetraphenylporphyrins

    NASA Astrophysics Data System (ADS)

    Shah, Esha V.; Roy, Debesh R.

    2018-05-01

    A density functional scrutiny on the structure, electronic and optical properties of metal doped tetraphenylporphyrins MTPP (M=Fe, Co, Ni) is performed. The structural stability of the molecules is evaluated based on the electronic parameters like HOMO-LUMO gap (HLG), chemical hardness (η) and binding energy of the central metal atom to the molecular frame etc. The computed UltraViolet-Visible (UV-Vis) optical absorption spectra for all the compounds are also compared. The molecular structures reported are the lowest energy configurations. The entire calculations are carried out with a widely reliable functional, viz. B3LYP with a popular basis set which includes a scaler relativistic effect, viz. LANL2DZ.

  10. A theoretical study of structural and electronic properties of pentacene/Al(100) interface.

    PubMed

    Saranya, G; Nair, Shiny; Natarajan, V; Kolandaivel, P; Senthilkumar, K

    2012-09-01

    The first principle calculations within the framework of density functional theory have been performed for the pentacene molecule deposited on the aluminum Al(100) substrate to study the structural and electronic properties of the pentacene/Al(100) interface. The most stable configuration was found at bridge site with 45° rotation of the pentacene molecule on Al(100) surface with a vertical distance of 3.4 Å within LDA and 3.8 Å within GGA functionals. The calculated adsorption energy reveals that the adsorption of pentacene molecule on Al(100) surface is physisorption. For the stable adsorption geometry the electronic properties such as density of states (DOS), partial density of states (PDOS), Mulliken population analysis and Schottky barrier height are studied. The analysis of atomic charge, DOS and PDOS show that the charge is transferred from the Al(100) surface to pentacene molecule, and the transferred charge is about -0.05 electrons. For the adsorbed system, the calculated Schottky barrier height for hole and electron transport is 0.27 and 1.55 eV, respectively. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Properties of highly frustrated magnetic molecules studied by the finite-temperature Lanczos method

    NASA Astrophysics Data System (ADS)

    Schnack, J.; Wendland, O.

    2010-12-01

    The very interesting magnetic properties of frustrated magnetic molecules are often hardly accessible due to the prohibitive size of the related Hilbert spaces. The finite-temperature Lanczos method is able to treat spin systems for Hilbert space sizes up to 109. Here we first demonstrate for exactly solvable systems that the method is indeed accurate. Then we discuss the thermal properties of one of the biggest magnetic molecules synthesized to date, the icosidodecahedron with antiferromagnetically coupled spins of s = 1/2. We show how genuine quantum features such as the magnetization plateau behave as a function of temperature.

  12. Structure and Electronic Properties of Interface-Confined Oxide Nanostructures

    DOE PAGES

    Liu, Yun; Ning, Yanxiao; Yu, Liang; ...

    2017-09-16

    The controlled fabrication of nanostructures has often made use of a substrate template to mediate and control the growth kinetics. Electronic substrate-mediated interactions have been demonstrated to guide the assembly of organic molecules or the nucleation of metal atoms but usually at cryogenic temperatures, where the diffusion has been limited. Combining STM, STS, and DFT studies, we report that the strong electronic interaction between transition metals and oxides could indeed govern the growth of low-dimensional oxide nanostructures. As a demonstration, a series of FeO triangles, which are of the same structure and electronic properties but with different sizes (side lengthmore » >3 nm), are synthesized on Pt(111). The strong interfacial interaction confines the growth of FeO nanostructures, leading to a discrete size distribution and a uniform step structure. Given the same interfacial configuration, as-grown FeO nanostructures not only expose identical edge/surface structure but also exhibit the same electronic properties, as manifested by the local density of states and local work functions. We expect the interfacial confinement effect can be generally applied to control the growth of oxide nanostructures on transition metal surfaces. These oxide nanostructures of the same structure and electronic properties are excellent models for studies of nanoscale effects and applications.« less

  13. Structure and Electronic Properties of Interface-Confined Oxide Nanostructures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Yun; Ning, Yanxiao; Yu, Liang

    The controlled fabrication of nanostructures has often made use of a substrate template to mediate and control the growth kinetics. Electronic substrate-mediated interactions have been demonstrated to guide the assembly of organic molecules or the nucleation of metal atoms but usually at cryogenic temperatures, where the diffusion has been limited. Combining STM, STS, and DFT studies, we report that the strong electronic interaction between transition metals and oxides could indeed govern the growth of low-dimensional oxide nanostructures. As a demonstration, a series of FeO triangles, which are of the same structure and electronic properties but with different sizes (side lengthmore » >3 nm), are synthesized on Pt(111). The strong interfacial interaction confines the growth of FeO nanostructures, leading to a discrete size distribution and a uniform step structure. Given the same interfacial configuration, as-grown FeO nanostructures not only expose identical edge/surface structure but also exhibit the same electronic properties, as manifested by the local density of states and local work functions. We expect the interfacial confinement effect can be generally applied to control the growth of oxide nanostructures on transition metal surfaces. These oxide nanostructures of the same structure and electronic properties are excellent models for studies of nanoscale effects and applications.« less

  14. Calculation of the structure of carbon clusters based on fullerene-like C24 and C48 molecules

    NASA Astrophysics Data System (ADS)

    Krylova, K. A.; Baimova, Yu. A.; Dmitriev, S. V.; Mulyukov, R. R.

    2016-02-01

    Equilibrium structures obtained by linking with valence bonds the carbon carcasses of two fullerene-like molecules have been studied by molecular dynamics simulation. In free fullerene, carbon atoms form sp 2 hybridized bonds, but at places of links between fullerenes, sp 3 hybridized bonds are formed, which determines the changes in the properties of such structures. In the literature, the topology of diamond-like phases is described, but equilibrium clusters based on fullerene-like molecules are underexplored. The right angles between the C-C bonds are energetically unfavorable, and the reduction in the energy of clusters in the process of relaxation is connected with the optimization of valence angles, which leads to a reduction in the symmetry of clusters and, in a number of cases, even to disruption of some valence bonds. It is shown that different fashions of linking two fullerenes result in the formation of clusters with different structures and energies. Different initial conditions can lead to different configurations of clusters with the same topology. Among the analyzed clusters, a structure with the minimum potential energy per atom was found. The results of this work contribute to the study of the real structure of carbon clusters.

  15. Conductance of Single Molecule Junctions: Dependence on Structure and Conformation

    NASA Astrophysics Data System (ADS)

    Venkataraman, Latha

    2007-03-01

    We recently demonstrated that the conductance of single molecule junctions formed by breaking Au point contacts in an environment of molecules with amine linkages can be measured reliably and reproducibly^1. We have now studied junctions formed by approximately 30 different amine terminated molecules, allowing systematic study of the correlation between molecular properties and single molecule junction conductance. This talk will focus on the relation between molecular conductance and molecule conformation for the simple case of a biphenyl, two benzene rings linked together by a single C-C bond. Our results from a series of seven biphenyl derivatives show that the molecular junction conductance depends on the twist angle. Specifically, we find that the planar molecule has the highest conductance, and the conductance for the series decreases with increasing twist angle, consistent with a cosine squared relation predicted theoretically^2. 1. L. Venkataraman, J.E. Klare, I.W. Tam, C. Nuckolls, M.S Hybertsen and M. Steigerwald, Nano Letters, vol. 5, pp. 458-462, 2006. 2. L. Venkataraman, J.E. Klare, C. Nuckolls, M.S Hybertsen and M. Steigerwald, Nature, vol. 442, pp. 904-907, 2006.

  16. Computational Study of the Bulk Properties of a Novel Molecule: alpha-Tocopherol-Ascorbic Acid Surfactant

    NASA Astrophysics Data System (ADS)

    Stirling, Shannon; Kim, Hye-Young

    Alpha-tocopherol-ascorbic acid surfactant (EC) is a novel amphiphilic molecule of antioxidant properties, which has a hydrophobic vitamin E and a hydrophilic vitamin C chemically linked. We have developed atomistic force fields (g54a7) for a protonated (neutral) EC molecule. Our goal is to carry out molecular dynamics (MD) simulations of protonated EC molecules using the newly developed force fields and study the molecular properties. First we ran energy minimization (EM) with one molecule in a vacuum to obtain the low energy molecular configuration with emtol =10. We then used Packmol to insert 125 EC molecules in a 3nm cube. We then performed MD simulations of the bulk system composed of 125 EC molecules, from which we measured the bulk density and the evaporation energy of the molecular system. Gromacs2016 is used for the EM and MD simulation studies. We will present the results of the ongoing research. National Institute Of General Medical Sciences of the National Institutes of Health under Award Number P20GM103424 (Kim). Computational resources were provided by the Louisiana Optical Network Initiative.

  17. Effects of adatom and gas molecule adsorption on the physical properties of tellurene: a first principles investigation.

    PubMed

    Wang, Xiao Hua; Wang, Da Wei; Yang, Ai Jun; Koratkar, Nikhil; Chu, Ji Feng; Lv, Pin Lei; Rong, Ming Zhe

    2018-02-07

    Tellurene is a new member of the two-dimensional (2D) materials' family, whose existence has been recently confirmed by first principles calculation and experimental work. Tellurene is also the first 2D mono-elemental material of group-VI predicted by scientists, and investigations of its basic properties are still in their infancy. In this study, we use first principles calculation based on density functional theory to investigate the adsorption of nineteen typical adatoms (Li, Na, K, Ca, Fe, Co, Ni, Cu, Zn, Ag, Au, Pd, Pt, B, N, O, Si, Cl, and Al), and five typical gas molecules (H 2 , O 2 , H 2 O, NO 2 , and NH 3 ) on α-phase as well as β-phase tellurene sheets. Our calculations shows that most adatoms are chemisorbed on tellurene sheets with large adsorption energies. Moreover, some of the adatoms are observed to give rise to distinct structural deformations and even local reconstructions. We report that a variety of electronic states are induced by the adatoms, which implies that different electronic structures can be engineered by the adsorption of adatoms. In fact, n-type doping, p-type doping, half-metal, and spin-gapless semiconductor features can be acquired by doping adatoms on tellurene sheets. Our calculations also show that the five gas molecules are all physisorbed on tellurene sheets, and no splitting behaviors are observed. Therefore, the adsorption of the five gas molecules has a weak effect on the electronic properties of tellurene. To conclude, our results indicate that adatom engineering may be used to greatly expand the potential applications of 2D tellurene.

  18. Inter-dot strain field effect on the optoelectronic properties of realistic InP lateral quantum-dot molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barettin, Daniele, E-mail: Daniele.Barettin@uniroma2.it; Auf der Maur, Matthias; De Angelis, Roberta

    2015-03-07

    We report on numerical simulations of InP surface lateral quantum-dot molecules on In{sub 0.48}Ga{sub 0.52 }P buffer, using a model strictly derived by experimental results by extrapolation of the molecules shape from atomic force microscopy images. Our study has been inspired by the comparison of a photoluminescence spectrum of a high-density InP surface quantum dot sample with a numerical ensemble average given by a weighted sum of simulated single quantum-dot spectra. A lack of experimental optical response from the smaller dots of the sample is found to be due to strong inter-dot strain fields, which influence the optoelectronic properties of lateralmore » quantum-dot molecules. Continuum electromechanical, k{sup →}·p{sup →} bandstructure, and optical calculations are presented for two different molecules, the first composed of two dots of nearly identical dimensions (homonuclear), the second of two dots with rather different sizes (heteronuclear). We show that in the homonuclear molecule the hydrostatic strain raises a potential barrier for the electrons in the connection zone between the dots, while conversely the holes do not experience any barrier, which considerably increases the coupling. Results for the heteronuclear molecule show instead that its dots do not appear as two separate and distinguishable structures, but as a single large dot, and no optical emission is observed in the range of higher energies where the smaller dot is supposed to emit. We believe that in samples of such a high density the smaller dots result as practically incorporated into bigger molecular structures, an effect strongly enforced by the inter-dot strain fields, and consequently it is not possible to experimentally obtain a separate optical emission from the smaller dots.« less

  19. Inter-dot strain field effect on the optoelectronic properties of realistic InP lateral quantum-dot molecules

    NASA Astrophysics Data System (ADS)

    Barettin, Daniele; Auf der Maur, Matthias; De Angelis, Roberta; Prosposito, Paolo; Casalboni, Mauro; Pecchia, Alessandro

    2015-03-01

    We report on numerical simulations of InP surface lateral quantum-dot molecules on In0.48Ga0.52P buffer, using a model strictly derived by experimental results by extrapolation of the molecules shape from atomic force microscopy images. Our study has been inspired by the comparison of a photoluminescence spectrum of a high-density InP surface quantum dot sample with a numerical ensemble average given by a weighted sum of simulated single quantum-dot spectra. A lack of experimental optical response from the smaller dots of the sample is found to be due to strong inter-dot strain fields, which influence the optoelectronic properties of lateral quantum-dot molecules. Continuum electromechanical, k →.p → bandstructure, and optical calculations are presented for two different molecules, the first composed of two dots of nearly identical dimensions (homonuclear), the second of two dots with rather different sizes (heteronuclear). We show that in the homonuclear molecule the hydrostatic strain raises a potential barrier for the electrons in the connection zone between the dots, while conversely the holes do not experience any barrier, which considerably increases the coupling. Results for the heteronuclear molecule show instead that its dots do not appear as two separate and distinguishable structures, but as a single large dot, and no optical emission is observed in the range of higher energies where the smaller dot is supposed to emit. We believe that in samples of such a high density the smaller dots result as practically incorporated into bigger molecular structures, an effect strongly enforced by the inter-dot strain fields, and consequently it is not possible to experimentally obtain a separate optical emission from the smaller dots.

  20. Ab initio study of the structural properties of acetonitrile-water mixtures

    NASA Astrophysics Data System (ADS)

    Chen, Jinfan; Sit, Patrick H.-L.

    2015-08-01

    Structural properties of acetonitrile and acetonitrile-water mixtures are studied using Density Functional Theory (DFT) and ab initio molecular dynamics simulations. Stable molecular clusters consisted of several water and acetonitrile molecules are identified to provide microscopic understanding of the interaction among water and acetonitrile molecules. Ab initio molecular dynamics simulations are performed to study the liquid structure at the finite temperature. Three mixing compositions in which the mole fraction of acetonitrile equals 0.109, 0.5 and 0.891 are studied. These compositions correspond to three distinct structural regimes. At the 0.109 and 0.891 mole fraction of acetonitrile, the majority species are mostly connected among themselves and the minority species are either isolated or forming small clusters without disrupting the network of the majority species. At the 0.5 mole fraction of acetonitrile, large water and acetonitrile clusters persist throughout the simulation, exhibiting the microheterogeneous behavior in acetonitrile-water mixtures in the mid-range mixing ratio.

  1. Ab initio study of structural and mechanical property of solid molecular hydrogens

    NASA Astrophysics Data System (ADS)

    Ye, Yingting; Yang, Li; Yang, Tianle; Nie, Jinlan; Peng, Shuming; Long, Xinggui; Zu, Xiaotao; Du, Jincheng

    2015-06-01

    Ab initio calculations based on density functional theory (DFT) were performed to investigate the structural and the elastic properties of solid molecular hydrogens (H2). The influence of molecular axes of H2 on structural relative stabilities of hexagonal close-packed (hcp) and face-centered cubic (fcc) structured hydrogen molecular crystals were systematically investigated. Our results indicate that for hcp structures, disordered hydrogen molecule structure is more stable, while for fcc structures, Pa3 hydrogen molecular crystal is most stable. The cohesive energy of fcc H2 crystal was found to be lower than hcp. The mechanical properties of fcc and hcp hydrogen molecular crystals were obtained, with results consistent with previous theoretical calculations. In addition, the effects of zero point energy (ZPE) and van der Waals (vdW) correction on the cohesive energy and the stability of hydrogen molecular crystals were systematically studied and discussed.

  2. A structural biology perspective on bioactive small molecules and their plant targets.

    PubMed

    Kumari, Selva; van der Hoorn, Renier A L

    2011-10-01

    Structural biology efforts in recent years have generated numerous co-crystal structures of bioactive small molecules interacting with their plant targets. These studies include the targets of various phytohormones, pathogen-derived effectors, herbicides and other bioactive compounds. Here we discuss that this collection of structures contains excellent examples of nine collective observations: molecular glues, allostery, inhibitors, molecular mimicry, promiscuous binding sites, unexpected electron densities, natural selection at atomic resolution, and applications in structure-guided mutagenesis and small molecule design. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Modulating the single-molecule magnet behaviour in phenoxo-O bridged Dy2 systems via subtle structural variations

    NASA Astrophysics Data System (ADS)

    Wang, Wen-Min; Zhao, Xiao-Yu; Qiao, Hui; Bai, Li; Han, Hong-Fei; Fang, Ming; Wu, Zhi-Lei; Zou, Ji-Yong

    2017-09-01

    In search of simple approaches to rationally modulate the single-molecule magnet behaviour in polynuclear lanthanide compound, a new system containing two structurally closely related dinuclear dysprosium complexes, namely [Dy2(hfac)4L2] (1) and [Dy2(hfac)4L‧2] (2) (hfac = hexafluoroacetylacetonate, HL = 2-[4-methylaniline-imino]methyl]-8-hydroxyquinoline and HL' = 2-[(3,4-dimethylaniline)-imino]methyl]-8-hydroxyquinoline), are successfully synthesized and the structure-dependent magnetic properties are investigated. The two Dy2 compounds display only slight variations in the coordination geometries of the center Dy(III) ion but display remarkably different single-molecule magnet behaviors with the anisotropic barriers (ΔE/kB) of 9.91 K for 1 and 20.57 K for 2. The different magnetic relaxation behaviors of the two Dy2 complexes mainly originate from the different chemical environments of the central DyIII ions.

  4. Chiral Superstructure Mesophases of Achiral Bent-Shaped Molecules - Hierarchical Chirality Amplification and Physical Properties.

    PubMed

    Le, Khoa V; Takezoe, Hideo; Araoka, Fumito

    2017-07-01

    Chiral mesophases in achiral bent-shaped molecules have attracted particular attention since their discovery in the middle 1990s, not only because of their homochirality and polarity, but also due to their unique physical/physicochemical properties. Here, the most intriguing results in the studies of such symmetry-broken states, mainly helical-nanofilament (HNF) and dark-conglomerate (DC) phases, are reviewed. Firstly, basic information on the typical appearance and optical activity in these phases is introduced. In the following section, the formation of mesoscopic chiral superstructures in the HNF and DC phases is discussed in terms of hierarchical chirality. Nanoscale phase segregation in mixture systems and gelation ability in the HNF phase are also described. In addition, some other related chiral phases of bent-shaped molecules are shown. Recent attempts to control such mesoscopic chiral structure and the alignment/confinement of HNFs are also discussed, along with several examples of their fascinating advanced physical properties, i.e. huge enhancement of circular dichroism, electro- and photo-tunable optical activities, chirality-induced nonlinear optics (second-harmonic-generation circular difference and electrogyration effect), enhanced hydrophobicity through the dual-scale surface morphological modulation, and photoconductivity in the HNF/fullerene binary system. Future prospects from basic science and application viewpoints are also indicated in the concluding section. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Magnetic properties of dendrimer structures with different coordination numbers: A Monte Carlo study

    NASA Astrophysics Data System (ADS)

    Masrour, R.; Jabar, A.

    2016-11-01

    We investigate the magnetic properties of Cayley trees of large molecules with dendrimer structure using Monte Carlo simulations. The thermal magnetization and magnetic susceptibility of a dendrimer structure are given with different coordination numbers, Z=3, 4, 5 and different generations g=3 and 2. The variation of magnetizations with the exchange interactions and crystal fields have been given of this system. The magnetic hysteresis cycles have been established.

  6. Structures, electronic properties and reaction paths from Fe(CO)5 molecule to small Fe clusters

    NASA Astrophysics Data System (ADS)

    Li, Zhi; Zhao, Zhen

    2018-04-01

    The geometries, electrical characters and reaction paths from Fe(CO)5 molecule to small Fe clusters were investigated by using all-electron density functional theory. The results show that in the decomposition process of pentacarbonyl-iron, Fe(CO)5 molecule prefers to remove a carbon monoxide and adsorb another Fe(CO)5 molecule to produce nonacarbonyldiiron Fe2(CO)9 then Fe2(CO)9 gradually removes carbon monoxide to produce small Fe clusters. As It can be seen from the highest occupied molecule orbital-lowest unoccupied molecule orbital gap curves, the Fe(CO)n=3, and 5 and Fe2(CO)n=3, 7 and 9 intermediates have higher chemical stability than their neighbors. The local magnetic moment of the carbon monoxide is aligning anti-ferromagnetic. The effect of external magnetic field to the initial decomposition products of Fe(CO)5 can be ignored.

  7. Correlation of the protein structure and gelling properties in dried egg white products.

    PubMed

    Handa, A; Hayashi, K; Shidara, H; Kuroda, N

    2001-08-01

    The relationship between protein structure and aggregation, as well as heat-induced gelling properties, of seven dried egg white (DEW) products was investigated. Strong correlations were found between average molecular weight and hydrophobicity plus surface SH groups of DEW-soluble protein aggregate (SPA). This suggests that hydrophobic interactions and disulfide bond formation between protein molecules were involved in the aggregation. The average molecular weight of DEW products with alkaline pHs was relatively higher than those with neutral pHs and the same degree of protein unfolding, probably because of more disulfide bond formation between protein molecules. In addition, strong correlations were found between hydrophobicity, surface SH groups plus average molecular weight of DEW-SPA, and physical properties of the gels from DEW products. These data indicated that controlling the aggregation of DEW proteins in the dry state is crucial to controlling the gelling properties of DEW.

  8. Small Molecules Affect Human Dental Pulp Stem Cell Properties Via Multiple Signaling Pathways

    PubMed Central

    Al-Habib, Mey; Yu, Zongdong

    2013-01-01

    One fundamental issue regarding stem cells for regenerative medicine is the maintenance of stem cell stemness. The purpose of the study was to test whether small molecules can enhance stem cell properties of mesenchymal stem cells (MSCs) derived from human dental pulp (hDPSCs), which have potential for multiple clinical applications. We identified the effects of small molecules (Pluripotin (SC1), 6-bromoindirubin-3-oxime and rapamycin) on the maintenance of hDPSC properties in vitro and the mechanisms involved in exerting the effects. Primary cultures of hDPSCs were exposed to optimal concentrations of these small molecules. Treated hDPSCs were analyzed for their proliferation, the expression levels of pluripotent and MSC markers, differentiation capacities, and intracellular signaling activations. We found that small molecule treatments decreased cell proliferation and increased the expression of STRO-1, NANOG, OCT4, and SOX2, while diminishing cell differentiation into odonto/osteogenic, adipogenic, and neurogenic lineages in vitro. These effects involved Ras-GAP-, ERK1/2-, and mTOR-signaling pathways, which may preserve the cell self-renewal capacity, while suppressing differentiation. We conclude that small molecules appear to enhance the immature state of hDPSCs in culture, which may be used as a strategy for adult stem cell maintenance and extend their capacity for regenerative applications. PMID:23573877

  9. Disentangling DNA molecules

    NASA Astrophysics Data System (ADS)

    Vologodskii, Alexander

    2016-09-01

    The widespread circular form of DNA molecules inside cells creates very serious topological problems during replication. Due to the helical structure of the double helix the parental strands of circular DNA form a link of very high order, and yet they have to be unlinked before the cell division. DNA topoisomerases, the enzymes that catalyze passing of one DNA segment through another, solve this problem in principle. However, it is very difficult to remove all entanglements between the replicated DNA molecules due to huge length of DNA comparing to the cell size. One strategy that nature uses to overcome this problem is to create the topoisomerases that can dramatically reduce the fraction of linked circular DNA molecules relative to the corresponding fraction at thermodynamic equilibrium. This striking property of the enzymes means that the enzymes that interact with DNA only locally can access their topology, a global property of circular DNA molecules. This review considers the experimental studies of the phenomenon and analyzes the theoretical models that have been suggested in attempts to explain it. We describe here how various models of enzyme action can be investigated computationally. There is no doubt at the moment that we understand basic principles governing enzyme action. Still, there are essential quantitative discrepancies between the experimental data and the theoretical predictions. We consider how these discrepancies can be overcome.

  10. Determining the elastic properties of aptamer-ricin single molecule multiple pathway interactions

    NASA Astrophysics Data System (ADS)

    Wang, Bin; Park, Bosoon; Kwon, Yongkuk; Xu, Bingqian

    2014-05-01

    We report on the elastic properties of ricin and anti-ricin aptamer interactions, which showed three stable binding conformations, each of which has its special elastic properties. These different unbinding pathways were investigated by the dynamic force spectroscopy. A series-spring model combining the worm-like-chain model and Hook's law was used to estimate the apparent spring constants of the aptamer and linker molecule polyethylene glycol. The aptamer in its three different unbinding pathways showed different apparent spring constants. The two reaction barriers in the unbinding pathways also influence the apparent spring constant of the aptamer. This special elastic behavior of aptamer was used to distinguish its three unbinding pathways under different loading rates. This method also offered a way to distinguish and discard the non-specific interactions in single molecule experiments.

  11. Density functional theory study of structural and electronic properties of trans and cis structures of thiothixene as a nano-drug.

    PubMed

    Noori Tahneh, Akram; Bagheri Novir, Samaneh; Balali, Ebrahim

    2017-11-25

    The geometrical structure, electronic and optical properties, electronic absorption spectra, vibrational frequencies, natural charge distribution, MEP analysis and thermodynamic properties of the trans and cis structures of the drug thiothixene were investigated using density functional theory (DFT) and time-dependent DFT (TDDFT) methods with the B3LYP hybrid functional and 6-311 + G(d,p) basis set. The results of the calculations demonstrate that the cis structure of thiothixene has appropriate quantum properties that can act as an active medicine. The relative energies of trans and cis structures of thiothixene shows that the cis structure is more stable than the trans structure, with a small energy difference. TDDFT calculations show that the cis structure of thiothixene has the best absorption properties. The calculated NLO properties show that the NLO properties of the cis structure of thiothixene are higher than the trans structure, and the fact that the chemical hardness of the cis structure is lower than that of the trans structure that indicates that the reactivity and charge transfer of the cis isomer of thiothixene is higher than that of trans thiothixene. The molecular electrostatic potential (MEP) maps of both structures of thiothixene demonstrate that the oxygen atoms of the molecule are appropriate areas for electrophilic reactions. The vibrational frequencies of the two conformations of thiothixene demonstrate that both structures of thiothixene have almost similar modes of vibrations. The calculated thermodynamic parameters show that these quantities increase with enhancing temperature due to the enhancement of molecular vibrational intensities with temperature. Graphical abstract Trans/Cis isomerization of thiothixene drug.

  12. Spin transport properties of n-polyacene molecules (n = 1–15) connected to Ni surface electrodes: Theoretical analysis

    PubMed Central

    Caliskan, S.; Laref, A.

    2014-01-01

    Using non-equilibrium Green function formalism in conjunction with density functional theory, we explore the spin-polarized transport characteristics of several planar n-acene molecules suspended between two semi-infinite Ni electrodes via the thiol group. We examine the spin-dependence transport on Ni-n-acenes-Ni junctions, while the number of fused benzene rings varies between 1 and 15. Intriguingly, the induced magnetic moments of small acene molecules are higher than that of longer acene rings. The augmentation of fused benzene rings affects both the magnetic and transport features, such as the transmission function and conductance owing to their coupling to the Ni surface contacts via the anchoring group. The interplay between the spin-polarized transport properties, structural configuration and molecular electronic is a fortiori essential in these attractive molecular devices. Thus, this can conduct to the engineering of the electron spin transport in atomistic and molecular junctions. These prominent molecules convincingly infer that the molecular spin valves can conduct to thriving molecular devices. PMID:25482076

  13. The electronic structure and second-order nonlinear optical properties of donor-acceptor acetylenes - A detailed investigation of structure-property relationships

    NASA Technical Reports Server (NTRS)

    Stiegman, A. E.; Graham, Eva; Khundkar, Lutfur R.; Perry, Joseph W.; Cheng, L.-T.; Perry, Kelly J.

    1991-01-01

    A series of donor-acceptor acetylene compounds was synthesized in which systematic changes in both the conjugation length and the donor-acceptor strength were made. The effect of these structural changes on the spectroscopic and electronic properties of the molecules and, ultimately, on the measured second-order molecular hyperpolarizabilities (beta) was investigated. It was found that increases in the donor-acceptor strength resulted in increases in the magnitude of beta. For this class of molecules, the increase is dominated by the energy of the intramolecular charge-transfer transition, while factors such as the ground to excited-state dipole moment change and the transition-moment integral are much less important. Increasing the conjugation length from one to two acetylene linkers did not result in an increase in the value of beta; however, beta increased sharply in going from two acetylenes to three. This increase is attributed to the superposition of several nearly isoenergetic excited states.

  14. Structure, reactivity, and electronic properties of V-doped Co clusters

    NASA Astrophysics Data System (ADS)

    Datta, Soumendu; Kabir, Mukul; Saha-Dasgupta, Tanusri; Mookerjee, Abhijit

    2009-08-01

    Structures and physicochemical properties of V-doped Co13 clusters have been studied in detail using density-functional-theory-based first-principles method. We have found anomalous variation in stability of the doped clusters with increasing V concentration, which has been nicely demonstrated in terms of energetics and electronic properties of the clusters. Our study explains the nonmonotonic variation in reactivity of Co13-mVm clusters toward H2 molecules as reported experimentally [Nonose , J. Phys. Chem. 94, 2744 (1990)]. Moreover, it provides useful insight into the cluster geometry and chemically active sites on the cluster surface, which can help to design better catalytic processes.

  15. Type II Heat-labile Enterotoxins: Structure, Function, and Immunomofdulatory Properties

    PubMed Central

    Hajishengallis, George; Connell, Terry D.

    2012-01-01

    The heat-labile enterotoxins (HLTs) of Escherichia coli and Vibrio cholerae are classified into two major types on the basis of genetic, biochemical, and immunological properties. Type I and Type II HLT have been intensively studied for their exceptionally strong adjuvant activities. Despite general structural similarities, these molecules, in intact or derivative (non-toxic) forms, display notable differences in their mode of immunomodulatory action. The molecular basis of these differences has remained largely uncharacterized until recently. This review focuses on the Type II HLTs and their immunomodulatory properties which depend largely on interactions with unique gangliosides and Toll-like receptors that are not utilized by the Type I HLTs. PMID:23137790

  16. Common Molecules: Bringing Research and Teaching Together through an Online Collection.

    ERIC Educational Resources Information Center

    Sandvoss, Leah M.; Harwood, William S.; Korkmaz, Ali; Bollinger, John C.; Huffman, John C.; Huffman, John N.

    2003-01-01

    Describes the design of a Common Molecules collection that provides interactive tools for 3-D visualization of molecules. The organizational design provides not only structural information, but also historical and/or key information on the properties of the molecules in the collection. Describes student use of the collection and the role of…

  17. What Can Interfacial Water Molecules Tell Us About Solute Structure?

    NASA Astrophysics Data System (ADS)

    Willard, Adam

    The molecular structure of bulk liquid water reflects a molecular tendency to engage in tetrahedrally coordinated hydrogen bonding. At a solute interface waters preferred three-dimensional hydrogen bonding network must conform to a locally anisotropy interfacial environment. Interfacial water molecules adopt configurations that balance water-solute and water-water interactions. The arrangements of interfacial water molecules, therefore encode information about the effective solute-water interactions. This solute-specific information is difficult to extract, however, because interfacial structure also reflects waters collective response to an anisotropic hydrogen bonding environment. Here I present a methodology for characterizing the molecular-level structure of liquid water interface from simulation data. This method can be used to explore waters static and/or dynamic response to a wide range of chemically and topologically heterogeneous solutes such as proteins.

  18. Glucose sensing molecules having selected fluorescent properties

    DOEpatents

    Satcher, Jr., Joe H.; Lane, Stephen M.; Darrow, Christopher B.; Cary, Douglas R.; Tran, Joe Anh

    2004-01-27

    An analyte sensing fluorescent molecule that employs intramolecular electron transfer is designed to exhibit selected fluorescent properties in the presence of analytes such as saccharides. The selected fluorescent properties include excitation wavelength, emission wavelength, fluorescence lifetime, quantum yield, photostability, solubility, and temperature or pH sensitivity. The compound comprises an aryl or a substituted phenyl boronic acid that acts as a substrate recognition component, a fluorescence switch component, and a fluorophore. The fluorophore and switch component are selected such that the value of the free energy for electron transfer is less than about 3.0 kcal mol.sup.-1. Fluorescent compounds are described that are excited at wavelengths greater than 400 nm and emit at wavelengths greater than 450 nm, which is advantageous for optical transmission through skin. The fluorophore is typically selected from transition metal-ligand complexes and thiazine, oxazine, oxazone, or oxazine-one as well as anthracene compounds. The fluorescent compound can be immobilized in a glucose permeable biocompatible polymer matrix that is implantable below the skin.

  19. Structure Property Relationships of Biobased Epoxy Resins

    NASA Astrophysics Data System (ADS)

    Maiorana, Anthony Surraht

    The thesis is about the synthesis, characterization, development, and application of epoxy resins derived from sustainable feedstocks such as lingo-cellulose, plant oils, and other non-food feedstocks. The thesis can be divided into two main topics 1) the synthesis and structure property relationship investigation of new biobased epoxy resin families and 2) mixing epoxy resins with reactive diluents, nanoparticles, toughening agents, and understanding co-curing reactions, filler/matrix interactions, and cured epoxy resin thermomechanical, viscoelastic, and dielectric properties. The thesis seeks to bridge the gap between new epoxy resin development, application for composites and advanced materials, processing and manufacturing, and end of life of thermoset polymers. The structures of uncured epoxy resins are characterized through traditional small molecule techniques such as nuclear magnetic resonance, high resolution mass spectrometry, and infrared spectroscopy. The structure of epoxy resin monomers are further understood through the process of curing the resins and cured resins' properties through rheology, chemorheology, dynamic mechanical analysis, tensile testing, fracture toughness, differential scanning calorimetry, scanning electron microscopy, thermogravimetric analysis, and notched izod impact testing. It was found that diphenolate esters are viable alternatives to bisphenol A and that the structure of the ester side chain can have signifi-cant effects on monomer viscosity. The structure of the cured diphenolate based epoxy resins also influence glass transition temperature and dielectric properties. Incorporation of reactive diluents and flexible resins can lower viscosity, extend gel time, and enable processing of high filler content composites and increase fracture toughness. Incorpora-tion of high elastic modulus nanoparticles such as graphene can provide increases in physical properties such as elastic modulus and fracture toughness. The synthesis

  20. PAT: predictor for structured units and its application for the optimization of target molecules for the generation of synthetic antibodies.

    PubMed

    Jeon, Jouhyun; Arnold, Roland; Singh, Fateh; Teyra, Joan; Braun, Tatjana; Kim, Philip M

    2016-04-01

    The identification of structured units in a protein sequence is an important first step for most biochemical studies. Importantly for this study, the identification of stable structured region is a crucial first step to generate novel synthetic antibodies. While many approaches to find domains or predict structured regions exist, important limitations remain, such as the optimization of domain boundaries and the lack of identification of non-domain structured units. Moreover, no integrated tool exists to find and optimize structural domains within protein sequences. Here, we describe a new tool, PAT ( http://www.kimlab.org/software/pat ) that can efficiently identify both domains (with optimized boundaries) and non-domain putative structured units. PAT automatically analyzes various structural properties, evaluates the folding stability, and reports possible structural domains in a given protein sequence. For reliability evaluation of PAT, we applied PAT to identify antibody target molecules based on the notion that soluble and well-defined protein secondary and tertiary structures are appropriate target molecules for synthetic antibodies. PAT is an efficient and sensitive tool to identify structured units. A performance analysis shows that PAT can characterize structurally well-defined regions in a given sequence and outperforms other efforts to define reliable boundaries of domains. Specially, PAT successfully identifies experimentally confirmed target molecules for antibody generation. PAT also offers the pre-calculated results of 20,210 human proteins to accelerate common queries. PAT can therefore help to investigate large-scale structured domains and improve the success rate for synthetic antibody generation.

  1. Rationalizing the photophysical properties of BODIPY laser dyes via aromaticity and electron-donor-based structural perturbations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Waddell, Paul G.; Liu, Xiaogang; Zhao, Teng

    2015-05-01

    The absorption and fluorescence properties of six boron dipyrromethene (BODIPY) laser dyes with simple non-aromatic substituents are rationalized by relating them to observable structural perturbations within the molecules of the dyes. An empirical relationship involving the structure and the optical properties is derived using a combination of single-crystal X-ray diffraction data, quantum chemical calculations and electronic constants: i.e. the tendency of the pyrrole bond lengths towards aromaticity and the UV-vis absorption and fluorescence wavelengths correlating with the electron-donor properties of the substituents. The effect of molecular conformation on the solid-state optical properties of the dyes is also discussed. The findingsmore » in this study also demonstrate the usefulness and limitations of using crystal structure data to develop structure-property relationships in this class of optical materials, contributing to the growing effort to design optoelectronic materials with tunable properties via molecular engineering.« less

  2. Molecule kernels: a descriptor- and alignment-free quantitative structure-activity relationship approach.

    PubMed

    Mohr, Johannes A; Jain, Brijnesh J; Obermayer, Klaus

    2008-09-01

    Quantitative structure activity relationship (QSAR) analysis is traditionally based on extracting a set of molecular descriptors and using them to build a predictive model. In this work, we propose a QSAR approach based directly on the similarity between the 3D structures of a set of molecules measured by a so-called molecule kernel, which is independent of the spatial prealignment of the compounds. Predictors can be build using the molecule kernel in conjunction with the potential support vector machine (P-SVM), a recently proposed machine learning method for dyadic data. The resulting models make direct use of the structural similarities between the compounds in the test set and a subset of the training set and do not require an explicit descriptor construction. We evaluated the predictive performance of the proposed method on one classification and four regression QSAR datasets and compared its results to the results reported in the literature for several state-of-the-art descriptor-based and 3D QSAR approaches. In this comparison, the proposed molecule kernel method performed better than the other QSAR methods.

  3. Structural and vibrational investigations of a neurotransmitter molecule: Serotonin (5-hydroxy tryptamine)

    NASA Astrophysics Data System (ADS)

    Jha, Omkant; Yadav, R. A.

    2016-11-01

    Structural and vibrational studies have been carried out for the most stable conformer of serotonin (5-HT) at the DFT/B3LYP/6-311++G** level using the Gaussian 09 software. In light of the computed vibrational parameters the observed IR and Raman frequencies have been analyzed. To help assign the vibrational fundamentals the GAR2PED software has been used to compute PEDs. Several of the fundamentals are drastically changed in going from indole to serotonin. The two NH bonds of the NH2 group are slightly different possibly due to bonding of the two H atoms of the NH2 group with different atoms. The rocking and wagging modes of the NH2 groups show mixing with the other modes while the remaining four modes are pure group modes. The Kekule phenyl ring stretching mode is found to remain almost unchanged. The HOMO-LUMO energy gap supports to pharmacological active property of the serotonin molecule. The HOMO and LUMO study suggests the existence of charge transfer within the molecule. The NBO analysis has been carried out to gather information regarding the proper and improper hydrogen bonds.

  4. Understanding molecular structure dependence of exciton diffusion in conjugated small molecules

    NASA Astrophysics Data System (ADS)

    Li, Zi; Zhang, Xu; Woellner, Cristiano F.; Lu, Gang

    2014-04-01

    First-principles simulations are carried out to understand molecular structure dependence of exciton diffusion in a series of small conjugated molecules arranged in a disordered, crystalline, and blend structure. Exciton diffusion length (LD), lifetime, and diffusivity in four diketopyrrolopyrrole derivatives are calculated and the results compare very well with experimental values. The correlation between exciton diffusion and molecular structure is examined in detail. In the disordered molecule structure, a longer backbone length leads to a shorter exciton lifetime and a higher exciton diffusivity, but it does not change LD substantially. Removal of the end alkyl chains or the extra branch on the side alkyl chains reduces LD. In the crystalline structure, exciton diffusion exhibits a strong anisotropy whose origin can be elucidated from the intermolecular transition density interaction point of view. In the blend structure, LD increases with the crystalline ratios, which are estimated and consistent with the experimental results.

  5. Connection between the conformation and emission properties of poly[2-methoxy-5-(2'-ethyl-hexyloxy)-1,4-phenylene vinylene] single molecules during thermal annealing

    NASA Astrophysics Data System (ADS)

    Ou, Jiemei; Yang, Yuzhao; Lin, Wensheng; Yuan, Zhongke; Gan, Lin; Lin, Xiaofeng; Chen, Xudong; Chen, Yujie

    2015-03-01

    We investigated the transitions of conformations and their effects on emission properties of poly[2-methoxy-5-(2'-ethyl-hexyloxy)-1,4-phenylene vinylene] (MEH-PPV) single molecules in PMMA matrix during thermal annealing process. Total internal reflection fluorescence microscopy measurements reveal the transformation from collapsed conformations to extended, highly ordered rod-like structures of MEH-PPV single molecules during thermal annealing. The blue shifts in the ensemble single molecule PL spectra support our hypnosis. The transition occurs as the annealing temperature exceeds 100 °C, implying that an annealing temperature near the glass transition temperature Tg of matrix is ideal for the control and optimization of blend polymer films.

  6. A small molecule chemical chaperone optimizes its unfolded state contraction and denaturant like properties

    NASA Astrophysics Data System (ADS)

    Sharma, Sunny; Sarkar, Suparna; Paul, Simanta Sarani; Roy, Syamal; Chattopadhyay, Krishnananda

    2013-12-01

    Protein aggregation is believed to occur through the formation of misfolded conformations. It is expected that, in order to minimize aggregation, an effective small molecule chaperone would destabilize these intermediates. To study the mechanism of a chemical chaperone, we have designed a series of mutant proteins in which a tryptophan residue experiences different local environments and solvent exposures. We show that these mutants correspond to a series of conformationally altered proteins with varying degree of misfolding stress and aggregation propensities. Using arginine as a model small molecule, we show that a combination of unfolded state contraction and denaturant like properties results in selective targeting and destabilization of the partially folded proteins. In comparison, the effect of arginine towards the folded like control mutant, which is not aggregation prone, is significantly less. Other small molecules, lacking either of the above two properties, do not offer any specificity towards the misfolded proteins.

  7. Theoretical investigation of the molecular structure of the isoquercitrin molecule

    NASA Astrophysics Data System (ADS)

    Cornard, J. P.; Boudet, A. C.; Merlin, J. C.

    1999-09-01

    Isoquercitrin is a glycosilated flavonoid that has received a great deal of attention because of its numerous biological effects. We present a theoretical study on isoquercitrin using both empirical (Molecular Mechanics (MM), with MMX force field) and quantum chemical (AM1 semiempirical method) techniques. The most stable structures of the molecule obtained by MM calculations have been used as input data for the semiempirical treatment. The position and orientation of the glucose moiety with regard to the remainder of the molecule have been investigated. The flexibility of isoquercitrin principally lies in rotations around the inter-ring bond and the sugar link. In order to know the structural modifications generated by the substitution by a sugar, geometrical parameters of quercetin (aglycon) and isoquercitrin have been compared. The good accordance between theoretical and experimental electronic spectra permits to confirm the reliability of the structural model.

  8. Molecules Without Atoms

    NASA Astrophysics Data System (ADS)

    Ruth, Anthony; Collins, Laura; Gomes, Kenjiro; Janko, Boldizsar

    We present a real-space representation of molecules which results in the normal bonding rules and electronic structure of chemistry without atom-centered coulomb potentials. Using a simple mapping, we can generate atomless molecules from the structure of real molecules. Additionally, molecules without atoms show similar covalent bonding energies and transfer of charge in ionic bonds as real molecules. The atomless molecules contain only the valence and conduction electronic structure of the real molecule. Using the framework of the Atoms in Molecules (AIM) theory of Bader, we prove that the topological features of the valence charge distribution of molecules without atoms are identical to that of real molecules. In particular, the charge basins of atomless molecules show identical location and quantities of representative charge. We compare the accuracy, computational cost, and intuition gained from electronic structure calculations of molecules without atoms with the use of pseudopotentials to represent atomic cores in density functional theory. A. R. acknowledges support from a NASA Space Technology Research Fellowship.

  9. Field-induced structural control of COx molecules adsorbed on graphene

    NASA Astrophysics Data System (ADS)

    Matsubara, Manaho; Okada, Susumu

    2018-05-01

    Using the density functional theory combined with both the van der Waals correction and the effective screening medium method, we investigate the energetics and electronic structures of CO and CO2 molecules adsorbed on graphene surfaces in the field-effect-transistor structure with respect to the external electric field by the excess electrons/holes. The binding energies of CO and CO2 molecules to graphene monotonically increase with increasing hole and electron concentrations. The increase occurs regardless of the molecular conformations to graphene and the counter electrode, indicating that the carrier injection substantially enhances the molecular adsorption on graphene. Injected carriers also modulate the stable molecular conformation, which is metastable in the absence of an electric field.

  10. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

  11. Mapping small molecule binding data to structural domains

    PubMed Central

    2012-01-01

    Background Large-scale bioactivity/SAR Open Data has recently become available, and this has allowed new analyses and approaches to be developed to help address the productivity and translational gaps of current drug discovery. One of the current limitations of these data is the relative sparsity of reported interactions per protein target, and complexities in establishing clear relationships between bioactivity and targets using bioinformatics tools. We detail in this paper the indexing of targets by the structural domains that bind (or are likely to bind) the ligand within a full-length protein. Specifically, we present a simple heuristic to map small molecule binding to Pfam domains. This profiling can be applied to all proteins within a genome to give some indications of the potential pharmacological modulation and regulation of all proteins. Results In this implementation of our heuristic, ligand binding to protein targets from the ChEMBL database was mapped to structural domains as defined by profiles contained within the Pfam-A database. Our mapping suggests that the majority of assay targets within the current version of the ChEMBL database bind ligands through a small number of highly prevalent domains, and conversely the majority of Pfam domains sampled by our data play no currently established role in ligand binding. Validation studies, carried out firstly against Uniprot entries with expert binding-site annotation and secondly against entries in the wwPDB repository of crystallographic protein structures, demonstrate that our simple heuristic maps ligand binding to the correct domain in about 90 percent of all assessed cases. Using the mappings obtained with our heuristic, we have assembled ligand sets associated with each Pfam domain. Conclusions Small molecule binding has been mapped to Pfam-A domains of protein targets in the ChEMBL bioactivity database. The result of this mapping is an enriched annotation of small molecule bioactivity data and a

  12. Impact of amphiphilic molecules on the structure and stability of homogeneous sphingomyelin bilayer: Insights from atomistic simulations

    NASA Astrophysics Data System (ADS)

    Kumari, Pratibha; Kaur, Supreet; Sharma, Shobha; Kashyap, Hemant K.

    2018-04-01

    Modulation of lipid membrane properties due to the permeation of amphiphiles is an important biological process pertaining to many applications in the field of pharmaceutics, toxicology, and biotechnology. Sphingolipids are both structural and functional lipids that constitute an important component of mechanically stable and chemically resistant outer leaflets of plasma membranes. Here, we present an atomistic molecular dynamics simulation study to appreciate the concentration-dependent effects of small amphiphilic molecules, such as ethanol, acetone, and dimethyl sulfoxide (DMSO), on the structure and stability of a fully hydrated homogeneous N-palmitoyl-sphingomyelin (PSM) bilayer. The study reveals an increase in the lateral expansion of the bilayer along with disordering of the hydrophobic lipid tails on increasing the concentration of ethanol. At higher concentrations of ethanol, rupturing of the bilayer is quite evident through the analysis of partial electron density profiles and lipid tail order parameters. For ethanol containing systems, permeation of water molecules in the hydrophobic part of the bilayer is allowed through local defects made due to the entry of ethanol molecules via ethanol-ethanol and ethanol-PSM hydrogen bonds. Moreover, the extent of PSM-PSM hydrogen bonding decreases with increasing ethanol concentration. On the other hand, acetone and DMSO exhibit minimal effects on the stability of the PSM bilayer at their lower concentrations, but at higher concentrations they tend to enhance the stability of the bilayer. The simulated potential of mean force (PMF) profiles for the translocation of the three solutes studied reveal that the free-energy of transfer of an ethanol molecule across the PSM lipid head region is lower than that for acetone and DMSO molecules. However, highest free-energy rise in the core hydrophobic part of the bilayer is observed for the DMSO molecule, whereas the ethanol and acetone PMF profiles show a lower barrier in

  13. Structural distributions from single-molecule measurements as a tool for molecular mechanics

    PubMed Central

    Hanson, Jeffrey A.; Brokaw, Jason; Hayden, Carl C.; Chu, Jhih-Wei; Yang, Haw

    2011-01-01

    A mechanical view provides an attractive alternative for predicting the behavior of complex systems since it circumvents the resource-intensive requirements of atomistic models; however, it remains extremely challenging to characterize the mechanical responses of a system at the molecular level. Here, the structural distribution is proposed to be an effective means to extracting the molecular mechanical properties. End-to-end distance distributions for a series of short poly-L-proline peptides with the sequence PnCG3K-biotin (n = 8, 12, 15 and 24) were used to experimentally illustrate this new approach. High-resolution single-molecule Förster-type resonance energy transfer (FRET) experiments were carried out and the conformation-resolving power was characterized and discussed in the context of the conventional constant-time binning procedure for FRET data analysis. It was shown that the commonly adopted theoretical polymer models—including the worm-like chain, the freely jointed chain, and the self-avoiding chain—could not be distinguished by the averaged end-to-end distances, but could be ruled out using the molecular details gained by conformational distribution analysis because similar polymers of different sizes could respond to external forces differently. Specifically, by fitting the molecular conformational distribution to a semi-flexible polymer model, the effective persistence lengths for the series of short poly-L-proline peptides were found to be size-dependent with values of ~190 Å, ~67 Å, ~51 Å, and ~76 Å for n = 8, 12, 15, and 24, respectively. A comprehensive computational modeling was carried out to gain further insights for this surprising discovery. It was found that P8 exists as the extended all-trans isomaer whereas P12 and P15 predominantly contained one proline residue in the cis conformation. P24 exists as a mixture of one-cis (75%) and two-cis (25%) isomers where each isomer contributes to an experimentally resolvable

  14. Supramolecular organization of pi-conjugated molecules monitored by single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Alvarez, Laurent; Almadori, Yann; Belhboub, Anouar; Le Parc, Rozenn; Aznar, Raymond; Dieudonné-George, Philippe; Rahmani, Abdelali; Hermet, Patrick; Fossard, Frédéric; Loiseau, Annick; Jousselme, Bruno; Campidelli, Stéphane; Saito, Takeshi; Wang, Guillaume; Bantignies, Jean-Louis

    2016-03-01

    Photoactive pi-conjugated molecules (quaterthiophene and phthalocyanine) are either encapsulated into the hollow core of single-walled carbon nanotubes or noncovalently stacked at their outer surface in order to elaborate hybrid nanosystems with new physical properties, providing practical routes to fit different requirements for potential applications. We are interested in the relationship between the structure and the optoelectronic properties. The structural properties are investigated mainly by x-ray diffraction and/or transmission electron microscopy and Raman spectroscopy. We show that the supramolecular organizations of confined quaterthiophenes depend on the nanocontainer size, whereas phthalocyanine encapsulation leads to the formation of a one-dimensional phase for which the angle between the molecule ring and the nanotube axis is close to 32 deg. Confined phthalocyanine molecules display Raman spectra hardly altered with respect to the bulk phase, suggesting a rather weak interaction with the tubes. In contrast, the vibrational properties of the molecules stacked at the outer surface of tubes display important modifications. We assume a significant curvature of the phthalocyanine induced by the interaction with the tube walls and a change of the central atom position within the molecular ring, in good agreement with our density functional theory calculations.

  15. Visualizing Chemical Bonds in Synthetic Molecules

    NASA Astrophysics Data System (ADS)

    Collins, Laura C.; Ruth, Anthony; Green, David B.; Janko, Boldizsar; Gomes, Kenjiro K.

    The use of synthetic quantum systems makes it possible to study phenomena that cannot be probed by conventional experiments. We created synthetic molecules using atomic manipulation and directly imaged the chemical bonds using tunneling spectroscopy. These synthetic systems allow us to probe the structure and electronic properties of chemical bonds in molecules, including those that would be unstable in nature, with unprecedented detail. The experimental images of electronic states in our synthetic molecules show a remarkable match to the charge distribution predicted by density functional theory calculations. The statistical analysis of the spectroscopy of these molecules can be adapted in the future to quantify aromaticity, which has been difficult to quantify universally thus far due to vague definitions. We can also study anti-aromatic molecules which are unstable naturally, to illuminate the electronic consequences of antiaromaticity.

  16. Stiffness, working stroke, and force of single-myosin molecules in skeletal muscle: elucidation of these mechanical properties via nonlinear elasticity evaluation.

    PubMed

    Kaya, Motoshi; Higuchi, Hideo

    2013-11-01

    In muscles, the arrays of skeletal myosin molecules interact with actin filaments and continuously generate force at various contraction speeds. Therefore, it is crucial for myosin molecules to generate force collectively and minimize the interference between individual myosin molecules. Knowledge of the elasticity of myosin molecules is crucial for understanding the molecular mechanisms of muscle contractions because elasticity directly affects the working and drag (resistance) force generation when myosin molecules are positively or negatively strained. The working stroke distance is also an important mechanical property necessary for elucidation of the thermodynamic efficiency of muscle contractions at the molecular level. In this review, we focus on these mechanical properties obtained from single-fiber and single-molecule studies and discuss recent findings associated with these mechanical properties. We also discuss the potential molecular mechanisms associated with reduction of the drag effect caused by negatively strained myosin molecules.

  17. Single molecule junction conductance and binding geometry

    NASA Astrophysics Data System (ADS)

    Kamenetska, Maria

    This Thesis addresses the fundamental problem of controlling transport through a metal-organic interface by studying electronic and mechanical properties of single organic molecule-metal junctions. Using a Scanning Tunneling Microscope (STM) we image, probe energy-level alignment and perform STM-based break junction (BJ) measurements on molecules bound to a gold surface. Using Scanning Tunneling Microscope-based break-junction (STM-BJ) techniques, we explore the effect of binding geometry on single-molecule conductance by varying the structure of the molecules, metal-molecule binding chemistry and by applying sub-nanometer manipulation control to the junction. These experiments are performed both in ambient conditions and in ultra high vacuum (UHV) at cryogenic temperatures. First, using STM imaging and scanning tunneling spectroscopy (STS) measurements we explore binding configurations and electronic properties of an amine-terminated benzene derivative on gold. We find that details of metal-molecule binding affect energy-level alignment at the interface. Next, using the STM-BJ technique, we form and rupture metal-molecule-metal junctions ˜104 times to obtain conductance-vs-extension curves and extract most likely conductance values for each molecule. With these measurements, we demonstrated that the control of junction conductance is possible through a choice of metal-molecule binding chemistry and sub-nanometer positioning. First, we show that molecules terminated with amines, sulfides and phosphines bind selectively on gold and therefore demonstrate constant conductance levels even as the junction is elongated and the metal-molecule attachment point is modified. Such well-defined conductance is also obtained with paracyclophane molecules which bind to gold directly through the pi system. Next, we are able to create metal-molecule-metal junctions with more than one reproducible conductance signatures that can be accessed by changing junction geometry. In the

  18. Generating Focused Molecule Libraries for Drug Discovery with Recurrent Neural Networks

    PubMed Central

    2017-01-01

    In de novo drug design, computational strategies are used to generate novel molecules with good affinity to the desired biological target. In this work, we show that recurrent neural networks can be trained as generative models for molecular structures, similar to statistical language models in natural language processing. We demonstrate that the properties of the generated molecules correlate very well with the properties of the molecules used to train the model. In order to enrich libraries with molecules active toward a given biological target, we propose to fine-tune the model with small sets of molecules, which are known to be active against that target. Against Staphylococcus aureus, the model reproduced 14% of 6051 hold-out test molecules that medicinal chemists designed, whereas against Plasmodium falciparum (Malaria), it reproduced 28% of 1240 test molecules. When coupled with a scoring function, our model can perform the complete de novo drug design cycle to generate large sets of novel molecules for drug discovery. PMID:29392184

  19. Spectral properties from Matsubara Green's function approach: Application to molecules

    NASA Astrophysics Data System (ADS)

    Schüler, M.; Pavlyukh, Y.

    2018-03-01

    We present results for many-body perturbation theory for the one-body Green's function at finite temperatures using the Matsubara formalism. Our method relies on the accurate representation of the single-particle states in standard Gaussian basis sets, allowing to efficiently compute, among other observables, quasiparticle energies and Dyson orbitals of atoms and molecules. In particular, we challenge the second-order treatment of the Coulomb interaction by benchmarking its accuracy for a well-established test set of small molecules, which includes also systems where the usual Hartree-Fock treatment encounters difficulties. We discuss different schemes how to extract quasiparticle properties and assess their range of applicability. With an accurate solution and compact representation, our method is an ideal starting point to study electron dynamics in time-resolved experiments by the propagation of the Kadanoff-Baym equations.

  20. Crystal engineering of giant molecules based on perylene diimide conjugated polyhedral oligomeric silsesquioxane nano-atom

    NASA Astrophysics Data System (ADS)

    Ren, He

    Molecular architectures and topologies are found contributing to the formation of supramolecular structures of giant molecules. Dr. Cheng's research group developed a diverse of giant molecules via precisely controlled chemistry synthetic routes. These giant molecules can be categorized into several different families, namely giant surfactants, giant shape amphiphiles and giant polyhedron. By analyzing the hierarchical structures of these carefully designed and precisely synthesized giant molecules, the structural factors which affect, or even dominates, in some cases, the formation of supramolecular structures are revealed in these intensive researches. The results will further contribute to the understanding of dependence of supramolecular structures on molecular designs as well as molecular topology, and providing a practical solution to the scaling up of microscopic molecular functionalities to macroscopic material properties. Molecular Nano Particles (MNPs), including fullerene (C60), POSS, Polyoxometalate (POM) and proteins etc., is defined and applied as a specific type of building blocks in the design and synthesis of giant molecules. The persistence in shape and symmetry is considered as one of the major properties of MNPs. This persistence will support the construction of giant molecules for further supramolecular structures' study by introducing specific shapes, or precisely located side groups which will facilitate self-assembling behaviors with pre-programmed secondary interactions. Dictating material physical properties by its chemical composition is an attractive yet currently failed approach in the study of materials. However, the pursuit of determining material properties by microscopic molecular level properties is never seized, and found its solution when the idea of crystal engineering is raised: should each atom in the material is located exactly where it is designed to be and is properly bonded, the property of the material is hence determined

  1. Structure and properties of starches from Arracacha (Arracacia xanthorrhiza) roots.

    PubMed

    Castanha, Nanci; Villar, James; Matta Junior, Manoel Divino da; Anjos, Carlota Boralli Prudente Dos; Augusto, Pedro Esteves Duarte

    2018-06-05

    Arracacha (Arracacia xanthorrhiza Bancroft) is an underexplored Andean root with a high starch content. In this work, starches from two different varieties of Peruvian arracacha were evaluated and characterized in relation to their granule morphology, molecular structure and properties. The starches presented round or polygonal shapes, with a mean diameter of ~20 μm and B-type granules. They were rich in amylopectin molecules with long chain lengths (with the ability to complex iodine) and some with intermediate sizes (indicating a defective crystalline structure). The starches presented low gelatinization temperature, enthalpy of gelatinization and tendency to retrogradation and high peak apparent viscosity and swelling capacity, even at moderate temperatures (60 °C), characteristics of high interest for industrial purposes. Besides, the starches presented a smooth and elastic gel and a high paste clarity. Overall, the arracacha roots presented attractive properties and can be used as an alternative botanical source for starch extraction. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Single Fluorescent Molecules as Nano-Illuminators for Biological Structure and Function

    NASA Astrophysics Data System (ADS)

    Moerner, W. E.

