Sample records for mosquito immune response

  1. Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses

    PubMed Central

    Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G.

    2017-01-01

    Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes. PMID:28426765

  2. Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses.

    PubMed

    Hernández-Martínez, Salvador; Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G

    2017-01-01

    Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes.

  3. Comprehensive Genetic Dissection of the Hemocyte Immune Response in the Malaria Mosquito Anopheles gambiae

    PubMed Central

    Lombardo, Fabrizio; Ghani, Yasmeen; Kafatos, Fotis C.; Christophides, George K.

    2013-01-01

    Reverse genetics in the mosquito Anopheles gambiae by RNAi mediated gene silencing has led in recent years to an advanced understanding of the mosquito immune response against infections with bacteria and malaria parasites. We developed RNAi screens in An. gambiae hemocyte-like cells using a library of double-stranded RNAs targeting 109 genes expressed highly or specifically in mosquito hemocytes to identify novel regulators of the hemocyte immune response. Assays included phagocytosis of bacterial bioparticles, expression of the antimicrobial peptide CEC1, and basal and induced expression of the mosquito complement factor LRIM1. A cell viability screen was also carried out to assess dsRNA cytotoxicity and to identify genes involved in cell growth and survival. Our results identify 22 novel immune regulators, including proteins putatively involved in phagosome assembly and maturation (Ca2+ channel, v-ATPase and cyclin-dependent protein kinase), pattern recognition (fibrinogen-domain lectins and Nimrod), immune modulation (peptidase and serine protease homolog), immune signaling (Eiger and LPS-induced factor), cell adhesion and communication (Laminin B1 and Ninjurin) and immune homeostasis (Lipophorin receptor). The development of robust functional cell-based assays paves the way for genome-wide functional screens to study the mosquito immune response to infections with human pathogens. PMID:23382679

  4. The human immune system's response to carcinogenic and other infectious agents transmitted by mosquito vectors.

    PubMed

    Johansson, Olle; Ward, Martin

    2017-01-01

    It has been hypothesised that mosquitoes [Diptera: Culicidae] may play more of a role in certain cancers than is currently appreciated. Research links 33 infectious agents to cancer, 27 of which have a presence in mosquitoes, and that, in addition, mosquito saliva downregulates the immune system. The objective of this paper is to review the literature on the immune system and cancer-causing infectious agents, particularly those present in mosquitoes, with a view to establishing whether such infectious agents can, in the long run, defeat the immune system or be defeated by it. Many of the viruses, bacteria and parasites recognised by the International Agency for Research on Cancer (IARC) as carcinogenic and suspected by others as being involved in cancer have evolved numerous complex ways of avoiding, suppressing or altering the immune system's responses. These features, coupled with the multiplicity and variety of serious infectious agents carried by some species of mosquitoes and the adverse effects on the immune system of mosquito saliva, suggest that post-mosquito bite the immune system is likely to be overwhelmed. In such a situation, immunisation strategies offer little chance of cancer prevention, unless a single or limited number of critical infectious agents can be isolated from the 'mosquito' cocktail. If that proves to be impossible cancer prevention will, therefore, if the hypothesis proves to be correct, rest on the twin strategies of environmentally controlling the mosquito population and humans avoiding being bitten. The latter strategy will involve determining the factors that demark those being bitten from those that are not.

  5. Molecular mechanisms mediating immune priming in Anopheles gambiae mosquitos

    USDA-ARS?s Scientific Manuscript database

    The Anopheles gambiae immune priming response is triggered when Plasmodium ookinetes invade the mosquito midgut and the microbiota comes in direct contact with injured cells. This is a long-lasting response that confers the challenged mosquito enhanced ability to control subsequent Plasmodium infect...