    2011-03-01

    Since the first optical detection and spectroscopy of a single molecule in a solid (Phys. Rev. Lett. {62}, 2535 (1989)), much has been learned about the ability of single molecules to probe local nanoenvironments and individual behavior in biological and nonbiological materials in the absence of ensemble averaging that can obscure heterogeneity. Because each single fluorophore acts a light source roughly 1 nm in size, microscopic imaging of individual fluorophores leads naturally to superlocalization, or determination of the position of the molecule with precision beyond the optical diffraction limit, simply by digitization of the point-spread function from the single emitter. For example, the shape of single filaments in a living cell can be extracted simply by allowing a single molecule to move through the filament (PNAS {103}, 10929 (2006)). The addition of photoinduced control of single-molecule emission allows imaging beyond the diffraction limit (super-resolution) and a new array of acronyms (PALM, STORM, F-PALM etc.) and advances have appeared. We have used the native blinking and switching of a common yellow-emitting variant of green fluorescent protein (EYFP) reported more than a decade ago (Nature {388}, 355 (1997)) to achieve sub-40 nm super-resolution imaging of several protein structures in the bacterium Caulobacter crescentus: the quasi-helix of the actin-like protein MreB (Nat. Meth. {5}, 947 (2008)), the cellular distribution of the DNA binding protein HU (submitted), and the recently discovered division spindle composed of ParA filaments (Nat. Cell Biol. {12}, 791 (2010)). Even with these advances, better emitters would provide more photons and improved resolution, and a new photoactivatable small-molecule emitter has recently been synthesized and targeted to specific structures in living cells to provide super-resolution images (JACS {132}, 15099 (2010)). Finally, a new optical method for extracting three-dimensional position information based on

  3. Global structure of forked DNA in solution revealed by high-resolution single-molecule FRET.

    PubMed

    Sabir, Tara; Schröder, Gunnar F; Toulmin, Anita; McGlynn, Peter; Magennis, Steven W

    2011-02-09

    Branched DNA structures play critical roles in DNA replication, repair, and recombination in addition to being key building blocks for DNA nanotechnology. Here we combine single-molecule multiparameter fluorescence detection and molecular dynamics simulations to give a general approach to global structure determination of branched DNA in solution. We reveal an open, planar structure of a forked DNA molecule with three duplex arms and demonstrate an ion-induced conformational change. This structure will serve as a benchmark for DNA-protein interaction studies.

  4. Structural basis of AMPK regulation by small molecule activators

    NASA Astrophysics Data System (ADS)

    Xiao, Bing; Sanders, Matthew J.; Carmena, David; Bright, Nicola J.; Haire, Lesley F.; Underwood, Elizabeth; Patel, Bhakti R.; Heath, Richard B.; Walker, Philip A.; Hallen, Stefan; Giordanetto, Fabrizio; Martin, Stephen R.; Carling, David; Gamblin, Steven J.

    2013-12-01

    AMP-activated protein kinase (AMPK) plays a major role in regulating cellular energy balance by sensing and responding to increases in AMP/ADP concentration relative to ATP. Binding of AMP causes allosteric activation of the enzyme and binding of either AMP or ADP promotes and maintains the phosphorylation of threonine 172 within the activation loop of the kinase. AMPK has attracted widespread interest as a potential therapeutic target for metabolic diseases including type 2 diabetes and, more recently, cancer. A number of direct AMPK activators have been reported as having beneficial effects in treating metabolic diseases, but there has been no structural basis for activator binding to AMPK. Here we present the crystal structure of human AMPK in complex with a small molecule activator that binds at a site between the kinase domain and the carbohydrate-binding module, stabilising the interaction between these two components. The nature of the activator-binding pocket suggests the involvement of an additional, as yet unidentified, metabolite in the physiological regulation of AMPK. Importantly, the structure offers new opportunities for the design of small molecule activators of AMPK for treatment of metabolic disorders.

  5. Interpretation of ES, CS, and IOS approximations within a translational--internal coupling scheme. IV. ES and IOS molecule--molecule cross sections

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Snider, R.F.; Parvatiyar, M.G.

    1981-05-15

    Properties of energy sudden and infinite order sudden translational--internal reduced S matrices are given for general molecule--molecule collisions. Formal similarities with the distorted wave Born approximation are discussed. Structural simplifications of energy dependent and kinetic cross sections associated with making the ES approximation are described. Conceptual difficulties associated with applying the ES and IOS approximations to kinetic processes dominated by energetically inelastic collisions are pointed out.

  6. Computational design of molecules for an all-quinone redox flow battery† †Electronic supplementary information (ESI) available: The list of computationally predicted candidate quinone molecules with interesting redox properties. See DOI: 10.1039/c4sc03030c Click here for additional data file.

    PubMed Central

    Er, Süleyman; Suh, Changwon; Marshak, Michael P.

    2015-01-01

    Inspired by the electron transfer properties of quinones in biological systems, we recently showed that quinones are also very promising electroactive materials for stationary energy storage applications. Due to the practically infinite chemical space of organic molecules, the discovery of additional quinones or other redox-active organic molecules for energy storage applications is an open field of inquiry. Here, we introduce a high-throughput computational screening approach that we applied to an accelerated study of a total of 1710 quinone (Q) and hydroquinone (QH2) (i.e., two-electron two-proton) redox couples. We identified the promising candidates for both the negative and positive sides of organic-based aqueous flow batteries, thus enabling an all-quinone battery. To further aid the development of additional interesting electroactive small molecules we also provide emerging quantitative structure-property relationships. PMID:29560173

  7. Structure-Property Relationships of Bismaleimides

    NASA Technical Reports Server (NTRS)

    Tenteris-Noebe, Anita D.

    1997-01-01

    The purpose of this research was to control and systematically vary the network topology of bismaleimides through cure temperature and chemistry (addition of various coreactants) and subsequently attempt to determine structure-mechanical property relationships. Characterization of the bismaleimide structures by dielectric, rheological, and thermal analyses, and density measurements was subsequently correlated with mechanical properties such as modulus, yield strength, fracture energy, and stress relaxation. The model material used in this investigation was 4,4'-BismaleiMidodIphenyl methane (BMI). BMI was coreacted with either 4,4'-Methylene Dianiline (MDA), o,o'-diallyl bisphenol A (DABA) from Ciba Geigy, or Diamino Diphenyl Sulfone (DDS). Three cure paths were employed: a low- temperature cure of 140 C where chain extension should predominate, a high-temperature cure of 220 C where both chain extension and crosslinking should occur simultaneously, and a low-temperature (140 C) cure followed immediately by a high-temperature (220 C) cure where the chain extension reaction or amine addition precedes BMI homopolymerization or crosslinking. Samples of cured and postcured PMR-15 were also tested to determine the effects of postcuring on the mechanical properties. The low-temperature cure condition of BMI/MDA exhibited the highest modulus values for a given mole fraction of BMI with the modulus decreasing with decreasing concentration of BMI. The higher elastic modulus is the result of steric hindrance by unreacted BMI molecules in the glassy state. The moduli values for the high- and low/high-temperature cure conditions of BMI/MDA decreased as the amount of diamine increased. All the moduli values mimic the yield strength and density trends. For the high-temperature cure condition, the room- temperature modulus remained constant with decreasing mole fraction of BMT for the BMI/DABA and BMI/DDS systems. Postcuring PMR-15 increases the modulus over that of the cured

  8. Glycomics: revealing the dynamic ecology and evolution of sugar molecules.

    PubMed

    Springer, Stevan A; Gagneux, Pascal

    2016-03-01

    Sugars are the most functionally and structurally diverse molecules in the biological world. Glycan structures range from tiny single monosaccharide units to giant chains thousands of units long. Some glycans are branched, their monosaccharides linked together in many different combinations and orientations. Some exist as solitary molecules; others are conjugated to proteins and lipids and alter their collective functional properties. In addition to structural and storage roles, glycan molecules participate in and actively regulate physiological and developmental processes. Glycans also mediate cellular interactions within and between individuals. Their roles in ecology and evolution are pivotal, but not well studied because glycan biochemistry requires different methods than standard molecular biology practice. The properties of glycans are in some ways convenient, and in others challenging. Glycans vary on organismal timescales, and in direct response to physiological and ecological conditions. Their mature structures are physical records of both genetic and environmental influences during maturation. We describe the scope of natural glycan variation and discuss how studying glycans will allow researchers to further integrate the fields of ecology and evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Looking beyond Lewis Structures: A General Chemistry Molecular Modeling Experiment Focusing on Physical Properties and Geometry

    ERIC Educational Resources Information Center

    Linenberger, Kimberly J.; Cole, Renee S.; Sarkar, Somnath

    2011-01-01

    We present a guided-inquiry experiment using Spartan Student Version, ready to be adapted and implemented into a general chemistry laboratory course. The experiment provides students an experience with Spartan Molecular Modeling software while discovering the relationships between the structure and properties of molecules. Topics discussed within…

  10. Structure and Properties of Polyurethanes. Part 1,

    DTIC Science & Technology

    1979-03-23

    solutions or from the investigations of the sorption of vapors by polymers, or from data in mechanical and relaxation properties. PROPERTIES OF DILUTE...well explained independent of a number of short rigid units in molecules by the theories, developed for linear networks. SORPTION PROPERTIES OP...of tue sorption of vapors of solvents by polymers and determination according to the law of Raoult of the effective (seeming) molar fraction of polymer

  11. DNA-Based Single-Molecule Electronics: From Concept to Function.

    PubMed

    Wang, Kun

    2018-01-17

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

  12. DNA-Based Single-Molecule Electronics: From Concept to Function

    PubMed Central

    2018-01-01

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

  13. Synthesis, growth, structural modeling and physio-chemical properties of a charge transfer molecule: Guanidinium tosylate

    NASA Astrophysics Data System (ADS)

    Era, Paavai; Jauhar, RO. MU.; Vinitha, G.; Murugakoothan, P.

    2018-05-01

    An organic nonlinear optical material, guanidinium tosylate was synthesized adopting slow evaporation method and the crystals were harvested from aqueous methanolic medium with dimensions 13 × 9 × 3 mm3. Constitution of crystalline material was confirmed by single crystal X-ray diffraction study. The title compound crystallizes in the monoclinic crystal system with space group P21/c. The UV-vis-NIR spectral study of the grown crystal exhibits high transparency of 80% in the entire visible region with lower cut-off wavelength at 282 nm. Optimized molecular geometry of the grown crystal was obtained using density functional theory (DFT) and the frontier energy gaps calculated from the DFT aids to understand the charge transfer taking place in the molecule. The dielectric properties were studied as a function of temperature and frequency to find the charge distribution within the crystal. The titular compound is thermally stable up to 230 °C assessed by thermogravimetric and differential thermal analysis. Anisotropy in the mechanical behavior was observed while measuring for individual planes. The laser induced surface damage threshold of the grown crystal was measured to be 0.344 GW/cm2 for 1064 nm Nd:YAG laser radiation. Z-scan technique confirms the third-order nonlinear optical property with the ascertained nonlinear refractive index (n2), nonlinear absorption coefficient (β) and third order nonlinear susceptibility (χ(3)). Optical limiting study divulges that the transmitted output power step-up linearly with the increase of the input power at lower power realms and saturates from the threshold 24.95 mW/cm2 and amplitude 0.23 mW/cm2.

  14. On the role of hydrogel structure and degradation in controlling the transport of cell-secreted matrix molecules for engineered cartilage

    PubMed Central

    Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J.; Vernerey, Franck J.

    2012-01-01

    Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one’s quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. PMID:23276516

  15. Structural properties of glucose-dimethylsulfoxide solutions probed by Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Paolantoni, Marco; Gallina, Maria Elena; Sassi, Paola; Morresi, Assunta

    2009-04-01

    Raman spectroscopy was employed to achieve a molecular level description of solvation properties in glucose-dimethylsulfoxide (DMSO) solutions. The analysis of Raman spectra confirms the importance of the dipole-dipole interaction in determining structural properties of pure DMSO; the overall intermolecular structure is maintained in the whole 20-75 °C temperature range investigated. The blueshift of the CH stretching modes observed at higher temperatures points out that CH3⋯O contacts contribute to the cohesive energy of the DMSO liquid system. The addition of glucose perturbs the intermolecular ordering of DMSO owing to the formation of stable solute-solvent hydrogen bonds. The average number of OH⋯OS contacts (3.2±0.3) and their corresponding energy (˜20 kJ/mol) were estimated. Besides, the concentration dependence of the CH stretching bands and the behavior of the noncoincidence effect on the SO band, suggest that the dipole-dipole and CH3⋯O interactions among DMSO molecules are disfavored within the glucose solvation layer. These findings contribute to improve our understanding about the microscopic origin of solvent properties of DMSO toward more complex biomolecular systems.

  16. Chemoinformatic Analysis of Combinatorial Libraries, Drugs, Natural Products and Molecular Libraries Small Molecule Repository

    PubMed Central

    Singh, Narender; Guha, Rajarshi; Giulianotti, Marc; Pinilla, Clemencia; Houghten, Richard; Medina-Franco, Jose L.

    2009-01-01

    A multiple criteria approach is presented, that is used to perform a comparative analysis of four recently developed combinatorial libraries to drugs, Molecular Libraries Small Molecule Repository (MLSMR) and natural products. The compound databases were assessed in terms of physicochemical properties, scaffolds and fingerprints. The approach enables the analysis of property space coverage, degree of overlap between collections, scaffold and structural diversity and overall structural novelty. The degree of overlap between combinatorial libraries and drugs was assessed using the R-NN curve methodology, which measures the density of chemical space around a query molecule embedded in the chemical space of a target collection. The combinatorial libraries studied in this work exhibit scaffolds that were not observed in the drug, MLSMR and natural products collections. The fingerprint-based comparisons indicate that these combinatorial libraries are structurally different to current drugs. The R-NN curve methodology revealed that a proportion of molecules in the combinatorial libraries are located within the property space of the drugs. However, the R-NN analysis also showed that there are a significant number of molecules in several combinatorial libraries that are located in sparse regions of the drug space. PMID:19301827

  17. The Use of Ultrashort Picosecond Laser Pulses to Generate Quantum Optical Properties of Single Molecules in Biophysics

    NASA Astrophysics Data System (ADS)

    Ly, Sonny

    Generation of quantum optical states from ultrashort laser-molecule interactions have led to fascinating discoveries in physics and chemistry. In recent years, these interactions have been extended to probe phenomena in single molecule biophysics. Photons emitted from a single fluorescent molecule contains important properties about how the molecule behave and function in that particular environment. Analysis of the second order coherence function through fluorescence correlation spectroscopy plays a pivotal role in quantum optics. At very short nanosecond timescales, the coherence function predicts photon antibunching, a purely quantum optical phenomena which states that a single molecule can only emit one photon at a time. Photon antibunching is the only direct proof of single molecule emission. From the nanosecond to microsecond timescale, the coherence function gives information about rotational diffusion coefficients, and at longer millisecond timescales, gives information regarding the translational diffusion coefficients. In addition, energy transfer between molecules from dipole-dipole interaction results in FRET, a highly sensitive method to probe conformational dynamics at nanometer distances. Here I apply the quantum optical techniques of photon antibunching, fluorescence correlation spectroscopy and FRET to probe how lipid nanodiscs form and function at the single molecule level. Lipid nanodiscs are particles that contain two apolipoprotein (apo) A-I circumventing a lipid bilayer in a belt conformation. From a technological point of view, nanodiscs mimics a patch of cell membrane that have recently been used to reconstitute a variety of membrane proteins including cytochrome P450 and bacteriorhodopsin. They are also potential drug transport vehicles due to its small and stable 10nm diameter size. Biologically, nanodiscs resemble to high degree, high density lipoproteins (HDL) in our body and provides a model platform to study lipid-protein interactions

  18. All-benzene carbon nanocages: size-selective synthesis, photophysical properties, and crystal structure.

    PubMed

    Matsui, Katsuma; Segawa, Yasutomo; Itami, Kenichiro

    2014-11-19

    The design and synthesis of a series of carbon nanocages consisting solely of benzene rings are described. Carbon nanocages are appealing molecules not only because they represent junction unit structures of branched carbon nanotubes, but also because of their potential utilities as unique optoelectronic π-conjugated materials and guest-encapsulating hosts. Three sizes of strained, conjugated [n.n.n]carbon nanocages (1, n = 4; 2, n = 5; 3, n = 6) were synthesized with perfect size-selectivity. Cyclohexane-containing units and 1,3,5-trisubstituted benzene-containing units were assembled to yield the minimally strained bicyclic precursors, which were successfully converted into the corresponding carbon nanocages via acid-mediated aromatization. X-ray crystallography of 1 confirmed the cage-shaped structure with an approximately spherical void inside the cage molecule. The present studies revealed the unique properties of carbon nanocages, including strain energies, size-dependent absorption and fluorescence, as well as unique size-dependency for the electronic features of 1-3.

  19. Structural properties of thiophenes investigated with simulations of a coarse-grained model

    NASA Astrophysics Data System (ADS)

    Luettmer-Strathmann, Jutta; Almutairi, Amani

    Thiophenes have important applications in organic electronics, energy conversion, and storage. The interfacial layer of an organic semiconductor in contact with a metal electrode has important effects on the performance of thin-film devices. However, the structure of this layer is not easy to model. In recent work, we developed a coarse-grained model for alpha-oligothiophenes in the bulk and near gold surfaces. We describe the molecules as linear chains of bonded, discotic particles with Gay-Berne potential interactions between non-bonded ellipsoids. In this work, we investigate structural properties of thiophenes with simulations of our coarse-grained model.

  20. Characterization of Structural and Configurational Properties of DNA by Atomic Force Microscopy.

    PubMed

    Meroni, Alice; Lazzaro, Federico; Muzi-Falconi, Marco; Podestà, Alessandro

    2018-01-01

    We describe a method to extract quantitative information on DNA structural and configurational properties from high-resolution topographic maps recorded by atomic force microscopy (AFM). DNA molecules are deposited on mica surfaces from an aqueous solution, carefully dehydrated, and imaged in air in Tapping Mode. Upon extraction of the spatial coordinates of the DNA backbones from AFM images, several parameters characterizing DNA structure and configuration can be calculated. Here, we explain how to obtain the distribution of contour lengths, end-to-end distances, and gyration radii. This modular protocol can be also used to characterize other statistical parameters from AFM topographies.

  1. Classification of ligand molecules in PDB with graph match-based structural superposition.

    PubMed

    Shionyu-Mitsuyama, Clara; Hijikata, Atsushi; Tsuji, Toshiyuki; Shirai, Tsuyoshi

    2016-12-01

    The fast heuristic graph match algorithm for small molecules, COMPLIG, was improved by adding a structural superposition process to verify the atom-atom matching. The modified method was used to classify the small molecule ligands in the Protein Data Bank (PDB) by their three-dimensional structures, and 16,660 types of ligands in the PDB were classified into 7561 clusters. In contrast, a classification by a previous method (without structure superposition) generated 3371 clusters from the same ligand set. The characteristic feature in the current classification system is the increased number of singleton clusters, which contained only one ligand molecule in a cluster. Inspections of the singletons in the current classification system but not in the previous one implied that the major factors for the isolation were differences in chirality, cyclic conformations, separation of substructures, and bond length. Comparisons between current and previous classification systems revealed that the superposition-based classification was effective in clustering functionally related ligands, such as drugs targeted to specific biological processes, owing to the strictness of the atom-atom matching.

  2. Correlating the vibrational spectra of structurally related molecules: A spectroscopic measure of similarity.

    PubMed

    Tao, Yunwen; Zou, Wenli; Cremer, Dieter; Kraka, Elfi

    2018-03-05

    Using catastrophe theory and the concept of a mutation path, an algorithm is developed that leads to the direct correlation of the normal vibrational modes of two structurally related molecules. The mutation path is defined by weighted incremental changes in mass and geometry of the molecules in question, which are successively applied to mutate a molecule into a structurally related molecule and thus continuously converting their normal vibrational spectra from one into the other. Correlation diagrams are generated that accurately relate the normal vibrational modes to each other by utilizing mode-mode overlap criteria and resolving allowed and avoided crossings of vibrational eigenstates. The limitations of normal mode correlation, however, foster the correlation of local vibrational modes, which offer a novel vibrational measure of similarity. It will be shown how this will open new avenues for chemical studies. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  3. Modern Possibilities for Calculating Some Properties of Molecules and Crystals from the Experimental Electron Density

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stash, A.I.; Tsirelson, V.G.

    2005-03-01

    Methods for calculating some properties of molecules and crystals from the electron density reconstructed from a precise X-ray diffraction experiment using the multipole model are considered. These properties include, on the one hand, the characteristics of the electron density and the inner-crystal electrostatic field and, on the other hand, the local electronic energies (kinetic, potential, total), the exchange energy density, the electron-pair localization function, the localized-orbital locator, the effective crystal potential, and others. It is shown that the integration of these characteristics over pseudoatomic volumes bounded by the surfaces of the zero flux of the electron density gradient makes itmore » possible to characterize directly from an experiment the properties of molecules and crystals in terms of the atomic contributions. The computer program WinXPRO2004, realizing these possibilities, is briefly described.« less

  4. Structural properties of prokaryotic promoter regions correlate with functional features.

    PubMed

    Meysman, Pieter; Collado-Vides, Julio; Morett, Enrique; Viola, Roberto; Engelen, Kristof; Laukens, Kris

    2014-01-01

    The structural properties of the DNA molecule are known to play a critical role in transcription. In this paper, the structural profiles of promoter regions were studied within the context of their diversity and their function for eleven prokaryotic species; Escherichia coli, Klebsiella pneumoniae, Salmonella Typhimurium, Pseudomonas auroginosa, Geobacter sulfurreducens Helicobacter pylori, Chlamydophila pneumoniae, Synechocystis sp., Synechoccocus elongates, Bacillus anthracis, and the archaea Sulfolobus solfataricus. The main anchor point for these promoter regions were transcription start sites identified through high-throughput experiments or collected within large curated databases. Prokaryotic promoter regions were found to be less stable and less flexible than the genomic mean across all studied species. However, direct comparison between species revealed differences in their structural profiles that can not solely be explained by the difference in genomic GC content. In addition, comparison with functional data revealed that there are patterns in the promoter structural profiles that can be linked to specific functional loci, such as sigma factor regulation or transcription factor binding. Interestingly, a novel structural element clearly visible near the transcription start site was found in genes associated with essential cellular functions and growth in several species. Our analyses reveals the great diversity in promoter structural profiles both between and within prokaryotic species. We observed relationships between structural diversity and functional features that are interesting prospects for further research to yet uncharacterized functional loci defined by DNA structural properties.

  5. Structural Ordering of Semiconducting Polymers and Small-Molecules for Organic Electronics

    NASA Astrophysics Data System (ADS)

    O'Hara, Kathryn Allison

    Semiconducting polymers and small-molecules can be readily incorporated into electronic devices such as organic photovoltaics (OPVs), thermoelectrics (OTEs), organic light emitting diodes (OLEDs), and organic thin film transistors (OTFTs). Organic materials offer the advantage of being processable from solution to form flexible and lightweight thin films. The molecular design, processing, and resulting thin film morphology of semiconducting polymers drastically affect the optical and electronic properties. Charge transport within films of semiconducting polymers relies on the nanoscale organization to ensure electronic coupling through overlap of molecular orbitals and to provide continuous transport pathways. While the angstrom-scale packing details can be studied using X-ray scattering methods, an understanding of the mesoscale, or the length scale over which smaller ordered regions connect, is much harder to achieve. Grain boundaries play an important role in semiconducting polymer thin films where the average grain size is much smaller than the total distance which charges must traverse in order to reach the electrodes in a device. The majority of semiconducting polymers adopt a lamellar packing structure in which the conjugated backbones align in parallel pi-stacks separated by the alkyl side-chains. Only two directions of transport are possible--along the conjugated backbone and in the pi-stacking direction. Currently, the discussion of transport between crystallites is centered around the idea of tie-chains, or "bridging" polymer chains connecting two ordered regions. However, as molecular structures become increasingly complex with the development of new donor-acceptor copolymers, additional forms of connectivity between ordered domains should be considered. High resolution transmission electron microscopy (HRTEM) is a powerful tool for directly imaging the crystalline grain boundaries in polymer and small-molecule thin films. Recently, structures

  6. Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape.

    PubMed

    Ferreon, Allan Chris M; Moosa, Mahdi Muhammad; Gambin, Yann; Deniz, Ashok A

    2012-10-30

    Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster resonance energy transfer to test the counteraction hypothesis of counterbalancing effects between the protecting osmolyte trimethylamine-N-oxide (TMAO) and denaturing osmolyte urea for the case of α-synuclein, a Parkinson's disease-linked protein whose monomer exhibits significant disorder. The single-molecule experiments, which avoid complications from protein aggregation, do not exhibit clear solvent-induced cooperative protein transitions for these osmolytes, unlike results from previous studies on globular proteins. Our data demonstrate the ability of TMAO and urea to shift α-synuclein structures towards either more compact or expanded average dimensions. Strikingly, the experiments directly reveal that a 21 [urea][TMAO] ratio has a net neutral effect on the protein's dimensions, a result that holds regardless of the absolute osmolyte concentrations. Our findings shed light on a surprisingly simple aspect of the interplay between urea and TMAO on α-synuclein in the context of intrinsically disordered proteins, with potential implications for the biological roles of such chemical chaperones. The results also highlight the strengths of single-molecule experiments in directly probing the chemical physics of protein structure and disorder in more chemically complex environments.

  7. Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape

    PubMed Central

    Ferreon, Allan Chris M.; Moosa, Mahdi Muhammad; Deniz, Ashok A.

    2012-01-01

    Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster resonance energy transfer to test the counteraction hypothesis of counterbalancing effects between the protecting osmolyte trimethylamine-N-oxide (TMAO) and denaturing osmolyte urea for the case of α-synuclein, a Parkinson’s disease-linked protein whose monomer exhibits significant disorder. The single-molecule experiments, which avoid complications from protein aggregation, do not exhibit clear solvent-induced cooperative protein transitions for these osmolytes, unlike results from previous studies on globular proteins. Our data demonstrate the ability of TMAO and urea to shift α-synuclein structures towards either more compact or expanded average dimensions. Strikingly, the experiments directly reveal that a 2∶1 [urea]∶[TMAO] ratio has a net neutral effect on the protein’s dimensions, a result that holds regardless of the absolute osmolyte concentrations. Our findings shed light on a surprisingly simple aspect of the interplay between urea and TMAO on α-synuclein in the context of intrinsically disordered proteins, with potential implications for the biological roles of such chemical chaperones. The results also highlight the strengths of single-molecule experiments in directly probing the chemical physics of protein structure and disorder in more chemically complex environments. PMID:22826265

  8. DFT calculations on spectroscopic and structural properties of a NLO chromophore

    NASA Astrophysics Data System (ADS)

    Altürk, Sümeyye; Avci, Davut; Tamer, Ömer; Atalay, Yusuf

    2016-03-01

    The molecular geometry optimization, vibrational frequencies and gauge including atomic orbital (GIAO) 1H and 13C NMR chemical shift values of 2-(1'-(4'''-Methoxyphenyl)-5'-(thien-2″-yl)pyrrol-2'-yl)-1,3-benzothiazole as potential nonlinear optical (NLO) material were calculated using density functional theory (DFT) HSEh1PBE method with 6-311G(d,p) basis set. The best of our knowledge, this study have not been reported to date. Additionally, a detailed vibrational study was performed on the basis of potential energy distribution (PED) using VEDA program. It is noteworthy that NMR chemical shifts are quite useful for understanding the relationship between the molecular structure and electronic properties of molecules. The computed IR and NMR spectra were used to determine the types of the experimental bands observed. Predicted values of structural and spectroscopic parameters of the chromophore were compared with each other so as to display the effects of the different substituents on the spectroscopic and structural properties. Obtained data showed that there is an agreement between the predicted and experimental data.

  9. Phase Structure of Strong-Field Tunneling Wave Packets from Molecules.

    PubMed

    Liu, Ming-Ming; Li, Min; Wu, Chengyin; Gong, Qihuang; Staudte, André; Liu, Yunquan

    2016-04-22

    We study the phase structure of the tunneling wave packets from strong-field ionization of molecules and present a molecular quantum-trajectory Monte Carlo model to describe the laser-driven dynamics of photoelectron momentum distributions of molecules. Using our model, we reproduce and explain the alignment-dependent molecular frame photoelectron spectra of strong-field tunneling ionization of N_{2} reported by M. Meckel et al. [Nat. Phys. 10, 594 (2014)]. In addition to modeling the low-energy photoelectron angular distributions quantitatively, we extract the phase structure of strong-field molecular tunneling wave packets, shedding light on its physical origin. The initial phase of the tunneling wave packets at the tunnel exit depends on both the initial transverse momentum distribution and the molecular internuclear distance. We further show that the ionizing molecular orbital has a critical effect on the initial phase of the tunneling wave packets. The phase structure of the photoelectron wave packet is a key ingredient for modeling strong-field molecular photoelectron holography, high-harmonic generation, and molecular orbital imaging.

  10. Electronic structure and physicochemical properties of selected penicillins

    NASA Astrophysics Data System (ADS)

    Soriano-Correa, Catalina; Ruiz, Juan F. Sánchez; Raya, A.; Esquivel, Rodolfo O.

    Traditionally, penicillins have been used as antibacterial agents due to their characteristics and widespread applications with few collateral effects, which have motivated several theoretical and experimental studies. Despite the latter, their mechanism of biological action has not been completely elucidated. We present a theoretical study at the Hartree-Fock and density functional theory (DFT) levels of theory of a selected group of penicillins such as the penicillin-G, amoxicillin, ampicillin, dicloxacillin, and carbenicillin molecules, to systematically determine the electron structure of full ?-lactam antibiotics. Our results allow us to analyze the electronic properties of the pharmacophore group, the aminoacyl side-chain, and the influence of the substituents (R and X) attached to the aminoacyl side-chain at 6? (in contrast with previous studies focused at the 3? substituents), and to corroborate the results of previous studies performed at the semiempirical level, solely on the ?-lactam ring of penicillins. Besides, several density descriptors are determined with the purpose of analyzing their link to the antibacterial activity of these penicillin compounds. Our results for the atomic charges (fitted to the electrostatic potential), the bond orders, and several global reactivity descriptors, such as the dipole moments, ionization potential, hardness, and the electrophilicity index, led us to characterize: the active sites, the effect of the electron-attracting substituent properties and their physicochemical features, which altogether, might be important to understand the biological activity of these type of molecules.

  11. Challenges for single molecule electronic devices with nanographene and organic molecules. Do single molecules offer potential as elements of electronic devices in the next generation?

    NASA Astrophysics Data System (ADS)

    Enoki, Toshiaki; Kiguchi, Manabu

    2018-03-01

    Interest in utilizing organic molecules to fabricate electronic materials has existed ever since organic (molecular) semiconductors were first discovered in the 1950s. Since then, scientists have devoted serious effort to the creation of various molecule-based electronic systems, such as molecular metals and molecular superconductors. Single-molecule electronics and the associated basic science have emerged over the past two decades and provided hope for the development of highly integrated molecule-based electronic devices in the future (after the Si-based technology era has ended). Here, nanographenes (nano-sized graphene) with atomically precise structures are among the most promising molecules that can be utilized for electronic/spintronic devices. To manipulate single small molecules for an electronic device, a single molecular junction has been developed. It is a powerful tool that allows even small molecules to be utilized. External electric, magnetic, chemical, and mechanical perturbations can change the physical and chemical properties of molecules in a way that is different from bulk materials. Therefore, the various functionalities of molecules, along with changes induced by external perturbations, allows us to create electronic devices that we cannot create using current top-down Si-based technology. Future challenges that involve the incorporation of condensed matter physics, quantum chemistry calculations, organic synthetic chemistry, and electronic device engineering are expected to open a new era in single-molecule device electronic technology.

  12. Is the regulation of the electronic properties of organic molecules by polynuclear superhalogens more effective than that by mononuclear superhalogens? A high-level ab initio case study.

    PubMed

    Li, Miao-Miao; Li, Jin-Feng; Bai, Hongcun; Sun, Yin-Yin; Li, Jian-Li; Yin, Bing

    2015-08-21

    The regulation of the electronic properties of organic molecules induced by polynuclear superhalogens is theoretically explored here for sixteen composite structures. It is clearly indicated by the higher vertical electron detachment energy (VDE) that polynuclear superhalogens are more effective in regulating the electronic properties than mononuclear structures. However, this enhanced regulation is not only determined by superhalogens themselves but also related to the distribution of the extra electron of the final composites. The composites, in which the extra electron is mainly aggregated into the superhalogen moiety, will possess higher VDE values, as reported in the case of C1', 7.12 eV at the CCSD(T) level. This is probably due to the fact that, compared with organic molecules, superhalogens possess stronger attraction towards the extra electron and thus should lead to lower energies of the extra electrons and to higher VDE values eventually. Compared with CCSD(T), the Outer Valence Green's Function (OVGF) method fails completely for composite structures containing Cl atoms, while MP2 results are generally consistent in terms of the relative order of VDEs. Actually if the extra electron distribution of the systems could be approximated by the HOMO, the results at the OVGF level will be consistent with the CCSD(T) results. Conversely, the difference in VDEs between OVGF and CCSD(T) is significantly large. Besides superhalogen properties, the structures, relative stabilities and thermodynamic stabilities with respect to various fragmentation channels were also investigated for all the composite structures.

  13. IPET and FETR: Experimental Approach for Studying Molecular Structure Dynamics by Cryo-Electron Tomography of a Single-Molecule Structure

    PubMed Central

    Zhang, Lei; Ren, Gang

    2012-01-01

    The dynamic personalities and structural heterogeneity of proteins are essential for proper functioning. Structural determination of dynamic/heterogeneous proteins is limited by conventional approaches of X-ray and electron microscopy (EM) of single-particle reconstruction that require an average from thousands to millions different molecules. Cryo-electron tomography (cryoET) is an approach to determine three-dimensional (3D) reconstruction of a single and unique biological object such as bacteria and cells, by imaging the object from a series of tilting angles. However, cconventional reconstruction methods use large-size whole-micrographs that are limited by reconstruction resolution (lower than 20 Å), especially for small and low-symmetric molecule (<400 kDa). In this study, we demonstrated the adverse effects from image distortion and the measuring tilt-errors (including tilt-axis and tilt-angle errors) both play a major role in limiting the reconstruction resolution. Therefore, we developed a “focused electron tomography reconstruction” (FETR) algorithm to improve the resolution by decreasing the reconstructing image size so that it contains only a single-instance protein. FETR can tolerate certain levels of image-distortion and measuring tilt-errors, and can also precisely determine the translational parameters via an iterative refinement process that contains a series of automatically generated dynamic filters and masks. To describe this method, a set of simulated cryoET images was employed; to validate this approach, the real experimental images from negative-staining and cryoET were used. Since this approach can obtain the structure of a single-instance molecule/particle, we named it individual-particle electron tomography (IPET) as a new robust strategy/approach that does not require a pre-given initial model, class averaging of multiple molecules or an extended ordered lattice, but can tolerate small tilt-errors for high-resolution single

  14. Oligomer Molecules for Efficient Organic Photovoltaics.

    PubMed

    Lin, Yuze; Zhan, Xiaowei

    2016-02-16

    Solar cells, a renewable, clean energy technology that efficiently converts sunlight into electricity, are a promising long-term solution for energy and environmental problems caused by a mass of production and the use of fossil fuels. Solution-processed organic solar cells (OSCs) have attracted much attention in the past few years because of several advantages, including easy fabrication, low cost, lightweight, and flexibility. Now, OSCs exhibit power conversion efficiencies (PCEs) of over 10%. In the early stage of OSCs, vapor-deposited organic dye materials were first used in bilayer heterojunction devices in the 1980s, and then, solution-processed polymers were introduced in bulk heterojunction (BHJ) devices. Relative to polymers, vapor-deposited small molecules offer potential advantages, such as a defined molecular structure, definite molecular weight, easy purification, mass-scale production, and good batch-to-batch reproducibility. However, the limited solubility and high crystallinity of vapor-deposited small molecules are unfavorable for use in solution-processed BHJ OSCs. Conversely, polymers have good solution-processing and film-forming properties and are easily processed into flexible devices, whereas their polydispersity of molecular weights and difficulty in purification results in batch to batch variation, which may hamper performance reproducibility and commercialization. Oligomer molecules (OMs) are monodisperse big molecules with intermediate molecular weights (generally in the thousands), and their sizes are between those of small molecules (generally with molecular weights <1000) and polymers (generally with molecular weights >10000). OMs not only overcome shortcomings of both vapor-deposited small molecules and solution-processed polymers, but also combine their advantages, such as defined molecular structure, definite molecular weight, easy purification, mass-scale production, good batch-to-batch reproducibility, good solution processability

  15. The use of small-molecule structures to complement protein–ligand crystal structures in drug discovery

    PubMed Central

    Cole, Jason C.

    2017-01-01

    Many ligand-discovery stories tell of the use of structures of protein–ligand complexes, but the contribution of structural chemistry is such a core part of finding and improving ligands that it is often overlooked. More than 800 000 crystal structures are available to the community through the Cambridge Structural Database (CSD). Individually, these structures can be of tremendous value and the collection of crystal structures is even more helpful. This article provides examples of how small-molecule crystal structures have been used to complement those of protein–ligand complexes to address challenges ranging from affinity, selectivity and bioavailability though to solubility. PMID:28291759

  16. SYVA: A program to analyze symmetry of molecules based on vector algebra

    NASA Astrophysics Data System (ADS)

    Gyevi-Nagy, László; Tasi, Gyula

    2017-06-01

    Symmetry is a useful concept in physics and chemistry. It can be used to find out some simple properties of a molecule or simplify complex calculations. In this paper a simple vector algebraic method is described to determine all symmetry elements of an arbitrary molecule. To carry out the symmetry analysis, a program has been written, which is also capable of generating the framework group of the molecule, revealing the symmetry properties of normal modes of vibration and symmetrizing the structure. To demonstrate the capabilities of the program, it is compared to other common widely used stand-alone symmetry analyzer (SYMMOL, Symmetrizer) and molecular modeling (NWChem, ORCA, MRCC) software. SYVA can generate input files for molecular modeling programs, e.g. Gaussian, using precisely symmetrized molecular structures. Possible applications are also demonstrated by integrating SYVA with the GAMESS and MRCC software.

  17. [Fine stereo structure for natural organic molecules, a preliminary study. II. Melting point influenced by structure factors].

    PubMed

    Lu, Y; Zheng, Q; Lu, D; Ma, P; Chen, Y

    1995-06-01

    Crystal structures of two compounds from Tripterygium wilfordii Hook f. have been determined by X-ray diffraction method. Structure factors influencing melting point of solid state have been analysed. Crystal class (or space group), recrystallization solvent, force between molecules and fine changes of molecular structures will all cause melting point changes of crystal substance.

  18. Single-molecule force-conductance spectroscopy of hydrogen-bonded complexes

    NASA Astrophysics Data System (ADS)

    Pirrotta, Alessandro; De Vico, Luca; Solomon, Gemma C.; Franco, Ignacio

    2017-03-01

    The emerging ability to study physical properties at the single-molecule limit highlights the disparity between what is observable in an ensemble of molecules and the heterogeneous contributions of its constituent parts. A particularly convenient platform for single-molecule studies are molecular junctions where forces and voltages can be applied to individual molecules, giving access to a series of electromechanical observables that can form the basis of highly discriminating multidimensional single-molecule spectroscopies. Here, we computationally examine the ability of force and conductance to inform about molecular recognition events at the single-molecule limit. For this, we consider the force-conductance characteristics of a prototypical class of hydrogen bonded bimolecular complexes sandwiched between gold electrodes. The complexes consist of derivatives of a barbituric acid and a Hamilton receptor that can form up to six simultaneous hydrogen bonds. The simulations combine classical molecular dynamics of the mechanical deformation of the junction with non-equilibrium Green's function computations of the electronic transport. As shown, in these complexes hydrogen bonds mediate transport either by directly participating as a possible transport pathway or by stabilizing molecular conformations with enhanced conductance properties. Further, we observe that force-conductance correlations can be very sensitive to small changes in the chemical structure of the complexes and provide detailed information about the behavior of single molecules that cannot be gleaned from either measurement alone. In fact, there are regions during the elongation that are only mechanically active, others that are only conductance active, and regions where both force and conductance changes as the complex is mechanically manipulated. The implication is that force and conductance provide complementary information about the evolution of molecules in junctions that can be used to

  19. Side-chain Engineering of Benzo[1,2-b:4,5-b']dithiophene Core-structured Small Molecules for High-Performance Organic Solar Cells.

    PubMed

    Yin, Xinxing; An, Qiaoshi; Yu, Jiangsheng; Guo, Fengning; Geng, Yongliang; Bian, Linyi; Xu, Zhongsheng; Zhou, Baojing; Xie, Linghai; Zhang, Fujun; Tang, Weihua

    2016-05-03

    Three novel small molecules have been developed by side-chain engineering on benzo[1,2-b:4,5-b']dithiophene (BDT) core. The typical acceptor-donor-acceptor (A-D-A) structure is adopted with 4,8-functionalized BDT moieties as core, dioctylterthiophene as π bridge and 3-ethylrhodanine as electron-withdrawing end group. Side-chain engineering on BDT core exhibits small but measurable effect on the optoelectronic properties of small molecules. Theoretical simulation and X-ray diffraction study reveal the subtle tuning of interchain distance between conjugated backbones has large effect on the charge transport and thus the photovoltaic performance of these molecules. Bulk-heterojunction solar cells fabricated with a configuration of ITO/PEDOT:PSS/SM:PC71BM/PFN/Al exhibit a highest power conversion efficiency (PCE) of 6.99% after solvent vapor annealing.

  20. From molecule to solid: The prediction of organic crystal structures

    NASA Astrophysics Data System (ADS)

    Dzyabchenko, A. V.

    2008-10-01

    A method for predicting the structure of a molecular crystal based on the systematic search for a global potential energy minimum is considered. The method takes into account unequal occurrences of the structural classes of organic crystals and symmetry of the multidimensional configuration space. The programs of global minimization PMC, comparison of crystal structures CRYCOM, and approximation to the distributions of the electrostatic potentials of molecules FitMEP are presented as tools for numerically solving the problem. Examples of predicted structures substantiated experimentally and the experience of author’s participation in international tests of crystal structure prediction organized by the Cambridge Crystallographic Data Center (Cambridge, UK) are considered.

  1. Relaxation of structural parameters and potential coefficients of nonrigid molecules. General symmetry properties and application to ab initio study of 1,2-difluoroethane

    NASA Astrophysics Data System (ADS)

    Ha, T.-K.; Günthard, H. H.

    1989-07-01

    Structural parameters like bond length, bond angles, etc. and harmonic and anharmonic potential coefficients of molecules with internal rotation, inversion or puckering modes are generally assumed to vary with the large amplitude internal coordinates in a concerted manner (relaxation). Taking the coordinate vectors of the nuclear configuration of semirigid molecules with relaxation (SRMRs) as functions of relaxing structural parameters and finite amplitude internal coordinate, the isometric group of SRMRs is discussed and the irreducible representations of the latter are shown to classify into engendered and nonengendered ones. On this basis a concept of equivalent sets of nuclei SRMRs is introduced and an analytical expression is derived which defines the most general functional form of relaxation increments of all common types of structural parameters compatible with isometric symmetry. This formula is shown to be a close analog of an analytical expression defining the transformations induced by the isometric group of infinitesimal internal coordinates associated with typical structural parameters. Furthermore analogous formulae are given for the most general form of the relaxation of harmonic potential coefficients as a function of finite internal coordinates. The general relations are illustrated by ab initio calculations for 1,2-difluoroethane at the MP4/DZP//HF/4-31G* level for twelve values of the dihedral angle including complete structure optimization. The potential to internal rotation is found to be in essential agreement with experimentally derived data. For a complete set of ab initio structural parameters the associated relaxation increments are represented as Fourier series, which are shown to confirm the form predicted by the general formula and the isometric group of 1,2-difluoroethane. Depending on type of the structural parameters (bond length, bond angles, etc.), the associated relaxation increments appear to follow some simple rules. Similarly

  2. Investigating the Crystallization Propensity of Structurally Similar Organic Molecules From Amorphous State

    NASA Astrophysics Data System (ADS)

    Kalra, Arjun

    Combinatorial chemistry and high-throughput screening approaches utilized during drug discovery have resulted in many potent pharmacologically active molecules with low aqueous solubility and consequently poor bioavailability. Enabling technologies, such as amorphous solid dispersions (ASD's), can obviate these challenges and provide an efficient route to formulate the drug as an oral solid dosage form. However, high-energy amorphous materials have an inherent tendency to crystallize and in doing so can negate the apparent solubility advantage achieved by using such formulations. Crystallization can occur during (1) cooling the drug molecule from the melt state (such as during hot melt extrusion); (2) during storage of an amorphous formulation; (3) during pharmaceutical processing unit operations such as compression, granulation etc. Current knowledge with regards to the relationship between crystallization propensity of an active pharmaceutical ingredient (API) from the amorphous state (supercooled liquid and glass) and its thermodynamic, kinetic and molecular properties is limited. Furthermore, examining the mechanistic steps involved in crystallization of organic molecules under conditions of supercooling provides an opportunity to examine supramolecular aggregation events occurring during early stages of crystallization. Studying crystallization mechanism from amorphous state is important for pharmaceutical formulation development because a molecular-level understanding of the crystallization process would provide clues regarding the intermolecular interactions at the early stages of nucleation and help in rational selection of polymeric excipients to hinder such events. The primary goal of this research is to develop an understanding of phase transition from amorphous pharmaceuticals, specifically focusing on the role of thermodynamic, kinetic and molecular properties of a series of structurally similar compounds. It is hypothesized that the there exists a

  3. Polarization properties of below-threshold harmonics from aligned molecules H2+ in linearly polarized laser fields.

    PubMed

    Dong, Fulong; Tian, Yiqun; Yu, Shujuan; Wang, Shang; Yang, Shiping; Chen, Yanjun

    2015-07-13

    We investigate the polarization properties of below-threshold harmonics from aligned molecules in linearly polarized laser fields numerically and analytically. We focus on lower-order harmonics (LOHs). Our simulations show that the ellipticity of below-threshold LOHs depends strongly on the orientation angle and differs significantly for different harmonic orders. Our analysis reveals that this LOH ellipticity is closely associated with resonance effects and the axis symmetry of the molecule. These results shed light on the complex generation mechanism of below-threshold harmonics from aligned molecules.

  4. On the role of hydrogel structure and degradation in controlling the transport of cell-secreted matrix molecules for engineered cartilage.

    PubMed

    Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J; Vernerey, Franck J

    2013-03-01

    Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one's quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Two-photon absorption in conjugated energetic molecule

    DOE PAGES

    Bjorgaard, Josiah August; Sifain, Andrew; Nelson, Tammie Renee; ...

    2016-06-03

    Time-dependent density functional theory (TD-DFT) is used to investigate the relationship between molecular structure and one- and two-photon absorption (OPA and TPA, respectively) properties in novel and recently synthesized conjugated energetic molecules (CEMs). The molecular structure of CEMs can be strategically altered to influence the heat of formation and oxygen balance, two factors that can contribute to the sensitivity and strength of an explosive material. OPA and TPA are sensitive to changes in molecular structure as well, influencing optical range of excitation. We find calculated vertical excitation energies in good agreement with experiment for most molecules. Peak TPA intensities aremore » significant and on the order of 102 GM. Natural transition orbitals for essential electronic states defining TPA peaks of relatively large intensity to examine the character of relevant transitions. Minor modification of molecular substituents, such as additional oxygen and other functional groups, produces significant changes in electronic structure, OPA, TPA, and improves the oxygen balance. Results show that select molecules are apt to nonlinear absorption, opening the possibility for controlled, direct optical initiation of CEMs through photochemical pathways.« less

  6. Physics of Molecules

    NASA Astrophysics Data System (ADS)

    Williams, D.; Murdin, P.

    2000-11-01

    Many varieties of molecule have been detected in the Milky Way and in other galaxies. The processes by which these molecules are formed and destroyed are now broadly understood (see INTERSTELLAR CHEMISTRY). These molecules are important components of galaxies in two ways. Firstly, radiation emitted by molecules enables us to trace the presence of diffuse gas, to infer its physical properties and ...

  7. Anti-trypanosomal activities and structural chemical properties of selected compound classes.

    PubMed

    Ponte-Sucre, Alicia; Bruhn, Heike; Schirmeister, Tanja; Cecil, Alexander; Albert, Christian R; Buechold, Christian; Tischer, Maximilian; Schlesinger, Susanne; Goebel, Tim; Fuß, Antje; Mathein, Daniela; Merget, Benjamin; Sotriffer, Christoph A; Stich, August; Krohne, Georg; Engstler, Markus; Bringmann, Gerhard; Holzgrabe, Ulrike

    2015-02-01

    Potent compounds do not necessarily make the best drugs in the market. Consequently, with the aim to describe tools that may be fundamental for refining the screening of candidates for animal and preclinical studies and further development, molecules of different structural classes synthesized within the frame of a broad screening platform were evaluated for their trypanocidal activities, cytotoxicities against murine macrophages J774.1 and selectivity indices, as well as for their ligand efficiencies and structural chemical properties. To advance into their modes of action, we also describe the morphological and ultrastructural changes exerted by selected members of each compound class on the parasite Trypanosoma brucei. Our data suggest that the potential organelles targeted are either the flagellar pocket (compound 77, N-Arylpyridinium salt; 15, amino acid derivative with piperazine moieties), the endoplasmic reticulum membrane systems (37, bisquaternary bisnaphthalimide; 77, N-Arylpyridinium salt; 68, piperidine derivative), or mitochondria and kinetoplasts (88, N-Arylpyridinium salt; 68, piperidine derivative). Amino acid derivatives with fumaric acid and piperazine moieties (4, 15) weakly inhibiting cysteine proteases seem to preferentially target acidic compartments. Our results suggest that ligand efficiency indices may be helpful to learn about the relationship between potency and chemical characteristics of the compounds. Interestingly, the correlations found between the physico-chemical parameters of the selected compounds and those of commercial molecules that target specific organelles indicate that our rationale might be helpful to drive compound design toward high activities and acceptable pharmacokinetic properties for all compound families.

  8. Many-Body Descriptors for Predicting Molecular Properties with Machine Learning: Analysis of Pairwise and Three-Body Interactions in Molecules.

    PubMed

    Pronobis, Wiktor; Tkatchenko, Alexandre; Müller, Klaus-Robert

    2018-06-12

    Machine learning (ML) based prediction of molecular properties across chemical compound space is an important and alternative approach to efficiently estimate the solutions of highly complex many-electron problems in chemistry and physics. Statistical methods represent molecules as descriptors that should encode molecular symmetries and interactions between atoms. Many such descriptors have been proposed; all of them have advantages and limitations. Here, we propose a set of general two-body and three-body interaction descriptors which are invariant to translation, rotation, and atomic indexing. By adapting the successfully used kernel ridge regression methods of machine learning, we evaluate our descriptors on predicting several properties of small organic molecules calculated using density-functional theory. We use two data sets. The GDB-7 set contains 6868 molecules with up to 7 heavy atoms of type CNO. The GDB-9 set is composed of 131722 molecules with up to 9 heavy atoms containing CNO. When trained on 5000 random molecules, our best model achieves an accuracy of 0.8 kcal/mol (on the remaining 1868 molecules of GDB-7) and 1.5 kcal/mol (on the remaining 126722 molecules of GDB-9) respectively. Applying a linear regression model on our novel many-body descriptors performs almost equal to a nonlinear kernelized model. Linear models are readily interpretable: a feature importance ranking measure helps to obtain qualitative and quantitative insights on the importance of two- and three-body molecular interactions for predicting molecular properties computed with quantum-mechanical methods.

  9. PHYSICOCHEMICAL PROPERTY CALCULATIONS

    EPA Science Inventory

    Computer models have been developed to estimate a wide range of physical-chemical properties from molecular structure. The SPARC modeling system approaches calculations as site specific reactions (pKa, hydrolysis, hydration) and `whole molecule' properties (vapor pressure, boilin...

  10. Electronic structure of Fe- vs. Ru-based dye molecules

    NASA Astrophysics Data System (ADS)

    Johnson, Phillip S.; Cook, Peter L.; Zegkinoglou, Ioannis; García-Lastra, J. M.; Rubio, Angel; Ruther, Rose E.; Hamers, Robert J.; Himpsel, F. J.

    2013-01-01

    In order to explore whether Ru can be replaced by inexpensive Fe in dye molecules for solar cells, the differences in the electronic structure of Fe- and Ru-based dyes are investigated by X-ray absorption spectroscopy and first-principles calculations. Molecules with the metal in a sixfold, octahedral N cage, such as tris(bipyridines) and tris(phenanthrolines), exhibit a systematic downward shift of the N 1s-to-π* transition when Ru is replaced by Fe. This shift is explained by an extra transfer of negative charge from the metal to the N ligands in the case of Fe, which reduces the binding energy of the N 1s core level. The C 1s-to-π* transitions show the opposite trend, with an increase in the transition energy when replacing Ru by Fe. Molecules with the metal in a fourfold, planar N cage (porphyrins) exhibit a more complex behavior due to a subtle competition between the crystal field, axial ligands, and the 2+ vs. 3+ oxidation states.

  11. Adsorption of methanol molecule on graphene: Experimental results and first-principles calculations

    NASA Astrophysics Data System (ADS)

    Zhao, X. W.; Tian, Y. L.; Yue, W. W.; Chen, M. N.; Hu, G. C.; Ren, J. F.; Yuan, X. B.

    2018-04-01

    Adsorption properties of methanol molecule on graphene surface are studied both theoretically and experimentally. The adsorption geometrical structures, adsorption energies, band structures, density of states and the effective masses are obtained by means of first-principles calculations. It is found that the electronic characteristics and conductivity of graphene are sensitive to the methanol molecule adsorption. After adsorption of methanol molecule, bandgap appears. With the increasing of the adsorption distance, the bandgap, adsorption energy and effective mass of the adsorption system decreased, hence the resistivity of the system decreases gradually, these results are consistent with the experimental results. All these calculations and experiments indicate that the graphene-based sensors have a wide range of applications in detecting particular molecules.

  12. Niclosamide methanol solvate and niclosamide hydrate: structure, solvent inclusion mode and implications for properties.

    PubMed

    Harriss, Bethany I; Wilson, Claire; Radosavljevic Evans, Ivana

    2014-08-01

    Structural studies have been carried out of two solid forms of niclosamide [5-chloro-N-(2-chloro-4-nitrophenyl)-2-hydroxybenzamide, NCL], a widely used anthelmintic drug, namely niclosamide methanol monosolvate, C13H8Cl2N2O4·CH3OH or NCL·MeOH, and niclosamide monohydrate, denoted HA. The structure of the methanol solvate obtained from single-crystal X-ray diffraction is reported for the first time, elucidating the key host-guest hydrogen-bonding interactions which lead to solvate formation. The essentially planar NCL host molecules interact via π-stacking and pack in a herringbone-type arrangement, giving rise to channels along the crystallographic a axis in which the methanol guest molecules are located. The methanol and NCL molecules interact via short O-H...O hydrogen bonds. Laboratory powder X-ray diffraction (PXRD) measurements reveal that the initially phase-pure NCL·MeOH solvate readily transforms into NCL monohydrate within hours under ambient conditions. PXRD further suggests that the NCL monohydrate, HA, is isostructural with the NCL·MeOH solvate. This is consistent with the facile transformation of the methanol solvate into the hydrate when stored in air. The crystal packing and the topology of guest-molecule inclusion are compared with those of other NCL solvates for which the crystal structures are known, giving a consistent picture which correlates well with known experimentally observed desolvation properties.

  13. Electrospray deposition of organic molecules on bulk insulator surfaces.

    PubMed

    Hinaut, Antoine; Pawlak, Rémy; Meyer, Ernst; Glatzel, Thilo

    2015-01-01

    Large organic molecules are of important interest for organic-based devices such as hybrid photovoltaics or molecular electronics. Knowing their adsorption geometries and electronic structures allows to design and predict macroscopic device properties. Fundamental investigations in ultra-high vacuum (UHV) are thus mandatory to analyze and engineer processes in this prospects. With increasing size, complexity or chemical reactivity, depositing molecules by thermal evaporation becomes challenging. A recent way to deposit molecules in clean conditions is Electrospray Ionization (ESI). ESI keeps the possibility to work with large molecules, to introduce them in vacuum, and to deposit them on a large variety of surfaces. Here, ESI has been successfully applied to deposit triply fused porphyrin molecules on an insulating KBr(001) surface in UHV environment. Different deposition coverages have been obtained and characterization of the surface by in-situ atomic force microscopy working in the non-contact mode shows details of the molecular structures adsorbed on the surface. We show that UHV-ESI, can be performed on insulating surfaces in the sub-monolayer regime and to single molecules which opens the possibility to study a variety of complex molecules.

  14. Structure-Property Relationships for Tailoring Phenoxazines as Reducing Photoredox Catalysts.

    PubMed

    McCarthy, Blaine G; Pearson, Ryan M; Lim, Chern-Hooi; Sartor, Steven M; Damrauer, Niels H; Miyake, Garret M

    2018-04-18

    Through the study of structure-property relationships using a combination of experimental and computational analyses, a number of phenoxazine derivatives have been developed as visible light absorbing, organic photoredox catalysts (PCs) with excited state reduction potentials rivaling those of highly reducing transition metal PCs. Time-dependent density functional theory (TD-DFT) computational modeling of the photoexcitation of N-aryl and core modified phenoxazines guided the design of PCs with absorption profiles in the visible regime. In accordance with our previous work with N, N-diaryl dihydrophenazines, characterization of noncore modified N-aryl phenoxazines in the excited state demonstrated that the nature of the N-aryl substituent dictates the ability of the PC to access a charge transfer excited state. However, our current analysis of core modified phenoxazines revealed that these molecules can access a different type of CT excited state which we posit involves a core substituent as the electron acceptor. Modification of the core of phenoxazine derivatives with electron-donating and electron-withdrawing substituents was used to alter triplet energies, excited state reduction potentials, and oxidation potentials of the phenoxazine derivatives. The catalytic activity of these molecules was explored using organocatalyzed atom transfer radical polymerization (O-ATRP) for the synthesis of poly(methyl methacrylate) (PMMA) using white light irradiation. All of the derivatives were determined to be suitable PCs for O-ATRP as indicated by a linear growth of polymer molecular weight as a function of monomer conversion and the ability to synthesize PMMA with moderate to low dispersity (dispersity less than or equal to 1.5) and initiator efficiencies typically greater than 70% at high conversions. However, only PCs that exhibit strong absorption of visible light and strong triplet excited state reduction potentials maintain control over the polymerization during the

  15. Contact-Engineered Electrical Properties of MoS2 Field-Effect Transistors via Selectively Deposited Thiol-Molecules.

    PubMed

    Cho, Kyungjune; Pak, Jinsu; Kim, Jae-Keun; Kang, Keehoon; Kim, Tae-Young; Shin, Jiwon; Choi, Barbara Yuri; Chung, Seungjun; Lee, Takhee

    2018-05-01

    Although 2D molybdenum disulfide (MoS 2 ) has gained much attention due to its unique electrical and optical properties, the limited electrical contact to 2D semiconductors still impedes the realization of high-performance 2D MoS 2 -based devices. In this regard, many studies have been conducted to improve the carrier-injection properties by inserting functional paths, such as graphene or hexagonal boron nitride, between the electrodes and 2D semiconductors. The reported strategies, however, require relatively time-consuming and low-yield transfer processes on sub-micrometer MoS 2 flakes. Here, a simple contact-engineering method is suggested, introducing chemically adsorbed thiol-molecules as thin tunneling barriers between the metal electrodes and MoS 2 channels. The selectively deposited thiol-molecules via the vapor-deposition process provide additional tunneling paths at the contact regions, improving the carrier-injection properties with lower activation energies in MoS 2 field-effect transistors. Additionally, by inserting thiol-molecules at the only one contact region, asymmetric carrier-injection is feasible depending on the temperature and gate bias. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Calculating Henry’s Constants of Charged Molecules Using SPARC

    EPA Science Inventory

    SPARC Performs Automated Reasoning in Chemistry is a computer program designed to model physical and chemical properties of molecules solely based on thier chemical structure. SPARC uses a toolbox of mechanistic perturbation models to model intermolecular interactions. SPARC has ...

  17. Properties of cellulase as template molecule on chitosan—methyl methacrylate membrane

    NASA Astrophysics Data System (ADS)

    Lian, Qi; Zheng, Xuefang; Wu, Haixia; Song, Shitao; Wang, Dongjun

    2015-12-01

    In this study, a novel molecular imprinting membrane made of chitosan and methyl methacrylate (MMA) was fabricated with cellulase as template molecule and the thermal response to cellulase was characterized. The film was characterized by infrared spectroscopy (IR), X-ray diffraction (XRD), scanning electron microscopy (SEM) and the permeation experiment. The results showed that the space structure of the film was as similar as the cellulase. Moreover, the membrane had advanced molecular imprinting capability to cellulase comparing to pepsin and pectinase at any temperature and the film had excellent ability to identify specific template molecule (cellulase) at the synthesis temperature compared to other temperatures.

  18. Influence of the aggregate state on band structure and optical properties of C60 computed with different methods

    NASA Astrophysics Data System (ADS)

    Pal, Amrita; Arabnejad, Saeid; Yamashita, Koichi; Manzhos, Sergei

    2018-05-01

    C60 and C60 based molecules are efficient acceptors and electron transport layers for planar perovskite solar cells. While properties of these molecules are well studied by ab initio methods, those of solid C60, specifically its optical absorption properties, are not. We present a combined density functional theory-Density Functional Tight Binding (DFTB) study of the effect of solid state packing on the band structure and optical absorption of C60. The valence and conduction band edge energies of solid C60 differ on the order of 0.1 eV from single molecule frontier orbital energies. We show that calculations of optical properties using linear response time dependent-DFT(B) or the imaginary part of the dielectric constant (dipole approximation) can result in unrealistically large redshifts in the presence of intermolecular interactions compared to available experimental data. We show that optical spectra computed from the frequency-dependent real polarizability can better reproduce the effect of C60 aggregation on optical absorption, specifically with a generalized gradient approximation functional, and may be more suited to study effects of molecular aggregation.

  19. SMMRNA: a database of small molecule modulators of RNA

    PubMed Central

    Mehta, Ankita; Sonam, Surabhi; Gouri, Isha; Loharch, Saurabh; Sharma, Deepak K.; Parkesh, Raman

    2014-01-01

    We have developed SMMRNA, an interactive database, available at http://www.smmrna.org, with special focus on small molecule ligands targeting RNA. Currently, SMMRNA consists of ∼770 unique ligands along with structural images of RNA molecules. Each ligand in the SMMRNA contains information such as Kd, Ki, IC50, ΔTm, molecular weight (MW), hydrogen donor and acceptor count, XlogP, number of rotatable bonds, number of aromatic rings and 2D and 3D structures. These parameters can be explored using text search, advanced search, substructure and similarity-based analysis tools that are embedded in SMMRNA. A structure editor is provided for 3D visualization of ligands. Advance analysis can be performed using substructure and OpenBabel-based chemical similarity fingerprints. Upload facility for both RNA and ligands is also provided. The physicochemical properties of the ligands were further examined using OpenBabel descriptors, hierarchical clustering, binning partition and multidimensional scaling. We have also generated a 3D conformation database of ligands to support the structure and ligand-based screening. SMMRNA provides comprehensive resource for further design, development and refinement of small molecule modulators for selective targeting of RNA molecules. PMID:24163098

  20. Effects of solvent on the solution properties, structural characteristics and properties of silk sericin.

    PubMed

    Jo, Yoon Nam; Um, In Chul

    2015-07-01

    Sericin films have attracted much attention from researchers in biomedical and cosmetic fields because of its unique properties, including good cytocompatibility and its promotion of wound healing. However, poor mechanical properties of sericin films have restricted its application in these fields. In this study, a new solvent, formic acid, was used to fabricate sericin solutions and films. The effects of formic acid on the structural characteristics and mechanical properties of the sericin solutions and films were examined and compared with water. The sericin/formic acid solution showed fewer aggregated sericin molecules, resulting in a lower turbidity than that of the sericin/water solution. In addition, the gelation of the sericin solution was retarded in formic acid compared to that of water. Sericin films cast from the formic acid solution exhibited a much higher crystallinity index than that produced from water. The tensile strength and elongation of the sericin films cast from the formic acid solution were more than double that of the sericin films cast from water. It is expected that the more stable sericin solution and high-crystallinity sericin films, which have significantly improved mechanical properties, produced by using formic acid as the solvent could be utilized in biomedical and cosmetic applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Sequence-Mandated, Distinct Assembly of Giant Molecules

    DOE PAGES

    Zhang, Wei; Lu, Xinlin; Mao, Jialin; ...

    2017-10-24

    Although controlling the primary structure of synthetic polymers is itself a great challenge, the potential of sequence control for tailoring hierarchical structures remains to be exploited, especially in the creation of new and unconventional phases. A series of model amphiphilic chain-like giant molecules was designed and synthesized by interconnecting both hydrophobic and hydrophilic molecular nanoparticles in precisely defined sequence and composition to investigate their sequence-dependent phase structures. Not only compositional variation changed the self-assembled supramolecular phases, but also specific sequences induce unconventional phase formation, including Frank-Kasper phases. The formation mechanism was attributed to the conformational change driven by the collectivemore » hydrogen bonding and the sequence-mandated topology of the molecules. Lastly, these results show that sequence control in synthetic polymers can have a dramatic impact on polymer properties and self-assembly.« less

  2. Sequence-Mandated, Distinct Assembly of Giant Molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Wei; Lu, Xinlin; Mao, Jialin

    Although controlling the primary structure of synthetic polymers is itself a great challenge, the potential of sequence control for tailoring hierarchical structures remains to be exploited, especially in the creation of new and unconventional phases. A series of model amphiphilic chain-like giant molecules was designed and synthesized by interconnecting both hydrophobic and hydrophilic molecular nanoparticles in precisely defined sequence and composition to investigate their sequence-dependent phase structures. Not only compositional variation changed the self-assembled supramolecular phases, but also specific sequences induce unconventional phase formation, including Frank-Kasper phases. The formation mechanism was attributed to the conformational change driven by the collectivemore » hydrogen bonding and the sequence-mandated topology of the molecules. Lastly, these results show that sequence control in synthetic polymers can have a dramatic impact on polymer properties and self-assembly.« less

  3. FlavorDB: a database of flavor molecules

    PubMed Central

    Garg, Neelansh; Sethupathy, Apuroop; Tuwani, Rudraksh; NK, Rakhi; Dokania, Shubham; Iyer, Arvind; Gupta, Ayushi; Agrawal, Shubhra; Singh, Navjot; Shukla, Shubham; Kathuria, Kriti; Badhwar, Rahul; Kanji, Rakesh; Jain, Anupam; Kaur, Avneet; Nagpal, Rashmi

    2018-01-01

    Abstract Flavor is an expression of olfactory and gustatory sensations experienced through a multitude of chemical processes triggered by molecules. Beyond their key role in defining taste and smell, flavor molecules also regulate metabolic processes with consequences to health. Such molecules present in natural sources have been an integral part of human history with limited success in attempts to create synthetic alternatives. Given their utility in various spheres of life such as food and fragrances, it is valuable to have a repository of flavor molecules, their natural sources, physicochemical properties, and sensory responses. FlavorDB (http://cosylab.iiitd.edu.in/flavordb) comprises of 25,595 flavor molecules representing an array of tastes and odors. Among these 2254 molecules are associated with 936 natural ingredients belonging to 34 categories. The dynamic, user-friendly interface of the resource facilitates exploration of flavor molecules for divergent applications: finding molecules matching a desired flavor or structure; exploring molecules of an ingredient; discovering novel food pairings; finding the molecular essence of food ingredients; associating chemical features with a flavor and more. Data-driven studies based on FlavorDB can pave the way for an improved understanding of flavor mechanisms. PMID:29059383

  4. Porous materials with pre-designed single-molecule traps for CO2 selective adsorption

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, JR; Yu, JM; Lu, WG

    2013-02-26

    Despite tremendous efforts, precise control in the synthesis of porous materials with pre-designed pore properties for desired applications remains challenging. Newly emerged porous metal-organic materials, such as metal-organic polyhedra and metal-organic frameworks, are amenable to design and property tuning, enabling precise control of functionality by accurate design of structures at the molecular level. Here we propose and validate, both experimentally and computationally, a precisely designed cavity, termed a 'single-molecule trap', with the desired size and properties suitable for trapping target CO2 molecules. Such a single-molecule trap can strengthen CO2-host interactions without evoking chemical bonding, thus showing potential for CO2 capture.more » Molecular single-molecule traps in the form of metal-organic polyhedra are designed, synthesised and tested for selective adsorption of CO2 over N-2 and CH4, demonstrating the trapping effect. Building these pre-designed single-molecule traps into extended frameworks yields metal-organic frameworks with efficient mass transfer, whereas the CO2 selective adsorption nature of single-molecule traps is preserved.« less

  5. Understanding and modulating the high-energy properties of noble-gas hydrides from their long-bonding: an NBO/NRT investigation on HNgCO+/CS+/OSi+ and HNgCN/NC (Ng = He, Ar, Kr, Xe, Rn) molecules.

    PubMed

    Zhang, Guiqiu; Song, Junjie; Fu, Lei; Tang, Kongshuang; Su, Yue; Chen, Dezhan

    2018-04-18

    The noble-gas hydrides, HNgX (X is an electronegative atom or fragment), represent potential high-energy materials because their two-body decomposition process, HNgX → Ng + HX, is strongly exoergic. Our previous studies have shown that each member of the HNgX (X = halogen atom or CN/NC fragment) molecules is composed of three leading resonance structures: two ω-bonding structures (H-Ng+ :X- and H:- Ng+-X) and one long-bonding structure (H∧X). The last one paints a novel [small sigma, Greek, circumflex]-type long-bonding picture. The present study focuses on the relationship between this novel bonding motif and the unusual energetic properties. We chose HNgCO+/CS+/OSi+/CN/NC, with the formula HNgAB (Ng = He, Ar, Kr, Xe, Rn; AB = CO+/CS+/OSi+/CN/NC) as the research system. We first investigated the bonding of HNgCO+ and its analogous HNgCS+/OSi+ species using NBO/NRT methods, and quantitatively compared the bonding with that in HNgCN/NC molecules. NBO/NRT results showed that each of the HNgCO+/CS+/OSi+ molecules could be better represented as a resonance hybrid of ω-bonding and long-bonding structures, but the long-bonding is much weaker than that in HNgCN/NC molecules. Furthermore, we introduced the long-bonding concept into the rationalization of the high-energy properties, and found a good correlation between the highly exothermic two-body dissociation channel and the long-bond order, bH-A. We also found that the long-bond order is highly tunable for these noble-gas hydrides due to its dependence on the nature of the electronegative AB fragments or the central noble-gas atoms, Ng. On the basis of these results, we could optimize the energetic properties by changing the long-bonding motif of our studied molecules. Overall, this study shows that the long-bonding model provides an easy way to rationalize and modulate the unusual energy properties of noble-gas hydrides, and that it is helpful to predict some noble-gas hydrides as potential energetic materials.

  6. Neutral, ion gas-phase energetics and structural properties of hydroxybenzophenones.

    PubMed

    Dávalos, Juan Z; Guerrero, Andrés; Herrero, Rebeca; Jimenez, Pilar; Chana, Antonio; Abboud, José Luis M; Lima, Carlos F R A C; Santos, Luís M N B F; Lago, Alexsandre F

    2010-04-16

    We have carried out a study of the energetics, structural, and physical properties of o-, m-, and p-hydroxybenzophenone neutral molecules, C(13)H(10)O(2), and their corresponding anions. In particular, the standard enthalpies of formation in the gas phase at 298.15 K for all of these species were determined. A reliable experimental estimation of the enthalpy associated with intramolecular hydrogen bonding in chelated species was experimentally obtained. The gas-phase acidities (GA) of benzophenones, substituted phenols, and several aliphatic alcohols are compared with the corresponding aqueous acidities (pK(a)), covering a range of 278 kJ.mol(-1) in GA and 11.4 in pK(a). A computational study of the various species shed light on structural effects and further confirmed the self-consistency of the experimental results.

  7. Self-Assembled Ag-MXA Superclusters with Structure-Dependent Mechanical Properties.

    PubMed

    Qin, Xiaoyun; Luo, Dan; Xue, Zhenjie; Song, Qian; Wang, Tie

    2018-03-01

    The low elastic modulus and time-consuming formation process represent the major challenges that impede the penetration of nanoparticle superstructures into daily life applications. As observed in the molecular or atomic crystals, more effective interactions between adjacent nanoparticles would introduce beneficial features to assemblies enabling optimized mechanical properties. Here, a straightforward synthetic strategy is showed that allows fast and scalable fabrication of 2D Ag-mercaptoalkyl acid superclusters of either hexagonal or lamellar topology. Remarkably, these ordered superstructures exhibit a structure-dependent elastic modulus which is subject to the tether length of straight-chain mercaptoalkyl acids or the ratio between silver and tether molecules. These superclusters are plastic and moldable against arbitrarily shaped masters of macroscopic dimensions, thereby opening a wealth of possibilities to develop more nanocrystals with practically useful nanoscopic properties. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Hydrogels constructed via self-assembly of beta-hairpin molecules

    NASA Astrophysics Data System (ADS)

    Ozbas, Bulent

    There is a recent and growing interest in hydrogel materials that are formed via peptide self-assembly for tissue engineering applications. Peptide based materials are excellent candidates for diverse applications in biomedical field due to their responsive behavior and complex self-assembled structures. However, there is very limited information on the self-assembly and resultant network and mechanical properties of these types of hydrogels. The main goal of this dissertation is to investigate the self-assembly mechanism and viscoelastic properties of hydrogels that can be altered by changing solution conditions as well as the primary structure of the peptide. These hydrogels are formed via intramolecular folding and consequent self-assembly of 20 amino acid long beta-hairpin peptide molecules (Max1). The peptide molecules are locally amphiphilic with two linear strands of alternating hydrophobic valine and hydrophilic lysine amino acids connected with a Dproline-LProline turn sequence. Circular dichroism and FTIR spectroscopy show that at physiological conditions peptides are unfolded in the absence of salt. By raising the ionic strength of the solution electrostatic interactions between charged lysines are screened and the peptide arms are forced into a beta-sheet secondary structure stabilized by the turn sequence. These folded molecules intermolecularly assemble via hydrophobic collapse and hydrogen bonding into a three dimensional network. Folding and self-assembly of these molecules can also be triggered by increasing temperature and/or pH of the peptide solution. In addition, the random-coil to beta-sheet transition of the beta-hairpin peptides is pH and, with proper changes in the peptide sequence, thermally reversible. Rheological measurements demonstrate that the resultant supramolecular structure forms an elastic material, whose structure, and thus modulus, can be tuned by magnitude of the stimulus. Hydrogels recover their initial viscoelastic

  9. Side-chain Engineering of Benzo[1,2-b:4,5-b’]dithiophene Core-structured Small Molecules for High-Performance Organic Solar Cells

    PubMed Central

    Yin, Xinxing; An, Qiaoshi; Yu, Jiangsheng; Guo, Fengning; Geng, Yongliang; Bian, Linyi; Xu, Zhongsheng; Zhou, Baojing; Xie, Linghai; Zhang, Fujun; Tang, Weihua

    2016-01-01

    Three novel small molecules have been developed by side-chain engineering on benzo[1,2-b:4,5-b’]dithiophene (BDT) core. The typical acceptor-donor-acceptor (A-D-A) structure is adopted with 4,8-functionalized BDT moieties as core, dioctylterthiophene as π bridge and 3-ethylrhodanine as electron-withdrawing end group. Side-chain engineering on BDT core exhibits small but measurable effect on the optoelectronic properties of small molecules. Theoretical simulation and X-ray diffraction study reveal the subtle tuning of interchain distance between conjugated backbones has large effect on the charge transport and thus the photovoltaic performance of these molecules. Bulk-heterojunction solar cells fabricated with a configuration of ITO/PEDOT:PSS/SM:PC71BM/PFN/Al exhibit a highest power conversion efficiency (PCE) of 6.99% after solvent vapor annealing. PMID:27140224

  10. Second rank direction cosine spherical tensor operators and the nuclear electric quadrupole hyperfine structure Hamiltonian of rotating molecules

    NASA Astrophysics Data System (ADS)

    di Lauro, C.

    2018-03-01

    Transformations of vector or tensor properties from a space-fixed to a molecule-fixed axis system are often required in the study of rotating molecules. Spherical components λμ,ν of a first rank irreducible tensor can be obtained from the direction cosines between the two axis systems, and a second rank tensor with spherical components λμ,ν(2) can be built from the direct product λ × λ. It is shown that the treatment of the interaction between molecular rotation and the electric quadrupole of a nucleus is greatly simplified, if the coefficients in the axis-system transformation of the gradient of the electric field of the outer charges at the coupled nucleus are arranged as spherical components λμ,ν(2). Then the reduced matrix elements of the field gradient operators in a symmetric top eigenfunction basis, including their dependence on the molecule-fixed z-angular momentum component k, can be determined from the knowledge of those of λ(2) . The hyperfine structure Hamiltonian Hq is expressed as the sum of terms characterized each by a value of the molecule-fixed index ν, whose matrix elements obey the rule Δk = ν. Some of these terms may vanish because of molecular symmetry, and the specific cases of linear and symmetric top molecules, orthorhombic molecules, and molecules with symmetry lower than orthorhombic are considered. Each ν-term consists of a contraction of the rotational tensor λ(2) and the nuclear quadrupole tensor in the space-fixed frame, and its matrix elements in the rotation-nuclear spin coupled representation can be determined by the standard spherical tensor methods.

  11. Intrinsic property measurement of surfactant-templated mesoporous silica films using time-resolved single-molecule imaging.

    PubMed

    Kennard, Raymond; DeSisto, William J; Giririjan, Thanu Praba; Mason, Michael D

    2008-04-07

    Mesoporous silica membranes fabricated by the surfactant-templated sol-gel process have received attention because of the potential to prepare membranes with a narrow pore size distribution and ordering of the interconnected pores. Potential applications include ultrafiltration, biological separations and drug delivery, and separators in lithium-ion batteries. Despite advancements in synthesis and characterization of these membranes, a quantitative description of the membrane microstructure remains a challenge. Currently the membrane microstructure is characterized by the combination of results from several techniques, i.e., gas permeance testing, x-ray diffraction scanning electron microscopy, transmission electron microscopy, and permporometry. The results from these ensemble methods are then compiled and the data fitted to a particular flow model. Although these methods are very effective in determining membrane performance, general pore size distribution, and defect concentration, they are unable to monitor molecular paths through the membrane and quantitatively measure molecular interactions between the molecular specie and pore network. Single-molecule imaging techniques enable optical measurements that probe materials on nanometer length scales through observation of individual molecules without the influence of averaging. Using single-molecule imaging spectroscopy, we can quantitatively characterize the interaction between the probe molecule and the interior of the pore within mesoporous silica membranes. This approach is radically different from typical membrane characterization methods in that it has the potential to spatially sample the underlying pore structure distribution, the surface energy, and the transport properties. Our hope is that this new fundamental knowledge can be quantitatively linked to both the preparation and the performance of membranes, leading to the advancement of membrane science and technology. Fluorescent molecules, 1

  12. Intrinsic property measurement of surfactant-templated mesoporous silica films using time-resolved single-molecule imaging

    NASA Astrophysics Data System (ADS)

    Kennard, Raymond; DeSisto, William J.; Giririjan, Thanu Praba; Mason, Michael D.

    2008-04-01

    Mesoporous silica membranes fabricated by the surfactant-templated sol-gel process have received attention because of the potential to prepare membranes with a narrow pore size distribution and ordering of the interconnected pores. Potential applications include ultrafiltration, biological separations and drug delivery, and separators in lithium-ion batteries. Despite advancements in synthesis and characterization of these membranes, a quantitative description of the membrane microstructure remains a challenge. Currently the membrane microstructure is characterized by the combination of results from several techniques, i.e., gas permeance testing, x-ray diffraction scanning electron microscopy, transmission electron microscopy, and permporometry. The results from these ensemble methods are then compiled and the data fitted to a particular flow model. Although these methods are very effective in determining membrane performance, general pore size distribution, and defect concentration, they are unable to monitor molecular paths through the membrane and quantitatively measure molecular interactions between the molecular specie and pore network. Single-molecule imaging techniques enable optical measurements that probe materials on nanometer length scales through observation of individual molecules without the influence of averaging. Using single-molecule imaging spectroscopy, we can quantitatively characterize the interaction between the probe molecule and the interior of the pore within mesoporous silica membranes. This approach is radically different from typical membrane characterization methods in that it has the potential to spatially sample the underlying pore structure distribution, the surface energy, and the transport properties. Our hope is that this new fundamental knowledge can be quantitatively linked to both the preparation and the performance of membranes, leading to the advancement of membrane science and technology. Fluorescent molecules, 1

  13. The quantum matrix and information from the hydrocarbon oil molecule

    NASA Astrophysics Data System (ADS)

    Seyful-Mulyukov, R. B.

    2016-03-01

    The quantum matrix of the hydrocarbon (HC) molecule is substantiated. On the basis of its properties and behavior, the genesis of oil is explained as a process of self-evolution of oil and preservation of molecules of different composition and generation time. Individual HC molecules are generated in nanoseconds, and the period of the genesis of oil is comparable with that of migration of the HC fluid from the mantle to the deposit. A model of subatomic abiogenic genesis of oil is presented. Hydrocarbon (HC) molecules of various structure and composition are formed due to interaction of the valency electron orbitals of C and H atoms, the elemental particles of which are quantum objects and carriers of information. On the basis of this, the term quantum matrix of the HC molecule, the properties and behavior of which explain the genesis of oil as a process of its self-evolution and preservation of the molecules of various composition and the period of generation of oil, is substantiated. It is proved that individual HC molecules are generated within nanoseconds and the period of origin of the entire assemblage of more than 500 molecules of oil of various types is comparable with the period of migration of the HC fluid from the mantle to the deposit.

  14. Dynamic behaviors and transport properties of ethanol molecules in transmembrane cyclic peptide nanotubes.

    PubMed

    Li, Rui; Fan, Jianfen; Li, Hui; Yan, Xiliang; Yu, Yi

    2015-07-07

    Classical molecular dynamics simulations have been performed to investigate the dynamic behaviors and transport properties of ethanol molecules in transmembrane cyclic peptide nanotubes (CPNTs) with various radii, i.e., 8×(WL¯)n=3,4,5/POPE. The results show that ethanol molecules spontaneously fill the octa- and deca-CPNTs, but not the hexa-CPNT. In the octa-CPNT, ethanol molecules are trapped at individual gaps with their carbon skeletons perpendicular to the tube axis and hydroxyl groups towards the tube wall, forming a broken single-file chain. As the channel radius increases, ethanol molecules inside the deca-CPNT tend to form a tubular layer and the hydroxyl groups mainly stretch towards the tube axis. Computations of diffusion coefficients indicate that ethanol molecules in the octa-CPNT nearly lost their diffusion abilities, while those in the deca-CPNT diffuse as 4.5 times as in a (8, 8) carbon nanotube with a similar tube diameter. The osmotic and diffusion permeabilities (pf and pd, respectively) of the octa- and deca-CPNTs transporting ethanol were deduced for the first time. The distributions of the gauche and trans conformers of ethanol molecules in two CPNTs are quite similar, both with approximately 57% gauche conformers. The non-bonded interactions of channel ethanol with a CPNT wall and surrounding ethanol were explored. The potential of mean force elucidates the mechanism underlying the transporting characteristics of channel ethanol in a transmembrane CPNT.

  15. Resolving Transition Metal Chemical Space: Feature Selection for Machine Learning and Structure-Property Relationships.

    PubMed

    Janet, Jon Paul; Kulik, Heather J

    2017-11-22

    Machine learning (ML) of quantum mechanical properties shows promise for accelerating chemical discovery. For transition metal chemistry where accurate calculations are computationally costly and available training data sets are small, the molecular representation becomes a critical ingredient in ML model predictive accuracy. We introduce a series of revised autocorrelation functions (RACs) that encode relationships of the heuristic atomic properties (e.g., size, connectivity, and electronegativity) on a molecular graph. We alter the starting point, scope, and nature of the quantities evaluated in standard ACs to make these RACs amenable to inorganic chemistry. On an organic molecule set, we first demonstrate superior standard AC performance to other presently available topological descriptors for ML model training, with mean unsigned errors (MUEs) for atomization energies on set-aside test molecules as low as 6 kcal/mol. For inorganic chemistry, our RACs yield 1 kcal/mol ML MUEs on set-aside test molecules in spin-state splitting in comparison to 15-20× higher errors for feature sets that encode whole-molecule structural information. Systematic feature selection methods including univariate filtering, recursive feature elimination, and direct optimization (e.g., random forest and LASSO) are compared. Random-forest- or LASSO-selected subsets 4-5× smaller than the full RAC set produce sub- to 1 kcal/mol spin-splitting MUEs, with good transferability to metal-ligand bond length prediction (0.004-5 Å MUE) and redox potential on a smaller data set (0.2-0.3 eV MUE). Evaluation of feature selection results across property sets reveals the relative importance of local, electronic descriptors (e.g., electronegativity, atomic number) in spin-splitting and distal, steric effects in redox potential and bond lengths.

  16. Acenes, Heteroacenes and Analogous Molecules for Organic Photovoltaic and Field Effect Transistor Applications

    NASA Astrophysics Data System (ADS)

    Granger, Devin Benjamin

    Polycyclic aromatic hydrocarbons composed of benzenoid rings fused in a linear fashion comprise the class of compounds known as acenes. The structures containing three to six ring fusions are brightly colored and possess band gaps and charge transport efficiencies sufficient for semiconductor applications. These molecules have been investigated throughout the past several decades to assess their optoelectronic properties. The absorption, emission and charge transport properties of this series of molecules has been studied extensively to elucidate structure-property relationships. A wide variety of analogous molecules, incorporating heterocycles in place of benzenoid rings, demonstrate similar properties to the parent compounds and have likewise been investigated. Functionalization of acene compounds by placement of groups around the molecule affects the way in which molecules interact in the solid state, in addition to the energetics of the molecule. The use of electron donating or electron withdrawing groups affects the frontier molecular orbitals and thus affects the optical and electronic gaps of the molecules. The use of bulky side groups such as alkylsilylethynyl groups allows for crystal engineering of molecular aggregates, and changing the volume and dimensions of the alkylsilyl groups affects the intermolecular interactions and thus changes the packing motif. In chapter 2, a series of tetracene and pentacene molecules with strongly electron withdrawing groups is described. The investigation focuses on the change in energetics of the frontier molecular orbitals between the base acene and the nitrile and dicyanovinyl derivatives as well as the differences between the pentacene and tetracene molecules. The differences in close packing motifs through use of bulky alkylsilylethynyl groups is also discussed in relation to electron acceptor material design and bulk heterojunction organic photovoltaic characteristics. Chapter 3 focuses on molecular acceptor and

  17. Structural and energetic properties of La3+ in water/DMSO mixtures

    NASA Astrophysics Data System (ADS)

    Montagna, Maria; Spezia, Riccardo; Bodo, Enrico

    2017-11-01

    By using molecular dynamics based on a custom polarizable force field, we have studied the solvation of La3+ in an equimolar mixture of dimethylsulfoxide (DMSO) with water. An extended structural analysis has been performed to provide a complete picture of the physical properties at the basis of the interaction of La3+ with both solvents. Through our simulations we found that, very likely, the first solvation shell in the mixture is not unlike the one found in pure water or pure DMSO and contains 9 solvent molecules. We have also found that the solvation is preferentially due to DMSO molecules with the water initially present in first shell quickly leaving to the bulk. The dehydration process of the first shell has been analyzed by both plain MD simulations and a constrained dynamics approach; the free energy profiles for the extraction of water from first shell have also been computed.

  18. A comparative study of the structures and electronic properties of graphene fragments: A DFT and MP2 survey

    NASA Astrophysics Data System (ADS)

    de Carvalho, E. F. V.; Lopez-Castillo, A.; Roberto-Neto, O.

    2018-01-01

    Graphene can be viewed as sheet of benzene rings fused together forming a variety of structures including the trioxotriangulenes (TOTs) which is a class of organic molecules with electro-active properties. In order to clarify such properties, structures and electronic properties of the graphene fragments phenalenyl, triangulene, 6-oxophenalenoxyl, and X3TOT (X = H, F, Cl) are computed. Validation of the methodologies are carried out using the density functionals B3LYP, M06-2X, B2PLYP-D, and the MP2 theory, giving equilibrium geometries of benzene, naphthalene, and anthracene with mean unsigned error (MUE) of only 0.003, 0.007, 0.004, and 0.007 Å, respectively in relation to experiment.

  19. Simultaneous optimization of biomolecular energy function on features from small molecules and macromolecules

    PubMed Central

    Park, Hahnbeom; Bradley, Philip; Greisen, Per; Liu, Yuan; Mulligan, Vikram Khipple; Kim, David E.; Baker, David; DiMaio, Frank

    2017-01-01

    Most biomolecular modeling energy functions for structure prediction, sequence design, and molecular docking, have been parameterized using existing macromolecular structural data; this contrasts molecular mechanics force fields which are largely optimized using small-molecule data. In this study, we describe an integrated method that enables optimization of a biomolecular modeling energy function simultaneously against small-molecule thermodynamic data and high-resolution macromolecular structural data. We use this approach to develop a next-generation Rosetta energy function that utilizes a new anisotropic implicit solvation model, and an improved electrostatics and Lennard-Jones model, illustrating how energy functions can be considerably improved in their ability to describe large-scale energy landscapes by incorporating both small-molecule and macromolecule data. The energy function improves performance in a wide range of protein structure prediction challenges, including monomeric structure prediction, protein-protein and protein-ligand docking, protein sequence design, and prediction of the free energy changes by mutation, while reasonably recapitulating small-molecule thermodynamic properties. PMID:27766851

  20. Diffusion properties of molecules at the blood-brain interface: potential contributions of astrocyte endfeet to diffusion barrier functions.

    PubMed

    Nuriya, Mutsuo; Shinotsuka, Takanori; Yasui, Masato

    2013-09-01

    Molecular diffusion in the extracellular space (ECS) plays a key role in determining tissue physiology and pharmacology. The blood-brain barrier regulates the exchange of substances between the brain and the blood, but the diffusion properties of molecules at this blood-brain interface, particularly around the astrocyte endfeet, are poorly characterized. In this study, we used 2-photon microscopy and acute brain slices of mouse neocortex and directly assessed the diffusion patterns of fluorescent molecules. By observing the diffusion of unconjugated and 10-kDa dextran-conjugated Alexa Fluor 488 from the ECS of the brain parenchyma to the blood vessels, we find various degrees of diffusion barriers at the endfeet: Some allow the invasion of dye inside the endfoot network while others completely block it. Detailed analyses of the time course for dye clearance support the existence of a tight endfoot network capable of acting as a diffusion barrier. Finally, we show that this diffusion pattern collapses under pathological conditions. These data demonstrate the heterogeneous nature of molecular diffusion dynamics around the endfeet and suggest that these structures can serve as the diffusion barrier. Therefore, astrocyte endfeet may add another layer of regulation to the exchange of molecules between blood vessels and brain parenchyma.

  1. Adsorbed Molecules and Surface Treatment Effect on Optical Properties of ZnO Nanowires Grown by MOCVD

    NASA Astrophysics Data System (ADS)

    Jabri, S.; Souissi, H.; Sallet, V.; Lusson, A.; Meftah, A.; Galtier, P.; Oueslati, M.

    2017-07-01

    We have investigated the optical properties of ZnO nanowires grown by metalorganic chemical vapor deposition (MOCVD) with nitrous oxide (N2O) as oxygen precursor. Photoluminescence (PL) and Raman measurements showed the influence of adsorbed molecules on the optical properties. Low-temperature (4 K) PL studies on the surface exciton (SX) at 3.3660 eV elucidated the nature and origin of this emission. In particular, surface treatment by annealing at high temperature under inert gas reduced the emission intensity of SX. Raman vibrational spectra proved that presence of a considerable amount of adsorbed molecules on the surface of ZnO nanowires plays a key role in the occurrence of surface excitons.

  2. Structural and vibrational study of a neurotransmitter molecule: Dopamine [4-(2-aminoethyl) benzene-1,2-diol

    NASA Astrophysics Data System (ADS)

    Jha, Omkant; Yadav, T. K.; Yadav, R. A.

    2018-01-01

    Structural and vibrational studies for the most stable conformer of dopamine {4-(2-Aminoethyl) benzene-1, 2-diol} have been carried out at the DFT/B3LYP/6-311 ++G** level using the Gaussian 09 software. The IR and Raman spectra have been recorded and analyzed in light of the computed vibrational parameters using the DFT and the PEDs computed with the help of the GAR2PED software. Some of the fundamentals have considerably changed frequencies in going from benzene to dopamine. Except the rocking and wagging modes of the NH2 group the other four modes are pure group modes. The rocking and wagging modes of the NH2 group show mixing with the other modes. The two Osbnd H stretching vibrations are highly localized modes. The Kekule phenyl ring stretching mode is found to remain almost unchanged. The HOMO-LUMO study suggests the existence of charge transfer within the molecule and the energy gap supports the pharmacological active property of the dopamine molecule. The NBO analysis has been carried out to understand the proper and improper hydrogen bonding.

  3. The properties of residual water molecules in ionic liquids: a comparison between direct and inverse Kirkwood-Buff approaches.

    PubMed

    Kobayashi, Takeshi; Reid, Joshua E S J; Shimizu, Seishi; Fyta, Maria; Smiatek, Jens

    2017-07-26

    We study the properties of residual water molecules at different mole fractions in dialkylimidazolium based ionic liquids (ILs), namely 1-ethyl-3-methylimidazolium tetrafluoroborate (EMIM/BF 4 ) and 1-butyl-3-methylimidazolium tetrafluoroborate (BMIM/BF 4 ) by means of atomistic molecular dynamics (MD) simulations. The corresponding Kirkwood-Buff (KB) integrals for the water-ion and ion-ion correlation behavior are calculated by a direct evaluation of the radial distribution functions. The outcomes are compared to the corresponding KB integrals derived by an inverse approach based on experimental data. Our results reveal a quantitative agreement between both approaches, which paves a way towards a more reliable comparison between simulation and experimental results. The simulation outcomes further highlight that water even at intermediate mole fractions has a negligible influence on the ion distribution in the solution. More detailed analysis on the local/bulk partition coefficients and the partial structure factors reveal that water molecules at low mole fractions mainly remain in the monomeric state. A non-linear increase of higher order water clusters can be found at larger water concentrations. For both ILs, a more pronounced water coordination around the cations when compared to the anions can be observed, which points out that the IL cations are mainly responsible for water pairing mechanisms. Our simulations thus provide detailed insights in the properties of dialkylimidazolium based ILs and their effects on water binding.

  4. SM-TF: A structural database of small molecule-transcription factor complexes.

    PubMed

    Xu, Xianjin; Ma, Zhiwei; Sun, Hongmin; Zou, Xiaoqin

    2016-06-30

    Transcription factors (TFs) are the proteins involved in the transcription process, ensuring the correct expression of specific genes. Numerous diseases arise from the dysfunction of specific TFs. In fact, over 30 TFs have been identified as therapeutic targets of about 9% of the approved drugs. In this study, we created a structural database of small molecule-transcription factor (SM-TF) complexes, available online at http://zoulab.dalton.missouri.edu/SM-TF. The 3D structures of the co-bound small molecule and the corresponding binding sites on TFs are provided in the database, serving as a valuable resource to assist structure-based drug design related to TFs. Currently, the SM-TF database contains 934 entries covering 176 TFs from a variety of species. The database is further classified into several subsets by species and organisms. The entries in the SM-TF database are linked to the UniProt database and other sequence-based TF databases. Furthermore, the druggable TFs from human and the corresponding approved drugs are linked to the DrugBank. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  5. Conductance based characterization of structure and hopping site density in 2D molecule-nanoparticle arrays

    NASA Astrophysics Data System (ADS)

    McCold, Cliff E.; Fu, Qiang; Howe, Jane Y.; Hihath, Joshua

    2015-09-01

    Composite molecule-nanoparticle hybrid systems have recently emerged as important materials for applications ranging from chemical sensing to nanoscale electronics. However, creating reproducible and repeatable composite materials with precise properties has remained one of the primary challenges to the implementation of these technologies. Understanding the sources of variation that dominate the assembly and transport behavior is essential for the advancement of nanoparticle-array based devices. In this work, we use a combination of charge-transport measurements, electron microscopy, and optical characterization techniques to determine the role of morphology and structure on the charge transport properties of 2-dimensional monolayer arrays of molecularly-interlinked Au nanoparticles. Using these techniques we are able to determine the role of both assembly-dependent and particle-dependent defects on the conductivities of the films. These results demonstrate that assembly processes dominate the dispersion of conductance values, while nanoparticle and ligand features dictate the mean value of the conductance. By performing a systematic study of the conductance of these arrays as a function of nanoparticle size we are able to extract the carrier mobility for specific molecular ligands. We show that nanoparticle polydispersity correlates with the void density in the array, and that because of this correlation it is possible to accurately determine the void density within the array directly from conductance measurements. These results demonstrate that conductance-based measurements can be used to accurately and non-destructively determine the morphological and structural properties of these hybrid arrays, and thus provide a characterization platform that helps move 2-dimensional nanoparticle arrays toward robust and reproducible electronic systems.Composite molecule-nanoparticle hybrid systems have recently emerged as important materials for applications ranging from

  6. Interfacial assembly structures and nanotribological properties of saccharic acids.

    PubMed

    Shi, Hongyu; Liu, Yuhong; Zeng, Qingdao; Yang, Yanlian; Wang, Chen; Lu, Xinchun

    2017-01-04

    Saccharides have been recognized as potential bio-lubricants because of their good hydration ability. However, the interfacial structures of saccharides and their derivatives are rarely studied and the molecular details of interaction mechanisms have not been well understood. In this paper, the supramolecular assembly structures of saccharic acids (including galactaric acid and lactobionic acid), mediated by hydrogen bonds O-HN and O-HO, were successfully constructed on a highly oriented pyrolytic graphite (HOPG) surface by introducing pyridine modulators and were explicitly revealed by using scanning tunneling microscopy (STM). Furthermore, friction forces were measured in the saccharic acid/pyridine co-assembled system by atomic force microscopy (AFM), revealing a larger value than a pristine saccharic acid system, which could be attributed to the stronger tip-assembled molecule interactions that lead to the higher potential energy barrier needed to overcome. The effort on saccharide-related supramolecular self-assembly and nanotribological behavior could provide a novel and promising pathway to explore the interaction mechanisms underlying friction and reveal the structure-property relationship at the molecular level.

  7. FlavorDB: a database of flavor molecules.

    PubMed

    Garg, Neelansh; Sethupathy, Apuroop; Tuwani, Rudraksh; Nk, Rakhi; Dokania, Shubham; Iyer, Arvind; Gupta, Ayushi; Agrawal, Shubhra; Singh, Navjot; Shukla, Shubham; Kathuria, Kriti; Badhwar, Rahul; Kanji, Rakesh; Jain, Anupam; Kaur, Avneet; Nagpal, Rashmi; Bagler, Ganesh

    2018-01-04

    Flavor is an expression of olfactory and gustatory sensations experienced through a multitude of chemical processes triggered by molecules. Beyond their key role in defining taste and smell, flavor molecules also regulate metabolic processes with consequences to health. Such molecules present in natural sources have been an integral part of human history with limited success in attempts to create synthetic alternatives. Given their utility in various spheres of life such as food and fragrances, it is valuable to have a repository of flavor molecules, their natural sources, physicochemical properties, and sensory responses. FlavorDB (http://cosylab.iiitd.edu.in/flavordb) comprises of 25,595 flavor molecules representing an array of tastes and odors. Among these 2254 molecules are associated with 936 natural ingredients belonging to 34 categories. The dynamic, user-friendly interface of the resource facilitates exploration of flavor molecules for divergent applications: finding molecules matching a desired flavor or structure; exploring molecules of an ingredient; discovering novel food pairings; finding the molecular essence of food ingredients; associating chemical features with a flavor and more. Data-driven studies based on FlavorDB can pave the way for an improved understanding of flavor mechanisms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Structurally conserved water molecules in ribonuclease T1.

    PubMed

    Malin, R; Zielenkiewicz, P; Saenger, W

    1991-03-15

    In the high resolution (1.7-1.9 A) crystal structures of ribonuclease T1 (RNase T1) in complex with guanosine, guanosine 2'-phosphate, guanylyl 2',5'-guanosine, and vanadate, there are 30 water sites in nearly identical (+/- 1 A) positions that are considered conserved. One water is tightly bound to Asp76(O delta), Thr93(O gamma), Cys6(O), and Asn9(N); another bridges two loops by hydrogen-bonding to Tyr68(O eta) and to Ser35(N), Asn36(N); a loop structure is stabilized by two waters coordinated to Gly31(O) and His27(N delta), and by water bound to cis-Pro39(O). Most notable is a hydrogen-bonded chain of 10 water molecules. Waters 1-5 of this chain are inaccessible to solvent, are anchored at Trp59(N), and stitch together the loop formed by segments 60-68; waters 5-8 coordinate to Ca2+, and waters 9 and 10 hydrogen-bond to N-terminal side chains of the alpha-helix. The water chain and two conserved water molecules are bound to amino acids adjacent to the active site residues His40, Glu58, Arg77, and His92; they are probably involved in maintaining their spatial orientation required for catalysis. Water sites must be considered in genetic engineering; the mutation Trp59Tyr, which probably influences the 10-water chain, doubles the catalytic activity of RNase T1.

  9. Physico-chemical properties and cytotoxic effects of sugar-based surfactants: Impact of structural variations.

    PubMed

    Lu, Biao; Vayssade, Muriel; Miao, Yong; Chagnault, Vincent; Grand, Eric; Wadouachi, Anne; Postel, Denis; Drelich, Audrey; Egles, Christophe; Pezron, Isabelle

    2016-09-01

    Surfactants derived from the biorefinery process can present interesting surface-active properties, low cytotoxicity, high biocompatibility and biodegradability. They are therefore considered as potential sustainable substitutes to currently used petroleum-based surfactants. To better understand and anticipate their performances, structure-property relationships need to be carefully investigated. For this reason, we applied a multidisciplinary approach to systematically explore the effect of subtle structural variations on both physico-chemical properties and biological effects. Four sugar-based surfactants, each with an eight carbon alkyl chain bound to a glucose or maltose head group by an amide linkage, were synthesized and evaluated together along with two commercially available standard surfactants. Physico-chemical properties including solubility, Krafft point, surface-tension lowering and critical micellar concentration (CMC) in water and biological medium were explored. Cytotoxicity evaluation by measuring proliferation index and metabolic activity against dermal fibroblasts showed that all surfactants studied may induce cell death at low concentrations (below their CMC). Results revealed significant differences in both physico-chemical properties and cytotoxic effects depending on molecule structural features, such as the position of the linkage on the sugar head-group, or the orientation of the amide linkage. Furthermore, the cytotoxic response increased with the reduction of surfactant CMC. This study underscores the relevance of a methodical and multidisciplinary approach that enables the consideration of surfactant solution properties when applied to biological materials. Overall, our results will contribute to a better understanding of the concomitant impact of surfactant structure at physico-chemical and biological levels. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. The angular electronic band structure and free particle model of aromatic molecules: High-frequency photon-induced ring current

    NASA Astrophysics Data System (ADS)

    Öncan, Mehmet; Koç, Fatih; Şahin, Mehmet; Köksal, Koray

    2017-05-01

    This work introduces an analysis of the relationship of first-principles calculations based on DFT method with the results of free particle model for ring-shaped aromatic molecules. However, the main aim of the study is to reveal the angular electronic band structure of the ring-shaped molecules. As in the case of spherical molecules such as fullerene, it is possible to observe a parabolic dispersion of electronic states with the variation of angular quantum number in the planar ring-shaped molecules. This work also discusses the transition probabilities between the occupied and virtual states by analyzing the angular electronic band structure and the possibility of ring currents in the case of spin angular momentum (SAM) or orbital angular momentum (OAM) carrying light. Current study focuses on the benzene molecule to obtain its angular electronic band structure. The obtained electronic band structure can be considered as a useful tool to see the transition probabilities between the electronic states and possible contribution of the states to the ring currents. The photoinduced current due to the transfer of SAM into the benzene molecule has been investigated by using analytical calculations within the frame of time-dependent perturbation theory.

  11. Analyzing Single-Molecule Time Series via Nonparametric Bayesian Inference

    PubMed Central

    Hines, Keegan E.; Bankston, John R.; Aldrich, Richard W.

    2015-01-01

    The ability to measure the properties of proteins at the single-molecule level offers an unparalleled glimpse into biological systems at the molecular scale. The interpretation of single-molecule time series has often been rooted in statistical mechanics and the theory of Markov processes. While existing analysis methods have been useful, they are not without significant limitations including problems of model selection and parameter nonidentifiability. To address these challenges, we introduce the use of nonparametric Bayesian inference for the analysis of single-molecule time series. These methods provide a flexible way to extract structure from data instead of assuming models beforehand. We demonstrate these methods with applications to several diverse settings in single-molecule biophysics. This approach provides a well-constrained and rigorously grounded method for determining the number of biophysical states underlying single-molecule data. PMID:25650922

  12. Cold Rydberg molecules

    NASA Astrophysics Data System (ADS)

    Raithel, Georg

    2017-04-01

    Cold atomic systems have opened new frontiers in atomic and molecular physics, including several types of Rydberg molecules. Three types will be reviewed. Long-range Rydberg-ground molecules, first predicted in and observed in, are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules. A classification into Hund's cases will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction of neutral Rydberg-Rydberg molecules is dipole-dipole, while for ionic Rydberg molecules it is dipole-monopole. Higher-order terms are discussed. FUNDING: NSF (PHY-1506093), NNSF of China (61475123).

  13. Cold Rydberg molecules

    NASA Astrophysics Data System (ADS)

    Raithel, Georg; Zhao, Jianming

    2017-04-01

    Cold atomic systems have opened new frontiers at the interface of atomic and molecular physics. These include research on novel types of Rydberg molecules. Three types of molecules will be reviewed. Long-range, homonuclear Rydberg molecules, first predicted in [1] and observed in [2], are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium [3]). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules [3]. A classification into Hund's cases [3, 4, 5] will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction term of neutral Rydberg-Rydberg molecules is between two dipoles, while for ionic Rydberg molecules it is between a dipole and a monopole. NSF (PHY-1506093), NNSF of China (61475123).

  14. Fragrances and other materials in deodorants: search for potentially sensitizing molecules using combined GC-MS and structure activity relationship (SAR) analysis.

    PubMed

    Rastogi, S C; Lepoittevin, J P; Johansen, J D; Frosch, P J; Menné, T; Bruze, M; Dreier, B; Andersen, K E; White, I R

    1998-12-01

    Deodorants are one of the most frequently-used types of cosmetics and are a source of allergic contact dermatitis. Therefore, a gas chromatography - mass spectrometric analysis of 71 deodorants was performed for identification of fragrance and non-fragrance materials present in marketed deodorants. Futhermore, the sensitizing potential of these molecules was evaluated using structure activity relationships (SARs) analysis. This was based on the presence of 1 or more chemically reactive site(s), in the chemical structure, associated with sensitizing potential. Among the many different substances used to formulate cosmetic products (over 3500), 226 chemicals were identified in a sample of 71 deodorants. 84 molecules were found to contain at least 1 structural alert, and 70 to belong to, or be susceptible to being metabolized into, the chemical group of aldehydes, ketones and alpha,beta-unsaturated aldehydes, ketone or esters. The combination of GC-MS and SARs analysis could be helpful in the selection of substances for supplementary investigations regarding sensitizing properties. Thus, it may be a valuable tool in the management of contact allergy to deodorants and for producing new deodorants with decreased propensity to cause contact allergy.

  15. Manipulating, Reacting, and Constructing Single Molecules with a Scanning Tunneling Microscope Tip

    NASA Astrophysics Data System (ADS)

    Hla, S.-W.

    The fascinating advances in atom and molecule manipulation with the scanning tunneling microscope (STM) tip allow scientists to fabricate artificial atomic scale structures, to study local quantum phenomena, or to probe physical and chemical properties of single atoms and molecules on surfaces. Recent achievements in individual synthesis of single molecules with the STM tip further open up an entirely new opportunities in nanoscience and technology. The STM manipulation techniques usef ul in the molecular construction are reviewed and prospects for future opportunities of single molecule chemical engineering and their possible implications to nano-scale science and technology are discussed.

  16. Influence of Hydrogen Sulfide Exposure on the Transport and Structural Properties of the Metal–Organic Framework ZIF-8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dutta, Akshita; Tymi?ska, Nina; Zhu, Guanghui

    In this paper, the interaction between hydrogen sulfide and ZIF-8 was studied via structural characterizations and guest molecule diffusion measurements. It was found that hydrogen sulfide reacts with the ZIF-8 external particle surface to form a surface barrier that excludes the uptake of larger molecules (ethanol) and slows down the uptake of smaller molecules (carbon dioxide). Nonetheless, bulk transport properties were unaltered, as supported by pulsed field gradient nuclear magnetic resonance studies. Dispersion-corrected density functional theory calculations revealed that H 2S is consumed by reactions occurring at the ZIF external surface. These reactions result in water and defect formation, bothmore » of which were found to be exothermic and independent of both crystallographic facets ({001} and {110}) and surface termination. Finally, we concluded that these surface reactions lead to structural and chemical changes to the ZIF-8 external surface that generate surface barriers to molecular transport.« less

  17. Influence of Hydrogen Sulfide Exposure on the Transport and Structural Properties of the Metal–Organic Framework ZIF-8

    DOE PAGES

    Dutta, Akshita; Tymi?ska, Nina; Zhu, Guanghui; ...

    2018-03-09

    In this paper, the interaction between hydrogen sulfide and ZIF-8 was studied via structural characterizations and guest molecule diffusion measurements. It was found that hydrogen sulfide reacts with the ZIF-8 external particle surface to form a surface barrier that excludes the uptake of larger molecules (ethanol) and slows down the uptake of smaller molecules (carbon dioxide). Nonetheless, bulk transport properties were unaltered, as supported by pulsed field gradient nuclear magnetic resonance studies. Dispersion-corrected density functional theory calculations revealed that H 2S is consumed by reactions occurring at the ZIF external surface. These reactions result in water and defect formation, bothmore » of which were found to be exothermic and independent of both crystallographic facets ({001} and {110}) and surface termination. Finally, we concluded that these surface reactions lead to structural and chemical changes to the ZIF-8 external surface that generate surface barriers to molecular transport.« less

  18. Structurally-driven Enhancement of Thermoelectric Properties within Poly(3,4-ethylenedioxythiophene) thin Films

    PubMed Central

    Petsagkourakis, Ioannis; Pavlopoulou, Eleni; Portale, Giuseppe; Kuropatwa, Bryan A.; Dilhaire, Stefan; Fleury, Guillaume; Hadziioannou, Georges

    2016-01-01

    Due to the rising need for clean energy, thermoelectricity has raised as a potential alternative to reduce dependence on fossil fuels. Specifically, thermoelectric devices based on polymers could offer an efficient path for near-room temperature energy harvesters. Thus, control over thermoelectric properties of conducting polymers is crucial and, herein, the structural, electrical and thermoelectric properties of poly(3,4-ethylenedioxythiophene) (PEDOT) thin films doped with p-toluenesulfonate (Tos) molecules were investigated with regards to thin film processing. PEDOT:Tos thin films were prepared by in-situ polymerization of (3,4-ethylenedioxythiophene) monomers in presence of iron(III) p-toluenesulfonate with different co-solvents in order to tune the film structure. While the Seebeck coefficient remained constant, a large improvement in the electrical conductivity was observed for thin films processed with high boiling point additives. The increase of electrical conductivity was found to be solely in-plane mobility-driven. Probing the thin film structure by Grazing Incidence Wide Angle X-ray Scattering has shown that this behavior is dictated by the structural properties of the PEDOT:Tos films; specifically by the thin film crystallinity combined to the preferential edge-on orientation of the PEDOT crystallites. Consequentially enhancement of the power factor from 25 to 78.5 μW/mK2 has been readily obtained for PEDOT:Tos thin films following this methodology. PMID:27470637

  19. Structurally-driven Enhancement of Thermoelectric Properties within Poly(3,4-ethylenedioxythiophene) thin Films.

    PubMed

    Petsagkourakis, Ioannis; Pavlopoulou, Eleni; Portale, Giuseppe; Kuropatwa, Bryan A; Dilhaire, Stefan; Fleury, Guillaume; Hadziioannou, Georges

    2016-07-29

    Due to the rising need for clean energy, thermoelectricity has raised as a potential alternative to reduce dependence on fossil fuels. Specifically, thermoelectric devices based on polymers could offer an efficient path for near-room temperature energy harvesters. Thus, control over thermoelectric properties of conducting polymers is crucial and, herein, the structural, electrical and thermoelectric properties of poly(3,4-ethylenedioxythiophene) (PEDOT) thin films doped with p-toluenesulfonate (Tos) molecules were investigated with regards to thin film processing. Tos thin films were prepared by in-situ polymerization of (3,4-ethylenedioxythiophene) monomers in presence of iron(III) p-toluenesulfonate with different co-solvents in order to tune the film structure. While the Seebeck coefficient remained constant, a large improvement in the electrical conductivity was observed for thin films processed with high boiling point additives. The increase of electrical conductivity was found to be solely in-plane mobility-driven. Probing the thin film structure by Grazing Incidence Wide Angle X-ray Scattering has shown that this behavior is dictated by the structural properties of the Tos films; specifically by the thin film crystallinity combined to the preferential edge-on orientation of the PEDOT crystallites. Consequentially enhancement of the power factor from 25 to 78.5 μW/mK(2) has been readily obtained for Tos thin films following this methodology.

  20. SerpentinaDB: a database of plant-derived molecules of Rauvolfia serpentina.

    PubMed

    Pathania, Shivalika; Ramakrishnan, Sai Mukund; Randhawa, Vinay; Bagler, Ganesh

    2015-08-04

    Plant-derived molecules (PDMs) are known to be a rich source of diverse scaffolds that could serve as a basis for rational drug design. Structured compilation of phytochemicals from traditional medicinal plants can facilitate prospection for novel PDMs and their analogs as therapeutic agents. Rauvolfia serpentina is an important medicinal plant, endemic to Himalayan mountain ranges of Indian subcontinent, reported to be of immense therapeutic value against various diseases. We present SerpentinaDB, a structured compilation of 147 R. serpentina PDMs, inclusive of their plant part source, chemical classification, IUPAC, SMILES, physicochemical properties, and 3D chemical structures with associated references. It also provides refined search option for identification of analogs of natural molecules against ZINC database at user-defined cut-off. SerpentinaDB is an exhaustive resource of R. serpentina molecules facilitating prospection for therapeutic molecules from a medicinally important source of natural products. It also provides refined search option to explore the neighborhood of chemical space against ZINC database to identify analogs of natural molecules obtained as leads. In a previous study, we have demonstrated the utility of this resource by identifying novel aldose reductase inhibitors towards intervention of complications of diabetes.

  1. Hydrothermal synthesis, crystal structure, luminescent and magnetic properties of a new mononuclear GdIII coordination complex

    NASA Astrophysics Data System (ADS)

    Coban, Mustafa Burak

    2018-06-01

    A new GdIII coordination complex, {[Gd(2-stp)2(H2O)6].2(4,4'-bipy).4(H2O)}, complex 1, (2-stp = 2-sulfoterephthalate anion and 4,4'-bipy = 4,4'-bipyridine), has been synthesized by hydrothermal method and characterized by elemental analysis, solid state UV-Vis and FT-IR spectroscopy, single-crystal X-ray diffraction, solid state photoluminescence and variable-temperature magnetic measurements. The crystal structure determination shows that GdIII ions are eight coordinated and adopt a distorted square-antiprismatic geometry. Molecules interacting through intra- and intermolecular (O-H⋯O, O-H⋯N) hydrogen bonds in complex 1, give rise to 3D hydrogen bonded structure and the discrete lattice 4,4'-bipy molecules occupy the channel of the 3D structure. π-π stacking interactions also exist 4,4'-bipy-4,4'-bipy and 4,4'-bipy-2-stp molecule rings in 3D structures. Additionally, solid state photoluminescence properties of complex 1 at room temperature have been investigated. Under the excitation of UV light (at 349 nm), the complex 1 exhibited green emissions (at 505 nm) of GdIII ion in the visible region. Furthermore, Variable-temperature magnetic susceptibility and isothermal magnetization as function of external magnetic field studies reveal that complex 1 displays possible antiferromagnetic interaction.