  6. The immune strategies of mosquito Aedes aegypti against microbial infection.

    PubMed

    Wang, Yan-Hong; Chang, Meng-Meng; Wang, Xue-Li; Zheng, Ai-Hua; Zou, Zhen

    2018-06-01

    Yellow fever mosquito Aedes aegypti transmits many devastating arthropod-borne viruses (arboviruses), such as dengue virus, yellow fever virus, Chikungunya virus, and Zika virus, which cause great concern to human health. Mosquito control is an effective method to block the spread of infectious diseases. Ae. aegypti uses its innate immune system to fight against arboviruses, parasites, and fungi. In this review, we briefly summarize the recent findings in the immune response of Ae. aegypti against arboviral and entomopathogenic infections. This review enriches our understanding of the mosquito immune system and provides evidence to support the development of novel mosquito control strategies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Molecular Profiling of Phagocytic Immune Cells in Anopheles gambiae Reveals Integral Roles for Hemocytes in Mosquito Innate Immunity*

    PubMed Central

    Smith, Ryan C.; King, Jonas G.; Tao, Dingyin; Zeleznik, Oana A.; Brando, Clara; Thallinger, Gerhard G.; Dinglasan, Rhoel R.

    2016-01-01

    The innate immune response is highly conserved across all eukaryotes and has been studied in great detail in several model organisms. Hemocytes, the primary immune cell population in mosquitoes, are important components of the mosquito innate immune response, yet critical aspects of their biology have remained uncharacterized. Using a novel method of enrichment, we isolated phagocytic granulocytes and quantified their proteomes by mass spectrometry. The data demonstrate that phagocytosis, blood-feeding, and Plasmodium falciparum infection promote dramatic shifts in the proteomic profiles of An. gambiae granulocyte populations. Of interest, large numbers of immune proteins were induced in response to blood feeding alone, suggesting that granulocytes have an integral role in priming the mosquito immune system for pathogen challenge. In addition, we identify several granulocyte proteins with putative roles as membrane receptors, cell signaling, or immune components that when silenced, have either positive or negative effects on malaria parasite survival. Integrating existing hemocyte transcriptional profiles, we also compare differences in hemocyte transcript and protein expression to provide new insight into hemocyte gene regulation and discuss the potential that post-transcriptional regulation may be an important component of hemocyte gene expression. These data represent a significant advancement in mosquito hemocyte biology, providing the first comprehensive proteomic profiling of mosquito phagocytic granulocytes during homeostasis blood-feeding, and pathogen challenge. Together, these findings extend current knowledge to further illustrate the importance of hemocytes in shaping mosquito innate immunity and their principal role in defining malaria parasite survival in the mosquito host. PMID:27624304

  8. Interorgan Molecular Communication Strategies of "Local" and "Systemic" Innate Immune Responses in Mosquito Anopheles stephensi.

    PubMed

    Das De, Tanwee; Sharma, Punita; Thomas, Tina; Singla, Deepak; Tevatiya, Sanjay; Kumari, Seena; Chauhan, Charu; Rani, Jyoti; Srivastava, Vartika; Kaur, Ramandeep; Pandey, Kailash C; Dixit, Rajnikant

    2018-01-01

    Mosquitoes that transmit many deadly infectious diseases also need to keep fighting against many microbial infections. Constitutive expression of multiple antimicrobial peptides (AMPs) in almost all body tissues is believed to facilitate the effective management of these local infections. When any infection breaches the local barrier, AMPs are induced rapidly in non-target tissues such as hemocytes (HCs) and establish their co-ordination with systemic immune effectors to clear off the body infection. But how interorgan immune communication is managed during local and systemic infections remain largely unknown. To understand this interorgan molecular relationship, we identified, extensively profiled and compared the expression of AMPs in three important mosquito tissues viz . midgut, fat body (FB), and HCs. dsRNA -mediated AMPs silencing suggests that mosquito tissues are able to manage an optimal expression of AMPs at the physiological level. We also examined the possible contribution of two important immune regulator genes relish (REL) and nitric oxide synthase, controlling AMPs expression in these tissues during local or systemic infections. We show that each tissue has a unique ability to respond to local/systemic challenges, but HCs are more specialized to recognize and discriminate-specific antigens than gut and FB. Our investigation also revealed that both REL and NO participate in the overall management of the interorgan immune responses, but at the same time each tissue also has its own ability to maintain the interorgan flow of signals. In our knowledge, this is the first large-scale study examining the interorgan immune relationship in the mosquito.