  2. Intense pumping and time- and frequency-resolved CARS for driving and tracking structural deformation and recovery of liquid nitromethane molecules

    NASA Astrophysics Data System (ADS)

    Wang, Chang; Wu, Hong-lin; Song, Yun-fei; He, Xing; Yang, Yan-qiang; Tan, Duo-wang

    2015-11-01

    A modified CARS technique with an intense nonresonant femtosecond laser is presented to drive the structural deformation of liquid nitromethane molecules and track their structural relaxation process. The CARS spectra reveal that the internal rotation of the molecule can couple with the CN symmetric stretching vibration and the molecules undergo ultrafast structural deformation of the CH3 groups from 'opened umbrella' to 'closed umbrella' shape, and then experience a structural recovery process within 720 fs.

  3. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  4. Single-molecule studies of multi-protein machines

    NASA Astrophysics Data System (ADS)

    van Oijen, Antoine

    2010-03-01

    Advances in optical imaging and molecular manipulation techniques have made it possible to observe individual enzymes and record molecular movies that provide new insight into their dynamics and reaction mechanisms. In a biological context, most of these enzymes function in concert with other enzymes in multi-protein complexes, so an important future direction will be the utilization of single-molecule techniques to unravel the orchestration of large macromolecular assemblies. Our group is developing the single-molecule tools that will make it possible to study biochemical pathways of arbitrary complexity at the single-molecule level. I will discuss results of single-molecule experiments on the replisome, the molecular machinery that is responsible for replication of DNA. We stretch individual DNA molecules and use their elastic properties to obtain dynamic information on the proteins that unwind the double helix and copy its genetic information. Furthermore, we visualize fluorescently labeled components of the replisome and thus obtain information on stochiometry and exchange kinetics. This simultaneous observation of catalytic activity and composition allows us to gain deeper insight into the structure-function relationship of the replisome.

  5. Electronic Structure of Energetic Molecules and Crystals Under Compression

    NASA Astrophysics Data System (ADS)

    Kay, Jeffrey

    Understanding how the electronic structure of energetic materials change under compression is important to elucidating mechanisms of shock-induced reactions and detonation. In this presentation, the electronic structure of prototypical energetic crystals are examined under high degrees of compression using ab initio quantum chemical calculations. The effects of compression on and interactions between the constituent molecules are examined in particular. The insights these results provide into previous experimental observations and theoretical predictions of energetic materials under high pressure are discussed. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. DOE's National Nuclear Security Administration under contract DE-AC04-94AL85000.

  6. Fabrication of a highly oriented line structure on an aluminum surface and the nanoscale patterning on the nanoscale structure using highly functional molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, Y.; Kato, H.; Takemura, S.

    2009-07-15

    The surface of an Al plate was treated with a combination of chemical and electrochemical processes for fabrication of surface nanoscale structures on Al plates. Chemical treatments by using acetone and pure water under supersonic waves were conducted on an Al surface. Additional electrochemical process in H{sub 2}SO{sub 4} solution created a finer and oriented nanoscale structure on the Al surface. Dynamic force microscopy (DFM) measurement clarified that the nanoscale highly oriented line structure was successfully created on the Al surface. The line distance was estimated approximately 30-40 nm. At the next stage, molecular patterning on the highly oriented linemore » structure by functional molecules such as copper phthalocyanine (CuPc) and fullerene C{sub 60} was also conducted. CuPc or C{sub 60} molecules were deposited on the highly oriented line structure on Al. A toluene droplet containing CuPc molecules was cast on the nanostructured Al plate and was extended on the surface. CuPc or C{sub 60} deposition on the nanostructured Al surface proceeded by evaporation of toluene. DFM and x-ray photoemission spectroscopy measurements demonstrated that a unique molecular pattern was fabricated so that the highly oriented groove channels were filled with the functional molecules.« less

  7. Communication: Gas-phase structural isomer identification by Coulomb explosion of aligned molecules

    NASA Astrophysics Data System (ADS)

    Burt, Michael; Amini, Kasra; Lee, Jason W. L.; Christiansen, Lars; Johansen, Rasmus R.; Kobayashi, Yuki; Pickering, James D.; Vallance, Claire; Brouard, Mark; Stapelfeldt, Henrik

    2018-03-01

    The gas-phase structures of four difluoroiodobenzene and two dihydroxybromobenzene isomers were identified by correlating the emission angles of atomic fragment ions created, following femtosecond laser-induced Coulomb explosion. The structural determinations were facilitated by confining the most polarizable axis of each molecule to the detection plane prior to the Coulomb explosion event using one-dimensional laser-induced adiabatic alignment. For a molecular target consisting of two difluoroiodobenzene isomers, each constituent structure could additionally be singled out and distinguished.

  8. Efficient optical nonlinear Langmuir-Blodgett films: roles of matrix molecules

    NASA Astrophysics Data System (ADS)

    Ma, Shihong; Lu, Xingze; Liu, Liying; Han, Kui; Wang, Wencheng; Zhang, Zhi-Ming

    1996-10-01

    A novel bifat-chain amphiphilic molecule nitrogencrown (NC) was adopted as an inert material for fabrication of optical nonlinear Langmuir-Blodgett (LB) multilayers. Structural improvement in the Z-type mixed fullerene derivative (C60-Be)/NC LB multilayers samples was realized by insertion of the C60-Be molecules between two hydrophobic chains of the NC molecules. The relatively large third-order susceptibility (chi) (3)xxxx(- 3(omega) ;(omega) ,(omega) ,(omega) ) equals 2.9 multiplied by 10-19 M2V-2 (or 2.1 multiplied by 10-11 esu) was deduced by measuring third harmonic generation (THG) from the C60-Be samples. The second harmonic generation (SHG) intensity increased quadratically with the bilayer number (up to 116 bilayers) in Y-type hemicyanine (HEM)/NC interleaving LB multilayers due to improvement of the structural properties by insertion of the long hydrophobic tail of HEM molecules between two chains of NC molecules. The second-order susceptibility (chi) (2)zxx(-2(omega) ;(omega) ,(omega) ) equals 18 pM V-1 (or 4.35 multiplied by 10-8 esu) was obtained by measuring SHG from the HEM samples. The NC molecule has attractive features as a matrix material in fabrications of LB multilayers made from optically nonlinear materials with hydrophobic long tails or ball-like molecules.

  9. Conformational, spectroscopic and nonlinear optical properties of biologically active N,N-dimethyltryptamine molecule: A theoretical study

    NASA Astrophysics Data System (ADS)

    Öner, Nazmiye; Tamer, Ömer; Avcı, Davut; Atalay, Yusuf

    2014-12-01

    The effective psychoactive properties of N,N-dimethyltryptamine (DMT) known as the near-death molecule have encouraged the imagination of many research disciplines for several decades. Although there is no theoretical study, a number of paper composed by experimental techniques have been reported for DMT molecule. In this study, the molecular modeling of DMT was carried out using B3LYP and HSEh1PBE levels of density functional theory (DFT). Our calculations showed that the energy gap between HOMO and LUMO is low, demonstrating that DMT is a biologically active molecule. Large hyperconjugation interaction energies imply that molecular charge transfer occurs in DMT. Moreover, NLO analysis indicates that DMT can be used an effective NLO material.

  10. Dielectric relaxation of guest molecules in a clathrate structure of syndiotactic polystyrene.

    PubMed

    Urakawa, Osamu; Kaneko, Fumitoshi; Kobayashi, Hideo

    2012-12-13

    Structure and dynamics of semicrystalline polymer films composed of syndiotactic polystyrene (sPS) and 2-butanone were examined through X-ray diffraction, polarized FTIR, and dielectric relaxation measurements. The X-ray and FTIR measurements revealed its crystal structure to be δ-clathrate containing 2-butanone molecules inside. The carbonyl group of 2-butanone in the crystal was found to orient preferentially parallel to the ac plane of the crystal through the polarized ATR FTIR measurements. Dielectric measurements were also conducted on these film samples to see only the relaxation dynamics of 2-butanone thanks to the high dielectric intensity of 2-butanone compared to sPS. Two relaxation modes denoted by slow and fast modes appeared. The former was assigned to the motion of 2-butanone molecules entrapped in the cavities of the crystalline (δ-form) and the latter to those in the amorphous region. We focused on the slow mode in order to elucidate the specific dynamics of the guest molecule confined in the crystalline region. The relaxation time of the slow mode was about 4 orders of magnitude longer than that of liquid 2-butanone. This suggests that the dynamics of guest molecules is highly restricted due to the high barrier to conformational and/or orientational change of the guest molecule in the cavity of δ-crystal. Furthermore, the dielectric intensity Δε of the slow mode was much smaller than the one calculated from that of bulk liquid 2-butanone and the guest concentration in the crystalline region (the intensity was only 10% of the estimated value from the bulk liquid data). This result also indicates that the free rotational motion of 2-butanone molecules is restricted inside the crystal. This will be consistently related to the weak uniplanar orientation of the carbonyl group of 2-butanone parallel to the ac plane revealed by the X-ray and polarized ATR FTIR measurements.

  11. The Structures & Properties of Carbon

    ERIC Educational Resources Information Center

    Castellini, Olivia M.; Lisensky, George C.; Ehrlich, Jennifer; Zenner, Greta M.; Crone, Wendy C.

    2006-01-01

    The four main forms of carbon--diamond, graphite, buckyballs, and carbon nanotubes (CNTs)--are an excellent vehicle for teaching fundamental principles of chemical bonding, material structure, and properties. Carbon atoms form a variety of structures that are intrinsically connected to the properties they exhibit. Educators can take advantage of…

  12. Hadronic molecules

    NASA Astrophysics Data System (ADS)

    Guo, Feng-Kun; Hanhart, Christoph; Meißner, Ulf-G.; Wang, Qian; Zhao, Qiang; Zou, Bing-Song

    2018-01-01

    A large number of experimental discoveries especially in the heavy quarkonium sector that did not meet the expectations of the until then very successful quark model led to a renaissance of hadron spectroscopy. Among various explanations of the internal structure of these excitations, hadronic molecules, being analogs of light nuclei, play a unique role since for those predictions can be made with controlled uncertainty. Experimental evidence of various candidates of hadronic molecules and methods of identifying such structures are reviewed. Nonrelativistic effective field theories are the suitable framework for studying hadronic molecules and are discussed in both the continuum and finite volumes. Also pertinent lattice QCD results are presented. Further, the production mechanisms and decays of hadronic molecules are discussed and comments are given on the reliability of certain assertions often made in the literature.

  13. Structures and chemical properties of silicene: unlike graphene.

    PubMed

    Jose, Deepthi; Datta, Ayan

    2014-02-18

    The discovery of graphene and its remarkable and exotic properties have aroused interest in other elements and molecules that form 2D atomic layers, such as metal chalcogenides, transition metal oxides, boron nitride, silicon, and germanium. Silicene and germanene, the Si and Ge counterparts of graphene, have interesting fundamental physical properties with potential applications in technology. For example, researchers expect that silicene will be relatively easy to incorporate within existing silicon-based electronics. In this Account, we summarize the challenges and progress in the field of silicene research. Theoretical calculations have predicted that silicene possesses graphene-like properties such as massless Dirac fermions that carry charge and the quantum spin Hall effect. Researchers are actively exploring the physical and chemical properties of silicene and tailoring it for wide variety of applications. The symmetric buckling in each of the six-membered rings of silicene differentiates it from graphene and imparts a variety of interesting properties with potential technological applications. The pseudo-Jahn-Teller (PJT) distortion breaks the symmetry and leads to the buckling in silicenes. In graphene, the two sublattice structures are equivalent, which does not allow for the opening of the band gap by an external electric field. However, in silicene where the neighboring Si atoms are displaced alternatively perpendicular to the plane, the intrinsic buckling permits a band gap opening in silicene in the presence of external electric field. Silicene's stronger spin orbit coupling than graphene has far reaching applications in spintronic devices. Because silicon prefers sp(3) hybridization over sp(2), hydrogenation is much easier in silicene. The hydrogenation of silicene to form silicane opens the band gap and increases the puckering angle. Lithiation can suppress the pseudo-Jahn-Teller distortion in silicene and hence can flatten silicene's structure

  14. The first 3-D LaIII-SrII heterometallic complex: Synthesis, structure and luminescent properties

    NASA Astrophysics Data System (ADS)

    Hong, Zhiwei; Ran, Jingwen; Li, Tao; Chen, Yanmei

    2016-10-01

    The first 3-D LaIII-SrII heterometallic complex, namely [La2Sr(pda)4(H2O)4]n·6nH2O (1, H2pda = pyridine-2,6-dicarboxylic acid), has been successfully synthesized under solvothermal conditions. Single crystal X-ray diffraction analysis reveals that complex 1 features a 3-D porous framework and displays a new topology. The crystal structure can be simplified to a 4,6-connected 3-D network with Schläfli symbol of {34·42·88·9}2{34·42}. The crystals also have been characterized by X-ray powder diffraction, elemental analysis, thermal analysis, and IR spectroscopy. The infrared spectral analysis indicates that complex 1 is a carboxylate coordinated compound, several water molecules exist in the compound. The thermal study shows that there are ten water molecules in the crystal structure. The luminescent property has also been investigated. It shows a blue-purple fluorescence emission.

  15. Thermodynamic and Structural Properties of Methanol-Water Solutions Using Non-Additive Interaction Models

    PubMed Central

    Zhong, Yang; Warren, G. Lee; Patel, Sandeep

    2014-01-01

    We study bulk structural and thermodynamic properties of methanol-water solutions via molecular dynamics simulations using novel interaction potentials based on the charge equilibration (fluctuating charge) formalism to explicitly account for molecular polarization at the atomic level. The study uses the TIP4P-FQ potential for water-water interactions, and the CHARMM-based (Chemistry at HARvard Molecular Mechanics) fluctuating charge potential for methanol-methanol and methanol-water interactions. In terms of bulk solution properties, we discuss liquid densities, enthalpies of mixing, dielectric constants, self-diffusion constants, as well as structural properties related to local hydrogen bonding structure as manifested in radial distribution functions and cluster analysis. We further explore the electronic response of water and methanol in the differing local environments established by the interaction of each species predominantly with molecules of the other species. The current force field for the alcohol-water interaction performs reasonably well for most properties, with the greatest deviation from experiment observed for the excess mixing enthalpies, which are predicted to be too favorable. This is qualitatively consistent with the overestimation of the methanol-water gas-phase interaction energy for the lowest-energy conformer (methanol as proton donor). Hydration free energies for methanol in TIP4P-FQ water are predicted to be −5.6±0.2 kcal/mole, in respectable agreement with the experimental value of −5.1 kcal/mole. With respect to solution micro-structure, the present cluster analysis suggests that the micro-scale environment for concentrations where select thermodynamic quantities reach extremal values is described by a bi-percolating network structure. PMID:18074339

  16. Structural and vibrational study of a neurotransmitter molecule: Dopamine [4-(2-aminoethyl) benzene-1,2-diol].

    PubMed

    Jha, Omkant; Yadav, T K; Yadav, R A

    2018-01-15

    Structural and vibrational studies for the most stable conformer of dopamine {4-(2-Aminoethyl) benzene-1, 2-diol} have been carried out at the DFT/B3LYP/6-311++G** level using the Gaussian 09 software. The IR and Raman spectra have been recorded and analyzed in light of the computed vibrational parameters using the DFT and the PEDs computed with the help of the GAR2PED software. Some of the fundamentals have considerably changed frequencies in going from benzene to dopamine. Except the rocking and wagging modes of the NH 2 group the other four modes are pure group modes. The rocking and wagging modes of the NH 2 group show mixing with the other modes. The two OH stretching vibrations are highly localized modes. The Kekule phenyl ring stretching mode is found to remain almost unchanged. The HOMO-LUMO study suggests the existence of charge transfer within the molecule and the energy gap supports the pharmacological active property of the dopamine molecule. The NBO analysis has been carried out to understand the proper and improper hydrogen bonding. Copyright © 2017. Published by Elsevier B.V.

  17. Computational design of molecules for an all-quinone redox flow battery.

    PubMed

    Er, Süleyman; Suh, Changwon; Marshak, Michael P; Aspuru-Guzik, Alán

    2015-02-01

    Inspired by the electron transfer properties of quinones in biological systems, we recently showed that quinones are also very promising electroactive materials for stationary energy storage applications. Due to the practically infinite chemical space of organic molecules, the discovery of additional quinones or other redox-active organic molecules for energy storage applications is an open field of inquiry. Here, we introduce a high-throughput computational screening approach that we applied to an accelerated study of a total of 1710 quinone (Q) and hydroquinone (QH 2 ) ( i.e. , two-electron two-proton) redox couples. We identified the promising candidates for both the negative and positive sides of organic-based aqueous flow batteries, thus enabling an all-quinone battery. To further aid the development of additional interesting electroactive small molecules we also provide emerging quantitative structure-property relationships.

  18. Using more than 801 296 small-molecule crystal structures to aid in protein structure refinement and analysis

    PubMed Central

    Cole, Jason C.

    2017-01-01

    The Cambridge Structural Database (CSD) is the worldwide resource for the dissemination of all published three-dimensional structures of small-molecule organic and metal–organic compounds. This paper briefly describes how this collection of crystal structures can be used en masse in the context of macromolecular crystallography. Examples highlight how the CSD and associated software aid protein–ligand complex validation, and show how the CSD could be further used in the generation of geometrical restraints for protein structure refinement. PMID:28291758

  19. Asymmetric nanopore membranes: Single molecule detection and unique transport properties

    NASA Astrophysics Data System (ADS)

    Bishop, Gregory William

    Biological systems rely on the transport properties of transmembrane channels. Such pores can display selective transport by allowing the passage of certain ions or molecules while rejecting others. Recent advances in nanoscale fabrication have allowed the production of synthetic analogs of such channels. Synthetic nanopores (pores with a limiting dimension of 1--100 nm) can be produced in a variety of materials by several different methods. In the Martin group, we have been exploring the track-etch method to produce asymmetric nanopores in thin films of polymeric or crystalline materials. Asymmetric nanopores are of particular interest due to their ability to serve as ion-current rectifiers. This means that when a membrane that contains such a pore or collection of pores is used to separate identical portions of electrolyte solution, the magnitude of the ionic current will depend not only on the magnitude of the applied potential (as expected) but also the polarity. Ion-current rectification is characterized by an asymmetric current--potential response. Here, the interesting transport properties of asymmetric nanopores (ion-current rectification and the related phenomenon of electroosmotic flow rectification) are explored. The effects of pore shape and pore density on these phenomena are investigated. Membranes that contain a single nanopore can serve as platforms for the single-molecule sensing technique known as resistive pulse sensing. The resistive-pulse sensing method is based on the Coulter principle. Thus, the selectivity of the technique is based largely upon size, making the analysis of mixtures by this method difficult in many cases. Here, the surface of a single nanopore membrane is modified with a molecular recognition agent in an attempt to obtain a more selective resistive-pulse sensor for a specific analyte.

  20. Measurement and control of detailed electronic properties in a single molecule break junction.

    PubMed

    Wang, Kun; Hamill, Joseph; Zhou, Jianfeng; Guo, Cunlan; Xu, Bingqian

    2014-01-01

    The lack of detailed experimental controls has been one of the major obstacles hindering progress in molecular electronics. While large fluctuations have been occurring in the experimental data, specific details, related mechanisms, and data analysis techniques are in high demand to promote our physical understanding at the single-molecule level. A series of modulations we recently developed, based on traditional scanning probe microscopy break junctions (SPMBJs), have helped to discover significant properties in detail which are hidden in the contact interfaces of a single-molecule break junction (SMBJ). For example, in the past we have shown that the correlated force and conductance changes under the saw tooth modulation and stretch-hold mode of PZT movement revealed inherent differences in the contact geometries of a molecular junction. In this paper, using a bias-modulated SPMBJ and utilizing emerging data analysis techniques, we report on the measurement of the altered alignment of the HOMO of benzene molecules with changing the anchoring group which coupled the molecule to metal electrodes. Further calculations based on Landauer fitting and transition voltage spectroscopy (TVS) demonstrated the effects of modulated bias on the location of the frontier molecular orbitals. Understanding the alignment of the molecular orbitals with the Fermi level of the electrodes is essential for understanding the behaviour of SMBJs and for the future design of more complex devices. With these modulations and analysis techniques, fruitful information has been found about the nature of the metal-molecule junction, providing us insightful clues towards the next step for in-depth study.

  1. High thermopower of mechanically stretched single-molecule junctions

    PubMed Central

    Tsutsui, Makusu; Morikawa, Takanori; He, Yuhui; Arima, Akihide

    2015-01-01

    Metal-molecule-metal junction is a promising candidate for thermoelectric applications that utilizes quantum confinement effects in the chemically defined zero-dimensional atomic structure to achieve enhanced dimensionless figure of merit ZT. A key issue in this new class of thermoelectric nanomaterials is to clarify the sensitivity of thermoelectricity on the molecular junction configurations. Here we report simultaneous measurements of the thermoelectric voltage and conductance on Au-1,4-benzenedithiol (BDT)-Au junctions mechanically-stretched in-situ at sub-nanoscale. We obtained the average single-molecule conductance and thermopower of 0.01 G0 and 15 μV/K, respectively, suggesting charge transport through the highest occupied molecular orbital. Meanwhile, we found the single-molecule thermoelectric transport properties extremely-sensitive to the BDT bridge configurations, whereby manifesting the importance to design the electrode-molecule contact motifs for optimizing the thermoelectric performance of molecular junctions. PMID:26112999

  2. Effects of sub-lethal high-pressure homogenization treatment on the outermost cellular structures and the volatile-molecule profiles of two strains of probiotic lactobacilli.

    PubMed

    Tabanelli, Giulia; Vernocchi, Pamela; Patrignani, Francesca; Del Chierico, Federica; Putignani, Lorenza; Vinderola, Gabriel; Reinheimer, Jorge A; Gardini, Fausto; Lanciotti, Rosalba

    2015-01-01

    Applying sub-lethal levels of high-pressure homogenization (HPH) to lactic acid bacteria has been proposed as a method of enhancing some of their functional properties. Because the principal targets of HPH are the cell-surface structures, the aim of this study was to examine the effect of sub-lethal HPH treatment on the outermost cellular structures and the proteomic profiles of two known probiotic bacterial strains. Moreover, the effect of HPH treatment on the metabolism of probiotic cells within a dairy product during its refrigerated storage was investigated using SPME-GC-MS. Transmission electron microscopy was used to examine the microstructural changes in the outermost cellular structures due to HPH treatment. These alterations may be involved in the changes in some of the technological and functional properties of the strains that were observed after pressure treatment. Moreover, the proteomic profiles of the probiotic strains treated with HPH and incubated at 37°C for various periods showed different peptide patterns compared with those of the untreated cells. In addition, there were differences in the peaks that were observed in the low-mass spectral region (2000-3000 Da) of the spectral profiles of the control and treated samples. Due to pressure treatment, the volatile-molecule profiles of buttermilk inoculated with treated or control cells and stored at 4°C for 30 days exhibited overall changes in the aroma profile and in the production of molecules that improved its sensory profile, although the two different species imparted specific fingerprints to the product. The results of this study will contribute to understanding the changes that occur in the outermost cellular structures and the metabolism of LAB in response to HPH treatment. The findings of this investigation may contribute to elucidating the relationships between these changes and the alterations of the technological and functional properties of LAB induced by pressure treatment.

  3. Structure-Property Relationships of Architectural Coatings by Neutron Methods

    NASA Astrophysics Data System (ADS)

    Nakatani, Alan

    2015-03-01

    Architectural coatings formulations are multi-component mixtures containing latex polymer binder, pigment, rheology modifiers, surfactants, and colorants. In order to achieve the desired flow properties for these formulations, measures of the underlying structure of the components as a function of shear rate and the impact of formulation variables on the structure is necessary. We have conducted detailed measurements to understand the evolution under shear of local microstructure and larger scale mesostructure in model architectural coatings formulations by small angle neutron scattering (SANS) and ultra small angle neutron scattering (USANS), respectively. The SANS results show an adsorbed layer of rheology modifier molecules exist on the surface of the latex particles. However, the additional hydrodynamic volume occupied by the adsorbed surface layer is insufficient to account for the observed viscosity by standard hard sphere suspension models (Krieger-Dougherty). The USANS results show the presence of latex aggregates, which are fractal in nature. These fractal aggregates are the primary structures responsible for coatings formulation viscosity. Based on these results, a new model for the viscosity of coatings formulations has been developed, which is capable of reproducing the observed viscosity behavior.

  4. Rational selection of structurally diverse natural product scaffolds with favorable ADME properties for drug discovery.

    PubMed

    Samiulla, D S; Vaidyanathan, V V; Arun, P C; Balan, G; Blaze, M; Bondre, S; Chandrasekhar, G; Gadakh, A; Kumar, R; Kharvi, G; Kim, H O; Kumar, S; Malikayil, J A; Moger, M; Mone, M K; Nagarjuna, P; Ogbu, C; Pendhalkar, D; Rao, A V S Raja; Rao, G Venkateshwar; Sarma, V K; Shaik, S; Sharma, G V R; Singh, S; Sreedhar, C; Sonawane, R; Timmanna, U; Hardy, L W

    2005-01-01

    Natural product analogs are significant sources for therapeutic agents. To capitalize efficiently on the effective features of naturally occurring substances, a natural product-based library production platform has been devised at Aurigene for drug lead discovery. This approach combines the attractive biological and physicochemical properties of natural product scaffolds, provided by eons of natural selection, with the chemical diversity available from parallel synthetic methods. Virtual property analysis, using computational methods described here, guides the selection of a set of natural product scaffolds that are both structurally diverse and likely to have favorable pharmacokinetic properties. The experimental characterization of several in vitro ADME properties of twenty of these scaffolds, and of a small set of designed congeners based upon one scaffold, is also described. These data confirm that most of the scaffolds and the designed library members have properties favorable to their utilization for creating libraries of lead-like molecules.

  5. Adsorption of organic molecules on mineral surfaces studied by first-principle calculations: A review.

    PubMed

    Zhao, Hongxia; Yang, Yong; Shu, Xin; Wang, Yanwei; Ran, Qianping

    2018-04-09

    First-principle calculations, especially by the density functional theory (DFT) methods, are becoming a power technique to study molecular structure and properties of organic/inorganic interfaces. This review introduces some recent examples on the study of adsorption models of organic molecules or oligomers on mineral surfaces and interfacial properties obtained from first-principles calculations. The aim of this contribution is to inspire scientists to benefit from first-principle calculations and to apply the similar strategies when studying and tailoring interfacial properties at the atomistic scale, especially for those interested in the design and development of new molecules and new products. Copyright © 2017. Published by Elsevier B.V.

  6. Impact of Dendrimers on Solubility of Hydrophobic Drug Molecules

    PubMed Central

    Choudhary, Sonam; Gupta, Lokesh; Rani, Sarita; Dave, Kaushalkumar; Gupta, Umesh

    2017-01-01

    Adequate aqueous solubility has been one of the desired properties while selecting drug molecules and other bio-actives for product development. Often solubility of a drug determines its pharmaceutical and therapeutic performance. Majority of newly synthesized drug molecules fail or are rejected during the early phases of drug discovery and development due to their limited solubility. Sufficient permeability, aqueous solubility and physicochemical stability of the drug are important for achieving adequate bioavailability and therapeutic outcome. A number of different approaches including co-solvency, micellar solubilization, micronization, pH adjustment, chemical modification, and solid dispersion have been explored toward improving the solubility of various poorly aqueous-soluble drugs. Dendrimers, a new class of polymers, possess great potential for drug solubility improvement, by virtue of their unique properties. These hyper-branched, mono-dispersed molecules have the distinct ability to bind the drug molecules on periphery as well as to encapsulate these molecules within the dendritic structure. There are numerous reported studies which have successfully used dendrimers to enhance the solubilization of poorly soluble drugs. These promising outcomes have encouraged the researchers to design, synthesize, and evaluate various dendritic polymers for their use in drug delivery and product development. This review will discuss the aspects and role of dendrimers in the solubility enhancement of poorly soluble drugs. The review will also highlight the important and relevant properties of dendrimers which contribute toward drug solubilization. Finally, hydrophobic drugs which have been explored for dendrimer assisted solubilization, and the current marketing status of dendrimers will be discussed. PMID:28559844

  7. π-π Interaction among violanthrone molecules: observation, enhancement, and resulting charge transport properties.

    PubMed

    Shi, Min-Min; Chen, Yi; Nan, Ya-Xiong; Ling, Jun; Zuo, Li-Jian; Qiu, Wei-Ming; Wang, Mang; Chen, Hong-Zheng

    2011-02-03

    To investigate the relationship between π-π stacking and charge transport property of organic semiconductors, a highly soluble violanthrone derivative, 16,17-bis(2-ethylhexyloxy)anthra[9,1,2-cde-]benzo[rst]pentaphene-5,10-dione (3), is designed and synthesized. The π-π stacking behavior and the aggregation of compound 3 in both solution and thin film were studied in detail by (1)H nuclear magnetic resonance (NMR) spectroscopy, ultraviolet-visible (UV-vis) absorption, X-ray diffraction (XRD), and atomic force microscopy (AFM). When (1)H NMR spectroscopy and theoretical modeling results were combined, the arrangements of compound 3 molecules in the aggregates are demonstrated, where the dipole moments of the two adjacent molecules are nearly reversed to achieve efficient intermolecular π-π overlapping. Furthermore, it is interesting to find that the π-π stacking of compound 3, in both solution and thin films, can be enhanced by introducing a poor solvent n-hexane into the dilute chloroform solution. The resulting film exhibits more red-shifted absorption and higher crystallinity than the film made from pure chloroform solvent, suggesting that π-π interactions in the solid state are intensified by the poor solvent. Organic field-effect transistors (OFETs) with compound 3 film as the transportation layer were fabricated. It is disclosed that the compound 3 film obtained from the chloroform/n-hexane mixed solvents exhibits 1 order of magnitude higher hole mobility than that from the pure chloroform solvent because of the enhanced π-π interactions and the higher crystallinity in the former film. This work provided us valuable information in the improvement of electronic and optoelectronic performances of organic semiconductors by tuning their aggregate structures.

  8. Enhancement of Raman scattering signal of a few molecules using photonic nanojet mediated SERS technique

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Das, G. M.; Parit, M. K.; Laha, R.

    2016-05-06

    Now a days, single molecule surface enhanced Raman spectroscopy (SMSERS) has become a fascinating tool for studying the structural properties, static and dynamic events of single molecules (instead of ensemble average), with the help of efficient plasmonic nanostructures. This is extremely useful in the field of proteomics because the structural properties of protein molecules are heterogeneous. Even though, SMSERS provides wealthy information about single molecules, it demands high quality surface enhanced Raman scattering (SERS) substrates. So far, a very few researchers succeeded in demonstrating the single molecule Raman scattering using conventional SERS technique. However, the experimental S/N of the Ramanmore » signal has been found to be very poor. Recently, with the help of photonic nanojet of an optical microsphere, we were able to enhance the SERS signal of a few molecules adsorbed on the SERS substrates (gold symmetric and asymmetric nanodimers and trimers dispersed on a glass slide). Herein, we report a few details about photonic nanojet mediated SERS technique, a few experimental results and a detailed theoretical study on symmetric and asymmetric nanosphere dimers to understand the dependence of localised surface plasmon resonance (LSPR) wavelength of a nanodimer on the nanogap size and polarization of the excitation light.« less

  9. Conformational, spectroscopic and nonlinear optical properties of biologically active N,N-dimethyltryptamine molecule: a theoretical study.

    PubMed

    Öner, Nazmiye; Tamer, Ömer; Avcı, Davut; Atalay, Yusuf

    2014-12-10

    The effective psychoactive properties of N,N-dimethyltryptamine (DMT) known as the near-death molecule have encouraged the imagination of many research disciplines for several decades. Although there is no theoretical study, a number of paper composed by experimental techniques have been reported for DMT molecule. In this study, the molecular modeling of DMT was carried out using B3LYP and HSEh1PBE levels of density functional theory (DFT). Our calculations showed that the energy gap between HOMO and LUMO is low, demonstrating that DMT is a biologically active molecule. Large hyperconjugation interaction energies imply that molecular charge transfer occurs in DMT. Moreover, NLO analysis indicates that DMT can be used an effective NLO material. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Individual Magnetic Molecules on Ultrathin Insulating Surfaces

    NASA Astrophysics Data System (ADS)

    El Hallak, Fadi; Warner, Ben; Hirjibehedin, Cyrus

    2012-02-01

    Single molecule magnets have attracted ample interest because of their exciting magnetic and quantum properties. Recent studies have demonstrated that some of these molecules can be evaporated on surfaces without losing their magnetic properties [M. Mannini et al., Nature 468, 417, (2010)]. This remarkable progress enhances the chances of real world applications for these molecules. We present STM imaging and spectroscopy data on iron phthalocyanine molecules deposited on Cu(100) and on a Cu2N ultrathin insulating surface. These molecules have been shown to display a large magnetic anisotropy on another thin insulating surface, oxidized Cu(110) [N. Tsukahara et al., Phys. Rev. Lett. 102, 167203 (2009)]. By using a combination of elastic and inelastic electron tunnelling spectroscopy, we investigate the binding of the molecules to the surface and the impact that the surface has on their electronic and magnetic properties.

  11. [Crystal structure of SMU.2055 protein from Streptococcus mutans and its small molecule inhibitors design and selection].

    PubMed

    Xiaodan, Chen; Xiurong, Zhan; Xinyu, Wu; Chunyan, Zhao; Wanghong, Zhao

    2015-04-01

    The aim of this study is to analyze the three-dimensional crystal structure of SMU.2055 protein, a putative acetyltransferase from the major caries pathogen Streptococcus mutans (S. mutans). The design and selection of the structure-based small molecule inhibitors are also studied. The three-dimensional crystal structure of SMU.2055 protein was obtained by structural genomics research methods of gene cloning and expression, protein purification with Ni²⁺-chelating affinity chromatography, crystal screening, and X-ray diffraction data collection. An inhibitor virtual model matching with its target protein structure was set up using computer-aided drug design methods, virtual screening and fine docking, and Libdock and Autodock procedures. The crystal of SMU.2055 protein was obtained, and its three-dimensional crystal structure was analyzed. This crystal was diffracted to a resolution of 0.23 nm. It belongs to orthorhombic space group C222(1), with unit cell parameters of a = 9.20 nm, b = 9.46 nm, and c = 19.39 nm. The asymmetric unit contained four molecules, with a solvent content of 56.7%. Moreover, five small molecule compounds, whose structure matched with that of the target protein in high degree, were designed and selected. Protein crystallography research of S. mutans SMU.2055 helps to understand the structures and functions of proteins from S. mutans at the atomic level. These five compounds may be considered as effective inhibitors to SMU.2055. The virtual model of small molecule inhibitors we built will lay a foundation to the anticaries research based on the crystal structure of proteins.

  12. Self-assembly of conjugated oligomers and polymers at the interface: structure and properties.

    PubMed

    Xu, Lirong; Yang, Liu; Lei, Shengbin

    2012-08-07

    In this review, we give a brief account on the recent scanning tunneling microscopy investigation of interfacial structures and properties of π-conjugated semiconducting oligomers and polymers, either at the solid-air (including solid-vacuum) or at the solid-liquid interface. The structural aspects of the self-assembly of both oligomers and polymers are highlighted. Conjugated oligomers can form well ordered supramolecular assemblies either at the air-solid or liquid-solid interface, thanks to the relatively high mobility and structural uniformity in comparison with polymers. The backbone structure, substitution of side chains and functional groups can affect the assembling behavior significantly, which offers the opportunity to tune the supramolecular structure of these conjugated oligomers at the interface. For conjugated polymers, the large molecular weight limits the mobility on the surface and the distribution in size also prevents the formation of long range ordered supramolecular assembly. The submolecular resolution obtained on the assembling monolayers enables a detailed investigation of the chain folding at the interface, both the structural details and the effect on electronic properties. Besides the ability in studying the assembling structures at the interfaces, STM also provides a reasonable way to evaluate the distribution of the molecular weight of conjugated polymers by statistic of the contour length of the adsorbed polymer chains. Both conjugated oligomers and polymers can form composite assemblies with other materials. The ordered assembly of oligomers can act as a template to controllably disperse other molecules such as coronene or fullerene. These investigations open a new avenue to fine tune the assembling structure at the interface and in turn the properties of the composite materials. To summarize scanning tunneling microscopy has demonstrated its surprising ability in the investigation of the assembling structures and properties of

  13. ChemNet: A Transferable and Generalizable Deep Neural Network for Small-Molecule Property Prediction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goh, Garrett B.; Siegel, Charles M.; Vishnu, Abhinav

    With access to large datasets, deep neural networks through representation learning have been able to identify patterns from raw data, achieving human-level accuracy in image and speech recognition tasks. However, in chemistry, availability of large standardized and labelled datasets is scarce, and with a multitude of chemical properties of interest, chemical data is inherently small and fragmented. In this work, we explore transfer learning techniques in conjunction with the existing Chemception CNN model, to create a transferable and generalizable deep neural network for small-molecule property prediction. Our latest model, ChemNet learns in a semi-supervised manner from inexpensive labels computed frommore » the ChEMBL database. When fine-tuned to the Tox21, HIV and FreeSolv dataset, which are 3 separate chemical tasks that ChemNet was not originally trained on, we demonstrate that ChemNet exceeds the performance of existing Chemception models, contemporary MLP models that trains on molecular fingerprints, and it matches the performance of the ConvGraph algorithm, the current state-of-the-art. Furthermore, as ChemNet has been pre-trained on a large diverse chemical database, it can be used as a universal “plug-and-play” deep neural network, which accelerates the deployment of deep neural networks for the prediction of novel small-molecule chemical properties.« less

  14. The mechanism and properties of bio-photon emission and absorption in protein molecules in living systems

    NASA Astrophysics Data System (ADS)

    Pang, Xiao-feng

    2012-05-01

    The mechanism and properties of bio-photon emission and absorption in bio-tissues were studied using Pang's theory of bio-energy transport, in which the energy spectra of protein molecules are obtained from the discrete dynamic equation. From the energy spectra, it was determined that the protein molecules could both radiate and absorb bio-photons with wavelengths of <3 μm and 5-7 μm, consistent with the energy level transitions of the excitons. These results were consistent with the experimental data; this consisted of infrared absorption data from collagen, bovine serum albumin, the protein-like molecule acetanilide, plasma, and a person's finger, and the laser-Raman spectra of acidity I-type collagen in the lungs of a mouse, and metabolically active Escherichia coli. We further elucidated the mechanism responsible for the non-thermal biological effects produced by the infrared light absorbed by the bio-tissues, using the above results. No temperature rise was observed; instead, the absorbed infrared light promoted the vibrations of amides as well the transport of the bio-energy from one place to other in the protein molecules, which changed their conformations. These experimental results, therefore, not only confirmed the validity of the mechanism of bio-photon emission, and the newly developed theory of bio-energy transport mentioned above, but also explained the mechanism and properties of the non-thermal biological effects produced by the absorption of infrared light by the living systems.

  15. Fine structure and optical properties of biological polarizers in crustaceans and cephalopods

    NASA Astrophysics Data System (ADS)

    Chiou, Tsyr-Huei; Caldwell, Roy L.; Hanlon, Roger T.; Cronin, Thomas W.

    2008-04-01

    The lighting of the underwater environment is constantly changing due to attenuation by water, scattering by suspended particles, as well as the refraction and reflection caused by the surface waves. These factors pose a great challenge for marine animals which communicate through visual signals, especially those based on color. To escape this problem, certain cephalopod mollusks and stomatopod crustaceans utilize the polarization properties of light. While the mechanisms behind the polarization vision of these two animal groups are similar, several distinctive types of polarizers (i.e. the structure producing the signal) have been found in these animals. To gain a better knowledge of how these polarizers function, we studied the relationships between fine structures and optical properties of four types of polarizers found in cephalopods and stomatopods. Although all the polarizers share a somewhat similar spectral range, around 450- 550 nm, the reflectance properties of the signals and the mechanisms used to produce them have dramatic differences. In cephalopods, stack-plates polarizers produce the polarization patterns found on the arms and around their eyes. In stomatopods, we have found one type of beam-splitting polarizer based on photonic structures and two absorptive polarizer types based on dichroic molecules. These stomatopod polarizers may be found on various appendages, and on the cuticle covering dorsal or lateral sides of the animal. Since the efficiencies of all these polarizer types are somewhat sensitive to the change of illumination and viewing angle, how these animals compensate with different behaviors or fine structural features of the polarizer also varies.

  16. Modeling molecule-plasmon interactions using quantized radiation fields within time-dependent electronic structure theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nascimento, Daniel R.; DePrince, A. Eugene, E-mail: deprince@chem.fsu.edu

    2015-12-07

    We present a combined cavity quantum electrodynamics/ab initio electronic structure approach for simulating plasmon-molecule interactions in the time domain. The simple Jaynes-Cummings-type model Hamiltonian typically utilized in such simulations is replaced with one in which the molecular component of the coupled system is treated in a fully ab initio way, resulting in a computationally efficient description of general plasmon-molecule interactions. Mutual polarization effects are easily incorporated within a standard ground-state Hartree-Fock computation, and time-dependent simulations carry the same formal computational scaling as real-time time-dependent Hartree-Fock theory. As a proof of principle, we apply this generalized method to the emergence ofmore » a Fano-like resonance in coupled molecule-plasmon systems; this feature is quite sensitive to the nanoparticle-molecule separation and the orientation of the molecule relative to the polarization of the external electric field.« less

  17. Small molecules targeting viral RNA.

    PubMed

    Hermann, Thomas

    2016-11-01

    Highly conserved noncoding RNA (ncRNA) elements in viral genomes and transcripts offer new opportunities to expand the repertoire of drug targets for the development of antiinfective therapy. Ligands binding to ncRNA architectures are able to affect interactions, structural stability or conformational changes and thereby block processes essential for viral replication. Proof of concept for targeting functional RNA by small molecule inhibitors has been demonstrated for multiple viruses with RNA genomes. Strategies to identify antiviral compounds as inhibitors of ncRNA are increasingly emphasizing consideration of drug-like properties of candidate molecules emerging from screening and ligand design. Recent efforts of antiviral lead discovery for RNA targets have provided drug-like small molecules that inhibit viral replication and include inhibitors of human immunodeficiency virus (HIV), hepatitis C virus (HCV), severe respiratory syndrome coronavirus (SARS CoV), and influenza A virus. While target selectivity remains a challenge for the discovery of useful RNA-binding compounds, a better understanding is emerging of properties that define RNA targets amenable for inhibition by small molecule ligands. Insight from successful approaches of targeting viral ncRNA in HIV, HCV, SARS CoV, and influenza A will provide a basis for the future exploration of RNA targets for therapeutic intervention in other viral pathogens which create urgent, unmet medical needs. Viruses for which targeting ncRNA components in the genome or transcripts may be promising include insect-borne flaviviruses (Dengue, Zika, and West Nile) and filoviruses (Ebola and Marburg). WIREs RNA 2016, 7:726-743. doi: 10.1002/wrna.1373 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.

  18. Characterizing and engineering tunable spin functionality inside indium arsenide/gallium arsenide quantum dot molecules

    NASA Astrophysics Data System (ADS)

    Liu, Weiwen

    The continual downsizing of the basic functional units used in the electronics industry has motivated the study of the quantum computation and related topics. To overcome the limitations of classical physics and engineering, some unique quantum mechanical features, especially entanglement and superpositions have begun to be considered as important properties for future bits. Including these quantum mechanical features is attractive because the ability to utilize quantum mechanics can dramatically enhance computational power. Among the various ways of constructing the basic building blocks for quantum computation, we are particularly interested in using spins inside epitaxially grown InAs/GaAs quantum dot molecules as quantum bits (qubits). The ability to design and engineer nanostructures with tailored quantum properties is critical to engineering quantum computers and other novel electro-optical devices and is one of the key challenges for scaling up new ideas for device application. In this thesis, we will focus on how the structure and composition of quantum dot molecules can be used to control spin properties and charge interactions. Tunable spin and charge properties can enable new, more scalable, methods of initializing and manipulating quantum information. In this thesis, we demonstrate one method to enable electric-field tunability of Zeeman splitting for a single electron spin inside a quantum dot molecules by using heterostructure engineering techniques to modify the barrier that separates quantum dots. We describe how these structural changes to the quantum dot molecules also change charge interactions and propose ways to use this effect to enable accurate measurement of coulomb interactions and possibly charge occupancy inside these complicated quantum dot molecules.

  19. Structure, processing, and properties of potatoes

    NASA Astrophysics Data System (ADS)

    Lloyd, Isabel K.; Kolos, Kimberly R.; Menegaux, Edmond C.; Luo, Huy; McCuen, Richard H.; Regan, Thomas M.

    1992-06-01

    The objective of this experiment and lesson intended for high school students in an engineering or materials science course or college freshmen is to demonstrate the relation between processing, structure, and thermodynamic and physical properties. The specific objectives are to show the effect of structure and structural changes on thermodynamic properties (specific heat) and physical properties (compressive strength); to illustrate the first law of thermodynamics; to compare boiling a potato in water with cooking it in a microwave in terms of the rate of structural change and the energy consumed to 'process' the potato; and to demonstrate compression testing.

  20. Structure, processing, and properties of potatoes

    NASA Technical Reports Server (NTRS)

    Lloyd, Isabel K.; Kolos, Kimberly R.; Menegaux, Edmond C.; Luo, Huy; Mccuen, Richard H.; Regan, Thomas M.

    1992-01-01

    The objective of this experiment and lesson intended for high school students in an engineering or materials science course or college freshmen is to demonstrate the relation between processing, structure, and thermodynamic and physical properties. The specific objectives are to show the effect of structure and structural changes on thermodynamic properties (specific heat) and physical properties (compressive strength); to illustrate the first law of thermodynamics; to compare boiling a potato in water with cooking it in a microwave in terms of the rate of structural change and the energy consumed to 'process' the potato; and to demonstrate compression testing.

  1. Amino Acid-Assisted Incorporation of Dye Molecules within Calcite Crystals.

    PubMed

    Marzec, Bartosz; Green, David C; Holden, Mark A; Coté, Alexander S; Ihli, Johannes; Khalid, Saba; Kulak, Alexander; Walker, Daniel; Tang, Chiu; Duffy, Dorothy M; Kim, Yi-Yeoun; Meldrum, Fiona C

    2018-05-23

    Biomineralisation processes invariably occur in the presence of multiple organic additives, which act in combination to give exceptional control over structures and properties. However, few synthetic studies have investigated the cooperative effects of soluble additives. This work addresses this challenge and focuses on the combined effects of amino acids and coloured dye molecules. The experiments demonstrate that strongly coloured calcite crystals only form in the presence of Brilliant Blue R (BBR) and four of the seventeen soluble amino acids, as compared with almost colourless crystals using the dye alone. The active amino acids are identified as those which themselves effectively occlude in calcite, suggesting a mechanism where they can act as chaperones for individual molecules or even aggregates of dyes molecules. These results provide new insight into crystal-additive interactions and suggest a novel strategy for generating materials with target properties. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Structures and Optical Properties of Hydrazones Derived from Biological Polyenes

    NASA Astrophysics Data System (ADS)

    Nakashima, Takayasu; Yamada, Takashi; Hashimoto, Hideki; Kobayashi, Takayoshi

    2001-08-01

    A set of hydrazone molecules was derived from a series of biological polyenes that have different polyene chain-lengths with common substituent group of 2,4-dinitrophenylhydrazine. Their structures were determined by high-resolution NMR spectroscopy as well as X-ray crystallography, and their optical properties were investigated by room and low temperature optical absorption spectroscopy. Among the derivatives so far synthesized, the one that has the shortest polyene chain (C13-DNPH) afforded single crystals without inversion symmetry, hence applicable for the second-order nonlinear optical devices. Molecular structures in the crystals were closely inspected in order to explain the cause to violate the inversion symmetry. Hydrazones derived in this study gave rise to two transition moments along the molecular axis. Comparison of the optical absorption spectra among the derivatives showed a unique phenomenon that could be attributed to the crossover of the excited state potential energy surfaces along the elongation of the polyene chain-lengths.

  3. Structures and Optical Properties of Hydrazones Derived from Biological Polyenes

    NASA Astrophysics Data System (ADS)

    Nakashima, Takayasu; Yamada, Takashi; Hashimoto, Hideki; Kobayashi, Takayoshi

    A set of hydrazone molecules was derived from a series of biological polyenes that have different polyene chain-lengths with common substituent group of 2,4-dinitrophenylhydrazine. Their structures were determined by high-resolution NMR spectroscopy as well as X-ray crystallography, and their optical properties were investigated by room and low temperature optical absorption spectroscopy. Among the derivatives so far synthesized, the one that has the shortest polyene chain (C13-DNPH) afforded single crystals without inversion symmetry, hence applicable for the second-order nonlinear optical devices. Molecular structures in the crystals were closely inspected in order to explain the cause to violate the inversion symmetry. Hydrazones derived in this study gave rise to two transition moments along the molecular axis. Comparison of the optical absorption spectra among the derivatives showed a unique phenomenon that could be attributed to the crossover of the excited state potential energy surfaces along the elongation of the polyene chain-lengths.

  4. Mechanical properties of hollow and water-filled graphyne nanotube and carbon nanotube hybrid structure.

    PubMed

    Lei, Guangping; Zhang, Yayun; Liu, Hantao; Song, Fenhong

    2018-05-11

    By performing molecular dynamics simulations, a GNT/CNT hybrid structure constructed via combing (6, 6) graphyne nanotube (GNT) with (6, 6) carbon nanotube (CNT) has been designed and investigated. The mechanical properties induced by the percentage of GNT, water content and electric field were examined. Calculation results reveal that the fracture strain and strength of hollow hybrid structure are remarkably smaller than that of perfect (6, 6) CNT. In addition, the Young's modulus decreases monotonously with the increase of percentage of GNT. More importantly, the tunable mechanical properties of hybrid structure can be achieved through filling with water molecules and applying an electric field along tensile direction. Specifically, increasing water content from 0.0 to 8.70 mmol g -1 in the absence of electric field could result in fracture strain and strength reducing by 15.09% and 12.87%, respectively. Besides, enhancing fracture strain and strength of water-filled hybrid structure with water content of 8.70 mmol g -1 can also be obtained with rising electric field intensity. These findings would provide a valuable theoretical basis for designing and fabricating a nanodevice with controllable mechanical performances.

  5. Mechanical properties of hollow and water-filled graphyne nanotube and carbon nanotube hybrid structure

    NASA Astrophysics Data System (ADS)

    Lei, Guangping; Zhang, Yayun; Liu, Hantao; Song, Fenhong

    2018-05-01

    By performing molecular dynamics simulations, a GNT/CNT hybrid structure constructed via combing (6, 6) graphyne nanotube (GNT) with (6, 6) carbon nanotube (CNT) has been designed and investigated. The mechanical properties induced by the percentage of GNT, water content and electric field were examined. Calculation results reveal that the fracture strain and strength of hollow hybrid structure are remarkably smaller than that of perfect (6, 6) CNT. In addition, the Young’s modulus decreases monotonously with the increase of percentage of GNT. More importantly, the tunable mechanical properties of hybrid structure can be achieved through filling with water molecules and applying an electric field along tensile direction. Specifically, increasing water content from 0.0 to 8.70 mmol g-1 in the absence of electric field could result in fracture strain and strength reducing by 15.09% and 12.87%, respectively. Besides, enhancing fracture strain and strength of water-filled hybrid structure with water content of 8.70 mmol g-1 can also be obtained with rising electric field intensity. These findings would provide a valuable theoretical basis for designing and fabricating a nanodevice with controllable mechanical performances.

  6. Ab initio study on the structural and electronic properties of water surrounding a multifunctional nanoprobe

    NASA Astrophysics Data System (ADS)

    Xia, Xiuli; Shao, Yuanzhi

    2018-02-01

    We report the magneto-electric behavior of a dual-modality biomedical nanoprobe, a ternary nanosystem consisting of gold and gadolinia clusters and water molecules, with the effect of both nanoclusters on the structural and electronic properties of water. The hydrogen-oxygen bond lengths and angles as well as electronic charges of water molecules surrounding both nanoclusters were calculated using Hubbard U corrected density functional theory aided by molecular dynamics approach. The calculations reveal existence of a magneto-electric interaction between gold and gadolinium oxide nanoclusters, which influences the physical properties of surrounding water remarkably. A broader (narrower) distribution of Hsbnd O bond lengths (Hsbnd Osbnd H bond angles) was observed at the presence of either gold or gadolinia nanoclusters. The presence of Gd6O9 cluster leads to the larger charges of neighbour oxygen atoms. The distribution of oxygen atom charges becomes border when both Gd6O9 and Au13 clusters coexist. Ab initio calculation provides a feasible approach to explore the most essential interactions among functional components of a multimodal nanoprobe applied in aqueous environment.

  7. Non-Markovian properties and multiscale hidden Markovian network buried in single molecule time series

    NASA Astrophysics Data System (ADS)

    Sultana, Tahmina; Takagi, Hiroaki; Morimatsu, Miki; Teramoto, Hiroshi; Li, Chun-Biu; Sako, Yasushi; Komatsuzaki, Tamiki

    2013-12-01

    We present a novel scheme to extract a multiscale state space network (SSN) from single-molecule time series. The multiscale SSN is a type of hidden Markov model that takes into account both multiple states buried in the measurement and memory effects in the process of the observable whenever they exist. Most biological systems function in a nonstationary manner across multiple timescales. Combined with a recently established nonlinear time series analysis based on information theory, a simple scheme is proposed to deal with the properties of multiscale and nonstationarity for a discrete time series. We derived an explicit analytical expression of the autocorrelation function in terms of the SSN. To demonstrate the potential of our scheme, we investigated single-molecule time series of dissociation and association kinetics between epidermal growth factor receptor (EGFR) on the plasma membrane and its adaptor protein Ash/Grb2 (Grb2) in an in vitro reconstituted system. We found that our formula successfully reproduces their autocorrelation function for a wide range of timescales (up to 3 s), and the underlying SSNs change their topographical structure as a function of the timescale; while the corresponding SSN is simple at the short timescale (0.033-0.1 s), the SSN at the longer timescales (0.1 s to ˜3 s) becomes rather complex in order to capture multiscale nonstationary kinetics emerging at longer timescales. It is also found that visiting the unbound form of the EGFR-Grb2 system approximately resets all information of history or memory of the process.

  8. Nanopipette Delivery of Individual Molecules to Cellular Compartments for Single-Molecule Fluorescence Tracking

    PubMed Central

    Bruckbauer, Andreas; James, Peter; Zhou, Dejian; Yoon, Ji Won; Excell, David; Korchev, Yuri; Jones, Roy; Klenerman, David

    2007-01-01

    We have developed a new method, using a nanopipette, for controlled voltage-driven delivery of individual fluorescently labeled probe molecules to the plasma membrane which we used for single-molecule fluorescence tracking (SMT). The advantages of the method are 1), application of the probe to predefined regions on the membrane; 2), release of only one or a few molecules onto the cell surface; 3), when combined with total internal reflection fluorescence microscopy, very low background due to unbound molecules; and 4), the ability to first optimize the experiment and then repeat it on the same cell. We validated the method by performing an SMT study of the diffusion of individual membrane glycoproteins labeled with Atto 647-wheat germ agglutin in different surface domains of boar spermatozoa. We found little deviation from Brownian diffusion with a mean diffusion coefficient of 0.79 ± 0.04 μm2/s in the acrosomal region and 0.10 ± 0.02 μm2/s in the postacrosomal region; this difference probably reflects different membrane structures. We also showed that we can analyze diffusional properties of different subregions of the cell membrane and probe for the presence of diffusion barriers. It should be straightforward to extend this new method to other probes and cells, and it can be used as a new tool to investigate the cell membrane. PMID:17631532

  9. Crystal structure of Urtica dioica agglutinin, a superantigen presented by MHC molecules of class I and class II.

    PubMed

    Saul, F A; Rovira, P; Boulot, G; Damme, E J; Peumans, W J; Truffa-Bachi, P; Bentley, G A

    2000-06-15

    Urtica dioica agglutinin (UDA), a monomeric lectin extracted from stinging nettle rhizomes, is specific for saccharides containing N-acetylglucosamine (GlcNAc). The lectin behaves as a superantigen for murine T cells, inducing the exclusive proliferation of Vbeta8.3(+) lymphocytes. UDA is unique among known T cell superantigens because it can be presented by major histocompatibility complex (MHC) molecules of both class I and II. The crystal structure of UDA has been determined in the ligand-free state, and in complex with tri-acetylchitotriose and tetra-acetylchitotetraose at 1.66 A, 1.90 A and 1.40 A resolution, respectively. UDA comprises two hevein-like domains, each with a saccharide-binding site. A serine and three aromatic residues at each site form the principal contacts with the ligand. The N-terminal domain binding site can centre on any residue of a chito-oligosaccharide, whereas that of the C-terminal domain is specific for residues at the nonreducing terminus of the ligand. We have shown previously that oligomers of GlcNAc inhibit the superantigenic activity of UDA and that the lectin binds to glycans on the MHC molecule. We show that UDA also binds to glycans on the T cell receptor (TCR). The presence of two saccharide-binding sites observed in the structure of UDA suggests that its superantigenic properties arise from the simultaneous fixation of glycans on the TCR and MHC molecules of the T cell and antigen-presenting cell, respectively. The well defined spacing between the two binding sites of UDA is probably a key factor in determining the specificity for Vbeta8.3(+) lymphocytes.

  10. Rotational and Fine Structure of Pseudo-Jahn Molecules with C_1 Symmetry

    NASA Astrophysics Data System (ADS)

    Liu, Jinjun

    2016-06-01

    It has been found in our previous works that rotational and fine-structure analysis of spectra involving nearly degenerate electronic states may aid in interpretation and analysis of the vibronic structure, specifically in the case of pseudo-Jahn-Teller (pJT) molecules with C_s symmetry. The spectral analysis of pJT derivatives (isopropoxy and cyclohexoxy of a prototypical JT molecule (the methoxy radical) allowed for quantitative determination of various contributions to the energy separation between the nearly degenerate electronic states, including the relativistic spin-orbit (SO) effect, the electrostatic interaction, and their zero-point energy difference. These states are coupled by SO and Coriolis interactions, which can also be determined accurately in rotational and fine structure analysis. Most recently, the spectroscopic model for rotational analysis of pJT molecules has been extended for analysis of molecules with C_1 symmetry, i.e., no symmetry. This model includes the six independently determinable components of the spin-rotation (SR) tensor and the three components of the SO and Coriolis interactions. It has been employed to simulate and fit high-resolution laser-induced fluorescence (LIF) spectra of jet-cooled alkoxy radicals with C_1 symmetry, including the 2-hexoxy and the 2-pentoxy radicals, as well as previously recorded LIF spectrum of the trans-conformer (defined by its OCCC dihedral angle) of the 2-butoxy radical. Although the LIF spectra can be reproduced by using either the SR constants or SO and Coriolis constants, the latter simulation offers results that are physically more meaningful whereas the SR constants have to be regarded as effective constants. Furthermore, we will review the SO and Coriolis constants of alkoxy radicals that have been investigated, starting from the well-studied methoxy radical (CH_3O). J. Liu, D. Melnik, and T. A. Miller, J. Chem. Phys. 139, 094308 (2013) J. Liu and T. A. Miller, J. Phys. Chem. A 118, 11871

  11. Single Molecule Conductance of Oligothiophene Derivatives

    NASA Astrophysics Data System (ADS)

    Dell, Emma J.