  9. Involvement of the Anopheles gambiae Nimrod gene family in mosquito immune responses.

    PubMed

    Estévez-Lao, Tania Y; Hillyer, Julián F

    2014-01-01

    Insects fight infection using a variety of signaling pathways and immune effector proteins. In Drosophila melanogaster, three members of the Nimrod gene family (draper, nimC1 and eater) bind bacteria, and this binding leads to phagocytosis by hemocytes. The Nimrod gene family has since been identified in other insects, but their function in non-drosophilids remains unknown. The purpose of this study was to identify the members of the Nimrod gene family in the malaria mosquito, Anopheles gambiae, and to assess their role in immunity. We identified and sequenced three members of this gene family, herein named draper, nimrod and eater, which are the orthologs of D. melanogaster draper, nimB2 and eater, respectively. The three genes are preferentially expressed in hemocytes and their peak developmental expression is in pupae and young adults. Infection induces the transcriptional upregulation of all three genes, but the magnitude of this upregulation becomes more attenuated as mosquitoes become older. RNAi-based knockdown of eater, but not draper or nimrod, decreased a mosquito's ability to kill Escherichia coli in the hemocoel. Knockdown of draper, eater, or any combination of Nimrod family genes rendered mosquitoes more likely to die from Staphylococcus epidermidis. Finally, knockdown of Nimrod family genes did not impact mRNA levels of the antimicrobial peptides defensin (def1), cecropin (cecA) or gambicin (gam1), but eater knockdown led to a decrease in mRNA levels of nitric oxide synthase. Together, these data show that members of the A. gambiae Nimrod gene family are positive regulators of the mosquito antibacterial response. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Infection-Induced Interaction between the Mosquito Circulatory and Immune Systems

    PubMed Central

    King, Jonas G.; Hillyer, Julián F.

    2012-01-01

    Insects counter infection with innate immune responses that rely on cells called hemocytes. Hemocytes exist in association with the insect's open circulatory system and this mode of existence has likely influenced the organization and control of anti-pathogen immune responses. Previous studies reported that pathogens in the mosquito body cavity (hemocoel) accumulate on the surface of the heart. Using novel cell staining, microdissection and intravital imaging techniques, we investigated the mechanism of pathogen accumulation in the pericardium of the malaria mosquito, Anopheles gambiae, and discovered a novel insect immune tissue, herein named periostial hemocytes, that sequesters pathogens as they flow with the hemolymph. Specifically, we show that there are two types of endocytic cells that flank the heart: periostial hemocytes and pericardial cells. Resident periostial hemocytes engage in the rapid phagocytosis of pathogens, and during the course of a bacterial or Plasmodium infection, circulating hemocytes migrate to the periostial regions where they bind the cardiac musculature and each other, and continue the phagocytosis of invaders. Periostial hemocyte aggregation occurs in a time- and infection dose-dependent manner, and once this immune process is triggered, the number of periostial hemocytes remains elevated for the lifetime of the mosquito. Finally, the soluble immune elicitors peptidoglycan and β-1,3-glucan also induce periostial hemocyte aggregation, indicating that this is a generalized and basal immune response that is induced by diverse immune stimuli. These data describe a novel insect cellular immune response that fundamentally relies on the physiological interaction between the insect circulatory and immune systems. PMID:23209421

  11. Ingested human insulin inhibits the mosquito NF-¿B-dependent immune response to Plasmodium falciparum

    USDA-ARS?s Scientific Manuscript database

    We showed previously that ingested human insulin activates the insulin/IGF-1 signaling pathway in Anopheles stephensi and increases the susceptibility of these mosquitoes to Plasmodium falciparum. In other organisms insulin can alter immune responsiveness through regulation of NF-kB transcription fa...

  12. The serine protease homolog CLIPA14 modulates the intensity of the immune response in the mosquito Anopheles gambiae

    PubMed Central

    Nakhleh, Johnny; Christophides, George K.; Osta, Mike A.

    2017-01-01

    Clip domain serine protease homologs (SPHs) are positive and negative regulators of Anopheles gambiae immune responses mediated by the complement-like protein TEP1 against Plasmodium malaria parasites and other microbial infections. We have previously reported that the SPH CLIPA2 is a negative regulator of the TEP1-mediated response by showing that CLIPA2 knockdown (kd) enhances mosquito resistance to infections with fungi, bacteria, and Plasmodium parasites. Here, we identify another SPH, CLIPA14, as a novel regulator of mosquito immunity. We found that CLIPA14 is a hemolymph protein that is rapidly cleaved following a systemic infection. CLIPA14 kd mosquitoes elicited a potent melanization response against Plasmodium berghei ookinetes and exhibited significantly increased resistance to Plasmodium infections as well as to systemic and oral bacterial infections. The activity of the enzyme phenoloxidase, which initiates melanin biosynthesis, dramatically increased in the hemolymph of CLIPA14 kd mosquitoes in response to systemic bacterial infections. Ookinete melanization and hemolymph phenoloxidase activity were further increased after cosilencing CLIPA14 and CLIPA2, suggesting that these two SPHs act in concert to control the melanization response. Interestingly, CLIPA14 RNAi phenotypes and its infection-induced cleavage were abolished in a TEP1 loss-of-function background. Our results suggest that a complex network of SPHs functions downstream of TEP1 to regulate the melanization reaction. PMID:28928218

  13. Injury and immune response: applying the danger theory to mosquitoes

    PubMed Central

    Moreno-García, Miguel; Recio-Tótoro, Benito; Claudio-Piedras, Fabiola; Lanz-Mendoza, Humberto

    2014-01-01

    The insect immune response can be activated by the recognition of both non-self and molecular by-products of tissue damage. Since pathogens and tissue damage usually arise at the same time during infection, the specific mechanisms of the immune response to microorganisms, and to tissue damage have not been unraveled. Consequently, some aspects of damage caused by microorganisms in vector-borne arthropods have been neglected. We herein reassess the Anopheles–Plasmodium interaction, incorporating Matzinger’s danger/damage hypothesis and George Salt’s injury assumptions. The invasive forms of the parasite cross the peritrophic matrix and midgut epithelia to reach the basal lamina and differentiate into an oocyst. The sporozoites produced in the oocyst are released into the hemolymph, and from there enter the salivary gland. During parasite development, wounds to midgut tissue and the basement membrane are produced. We describe the response of the different compartments where the parasite interacts with the mosquito. In the midgut, the response includes the expression of antimicrobial peptides, production of reactive oxygen species, and possible activation of midgut regenerative cells. In the basal membrane, wound repair mainly involves the production of molecules and the recruitment of hemocytes. We discuss the susceptibility to damage in tissues, and how the place and degree of damage may influence the differential response and the expression of damage associated molecular patterns (DAMPs). Knowledge about damage caused by parasites may lead to a deeper understanding of the relevance of tissue damage and the immune response it generates, as well as the origins and progression of infection in this insect–parasite interaction. PMID:25250040

  14. Eater and draper are involved in the periostial haemocyte immune response in the mosquito Anopheles gambiae.

    PubMed

    Sigle, L T; Hillyer, J F

    2018-03-09

    Haemocytes respond to infection by phagocytosing pathogens, producing the enzymes that drive the phenoloxidase-based melanization cascade, secreting lytic factors, and producing other humoral proteins. A subset of haemocytes, called periostial haemocytes, aggregate on the surface of the heart of mosquitoes and kill pathogens in areas of high haemolymph flow. Periostial haemocytes are always present, but an infection induces the recruitment of additional haemocytes to these regions. Here, we tested whether members of the Nimrod gene family are involved in the periostial immune response of the African malaria mosquito, Anopheles gambiae. Using organismal manipulations, RNA interference (RNAi) and microscopy, we show that, following an infection with Escherichia coli, nimrod - the orthologue of Drosophila NimB2 - is not involved in periostial responses. At 4 h postinfection, however, RNAi-based knockdown of draper results in a marginal increase in the number of periostial haemocytes and a doubling of E. coli accumulation at the periostial regions. Finally, at 24 h postinfection, knockdown of eater decreases the number of periostial haemocytes and decreases the phagocytosis of E. coli on the surface of the heart. Phagocytosis of bacteria is more prevalent in the periostial regions of the mid abdominal segments, and knockdown of draper, nimrod or eater does not alter this distribution. Finally, knockdown of Nimrod family genes did not have a meaningful effect on the accumulation of melanin at the periostial regions. This study identifies roles for eater and draper in the functional integration of the mosquito immune and circulatory systems. © 2018 The Royal Entomological Society.