    This thesis studies the electronic properties of small organic molecules based on the thiophene motif. If we are to build next-generation devices, advanced materials must be designed which possess requisite electronic functionality. Molecules present attractive candidates for these ad- vanced materials since nanoscale devices are particularly sought after. However, selecting a molecule that is suited to a certain electronic function remains a challenge, and characterization of electronic behavior is therefore critical. Single molecule conductance measurements are a powerful tool to determine properties on the nanoscale and, as such, can be used to investigate novel building blocks that may fulfill the design requirements of next-generation devices. Combining these conductance results with strategic chemical synthesis allows for the development of new families of molecules that show attractive properties for future electronic devices. Since thiophene rings are the fruitflies of organic semiconductors on the bulk scale, they present an intriguing starting point for building functional materials on the nanoscale, and therefore form the structural basis of all molecules studied herein. First, the single-molecule conductance of a family of bithiophene derivatives was measured. A broad distribution in the single-molecule conductance of bithiophene was found compared with that of a biphenyl. This increased breadth in the conductance distribution was shown to be explained by the difference in 5-fold symmetry of thiophene rings as compared to the 6-fold symmetry of benzene rings. The reduced symmetry of thiophene rings results in a restriction on the torsion angle space available to these molecules when bound between two metal electrodes in a junction, causing each molecular junction to sample a different set of conformers in the conductance measurements. By contrast, the rotations of biphenyl are essentially unimpeded by junction binding, allowing each molecular junction

  12. BioCompoundML: A General Biofuel Property Screening Tool for Biological Molecules Using Random Forest Classifiers

    DOE PAGES

    Whitmore, Leanne S.; Davis, Ryan W.; McCormick, Robert L.; ...

    2016-09-15

    Screening a large number of biologically derived molecules for potential fuel compounds without recourse to experimental testing is important in identifying understudied yet valuable molecules. Experimental testing, although a valuable standard for measuring fuel properties, has several major limitations, including the requirement of testably high quantities, considerable expense, and a large amount of time. This paper discusses the development of a general-purpose fuel property tool, using machine learning, whose outcome is to screen molecules for desirable fuel properties. BioCompoundML adopts a general methodology, requiring as input only a list of training compounds (with identifiers and measured values) and a listmore » of testing compounds (with identifiers). For the training data, BioCompoundML collects open data from the National Center for Biotechnology Information, incorporates user-provided features, imputes missing values, performs feature reduction, builds a classifier, and clusters compounds. BioCompoundML then collects data for the testing compounds, predicts class membership, and determines whether compounds are found in the range of variability of the training data set. We demonstrate this tool using three different fuel properties: research octane number (RON), threshold soot index (TSI), and melting point (MP). Here we provide measures of its success with these properties using randomized train/test measurements: average accuracy is 88% in RON, 85% in TSI, and 94% in MP; average precision is 88% in RON, 88% in TSI, and 95% in MP; and average recall is 88% in RON, 82% in TSI, and 97% in MP. The receiver operator characteristics (area under the curve) were estimated at 0.88 in RON, 0.86 in TSI, and 0.87 in MP. We also measured the success of BioCompoundML by sending 16 compounds for direct RON determination. Finally, we provide a screen of 1977 hydrocarbons/oxygenates within the 8696 compounds in MetaCyc, identifying compounds with high

  13. Structural Information from Single-molecule FRET Experiments Using the Fast Nano-positioning System

    PubMed Central

    Röcker, Carlheinz; Nagy, Julia; Michaelis, Jens

    2017-01-01

    Single-molecule Förster Resonance Energy Transfer (smFRET) can be used to obtain structural information on biomolecular complexes in real-time. Thereby, multiple smFRET measurements are used to localize an unknown dye position inside a protein complex by means of trilateration. In order to obtain quantitative information, the Nano-Positioning System (NPS) uses probabilistic data analysis to combine structural information from X-ray crystallography with single-molecule fluorescence data to calculate not only the most probable position but the complete three-dimensional probability distribution, termed posterior, which indicates the experimental uncertainty. The concept was generalized for the analysis of smFRET networks containing numerous dye molecules. The latest version of NPS, Fast-NPS, features a new algorithm using Bayesian parameter estimation based on Markov Chain Monte Carlo sampling and parallel tempering that allows for the analysis of large smFRET networks in a comparably short time. Moreover, Fast-NPS allows the calculation of the posterior by choosing one of five different models for each dye, that account for the different spatial and orientational behavior exhibited by the dye molecules due to their local environment. Here we present a detailed protocol for obtaining smFRET data and applying the Fast-NPS. We provide detailed instructions for the acquisition of the three input parameters of Fast-NPS: the smFRET values, as well as the quantum yield and anisotropy of the dye molecules. Recently, the NPS has been used to elucidate the architecture of an archaeal open promotor complex. This data is used to demonstrate the influence of the five different dye models on the posterior distribution. PMID:28287526

  14. Structural Information from Single-molecule FRET Experiments Using the Fast Nano-positioning System.

    PubMed

    Dörfler, Thilo; Eilert, Tobias; Röcker, Carlheinz; Nagy, Julia; Michaelis, Jens

    2017-02-09

    Single-molecule Förster Resonance Energy Transfer (smFRET) can be used to obtain structural information on biomolecular complexes in real-time. Thereby, multiple smFRET measurements are used to localize an unknown dye position inside a protein complex by means of trilateration. In order to obtain quantitative information, the Nano-Positioning System (NPS) uses probabilistic data analysis to combine structural information from X-ray crystallography with single-molecule fluorescence data to calculate not only the most probable position but the complete three-dimensional probability distribution, termed posterior, which indicates the experimental uncertainty. The concept was generalized for the analysis of smFRET networks containing numerous dye molecules. The latest version of NPS, Fast-NPS, features a new algorithm using Bayesian parameter estimation based on Markov Chain Monte Carlo sampling and parallel tempering that allows for the analysis of large smFRET networks in a comparably short time. Moreover, Fast-NPS allows the calculation of the posterior by choosing one of five different models for each dye, that account for the different spatial and orientational behavior exhibited by the dye molecules due to their local environment. Here we present a detailed protocol for obtaining smFRET data and applying the Fast-NPS. We provide detailed instructions for the acquisition of the three input parameters of Fast-NPS: the smFRET values, as well as the quantum yield and anisotropy of the dye molecules. Recently, the NPS has been used to elucidate the architecture of an archaeal open promotor complex. This data is used to demonstrate the influence of the five different dye models on the posterior distribution.

  15. 3-D Structure of Molecules of Biological Significance

    ERIC Educational Resources Information Center

    Bennett, Alice S.; Schwenk, Karl

    1974-01-01

    Describes how to use the distinctive properties of osazone formation in conjunction with molecular model construction to demonstrate the relationship between the three-dimensional structures of simple sugars and the shapes of crystals they form. (BR)

  16. Ab initio studies of electronic transport through amine-Au-linked junctions of photoactive molecules

    NASA Astrophysics Data System (ADS)

    Strubbe, David A.; Quek, Su Ying; Venkataraman, Latha; Choi, Hyoung Joon; Neaton, J. B.; Louie, Steven G.

    2008-03-01

    Molecules linked to Au electrodes via amine groups have been shown to result in reproducible molecular conductance values for a wide range of single-molecule junctions [1,2]. Recent calculations have shown that these linkages result in a junction conductance relatively insensitive to atomic structure [3]. Here we exploit these well-defined linkages to study the effect of isomerization on conductance for the photoactive molecule 4,4'-diaminoazobenzene. We use a first-principles scattering-state method based on density-functional theory to explore structure and transport properties of the cis and trans isomers of the molecule, and we discuss implications for experiment. [1] L Venkataraman et al., Nature 442, 904-907 (2006); [2] L Venkataraman et al., Nano Lett. 6, 458-462 (2006); [3] SY Quek et al., Nano Lett. 7, 3477-3482 (2007).

  17. Tunable electronic and optical properties of gas molecules adsorbed monolayer graphitic ZnO: Implications for gas sensor and environment monitoring

    NASA Astrophysics Data System (ADS)

    Zhang, Wei; Du, Qikui; Zhang, Lifa

    2017-12-01

    Due to the large surface area and the peculiar electronic characters, great attention has been paid to 2D materials for the gas sensing applications. Here, using the hybrid density functional calculations, we systematically study the adsorptions of gas molecules on the monolayer graphitic ZnO (g-ZnO), including CO, H2, H2O, H2S, NH3, NO, NO2, O2, and SO2. For most of the molecules, g-ZnO shows superior sensing performance to the well-known MoS2, black phosphorus, blue phosphorus, antimonene, and germanene. H2S, NO, NO2, and SO2 act as charge acceptors, and CO, H2, H2O, and NH3 serve as charge donors. These molecules also induce distinct modifications to the electronic structures, work functions, and optical adsorptions. NO, NO2, and O2 form flat bands in the bandgaps of the spin-up or spin-down states, whereas other molecules mainly tune the bandgaps and the orbital couplings. In particular, g-ZnO is most likely to adsorb the atmospheric pollutant SO2, which has the strongest interaction through hybridizing its widely broadened 2p orbitals with the 3d orbitals of g-ZnO. Moreover, the improved visible light absorption is demonstrated in the NO2 adsorbed g-ZnO. Our results not only confirm that the electronic and optical properties of g-ZnO can be effectively tuned by the selective adsorption of gas molecules but also provide insightful guidance for the potential application of g-ZnO in the field of gas sensors.

  18. Structural Design Principle of Small-Molecule Organic Semiconductors for Metal-Free, Visible-Light-Promoted Photocatalysis.

    PubMed

    Wang, Lei; Huang, Wei; Li, Run; Gehrig, Dominik; Blom, Paul W M; Landfester, Katharina; Zhang, Kai A I

    2016-08-08

    Herein, we report on the structural design principle of small-molecule organic semiconductors as metal-free, pure organic and visible light-active photocatalysts. Two series of electron-donor and acceptor-type organic semiconductor molecules were synthesized to meet crucial requirements, such as 1) absorption range in the visible region, 2) sufficient photoredox potential, and 3) long lifetime of photogenerated excitons. The photocatalytic activity was demonstrated in the intermolecular C-H functionalization of electron-rich heteroaromates with malonate derivatives. A mechanistic study of the light-induced electron transport between the organic photocatalyst, substrate, and the sacrificial agent are described. With their tunable absorption range and defined energy-band structure, the small-molecule organic semiconductors could offer a new class of metal-free and visible light-active photocatalysts for chemical reactions. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Structural flexibility of the sulfur mustard molecule at finite temperature from Car-Parrinello molecular dynamics simulations.

    PubMed

    Lach, Joanna; Goclon, Jakub; Rodziewicz, Pawel

    2016-04-05

    Sulfur mustard (SM) is one of the most dangerous chemical compounds used against humans, mostly at war conditions but also in terrorist attacks. Even though the sulfur mustard has been synthesized over a hundred years ago, some of its molecular properties are not yet resolved. We investigate the structural flexibility of the SM molecule in the gas phase by Car-Parrinello molecular dynamics simulations. Thorough conformation analysis of 81 different SM configurations using density functional theory is performed to analyze the behavior of the system at finite temperature. The conformational diversity is analyzed with respect to the formation of intramolecular blue-shifting CH⋯S and CH⋯Cl hydrogen bonds. Molecular dynamics simulations indicate that all structural rearrangements between SM local minima are realized either in direct or non-direct way, including the intermediate structure in the last case. We study the lifetime of the SM conformers and perform the population analysis. Additionally, we provide the anharmonic dynamical finite temperature IR spectrum from the Fourier Transform of the dipole moment autocorrelation function to mimic the missing experimental IR spectrum. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Structures and Spectroscopic Properties of F-(H2O) n with n = 1-10 Clusters from a Global Search Based On Density Functional Theory.

    PubMed

    Shi, Ruili; Wang, Pengju; Tang, Lingli; Huang, Xiaoming; Chen, Yonggang; Su, Yan; Zhao, Jijun

    2018-04-05

    Using a genetic algorithm incorporated in density functional theory, we explore the ground state structures of fluoride anion-water clusters F - (H 2 O) n with n = 1-10. The F - (H 2 O) n clusters prefer structures in which the F - anion remains at the surface of the structure and coordinates with four water molecules, as the F - (H 2 O) n clusters have strong F - -H 2 O interactions as well as strong hydrogen bonds between H 2 O molecules. The strong interaction between the F - anion and adjacent H 2 O molecule leads to a longer O-H distance in the adjacent molecule than in an individual water molecule. The simulated infrared (IR) spectra of the F - (H 2 O) 1-5 clusters obtained via second-order vibrational perturbation theory (VPT2) and including anharmonic effects reproduce the experimental results quite well. The strong interaction between the F - anion and water molecules results in a large redshift (600-2300 cm -1 ) of the adjacent O-H stretching mode. Natural bond orbital (NBO) analysis of the lowest-energy structures of the F - (H 2 O) 1-10 clusters illustrates that charge transfer from the lone pair electron orbital of F - to the antibonding orbital of the adjacent O-H is mainly responsible for the strong interaction between the F - anion and water molecules, which leads to distinctly different geometric and vibrational properties compared with neutral water clusters.

  1. Detecting and characterizing N-acyl-homoserine lactone signal molecules by thin-layer chromatography

    PubMed Central

    Shaw, Paul D.; Ping, Gao; Daly, Sean L.; Cha, Chung; Cronan, John E.; Rinehart, Kenneth L.; Farrand, Stephen K.

    1997-01-01

    Many Gram-negative bacteria regulate gene expression in response to their population size by sensing the level of acyl-homoserine lactone signal molecules which they produce and liberate to the environment. We have developed an assay for these signals that couples separation by thin-layer chromatography with detection using Agrobacterium tumefaciens harboring lacZ fused to a gene that is regulated by autoinduction. With the exception of N-butanoyl-l-homoserine lactone, the reporter detected acyl-homoserine lactones with 3-oxo-, 3-hydroxy-, and 3-unsubstituted side chains of all lengths tested. The intensity of the response was proportional to the amount of the signal molecule chromatographed. Each of the 3-oxo- and the 3-unsubstituted derivatives migrated with a unique mobility. Using the assay, we showed that some bacteria produce as many as five detectable signal molecules. Structures could be assigned tentatively on the basis of mobility and spot shape. The dominant species produced by Pseudomonas syringae pv. tabaci chromatographed with the properties of N-(3-oxohexanoyl)-l-homoserine lactone, a structure that was confirmed by mass spectrometry. An isolate of Pseudomonas fluorescens produced five detectable species, three of which had novel chromatographic properties. These were identified as the 3-hydroxy- forms of N-hexanoyl-, N-octanoyl-, and N-decanoyl-l-homoserine lactone. The assay can be used to screen cultures of bacteria for acyl-homoserine lactones, for quantifying the amounts of these molecules produced, and as an analytical and preparative aid in determining the structures of these signal molecules. PMID:9177164

  2. NMR structure calculation for all small molecule ligands and non-standard residues from the PDB Chemical Component Dictionary.

    PubMed

    Yilmaz, Emel Maden; Güntert, Peter

    2015-09-01

    An algorithm, CYLIB, is presented for converting molecular topology descriptions from the PDB Chemical Component Dictionary into CYANA residue library entries. The CYANA structure calculation algorithm uses torsion angle molecular dynamics for the efficient computation of three-dimensional structures from NMR-derived restraints. For this, the molecules have to be represented in torsion angle space with rotations around covalent single bonds as the only degrees of freedom. The molecule must be given a tree structure of torsion angles connecting rigid units composed of one or several atoms with fixed relative positions. Setting up CYANA residue library entries therefore involves, besides straightforward format conversion, the non-trivial step of defining a suitable tree structure of torsion angles, and to re-order the atoms in a way that is compatible with this tree structure. This can be done manually for small numbers of ligands but the process is time-consuming and error-prone. An automated method is necessary in order to handle the large number of different potential ligand molecules to be studied in drug design projects. Here, we present an algorithm for this purpose, and show that CYANA structure calculations can be performed with almost all small molecule ligands and non-standard amino acid residues in the PDB Chemical Component Dictionary.

  3. Structure-related frustrated magnetism of nanosized polyoxometalates: aesthetics and properties in harmony.

    PubMed

    Kögerler, Paul; Tsukerblat, Boris; Müller, Achim

    2010-01-07

    The structural versatility characterizing polyoxometalate chemistry, in combination with the option to deliberately use well-defined building blocks, serves as the foundation for the generation of a large family of magnetic clusters, frequently comprising highly symmetric spin arrays. If the spin centers are coupled by antiferromagnetic exchange, some of these systems exhibit spin frustration, which can result in novel magnetic properties of purely molecular origins. We discuss here the magnetic properties of selected nanosized polyoxometalate clusters featuring spin triangles as their magnetic 'building blocks' or fragments. This includes unique porous Keplerate clusters of the type {(Mo)Mo(5)}(12)M(30) (M = Fe(III), Cr(III), V(IV)) with the spin centers defining a regular icosidodecahedron and the {V(15)As(6)}-type cluster sphere containing a single equilateral spin triangle; these species are widely discussed and studied in the literature for their role in materials science as molecular representations of Kagomé lattices and in relation to quantum computing, respectively. Exhibiting fascinating and unique structural features, these magnetic molecules allow the study of the implications of frustrated spin ordering. Furthermore, this perspective covers the impact of spin frustration on the degeneracy of the ground state and related problems, namely strong magnetic anisotropy and the interplay of antisymmetric exchange and structural Jahn-Teller effects.

  4. Single molecule tools for enzymology, structural biology, systems biology and nanotechnology: an update

    PubMed Central

    Widom, Julia R.; Dhakal, Soma; Heinicke, Laurie A.; Walter, Nils G.

    2015-01-01

    Toxicology is the highly interdisciplinary field studying the adverse effects of chemicals on living organisms. It requires sensitive tools to detect such effects. After their initial implementation during the 1990s, single-molecule fluorescence detection tools were quickly recognized for their potential to contribute greatly to many different areas of scientific inquiry. In the intervening time, technical advances in the field have generated ever-improving spatial and temporal resolution, and have enabled the application of single-molecule fluorescence to increasingly complex systems, such as live cells. In this review, we give an overview of the optical components necessary to implement the most common versions of single-molecule fluorescence detection. We then discuss current applications to enzymology and structural studies, systems biology, and nanotechnology, presenting the technical considerations that are unique to each area of study, along with noteworthy recent results. We also highlight future directions that have the potential to revolutionize these areas of study by further exploiting the capabilities of single-molecule fluorescence microscopy. PMID:25212907

  5. Recrystallization of starches by hydrothermal treatment: digestibility, structural, and physicochemical properties.

    PubMed

    Trinh, Khanh Son

    2015-12-01

    Gelatinized starches were recrystallized under hydrothermal treatment and their properties were characterized by X-ray diffractometry, solid-state (13)C cross-polarization and magic-angle spinning nuclear magnetic resonance, differential scanning calorimetry, gel-permeation chromatography, high-performance anion-exchange chromatography using pulsed amperomeric detection, high-performance size-exclusion chromatography with attached multiangle laser light scattering and refractive index detectors, and digestibility analysis. Amylopectin molecules of hylon (V, VII) and water yam starch contained long side-chains with high proportion of fb1 and fb2. Under hydrothermal treatment, the double helix proportion and relative crystallinity significantly increased and reached maxima of water yam (48.7 and 28.2 %, respectively). Except water yam starch, X-ray diffraction pattern of all starches exhibited the evidence of type 2 amylose-lipid complex. Besides, under DSC measurement, potato and hylon starches showed the endotherm of amylose-amylose interaction. The hydrothermal treatment caused the recrystallization resulting in the decrease of RDS, especially in case of hylon and water yam starch. HTT water yam contained highest SDS (48.3 %) and HTT hylon VII contained highest RS (44.5 %). The relationship between structure and digestibility was observed, in which, high amylose content and specific structures of amylopectin molecule were necessary for the production of RS and/or SDS of hydrothermally treated starches.

  6. Chemical wiring and soldering toward all-molecule electronic circuitry.

    PubMed

    Okawa, Yuji; Mandal, Swapan K; Hu, Chunping; Tateyama, Yoshitaka; Goedecker, Stefan; Tsukamoto, Shigeru; Hasegawa, Tsuyoshi; Gimzewski, James K; Aono, Masakazu

    2011-06-01

    Key to single-molecule electronics is connecting functional molecules to each other using conductive nanowires. This involves two issues: how to create conductive nanowires at designated positions, and how to ensure chemical bonding between the nanowires and functional molecules. Here, we present a novel method that solves both issues. Relevant functional molecules are placed on a self-assembled monolayer of diacetylene compound. A probe tip of a scanning tunneling microscope is then positioned on the molecular row of the diacetylene compound to which the functional molecule is adsorbed, and a conductive polydiacetylene nanowire is fabricated by initiating chain polymerization by stimulation with the tip. Since the front edge of chain polymerization necessarily has a reactive chemical species, the created polymer nanowire forms chemical bonding with an encountered molecular element. We name this spontaneous reaction "chemical soldering". First-principles theoretical calculations are used to investigate the structures and electronic properties of the connection. We demonstrate that two conductive polymer nanowires are connected to a single phthalocyanine molecule. A resonant tunneling diode formed by this method is discussed. © 2011 American Chemical Society

  7. Surface structure, crystallographic and ice-nucleating properties of cellulose

    NASA Astrophysics Data System (ADS)

    Hiranuma, Naruki; Möhler, Ottmar; Kiselev, Alexei; Saathoff, Harald; Weidler, Peter; Shutthanandan, Shuttha; Kulkarni, Gourihar; Jantsch, Evelyn; Koop, Thomas

    2015-04-01

    Increasing evidence of the high diversity and efficient freezing ability of biological ice-nucleating particles is driving a reevaluation of their impact upon climate. Despite their potential importance, little is known about their atmospheric abundance and ice nucleation efficiency, especially non-proteinaceous ones, in comparison to non-biological materials (e.g., mineral dust). Recently, microcrystalline cellulose (MCC; non-proteinaceous plant structural polymer) has been identified as a potential biological ice-nucleating particle. However, it is still uncertain if the ice-nucleating activity is specific to the MCC structure or generally relevant to all cellulose materials, such that the results of MCC can be representatively scaled up to the total cellulose content in the atmosphere to address its role in clouds and the climate system. Here we use the helium ion microscopy (HIM) imaging and the X-ray diffraction (XRD) technique to characterize the nanoscale surface structure and crystalline properties of the two different types of cellulose (MCC and fibrous cellulose extracted from natural wood pulp) as model proxies for atmospheric cellulose particles and to assess their potential accessibility for water molecules. To complement these structural characterizations, we also present the results of immersion freezing experiments using the cold stage-based droplet freezing BINARY (Bielefeld Ice Nucleation ARaY) technique. The HIM results suggest that both cellulose types have a complex porous morphology with capillary spaces between the nanoscale fibrils over the microfiber surface. These surface structures may make cellulose accessible to water. The XRD results suggest that the structural properties of both cellulose materials are in agreement (i.e., P21 space group; a=7.96 Å, b=8.35 Å, c=10.28 Å) and comparable to the crystallographic properties of general monoclinic cellulose (i.e., Cellulose Iβ). The results obtained from the BINARY measurements suggest

  8. Structure, reactivity and electronic properties of Mn doped Ni13 clusters

    NASA Astrophysics Data System (ADS)

    Banerjee, Radhashyam; Datta, Soumendu; Mookerjee, Abhijit

    2013-06-01

    In this work we have studied the structural and magnetic properties of Ni13 cluster mono- and bi-doped with Mn atoms. We have noted their tendency of being reactive toward the H2 molecule. We have found unusually enhanced stability in the mono-doped cluster (i.e. of the Ni12Mn) and the diminished stability of the corresponding chemisorbed cluster, Ni12MnH2. Our analysis of the stability and HOMO-LUMO gap explains this unusual behavior. Interestingly, we have also seen the quenching in the net magnetic moment upon H2 absorption in the doped NiMnm alloy clusters. This has been reported earlier for smaller Nin clusters [1].

  9. Resolving metal-molecule interfaces at single-molecule junctions

    NASA Astrophysics Data System (ADS)

    Komoto, Yuki; Fujii, Shintaro; Nakamura, Hisao; Tada, Tomofumi; Nishino, Tomoaki; Kiguchi, Manabu

    2016-05-01

    Electronic and structural detail at the electrode-molecule interface have a significant influence on charge transport across molecular junctions. Despite the decisive role of the metal-molecule interface, a complete electronic and structural characterization of the interface remains a challenge. This is in no small part due to current experimental limitations. Here, we present a comprehensive approach to obtain a detailed description of the metal-molecule interface in single-molecule junctions, based on current-voltage (I-V) measurements. Contrary to conventional conductance studies, this I-V approach provides a correlated statistical description of both, the degree of electronic coupling across the metal-molecule interface, and the energy alignment between the conduction orbital and the Fermi level of the electrode. This exhaustive statistical approach was employed to study single-molecule junctions of 1,4-benzenediamine (BDA), 1,4-butanediamine (C4DA), and 1,4-benzenedithiol (BDT). A single interfacial configuration was observed for both BDA and C4DA junctions, while three different interfacial arrangements were resolved for BDT. This multiplicity is due to different molecular adsorption sites on the Au surface namely on-top, hollow, and bridge. Furthermore, C4DA junctions present a fluctuating I-V curve arising from the greater conformational freedom of the saturated alkyl chain, in sharp contrast with the rigid aromatic backbone of both BDA and BDT.

  10. A DFT-D Study on Structural, Electronic, Thermodynamic, and Mechanical Properties of HMX/MPNO Cocrystal under High Pressure

    NASA Astrophysics Data System (ADS)

    Lin, He; Chen, Jian-Fu; Cui, Yu-Ming; Zhang, Zhen-Jiang; Yang, Dong-Dong; Zhu, Shun-Guan; Li, Hong-Zhen

    2017-04-01

    An investigation on the structural, electronic, thermodynamic, and mechanical properties of octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (HMX)/2-methylpyridine-N-oxide (MPNO) cocrystal was carried out from 0 to 100 GPa by using a dispersion-corrected density functional theory (DFT-D) method. Our calculated crystal structure is in excellent agreement with experimental results at ambient pressure. Based on the analysis of lattice parameters, lattice angles, bond lengths, bond angles, and dihedral angles under high pressure, we observe that HMX molecules in the cocrystal bulk are seriously distorted but MPNO molecules remain relatively unchanged. Hydrogen bond lengths are greatly shortened under high pressure. In addition, with the increase in pressure, the bandgap decreases gradually. However, it increases suddenly at 70 GPa. Some important hydrogen bonds between HMX and MPNO are also observed in the density of states spectrum. According to the thermodynamic analysis, this cocrystal is more easily prepared under low pressure. Finally, we characterized its mechanical properties and the results show that this cocrystal is malleable in nature. We expect that this research can provide a fundamental basis for further HMX cocrystal design and preparation.

  11. In situ STM imaging of the structures of pentacene molecules adsorbed on Au(111).

    PubMed

    Pong, Ifan; Yau, Shuehlin; Huang, Peng-Yi; Chen, Ming-Chou; Hu, Tarng-Shiang; Yang, Yawchia; Lee, Yuh-Lang

    2009-09-01

    In situ scanning tunneling microscope (STM) was used to examine the spatial structures of pentacene molecules adsorbed onto a Au(111) single-crystal electrode from a benzene dosing solution containing 16-400 microM pentacene. Molecular-resolution STM imaging conducted in 0.1 M HClO(4) revealed highly ordered pentacene structures of ( radical31 x radical31)R8.9 degrees , (3 x 10), ( radical31 x 10), and ( radical7 x 2 radical7)R19.1 degrees adsorbed on the reconstructed Au(111) electrode dosed with different pentacene solutions. These pentacene structures and the reconstructed Au(111) substrate were stable between 0.2 and 0.8 V [vs reversible hydrogen electrode, RHE]. Increasing the potential to E > 0.8 V lifted the reconstructed Au(111) surface and disrupted the ordered pentacene adlattices simultaneously. Ordered pentacene structures could be restored by applying potentials negative enough to reinforce the reconstructed Au(111). At potentials negative of 0.2 V, the adsorption of protons became increasingly important to displace adsorbed pentacene admolecules. Although the reconstructed Au(111) structure was not essential to produce ordered pentacene adlayers, it seemed to help the adsorption of pentacene molecules in a long-range ordered pattern. At room temperature (25 degrees C), approximately 100 pentacene molecules seen in STM images could rotate and align themselves to a neighboring domain in 10 s, suggesting that pentacene admolecules could be mobile on Au(111) under the STM imaging conditions of -150 mV in bias voltage and 1 nA in feedback current.

  12. Ordered Structure Formed by Biologically Related Molecules

    NASA Astrophysics Data System (ADS)

    Hatta, Ichiro; Nishino, Junichiro; Sumi, Akinori; Hibino, Masahiro

    1995-07-01

    The two-dimensional arrangement of biologically related molecules was studied by means of scanning probe microscopy. For monolayers of fatty acid molecules with a saturated hydrocarbon chain adsorbed on a graphite substrate, in the scanning tunneling microscope image, the position associated with the carbon atoms was clearly distinguished. In addition, based on the image for fatty acid molecules with an unsaturated hydrocarbon chain, at the position of a double bond, local electrical conductance was found to increase. Based on the images, it was pointed out that not the position of each carbon but the interaction between a graphite substrate and an alkyl chain plays an important role in imaging. On the other hand, for the surface of Langmuir-Blodgett films composed of phosphatidic acids with cations, the scanning force microscope image shows, for the first time, evidence of the methyl ends in the arrangement of phospholipid molecules.

  13. Halide salts and their structural properties in presence of secondary amine based molecule: A combined experimental and theoretical analysis

    NASA Astrophysics Data System (ADS)

    Ghosh, Pritam; Hazra, Abhijit; Ghosh, Meenakshi; Chandra Murmu, Naresh; Banerjee, Priyabrata

    2018-04-01

    Biologically relevant halide salts and its solution state structural properties are always been significant. In general, exposure of halide salts into polar solution medium results in solvation which in turn separates the cationic and anionic part of the salt. However, the conventional behaviour of salts might alter in presence of any secondary amine based compound, i.e.; moderately strong Lewis acid. In its consequence, to investigate the effect of secondary amine based compound in the salt solution, novel (E)-2-(4-bromobenzylidene)-1-(perfluorophenyl) hydrazine has been synthesized and used as secondary amine source. The secondary amine compound interestingly shows a drastic color change upon exposure to fluoride salts owing to hydrogen bonding interaction. Several experimental methods, e.g.; SCXRD, UV-Vis, FT-IR, ESI-MS and DLS together with modern DFT (i.e.; DFT-D3) have been performed to explore the structural properties of the halide salts upon exposure to secondary amine based compound. The effect of counter cation of the fluoride salt in binding with secondary amine source has also been investigated.

  14. Tuning the Redox Properties of a Nonheme Iron(III)-Peroxo Complex Binding Redox-Inactive Zinc Ions by Water Molecules.

    PubMed

    Lee, Yong-Min; Bang, Suhee; Yoon, Heejung; Bae, Seong Hee; Hong, Seungwoo; Cho, Kyung-Bin; Sarangi, Ritimukta; Fukuzumi, Shunichi; Nam, Wonwoo

    2015-07-20

    Redox-inactive metal ions play important roles in tuning chemical properties of metal-oxygen intermediates. Herein we report the effect of water molecules on the redox properties of a nonheme iron(III)-peroxo complex binding redox-inactive metal ions. The coordination of two water molecules to a Zn(2+) ion in (TMC)Fe(III) -(O2 )-Zn(CF3 SO3 )2 (1-Zn(2+) ) decreases the Lewis acidity of the Zn(2+) ion, resulting in the decrease of the one-electron oxidation and reduction potentials of 1-Zn(2+) . This further changes the reactivities of 1-Zn(2+) in oxidation and reduction reactions; no reaction occurred upon addition of an oxidant (e.g., cerium(IV) ammonium nitrate (CAN)) to 1-Zn(2+) , whereas 1-Zn(2+) coordinating two water molecules, (TMC)Fe(III) -(O2 )-Zn(CF3 SO3 )2 -(OH2 )2 [1-Zn(2+) -(OH2 )2 ], releases the O2 unit in the oxidation reaction. In the reduction reactions, 1-Zn(2+) was converted to its corresponding iron(IV)-oxo species upon addition of a reductant (e.g., a ferrocene derivative), whereas such a reaction occurred at a much slower rate in the case of 1-Zn(2+) -(OH2 )2 . The present results provide the first biomimetic example showing that water molecules at the active sites of metalloenzymes may participate in tuning the redox properties of metal-oxygen intermediates. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Tuning the Redox Properties of a Nonheme Iron(III)-Peroxo Complex Binding Redox-Inactive Zinc Ions by Water Molecules

    DOE PAGES

    Lee, Yong-Min; Bang, Suhee; Yoon, Heejung; ...

    2015-06-19

    Here we report redox-inactive metal ions play important roles in tuning chemical properties of metal–oxygen intermediates. We describe the effect of water molecules on the redox properties of a nonheme iron(III)–peroxo complex binding redox-inactive metal ions. The coordination of two water molecules to a Zn 2+ ion in (TMC)Fe III-(O 2)-Zn(CF 3SO 3) 2 (1-Zn 2+) decreases the Lewis acidity of the Zn 2+ ion, resulting in the decrease of the one-electron oxidation and reduction potentials of 1-Zn 2+. This further changes the reactivities of 1-Zn 2+ in oxidation and reduction reactions; no reaction occurred upon addition of an oxidantmore » (e.g., cerium(IV) ammonium nitrate (CAN)) to 1-Zn 2+, whereas 1-Zn 2+ coordinating two water molecules, (TMC)Fe III-(O 2)-Zn(CF 3SO 3) 2-(OH 2) 2 [1-Zn 2+-(OH 2) 2], releases the O 2 unit in the oxidation reaction. In the reduction reactions, 1-Zn 2+ was converted to its corresponding iron(IV)–oxo species upon addition of a reductant (e.g., a ferrocene derivative), whereas such a reaction occurred at a much slower rate in the case of 1-Zn 2+-(OH 2) 2. Finally, the present results provide the first biomimetic example showing that water molecules at the active sites of metalloenzymes may participate in tuning the redox properties of metal–oxygen intermediates.« less

  16. Structural and electronic properties of OsB2 : A hard metallic material

    NASA Astrophysics Data System (ADS)

    Chen, Z. Y.; Xiang, H. J.; Yang, Jinlong; Hou, J. G.; Zhu, Qingshi

    2006-07-01

    We calculate the structural and electronic properties of OsB2 using density functional theory with or without taking into account the spin-orbit (SO) interaction. Our results show that the bulk modulus with and without SO interactions are 364 and 365GPa , respectively, both are in good agreement with experiment (365-395GPa) . The evidence of covalent bonding of Os-B, which plays an important role to form a hard material, is indicated both in charge density, atoms in molecules analysis, and density of states analysis. The good metallicity and hardness of OsB2 might suggest its potential application as hard conductors.

  17. Aircraft Structural Mass Property Prediction Using Conceptual-Level Structural Analysis

    NASA Technical Reports Server (NTRS)

    Sexstone, Matthew G.

    1998-01-01

    This paper describes a methodology that extends the use of the Equivalent LAminated Plate Solution (ELAPS) structural analysis code from conceptual-level aircraft structural analysis to conceptual-level aircraft mass property analysis. Mass property analysis in aircraft structures has historically depended upon parametric weight equations at the conceptual design level and Finite Element Analysis (FEA) at the detailed design level. ELAPS allows for the modeling of detailed geometry, metallic and composite materials, and non-structural mass coupled with analytical structural sizing to produce high-fidelity mass property analyses representing fully configured vehicles early in the design process. This capability is especially valuable for unusual configuration and advanced concept development where existing parametric weight equations are inapplicable and FEA is too time consuming for conceptual design. This paper contrasts the use of ELAPS relative to empirical weight equations and FEA. ELAPS modeling techniques are described and the ELAPS-based mass property analysis process is detailed. Examples of mass property stochastic calculations produced during a recent systems study are provided. This study involved the analysis of three remotely piloted aircraft required to carry scientific payloads to very high altitudes at subsonic speeds. Due to the extreme nature of this high-altitude flight regime, few existing vehicle designs are available for use in performance and weight prediction. ELAPS was employed within a concurrent engineering analysis process that simultaneously produces aerodynamic, structural, and static aeroelastic results for input to aircraft performance analyses. The ELAPS models produced for each concept were also used to provide stochastic analyses of wing structural mass properties. The results of this effort indicate that ELAPS is an efficient means to conduct multidisciplinary trade studies at the conceptual design level.

  18. Aircraft Structural Mass Property Prediction Using Conceptual-Level Structural Analysis

    NASA Technical Reports Server (NTRS)

    Sexstone, Matthew G.

    1998-01-01

    This paper describes a methodology that extends the use of the Equivalent LAminated Plate Solution (ELAPS) structural analysis code from conceptual-level aircraft structural analysis to conceptual-level aircraft mass property analysis. Mass property analysis in aircraft structures has historically depended upon parametric weight equations at the conceptual design level and Finite Element Analysis (FEA) at the detailed design level ELAPS allows for the modeling of detailed geometry, metallic and composite materials, and non-structural mass coupled with analytical structural sizing to produce high-fidelity mass property analyses representing fully configured vehicles early in the design process. This capability is especially valuable for unusual configuration and advanced concept development where existing parametric weight equations are inapplicable and FEA is too time consuming for conceptual design. This paper contrasts the use of ELAPS relative to empirical weight equations and FEA. ELAPS modeling techniques are described and the ELAPS-based mass property analysis process is detailed Examples of mass property stochastic calculations produced during a recent systems study are provided This study involved the analysis of three remotely piloted aircraft required to carry scientific payloads to very high altitudes at subsonic speeds. Due to the extreme nature of this high-altitude flight regime,few existing vehicle designs are available for use in performance and weight prediction. ELAPS was employed within a concurrent engineering analysis process that simultaneously produces aerodynamic, structural, and static aeroelastic results for input to aircraft performance analyses. The ELAPS models produced for each concept were also used to provide stochastic analyses of wing structural mass properties. The results of this effort indicate that ELAPS is an efficient means to conduct multidisciplinary trade studies at the conceptual design level.

  19. Quantitative structure-property relationships for octanol-water partition coefficients of polybrominated diphenyl ethers.

    PubMed

    Li, Linnan; Xie, Shaodong; Cai, Hao; Bai, Xuetao; Xue, Zhao

    2008-08-01

    Theoretical molecular descriptors were tested against logK(OW) values for polybrominated diphenyl ethers (PBDEs) using the Partial Least-Squares Regression method which can be used to analyze data with many variables and few observations. A quantitative structure-property relationship (QSPR) model was successfully developed with a high cross-validated value (Q(cum)(2)) of 0.961, indicating a good predictive ability and stability of the model. The predictive power of the QSPR model was further cross-validated. The values of logK(OW) for PBDEs are mainly governed by molecular surface area, energy of the lowest unoccupied molecular orbital and the net atomic charges on the oxygen atom. All these descriptors have been discussed to interpret the partitioning mechanism of PBDE chemicals. The bulk property of the molecules represented by molecular surface area is the leading factor, and K(OW) values increase with the increase of molecular surface area. Higher energy of the lowest unoccupied molecular orbital and higher net atomic charge on the oxygen atom of PBDEs result in smaller K(OW). The energy of the lowest unoccupied molecular orbital and the net atomic charge on PBDEs oxygen also play important roles in affecting the partition of PBDEs between octanol and water by influencing the interactions between PBDEs and solvent molecules.

  20. Small Molecule Organic Optoelectronic Devices

    NASA Astrophysics Data System (ADS)

    Bakken, Nathan

    Organic optoelectronics include a class of devices synthesized from carbon containing 'small molecule' thin films without long range order crystalline or polymer structure. Novel properties such as low modulus and flexibility as well as excellent device performance such as photon emission approaching 100% internal quantum efficiency have accelerated research in this area substantially. While optoelectronic organic light emitting devices have already realized commercial application, challenges to obtain extended lifetime for the high energy visible spectrum and the ability to reproduce natural white light with a simple architecture have limited the value of this technology for some display and lighting applications. In this research, novel materials discovered from a systematic analysis of empirical device data are shown to produce high quality white light through combination of monomer and excimer emission from a single molecule: platinum(II) bis(methyl-imidazolyl)toluene chloride (Pt-17). Illumination quality achieved Commission Internationale de L'Eclairage (CIE) chromaticity coordinates (x = 0.31, y = 0.38) and color rendering index (CRI) > 75. Further optimization of a device containing Pt-17 resulted in a maximum forward viewing power efficiency of 37.8 lm/W on a plain glass substrate. In addition, accelerated aging tests suggest high energy blue emission from a halogen-free cyclometalated platinum complex could demonstrate degradation rates comparable to known stable emitters. Finally, a buckling based metrology is applied to characterize the mechanical properties of small molecule organic thin films towards understanding the deposition kinetics responsible for an elastic modulus that is both temperature and thickness dependent. These results could contribute to the viability of organic electronic technology in potentially flexible display and lighting applications. The results also provide insight to organic film growth kinetics responsible for optical

  1. Synthesis, crystal structures, and optical properties of the π-π interacting pyrrolo[2,3-b]quinoxaline derivatives containing 2-thienyl substituent

    NASA Astrophysics Data System (ADS)

    Goszczycki, Piotr; Stadnicka, Katarzyna; Brela, Mateusz Z.; Grolik, Jarosław; Ostrowska, Katarzyna

    2017-10-01

    Three (E/Z)-diastereoisomers, based on pyrrolo[2,3-b]quinoxaline system as fluorophore and containing: 2-thienylmethyl (1), bis(2-thienylmethyl)-2-aminoethyl (3a), bis(2-thienylmethyl)-3-aminopropyl (3b) groups as substituents, were synthesized and characterized by X-ray structural analysis, PXRD, NMR, UV-Vis as well as fluorescence. These compounds are non-fluorescent in acetonitrile solution, however, they exhibit aggregation induced emission enhancement (AIEE) upon water addition and in solid state. X-ray structural analysis revealed that molecules with 2-thienylmethyl and bis(2-thienylmethyl)-2-aminoethyl groups form dimers and π-stacks through π-π interactions between anitiparallel oriented pyrroloquinoxaline cores with interplanar distances 3.45 Å and 3.20 Å, respectively. Conformation of bis(2-thienylmethyl)-3-aminopropyl group is imposed by incorporated DMSO-d6 solvent molecule and weak intermolecular S-π and CH-π interactions, that prevents π-π interaction between fluorophore cores. The correlation between crystal structure and fluorescent properties of synthesized molecules was discussed. The DFT calculations were performed to rationalize the differences between considered systems.

  2. Why Do Simple Molecules with "Isolated" Phenyl Rings Emit Visible Light?

    PubMed

    Zhang, Haoke; Zheng, Xiaoyan; Xie, Ni; He, Zikai; Liu, Junkai; Leung, Nelson L C; Niu, Yingli; Huang, Xuhui; Wong, Kam Sing; Kwok, Ryan T K; Sung, Herman H Y; Williams, Ian D; Qin, Anjun; Lam, Jacky W Y; Tang, Ben Zhong

    2017-11-15

    π-Bonds connected with aromatic rings were generally believed as the standard structures for constructing highly efficient fluorophores. Materials without these typical structures, however, exhibited only low fluorescence quantum yields and emitted in the ultraviolet spectral region. In this work, three molecules, namely bis(2,4,5-trimethylphenyl)methane, 1,1,2,2-tetrakis(2,4,5-trimethylphenyl)ethane, and 1,1,2,2-tetraphenylethane, with nonconjugated structures and isolated phenyl rings were synthesized and their photophysical properties were systematically investigated. Interestingly, the emission spectra of these three molecules could be well extended to 600 nm with high solid-state quantum yields of up to 70%. Experimental and theoretical analyses proved that intramolecular through-space conjugation between the "isolated" phenyl rings played an important role for this abnormal phenomenon.

  3. Covalent lanthanide(III) macrocyclic complexes: the bonding nature and optical properties of a promising single antenna molecule.

    PubMed

    Rabanal-León, Walter A; Páez-Hernández, Dayán; Arratia-Pérez, Ramiro

    2014-12-21

    The present work is focused on the elucidation of the electronic structure, bonding nature and optical properties of a series of low symmetry (C2) coordination compounds of type [Ln(III)HAM](3+), where "Ln(III)" are the trivalent lanthanide ions: La(3+), Ce(3+), Eu(3+) and Lu(3+), while "HAM" is the neutral six-nitrogen donor macrocyclic ligand [C22N6H26]. This systematic study has been performed in the framework of the Relativistic Density Functional Theory (R-DFT) and also using a multi-reference approach via the Complete Active Space (CAS) wavefunction treatment with the aim of analyzing their ground state and excited state electronic structures as well as electronic correlation. Furthermore, the use of the energy decomposition scheme proposed by Morokuma-Ziegler and the electron localization function (ELF) allows us to characterize the bonding between the lanthanide ions and the macrocyclic ligand, obtaining as a result a dative-covalent interaction. Due to a great deal of lanthanide optical properties and their technological applications, the absorption spectra of this set of coordination compounds were calculated using the time-dependent density functional theory (TD-DFT), where the presence of the intense Ligand to Metal Charge Transfer (LMCT) bands in the ultraviolet and visible region and the inherent f-f electronic transitions in the Near-Infra Red (NIR) region for some lanthanide ions allow us to propose these systems as "single antenna molecules" with potential applications in NIR technologies.

  4. Organization of Single Molecule Magnets on Surfaces

    NASA Astrophysics Data System (ADS)

    Sessoli, Roberta

    2006-03-01

    The field of magnetic molecular clusters showing slow relaxation of the magnetization has attracted a great interest for the spectacular quantum effects in the dynamics of the magnetization that range from resonant quantum tunneling to topological interferences. Recently these systems, known as Single Molecule Magnets (SMMs), have also been proposed as model systems for the investigation of flame propagation in flammable substances. A renewed interest in SMMs also comes from the possibility to exploit their rich and complex magnetic behavior in nano-spintronics. However, at the crystalline state these molecular materials are substantially insulating. They can however exhibit significant transport properties if the conduction occurs through one molecule connected to two metal electrodes, or through a tunneling mechanism when the SMM is grafted on a conducting surface, as occurs in scanning tunnel microscopy experiments. Molecular compounds can be organized on surfaces thanks to the self assembly technique that exploits the strong affinity of some groups for the surface, e.g. thiols for gold surfaces. However the deposition of large molecules mainly comprising relatively weak coordinative bonds is far from trivial. Several different approaches have started to be investigated. We will briefly review here the strategies developed in a collaboration between the Universities of Florence and Modena. Well isolated molecules on Au(111) surfaces have been obtained with sub-monolayer coverage and different spacers. Organization on a large scale of micrometric structures has been obtained thanks to micro-contact printing. The magnetic properties of the grafted molecules have been investigated through magneto-optical techniques and the results show a significant change in the magnetization dynamics whose origin is still object of investigations.

  5. Mobius Molecules

    ERIC Educational Resources Information Center

    Eckert, J. M.

    1973-01-01

    Discusses formation of chemical molecules via Mobius strip intermediates, and concludes that many special physics-chemical properties of the fully closed circular form (1) of polyoma DNA are explainable by this topological feature. (CC)

  6. Coupling carbon nanomaterials with photochromic molecules for the generation of optically responsive materials

    PubMed Central

    Zhang, Xiaoyan; Hou, Lili; Samorì, Paolo

    2016-01-01

    Multifunctional carbon-based nanomaterials offer routes towards the realization of smart and high-performing (opto)electronic (nano)devices, sensors and logic gates. Meanwhile photochromic molecules exhibit reversible transformation between two forms, induced by the absorption of electromagnetic radiation. By combining carbon-based nanomaterials with photochromic molecules, one can achieve reversible changes in geometrical structure, electronic properties and nanoscale mechanics triggering by light. This thus enables a reversible modulation of numerous physical and chemical properties of the carbon-based nanomaterials towards the fabrication of cognitive devices. This review examines the state of the art with respect to these responsive materials, and seeks to identify future directions for investigation. PMID:27067387

  7. Incorporation of local structure into kriging models for the prediction of atomistic properties in the water decamer.

    PubMed

    Davie, Stuart J; Di Pasquale, Nicodemo; Popelier, Paul L A

    2016-10-15

    Machine learning algorithms have been demonstrated to predict atomistic properties approaching the accuracy of quantum chemical calculations at significantly less computational cost. Difficulties arise, however, when attempting to apply these techniques to large systems, or systems possessing excessive conformational freedom. In this article, the machine learning method kriging is applied to predict both the intra-atomic and interatomic energies, as well as the electrostatic multipole moments, of the atoms of a water molecule at the center of a 10 water molecule (decamer) cluster. Unlike previous work, where the properties of small water clusters were predicted using a molecular local frame, and where training set inputs (features) were based on atomic index, a variety of feature definitions and coordinate frames are considered here to increase prediction accuracy. It is shown that, for a water molecule at the center of a decamer, no single method of defining features or coordinate schemes is optimal for every property. However, explicitly accounting for the structure of the first solvation shell in the definition of the features of the kriging training set, and centring the coordinate frame on the atom-of-interest will, in general, return better predictions than models that apply the standard methods of feature definition, or a molecular coordinate frame. © 2016 The Authors. Journal of Computational Chemistry Published by Wiley Periodicals, Inc. © 2016 The Authors. Journal of Computational Chemistry Published by Wiley Periodicals, Inc.

  8. Structural interaction fingerprints: a new approach to organizing, mining, analyzing, and designing protein-small molecule complexes.

    PubMed

    Singh, Juswinder; Deng, Zhan; Narale, Gaurav; Chuaqui, Claudio

    2006-01-01

    The combination of advances in structure-based drug design efforts in the pharmaceutical industry in parallel with structural genomics initiatives in the public domain has led to an explosion in the number of structures of protein-small molecule complexes structures. This information has critical importance to both the understanding of the structural basis for molecular recognition in biological systems and the design of better drugs. A significant challenge exists in managing this vast amount of data and fully leveraging it. Here, we review our work to develop a simple, fast way to store, organize, mine, and analyze large numbers of protein-small molecule complexes. We illustrate the utility of the approach to the management of inhibitor complexes from the protein kinase family. Finally, we describe our recent efforts in applying this method to the design of target-focused chemical libraries.

  9. Low-Dimensional Material: Structure-Property Relationship and Applications in Energy and Environmental Engineering

    NASA Astrophysics Data System (ADS)

    Xiao, Hang

    properties of P2S3 structure can be tuned by stacking into multilayer P2S3 structures, forming P2S3 nanoribbons or rolling into P2S3 nanotubes, expanding its potential applications for the emerging field of 2D electronics. Then we showed that the hydrolysis reaction is strongly affected by relative humidity. The hydrolysis of CO32- with n = 1-8 water molecules was investigated by ab initio method. For n = 1-5 water molecules, all the reactants follow a stepwise pathway to the transition state. For n = 6-8 water molecules, all the reactants undergo a direct proton transfer to the transition state with overall lower activation free energy. The activation free energy of the reaction is dramatically reduced from 10.4 to 2.4 kcal/mol as the number of water molecules increases from 1 to 6. Meanwhile, the degree of the hydrolysis of CO32- is significantly increased compared to the bulk water solution scenario. The incomplete hydration shells facilitate the hydrolysis of CO3 2- with few water molecules to be not only thermodynamically favorable but also kinetically favorable. We showed that the chemical kinetics is not likely to constrain the speed of CO2 air capture driven by the humidity-swing. (Abstract shortened by ProQuest.).

  10. Crystal structure of a c-kit promoter quadruplex reveals the structural role of metal ions and water molecules in maintaining loop conformation.

    PubMed

    Wei, Dengguo; Parkinson, Gary N; Reszka, Anthony P; Neidle, Stephen

    2012-05-01

    We report here the 1.62 Å crystal structure of an intramolecular quadruplex DNA formed from a sequence in the promoter region of the c-kit gene. This is the first reported crystal structure of a promoter quadruplex and the first observation of localized magnesium ions in a quadruplex structure. The structure reveals that potassium and magnesium ions have an unexpected yet significant structural role in stabilizing particular quadruplex loops and grooves that is distinct from but in addition to the role of potassium ions in the ion channel at the centre of all quadruplex structures. The analysis also shows how ions cluster together with structured water molecules to stabilize the quadruplex arrangement. This particular quadruplex has been previously studied by NMR methods, and the present X-ray structure is in accord with the earlier topology assignment. However, as well as the observations of potassium and magnesium ions, the crystal structure has revealed a highly significant difference in the dimensions of the large cleft in the structure, which is a plausible target for small molecules. This difference can be understood by the stabilizing role of structured water networks.

  11. Structural and mechanical properties of glassy water in nanoscale confinement.

    PubMed

    Lombardo, Thomas G; Giovambattista, Nicolás; Debenedetti, Pablo G

    2009-01-01

    We investigate the structure and mechanical properties of glassy water confined between silica-based surfaces with continuously tunable hydrophobicity and hydrophilicity by computing and analyzing minimum energy, mechanically stable configurations (inherent structures). The structured silica substrate imposes long-range order on the first layer of water molecules under hydrophobic confinement at high density (p > or = 1.0 g cm(-3)). This proximal layer is also structured in hydrophilic confinement at very low density (p approximately 0.4 g cm(-3)). The ordering of water next to the hydrophobic surface greatly enhances the mechanical strength of thin films (0.8 nm). This leads to a substantial stress anisotropy; the transverse strength of the film exceeds the normal strength by 500 MPa. The large transverse strength results in a minimum in the equation of state of the energy landscape that does not correspond to a mechanical instability, but represents disruption of the ordered layer of water next to the wall. In addition, we find that the mode of mechanical failure is dependent on the type of confinement. Under large lateral strain, water confined by hydrophilic surfaces preferentially forms voids in the middle of the film and fails cohesively. In contrast, water under hydrophobic confinement tends to form voids near the walls and fails by loss of adhesion.

  12. Asymmetric orientation of toluene molecules at oil-silica interfaces

    NASA Astrophysics Data System (ADS)

    Ledyastuti, Mia; Liang, Yunfeng; Kunieda, Makoto; Matsuoka, Toshifumi

    2012-08-01

    The interfacial structure of heptane and toluene at oil-silica interfaces has previously been studied by sum frequency generation [Z. Yang et al., J. Phys. Chem. C. 113, 20355 (2009)], 10.1021/jp9043122. It was found that the toluene molecule is almost perpendicular to the silica surface with a tilt angle of about 25°. Here, we have investigated the structural properties of toluene and heptane at oil-silica interfaces using molecular dynamics simulations for two different surfaces: the oxygen-bridging (hydrophobic) and hydroxyl-terminated (hydrophilic) surfaces of quartz (silica). Based on the density profile, it was found that both heptane and toluene oscillate on silica surfaces, with heptane showing more oscillation peaks. Furthermore, the toluene molecules of the first layer were found to have an asymmetric distribution of orientations, with more CH3 groups pointed away from the silica surface than towards the silica surface. These findings are generally consistent with previous experiments, and reveal enhanced molecular structures of liquids at oil-silica interfaces.

  13. Asymmetric orientation of toluene molecules at oil-silica interfaces.

    PubMed

    Ledyastuti, Mia; Liang, Yunfeng; Kunieda, Makoto; Matsuoka, Toshifumi

    2012-08-14

    The interfacial structure of heptane and toluene at oil-silica interfaces has previously been studied by sum frequency generation [Z. Yang et al., J. Phys. Chem. C. 113, 20355 (2009)]. It was found that the toluene molecule is almost perpendicular to the silica surface with a tilt angle of about 25°. Here, we have investigated the structural properties of toluene and heptane at oil-silica interfaces using molecular dynamics simulations for two different surfaces: the oxygen-bridging (hydrophobic) and hydroxyl-terminated (hydrophilic) surfaces of quartz (silica). Based on the density profile, it was found that both heptane and toluene oscillate on silica surfaces, with heptane showing more oscillation peaks. Furthermore, the toluene molecules of the first layer were found to have an asymmetric distribution of orientations, with more CH(3) groups pointed away from the silica surface than towards the silica surface. These findings are generally consistent with previous experiments, and reveal enhanced molecular structures of liquids at oil-silica interfaces.

  14. Cellulose nanomaterials review: structure, properties and nanocomposites

    Treesearch

    Robert J. Moon; Ashlie Martini; John Nairn; John Simonsen; Jeff Youngblood

    2011-01-01

    This critical review provides a processing-structure-property perspective on recent advances in cellulose nanoparticles and composites produced from them. It summarizes cellulose nanoparticles in terms of particle morphology, crystal structure, and properties. Also described are the self-assembly and rheological properties of cellulose nanoparticle suspensions. The...

  15. Structures and physical properties of the cocrystals of adefovir dipivoxil with dicarboxylic acids

    NASA Astrophysics Data System (ADS)

    Jung, Sungyup; Lee, Jonghwi; Kim, Il Won

    2013-06-01

    The cocrystallization of adefovir dipivoxil (AD) with suberic acid (SUB) or succinic acid (SUC) was examined. X-ray diffraction was used to determine the structures of AD/SUB and AD/SUC cocrystals. Both cocrystals were formed via multiple hydrogen bonds between the adenine part of AD and the carboxylic acid groups of SUB or SUC. Longer SUB effectively dispersed AD molecules, and AD hydrogen-bonded only to SUB. When shorter SUC was used, AD formed hydrogen bonding with both SUC and adjacent AD. As a result, the cocrystal compositions were AD/SUB=1:1 and AD/SUC=2:1. Both cocrystals displayed superior thermal stability and increased aqueous solubility. The present study demonstrated that the adenine and similar structures of active pharmaceutical ingredients could be used to produce cocrystals of improved physical properties.

  16. Static force fields simulations of reduced CeO2 (110) surface: Structure and adsorption of H2O molecule

    NASA Astrophysics Data System (ADS)

    Vives, Serge; Meunier, Cathy

    2018-02-01

    The CeO2(110) surface properties are largely involved in the catalysis, energy and biological phenomenon. The Static Force Fields simulations are able to describe large atomic systems surface even if no information on the electronic structure can be obtained. We employ those simulations to study the formation of the neutral 2 CeCe‧ VO•• cluster. We focus on seven different cluster configurations and find that the defect formation energy is the lower for the 1N-2N configurations. Two geometries are possible, as it is the case for the ab initio studies, the in plane and the more stable bridging one. We evidence the modifications of the surface energy and the Potential Energy Surface due to the presence of the 2 CeCe‧ VO•• defect. The physical adsorption of a water molecule is calculated and the geometry described for all the cluster configurations. The H2O molecule physisorption stabilizes the Ce(110) surface and the presence of the 2 CeCe‧ VO•• defect increases this effect.

  17. Ocean acidification affects marine chemical communication by changing structure and function of peptide signalling molecules.