  15. The bacterium Wolbachia exploits host innate immunity to establish a symbiotic relationship with the dengue vector mosquito Aedes aegypti.

    PubMed

    Pan, Xiaoling; Pike, Andrew; Joshi, Deepak; Bian, Guowu; McFadden, Michael J; Lu, Peng; Liang, Xiao; Zhang, Fengrui; Raikhel, Alexander S; Xi, Zhiyong

    2018-01-01

    A host's immune system plays a central role in shaping the composition of the microbiota and, in return, resident microbes influence immune responses. Symbiotic associations of the maternally transmitted bacterium Wolbachia occur with a wide range of arthropods. It is, however, absent from the dengue and Zika vector mosquito Aedes aegypti in nature. When Wolbachia is artificially forced to form symbiosis with this new mosquito host, it boosts the basal immune response and enhances the mosquito's resistance to pathogens, including dengue, Zika virus and malaria parasites. The mechanisms involved in establishing a symbiotic relationship between Wolbachia and A. aegypti, and the long-term outcomes of this interaction, are not well understood. Here, we have demonstrated that both the immune deficiency (IMD) and Toll pathways are activated by the Wolbachia strain wAlbB upon its introduction into A. aegypti. Silencing the Toll and IMD pathways via RNA interference reduces the wAlbB load. Notably, wAlbB induces peptidoglycan recognition protein (PGRP)-LE expression in the carcass of A. aegypti, and its silencing results in a reduction of symbiont load. Using transgenic mosquitoes with stage-specific induction of the IMD and Toll pathways, we have shown that elevated wAlbB infection in these mosquitoes is maintained via maternal transmission. These results indicate that host innate immunity is utilized to establish and promote host-microbial symbiosis. Our results will facilitate a long-term projection of the stability of the Wolbachia-A. aegypti mosquito system that is being developed to control dengue and Zika virus transmission to humans.

  16. Hemocyte-mediated phagocytosis and melanization in the mosquito Armigeres subalbatus following immune challenge by bacteria.

    PubMed

    Hillyer, Julián F; Schmidt, Shelley L; Christensen, Bruce M

    2003-07-01

    Mosquitoes are important vectors of disease. These insects respond to invading organisms with strong cellular and humoral immune responses that share many similarities with vertebrate immune systems. The strength and specificity of these responses are directly correlated to a mosquito's ability to transmit disease. In the current study, we characterized the hemocytes (blood cells) of Armigeres subalbatus by morphology (ultrastructure), lectin binding, enzyme activity, immunocytochemistry, and function. We found four hemocyte types: granulocytes, oenocytoids, adipohemocytes, and thrombocytoids. Granulocytes contained acid phosphatase activity and bound the exogenous lectins Helix pomatia agglutinin, Galanthus nivalis lectin, and wheat germ agglutinin. Following bacteria inoculation, granulocytes mounted a strong phagocytic response as early as 5 min postexposure. Bacteria also elicited a hemocyte-mediated melanization response. Phenoloxidase, the rate-limiting enzyme in the melanization pathway, was present exclusively in oenocytoids and in many of the melanotic capsules enveloping bacteria. The immune responses mounted against different bacteria were not identical; gram(-) Escherichia coli were predominantly phagocytosed and gram(+) Micrococcus luteus were melanized. These studies implicate hemocytes as the primary line of defense against bacteria.

  17. The interplay between dose and immune system activation determines fungal infection outcome in the African malaria mosquito, Anopheles gambiae.

    PubMed

    Rhodes, Victoria L; Thomas, Matthew B; Michel, Kristin

    2018-08-01

    The Toll pathway is a central regulator of antifungal immunity in insects. In mosquitoes, the Toll pathway affects infections with the fungal entomopathogen, Beauveria bassiana, which is considered a potential mosquito biopesticide. We report here the use of B. bassiana strain I93-825 in Anopheles gambiae to analyze the impact of Toll pathway modulation on mosquito survival. Exposure to a narrow dose range of conidia by direct contact decreased mosquito longevity and median survival. In addition, fungal exposure dose correlated positively and linearly with hazard ratio. Increased Toll signaling by knockdown of its inhibitor, cactus, decreased survivorship of uninfected females, increased mosquito survival after low dose B. bassiana exposure, but had little effect following exposure to higher doses. This observed trade-off could have implications for development of B. bassiana as a prospective vector control tool. On the one hand, selection for small increases in mosquito immune signaling across a narrow dose range could impair efficacy of B. bassiana. On the other hand, costs of immunity and the capacity for higher doses of fungus to overwhelm immune responses could limit evolution of resistance. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Spatial and temporal in vivo analysis of circulating and sessile immune cells in mosquitoes: hemocyte mitosis following infection

    PubMed Central

    2013-01-01

    Background Mosquitoes respond to infection by mounting immune responses. The primary regulators of these immune responses are cells called hemocytes, which kill pathogens via phagocytosis and via the production of soluble antimicrobial factors. Mosquito hemocytes are circulated throughout the hemocoel (body cavity) by the swift flow of hemolymph (blood), and data show that some hemocytes also exist as sessile cells that are attached to tissues. The purpose of this study was to create a quantitative physical map of hemocyte distribution in the mosquito, Anopheles gambiae, and to describe the cellular immune response in an organismal context. Results Using correlative imaging methods we found that the number of hemocytes in a mosquito decreases with age, but that regardless of age, approximately 75% of the hemocytes occur in circulation and 25% occur as sessile cells. Infection induces an increase in the number of hemocytes, and tubulin and nuclear staining showed that this increase is primarily due to mitosis and, more specifically, autonomous cell division, by circulating granulocytes. The majority of sessile hemocytes are present on the abdominal wall, although significant numbers of hemocytes are also present in the thorax, head, and several of the appendages. Within the abdominal wall, the areas of highest hemocyte density are the periostial regions (regions surrounding the valves of the heart, or ostia), which are ideal locations for pathogen capture as these are areas of high hemolymph flow. Conclusions These data describe the spatial and temporal distribution of mosquito hemocytes, and map the cellular response to infection throughout the hemocoel. PMID:23631603

  19. Whole-Killed Blood-Stage Vaccine-Induced Immunity Suppresses the Development of Malaria Parasites in Mosquitoes.

    PubMed

    Zhu, Feng; Liu, Taiping; Zhao, Chenhao; Lu, Xiao; Zhang, Jian; Xu, Wenyue

    2017-01-01

    As a malaria transmission-blocking vaccine alone does not confer a direct benefit to the recipient, it is necessary to develop a vaccine that not only blocks malaria transmission but also protects vaccinated individuals. In this study we observed that a whole-killed blood-stage vaccine (WKV) not only conferred protection against the blood-stage challenge but also markedly inhibited the transmission of different strains of the malaria parasite. Although the parasitemia is much lower in WKV-immunized mice challenged with malaria parasites, the gametocytemia is comparable between control and immunized mice during the early stages of infection. The depletion of CD4 + T cells prior to the adoptive transfer of parasites into WKV-immunized mice has no effect on the development of the malaria parasite in the mosquito, but the adoptive transfer of the serum from the immunized mice into the parasite-inoculated mice remarkably suppresses the development of malaria parasites in mosquitoes. Furthermore, immunized mice challenged with the malaria parasite generate higher levels of parasite-specific Abs and the inflammatory cytokines MCP-1 and IFN-γ. However, the adoptive transfer of parasite-specific IgG or the depletion of MCP-1, but not IFN-γ, to some extent is closely associated with the suppression of malaria parasite development in mosquitoes. These data strongly suggest that WKV-induced immune responses confer protection against the mosquito stage, which is largely dependent on malaria parasite-specific Abs and MCP-1. This finding sheds new light on blocking malaria transmission through the immunization of individuals with the WKV. Copyright © 2016 by The American Association of Immunologists, Inc.