    PubMed

    Roggatz, Christina C; Lorch, Mark; Hardege, Jörg D; Benoit, David M

    2016-12-01

    Ocean acidification is a global challenge that faces marine organisms in the near future with a predicted rapid drop in pH of up to 0.4 units by the end of this century. Effects of the change in ocean carbon chemistry and pH on the development, growth and fitness of marine animals are well documented. Recent evidence also suggests that a range of chemically mediated behaviours and interactions in marine fish and invertebrates will be affected. Marine animals use chemical cues, for example, to detect predators, for settlement, homing and reproduction. But, while effects of high CO 2 conditions on these behaviours are described across many species, little is known about the underlying mechanisms, particularly in invertebrates. Here, we investigate the direct influence of future oceanic pH conditions on the structure and function of three peptide signalling molecules with an interdisciplinary combination of methods. NMR spectroscopy and quantum chemical calculations were used to assess the direct molecular influence of pH on the peptide cues, and we tested the functionality of the cues in different pH conditions using behavioural bioassays with shore crabs (Carcinus maenas) as a model system. We found that peptide signalling cues are susceptible to protonation in future pH conditions, which will alter their overall charge. We also show that structure and electrostatic properties important for receptor binding differ significantly between the peptide forms present today and the protonated signalling peptides likely to be dominating in future oceans. The bioassays suggest an impaired functionality of the signalling peptides at low pH. Physiological changes due to high CO 2 conditions were found to play a less significant role in influencing the investigated behaviour. From our results, we conclude that the change of charge, structure and consequently function of signalling molecules presents one possible mechanism to explain altered behaviour under future oceanic p

  18. Functional materials discovery using energy-structure-function maps

    NASA Astrophysics Data System (ADS)

    Pulido, Angeles; Chen, Linjiang; Kaczorowski, Tomasz; Holden, Daniel; Little, Marc A.; Chong, Samantha Y.; Slater, Benjamin J.; McMahon, David P.; Bonillo, Baltasar; Stackhouse, Chloe J.; Stephenson, Andrew; Kane, Christopher M.; Clowes, Rob; Hasell, Tom; Cooper, Andrew I.; Day, Graeme M.

    2017-03-01

    Molecular crystals cannot be designed in the same manner as macroscopic objects, because they do not assemble according to simple, intuitive rules. Their structures result from the balance of many weak interactions, rather than from the strong and predictable bonding patterns found in metal-organic frameworks and covalent organic frameworks. Hence, design strategies that assume a topology or other structural blueprint will often fail. Here we combine computational crystal structure prediction and property prediction to build energy-structure-function maps that describe the possible structures and properties that are available to a candidate molecule. Using these maps, we identify a highly porous solid, which has the lowest density reported for a molecular crystal so far. Both the structure of the crystal and its physical properties, such as methane storage capacity and guest-molecule selectivity, are predicted using the molecular structure as the only input. More generally, energy-structure-function maps could be used to guide the experimental discovery of materials with any target function that can be calculated from predicted crystal structures, such as electronic structure or mechanical properties.

  19. Functional materials discovery using energy-structure-function maps.

    PubMed

    Pulido, Angeles; Chen, Linjiang; Kaczorowski, Tomasz; Holden, Daniel; Little, Marc A; Chong, Samantha Y; Slater, Benjamin J; McMahon, David P; Bonillo, Baltasar; Stackhouse, Chloe J; Stephenson, Andrew; Kane, Christopher M; Clowes, Rob; Hasell, Tom; Cooper, Andrew I; Day, Graeme M

    2017-03-30

    Molecular crystals cannot be designed in the same manner as macroscopic objects, because they do not assemble according to simple, intuitive rules. Their structures result from the balance of many weak interactions, rather than from the strong and predictable bonding patterns found in metal-organic frameworks and covalent organic frameworks. Hence, design strategies that assume a topology or other structural blueprint will often fail. Here we combine computational crystal structure prediction and property prediction to build energy-structure-function maps that describe the possible structures and properties that are available to a candidate molecule. Using these maps, we identify a highly porous solid, which has the lowest density reported for a molecular crystal so far. Both the structure of the crystal and its physical properties, such as methane storage capacity and guest-molecule selectivity, are predicted using the molecular structure as the only input. More generally, energy-structure-function maps could be used to guide the experimental discovery of materials with any target function that can be calculated from predicted crystal structures, such as electronic structure or mechanical properties.

  20. Recent advances in the structure elucidation of small organic molecules by the LSD software.

    PubMed

    Plainchont, Bertrand; de Paulo Emerenciano, Vicente; Nuzillard, Jean-Marc

    2013-08-01

    The LSD software proposes the structures of small organic molecules that fit with structural constraints from 1D and 2D NMR spectroscopy. Its initial design introduced limits that needed to be eliminated to extend its scope and help its users choose the most likely structure among those proposed. The LSD software code has been improved, so that it recognizes a wider set of atom types to build molecules. More flexibility has been given in the interpretation of 2D NMR data, including the automatic detection of very long-range correlations. A program named pyLSD was written to deal with problems in which atom types are ambiguously defined. It also provides a (13)C NMR chemical shift-based solution ranking algorithm. PyLSD was able to propose the correct structure of hexacyclinol, a natural product whose structure determination has been highly controversal. The solution was ranked first within a list of ten structures that were produced by pyLSD from the literature NMR data. The structure of an aporphin natural product was determined by pyLSD, taking advantage of the possibility of handling electrically charged atoms. The structure generation of the insect antifeedant azadirachtin by LSD was reinvestigated by pyLSD, considering that three (13)C resonances did not lead to univocal hybridization states. Copyright © 2013 John Wiley & Sons, Ltd.

  1. Principal Component Analysis of Lipid Molecule Conformational Changes in Molecular Dynamics Simulations.

    PubMed

    Buslaev, Pavel; Gordeliy, Valentin; Grudinin, Sergei; Gushchin, Ivan

    2016-03-08

    Molecular dynamics simulations of lipid bilayers are ubiquitous nowadays. Usually, either global properties of the bilayer or some particular characteristics of each lipid molecule are evaluated in such simulations, but the structural properties of the molecules as a whole are rarely studied. Here, we show how a comprehensive quantitative description of conformational space and dynamics of a single lipid molecule can be achieved via the principal component analysis (PCA). We illustrate the approach by analyzing and comparing simulations of DOPC bilayers obtained using eight different force fields: all-atom generalized AMBER, CHARMM27, CHARMM36, Lipid14, and Slipids and united-atom Berger, GROMOS43A1-S3, and GROMOS54A7. Similarly to proteins, most of the structural variance of a lipid molecule can be described by only a few principal components. These major components are similar in different simulations, although there are notable distinctions between the older and newer force fields and between the all-atom and united-atom force fields. The DOPC molecules in the simulations generally equilibrate on the time scales of tens to hundreds of nanoseconds. The equilibration is the slowest in the GAFF simulation and the fastest in the Slipids simulation. Somewhat unexpectedly, the equilibration in the united-atom force fields is generally slower than in the all-atom force fields. Overall, there is a clear separation between the more variable previous generation force fields and significantly more similar new generation force fields (CHARMM36, Lipid14, Slipids). We expect that the presented approaches will be useful for quantitative analysis of conformations and dynamics of individual lipid molecules in other simulations of lipid bilayers.

  2. Spectrophotometric and electrical properties of imperatorin: an organic molecule

    NASA Astrophysics Data System (ADS)

    Mir, Feroz A.

    2015-09-01

    Imperatorin (molecular formula = C16H14O4, molecular mass = 270) an organic molecule was isolated from ethyl acetate extract of the root parts of the plant Prangos pabularia. The optical study was carried out by ultraviolet-visible spectroscopy, and this compound showed an indirect allowed transition. The optical band gap ( E g ) was found around 3.75 eV. Photoluminescence shows various good emission bands. The frequency-dependent real part of the complex ac conductivity was found to follow the universal dielectric response: σ ac ( ω) α ω s [where σ ac ( ω) is the frequency-dependent total conductivity, ω is the frequency, and s is the frequency exponent]. From ac conductivity data analysis, correlated barrier hopping charge-transport mechanism is the dominant electrical transport process shown by this compound. The good emission, less absorption, wide band gap and good electrical properties shown by this compound project them as a bright choice for organic electronic devices.

  3. Coherent interaction of single molecules and plasmonic nanowires

    NASA Astrophysics Data System (ADS)

    Gerhardt, Ilja; Grotz, Bernhard; Siyushev, Petr; Wrachtrup, Jörg

    2017-09-01

    Quantum plasmonics opens the option to integrate complex quantum optical circuitry onto chip scale devices. In the past, often external light sources were used and nonclassical light was coupled in and out of plasmonic structures, such as hole arrays or waveguide structures. Another option to launch single plasmonic excitations is the coupling of single emitters in the direct proximity of, e.g., a silver or gold nanostructure. Here, we present our attempts to integrate the research of single emitters with wet-chemically grown silver nanowires. The emitters of choice are single organic dye molecules under cryogenic conditions, which are known to act as high-brightness and extremely narrow-band single photon sources. Another advantage is their high optical nonlinearity, such that they might mediate photon-photon interactions on the nanoscale. We report on the coupling of a single molecule fluorescence emission through the wire over the length of several wavelengths. The transmission of coherently emitted photons is proven by an extinction type experiment. As for influencing the spectral properties of a single emitter, we are able to show a remote change of the line-width of a single terrylene molecule, which is in close proximity to the nanowire.

  4. “Roller-Wheel”-Type Pt-Containing Small Molecules and the Impact of “Rollers” on Material Crystallinity, Electronic Properties, and Solar Cell Performance

    DOE PAGES

    He, Wenhan; Livshits, Maksim Y.; Dickie, Diane A.; ...

    2017-07-21

    We report the synthesis, characterization, and detailed comparison of a series of novel Pt-bisacetylide containing conjugated small molecules possessing an unconventional “roller-wheel” shaped structure that is distinctly different from the “dumbbell” designs in traditional Pt-bisacetylide containing conjugated polymers and small molecules. The relationships between the chemical nature and length of the “rollers” and the electronic and physical properties of the materials are carefully studied by steady-state spectroscopy, cyclic voltammetry, differential scanning calorimetry, single-crystal X-ray diffraction, transient absorption spectroscopy, theoretical calculation, and device application. It was revealed that if the roller are long enough, these molecules can “slip-stack” in the solidmore » state, leading to high crystallinity and charge mobility. Organic solar cells were fabricated and showed power conversion efficiencies up to 5.9%, out-performing all existing Pt-containing materials. The device performance was also found to be sensitive to optimization conditions and blend morphologies, which are a result of the intricate interplay among materials crystallinity, phase separation, and the relative positions of the lowest singlet and triplet excited states.« less

  5. “Roller-Wheel”-Type Pt-Containing Small Molecules and the Impact of “Rollers” on Material Crystallinity, Electronic Properties, and Solar Cell Performance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Wenhan; Livshits, Maksim Y.; Dickie, Diane A.

    We report the synthesis, characterization, and detailed comparison of a series of novel Pt-bisacetylide containing conjugated small molecules possessing an unconventional “roller-wheel” shaped structure that is distinctly different from the “dumbbell” designs in traditional Pt-bisacetylide containing conjugated polymers and small molecules. The relationships between the chemical nature and length of the “rollers” and the electronic and physical properties of the materials are carefully studied by steady-state spectroscopy, cyclic voltammetry, differential scanning calorimetry, single-crystal X-ray diffraction, transient absorption spectroscopy, theoretical calculation, and device application. It was revealed that if the roller are long enough, these molecules can “slip-stack” in the solidmore » state, leading to high crystallinity and charge mobility. Organic solar cells were fabricated and showed power conversion efficiencies up to 5.9%, out-performing all existing Pt-containing materials. The device performance was also found to be sensitive to optimization conditions and blend morphologies, which are a result of the intricate interplay among materials crystallinity, phase separation, and the relative positions of the lowest singlet and triplet excited states.« less

  6. Advances in structure elucidation of small molecules using mass spectrometry

    PubMed Central

    Fiehn, Oliver

    2010-01-01

    The structural elucidation of small molecules using mass spectrometry plays an important role in modern life sciences and bioanalytical approaches. This review covers different soft and hard ionization techniques and figures of merit for modern mass spectrometers, such as mass resolving power, mass accuracy, isotopic abundance accuracy, accurate mass multiple-stage MS(n) capability, as well as hybrid mass spectrometric and orthogonal chromatographic approaches. The latter part discusses mass spectral data handling strategies, which includes background and noise subtraction, adduct formation and detection, charge state determination, accurate mass measurements, elemental composition determinations, and complex data-dependent setups with ion maps and ion trees. The importance of mass spectral library search algorithms for tandem mass spectra and multiple-stage MS(n) mass spectra as well as mass spectral tree libraries that combine multiple-stage mass spectra are outlined. The successive chapter discusses mass spectral fragmentation pathways, biotransformation reactions and drug metabolism studies, the mass spectral simulation and generation of in silico mass spectra, expert systems for mass spectral interpretation, and the use of computational chemistry to explain gas-phase phenomena. A single chapter discusses data handling for hyphenated approaches including mass spectral deconvolution for clean mass spectra, cheminformatics approaches and structure retention relationships, and retention index predictions for gas and liquid chromatography. The last section reviews the current state of electronic data sharing of mass spectra and discusses the importance of software development for the advancement of structure elucidation of small molecules. Electronic supplementary material The online version of this article (doi:10.1007/s12566-010-0015-9) contains supplementary material, which is available to authorized users. PMID:21289855

  7. Transport mirages in single-molecule devices

    NASA Astrophysics Data System (ADS)

    Gaudenzi, R.; Misiorny, M.; Burzurí, E.; Wegewijs, M. R.; van der Zant, H. S. J.

    2017-03-01

    Molecular systems can exhibit a complex, chemically tailorable inner structure which allows for targeting of specific mechanical, electronic, and optical properties. At the single-molecule level, two major complementary ways to explore these properties are molecular quantum-dot structures and scanning probes. This article outlines comprehensive principles of electron-transport spectroscopy relevant to both these approaches and presents a new, high-resolution experiment on a high-spin single-molecule junction exemplifying these principles. Such spectroscopy plays a key role in further advancing our understanding of molecular and atomic systems, in particular, the relaxation of their spin. In this joint experimental and theoretical analysis, particular focus is put on the crossover between the resonant regime [single-electron tunneling] and the off-resonant regime [inelastic electron (co)tunneling spectroscopy (IETS)]. We show that the interplay of these two processes leads to unexpected mirages of resonances not captured by either of the two pictures alone. Although this turns out to be important in a large fraction of the possible regimes of level positions and bias voltages, it has been given little attention in molecular transport studies. Combined with nonequilibrium IETS—four-electron pump-probe excitations—these mirages provide crucial information on the relaxation of spin excitations. Our encompassing physical picture is supported by a master-equation approach that goes beyond weak coupling. The present work encourages the development of a broader connection between the fields of molecular quantum-dot and scanning probe spectroscopy.

  8. Modeling Molecules

    NASA Technical Reports Server (NTRS)

    2000-01-01

    The molecule modeling method known as Multibody Order (N) Dynamics, or MBO(N)D, was developed by Moldyn, Inc. at Goddard Space Flight Center through funding provided by the SBIR program. The software can model the dynamics of molecules through technology which stimulates low-frequency molecular motions and properties, such as movements among a molecule's constituent parts. With MBO(N)D, a molecule is substructured into a set of interconnected rigid and flexible bodies. These bodies replace the computation burden of mapping individual atoms. Moldyn's technology cuts computation time while increasing accuracy. The MBO(N)D technology is available as Insight II 97.0 from Molecular Simulations, Inc. Currently the technology is used to account for forces on spacecraft parts and to perform molecular analyses for pharmaceutical purposes. It permits the solution of molecular dynamics problems on a moderate workstation, as opposed to on a supercomputer.

  9. Morphological study on small molecule acceptor-based organic solar cells with efficiencies beyond 7% (Presentation Recording)

    NASA Astrophysics Data System (ADS)

    Ma, Wei; Yan, He

    2015-10-01

    Despite the essential role of fullerenes in achieving best-performance organic solar cells (OSCs), fullerene acceptors have several drawbacks including poor light absorption, high-cost production and purification. For this reason, small molecule acceptor (SMA)-based OSCs have attracted much attention due to the easy tunability of electronic and optical properties of SMA materials. In this study, polymers with temperature dependent aggregation behaviors are combined with various small molecule acceptor materials, which lead to impressive power conversion efficiencies of up to 7.3%. The morphological and aggregation properties of the polymer:small molecule blends are studied in details. It is found that the temperature-dependent aggregation behavior of polymers allows for the processing of the polymer solutions at moderately elevated temperature, and more importantly, controlled aggregation and strong crystallization of the polymer during the film cooling and drying process. This results in a well-controlled and near-ideal polymer:small molecule morphology that is controlled by polymer aggregation during warm casting and thus insensitive to the choice of small molecules. As a result, several cases of highly efficient (PCE between 6-7.3%) SMA OSCs are achieved. The second part of this presentation will describe the morphology of a new small molecule acceptor with a unique 3D structure. The relationship between molecular structure and morphology is revealed.

  10. Structures and anti-inflammatory properties of 4-halogenated -mofebutazones

    NASA Astrophysics Data System (ADS)

    Reichelt, Hendrik; Paradies, Henrich H.

    2018-02-01

    The crystal structures of the 4-halogenated (hal: F, Cl, Br)-4-butyl-1-phenyl-1,3-pyrolidine-dione (mofebutazone) are determined, and compared with their solution structures. The racemic 4-halogenated mofebutazone approximants crystallize in a monoclinic space group with four molecules in the unit cell. The 4-hal-mofebutazone molecules reveal strong hydrogen bonding between the hydrogen atom located at the N-2 nitrogen atom and a carbonyl oxygen atom of an adjacent 4-hal-mofebutazone molecule. The hydrogen bond angle for 4-Br-mifebutazone N (2)sbnd H (1)⋯O (1) is 173(3) °, so that the hydrogen bond is essentially linear indicating an infinite chain hydrogen bond network. The 3d and 2d structures are stabilized by π-π and σ-π interactions, short intermolecular distances, and apolar forces between adjacently stacked phenyl rings. Small-angle-X-ray scattering (SAXS) experiments and osmometric measurements reveal the presence of dimers for the 4-hal-mofebutazone molecules. Molecular simulations indicate similar solution structure factors for the 4-hal-mofebutazones solutions, S(Q), and in the solid state. There is a strong indication that the [1,1,0], [1,0,0], and [1,0,0] periodicities of the 4-Brsbnd , 4-Clsbnd and 4-F-mofebutazone in the crystalline solid state were also present in the solution phase. The biochemical and cellular activities of the different 4-hal-mofebutazones were monitored by the magnitude of their inhibition of the PGE2 biosynthesis through the cyclo-oxygenase (COX-1) in macrophages, and on the inhibition of LTD4 (5-lipoxygenase) in polymorphonuclear leukocytes.

  11. Supramolecular Amino Acid Based Hydrogels: Probing the Contribution of Additive Molecules using NMR Spectroscopy

    PubMed Central

    Ramalhete, Susana M.; Nartowski, Karol P.; Sarathchandra, Nichola; Foster, Jamie S.; Round, Andrew N.; Angulo, Jesús

    2017-01-01

    Abstract Supramolecular hydrogels are composed of self‐assembled solid networks that restrict the flow of water. l‐Phenylalanine is the smallest molecule reported to date to form gel networks in water, and it is of particular interest due to its crystalline gel state. Single and multi‐component hydrogels of l‐phenylalanine are used herein as model materials to develop an NMR‐based analytical approach to gain insight into the mechanisms of supramolecular gelation. Structure and composition of the gel fibres were probed using PXRD, solid‐state NMR experiments and microscopic techniques. Solution‐state NMR studies probed the properties of free gelator molecules in an equilibrium with bound molecules. The dynamics of exchange at the gel/solution interfaces was investigated further using high‐resolution magic angle spinning (HR‐MAS) and saturation transfer difference (STD) NMR experiments. This approach allowed the identification of which additive molecules contributed in modifying the material properties. PMID:28401991

  12. Electronic absorption, vibrational spectra, nonlinear optical properties, NBO analysis and thermodynamic properties of N-(4-nitro-2-phenoxyphenyl) methanesulfonamide molecule by ab initio HF and density functional methods.

    PubMed

    Rajamani, T; Muthu, S; Karabacak, M

    2013-05-01

    In this work, the vibrational spectral analysis was carried out by using FT-Raman and FT-IR spectroscopy in the range 4000-100 cm(-1) and 4000-400 cm(-1), respectively, for N-(4-nitro-2-phenoxyphenyl) methanesulfonamide molecule. Theoretical calculations were performed by ab initio RHF and density functional theory (DFT) method using 6-31G(d,p) and 6-311G(d,p) basis sets. The complete vibrational assignments of wavenumbers were made on the basis of potential energy distribution (PED). The results of the calculations were applied to simulated spectra of the title compound, which show excellent agreement with observed spectra. The frontier orbital energy gap and dipole moment illustrates the high reactivity of the title molecule. The first order hyperpolarizability (β0) and related properties (μ, α and Δα) of the molecule were also calculated. Stability of the molecule arising from hyperconjugative interactions and charge delocalization were analyzed using natural bond orbital (NBO) analysis. The results show that electron density (ED) in the σ(*) and π(*) anti-bonding orbitals and second order delocalization energies (E2) confirm the occurrence of intramolecular charge transfer (ICT) within the molecule. UV-vis spectrum of the compound was recorded in the region 200-500 nm in ethanol and electronic properties such as excitation energies, oscillator strength and wavelength were calculated by TD-DFT/B3LYP, CIS and TD-HF methods using 6-31G(d,p) basis set. Molecular electrostatic potential (MEP) and HOMO-LUMO energy levels are also constructed. The thermodynamic properties of the title compound were calculated at different temperatures and the results reveals the heat capacity (C), and entropy (S) increases with rise in temperature. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Influence of Inert and Oxidizing Atmospheres on the Physical and Optical Properties of Luminescent Carbon Dots Prepared through Pyrolysis of a Model Molecule.

    PubMed

    Machado, Cláudia Emanuele; Tartuci, Letícia Gazola; de Fátima Gorgulho, Honória; de Oliveira, Luiz Fernando Cappa; Bettini, Jefferson; Pereira dos Santos, Daniela; Ferrari, Jefferson Luis; Schiavon, Marco Antônio

    2016-03-18

    This work used L-tartaric acid as a model molecule to evaluate how the use of inert and oxidizing atmospheres during pyrolysis affected the physical and optical properties of the resulting carbon dots (CDs). Pyrolysis revealed to be a simple procedure that afforded CDs in a single step, dismissed the addition of organic solvents, and involved only one extraction stage that employed water. By X-ray diffraction a dependency between the structure of the CDs and the atmosphere (oxidizing or inert) used during the pyrolysis was found. Potentiometric titration demonstrated that the CDs were largely soluble in water; it also aided characterization of the various groups that contained sp(3) -hybridized carbon atoms on the surface of the dots. Raman spectroscopy suggested that different amounts of sp(2)- and sp(3)-hybridized carbon atoms emerged on the CDs depending on the pyrolysis atmosphere. In conclusion, the pyrolysis atmosphere influenced the physical properties, such as the composition and the final structure. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. pH-dependent structures and properties of casein micelles.

    PubMed

    Liu, Yan; Guo, Rong

    2008-08-01

    The association behavior of casein over a broad pH range has first been investigated by fluorescent technique together with DLS and turbidity measurements. Casein molecules can self-assemble into casein micelles in the pH ranges 2.0 to 3.0, and 5.5 to 12.0. The hydrophobic interaction, hydrogen bond and electrostatic action are the main interactions in the formation of casein micelles. The results show that the structure of casein micelles is more compact at low pH and looser at high pH. The casein micelle has the most compact structure at pH 5.5, when it has almost no electrostatic repulsion between casein molecules.

  15. Pulse gas chromatographic study of adsorption of substituted aromatics and heterocyclic molecules on MIL-47 at zero coverage.

    PubMed

    Duerinck, Tim; Couck, Sarah; Vermoortele, Frederik; De Vos, Dirk E; Baron, Gino V; Denayer, Joeri F M

    2012-10-02

    The low coverage adsorptive properties of the MIL-47 metal organic framework toward aromatic and heterocyclic molecules are reported in this paper. The effect of molecular functionality and size on Henry adsorption constants and adsorption enthalpies of alkyl and heteroatom functionalized benzene derivates and heterocyclic molecules was studied using pulse gas chromatography. By means of statistical analysis, experimental data was analyzed and modeled using principal component analysis and partial least-squares regression. Structure-property relationships were established, revealing and confirming several trends. Among the molecular properties governing the adsorption process, vapor pressure, mean polarizability, and dipole moment play a determining role.

  16. Electron transport property of tetrathiafulvalene molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mondal, Rajkumar; Bhattacharya, Barnali; Deb, Jyotirmoy

    2016-05-23

    We have investigated electron transport behavior of tetrathiafulvalene molecule connected with zigzag graphene nanoribbon (zGNR) using density functional theory combined with non-equilibrium Green’s function method. We have reported the transmission coefficient of the scattering region at different bias voltage to explain the nature of the current.

  17. Quantum molecular dynamics study on the proton exchange, ionic structures, and transport properties of warm dense hydrogen-deuterium mixtures

    NASA Astrophysics Data System (ADS)

    Liu, Lei; Li, Zhi-Guo; Dai, Jia-Yu; Chen, Qi-Feng; Chen, Xiang-Rong

    2018-06-01

    Comprehensive knowledge of physical properties such as equation of state (EOS), proton exchange, dynamic structures, diffusion coefficients, and viscosities of hydrogen-deuterium mixtures with densities from 0.1 to 5 g /cm3 and temperatures from 1 to 50 kK has been presented via quantum molecular dynamics (QMD) simulations. The existing multi-shock experimental EOS provides an important benchmark to evaluate exchange-correlation functionals. The comparison of simulations with experiments indicates that a nonlocal van der Waals density functional (vdW-DF1) produces excellent results. Fraction analysis of molecules using a weighted integral over pair distribution functions was performed. A dissociation diagram together with a boundary where the proton exchange (H2+D2⇌2 HD ) occurs was generated, which shows evidence that the HD molecules form as the H2 and D2 molecules are almost 50% dissociated. The mechanism of proton exchange can be interpreted as a process of dissociation followed by recombination. The ionic structures at extreme conditions were analyzed by the effective coordination number model. High-order cluster, circle, and chain structures can be founded in the strongly coupled warm dense regime. The present QMD diffusion coefficient and viscosity can be used to benchmark two analytical one-component plasma (OCP) models: the Coulomb and Yukawa OCP models.

  18. Structure and physical properties of silkworm cocoons

    PubMed Central

    Chen, Fujia; Porter, David; Vollrath, Fritz

    2012-01-01

    Silkworm cocoons have evolved a wide range of different structures and combinations of physical and chemical properties in order to cope with different threats and environmental conditions. We present our observations and measurements on 25 diverse types of cocoons in a first attempt to correlate physical properties with the structure and morphology of the cocoons. These two architectural parameters appear to be far more important than the material properties of the silk fibres themselves. We consider tensile and compressive mechanical properties and gas permeation of the cocoon walls, and in each case identify mechanisms or models that relate these properties to cocoon structure, usually based upon non-woven fibre composites. These properties are of relevance also for synthetic non-woven composite materials and our studies will help formulate bio-inspired design principles for new materials. PMID:22552916

  19. A single-molecule diode

    NASA Astrophysics Data System (ADS)

    Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B.; Mayor, Marcel

    2005-06-01

    We have designed and synthesized a molecular rod that consists of two weakly coupled electronic π -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current-voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur-gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current-voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical π -systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current-voltage characteristics, similar to the phenomena in a semiconductor diode. Author contributions: F.E., H.B.W., and M.M. designed research; M.E., R.O., M.K., M.F., F.E., H.B.W., and M.M. performed research; M.E., R.O., M.K., M.F., C.v.H., F.W., F.E., H.B.W., and M.M. contributed new reagents/analytic tools; M.E., R.O., M.K., C.v.H., F.E., H.B.W., and M.M. analyzed data; and F.E., H.B.W., and M.M. wrote the paper.This paper was submitted directly (Track II) to the PNAS office.Abbreviations: A, acceptor; D, donor; MCB, mechanically controlled break junction.Data deposition: The atomic coordinates have been deposited in the Cambridge Structural Database, Cambridge Crystallographic Data Centre, Cambridge CB2 1EZ, United Kingdom (CSD reference no. 241632).

  20. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rønnest, A. K.; Peters, G. H.; Hansen, F. Y., E-mail: flemming@kemi.dtu.dk

    2016-04-14

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for allmore » water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10{sup 8}–10{sup 9} V m{sup −1}, which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10{sup 8} V m{sup −1}) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10{sup 8} V m{sup −1}) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred

  1. High-harmonic spectroscopy of aligned molecules

    NASA Astrophysics Data System (ADS)

    Yun, Hyeok; Yun, Sang Jae; Lee, Gae Hwang; Nam, Chang Hee

    2017-01-01

    High harmonics emitted from aligned molecules driven by intense femtosecond laser pulses provide the opportunity to explore the structural information of molecules. The field-free molecular alignment technique is an expedient tool for investigating the structural characteristics of linear molecules. The underlying physics of field-free alignment, showing the characteristic revival structure specific to molecular species, is clearly explained from the quantum-phase analysis of molecular rotational states. The anisotropic nature of molecules is shown from the harmonic polarization measurement performed with spatial interferometry. The multi-orbital characteristics of molecules are investigated using high-harmonic spectroscopy, applied to molecules of N2 and CO2. In the latter case the two-dimensional high-harmonic spectroscopy, implemented using a two-color laser field, is applied to distinguish harmonics from different orbitals. Molecular high-harmonic spectroscopy will open a new route to investigate ultrafast dynamics of molecules.

  2. Structural and Functional Hierarchy in Photosynthetic Energy Conversion—from Molecules to Nanostructures

    NASA Astrophysics Data System (ADS)

    Szabó, Tibor; Magyar, Melinda; Hajdu, Kata; Dorogi, Márta; Nyerki, Emil; Tóth, Tünde; Lingvay, Mónika; Garab, Győző; Hernádi, Klára; Nagy, László

    2015-12-01

    Basic principles of structural and functional requirements of photosynthetic energy conversion in hierarchically organized machineries are reviewed. Blueprints of photosynthesis, the energetic basis of virtually all life on Earth, can serve the basis for constructing artificial light energy-converting molecular devices. In photosynthetic organisms, the conversion of light energy into chemical energy takes places in highly organized fine-tunable systems with structural and functional hierarchy. The incident photons are absorbed by light-harvesting complexes, which funnel the excitation energy into reaction centre (RC) protein complexes containing redox-active chlorophyll molecules; the primary charge separations in the RCs are followed by vectorial transport of charges (electrons and protons) in the photosynthetic membrane. RCs possess properties that make their use in solar energy-converting and integrated optoelectronic systems feasible. Therefore, there is a large interest in many laboratories and in the industry toward their use in molecular devices. RCs have been bound to different carrier matrices, with their photophysical and photochemical activities largely retained in the nano-systems and with electronic connection to conducting surfaces. We show examples of RCs bound to carbon-based materials (functionalized and non-functionalized single- and multiwalled carbon nanotubes), transitional metal oxides (ITO) and conducting polymers and porous silicon and characterize their photochemical activities. Recently, we adapted several physical and chemical methods for binding RCs to different nanomaterials. It is generally found that the P+(QAQB)- charge pair, which is formed after single saturating light excitation is stabilized after the attachment of the RCs to the nanostructures, which is followed by slow reorganization of the protein structure. Measuring the electric conductivity in a direct contact mode or in electrochemical cell indicates that there is an

  3. Conserved water molecules in bacterial serine hydroxymethyltransferases.

    PubMed

    Milano, Teresa; Di Salvo, Martino Luigi; Angelaccio, Sebastiana; Pascarella, Stefano

    2015-10-01

    Water molecules occurring in the interior of protein structures often are endowed with key structural and functional roles. We report the results of a systematic analysis of conserved water molecules in bacterial serine hydroxymethyltransferases (SHMTs). SHMTs are an important group of pyridoxal-5'-phosphate-dependent enzymes that catalyze the reversible conversion of l-serine and tetrahydropteroylglutamate to glycine and 5,10-methylenetetrahydropteroylglutamate. The approach utilized in this study relies on two programs, ProACT2 and WatCH. The first software is able to categorize water molecules in a protein crystallographic structure as buried, positioned in clefts or at the surface. The other program finds, in a set of superposed homologous proteins, water molecules that occur approximately in equivalent position in each of the considered structures. These groups of molecules are referred to as 'clusters' and represent structurally conserved water molecules. Several conserved clusters of buried or cleft water molecules were found in the set of 11 bacterial SHMTs we took into account for this work. The majority of these clusters were not described previously. Possible structural and functional roles for the conserved water molecules are envisaged. This work provides a map of the conserved water molecules helpful for deciphering SHMT mechanism and for rational design of molecular engineering experiments. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. Relative Sizes of Organic Molecules

    NASA Technical Reports Server (NTRS)

    2000-01-01

    This computer graphic depicts the relative complexity of crystallizing large proteins in order to study their structures through x-ray crystallography. Insulin is a vital protein whose structure has several subtle points that scientists are still trying to determine. Large molecules such as insuline are complex with structures that are comparatively difficult to understand. For comparison, a sugar molecule (which many people have grown as hard crystals in science glass) and a water molecule are shown. These images were produced with the Macmolecule program. Photo credit: NASA/Marshall Space Flight Center (MSFC)

  5. Relative orientation of collagen molecules within a fibril: a homology model for homo sapiens type I collagen.

    PubMed

    Collier, Thomas A; Nash, Anthony; Birch, Helen L; de Leeuw, Nora H

    2018-02-15

    Type I collagen is an essential extracellular protein that plays an important structural role in tissues that require high tensile strength. However, owing to the molecule's size, to date no experimental structural data are available for the Homo sapiens species. Therefore, there is a real need to develop a reliable homology model and a method to study the packing of the collagen molecules within the fibril. Through the use of the homology model and implementation of a novel simulation technique, we have ascertained the orientations of the collagen molecules within a fibril, which is currently below the resolution limit of experimental techniques. The longitudinal orientation of collagen molecules within a fibril has a significant effect on the mechanical and biological properties of the fibril, owing to the different amino acid side chains available at the interface between the molecules.

  6. Modeling adsorption properties of structurally deformed metal–organic frameworks using structure–property map

    PubMed Central

    Lim, Dae-Woon; Kim, Sungjune; Harale, Aadesh; Yoon, Minyoung; Suh, Myunghyun Paik; Kim, Jihan

    2017-01-01

    Structural deformation and collapse in metal-organic frameworks (MOFs) can lead to loss of long-range order, making it a challenge to model these amorphous materials using conventional computational methods. In this work, we show that a structure–property map consisting of simulated data for crystalline MOFs can be used to indirectly obtain adsorption properties of structurally deformed MOFs. The structure–property map (with dimensions such as Henry coefficient, heat of adsorption, and pore volume) was constructed using a large data set of over 12000 crystalline MOFs from molecular simulations. By mapping the experimental data points of deformed SNU-200, MOF-5, and Ni-MOF-74 onto this structure–property map, we show that the experimentally deformed MOFs share similar adsorption properties with their nearest neighbor crystalline structures. Once the nearest neighbor crystalline MOFs for a deformed MOF are selected from a structure–property map at a specific condition, then the adsorption properties of these MOFs can be successfully transformed onto the degraded MOFs, leading to a new way to obtain properties of materials whose structural information is lost. PMID:28696307

  7. Modeling Adsorption and Reactions of Organic Molecules at Metal Surfaces

    PubMed Central

    2014-01-01

    Conspectus The understanding of adsorption and reactions of (large) organic molecules at metal surfaces plays an increasingly important role in modern surface science and technology. Such hybrid inorganic/organic systems (HIOS) are relevant for many applications in catalysis, light-emitting diodes, single-molecule junctions, molecular sensors and switches, and photovoltaics. Obviously, the predictive modeling and understanding of the structure and stability of such hybrid systems is an essential prerequisite for tuning their electronic properties and functions. At present, density-functional theory (DFT) is the most promising approach to study the structure, stability, and electronic properties of complex systems, because it can be applied to both molecules and solids comprising thousands of atoms. However, state-of-the-art approximations to DFT do not provide a consistent and reliable description for HIOS, which is largely due to two issues: (i) the self-interaction of the electrons with themselves arising from the Hartree term of the total energy that is not fully compensated in approximate exchange-correlation functionals, and (ii) the lack of long-range part of the ubiquitous van der Waals (vdW) interactions. The self-interaction errors sometimes lead to incorrect description of charge transfer and electronic level alignment in HIOS, although for molecules adsorbed on metals these effects will often cancel out in total energy differences. Regarding vdW interactions, several promising vdW-inclusive DFT-based methods have been recently demonstrated to yield remarkable accuracy for intermolecular interactions in the gas phase. However, the majority of these approaches neglect the nonlocal collective electron response in the vdW energy tail, an effect that is particularly strong in condensed phases and at interfaces between different materials. Here we show that the recently developed DFT+vdWsurf method that accurately accounts for the collective electronic

  8. Mechanical response of collagen molecule under hydrostatic compression.

    PubMed

    Saini, Karanvir; Kumar, Navin

    2015-04-01

    Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials. Copyright © 2015 Elsevier B.V. All rights

  9. Enhancement of physico-chemical properties of the hydrophobic anticancer molecule following nanoencapsulation

    NASA Astrophysics Data System (ADS)

    Kumari, Anshu; Kumar, Amit; Gupta, Sharad

    2018-02-01

    Flavonoids are one of the important naturally available small molecules found in our daily diets. They have been considered as potential therapeutic agents for anticancer therapy. Despite their anti-cancer properties, their therapeutic application is very limited due to poor water solubility, which results in poor bioavailability to the diseased cells. Hence, to overcome this limitation of Flavonoids, Quercetin (Qct), the most extensively studied flavonoid, prompted us to encapsulate it within nanoparticles. We have successfully encapsulated Qct within cationic polymer based nanoparticles using simple two-step self-assembly fabrication method and studied its effect on absorption and emission properties of Qct. This study was aimed at Qct encapsulation and its effect on the optical properties of Qct for the diagnostic applications. Our results indicate that Qct was efficiently encapsulated within the polymeric nanoparticles. This resulted into 17 times increase in fluorescence emission of encapsulated Qct (Qct-NPs) in comparison with its aqueous suspension. Thus, Qct-NPs can be utilized as a fluorescent probe for various biomedical applications. These probes will have multiple functions integrated into a single nanostructure, enabling the Qct nanoparticles for imaging and therapy. This is the first report on the effect of nanoencapsulation on optical properties of Qct. Thus, Qct-NPs can be harnessed as an effective theranostic agent, and that will not only allow to image and but also treat the cancer in a single clinical procedure.

  10. Strain-induced formation of fourfold symmetric SiGe quantum dot molecules.

    PubMed

    Zinovyev, V A; Dvurechenskii, A V; Kuchinskaya, P A; Armbrister, V A

    2013-12-27

    The strain field distribution at the surface of a multilayer structure with disklike SiGe nanomounds formed by heteroepitaxy is exploited to arrange the symmetric quantum dot molecules typically consisting of four elongated quantum dots ordered along the [010] and [100] directions. The morphological transition from fourfold quantum dot molecules to continuous fortresslike quantum rings with an increasing amount of deposited Ge is revealed. We examine key mechanisms underlying the formation of lateral quantum dot molecules by using scanning tunneling microscopy and numerical calculations of the strain energy distribution on the top of disklike SiGe nanomounds. Experimental data are well described by a simple thermodynamic model based on the accurate evaluation of the strain dependent part of the surface chemical potential. The spatial arrangement of quantum dots inside molecules is attributed to the effect of elastic property anisotropy.

  11. Hyperfine-Structure-Induced Depolarization of Impulsively Aligned I2 Molecules

    NASA Astrophysics Data System (ADS)

    Thomas, Esben F.; Søndergaard, Anders A.; Shepperson, Benjamin; Henriksen, Niels E.; Stapelfeldt, Henrik

    2018-04-01

    A moderately intense 450 fs laser pulse is used to create rotational wave packets in gas phase I2 molecules. The ensuing time-dependent alignment, measured by Coulomb explosion imaging with a delayed probe pulse, exhibits the characteristic revival structures expected for rotational wave packets but also a complex nonperiodic substructure and decreasing mean alignment not observed before. A quantum mechanical model attributes the phenomena to coupling between the rotational angular momenta and the nuclear spins through the electric quadrupole interaction. The calculated alignment trace agrees very well with the experimental results.

  12. Structure of a Pheromone Receptor-Associated Mhc Molecule With An Open And Empty Groove

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Olson, R.; Huey-Tubman, K.E.; Dulac, C.

    2006-10-06

    Neurons in the murine vomeronasal organ (VNO) express a family of class Ib major histocompatibility complex (MHC) proteins (M10s) that interact with the V2R class of VNO receptors. This interaction may play a direct role in the detection of pheromonal cues that initiate reproductive and territorial behaviors. The crystal structure of M10.5, an M10 family member, is similar to that of classical MHC molecules. However, the M10.5 counterpart of the MHC peptide-binding groove is open and unoccupied, revealing the first structure of an empty class I MHC molecule. Similar to empty MHC molecules, but unlike peptide-filled MHC proteins and non-peptide-bindingmore » MHC homologs, M10.5 is thermally unstable, suggesting that its groove is normally occupied. However, M10.5 does not bind endogenous peptides when expressed in mammalian cells or when offered a mixture of class I-binding peptides. The F pocket side of the M10.5 groove is open, suggesting that ligands larger than 8-10-mer class I-binding peptides could fit by extending out of the groove. Moreover, variable residues point up from the groove helices, rather than toward the groove as in classical MHC structures. These data suggest that M10s are unlikely to provide specific recognition of class I MHC-binding peptides, but are consistent with binding to other ligands, including proteins such as the V2Rs.« less

  13. Spin-orbit-coupled Bose-Einstein condensates of rotating polar molecules

    NASA Astrophysics Data System (ADS)

    Deng, Y.; You, L.; Yi, S.

    2018-05-01

    An experimental proposal for realizing spin-orbit (SO) coupling of pseudospin 1 in the ground manifold 1Σ (υ =0 ) of (bosonic) bialkali polar molecules is presented. The three spin components are composed of the ground rotational state and two substates from the first excited rotational level. Using hyperfine resolved Raman processes through two select excited states resonantly coupled by a microwave, an effective coupling between the spin tensor and linear momentum is realized. The properties of Bose-Einstein condensates for such SO-coupled molecules exhibiting dipolar interactions are further explored. In addition to the SO-coupling-induced stripe structures, the singly and doubly quantized vortex phases are found to appear, implicating exciting opportunities for exploring novel quantum physics using SO-coupled rotating polar molecules with dipolar interactions.

  14. Structure-property relationships of Thai silk-microcrystalline cellulose biocomposite materials fabricated from ionic liquid.

    PubMed

    DeFrates, Kelsey; Markiewicz, Theodore; Callaway, Kayla; Xue, Ye; Stanton, John; Salas-de la Cruz, David; Hu, Xiao

    2017-11-01

    Biomaterials made from natural proteins and polysaccharides have become increasingly popular in the biomedical field due to their good biocompatibility and tunable biodegradability. However, the low miscibility of polysaccharides with proteins presents challenges in the creation of protein-polysaccharide composite materials. In this study, neat 1-allyl-3-methylimidazolium chloride (AMIMCl) ionic liquid was used to regenerate Thailand gold Bombyx mori silk and microcrystalline cellulose blended films. This solvent was found to not only effectively dissolve both natural polymers, but also preserve the structure and integrity of the polymers. A single glass transition temperature for each blend was found in DSC curves, indicating good miscibility between the Thai silk and cellulose molecules. The structural composition as well as the morphology and thermal stability of blend films were then determined using FTIR, SEM and TGA. It was found that by varying the ratio of Thai silk to cellulose, the thermal and physical properties of the material could be tuned. Blended films tended to be more thermally stable which could be due to the presence of hydrophobic-hydrophobic or electrostatic interactions between the silk and cellulose. These studies offered a new pathway to understand the tunable properties of protein-polysaccharide composite biomaterials with controllable physical and biological properties. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Micropipet manipulation of lipid membranes: Direct measurement of the material properties of a cohesive structure that is only two molecules thick

    NASA Technical Reports Server (NTRS)

    Needham, David

    1993-01-01

    The objectives are to demonstrate how we can make direct measurements of the mechanical properties of a special structure in biology, namely the lipid bilayer membrane, using a micromanipulation technique, and how these properties compare and contrast with 'more traditional' technological/engineering materials. Given that the investment in equipment and expertise to carry out these experiments is probably beyond the scope of most teaching labs, the described experiment is not intended as one that can actually be demonstrated in a student laboratory class. The intention behind presenting this work is to begin to raise awareness in the Material Science community about the material properties of biological material that form a new (to us) category of soft engineering materials that have dimensions on the nanoscale.

  16. Structure-property study of keto-ether polyimides

    NASA Technical Reports Server (NTRS)

    Dezern, James F.; Croall, Catharine I.

    1991-01-01

    As part of an on-going effort to develop an understanding of how changes in the chemical structure affect polymer properties, an empirical study was performed on polyimides containing only ether and/or carbonyl connecting groups in the polymer backbone. During the past two decades the structure-property relationships in linear aromatic polyimides have been extensively investigated. More recently, work has been performed to study the effect of isomeric attachment of keto-ether polyimides on properties such as glass transition temperature and solubility. However, little work has been reported on the relation of polyimide structure to mechanical properties. The purpose of this study was to determine the effect of structural changes in the backbone of keto-ether polyimides on their mechanical properties, specifically, unoriented thin film tensile properties. This study was conducted in two stages. The purpose of the initial stage was to examine the physical and mechanical properties of a representative group (four) of polyimide systems to determine the optimum solvent and cure cycle requirements. These optimum conditions were then utilized in the second stage to prepare films of keto-ether polyimides which were evaluated for mechanical and physical properties. All of the polyimides were prepared using isomers of oxydianiline (ODA) and diaminobenzophenone (DABP) in combination with 3,3',4,4'-benzophenonetetracarboxylic dianhydride (BTDA) and 4,4'-oxydiphthalic anhydride (ODPA).

  17. Study of the micro-structural properties of RISUG--a newly developed male contraceptive.

    PubMed

    Kumar, Sunil; Roy, Sohini; Chaudhury, Koel; Sen, Prasenjit; Guha, Sujoy K

    2008-07-01

    A new male contraceptive given the name RISUG (an acronym for reversible inhibition of sperm under guidance) and presently undergoing advanced clinical trials has been developed. When injected into the lumen of the vas deferens, its polyelectrolytic nature induces a surface charge imbalance on sperm membrane system leading to the leakage of enzymes essential for fertilization. Contact mode atomic force microscopy (AFM) has been used to analyze quantitatively the micro-structural properties of RISUG and its precipitate in various systems. Hydrolysis of the contraceptive gel resulted in the formation of pores of varying dimensions. RISUG being a highly charged molecule, as evident from zeta potential measurements, has a tendency to form a complex with ionic biomolecules present in the seminal plasma. This is supported by the experimental observations using AFM. This RISUG-biomolecule complex possibly acts as an ionic trap for spermatozoa passing through the vas deferens. Micro-structural properties of RISUG including amplitude (root mean square, peak-to-valley distance, skewness and kurtosis) and spatial roughness have been studied to understand its response to various physiological conditions. Significant alterations in the surface charge distribution of the sperm cell is observed on exposure to RISUG. 2007 Wiley Periodicals, Inc.

  18. Redox properties of structural Fe in clay minerals: 3. Relationships between smectite redox and structural properties.

    PubMed

    Gorski, Christopher A; Klüpfel, Laura E; Voegelin, Andreas; Sander, Michael; Hofstetter, Thomas B

    2013-01-01

    Structural Fe in clay minerals is an important redox-active species in many pristine and contaminated environments as well as in engineered systems. Understanding the extent and kinetics of redox reactions involving Fe-bearing clay minerals has been challenging due to the inability to relate structural Fe(2+)/Fe(total) fractions to fundamental redox properties, such as reduction potentials (EH). Here, we overcame this challenge by using mediated electrochemical reduction (MER) and oxidation (MEO) to characterize the fraction of redox-active structural Fe (Fe(2+)/Fe(total)) in smectites over a wide range of applied EH-values (-0.6 V to +0.6 V). We examined Fe(2+)/Fe(total )- EH relationships of four natural Fe-bearing smectites (SWy-2, SWa-1, NAu-1, NAu-2) in their native, reduced, and reoxidized states and compared our measurements with spectroscopic observations and a suite of mineralogical properties. All smectites exhibited unique Fe(2+)/Fe(total) - EH relationships, were redox active over wide EH ranges, and underwent irreversible electron transfer induced structural changes that were observable with X-ray absorption spectroscopy. Variations among the smectite Fe(2+)/Fe(total) - EH relationships correlated well with both bulk and molecular-scale properties, including Fe(total) content, layer charge, and quadrupole splitting values, suggesting that multiple structural parameters determined the redox properties of smectites. The Fe(2+)/Fe(total) - EH relationships developed for these four commonly studied clay minerals may be applied to future studies interested in relating the extent of structural Fe reduction or oxidation to EH-values.

  19. Silicene-terminated surface of calcium and strontium disilicides: properties and comparison with bulk structures by computational methods

    NASA Astrophysics Data System (ADS)

    Brázda, Petr; Mutombo, Pingo; Ondráček, Martin; Corrêa, Cinthia Antunes; Kopeček, Jaromír; Palatinus, Lukáš

    2018-05-01

    The bulk and surface structures of calcium and strontium disilicides are investigated by computational methods using density functional theory. The investigated structures are R6, R3 and P1-CaSi2 and P1-SrSi2. The investigated properties are the cleavage energy at the silicene sheet, buckling of the bulk and surface silicene layers, charge transfer from calcium to silicon, band structure of bulk and surface-terminated structures and adsorption energies on H atoms and H2 molecules on the silicene-terminated surface of the R3 phase. The cleavage energy at the silicene surface is low in all cases. Structures P1-CaSi2 and R3-CaSi2 contain silicene sheets with different coordination to Ca, while R6-CaSi2 contains both types of the sheets. It is shown that the properties of the two types of silicene-like sheets in R6-CaSi2 are similar to those of the corresponding sheets in P1-CaSi2 and R3-CaSi2, and the thermodynamically stable R6 phase is a good candidate for experimental investigation of silicene-terminated surface in calcium disilicide.

  20. Inorganic and Organometallic Molecular Wires for Single-Molecule Devices.

    PubMed

    Tanaka, Yuya; Kiguchi, Manabu; Akita, Munetaka

    2017-04-06

    Recent developments of single-molecule conductance measurements allow us to understand fundamental conducting properties of molecular wires. While a wide variety of organic molecular wires have been studied so far, inorganic and organometallic molecular wires have received much less attention. However, molecular wires with transition-metal atoms show interesting features and functions distinct from those of organic wires. These properties originate mainly from metal-ligand dπ-pπ interactions and metal-metal d-d interactions. Thanks to the rich combination of metal atoms and supporting ligands, frontier orbital energies of the molecular wires can be finely tuned to lead to highly conducting molecular wires. Moreover, the unique electronic structures of metal complexes are susceptible to subtle environmental changes, leading to potential functional molecular devices. This article reviews recent advances in the single-molecule conductance study of inorganic and organometallic molecular wires. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Structure-Property Relationships of Polymer Brushes in Restricted Geometries and their Utilization as Ultra-Low Lubricants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuhl, Tonya Lynn; Faller, Roland

    2015-09-28

    Though polymer films are widely used to modify or tailor the physical, chemical and mechanical properties of interfaces in both solid and liquid systems, the rational design of interface- or surface-active polymer modifiers has been hampered by a lack of information about the behavior and structure-property relationships of this class of molecules. This is especially true for systems in which the role of the polymer is to modify the interaction between two solid surfaces in intimate contact and under load, to cause them to be mechanically coupled (e.g. to promote adhesion and wetting) or to minimize their interaction (e.g. lubrication,more » colloidal stabilization, etc.). Detailed structural information on these systems has largely been precluded by the many difficulties and challenges associated with direct experimental measurements of polymer structure in these geometries. As a result, many practitioners have been forced to employ indirect measurements or rely wholly on theoretical modeling. This has resulted in an incomplete understanding of the structure-property relationships, which are relied upon for the rational design of improved polymer modifiers. Over the course of this current research program, we made direct measurements of the structure of polymers at the interface between two solid surfaces under confinement and elucidated the fundamental physics behind these phenomena using atomistic and coarse grained simulations. The research has potential to lead to new lubricants and wear reducing agents to improve efficiency.« less

  2. RaptorX-Property: a web server for protein structure property prediction.

    PubMed

    Wang, Sheng; Li, Wei; Liu, Shiwang; Xu, Jinbo

    2016-07-08

    RaptorX Property (http://raptorx2.uchicago.edu/StructurePropertyPred/predict/) is a web server predicting structure property of a protein sequence without using any templates. It outperforms other servers, especially for proteins without close homologs in PDB or with very sparse sequence profile (i.e. carries little evolutionary information). This server employs a powerful in-house deep learning model DeepCNF (Deep Convolutional Neural Fields) to predict secondary structure (SS), solvent accessibility (ACC) and disorder regions (DISO). DeepCNF not only models complex sequence-structure relationship by a deep hierarchical architecture, but also interdependency between adjacent property labels. Our experimental results show that, tested on CASP10, CASP11 and the other benchmarks, this server can obtain ∼84% Q3 accuracy for 3-state SS, ∼72% Q8 accuracy for 8-state SS, ∼66% Q3 accuracy for 3-state solvent accessibility, and ∼0.89 area under the ROC curve (AUC) for disorder prediction. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Controlled Bioactive Molecules Delivery Strategies for Tendon and Ligament Tissue Engineering using Polymeric Nanofibers.

    PubMed

    Hiong Teh, Thomas Kok; Hong Goh, James Cho; Toh, Siew Lok

    2015-01-01

    The interest in polymeric nanofibers has escalated over the past decade given its promise as tissue engineering scaffolds that can mimic the nanoscale structure of the native extracellular matrix. With functionalization of the polymeric nanofibers using bioactive molecules, localized signaling moieties can be established for the attached cells, to stimulate desired biological effects and direct cellular or tissue response. The inherently high surface area per unit mass of polymeric nanofibers can enhance cell adhesion, bioactive molecules loading and release efficiencies, and mass transfer properties. In this review article, the application of polymeric nanofibers for controlled bioactive molecules delivery will be discussed, with a focus on tendon and ligament tissue engineering. Various polymeric materials of different mechanical and degradation properties will be presented along with the nanofiber fabrication techniques explored. The bioactive molecules of interest for tendon and ligament tissue engineering, including growth factors and small molecules, will also be reviewed and compared in terms of their nanofiber incorporation strategies and release profiles. This article will also highlight and compare various innovative strategies to control the release of bioactive molecules spatiotemporally and explore an emerging tissue engineering strategy involving controlled multiple bioactive molecules sequential release. Finally, the review article concludes with challenges and future trends in the innovation and development of bioactive molecules delivery using polymeric nanofibers for tendon and ligament tissue engineering.

  4. Superstructures and Electronic Properties of Manganese-Phthalocyanine Molecules on Au(110) from Submonolayer Coverage to Ultrathin Molecular Films.

    PubMed

    Topyła, M; Néel, N; Kröger, J

    2016-07-12

    The adsorption of manganese-phthalocyanine molecules on Au(110) was investigated using a low-temperature scanning tunneling microscope. A rich variety of commensurate superstructures was observed upon increasing the molecule coverage from submonolayers to ultrathin films. All structures were associated with reconstructions of the Au(110) substrate. Molecules adsorbed in the second molecular layer exhibited negative differential conductance occurring symmetrically around zero bias voltage. A double-barrier tunneling model rationalized this observation in terms of a peaked molecular resonance at the Fermi energy together with a voltage drop across the molecular film.

  5. Binding Structures of Diatomic Molecules to Co-Porphyrins on Au(111) Studied by Scanning Tunneling Microscopy

    NASA Astrophysics Data System (ADS)

    Lee, Soon-Hyeong; Chang, Yun; Kim, Howon; Jang, Won; Kim, Yong-Hyun; Kahng, Se-Jong; Department Of Physics, Korea University. Collaboration; Graduate School Of Nanoscience; Technology (Wcu), Kaist Collaboration

    2013-03-01

    Axial bindings of diatomic molecules to metalloporphyrins involve in the dynamic processes of biological functions such as respiration, neurotransmission, and photosynthesis. The binding reactions are also useful in sensor applications and to control molecular spins in metalloporphyrins for spintronic applications. Here, we present the binding structures of diatomic molecules to surface-supported Co-porphyrins studied using scanning tunneling microscopy. Upon gas exposure, three-lobed structures of Co-porphyrins transformed to bright ring shapes on Au(111), whereas H2-porphyrins of dark rings remained intact. The bright rings are explained by the structures of reaction complexes where a diatomic ligand, tilted away from the axis normal to the porphyrin plane, is under precession. Our results are consistent with previous bulk experiments using X-ray diffraction and nuclear magnetic resonance spectroscopy.

  6. Spacer conformation in biologically active molecules. Part 1. Structure and conformational preferences of 2-substituted benzoxazoles

    NASA Astrophysics Data System (ADS)

    Czylkowski, R.; Karolak-Wojciechowska, J.; Mrozek, A.; Yalçin, I.; Aki-Şener, E.

    2001-12-01

    The mutual position of two pharmacophoric elements in flexible biologically active molecules depends on the spacer conformation. This is true even for a two-atomic chain put to use as a spacer. It was established for 2-substituted-benzoxazoles containing two aromatic centres joined by -CH2-X- (X=S or O). From crystallographic studies of four molecules it was found that the role of heteroatom is essential for the whole molecule conformation. The spacer with X=S adopts the (-)synclinal conformation while for X=O the (+)antiperiplanar one. Such preferences were also found in the statistical data from Cambridge Structural Database (CSD).

  7. Molecular basis of quantitative structure-properties relationships (QSPR): a quantum similarity approach.

    PubMed

    Ponec, R; Amat, L; Carbó-Dorca, R

    1999-05-01

    Since the dawn of quantitative structure-properties relationships (QSPR), empirical parameters related to structural, electronic and hydrophobic molecular properties have been used as molecular descriptors to determine such relationships. Among all these parameters, Hammett sigma constants and the logarithm of the octanol-water partition coefficient, log P, have been massively employed in QSPR studies. In the present paper, a new molecular descriptor, based on quantum similarity measures (QSM), is proposed as a general substitute of these empirical parameters. This work continues previous analyses related to the use of QSM to QSPR, introducing molecular quantum self-similarity measures (MQS-SM) as a single working parameter in some cases. The use of MQS-SM as a molecular descriptor is first confirmed from the correlation with the aforementioned empirical parameters. The Hammett equation has been examined using MQS-SM for a series of substituted carboxylic acids. Then, for a series of aliphatic alcohols and acetic acid esters, log P values have been correlated with the self-similarity measure between density functions in water and octanol of a given molecule. And finally, some examples and applications of MQS-SM to determine QSAR are presented. In all studied cases MQS-SM appeared to be excellent molecular descriptors usable in general QSPR applications of chemical interest.

  8. Molecular basis of quantitative structure-properties relationships (QSPR): A quantum similarity approach

    NASA Astrophysics Data System (ADS)

    Ponec, Robert; Amat, Lluís; Carbó-dorca, Ramon

    1999-05-01

    Since the dawn of quantitative structure-properties relationships (QSPR), empirical parameters related to structural, electronic and hydrophobic molecular properties have been used as molecular descriptors to determine such relationships. Among all these parameters, Hammett σ constants and the logarithm of the octanol- water partition coefficient, log P, have been massively employed in QSPR studies. In the present paper, a new molecular descriptor, based on quantum similarity measures (QSM), is proposed as a general substitute of these empirical parameters. This work continues previous analyses related to the use of QSM to QSPR, introducing molecular quantum self-similarity measures (MQS-SM) as a single working parameter in some cases. The use of MQS-SM as a molecular descriptor is first confirmed from the correlation with the aforementioned empirical parameters. The Hammett equation has been examined using MQS-SM for a series of substituted carboxylic acids. Then, for a series of aliphatic alcohols and acetic acid esters, log P values have been correlated with the self-similarity measure between density functions in water and octanol of a given molecule. And finally, some examples and applications of MQS-SM to determine QSAR are presented. In all studied cases MQS-SM appeared to be excellent molecular descriptors usable in general QSPR applications of chemical interest.

  9. Control of Resonances and Optical Properties of Plasmonic-Patch Metamaterials

    DTIC Science & Technology

    2012-08-01

    entitled "Control of resonances and optical properties of plasmonic-patch metamaterials", under Award No. FA2386-11-1-4707 The stated research goals...their photonic properties when nonlinear amplifying dye molecules are imbedded in the structures. We will particularly focus on three...metamaterial structures. 4. Measurement of plasmon resonance and florescence properties in the dye-doped metamaterials with and without the

  10. Single-Molecule Tracking Photoactivated Localization Microscopy to Map Nano-Scale Structure and Dynamics in Living Spines

    PubMed Central

    MacGillavry, Harold D.; Blanpied, Thomas A.

    2013-01-01

    Super-resolution microscopy has rapidly become an indispensable tool in cell biology and neuroscience by enabling measurement in live cells of structures smaller than the classical limit imposed by diffraction. The most widely applied super-resolution method currently is localization microscopy, which takes advantage of the ability to determine the position of individual fluorescent molecules with nanometer accuracy even in cells. By iteratively measuring sparse subsets of photoactivatable fluorescent proteins, protein distribution in macromolecular structures can be accurately reconstructed. Moreover, the motion trajectories of individual molecules within cells can be measured, providing unique ability to measure transport kinetics, exchange rates, and binding affinities of even small subsets of molecules with high temporal resolution and great spatial specificity. This unit describes protocols to measure and quantify the distribution of scaffold proteins within single synapses of cultured hippocampal neurons, and to track and measure the diffusion of intracellular constituents of the neuronal plasma membrane. PMID:25429311

  11. Influence of Aromatic Molecules on the Structure and Spectroscopy of Water Clusters

    NASA Astrophysics Data System (ADS)

    Tabor, Daniel P.; Sibert, Edwin; Walsh, Patrick S.; Zwier, Timothy S.

    2016-06-01

    Isomer-specific resonant ion-dip infrared spectra are presented for benzene-(water)_n, 1-2-diphenoxyethane-(water)_n, and tricyclophane-(water)_n clusters. The IR spectra are modeled with a local mode Hamiltonian that was originally formulated for the analysis of benzene-(water)_n clusters with up to seven waters. The model accounts for stretch-bend Fermi coupling, which can complicate the IR spectra in the 3150-3300 cm-1 region. When the water clusters interact with each of the solutes, the hydrogen bond lengths between the water molecules change in a characteristic way, reflecting the strength of the solute-water interaction. These structural effects are also reflected spectroscopically in the shifts of the local mode OH stretch frequencies. When diphenoxyethane is the solute, the water clusters distort more significantly than when bound to benzene. Tricyclophane's structure provides an aromatic-rich binding pocket for the water clusters. The local mode model is used to extract Hamiltonians for individual water molecules. These monomer Hamiltonians divide into groups based on their local H-bonding architecture, allowing for further classification of the wide variety of water environments encountered in this study.

  12. Photonic Molecule Lasers Revisited

    NASA Astrophysics Data System (ADS)

    Gagnon, Denis; Dumont, Joey; Déziel, Jean-Luc; Dubé, Louis J.

    2014-05-01

    Photonic molecules (PMs) formed by coupling two or more optical resonators are ideal candidates for the fabrication of integrated microlasers, photonic molecule lasers. Whereas most calculations on PM lasers have been based on cold-cavity (passive) modes, i.e. quasi-bound states, a recently formulated steady-state ab initio laser theory (SALT) offers the possibility to take into account the spectral properties of the underlying gain transition, its position and linewidth, as well as incorporating an arbitrary pump profile. We will combine two theoretical approaches to characterize the lasing properties of PM lasers: for two-dimensional systems, the generalized Lorenz-Mie theory will obtain the resonant modes of the coupled molecules in an active medium described by SALT. Not only is then the theoretical description more complete, the use of an active medium provides additional parameters to control, engineer and harness the lasing properties of PM lasers for ultra-low threshold and directional single-mode emission. We will extend our recent study and present new results for a number of promising geometries. The authors acknowledge financial support from NSERC (Canada) and the CERC in Photonic Innovations of Y. Messaddeq.

  13. Determination of structure parameters in strong-field tunneling ionization theory of molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao Songfeng; Jin Cheng; College of Physics and Electronic Engineering, Northwest Normal University, Lanzhou, Gansu 730070

    2010-03-15

    In the strong field molecular tunneling ionization theory of Tong et al. [Phys. Rev. A 66, 033402 (2002)], the ionization rate depends on the asymptotic wave function of the molecular orbital from which the electron is removed. The orbital wave functions obtained from standard quantum chemistry packages in general are not good enough in the asymptotic region. Here we construct a one-electron model potential for several linear molecules using density functional theory. We show that the asymptotic wave function can be improved with an iteration method and after one iteration accurate asymptotic wave functions and structure parameters are determined. Withmore » the new parameters we examine the alignment-dependent tunneling ionization probabilities for several molecules and compare with other calculations and with recent measurements, including ionization from inner molecular orbitals.« less

  14. Smectite flocculation structure modified by Al13 macro-molecules--as revealed by the transmission X-ray microscopy (TXM).

    PubMed

    Zbik, Marek S; Martens, Wayde N; Frost, Ray L; Song, Yen-Fang; Chen, Yi-Ming; Chen, Jian-Hua

    2010-05-01

    The aggregate structure which occurs in aqueous smectitic suspensions is responsible for poor water clarification, difficulties in sludge dewatering and the unusual rheological behaviour of smectite rich soils. These macroscopic properties are dictated by the 3D structural arrangement of smectite finest fraction within flocculated aggregates. Here, we report results from a relatively new technique, transmission X-ray microscopy (TXM), which makes it possible to investigate the internal structure and 3D tomographic reconstruction of the smectite clay aggregates modified by Al(13) Keggin macro-molecule [Al(13)(O)(4)(OH)(24)(H(2)O)(12)](7+). Three different treatment methods were shown resulted in three different micro-structural environments of the resulting flocculation. In case of smectite sample prepared in Methods 1 and 3 particles fall into the primary minimum where Van der Waals forces act between FF oriented smectite flakes and aggregates become approach irreversible flocculation. In case of sample prepared using Method 2, particles contacting by edges (EE) and edge to face (EF) orientation fell into secondary minimum and weak flocculation resulted in severe gelation and formation of the micelle-like texture in fringe superstructure, which was first time observed in smectite based gel. Copyright 2010 Elsevier Inc. All rights reserved.

  15. Adsorption and Transport of Methane Molecules through One-Dimensional Channels in Dipeptide-Based Materials

    NASA Astrophysics Data System (ADS)

    Paradiso, Daniele; Perelli Cippo, Enrico; Gorini, Giuseppe; Rossi, Giorgio; Larese, John Z.

    The development of new materials for use in energy and environmental applications is of great interest, in particular in the areas of gas separation and carbon capture, where molecular transport plays a significant role. The dipeptides are organic molecules that offer an attractive possibility in such areas, because they form open hexagonal crystalline structures (space group P61) with quasi one-dimensional channels of tunable pore diameters in the range 3-6 Å. These molecular crystals exhibit selective adsorption, as well as, water and gas transport properties: these are believed to result from collective vibrations of the crystal structure that are coupled to the motions of the guest molecules within the channels. Current studies focus on characterizing the system methane and L-Isoleucyl-L-Valine (IV): this was initially done with high-resolution adsorption isotherms; then, high-resolution Inelastic Neutron Scattering measurements at the Spallation Neutron Source (BASIS spectrometer) revealed clear rotational tunneling peaks, offering details to unravel the potential energy surface of the system, as well as, evidences that channels flexibility and dynamical motion of the molecules have influence on the dipeptides adsorption properties.

  16. Electronic structure of metals and semiconductors: bulk, surface, and interface properties

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Louie, S.G.S.

    1976-09-01

    A theoretical study of the electronic structure of various metals and semiconductors is presented with the emphasis on understanding the properties of these materials when they are subjected to extreme conditions and in various different configurations. Among the bulk systems studied, the properties of cesium under high pressure are discussed in terms of the electronic structure calculated at various cell volumes using the pseudopotential method. Local fields or umklapp processes in semiconductors are studied within the random phase approximation (RPA). Specifically the dielectric response matrix epsilon/sub GG'/ (q = 0,omega) is evaluated numerically to determine the effects of local-field correctionsmore » in the optical spectrum of Si. Also, some comments on the excitonic mechanism of superconductivity are presented and the role of local fields is discussed. The pseudo-potential method is next extended to calculate the electronic structure of a transition metal Nb. The calculation is performed self-consistently with the use of a non-local ionic potential determined from atomic spectra. Finally the theory of the superconducting transition temperature T/sub c/ is discussed in the strong-coupling formulation of the BCS theory. The Eliashberg equations in the Matsubara representation are solved analytically and a general T/sub c/ equation is obtained. A new method is developed using pseudopotentials in a self-consistent manner to describe non-periodic systems. The method is applicable to localized configurations such as molecules, surfaces, impurities, vacancies, finite chains of atoms, adsorbates, and solid interfaces. Specific applications to surfaces, metal-semiconductor interfaces and vacancies are presented.« less

  17. Influence of residual composition on the structure and properties of extracellular matrix derived hydrogels.

    PubMed

    Claudio-Rizo, Jesús A; Rangel-Argote, Magdalena; Castellano, Laura E; Delgado, Jorge; Mata-Mata, José L; Mendoza-Novelo, Birzabith

    2017-10-01

    In this work, hydrolysates of extracellular matrix (hECM) were obtained from rat tail tendon (TR), bovine Achilles tendon (TAB), porcine small intestinal submucosa (SIS) and bovine pericardium (PB), and they were polymerized to generate ECM hydrogels. The composition of hECM was evaluated by quantifying the content of sulphated glycosaminoglycans (sGAG), fibronectin and laminin. The polymerization process, structure, physicochemical properties, in vitro degradation and biocompatibility were studied and related to their composition. The results indicated that the hECM derived from SIS and PB were significantly richer in sGAG, fibronectin and laminin, than those derived from TAB and TR. These differences in hECM composition influenced the polymerization and the structural characteristics of the fibrillar gel network. Consequently, the swelling, mechanics and degradation of the hydrogels showed a direct relationship with the remaining composition. Moreover, the cytocompatibility and the secretion of transforming growth factor beta-1 (TGF-β1) by macrophages were enhanced in hydrogels with the highest residual content of ECM biomolecules. The results of this work evidenced the role of the ECM molecules remaining after both decellularization and hydrolysis steps to produce tissue derived hydrogels with structure and properties tailored to enhance their performance in tissue engineering and regenerative medicine applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Protein mechanics: from single molecules to functional biomaterials.

    PubMed

    Li, Hongbin; Cao, Yi

    2010-10-19

    Elastomeric proteins act as the essential functional units in a wide variety of biomechanical machinery and serve as the basic building blocks for biological materials that exhibit superb mechanical properties. These proteins provide the desired elasticity, mechanical strength, resilience, and toughness within these materials. Understanding the mechanical properties of elastomeric protein-based biomaterials is a multiscale problem spanning from the atomistic/molecular level to the macroscopic level. Uncovering the design principles of individual elastomeric building blocks is critical both for the scientific understanding of multiscale mechanics of biomaterials and for the rational engineering of novel biomaterials with desirable mechanical properties. The development of single-molecule force spectroscopy techniques has provided methods for characterizing mechanical properties of elastomeric proteins one molecule at a time. Single-molecule atomic force microscopy (AFM) is uniquely suited to this purpose. Molecular dynamic simulations, protein engineering techniques, and single-molecule AFM study have collectively revealed tremendous insights into the molecular design of single elastomeric proteins, which can guide the design and engineering of elastomeric proteins with tailored mechanical properties. Researchers are focusing experimental efforts toward engineering artificial elastomeric proteins with mechanical properties that mimic or even surpass those of natural elastomeric proteins. In this Account, we summarize our recent experimental efforts to engineer novel artificial elastomeric proteins and develop general and rational methodologies to tune the nanomechanical properties of elastomeric proteins at the single-molecule level. We focus on general design principles used for enhancing the mechanical stability of proteins. These principles include the development of metal-chelation-based general methodology, strategies to control the unfolding hierarchy of

  19. Single-Molecule Spectroscopy and Imaging Over the Decades

    PubMed Central

    Moerner, W. E.; Shechtman, Yoav; Wang, Quan

    2016-01-01

    As of 2015, it has been 26 years since the first optical detection and spectroscopy of single molecules in condensed matter. This area of science has expanded far beyond the early low temperature studies in crystals to include single molecules in cells, polymers, and in solution. The early steps relied upon high-resolution spectroscopy of inhomogeneously broadened optical absorption profiles of molecular impurities in solids at low temperatures. Spectral fine structure arising directly from the position-dependent fluctuations of the number of molecules in resonance led to the attainment of the single-molecule limit in 1989 using frequency-modulation laser spectroscopy. In the early 1990's, a variety of fascinating physical effects were observed for individual molecules, including imaging of the light from single molecules as well as observations of spectral diffusion, optical switching and the ability to select different single molecules in the same focal volume simply by tuning the pumping laser frequency. In the room temperature regime, researchers showed that bursts of light from single molecules could be detected in solution, leading to imaging and microscopy by a variety of methods. Studies of single copies of the green fluorescent protein also uncovered surprises, especially the blinking and photoinduced recovery of emitters, which stimulated further development of photoswitchable fluorescent protein labels. All of these early steps provided important fundamentals underpinning the development of super-resolution microscopy based on single-molecule localization and active control of emitting concentration. Current thrust areas include extensions to three-dimensional imaging with high precision, orientational analysis of single molecules, and direct measurements of photodynamics and transport properties for single molecules trapped in solution by suppression of Brownian motion. Without question, a huge variety of studies of single molecules performed by many

  20. Theoretical investigations on the structure and properties of p-n-alkoxy benzoic acid based liquid crystals

    NASA Astrophysics Data System (ADS)

    Subhapriya, P.; Dhanapal, V.; Sadasivam, K.; Vijayanand, P. S.

    2016-05-01

    The present study focused on the structural conformations, alkoxy chain lengths and mesogenic properties of two mole of alkoxy benzoic acid(nOBA) and one mole of suberic acid (SA) hydrogen bonded (nOBASA) complexes (n=8 to 10) by density functional theory (DFT) calculations and the Fourier Transform Infrared (FT-IR) spectrum. The intermolecular hydrogen bond formation was confirmed by the optimized geometric bond lengths and bond angles obtained by computation. Using the natural bond orbital (NBO) analysis, the stability of the molecule arising from hyper conjugative interactions and charge delocalization has been analyzed. Results obtained shows that the charge in electron density (ED) in σ*and π* antibonding orbital and second order delocalization energies E(2) authorizes the occurrence of intermolecular charge transfer. The molecular electrostatic potential (MEP) surface map is plotted over the optimized geometry of the molecule to obtain the chemical reactivity of the molecule. From the local charge distributions, the mesomorphic behavior and the nematic phase stabilities for each of the molecule have been predicted. Finally the calculated result is applied to simulated infrared spectra of 8OBASA mesogens which shows good agreement with the observed spectra. The comparison of the theoretical results obtained with the experimental ones shows the reliability of this DFT method.

  1. Small molecule solution-processed bulk heterojunction solar cells with inverted structure using porphyrin donor

    NASA Astrophysics Data System (ADS)

    Yamamoto, Takaki; Hatano, Junichi; Nakagawa, Takafumi; Yamaguchi, Shigeru; Matsuo, Yutaka

    2013-01-01

    Utilizing tetraethynyl porphyrin derivative (TE-Por) as a small molecule donor material, we fabricated a small molecule solution-processed bulk heterojunction (BHJ) solar cell with inverted structure, which exhibited 1.6% power conversion efficiency (JSC (short-circuit current) = 4.6 mA/cm2, VOC (open-circuit voltage) = 0.90 V, and FF (fill factor) = 0.39) in the device configuration indium tin oxide/TiOx (titanium sub-oxide)/[6,6]-phenyl-C61-butyric acid methyl ester:TE-Por (5:1)/MoOx (molybdenum sub-oxide)/Au under AM1.5 G illumination at 100 mW/cm2. Without encapsulation, the small molecule solution-processed inverted BHJ solar cell also showed remarkable durability to air, where it kept over 73% of its initial power conversion efficiency after storage for 28 days under ambient atmosphere in the dark.

  2. Fermi orbital self-interaction corrected electronic structure of molecules beyond local density approximation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hahn, T., E-mail: torsten.hahn@physik.tu-freiberg.de; Liebing, S.; Kortus, J.

    2015-12-14

    The correction of the self-interaction error that is inherent to all standard density functional theory calculations is an object of increasing interest. In this article, we apply the very recently developed Fermi-orbital based approach for the self-interaction correction [M. R. Pederson et al., J. Chem. Phys. 140, 121103 (2014) and M. R. Pederson, J. Chem. Phys. 142, 064112 (2015)] to a set of different molecular systems. Our study covers systems ranging from simple diatomic to large organic molecules. We focus our analysis on the direct estimation of the ionization potential from orbital eigenvalues. Further, we show that the Fermi orbitalmore » positions in structurally similar molecules appear to be transferable.« less

  3. Single-molecule detection of dihydroazulene photo-thermal reaction using break junction technique

    NASA Astrophysics Data System (ADS)

    Huang, Cancan; Jevric, Martyn; Borges, Anders; Olsen, Stine T.; Hamill, Joseph M.; Zheng, Jue-Ting; Yang, Yang; Rudnev, Alexander; Baghernejad, Masoud; Broekmann, Peter; Petersen, Anne Ugleholdt; Wandlowski, Thomas; Mikkelsen, Kurt V.; Solomon, Gemma C.; Brøndsted Nielsen, Mogens; Hong, Wenjing

    2017-05-01

    Charge transport by tunnelling is one of the most ubiquitous elementary processes in nature. Small structural changes in a molecular junction can lead to significant difference in the single-molecule electronic properties, offering a tremendous opportunity to examine a reaction on the single-molecule scale by monitoring the conductance changes. Here, we explore the potential of the single-molecule break junction technique in the detection of photo-thermal reaction processes of a photochromic dihydroazulene/vinylheptafulvene system. Statistical analysis of the break junction experiments provides a quantitative approach for probing the reaction kinetics and reversibility, including the occurrence of isomerization during the reaction. The product ratios observed when switching the system in the junction does not follow those observed in solution studies (both experiment and theory), suggesting that the junction environment was perturbing the process significantly. This study opens the possibility of using nano-structured environments like molecular junctions to tailor product ratios in chemical reactions.

  4. A straightforward strategy toward large BN-embedded π-systems: synthesis, structure, and optoelectronic properties of extended BN heterosuperbenzenes.

    PubMed

    Wang, Xiao-Ye; Zhuang, Fang-Dong; Wang, Rui-Bo; Wang, Xin-Chang; Cao, Xiao-Yu; Wang, Jie-Yu; Pei, Jian

    2014-03-12

    A straightforward strategy has been used to construct large BN-embedded π-systems simply from azaacenes. BN heterosuperbenzene derivatives, the largest BN heteroaromatics to date, have been synthesized in three steps. The molecules exhibit curved π-surfaces, showing two different conformations which are self-organized into a sandwich structure and further packed into a π-stacking column. The assembled microribbons exhibit good charge transport properties and photoconductivity, representing an important step toward the optoelectronic applications of BN-embedded aromatics.

  5. Transport and Stability of Biological Molecules in Surfactant-Alginate Composite Hydrogels

    PubMed Central

    Stoppel, Whitney L.; White, Joseph C.; Horava, Sarena D.; Bhatia, Surita R.; Roberts, Susan C.

    2013-01-01

    Obstructed transport of biological molecules can result in improper release of pharmaceuticals or biologics from biomedical devices. Recent studies have shown that nonionic surfactants, such as Pluronic® F68 (F68), positively alter biomaterial properties, such as mesh size and microcapsule diameter. To further understand the effect of F68 (incorporated at concentrations well above the critical micelle concentration (CMC)) in traditional biomaterials, the transport properties of BSA and riboflavin were investigated in F68-alginate composite hydrogels. Results indicate that small molecule transport (represented by riboflavin) was not significantly hindered by F68 in homogeneously crosslinked hydrogels (up to an 11% decrease in loading capacity and 14% increase in effective diffusion coefficient, Deff), while protein transport in homogeneously crosslinked hydrogels (represented by BSA) was significantly affected (up to a 43% decrease in loading capacity and 40% increase in Deff). For inhomogeneously crosslinked hydrogels (CaCl2 or BaCl2 gelation), the Deff increased up to 50% and 83% for small molecule and proteins, respectively. Variation in the alginate gelation method was shown to affect transport through measurable changes in swelling ratio (30% decrease) and observable changes in crosslinking structure as well as up to a 3.6 and 11.8-fold difference in Deff for riboflavin and BSA, respectively. The change in protein transport properties is a product of mesh size restrictions (10–25 nm estimated by mechanical properties) and BSA-F68 interaction (DLS). Taken as a whole, these results show that incorporation of a nonionic surfactant at concentrations above the CMC can affect device functionality by impeding the transport of large biological molecules. PMID:21798381

  6. A semantic web ontology for small molecules and their biological targets.

    PubMed

    Choi, Jooyoung; Davis, Melissa J; Newman, Andrew F; Ragan, Mark A

    2010-05-24

    A wide range of data on sequences, structures, pathways, and networks of genes and gene products is available for hypothesis testing and discovery in biological and biomedical research. However, data describing the physical, chemical, and biological properties of small molecules have not been well-integrated with these resources. Semantically rich representations of chemical data, combined with Semantic Web technologies, have the potential to enable the integration of small molecule and biomolecular data resources, expanding the scope and power of biomedical and pharmacological research. We employed the Semantic Web technologies Resource Description Framework (RDF) and Web Ontology Language (OWL) to generate a Small Molecule Ontology (SMO) that represents concepts and provides unique identifiers for biologically relevant properties of small molecules and their interactions with biomolecules, such as proteins. We instanced SMO using data from three public data sources, i.e., DrugBank, PubChem and UniProt, and converted to RDF triples. Evaluation of SMO by use of predetermined competency questions implemented as SPARQL queries demonstrated that data from chemical and biomolecular data sources were effectively represented and that useful knowledge can be extracted. These results illustrate the potential of Semantic Web technologies in chemical, biological, and pharmacological research and in drug discovery.

  7. Synthesis, crystal structure, photophysical properties and theoretical studies of a novel bis(phenylisoxazolyl) benzene derivative

    NASA Astrophysics Data System (ADS)

    de Brito, A. C. F.; Correa, R. S.; Pinto, A. A.; Matos, M. J. S.; Tenorio, J. C.; Taylor, J. G.; Cazati, T.

    2018-07-01

    Isoxazoles have well established biological activities but, have been underexplored as synthetic intermediates for applications in materials science. The aims of this work are to synthesis a novel isoxazole and analyze its structural and photophysical properties for application in electronic organic materials. The novel bis (phenylisoxazolyl) benzene compound was synthesized in four steps and characterized by NMR, high resolution mass spectrometry, differential thermal analysis, infrared spectroscopy, cyclic voltammetry, ultraviolet-visible spectroscopy, fluorescence spectroscopy, DFT and TDDFT calculations. The molecule presented optical absorption in the ultraviolet region (from 290 nm to 330 nm), with maximum absorption length centered at 306 nm. The molar extinction coefficients (ε), fluorescence emission spectra and quantum efficiencies in chloroform and dimethylformamide solution were determined. Cyclic voltammetry analysis was carried out for estimating the HOMO energy level and these properties make it desirable material for photovoltaic device applications. Finally, the excited-state properties of present compound were calculated by time-dependent density functional theory (TDDFT).

  8. Decay width of hadronic molecule structure for quarks

    NASA Astrophysics Data System (ADS)

    Chen, Xiaozhao; Lü, Xiaofu

    2018-06-01

    Based on the general form of the Bethe-Salpeter wave functions for the bound states consisting of two vector fields, we obtain the general formulas for the decay widths of molecular states composed of two heavy vector mesons with arbitrary spin and parity into a heavy meson plus a light meson. In this approach, our attention is still focused on the internal structure of heavy vector mesons in the molecular state. According to the molecule state model of exotic meson, we give the generalized Bethe-Salpeter wave function of molecular state as a four-quark state. Then the observed Y (3940 ) state is considered as a molecular state consisting of two heavy vector mesons D*0D¯*0 and the strong Y (3940 )→J /ψ ω decay width is calculated. The numerical result is consistent with the experimental values.

  9. Structures of the Ca2+-regulated photoprotein obelin Y138F mutant before and after bioluminescence support the catalytic function of a water molecule in the reaction.

    PubMed

    Natashin, Pavel V; Ding, Wei; Eremeeva, Elena V; Markova, Svetlana V; Lee, John; Vysotski, Eugene S; Liu, Zhi-Jie

    2014-03-01

    Ca(2+)-regulated photoproteins, which are responsible for light emission in a variety of marine coelenterates, are a highly valuable tool for measuring Ca(2+) inside living cells. All of the photoproteins are a single-chain polypeptide to which a 2-hydroperoxycoelenterazine molecule is tightly but noncovalently bound. Bioluminescence results from the oxidative decarboxylation of 2-hydroperoxycoelenterazine, generating protein-bound coelenteramide in an excited state. Here, the crystal structures of the Y138F obelin mutant before and after bioluminescence are reported at 1.72 and 1.30 Å resolution, respectively. The comparison of the spatial structures of the conformational states of Y138F obelin with those of wild-type obelin gives clear evidence that the substitution of Tyr by Phe does not affect the overall structure of both Y138F obelin and its product following Ca(2+) discharge compared with the corresponding conformational states of wild-type obelin. Despite the similarity of the overall structures and internal cavities of Y138F and wild-type obelins, there is a substantial difference: in the cavity of Y138F obelin a water molecule corresponding to W2 in wild-type obelin is not found. However, in Ca(2+)-discharged Y138F obelin this water molecule now appears in the same location. This finding, together with the observed much slower kinetics of Y138F obelin, clearly supports the hypothesis that the function of a water molecule in this location is to catalyze the 2-hydroperoxycoelenterazine decarboxylation reaction by protonation of a dioxetanone anion before its decomposition into the excited-state product. Although obelin differs from other hydromedusan Ca(2+)-regulated photoproteins in some of its properties, they are believed to share a common mechanism.

  10. Fabrication method, structure, mechanical, and biological properties of decellularized extracellular matrix for replacement of wide bone tissue defects.

    PubMed

    Anisimova, N Y; Kiselevsky, M V; Sukhorukova, I V; Shvindina, N V; Shtansky, D V

    2015-09-01

    The present paper was focused on the development of a new method of decellularized extracellular matrix (DECM) fabrication via a chemical treatment of a native bone tissue. Particular attention was paid to the influence of chemical treatment on the mechanical properties of native bones, sterility, and biological performance in vivo using the syngeneic heterotopic and orthotopic implantation models. The obtained data indicated that after a chemical decellularization treatment in 4% aqueous sodium chlorite, no noticeable signs of the erosion of compact cortical bone surface or destruction of trabeculae of spongy bone in spinal channel were observed. The histological studies showed that the chemical treatment resulted in the decellularization of both bone and cartilage tissues. The DECM samples demonstrated no signs of chemical and biological degradation in vivo. Thorough structural characterization revealed that after decellularization, the mineral frame retained its integrity with the organic phase; however clotting and destruction of organic molecules and fibers were observed. FTIR studies revealed several structural changes associated with the destruction of organic molecules, although all organic components typical of intact bone were preserved. The decellularization-induced structural changes in the collagen constituent resulted changed the deformation under compression mechanism: from the major fracture by crack propagation throughout the sample to the predominantly brittle fracture. Although the mechanical properties of radius bones subjected to decellularization were observed to degrade, the mechanical properties of ulna bones in compression and humerus bones in bending remained unchanged. The compressive strength of both the intact and decellularized ulna bones was 125-130 MPa and the flexural strength of humerus bones was 156 and 145 MPa for the intact and decellularized samples, respectively. These results open new avenues for the use of DECM samples as

  11. Role of water molecules in structure and energetics of Pseudomonas aeruginosa lectin I interacting with disaccharides.

    PubMed

    Nurisso, Alessandra; Blanchard, Bertrand; Audfray, Aymeric; Rydner, Lina; Oscarson, Stefan; Varrot, Annabelle; Imberty, Anne

    2010-06-25

    Calcium-dependent lectin I from Pseudomonas aeruginosa (PA-IL) binds specifically to oligosaccharides presenting an alpha-galactose residue at their nonreducing end, such as the disaccharides alphaGal1-2betaGalOMe, alphaGal1-3betaGalOMe, and alphaGal1-4betaGalOMe. This provides a unique model for studying the effect of the glycosidic linkage of the ligands on structure and thermodynamics of the complexes by means of experimental and theoretical tools. The structural features of PA-IL in complex with the three disaccharides were established by docking and molecular dynamics simulations and compared with those observed in available crystal structures, including PA-IL.alphaGal1-2betaGalOMe complex, which was solved at 2.4 A resolution and reported herein. The role of a structural bridge water molecule in the binding site of PA-IL was also elucidated through molecular dynamics simulations and free energy calculations. This water molecule establishes three very stable hydrogen bonds with O6 of nonreducing galactose, oxygen from Pro-51 main chain, and nitrogen from Gln-53 main chain of the lectin binding site. Binding free energies for PA-IL in complex with the three disaccharides were investigated, and the results were compared with the experimental data determined by titration microcalorimetry. When the bridge water molecule was included in the free energy calculations, the simulations predicted the correct binding affinity trends with the 1-2-linked disaccharide presenting three times stronger affinity ligand than the other two. These results highlight the role of the water molecule in the binding site of PA-IL and indicate that it should be taken into account when designing glycoderivatives active against P. aeruginosa adhesion.

  12. Enhancement of charge transport properties of small molecule semiconductors by controlling fluorine substitution and effects on photovoltaic properties of organic solar cells and perovskite solar cells.

    PubMed

    Yun, Jae Hoon; Park, Sungmin; Heo, Jin Hyuck; Lee, Hyo-Sang; Yoon, Seongwon; Kang, Jinback; Im, Sang Hyuk; Kim, Hyunjung; Lee, Wonmok; Kim, BongSoo; Ko, Min Jae; Chung, Dae Sung; Son, Hae Jung

    2016-11-01

    We prepared a series of small molecules based on 7,7'-(4,4-bis(2-ethylhexyl)-4 H -silolo[3,2- b :4,5- b ']dithiophene-2,6-diyl)bis(4-(5'-hexyl-[2,2'-bithiophene]-5-yl)benzo[ c ][1,2,5]thiadiazole) with different fluorine substitution patterns ( 0F-4F ). Depending on symmetricity and numbers of fluorine atoms incorporated in the benzo[ c ][1,2,5]thiadiazole unit, they show very different optical and morphological properties in a film. 2F and 4F , which featured symmetric and even-numbered fluorine substitution patterns, display improved molecular packing structures and higher crystalline properties in a film compared with 1F and 3F and thus, 2F achieved the highest OTFT mobility, which is followed by 4F . In the bulk heterojunction solar cell fabricated with PC 71 BM, 2F achieves the highest photovoltaic performance with an 8.14% efficiency and 0F shows the lowest efficiency of 1.28%. Moreover, the planar-type perovskite solar cell (PSC) prepared with 2F as a dopant-free hole transport material shows a high power conversion efficiency of 14.5% due to its high charge transporting properties, which were significantly improved compared with the corresponding PSC device obtained from 0F (8.5%). From the studies, it is demonstrated that low variation in the local dipole moment and the narrow distribution of 2F conformers make intermolecular interactions favorable, which may effectively drive crystal formations in the solid state and thus, higher charge transport properties compared with 1F and 3F .

  13. Dehalogenation of persistent halogenated organic compounds: A review of computational studies and quantitative structure-property relationships.

    PubMed

    Luo, Jin; Hu, Jiwei; Wei, Xionghui; Fu, Liya; Li, Lingyun

    2015-07-01

    Dehalogenation is one of the highly important degradation reactions for halogenated organic compounds (HOCs) in the environment, which is also being developed as a potential type of the remediation technologies. In combination with the experimental results, intensive efforts have recently been devoted to the development of efficient theoretical methodologies (e.g. multi-scale simulation) to investigate the mechanisms for dehalogenation of HOCs. This review summarizes the structural characteristics of neutral molecules, anionic species and excited states of HOCs as well as their adsorption behavior on the surface of graphene and the Fe cluster. It discusses the key physiochemical properties (e.g. frontier orbital energies and thermodynamic properties) calculated at various levels of theory (e.g. semiempirical, ab initio, density functional theory (DFT) and the periodic DFT) as well as their connections to the reactivity and reaction pathway for the dehalogenation. This paper also reviews the advances in the linear and nonlinear quantitative structure-property relationship models for the dehalogenation kinetics of HOCs and in the mathematical modeling of the dehalogenation processes. Furthermore, prospects of further expansion and exploration of the current research fields are described in this article. Published by Elsevier Ltd.

  14. A single-molecule diode.

    PubMed

    Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B; Mayor, Marcel

    2005-06-21

    We have designed and synthesized a molecular rod that consists of two weakly coupled electronic pi -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current-voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur-gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current-voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical pi-systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current-voltage characteristics, similar to the phenomena in a semiconductor diode.

  15. EDULISS: a small-molecule database with data-mining and pharmacophore searching capabilities

    PubMed Central

    Hsin, Kun-Yi; Morgan, Hugh P.; Shave, Steven R.; Hinton, Andrew C.; Taylor, Paul; Walkinshaw, Malcolm D.

    2011-01-01

    We present the relational database EDULISS (EDinburgh University Ligand Selection System), which stores structural, physicochemical and pharmacophoric properties of small molecules. The database comprises a collection of over 4 million commercially available compounds from 28 different suppliers. A user-friendly web-based interface for EDULISS (available at http://eduliss.bch.ed.ac.uk/) has been established providing a number of data-mining possibilities. For each compound a single 3D conformer is stored along with over 1600 calculated descriptor values (molecular properties). A very efficient method for unique compound recognition, especially for a large scale database, is demonstrated by making use of small subgroups of the descriptors. Many of the shape and distance descriptors are held as pre-calculated bit strings permitting fast and efficient similarity and pharmacophore searches which can be used to identify families of related compounds for biological testing. Two ligand searching applications are given to demonstrate how EDULISS can be used to extract families of molecules with selected structural and biophysical features. PMID:21051336

  16. New Aspects of the Structure of Human Scalp Hair-II: Tubular Structure and Material Flow Property of the Medulla.

    PubMed

    Yamauchi, Asao; Yamauchi, Kiyoshi

    Asian scalp hair fibers were made thin by treatment with papain or sliced along the longitudinal axis or randomly cut by mechanical means. Optical microscopic observations of the resulting specimens indicated that (i) the medulla (M) consisted of two types of the M-surrounding cells which were linearly linked one another to form a tubular structure running through the fiber and (ii) the drum-shaped vesicles containing small proteinous granules were neatly or sparsely stored within the tube. On the other hand, H + and OH - ions were able to move spontaneously from one end to another through the M tube. Large molecules such as an anthocyanin dye (from purple sweet potato) were also capable of flowing through the M tube, especially rapidly when DC voltage was applied between the two ends of the hair fiber. The possible function of the M is briefly discussed in conjunction with the tubular structure and the material flow property.

  17. Cavity mutants of Savinase. Crystal structures and differential scanning calorimetry experiments give hints of the function of the buried water molecules in subtilisins.

    PubMed

    Pedersen, J T; Olsen, O H; Betzel, C; Eschenburg, S; Branner, S; Hastrup, S

    1994-09-23

    The subtilisin molecule possesses several internal water molecules, which may be characterised as an integral part of the protein structure. We have introduced specific mutations (T71I, T71S, T71V, T71A and T71G) at position 71 in the subtilisin variant Savinase from Bacillus lentus. This position is involved in a hydrogen bonded network with several internal water molecules, forming a water channel. The water channel and most of the other internal water molecules are positioned in the interface between two half-domains of the subtilisin molecule. The data presented here indicate that the internal water molecules are structural, and may be the result of trapping during the folding process.

  18. Targeting Cullin–RING E3 ubiquitin ligases for drug discovery: structure, assembly and small-molecule modulation

    PubMed Central

    Bulatov, Emil; Ciulli, Alessio

    2015-01-01

    In the last decade, the ubiquitin–proteasome system has emerged as a valid target for the development of novel therapeutics. E3 ubiquitin ligases are particularly attractive targets because they confer substrate specificity on the ubiquitin system. CRLs [Cullin–RING (really interesting new gene) E3 ubiquitin ligases] draw particular attention, being the largest family of E3s. The CRLs assemble into functional multisubunit complexes using a repertoire of substrate receptors, adaptors, Cullin scaffolds and RING-box proteins. Drug discovery targeting CRLs is growing in importance due to mounting evidence pointing to significant roles of these enzymes in diverse biological processes and human diseases, including cancer, where CRLs and their substrates often function as tumour suppressors or oncogenes. In the present review, we provide an account of the assembly and structure of CRL complexes, and outline the current state of the field in terms of available knowledge of small-molecule inhibitors and modulators of CRL activity. A comprehensive overview of the reported crystal structures of CRL subunits, components and full-size complexes, alone or with bound small molecules and substrate peptides, is included. This information is providing increasing opportunities to aid the rational structure-based design of chemical probes and potential small-molecule therapeutics targeting CRLs. PMID:25886174

  19. A comprehensive study of extended tetrathiafulvalene cruciform molecules for molecular electronics: synthesis and electrical transport measurements.

    PubMed

    Parker, Christian R; Leary, Edmund; Frisenda, Riccardo; Wei, Zhongming; Jennum, Karsten S; Glibstrup, Emil; Abrahamsen, Peter Bæch; Santella, Marco; Christensen, Mikkel A; Della Pia, Eduardo Antonio; Li, Tao; Gonzalez, Maria Teresa; Jiang, Xingbin; Morsing, Thorbjørn J; Rubio-Bollinger, Gabino; Laursen, Bo W; Nørgaard, Kasper; van der Zant, Herre; Agrait, Nicolas; Nielsen, Mogens Brøndsted

    2014-11-26

    Cruciform-like molecules with two orthogonally placed π-conjugated systems have in recent years attracted significant interest for their potential use as molecular wires in molecular electronics. Here we present synthetic protocols for a large selection of cruciform molecules based on oligo(phenyleneethynylene) (OPE) and tetrathiafulvalene (TTF) scaffolds, end-capped with acetyl-protected thiolates as electrode anchoring groups. The molecules were subjected to a comprehensive study of their conducting properties as well as their photophysical and electrochemical properties in solution. The complex nature of the molecules and their possible binding in different configurations in junctions called for different techniques of conductance measurements: (1) conducting-probe atomic force microscopy (CP-AFM) measurements on self-assembled monolayers (SAMs), (2) mechanically controlled break-junction (MCBJ) measurements, and (3) scanning tunneling microscopy break-junction (STM-BJ) measurements. The CP-AFM measurements showed structure-property relationships from SAMs of series of OPE3 and OPE5 cruciform molecules; the conductance of the SAM increased with the number of dithiafulvene (DTF) units (0, 1, 2) along the wire, and it increased when substituting two arylethynyl end groups of the OPE3 backbone with two DTF units. The MCBJ and STM-BJ studies on single molecules both showed that DTFs decreased the junction formation probability, but, in contrast, no significant influence on the single-molecule conductance was observed. We suggest that the origins of the difference between SAM and single-molecule measurements lie in the nature of the molecule-electrode interface as well as in effects arising from molecular packing in the SAMs. This comprehensive study shows that for complex molecules care should be taken when directly comparing single-molecule measurements and measurements of SAMs and solid-state devices thereof.

  20. Enthalpy Costs of Making and Breaking Bonds: A Game of Generating Molecules with Proper Lewis Structures

    ERIC Educational Resources Information Center

    Bell, Peter T.; Adkins, Alyssa D.; Gamble, Rex J.; Schultz, Linda D.

    2009-01-01

    "Enthalpy Costs" is a simple card game created to assist students in developing proper Lewis structure drawing skills. Score keeping is accomplished by tracking the enthalpy changes associated with bond-making and bond-breaking processes during formation of molecules represented by proper Lewis structures. Playing the game requires the student to…

  1. Inelastic electron tunneling spectroscopy of difurylethene-based photochromic single-molecule junctions

    PubMed Central

    Sysoiev, Dmytro; Huhn, Thomas; Pauly, Fabian

    2017-01-01

    Diarylethene-derived molecules alter their electronic structure upon transformation between the open and closed forms of the diarylethene core, when exposed to ultraviolet (UV) or visible light. This transformation results in a significant variation of electrical conductance and vibrational properties of corresponding molecular junctions. We report here a combined experimental and theoretical analysis of charge transport through diarylethene-derived single-molecule devices, which are created using the mechanically controlled break-junction technique. Inelastic electron tunneling (IET) spectroscopy measurements performed at 4.2 K are compared with first-principles calculations in the two distinct forms of diarylethenes connected to gold electrodes. The combined approach clearly demonstrates that the IET spectra of single-molecule junctions show specific vibrational features that can be used to identify different isomeric molecular states by transport experiments. PMID:29259875

  2. Polyamidoamine Dendrimers for Enhanced Solubility of Small Molecules and Other Desirable Properties for Site Specific Delivery: Insights from Experimental and Computational Studies.

    PubMed

    Shadrack, Daniel M; Swai, Hulda S; Munissi, Joan J E; Mubofu, Egid B; Nyandoro, Stephen S

    2018-06-12

    Clinical applications of many small molecules are limited due to poor solubility and lack of controlled release besides lack of other desirable properties. Experimental and computational studies have reported on the therapeutic potential of polyamidoamine (PAMAM) dendrimers as solubility enhancers in pre-clinical and clinical settings. Besides formulation strategies, factors such as pH, PAMAM dendrimer generation, PAMAM dendrimer concentration, nature of the PAMAM core, special ligand and surface modifications of PAMAM dendrimer have an influence on drug solubility and other recommendable pharmacological properties. This review, therefore, compiles the recently reported applications of PAMAM dendrimers in pre-clinical and clinical uses as enhancers of solubility and other desirable properties such as sustained and controlled release, bioavailability, bio-distribution, toxicity reduction or enhancement, and targeted delivery of small molecules with emphasis on cancer treatment.

  3. Electrophilic properties of common MALDI matrix molecules

    NASA Astrophysics Data System (ADS)

    Lippa, T. P.; Eustis, S. N.; Wang, D.; Bowen, K. H.

    2007-11-01

    The negative ion photoelectron spectra of the following MALDI matrix molecules have been measured: 3-carboxypyridine (nicotinic acid), 2,5-dihydroxybenzoic acid (DHB), 3,5-dimethoxy-4-hydroxycinnamic acid (sinapinic acid), 2,6-dihydroxyacetophenone (DHAP), 3-(4-hydroxy-3-methoxyphenyl)-2-propenoic acid (ferulic acid), 3-hydroxy-2-pyridinecarboxylic acid (3HPA), and 2,6-pyridinedicarboxylic acid (dipicolinic acid). Adiabatic electron affinities and vertical detachment energies were extracted from these spectra and reported. In addition, electron affinities were calculated for DHAP, ferulic acid, dipicolinic acid and sinapinic acid. Photoelectron spectra were also measured for the dimer anions of DHB and nicotinic acid and for the fragment anion in which alpha-cyano-cinnamic acid had lost a CO2 unit. Together, these results augment the database of presently available electrophilic data on common matrix molecules along with some of their dimers and fragments.

  4. First principles investigations of vinazene molecule and molecular crystal: a prospective candidate for organic photovoltaic applications.

    PubMed

    Mohamad, Mazmira; Ahmed, Rashid; Shaari, Amirudin; Goumri-Said, Souraya

    2015-02-01

    Escalating demand for sustainable energy resources, because of the rapid exhaustion of conventional energy resources as well as to maintain the environmental level of carbon dioxide (CO2) to avoid its adverse effect on the climate, has led to the exploitation of photovoltaic technology manifold more than ever. In this regard organic materials have attracted great attention on account of demonstrating their potential to harvest solar energy at an affordable rate for photovoltaic technology. 2-vinyl-4,5-dicyanoimidazole (vinazene) is considered as a suitable material over the fullerenes for photovoltaic applications because of its particular chemical and physical nature. In the present study, DFT approaches are employed to provide an exposition of optoelectronic properties of vinazene molecule and molecular crystal. To gain insight into its properties, different forms of exchange correlation energy functional/potential such as LDA, GGA, BLYP, and BL3YP are used. Calculated electronic structure of vinazene molecule has been displayed via HOMO-LUMO isosurfaces, whereas electronic structure of the vinazene molecular crystal, via electronic band structure, is presented. The calculated electronic and optical properties were analyzed and compared as well. Our results endorse vinazene as a suitable material for organic photovoltaic applications.

  5. Effect of an electric field on the structural and optical properties of fluorinated freely suspended smectic films

    NASA Astrophysics Data System (ADS)

    Śliwa, I.; Zakharov, A. V.

    2017-12-01

    Within the framework of the generalized mean-field model that takes into account the anisotropic interactions between the nearest neighbors of molecules forming freely suspended smectic films (FSSFs) and the stabilizing effects of the smectic-A (SmA)-air interface, a numerical study was performed of the structural, thermodynamic, and optical properties of these systems in the process of their layer-by-layer thinning. The results of calculating the disjoining pressure P, the average thickness of the smectic layers L, and the reflectivity index R of a FSSF formed by 5- n-alkyl-2-(4- n-(perfluoroalkyl-methylene oxide)-pentyl) (H10F5MOPP) molecules showed that these values undergo precipitous changes in the process of layer-bylayer thinning of the film. Calculations of R( T) as a function of temperature T exceeding the phase transition temperature of SmA into an isotropic state in the bulk of the liquid crystal material are in good agreement with the experimentally obtained data for the reflectivity of the FSSF formed by H10F5MOPP molecules.

  6. Inforna 2.0: A Platform for the Sequence-Based Design of Small Molecules Targeting Structured RNAs.

    PubMed

    Disney, Matthew D; Winkelsas, Audrey M; Velagapudi, Sai Pradeep; Southern, Mark; Fallahi, Mohammad; Childs-Disney, Jessica L

    2016-06-17

    The development of small molecules that target RNA is challenging yet, if successful, could advance the development of chemical probes to study RNA function or precision therapeutics to treat RNA-mediated disease. Previously, we described Inforna, an approach that can mine motifs (secondary structures) within target RNAs, which is deduced from the RNA sequence, and compare them to a database of known RNA motif-small molecule binding partners. Output generated by Inforna includes the motif found in both the database and the desired RNA target, lead small molecules for that target, and other related meta-data. Lead small molecules can then be tested for binding and affecting cellular (dys)function. Herein, we describe Inforna 2.0, which incorporates all known RNA motif-small molecule binding partners reported in the scientific literature, a chemical similarity searching feature, and an improved user interface and is freely available via an online web server. By incorporation of interactions identified by other laboratories, the database has been doubled, containing 1936 RNA motif-small molecule interactions, including 244 unique small molecules and 1331 motifs. Interestingly, chemotype analysis of the compounds that bind RNA in the database reveals features in small molecule chemotypes that are privileged for binding. Further, this updated database expanded the number of cellular RNAs to which lead compounds can be identified.

  7. A systematic and feasible method for computing nuclear contributions to electrical properties of polyatomic molecules

    NASA Astrophysics Data System (ADS)

    Luis, Josep M.; Duran, Miquel; Andrés, José L.

    1997-08-01

    An analytic method to evaluate nuclear contributions to electrical properties of polyatomic molecules is presented. Such contributions control changes induced by an electric field on equilibrium geometry (nuclear relaxation contribution) and vibrational motion (vibrational contribution) of a molecular system. Expressions to compute the nuclear contributions have been derived from a power series expansion of the potential energy. These contributions to the electrical properties are given in terms of energy derivatives with respect to normal coordinates, electric field intensity or both. Only one calculation of such derivatives at the field-free equilibrium geometry is required. To show the useful efficiency of the analytical evaluation of electrical properties (the so-called AEEP method), results for calculations on water and pyridine at the SCF/TZ2P and the MP2/TZ2P levels of theory are reported. The results obtained are compared with previous theoretical calculations and with experimental values.

  8. Persistence length of collagen molecules based on nonlocal viscoelastic model.

    PubMed

    Ghavanloo, Esmaeal

    2017-12-01

    Persistence length is one of the most interesting properties of a molecular chain, which is used to describe the stiffness of a molecule. The experimentally measured values of the persistence length of the collagen molecule are widely scattered from 14 to 180 nm. Therefore, an alternative approach is highly desirable to predict the persistence length of a molecule and also to explain the experimental results. In this paper, a nonlocal viscoelastic model is developed to obtain the persistence length of the collagen molecules in solvent. A new explicit formula is proposed for the persistence length of the molecule with the consideration of the small-scale effect, viscoelastic properties of the molecule, loading frequency, and viscosity of the solvent. The presented model indicates that there exists a range of molecule lengths in which the persistence length strongly depends on the frequency and spatial mode of applied loads, small-scale effect, and viscoelastic properties of the collagen.

  9. Statistical Exploration of Electronic Structure of Molecules from Quantum Monte-Carlo Simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prabhat, Mr; Zubarev, Dmitry; Lester, Jr., William A.

    In this report, we present results from analysis of Quantum Monte Carlo (QMC) simulation data with the goal of determining internal structure of a 3N-dimensional phase space of an N-electron molecule. We are interested in mining the simulation data for patterns that might be indicative of the bond rearrangement as molecules change electronic states. We examined simulation output that tracks the positions of two coupled electrons in the singlet and triplet states of an H2 molecule. The electrons trace out a trajectory, which was analyzed with a number of statistical techniques. This project was intended to address the following scientificmore » questions: (1) Do high-dimensional phase spaces characterizing electronic structure of molecules tend to cluster in any natural way? Do we see a change in clustering patterns as we explore different electronic states of the same molecule? (2) Since it is hard to understand the high-dimensional space of trajectories, can we project these trajectories to a lower dimensional subspace to gain a better understanding of patterns? (3) Do trajectories inherently lie in a lower-dimensional manifold? Can we recover that manifold? After extensive statistical analysis, we are now in a better position to respond to these questions. (1) We definitely see clustering patterns, and differences between the H2 and H2tri datasets. These are revealed by the pamk method in a fairly reliable manner and can potentially be used to distinguish bonded and non-bonded systems and get insight into the nature of bonding. (2) Projecting to a lower dimensional subspace ({approx}4-5) using PCA or Kernel PCA reveals interesting patterns in the distribution of scalar values, which can be related to the existing descriptors of electronic structure of molecules. Also, these results can be immediately used to develop robust tools for analysis of noisy data obtained during QMC simulations (3) All dimensionality reduction and estimation techniques that we tried

  10. Optical and structural properties of protein/gold hybrid bio-nanofilms prepared by layer-by-layer method.

    PubMed

    Pál, Edit; Hornok, Viktória; Sebok, Dániel; Majzik, Andrea; Dékány, Imre

    2010-08-01

    Lysozyme/gold thin layers were prepared by layer-by-layer (LbL) self-assembly method. The build-up of the films was followed by UV-vis-absorbance spectra, quartz crystal microbalance (QCM) and surface plasmon resonance (SPR) techniques. The structural property of films was examined by X-ray diffraction (XRD) measurements, while their morphology was studied by scanning electron microscopy (SEM) and atomic force microscopy (AFM). It was found that gold nanoparticles (NPs) had cubic crystalline structure, the primary particles form aggregates in the thin layer due to the presence of lysozyme molecules. The UV-vis measurements prove change in particle size while the colour of the film changes from wine-red to blue. The layer thickness of films was determined using the above methods and the loose, porous structure of the films explains the difference in the results. The vapour adsorption property of hybrid layers was also studied by QCM using different saturated vapours and ammonia gas. The lysozyme/Au films were most sensitive for ammonia gas among the tested gases/vapours due to the strongest interaction between the functional groups of the protein. Copyright 2010 Elsevier B.V. All rights reserved.

  11. Nanogap structures for molecular nanoelectronics

    PubMed Central

    2012-01-01

    This study is focused on the realization of nanodevices for nano and molecular electronics, based on molecular interactions in a metal-molecule-metal (M-M-M) structure. In an M-M-M system, the electronic function is a property of the structure and can be characterized through I/V measurements. The contact between the metals and the molecule was obtained by gold nanogaps (with a dimension of less than 10 nm), produced with the electromigration technique. The nanogap fabrication was controlled by a custom hardware and the related software system. The studies were carried out through experiments and simulations of organic molecules, in particular oligothiophenes. PMID:22321736

  12. Nanogap structures for molecular nanoelectronics.

    PubMed

    Motto, Paolo; Dimonte, Alice; Rattalino, Ismael; Demarchi, Danilo; Piccinini, Gianluca; Civera, Pierluigi

    2012-02-09

    This study is focused on the realization of nanodevices for nano and molecular electronics, based on molecular interactions in a metal-molecule-metal (M-M-M) structure. In an M-M-M system, the electronic function is a property of the structure and can be characterized through I/V measurements. The contact between the metals and the molecule was obtained by gold nanogaps (with a dimension of less than 10 nm), produced with the electromigration technique. The nanogap fabrication was controlled by a custom hardware and the related software system. The studies were carried out through experiments and simulations of organic molecules, in particular oligothiophenes.

  13. Random Walks on a Simple Cubic Lattice, the Multinomial Theorem, and Configurational Properties of Polymers

    ERIC Educational Resources Information Center

    Hladky, Paul W.

    2007-01-01

    Random-climb models enable undergraduate chemistry students to visualize polymer molecules, quantify their configurational properties, and relate molecular structure to a variety of physical properties. The model could serve as an introduction to more elaborate models of polymer molecules and could help in learning topics such as lattice models of…

  14. Structural analysis on mutation residues and interfacial water molecules for human TIM disease understanding

    PubMed Central

    2013-01-01

    Background Human triosephosphate isomerase (HsTIM) deficiency is a genetic disease caused often by the pathogenic mutation E104D. This mutation, located at the side of an abnormally large cluster of water in the inter-subunit interface, reduces the thermostability of the enzyme. Why and how these water molecules are directly related to the excessive thermolability of the mutant have not been investigated in structural biology. Results This work compares the structure of the E104D mutant with its wild type counterparts. It is found that the water topology in the dimer interface of HsTIM is atypical, having a "wet-core-dry-rim" distribution with 16 water molecules tightly packed in a small deep region surrounded by 22 residues including GLU104. These water molecules are co-conserved with their surrounding residues in non-archaeal TIMs (dimers) but not conserved across archaeal TIMs (tetramers), indicating their importance in preserving the overall quaternary structure. As the structural permutation induced by the mutation is not significant, we hypothesize that the excessive thermolability of the E104D mutant is attributed to the easy propagation of atoms' flexibility from the surface into the core via the large cluster of water. It is indeed found that the B factor increment in the wet region is higher than other regions, and, more importantly, the B factor increment in the wet region is maintained in the deeply buried core. Molecular dynamics simulations revealed that for the mutant structure at normal temperature, a clear increase of the root-mean-square deviation is observed for the wet region contacting with the large cluster of interfacial water. Such increase is not observed for other interfacial regions or the whole protein. This clearly suggests that, in the E104D mutant, the large water cluster is responsible for the subunit interface flexibility and overall thermolability, and it ultimately leads to the deficiency of this enzyme. Conclusions Our study

  15. Research Update: Molecular electronics: The single-molecule switch and transistor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sotthewes, Kai; Heimbuch, René, E-mail: r.heimbuch@utwente.nl; Kumar, Avijit

    2014-01-01

    In order to design and realize single-molecule devices it is essential to have a good understanding of the properties of an individual molecule. For electronic applications, the most important property of a molecule is its conductance. Here we show how a single octanethiol molecule can be connected to macroscopic leads and how the transport properties of the molecule can be measured. Based on this knowledge we have realized two single-molecule devices: a molecular switch and a molecular transistor. The switch can be opened and closed at will by carefully adjusting the separation between the electrical contacts and the voltage dropmore » across the contacts. This single-molecular switch operates in a broad temperature range from cryogenic temperatures all the way up to room temperature. Via mechanical gating, i.e., compressing or stretching of the octanethiol molecule, by varying the contact's interspace, we are able to systematically adjust the conductance of the electrode-octanethiol-electrode junction. This two-terminal single-molecule transistor is very robust, but the amplification factor is rather limited.« less

  16. Synthesis of Large Molecules in Cometary Ice Analogs: Physical Properties Related to Self-Assembly Processes

    NASA Technical Reports Server (NTRS)

    Dworkin, Jason P.; Sandford, Scott A.; Deamer, David W.; Gillette, J. Seb; Zare, Richard N.; Allamandola, Louis J. (Technical Monitor)

    1999-01-01

    The combination of realistic laboratory simulations and infrared observations have revolutionized our understanding of interstellar dust and ice-the main component of comets. Since comets and carbonaceous micrometeorites may have been important sources of volatiles and carbon compounds on the early Earth, their organic composition may be related to the origin of life. Ices on grains in molecular clouds contain a variety of simple molecules. The D/H ratios of the comets Hale-Bopp and Hyakutake are consistent with a primarily interstellar ice mixture. Within the cloud and especially in the presolar nebula through the early solar system, these icy grains would have been photoprocessed by the ultraviolet producing more complex species such as hexamethylenetetramine, polyoxymethylenes, and simple keones. We reported at the 1999 Bioastronomy meeting laboratory simulations studied to identify the types of molecules which could have been generated in pre-cometary ices. Experiments were conducted by forming a realistic interstellar mixed-molecular ice (H2O, CH3OH, NH3 and CO) at approximately 10 K under high vacuum irradiated with UV light from a hydrogen plasma lamp. The gas mixture was typically 100:50:1:1, however when different ratios were used material with similar characteristics was still produced. The residue that remained after warming to room temperature was analyzed by HPLC, and by several mass spectrometric methods. This material contains a rich mixture of complex compounds with mass spectral profiles resembling those found in IDPs and meteorites. Surface tension measurements show that an amphiphilic component is also present. These species do not appear in various controls or in unphotolyzed samples. Residues from the simulations were also dispersed in aqueous media for microscopy. The organic material forms 10-40 gm diameter droplets that fluoresce at 300-450 nm under UV excitation. These droplets have a morphology and internal structure which appear

  17. The structure and function of cell membranes examined by atomic force microscopy and single-molecule force spectroscopy.