  20. Plasmodium evasion of mosquito immunity and global malaria transmission: The lock-and-key theory.

    PubMed

    Molina-Cruz, Alvaro; Canepa, Gaspar E; Kamath, Nitin; Pavlovic, Noelle V; Mu, Jianbing; Ramphul, Urvashi N; Ramirez, Jose Luis; Barillas-Mury, Carolina

    2015-12-08

    Plasmodium falciparum malaria originated in Africa and became global as humans migrated to other continents. During this journey, parasites encountered new mosquito species, some of them evolutionarily distant from African vectors. We have previously shown that the Pfs47 protein allows the parasite to evade the mosquito immune system of Anopheles gambiae mosquitoes. Here, we investigated the role of Pfs47-mediated immune evasion in the adaptation of P. falciparum to evolutionarily distant mosquito species. We found that P. falciparum isolates from Africa, Asia, or the Americas have low compatibility to malaria vectors from a different continent, an effect that is mediated by the mosquito immune system. We identified 42 different haplotypes of Pfs47 that have a strong geographic population structure and much lower haplotype diversity outside Africa. Replacement of the Pfs47 haplotypes in a P. falciparum isolate is sufficient to make it compatible to a different mosquito species. Those parasites that express a Pfs47 haplotype compatible with a given vector evade antiplasmodial immunity and survive. We propose that Pfs47-mediated immune evasion has been critical for the globalization of P. falciparum malaria as parasites adapted to new vector species. Our findings predict that this ongoing selective force by the mosquito immune system could influence the dispersal of Plasmodium genetic traits and point to Pfs47 as a potential target to block malaria transmission. A new model, the "lock-and-key theory" of P. falciparum globalization, is proposed, and its implications are discussed.

  1. Primary lymph node responses to mosquito bites.

    PubMed

    Mellink, J J; Vos, B J

    1977-03-29

    Post-auricular lymph node responses and changes in fresh weight of thymus and spleen of hamsters and mice at 4 and 8 days after primary exposure of both ears to 20 bites by the mosquito Aedes aegypti were studied quantitatively. In both hosts lymph node changes characteristic of the development of cell-mediated immune responses and those which are believed to lead to antibody production occurred, with the emphasis on the latter phenomena. No reactions of thymus and spleen were observed. The responses recorded are considered to be immunologically specific. In hamsters, but not in mice, the responses related to humoral sensitization coincided in time to a large extent with those of the cell-mediated immune processes. The stronger humoral responses in mice were probably in the first place the result of the relatively higher dosages applied.

  2. Dengue subgenomic flaviviral RNA disrupts immunity in mosquito salivary glands to increase virus transmission

    PubMed Central

    Manuel, Menchie; Shan, Chao; Manokaran, Gayathri; Bradrick, Shelton S.; Missé, Dorothée; Shi, Pei-Yong

    2017-01-01

    Globally re-emerging dengue viruses are transmitted from human-to-human by Aedes mosquitoes. While viral determinants of human pathogenicity have been defined, there is a lack of knowledge of how dengue viruses influence mosquito transmission. Identification of viral determinants of transmission can help identify isolates with high epidemiological potential. Additionally, mechanistic understanding of transmission will lead to better understanding of how dengue viruses harness evolution to cycle between the two hosts. Here, we identified viral determinants of transmission and characterized mechanisms that enhance production of infectious saliva by inhibiting immunity specifically in salivary glands. Combining oral infection of Aedes aegypti mosquitoes and reverse genetics, we identified two 3’ UTR substitutions in epidemic isolates that increased subgenomic flaviviral RNA (sfRNA) quantity, infectious particles in salivary glands and infection rate of saliva, which represents a measure of transmission. We also demonstrated that various 3’UTR modifications similarly affect sfRNA quantity in both whole mosquitoes and human cells, suggesting a shared determinism of sfRNA quantity. Furthermore, higher relative quantity of sfRNA in salivary glands compared to midgut and carcass pointed to sfRNA function in salivary glands. We showed that the Toll innate immune response was preferentially inhibited in salivary glands by viruses with the 3’UTR substitutions associated to high epidemiological fitness and high sfRNA quantity, pointing to a mechanism for higher saliva infection rate. By determining that sfRNA is an immune suppressor in a tissue relevant to mosquito transmission, we propose that 3’UTR/sfRNA sequence evolution shapes dengue epidemiology not only by influencing human pathogenicity but also by increasing mosquito transmission, thereby revealing a viral determinant of epidemiological fitness that is shared between the two hosts. PMID:28753642

  3. The Role of Innate Immunity in Conditioning Mosquito Susceptibility to West Nile Virus

    PubMed Central

    Prasad, Abhishek N.; Brackney, Doug. E.; Ebel, Gregory D.