    PubMed

    Shan, Yuping; Wang, Hongda

    2015-06-07

    The cell membrane is one of the most complicated biological complexes, and long-term fierce debates regarding the cell membrane persist because of technical hurdles. With the rapid development of nanotechnology and single-molecule techniques, our understanding of cell membranes has substantially increased. Atomic force microscopy (AFM) has provided several unprecedented advances (e.g., high resolution, three-dimensional and in situ measurements) in the study of cell membranes and has been used to systematically dissect the membrane structure in situ from both sides of membranes; as a result, novel models of cell membranes have recently been proposed. This review summarizes the new progress regarding membrane structure using in situ AFM and single-molecule force spectroscopy (SMFS), which may shed light on the study of the structure and functions of cell membranes.

  18. Understanding the Mechanical Properties and Structure Transition of Antheraea pernyi Silk Fiber Induced by Its Contraction.

    PubMed

    Wang, Yu; Wen, Jianchuan; Peng, Bo; Hu, Bingwen; Chen, Xin; Shao, Zhengzhong

    2018-02-23

    Like most major ampullate silks of spider, the length of Antheraea pernyi silkworm silk can shrink to a certain degree when the fiber is in contact with water. However, what happens in terms of molecule chain level and how it correlates to the mechanical properties of the silk during its contraction is not yet fully understood. Here, we investigate the water-induced mechanical property changes as well as the structure transition of two kinds of A. pernyi silk fiber, which are forcibly reeled from two different individuals (silkworm a and silkworm b; the silk fiber from either one represents the lower and upper limit of the distribution of mechanical properties, respectively). The tensile test results present that most of the mechanical parameters except the post-yield modulus and breaking strain for both silk fibers have the same variation trend before and after their water contraction. Synchrotron FTIR and Raman spectra show that the native filament from silkworm a contains more α-helix structures than that in silkworm b filament, and these α-helices are partially converted to β-sheet structures after the contraction of the fibers, while the order of both β-sheet and α-helix slightly increase. On the other side, the content and orientation of both secondary structural components in silkworm b fiber keep unchanged, no matter if it is native or contracted. 13 C CP/MAS NMR results further indicate that the α-helix/random coil to β-sheet conformational transition that occurred in the silk of silkworm a corresponds the Ala residues. Based upon these results, the detailed structure transition models of both as-reeled A. pernyi silk fibers during water contraction are proposed finally to interpret their properties transformation.

  19. Model Hamiltonian Calculations of the Nonlinear Polarizabilities of Conjugated Molecules.

    NASA Astrophysics Data System (ADS)

    Risser, Steven Michael

    This dissertation advances the theoretical knowledge of the nonlinear polarizabilities of conjugated molecules. The unifying feature of these molecules is an extended delocalized pi electron structure. The pi electrons dominate the electronic properties of the molecules, allowing prediction of molecular properties based on the treatment of just the pi electrons. Two separate pi electron Hamiltonians are used in the research. The principal Hamiltonian used is the non-interacting single-particle Huckel Hamiltonian, which replaces the Coulomb interaction among the pi electrons with a mean field interaction. The simplification allows for exact solution of the Hamiltonian for large molecules. The second Hamiltonian used for this research is the interacting multi-particle Pariser-Parr-Pople (PPP) Hamiltonian, which retains explicit Coulomb interactions. This limits exact solutions to molecules containing at most eight electrons. The molecular properties being investigated are the linear polarizability, and the second and third order hyperpolarizabilities. The hyperpolarizabilities determine the nonlinear optical response of materials. These molecular parameters are determined by two independent approaches. The results from the Huckel Hamiltonian are obtained through first, second and third order perturbation theory. The results from the PPP Hamiltonian are obtained by including the applied field directly in the Hamiltonian and determining the ground state energy at a series of field strengths. By fitting the energy to a polynomial in field strength, the polarizability and hyperpolarizabilities are determined. The Huckel Hamiltonian is used to calculate the third order hyperpolarizability of polyenes. These calculations were the first to show the average hyperpolarizability of the polyenes to be positive, and also to show the saturation of the hyperpolarizability. Comparison of these Huckel results to those from the PPP Hamiltonian shows the lack of explicit Coulomb

  20. Structure Defect Property Relationships in Binary Intermetallics

    NASA Astrophysics Data System (ADS)

    Medasani, Bharat; Ding, Hong; Chen, Wei; Persson, Kristin; Canning, Andrew; Haranczyk, Maciej; Asta, Mark

    2015-03-01

    Ordered intermetallics are light weight materials with technologically useful high temperature properties such as creep resistance. Knowledge of constitutional and thermal defects is required to understand these properties. Vacancies and antisites are the dominant defects in the intermetallics and their concentrations and formation enthalpies could be computed by using first principles density functional theory and thermodynamic formalisms such as dilute solution method. Previously many properties of the intermetallics such as melting temperatures and formation enthalpies were statistically analyzed for large number of intermetallics using structure maps and data mining approaches. We undertook a similar exercise to establish the dependence of the defect properties in binary intermetallics on the underlying structural and chemical composition. For more than 200 binary intermetallics comprising of AB, AB2 and AB3 structures, we computed the concentrations and formation enthalpies of vacancies and antisites in a small range of stoichiometries deviating from ideal stoichiometry. The calculated defect properties were datamined to gain predictive capabilities of defect properties as well as to classify the intermetallics for their suitability in high-T applications. Supported by the US DOE under Contract No. DEAC02-05CH11231 under the Materials Project Center grant (Award No. EDCBEE).

  1. Structures, Bonding, and Energetics of Potential Triatomic Circumstellar Molecules Containing Group 15 and 16 Elements.

    PubMed

    Turner, Walter E; Agarwal, Jay; Schaefer, Henry F

    2015-12-03

    The recent discovery of PN in the oxygen-rich shell of the supergiant star VY Canis Majoris points to the formation of several triatomic molecules involving oxygen, nitrogen, and phosphorus; these are also intriguing targets for main-group synthetic inorganic chemistry. In this research, high-level ab initio electronic structure computations were conducted on the potential circumstellar molecule OPN and several of its heavier group 15 and 16 congeners (SPN, SePN, TePN, OPP, OPAs, and OPSb). For each congener, four isomers were examined. Optimized geometries were obtained with coupled cluster theory [CCSD(T)] using large Dunning basis sets [aug-cc-pVQZ, aug-cc-pV(Q+d)Z, and aug-cc-pVQZ-PP], and relative energies were determined at the complete basis set limit of CCSDT(Q) from focal point analyses. The linear phosphorus-centered molecules were consistently the lowest in energy of the group 15 congeners by at least 6 kcal mol(-1), resulting from double-triple and single-double bond resonances within the molecule. The linear nitrogen-centered molecules were consistently the lowest in energy of the group 16 congeners by at least 5 kcal mol(-1), due to the electronegative central nitrogen atom encouraging electron delocalization throughout the molecule. For OPN, OPP, and SPN, anharmonic vibrational frequencies and vibrationally corrected rotational constants are predicted; good agreement with available experimental data is observed.

  2. Finite Element Estimation of Meteorite Structural Properties

    NASA Technical Reports Server (NTRS)

    Hart, Kenneth Arthur

    2015-01-01

    The goal of the project titled Asteroid Threat Assessment at NASA Ames Research Center is to develop risk assessment tools. The expertise in atmospheric entry in the Entry Systems and Technology Division is being used to describe the complex physics of meteor breakup in the atmosphere. The breakup of a meteor is dependent on its structural properties, including homogeneity of the material. The present work describes an 11-week effort in which a literature survey was carried for structural properties of meteoritic material. In addition, the effect of scale on homogeneity isotropy was studied using a Monte Carlo approach in Nastran. The properties were then in a static structural response simulation of an irregularly-shape meteor (138-scale version of Asteroid Itokawa). Finally, an early plan was developed for doctoral research work at Georgia Tech. in the structural failure fragmentation of meteors.

  3. Biological Nanopores: Confined Spaces for Electrochemical Single-Molecule Analysis.

    PubMed

    Cao, Chan; Long, Yi-Tao

    2018-02-20

    Nanopore sensing is developing into a powerful single-molecule approach to investigate the features of biomolecules that are not accessible by studying ensemble systems. When a target molecule is transported through a nanopore, the ions occupying the pore are excluded, resulting in an electrical signal from the intermittent ionic blockade event. By statistical analysis of the amplitudes, duration, frequencies, and shapes of the blockade events, many properties of the target molecule can be obtained in real time at the single-molecule level, including its size, conformation, structure, charge, geometry, and interactions with other molecules. With the development of the use of α-hemolysin to characterize individual polynucleotides, nanopore technology has attracted a wide range of research interest in the fields of biology, physics, chemistry, and nanoscience. As a powerful single-molecule analytical method, nanopore technology has been applied for the detection of various biomolecules, including oligonucleotides, peptides, oligosaccharides, organic molecules, and disease-related proteins. In this Account, we highlight recent developments of biological nanopores in DNA-based sensing and in studying the conformational structures of DNA and RNA. Furthermore, we introduce the application of biological nanopores to investigate the conformations of peptides affected by charge, length, and dipole moment and to study disease-related proteins' structures and aggregation transitions influenced by an inhibitor, a promoter, or an applied voltage. To improve the sensing ability of biological nanopores and further extend their application to a wider range of molecular sensing, we focus on exploring novel biological nanopores, such as aerolysin and Stable Protein 1. Aerolysin exhibits an especially high sensitivity for the detection of single oligonucleotides both in current separation and duration. Finally, to facilitate the use of nanopore measurements and statistical analysis

  4. Crystal engineering of ibuprofen compounds: From molecule to crystal structure to morphology prediction by computational simulation and experimental study

    NASA Astrophysics Data System (ADS)

    Zhang, Min; Liang, Zuozhong; Wu, Fei; Chen, Jian-Feng; Xue, Chunyu; Zhao, Hong

    2017-06-01

    We selected the crystal structures of ibuprofen with seven common space groups (Cc, P21/c, P212121, P21, Pbca, Pna21, and Pbcn), which was generated from ibuprofen molecule by molecular simulation. The predicted crystal structures of ibuprofen with space group P21/c has the lowest total energy and the largest density, which is nearly indistinguishable with experimental result. In addition, the XRD patterns for predicted crystal structure are highly consistent with recrystallization from solvent of ibuprofen. That indicates that the simulation can accurately predict the crystal structure of ibuprofen from the molecule. Furthermore, based on this crystal structure, we predicted the crystal habit in vacuum using the attachment energy (AE) method and considered solvent effects in a systematic way using the modified attachment energy (MAE) model. The simulation can accurately construct a complete process from molecule to crystal structure to morphology prediction. Experimentally, we observed crystal morphologies in four different polarity solvents compounds (ethanol, acetonitrile, ethyl acetate, and toluene). We found that the aspect ratio decreases of crystal habits in this ibuprofen system were found to vary with increasing solvent relative polarity. Besides, the modified crystal morphologies are in good agreement with the observed experimental morphologies. Finally, this work may guide computer-aided design of the desirable crystal morphology.

  5. Mechanism for starch granule ghost formation deduced from structural and enzyme digestion properties.

    PubMed

    Zhang, Bin; Dhital, Sushil; Flanagan, Bernadine M; Gidley, Michael J

    2014-01-22

    After heating in excess water under little or no shear, starch granules do not dissolve completely but persist as highly swollen fragile forms, commonly termed granule "ghosts". The macromolecular architecture of these ghosts has not been defined, despite their importance in determining characteristic properties of starches. In this study, amylase digestion of isolated granule ghosts from maize and potato starches is used as a probe to study the mechanism of ghost formation, through microstructural, mesoscopic, and molecular scale analyses of structure before and after digestion. Digestion profiles showed that neither integral nor surface proteins/lipids were crucial for control of either ghost digestion or integrity. On the basis of the molecular composition and conformation of enzyme-resistant fractions, it was concluded that the condensed polymeric surface structure of ghost particles is mainly composed of nonordered but entangled amylopectin (and some amylose) molecules, with limited reinforcement through partially ordered enzyme-resistant structures based on amylose (for maize starch; V-type order) or amylopectin (for potato starch; B-type order). The high level of branching and large molecular size of amylopectin is proposed to be the origin for the unusual stability of a solid structure based primarily on temporary entanglements.

  6. Estimation of global structural and transport properties of peptides through the modeling of their CZE mobility data.

    PubMed

    Piaggio, Maria V; Peirotti, Marta B; Deiber, Julio A

    2010-08-01

    Peptide electrophoretic mobility data are interpreted through a physicochemical CZE model, providing estimates of the equivalent hydrodynamic radius, hydration, effective and total charge numbers, actual ionizing pK, pH-near molecule and electrical permittivity of peptide domain, among other basic properties. In this study, they are used to estimate some peptide global structural properties proposed, providing thus a distinction among different peptides. Therefore, the solvent drag on the peptide is obtained through a characteristic friction power coefficient of the number of amino acid residues, defined from the global chain conformation in solution. As modeling of the effective electrophoretic mobility of peptides is carried out in terms of particle hydrodynamic size and shape coupled to hydration and effective charge, a packing dimension related to chain conformation within the peptide domain may be defined. In addition, the effective and total charge number fractions of peptides provide some clues on the interpretation of chain conformations within the framework of scaling laws. Furthermore, the model estimates transport properties, such as sedimentation, friction and diffusion coefficients. As the relative numbers of ionizing, polar and non-polar amino acid residues vary in peptides, their global structural properties defined here change appreciably. Needs for further research are also discussed.

  7. Tutorial for the structure elucidation of small molecules by means of the LSD software.

    PubMed

    Nuzillard, Jean-Marc; Plainchont, Bertrand

    2018-06-01

    Automatic structure elucidation of small molecules by means of the "logic for structure elucidation" (LSD) software is introduced in the context of the automatic exploitation of chemical shift correlation data and with minimal input from chemical shift values. The first step in solving a structural problem by means of LSD is the extraction of pertinent data from the 1D and 2D spectra. This operation requires the labeling of the resonances and of their correlations; its reliability highly depends on the quality of the spectra. The combination of COSY, HSQC, and HMBC spectra results in proximity relationships between nonhydrogen atoms that are associated in order to build the possible solutions of a problem. A simple molecule, camphor, serves as an example for the writing of an LSD input file and to show how solution structures are obtained. An input file for LSD must contain a nonambiguous description of each atom, or atom status, which includes the chemical element symbol, the hybridization state, the number of bound hydrogen atoms and the formal electric charge. In case of atom status ambiguity, the pyLSD program performs clarification by systematically generating the status of the atoms. PyLSD also proposes the use of the nmrshiftdb algorithm in order to rank the solutions of a problem according to the quality of the fit between the experimental carbon-13 chemical shifts, and the ones predicted from the proposed structures. To conclude, some hints toward future uses and developments of computer-assisted structure elucidation by LSD are proposed. Copyright © 2017 John Wiley & Sons, Ltd.

  8. Structure and spectroscopic propierties of imine acetaldehyde: a possible interstellar molecule

    NASA Astrophysics Data System (ADS)

    Redondo, Pilar; Largo, Antonio; Barrientos, Carmen

    2018-05-01

    A previous theoretical study shows that imine acetaldehyde can be obtained from the reaction between protonated vinyl alcohol and azanone. Therefore, imine acetaldehyde could be considered as a good molecule candidate to be found in space and could evolve to more complex organic molecules of prebiotic interest. In the present work, we carried out a computational study of the different conformers of imine acetaldehyde. For characterize its conformers we apply a composite approach which considers the extrapolation to the complete basis set (CBS) limit and core-valence (CV) electron correlation corrections at the at the CC level including single and double excitations and a perturbative treatment of triple excitations (CCSD(T)). This approach provides bond distances with an accuracy of 0.001-0.002 Åand angles accurate to 0.05-0.1°. Vibrational harmonic and anharmonic frequencies and IR intensities are also reported at the CCSD level. The most stable structure corresponds to an antiperiplanar disposition of the oxygen atom and of NH group with the hydrogen atom of the NH group addressed outside the skeleton. Interconversion processes between the four conformers characterized are studied. The lowest isomerization barrier is estimated to be around 1.2 kcal mol-1, making these processes unlikely under low temperature conditions, such as those reigning in the interstellar medium. The reported, at "spectroscopic" accuracy, stabilities, molecular structures, as well as spectroscopic parameters for the four imine acetaldehyde conformers that could help in their laboratory or astronomical detection.

  9. Modeling corrosion inhibition efficacy of small organic molecules as non-toxic chromate alternatives using comparative molecular surface analysis (CoMSA).

    PubMed

    Fernandez, Michael; Breedon, Michael; Cole, Ivan S; Barnard, Amanda S

    2016-10-01

    Traditionally many structural alloys are protected by primer coatings loaded with corrosion inhibiting additives. Strontium Chromate (or other chromates) have been shown to be extremely effectively inhibitors, and find extensive use in protective primer formulations. Unfortunately, hexavalent chromium which imbues these coatings with their corrosion inhibiting properties is also highly toxic, and their use is being increasingly restricted by legislation. In this work we explore a novel tridimensional Quantitative-Structure Property Relationship (3D-QSPR) approach, comparative molecular surface analysis (CoMSA), which was developed to recognize "high-performing" corrosion inhibitor candidates from the distributions of electronegativity, polarizability and van der Waals volume on the molecular surfaces of 28 small organic molecules. Multivariate statistical analysis identified five prototypes molecules, which are capable of explaining 71% of the variance within the inhibitor data set; whilst a further five molecules were also identified as archetypes, describing 75% of data variance. All active corrosion inhibitors, at a 80% threshold, were successfully recognized by the CoMSA model with adequate specificity and precision higher than 70% and 60%, respectively. The model was also capable of identifying structural patterns, that revealed reasonable starting points for where structural changes may augment corrosion inhibition efficacy. The presented methodology can be applied to other functional molecules and extended to cover structure-activity studies in a diverse range of areas such as drug design and novel material discovery. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Observation of pendular butterfly Rydberg molecules

    PubMed Central

    Niederprüm, Thomas; Thomas, Oliver; Eichert, Tanita; Lippe, Carsten; Pérez-Ríos, Jesús; Greene, Chris H.; Ott, Herwig

    2016-01-01

    Engineering molecules with a tunable bond length and defined quantum states lies at the heart of quantum chemistry. The unconventional binding mechanism of Rydberg molecules makes them a promising candidate to implement such tunable molecules. A very peculiar type of Rydberg molecules are the so-called butterfly molecules, which are bound by a shape resonance in the electron–perturber scattering. Here we report the observation of these exotic molecules and employ their exceptional properties to engineer their bond length, vibrational state, angular momentum and orientation in a small electric field. Combining the variable bond length with their giant dipole moment of several hundred Debye, we observe counter-intuitive molecules which locate the average electron position beyond the internuclear distance. PMID:27703143

  11. Library design practices for success in lead generation with small molecule libraries.

    PubMed

    Goodnow, R A; Guba, W; Haap, W

    2003-11-01

    The generation of novel structures amenable to rapid and efficient lead optimization comprises an emerging strategy for success in modern drug discovery. Small molecule libraries of sufficient size and diversity to increase the chances of discovery of novel structures make the high throughput synthesis approach the method of choice for lead generation. Despite an industry trend for smaller, more focused libraries, the need to generate novel lead structures makes larger libraries a necessary strategy. For libraries of a several thousand or more members, solid phase synthesis approaches are the most suitable. While the technology and chemistry necessary for small molecule library synthesis continue to advance, success in lead generation requires rigorous consideration in the library design process to ensure the synthesis of molecules possessing the proper characteristics for subsequent lead optimization. Without proper selection of library templates and building blocks, solid phase synthesis methods often generate molecules which are too heavy, too lipophilic and too complex to be useful for lead optimization. The appropriate filtering of virtual library designs with multiple computational tools allows the generation of information-rich libraries within a drug-like molecular property space. An understanding of the hit-to-lead process provides a practical guide to molecular design characteristics. Examples of leads generated from library approaches also provide a benchmarking of successes as well as aspects for continued development of library design practices.

  12. Properties of complexes formed by Na(+), Mg(2+), and Fe(2+) binding with benzene molecules.

    PubMed

    Kolakkandy, Sujitha; Pratihar, Subha; Aquino, Adelia J A; Wang, Hai; Hase, William L

    2014-10-09

    A theoretical investigation was performed to study cation-π interactions in complexes of benzene (Bz) with cations, that is, M(z+)(Bz)n for M(z+) = Na(+), Mg(2+), Fe(2+) and n = 1-3, using MP2 theory with the 6-31+G* and 6-311++G** basis sets and the DFT/(B3LYP and B3LYP-D)/6-311++G** methods. Binding energies and structures of the complexes are reported. The splitting between the quintet and single states of the Fe(2+) complexes was found to depend on the number of benzene molecules in the complex and the complex's structure. All of the M(z+)(Bz) complexes prefer a half-sandwich geometry. A geometry with the cation sandwiched between the two benzene rings was found for the M(z+)(Bz)2 complexes, with the benzene rings either in an eclipsed or staggered conformation. An approximate cyclic structure, with the cation at its center, was found for three benzene molecules interacting with the cation. The cation-benzene binding energy is substantial and equal to 22, 108, and 151 kcal/mol for the Na(+)(Bz), Mg(2+)(Bz), and Fe(2+)(Bz) complexes, respectively. The strength of the interaction of the cation with an individual benzene molecule decreases as the number of benzene molecules bound to the cation increases; for example, it is 108 kcal/mol for Mg(2+)(Bz), but only 71 kcal/mol for Mg(2+)(Bz)3. There is a range of values for the M(z+)(Bz)n intermolecular vibrational frequencies; for example, they are ∼230-360 and ∼10-330 cm(-1) for the Mg(2+)(Bz) and Mg(2+)(Bz)3 complexes, respectively. Binding of the cation to benzene both red and blue shifts the benzene vibrational frequencies. This shifting is larger for the Mg(2+) and Fe(2+) complexes, as compared to those for Na(+), as a result of the former's stronger cation-benzene binding. The present study is an initial step to understand the possible importance of cation-π interactions for polycyclic aromatic hydrocarbon aggregation processes during soot formation.

  13. Thermodynamic stability and structural properties of cluster crystals formed by amphiphilic dendrimers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lenz, Dominic A.; Likos, Christos N.; Blaak, Ronald

    We pursue the goal of finding real-world examples of macromolecular aggregates that form cluster crystals, which have been predicted on the basis of coarse-grained, ultrasoft pair potentials belonging to a particular mathematical class [B. M. Mladek et al., Phys. Rev. Lett. 46, 045701 (2006)]. For this purpose, we examine in detail the phase behavior and structural properties of model amphiphilic dendrimers of the second generation by means of monomer-resolved computer simulations. On augmenting the density of these systems, a fluid comprised of clusters that contain several overlapping and penetrating macromolecules is spontaneously formed. Upon further compression of the system, amore » transition to multi-occupancy crystals takes place, the thermodynamic stability of which is demonstrated by means of free-energy calculations, and where the FCC is preferred over the BCC-phase. Contrary to predictions for coarse-grained theoretical models in which the particles interact exclusively by effective pair potentials, the internal degrees of freedom of these molecules cause the lattice constant to be density-dependent. Furthermore, the mechanical stability of monodisperse BCC and FCC cluster crystals is restricted to a bounded region in the plane of cluster occupation number versus density. The structural properties of the dendrimers in the dense crystals, including their overall sizes and the distribution of monomers are also thoroughly analyzed.« less

  14. Single-Molecule FRET Spectroscopy and the Polymer Physics of Unfolded and Intrinsically Disordered Proteins.

    PubMed

    Schuler, Benjamin; Soranno, Andrea; Hofmann, Hagen; Nettels, Daniel

    2016-07-05

    The properties of unfolded proteins have long been of interest because of their importance to the protein folding process. Recently, the surprising prevalence of unstructured regions or entirely disordered proteins under physiological conditions has led to the realization that such intrinsically disordered proteins can be functional even in the absence of a folded structure. However, owing to their broad conformational distributions, many of the properties of unstructured proteins are difficult to describe with the established concepts of structural biology. We have thus seen a reemergence of polymer physics as a versatile framework for understanding their structure and dynamics. An important driving force for these developments has been single-molecule spectroscopy, as it allows structural heterogeneity, intramolecular distance distributions, and dynamics to be quantified over a wide range of timescales and solution conditions. Polymer concepts provide an important basis for relating the physical properties of unstructured proteins to folding and function.

  15. Semiexperimental equilibrium structures for building blocks of organic and biological molecules: the B2PLYP route.

    PubMed

    Penocchio, Emanuele; Piccardo, Matteo; Barone, Vincenzo

    2015-10-13

    The B2PLYP double hybrid functional, coupled with the correlation-consistent triple-ζ cc-pVTZ (VTZ) basis set, has been validated in the framework of the semiexperimental (SE) approach for deriving accurate equilibrium structures of molecules containing up to 15 atoms. A systematic comparison between new B2PLYP/VTZ results and several equilibrium SE structures previously determined at other levels, in particular B3LYP/SNSD and CCSD(T) with various basis sets, has put in evidence the accuracy and the remarkable stability of such model chemistry for both equilibrium structures and vibrational corrections. New SE equilibrium structures for phenylacetylene, pyruvic acid, peroxyformic acid, and phenyl radical are discussed and compared with literature data. Particular attention has been devoted to the discussion of systems for which lack of sufficient experimental data prevents a complete SE determination. In order to obtain an accurate equilibrium SE structure for these situations, the so-called templating molecule approach is discussed and generalized with respect to our previous work. Important applications are those involving biological building blocks, like uracil and thiouracil. In addition, for more general situations the linear regression approach has been proposed and validated.

  16. Structure of the Repulsive Guidance Molecule (RGM)—Neogenin Signaling Hub

    PubMed Central

    Bell, Christian H.; Bishop, Benjamin; Tang, Chenxiang; Gilbert, Robert J.C.; Aricescu, A. Radu; Pasterkamp, R. Jeroen; Siebold, Christian

    2016-01-01

    Repulsive guidance molecule family members (RGMs) control fundamental and diverse cellular processes, including motility and adhesion, immune cell regulation, and systemic iron metabolism. However, it is not known how RGMs initiate signaling through their common cell-surface receptor, neogenin (NEO1). Here, we present crystal structures of the NEO1 RGM-binding region and its complex with human RGMB (also called dragon). The RGMB structure reveals a previously unknown protein fold and a functionally important autocatalytic cleavage mechanism and provides a framework to explain numerous disease-linked mutations in RGMs. In the complex, two RGMB ectodomains conformationally stabilize the juxtamembrane regions of two NEO1 receptors in a pH-dependent manner. We demonstrate that all RGM-NEO1 complexes share this architecture, which therefore represents the core of multiple signaling pathways. PMID:23744777

  17. What is the minimum number of water molecules required to dissolve a potassium chloride molecule?

    PubMed

    Sen, Anik; Ganguly, Bishwajit

    2010-12-01

    This work answers an unsolved question that consists of determining the least number of water molecules necessary to separate a potassium chloride molecule. The answer based on accurate quantum chemical calculations suggests that tetramers are the smallest clusters necessary to dissociate KCl molecules. The study was made with Møller-Plesset second-order perturbation theory modified with the cluster theory having single, double, and perturbative triple excitations. With this extensive study, the dissociation of KCl molecule in different water clusters was evaluated. The calculated results show that four water molecules stabilize a solvent separated K(+)/Cl(-) ion-pair in prismatic structure and with six water molecules further dissociation was observed. Attenuated total reflection infrared spectroscopy of KCl dissolved in water establishes that clusters are made of closely bound ions with a mean of five water molecules per ion-pair [K(+)(H(2)O)(5)Cl(-)]. (Max and Chapados, Appl Spectrosc 1999, 53, 1601; Max and Chapados, J Chem Phys 2001, 115, 2664.) The calculated results tend to support that five water molecules leads toward the formation of contact ion-pair. The structures, energies, and infrared spectra of KCl molecules in different water clusters are also discussed. © 2010 Wiley Periodicals, Inc.

  18. Click strategies for single-molecule protein fluorescence.

    PubMed

    Milles, Sigrid; Tyagi, Swati; Banterle, Niccolò; Koehler, Christine; VanDelinder, Virginia; Plass, Tilman; Neal, Adrian P; Lemke, Edward A

    2012-03-21

    Single-molecule methods have matured into central tools for studies in biology. Foerster resonance energy transfer (FRET) techniques, in particular, have been widely applied to study biomolecular structure and dynamics. The major bottleneck for a facile and general application of these studies arises from the need to label biological samples site-specifically with suitable fluorescent dyes. In this work, we present an optimized strategy combining click chemistry and the genetic encoding of unnatural amino acids (UAAs) to overcome this limitation for proteins. We performed a systematic study with a variety of clickable UAAs and explored their potential for high-resolution single-molecule FRET (smFRET). We determined all parameters that are essential for successful single-molecule studies, such as accessibility of the probes, expression yield of proteins, and quantitative labeling. Our multiparameter fluorescence analysis allowed us to gain new insights into the effects and photophysical properties of fluorescent dyes linked to various UAAs for smFRET measurements. This led us to determine that, from the extended tool set that we now present, genetically encoding propargyllysine has major advantages for state-of-the-art measurements compared to other UAAs. Using this optimized system, we present a biocompatible one-step dual-labeling strategy of the regulatory protein RanBP3 with full labeling position freedom. Our technique allowed us then to determine that the region encompassing two FxFG repeat sequences adopts a disordered but collapsed state. RanBP3 serves here as a prototypical protein that, due to its multiple cysteines, size, and partially disordered structure, is not readily accessible to any of the typical structure determination techniques such as smFRET, NMR, and X-ray crystallography.

  19. Modeling single molecule junction mechanics as a probe of interface bonding

    NASA Astrophysics Data System (ADS)

    Hybertsen, Mark S.

    2017-03-01

    Using the atomic force microscope based break junction approach, applicable to metal point contacts and single molecule junctions, measurements can be repeated thousands of times resulting in rich data sets characterizing the properties of an ensemble of nanoscale junction structures. This paper focuses on the relationship between the measured force extension characteristics including bond rupture and the properties of the interface bonds in the junction. A set of exemplary model junction structures has been analyzed using density functional theory based calculations to simulate the adiabatic potential surface that governs the junction elongation. The junction structures include representative molecules that bond to the electrodes through amine, methylsulfide, and pyridine links. The force extension characteristics are shown to be most effectively analyzed in a scaled form with maximum sustainable force and the distance between the force zero and force maximum as scale factors. Widely used, two parameter models for chemical bond potential energy versus bond length are found to be nearly identical in scaled form. Furthermore, they fit well to the present calculations of N-Au and S-Au donor-acceptor bonds, provided no other degrees of freedom are allowed to relax. Examination of the reduced problem of a single interface, but including relaxation of atoms proximal to the interface bond, shows that a single-bond potential form renormalized by an effective harmonic potential in series fits well to the calculated results. This allows relatively accurate extraction of the interface bond energy. Analysis of full junction models shows cooperative effects that go beyond the mechanical series inclusion of the second bond in the junction, the spectator bond that does not rupture. Calculations for a series of diaminoalkanes as a function of molecule length indicate that the most important cooperative effect is due to the interactions between the dipoles induced by the donor

  20. Modeling single molecule junction mechanics as a probe of interface bonding

    DOE PAGES

    Hybertsen, Mark S.

    2017-03-07

    Using the atomic force microscope based break junction approach, applicable to metal point contacts and single molecule junctions, measurements can be repeated thousands of times resulting in rich data sets characterizing the properties of an ensemble of nanoscale junction structures. This paper focuses on the relationship between the measured force extension characteristics including bond rupture and the properties of the interface bonds in the junction. We analyzed a set of exemplary model junction structures using density functional theory based calculations to simulate the adiabatic potential surface that governs the junction elongation. The junction structures include representative molecules that bond tomore » the electrodes through amine, methylsulfide, and pyridine links. The force extension characteristics are shown to be most effectively analyzed in a scaled form with maximum sustainable force and the distance between the force zero and force maximum as scale factors. Widely used, two parameter models for chemical bond potential energy versus bond length are found to be nearly identical in scaled form. Furthermore, they fit well to the present calculations of N–Au and S–Au donor-acceptor bonds, provided no other degrees of freedom are allowed to relax. Examination of the reduced problem of a single interface, but including relaxation of atoms proximal to the interface bond, shows that a single-bond potential form renormalized by an effective harmonic potential in series fits well to the calculated results. This, then, allows relatively accurate extraction of the interface bond energy. Analysis of full junction models shows cooperative effects that go beyond the mechanical series inclusion of the second bond in the junction, the spectator bond that does not rupture. Calculations for a series of diaminoalkanes as a function of molecule length indicate that the most important cooperative effect is due to the interactions between the dipoles induced by

  1. Modeling single molecule junction mechanics as a probe of interface bonding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hybertsen, Mark S.

    Using the atomic force microscope based break junction approach, applicable to metal point contacts and single molecule junctions, measurements can be repeated thousands of times resulting in rich data sets characterizing the properties of an ensemble of nanoscale junction structures. This paper focuses on the relationship between the measured force extension characteristics including bond rupture and the properties of the interface bonds in the junction. We analyzed a set of exemplary model junction structures using density functional theory based calculations to simulate the adiabatic potential surface that governs the junction elongation. The junction structures include representative molecules that bond tomore » the electrodes through amine, methylsulfide, and pyridine links. The force extension characteristics are shown to be most effectively analyzed in a scaled form with maximum sustainable force and the distance between the force zero and force maximum as scale factors. Widely used, two parameter models for chemical bond potential energy versus bond length are found to be nearly identical in scaled form. Furthermore, they fit well to the present calculations of N–Au and S–Au donor-acceptor bonds, provided no other degrees of freedom are allowed to relax. Examination of the reduced problem of a single interface, but including relaxation of atoms proximal to the interface bond, shows that a single-bond potential form renormalized by an effective harmonic potential in series fits well to the calculated results. This, then, allows relatively accurate extraction of the interface bond energy. Analysis of full junction models shows cooperative effects that go beyond the mechanical series inclusion of the second bond in the junction, the spectator bond that does not rupture. Calculations for a series of diaminoalkanes as a function of molecule length indicate that the most important cooperative effect is due to the interactions between the dipoles induced by

  2. First-Principles Study on the Structural, Electronic, Magnetic and Thermodynamic Properties of Full Heusler Alloys Co2VZ (Z = Al, Ga)

    NASA Astrophysics Data System (ADS)

    Bentouaf, Ali; Hassan, Fouad H.; Reshak, Ali H.; Aïssa, Brahim

    2017-01-01

    We report on the investigation of the structural and physical properties of the Co2VZ (Z = Al, Ga) Heusler alloys, with L21 structure, through first-principles calculations involving the full potential linearized augmented plane-wave method within density functional theory. These physical properties mainly revolve around the electronic, magnetic and thermodynamic properties. By using the Perdew-Burke-Ernzerhof generalized gradient approximation, the calculated lattice constants and spin magnetic moments were found to be in good agreement with the experimental data. Furthermore, the thermal effects using the quasi-harmonic Debye model have been investigated in depth while taking into account the lattice vibrations, the temperature and the pressure effects on the structural parameters. The heat capacities, the thermal expansion coefficient and the Debye temperatures have also been determined from the non-equilibrium Gibbs functions. An application of the atom in molecule theory is presented and discussed in order to analyze the bonding nature of the Heusler alloys. The focus is on the mixing of the metallic and covalent behavior of Co2VZ (Z = Al, Ga) Heusler alloys.

  3. Assembly, Thermodynamics, and Structure of a Two-Wheeled Composite of a Dumbbell-Shaped Molecule and Cylindrical Molecules with Different Edges.

    PubMed

    Matsuno, Taisuke; Kamata, Sho; Sato, Sota; Yokoyama, Atsutoshi; Sarkar, Parantap; Isobe, Hiroyuki

    2017-11-20

    A carbonaceous dumbbell was able to spontaneously glue two tubular receptors to form a unique two-wheeled composite through van der Waals interactions, thus forcing the wheel components into contact with each other at the edges. In the present study, two tubular receptors with enantiomeric carbon networks were assembled on the dumbbell joint, and the handedness of the receptors was discriminated, thus leading to the self-sorting of homomeric receptors from a mixture of enantiomeric tubes. The crystal structures of the composites revealed the structural origins of the molecular recognition driven by van der Waals forces as well as the presence of a columnar array of C 120 molecules in a 1:1 composite. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Controlling microstructure of pentacene derivatives by solution processing: impact of structural anisotropy on optoelectronic properties.

    PubMed

    James, David T; Frost, Jarvist M; Wade, Jessica; Nelson, Jenny; Kim, Ji-Seon

    2013-09-24

    The consideration of anisotropic structural properties and their impact on optoelectronic properties in small-molecule thin films is vital to understand the performance of devices incorporating crystalline organic semiconductors. Here we report on the important relationship between structural and optoelectronic anisotropy in aligned, functionalized-pentacene thin films fabricated using the solution-based zone-casting technique. The microstructure of thin films composed of 6,13-bis(triisopropylsilylethynyl)pentacene (TIPS-pentacene) and 6,13-bis(triethylsilylethynyl)pentacene (TES-pentacene) is systematically controlled by varying the casting speed. By controlling the structural alignment, we were able to experimentally decouple, for the first time in these films, an intramolecular absorption transition dipole (at ∼440 nm) oriented close to the pentacene short axis and an intermolecular absorption transition dipole (at ∼695 nm) oriented predominantly along the conjugated pentacene-pentacene core stacking axis (crystallographic a-axis) in both films. Using the intermolecular absorption as a signature for intermolecular delocalization, much higher optical dichroism was obtained in TES-pentacene (16 ± 6) than TIPS-pentacene (3.2 ± 0.1), which was attributed to the 1D packing structure of TES-pentacene compared to the 2D packing structure of TIPS-pentacene. This result was also supported by field-effect mobility anisotropy measurements of the films, with TES-pentacene exhibiting a higher anisotropy (∼21-47, depending on the casting speed) than TIPS-pentacene (∼3-10).

  5. Energy level alignment at molecule-metal interfaces from an optimally tuned range-separated hybrid functional

    DOE PAGES

    Liu, Zhen-Fei; Egger, David A.; Refaely-Abramson, Sivan; ...

    2017-02-21

    The alignment of the frontier orbital energies of an adsorbed molecule with the substrate Fermi level at metal-organic interfaces is a fundamental observable of significant practical importance in nanoscience and beyond. Typical density functional theory calculations, especially those using local and semi-local functionals, often underestimate level alignment leading to inaccurate electronic structure and charge transport properties. Here, we develop a new fully self-consistent predictive scheme to accurately compute level alignment at certain classes of complex heterogeneous molecule-metal interfaces based on optimally tuned range-separated hybrid functionals. Starting from a highly accurate description of the gas-phase electronic structure, our method by constructionmore » captures important nonlocal surface polarization effects via tuning of the long-range screened exchange in a range-separated hybrid in a non-empirical and system-specific manner. We implement this functional in a plane-wave code and apply it to several physisorbed and chemisorbed molecule-metal interface systems. Our results are in quantitative agreement with experiments, the both the level alignment and work function changes. This approach constitutes a new practical scheme for accurate and efficient calculations of the electronic structure of molecule-metal interfaces.« less

  6. Energy level alignment at molecule-metal interfaces from an optimally tuned range-separated hybrid functional

    NASA Astrophysics Data System (ADS)

    Liu, Zhen-Fei; Egger, David A.; Refaely-Abramson, Sivan; Kronik, Leeor; Neaton, Jeffrey B.

    2017-03-01

    The alignment of the frontier orbital energies of an adsorbed molecule with the substrate Fermi level at metal-organic interfaces is a fundamental observable of significant practical importance in nanoscience and beyond. Typical density functional theory calculations, especially those using local and semi-local functionals, often underestimate level alignment leading to inaccurate electronic structure and charge transport properties. In this work, we develop a new fully self-consistent predictive scheme to accurately compute level alignment at certain classes of complex heterogeneous molecule-metal interfaces based on optimally tuned range-separated hybrid functionals. Starting from a highly accurate description of the gas-phase electronic structure, our method by construction captures important nonlocal surface polarization effects via tuning of the long-range screened exchange in a range-separated hybrid in a non-empirical and system-specific manner. We implement this functional in a plane-wave code and apply it to several physisorbed and chemisorbed molecule-metal interface systems. Our results are in quantitative agreement with experiments, the both the level alignment and work function changes. Our approach constitutes a new practical scheme for accurate and efficient calculations of the electronic structure of molecule-metal interfaces.

  7. Structural and Interfacial Properties of Hyperbranched-Linear Polymer Surfactant.

    PubMed

    Qiang, Taotao; Bu, Qiaoqiao; Huang, Zhaofeng; Wang, Xuechuan

    2014-01-01

    With oleic acid grafting modification, a series of hyperbranched-linear polymer surfactants (HLPS) were prepared by hydroxyl-terminated hyperbranched polymer (HBP), which was gained through a step synthesis method using trimethylolpropane and AB 2 monomer. The AB 2 monomers were obtained through the Michael addition reaction of methyl acrylate and diethanol amine. The structures of HLPS were characterised by Fourier transform infrared spectrophotometer and nuclear magnetic resonance (NMR), which indicated that HBP was successfully modified by oleic acid. Furthermore, the properties of surface tension and critical micelle concentration of HLPS solution showed that HLPS can significantly reduce the surface tension of water. The morphology of the HLPS solution was characterised by dynamic light scattering, which revealed that HLPS exhibited a nonmonotonic appearance in particle size at different scattering angles owing to the different replaced linear portions. The relationships of the surface pressure to monolayer area and time were measured using the Langmuir-Blodgett instrument, which showed that the surface tension of monolayer molecules increased with the increasing of hydrophobic groups. In addition, the interface conditions of different replaced HLPS solutions were simulated.

  8. Predicting structural properties of fluids by thermodynamic extrapolation

    NASA Astrophysics Data System (ADS)

    Mahynski, Nathan A.; Jiao, Sally; Hatch, Harold W.; Blanco, Marco A.; Shen, Vincent K.

    2018-05-01

    We describe a methodology for extrapolating the structural properties of multicomponent fluids from one thermodynamic state to another. These properties generally include features of a system that may be computed from an individual configuration such as radial distribution functions, cluster size distributions, or a polymer's radius of gyration. This approach is based on the principle of using fluctuations in a system's extensive thermodynamic variables, such as energy, to construct an appropriate Taylor series expansion for these structural properties in terms of intensive conjugate variables, such as temperature. Thus, one may extrapolate these properties from one state to another when the series is truncated to some finite order. We demonstrate this extrapolation for simple and coarse-grained fluids in both the canonical and grand canonical ensembles, in terms of both temperatures and the chemical potentials of different components. The results show that this method is able to reasonably approximate structural properties of such fluids over a broad range of conditions. Consequently, this methodology may be employed to increase the computational efficiency of molecular simulations used to measure the structural properties of certain fluid systems, especially those used in high-throughput or data-driven investigations.

  9. A single-molecule diode

    PubMed Central

    Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B.; Mayor, Marcel

    2005-01-01

    We have designed and synthesized a molecular rod that consists of two weakly coupled electronic π -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current–voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur–gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current–voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical π -systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current–voltage characteristics, similar to the phenomena in a semiconductor diode. PMID:15956208

  10. Quantum mechanical computations and spectroscopy: from small rigid molecules in the gas phase to large flexible molecules in solution.

    PubMed

    Barone, Vincenzo; Improta, Roberto; Rega, Nadia

    2008-05-01

    Interpretation of structural properties and dynamic behavior of molecules in solution is of fundamental importance to understand their stability, chemical reactivity, and catalytic action. While information can be gained, in principle, by a variety of spectroscopic techniques, the interpretation of the rich indirect information that can be inferred from the analysis of experimental spectra is seldom straightforward because of the subtle interplay of several different effects, whose specific role is not easy to separate and evaluate. In such a complex scenario, theoretical studies can be very helpful at two different levels: (i) supporting and complementing experimental results to determine the structure of the target molecule starting from its spectral properties; (ii) dissecting and evaluating the role of different effects in determining the observed spectroscopic properties. This is the reason why computational spectroscopy is rapidly evolving from a highly specialized research field into a versatile and widespread tool for the assignment of experimental spectra and their interpretation in terms of chemical physical effects. In such a situation, it becomes important that both computationally and experimentally oriented chemists are aware that new methodological advances and integrated computational strategies are available, providing reliable estimates of fundamental spectral parameters not only for relatively small molecules in the gas phase but also for large and flexible molecules in condensed phases. In this Account, we review the most significant methodological contributions from our research group in this field, and by exploiting some recent results of their application to the computation of IR, UV-vis, NMR, and EPR spectral parameters, we discuss the microscopic mechanisms underlying solvent and vibrational effects on the spectral parameters. After reporting some recent achievements for the study of excited states by first principle quantum mechanical

  11. Quantum Chemistry Meets Spectroscopy for Astrochemistry: Increasing Complexity toward Prebiotic Molecules.

    PubMed

    Barone, Vincenzo; Biczysko, Malgorzata; Puzzarini, Cristina

    2015-05-19

    For many years, scientists suspected that the interstellar medium was too hostile for organic species and that only a few simple molecules could be formed under such extreme conditions. However, the detection of approximately 180 molecules in interstellar or circumstellar environments in recent decades has changed this view dramatically. A rich chemistry has emerged, and relatively complex molecules such as C60 and C70 are formed. Recently, researchers have also detected complex organic and potentially prebiotic molecules, such as amino acids, in meteorites and in other space environments. Those discoveries have further stimulated the debate on the origin of the building blocks of life in the universe. Many efforts continue to focus on the physical, chemical, and astrophysical processes by which prebiotic molecules can be formed in the interstellar dust and dispersed to Earth or to other planets.Spectroscopic techniques, which are widely used to infer information about molecular structure and dynamics, play a crucial role in the investigation of planetary atmosphere and the interstellar medium. Increasingly these astrochemical investigations are assisted by quantum-mechanical calculations of structures as well as spectroscopic and thermodynamic properties, such as transition frequencies and reaction enthalpies, to guide and support observations, line assignments, and data analysis in these new and chemically complicated situations. However, it has proved challenging to extend accurate quantum-chemical computational approaches to larger systems because of the unfavorable scaling with the number of degrees of freedom (both electronic and nuclear).In this Account, we show that it is now possible to compute physicochemical properties of building blocks of biomolecules with an accuracy rivaling that of the most sophisticated experimental techniques, and we summarize specific contributions from our groups. As a test case, we present the underlying computational machinery

  12. Designing small molecule polyaromatic p- and n-type semiconductor materials for organic electronics

    NASA Astrophysics Data System (ADS)

    Collis, Gavin E.

    2015-12-01

    By combining computational aided design with synthetic chemistry, we are able to identify core 2D polyaromatic small molecule templates with the necessary optoelectronic properties for p- and n-type materials. By judicious selection of the functional groups, we can tune the physical properties of the material making them amenable to solution and vacuum deposition. In addition to solubility, we observe that the functional group can influence the thin film molecular packing. By developing structure-property relationships (SPRs) for these families of compounds we observe that some compounds are better suited for use in organic solar cells, while others, varying only slightly in structure, are favoured in organic field effect transistor devices. We also find that the processing conditions can have a dramatic impact on molecular packing (i.e. 1D vs 2D polymorphism) and charge mobility; this has implications for material and device long term stability. We have developed small molecule p- and n-type materials for organic solar cells with efficiencies exceeding 2%. Subtle variations in the functional groups of these materials produces p- and ntype materials with mobilities higher than 0.3 cm2/Vs. We are also interested in using our SPR approach to develop materials for sensor and bioelectronic applications.

  13. A 3D visualization system for molecular structures

    NASA Technical Reports Server (NTRS)

    Green, Terry J.

    1989-01-01

    The properties of molecules derive in part from their structures. Because of the importance of understanding molecular structures various methodologies, ranging from first principles to empirical technique, were developed for computing the structure of molecules. For large molecules such as polymer model compounds, the structural information is difficult to comprehend by examining tabulated data. Therefore, a molecular graphics display system, called MOLDS, was developed to help interpret the data. MOLDS is a menu-driven program developed to run on the LADC SNS computer systems. This program can read a data file generated by the modeling programs or data can be entered using the keyboard. MOLDS has the following capabilities: draws the 3-D representation of a molecule using stick, ball and ball, or space filled model from Cartesian coordinates, draws different perspective views of the molecule; rotates the molecule on the X, Y, Z axis or about some arbitrary line in space, zooms in on a small area of the molecule in order to obtain a better view of a specific region; and makes hard copy representation of molecules on a graphic printer. In addition, MOLDS can be easily updated and readily adapted to run on most computer systems.

  14. Human glucose-6-phosphate dehydrogenase: the crystal structure reveals a structural NADP(+) molecule and provides insights into enzyme deficiency.

    PubMed

    Au, S W; Gover, S; Lam, V M; Adams, M J

    2000-03-15

    Glucose-6-phosphate dehydrogenase (G6PD) catalyses the first committed step in the pentose phosphate pathway; the generation of NADPH by this enzyme is essential for protection against oxidative stress. The human enzyme is in a dimer<-->tetramer equilibrium and its stability is dependent on NADP(+) concentration. G6PD deficiency results from many different point mutations in the X-linked gene encoding G6PD and is the most common human enzymopathy. Severe deficiency causes chronic non-spherocytic haemolytic anaemia; the usual symptoms are neonatal jaundice, favism and haemolytic anaemia. We have determined the first crystal structure of a human G6PD (the mutant Canton, Arg459-->Leu) at 3 A resolution. The tetramer is a dimer of dimers. Despite very similar dimer topology, there are two major differences from G6PD of Leuconostoc mesenteroides: a structural NADP(+) molecule, close to the dimer interface but integral to the subunit, is visible in all subunits of the human enzyme; and an intrasubunit disulphide bond tethers the otherwise disordered N-terminal segment. The few dimer-dimer contacts making the tetramer are charge-charge interactions. The importance of NADP(+) for stability is explained by the structural NADP(+) site, which is not conserved in prokaryotes. The structure shows that point mutations causing severe deficiency predominate close to the structural NADP(+) and the dimer interface, primarily affecting the stability of the molecule. They also indicate that a stable dimer is essential to retain activity in vivo. As there is an absolute requirement for some G6PD activity, residues essential for coenzyme or substrate binding are rarely modified.

  15. Effect of lattice-gas atoms on the adsorption behaviour of thioether molecules.

    PubMed

    Pan, Yi; Yang, Bing; Hulot, Catherine; Blechert, Siegfried; Nilius, Niklas; Freund, Hans-Joachim

    2012-08-21

    Using STM topographic imaging and spectroscopy, we have investigated the adsorption of two thioether molecules, 1,2-bis(phenylthio)benzene and (bis(3-phenylthio)-phenyl)sulfane, on noble and transition metal surfaces. The two substrates show nearly antipodal behaviour. Whereas complexes with one or two protruding centres are observed on Au(111), only flat and uniform ad-structures are found on NiAl(110). The difference is ascribed to the possibility of the thioethers to form metal-organic complexes by coordinating lattice-gas atoms on the Au(111), while only the pristine molecules adsorb on the alloy surface. The metal coordination in the first case is driven by the formation of strong Au-S bonds and enables the formation of characteristic monomer, dimer and chain-like structures of the thioethers, using the Au atoms as linkers. A similar mechanism is not available on the NiAl, because no lattice gas develops at this surface at room temperature. Our work demonstrates how surface properties, i.e. the availability of mobile ad-species, determine the interaction of organic molecules with metallic substrates.

  16. Cyclic tetraureas with variable flexibility--synthesis, crystal structures and properties.

    PubMed

    Meshcheryakov, Denys; Arnaud-Neu, Françoise; Böhmer, Volker; Bolte, Michael; Cavaleri, Julien; Hubscher-Bruder, Véronique; Thondorf, Iris; Werner, Sabine

    2008-09-21

    Macrocyclic molecules containing several amide or urea functions may serve as anion receptors. We describe the synthesis of 32-membered macrocycles, in which four rigid xanthene units (X) and/or diphenyl ether units (D) as flexible analogues are linked via urea groups. All six possible combinations of these units (XXXX, XXXD, XXDD, XDXD, XDDD and DDDD) were synthesized and two examples were characterised by single-crystal X-ray analyses (DDDD and two structures for XXXD). Both macrocycles showed distinct differences in their overall conformation and consequently in their hydrogen-bonding pattern. Hydrogen-bonded solvent molecules are found for both compounds and intramolecular hydrogen bonds for the two structures of XXXD, but surprisingly no direct intermolecular hydrogen bonds between the macrocyclic tetraurea molecules. The interaction with various anions was studied by (1)H NMR spectroscopy. Stability constants for all tetramers were determined by UV spectroscopy for complexes with chloride, bromide, acetate and dihydrogenphosphate in acetonitrile-THF (3:1). The strongest binding was found for XXXD and acetate (log beta = 7.4 +/- 0.2), the weakest for XXXX and acetate (log beta = 5.1 +/- 0.5). MD simulations in chloroform and acetonitrile boxes show that all molecules except DDDD adopt very similar conformations characterized by an up-down-up-down arrangement of the spacer groups. Clustered solvation shells of acetonitrile molecules around XXXX and DDDD suggest their preorganization for spherical/planar and tetrahedral/bidentate anions, respectively, which in turn was corroborated by simulation of the corresponding complexes with chloride and dihydrogenphosphate.

  17. Potential mesogens based on pyridine derivatives: The geometric structure, conformational properties and characteristics of intermolecular hydrogen bonds

    NASA Astrophysics Data System (ADS)

    Fedorov, Mikhail S.; Giricheva, Nina I.; Shpilevaya, Kseniya E.; Lapykina, Elena A.; Syrbu, Svetlana A.

    2017-03-01

    Conformational properties of the main part (excluding sbnd OC3H7 radicals) of the p-n-propyloxybenzoic (A1) and p-n-propyloxycinnamic (A2) acids molecules (relating to mesomorphic compounds) as well as p-n-propyloxybenzoic acid pyridine ester (B1) and p-n-propyloxyphenylazopyridine (B2) molecules (relating to non-mesomorphic compounds) were studied by DFT(B3LYP)/cc-pVTZ method. It was shown that the main parts of A1 and A2 acids are rigid. The barrier to internal rotation of pyridine fragment in the B1 and B2 molecules depends on the nature of the bridging group. It was determined that all studied A1⋯B1, A2⋯B1 and A2⋯B2 complexes are characterized by a strong hydrogen bond. The binding energy of complexes (≈14 kcal/mol, with BSSE corrections, DFT(B97D)/6-311++G**) exceeds the energy per hydrogen bond in the corresponding acid dimers (≈10 kcal/mol). The structural non-rigidity of A⋯B complexes is mainly caused by possibility of sbnd OC3H7 radicals internal rotation and A and B molecules rotation about the (H)O⋯N line. The characteristics of intermolecular hydrogen bonds were determined by NBO-analysis. The obtained results indicate that examined complexes correspond to the basic requirements to mesogen molecular forms. The thermodynamic functions of the gas-phase complexation reactions (idealized model of the complexes formation in the condensed state) were calculated. Preliminary studies of mesogen-non-mesogen A1⋯B2 system by differential scanning calorimetry and polarizing optical microscopy, showed that it has mesomorphic properties.

  18. Self-Assemblies of novel molecules, VECAR

    NASA Astrophysics Data System (ADS)

    Shrestha, Bijay; Kim, Hye-Young; Lee, Soojin; Novak, Brian; Moldovan, Dorel

    2015-03-01

    VECAR is a newly synthesized molecule, which is an amphiphilic antioxidant molecule that consists of two molecular groups, vitamin-E and Carnosine, linked by a hydrocarbon chain. The hydrocarbon chain is hydrophobic and both vitamin-E and Carnosine ends are hydrophilic. In the synthesis process, the length of the hydrophobic chain of VECAR molecules can vary from the shortest (n =0) to the longest (n =18), where n indicates the number of carbon atoms in the chain. We conducted MD simulation studies of self-assembly of VECAR molecules in water using GROMACS on LONI HPC resources. Our study shows that there is a strong correlation between the shape and atomistic structure of the self-assembled nano-structures (SANs) and the chain-length (n) of VECAR molecules. We will report the results of data analyses including the atomistic structure of each SANs and the dynamic and energetic mechanisms of their formation as function of time. In summary, both VECAR molecules of chain-length n =18 and 9 form worm-like micelles, which may be used as a drug delivery system. This research is supported by the Louisiana Board of Regents-RCS Grant (LEQSF(2012-15)-RD-A-19).

  19. ForceGen 3D structure and conformer generation: from small lead-like molecules to macrocyclic drugs

    NASA Astrophysics Data System (ADS)

    Cleves, Ann E.; Jain, Ajay N.

    2017-05-01

    We introduce the ForceGen method for 3D structure generation and conformer elaboration of drug-like small molecules. ForceGen is novel, avoiding use of distance geometry, molecular templates, or simulation-oriented stochastic sampling. The method is primarily driven by the molecular force field, implemented using an extension of MMFF94s and a partial charge estimator based on electronegativity-equalization. The force field is coupled to algorithms for direct sampling of realistic physical movements made by small molecules. Results are presented on a standard benchmark from the Cambridge Crystallographic Database of 480 drug-like small molecules, including full structure generation from SMILES strings. Reproduction of protein-bound crystallographic ligand poses is demonstrated on four carefully curated data sets: the ConfGen Set (667 ligands), the PINC cross-docking benchmark (1062 ligands), a large set of macrocyclic ligands (182 total with typical ring sizes of 12-23 atoms), and a commonly used benchmark for evaluating macrocycle conformer generation (30 ligands total). Results compare favorably to alternative methods, and performance on macrocyclic compounds approaches that observed on non-macrocycles while yielding a roughly 100-fold speed improvement over alternative MD-based methods with comparable performance.

  20. Monte Carlo study of the honeycomb structure of anthraquinone molecules on Cu(111)

    NASA Astrophysics Data System (ADS)

    Kim, Kwangmoo; Einstein, T. L.

    2011-06-01

    Using Monte Carlo calculations of the two-dimensional (2D) triangular lattice gas model, we demonstrate a mechanism for the spontaneous formation of honeycomb structure of anthraquinone (AQ) molecules on a Cu(111) plane. In our model long-range attractions play an important role, in addition to the long-range repulsions and short-range attractions proposed by Pawin, Wong, Kwon, and Bartels [ScienceSCIEAS0036-807510.1126/science.1129309 313, 961 (2006)]. We provide a global account of the possible combinations of long-range attractive coupling constants which lead to a honeycomb superstructure. We also provide the critical temperature of disruption of the honeycomb structure and compare the critical local coverage rate of AQ’s where the honeycomb structure starts to form with the experimental observations.