    2013-01-01

    Arthropod-borne viruses (arboviruses) represent an emerging threat to human and livestock health globally. In particular, those transmitted by mosquitoes present the greatest challenges to disease control efforts. An understanding of the molecular basis for mosquito innate immunity to arbovirus infection is therefore critical to investigations regarding arbovirus evolution, virus-vector ecology, and mosquito vector competence. In this review, we discuss the current state of understanding regarding mosquito innate immunity to West Nile virus. We draw from the literature with respect to other virus-vector pairings to attempt to draw inferences to gaps in our knowledge about West Nile virus and relevant vectors. PMID:24351797

  4. The Mosquito Melanization Response Is Implicated in Defense against the Entomopathogenic Fungus Beauveria bassiana

    PubMed Central

    Osta, Mike A.

    2012-01-01

    Mosquito immunity studies have focused mainly on characterizing immune effector mechanisms elicited against parasites, bacteria and more recently, viruses. However, those elicited against entomopathogenic fungi remain poorly understood, despite the ubiquitous nature of these microorganisms and their unique invasion route that bypasses the midgut epithelium, an important immune tissue and physical barrier. Here, we used the malaria vector Anopheles gambiae as a model to investigate the role of melanization, a potent immune effector mechanism of arthropods, in mosquito defense against the entomopathogenic fungus Beauveria bassiana, using in vivo functional genetic analysis and confocal microscopy. The temporal monitoring of fungal growth in mosquitoes injected with B. bassiana conidia showed that melanin eventually formed on all stages, including conidia, germ tubes and hyphae, except the single cell hyphal bodies. Nevertheless, melanin rarely aborted the growth of any of these stages and the mycelium continued growing despite being melanized. Silencing TEP1 and CLIPA8, key positive regulators of Plasmodium and bacterial melanization in A. gambiae, abolished completely melanin formation on hyphae but not on germinating conidia or germ tubes. The detection of a layer of hemocytes surrounding germinating conidia but not hyphae suggested that melanization of early fungal stages is cell-mediated while that of late stages is a humoral response dependent on TEP1 and CLIPA8. Microscopic analysis revealed specific association of TEP1 with surfaces of hyphae and the requirement of both, TEP1 and CLIPA8, for recruiting phenoloxidase to these surfaces. Finally, fungal proliferation was more rapid in TEP1 and CLIPA8 knockdown mosquitoes which exhibited increased sensitivity to natural B. bassiana infections than controls. In sum, the mosquito melanization response retards significantly B. bassiana growth and dissemination, a finding that may be exploited to design transgenic

  5. Participation of 14-3-3ε and 14-3-3ζ proteins in the phagocytosis, component of cellular immune response, in Aedes mosquito cell lines.

    PubMed

    Trujillo-Ocampo, Abel; Cázares-Raga, Febe Elena; Del Angel, Rosa María; Medina-Ramírez, Fernando; Santos-Argumedo, Leopoldo; Rodríguez, Mario H; Hernández-Hernández, Fidel de la Cruz

    2017-08-01

    Better knowledge of the innate immune system of insects will improve our understanding of mosquitoes as potential vectors of diverse pathogens. The ubiquitously expressed 14-3-3 protein family is evolutionarily conserved from yeast to mammals, and at least two isoforms of 14-3-3, the ε and ζ, have been identified in insects. These proteins have been shown to participate in both humoral and cellular immune responses in Drosophila. As mosquitoes of the genus Aedes are the primary vectors for arboviruses, causing several diseases such as dengue fever, yellow fever, Zika and chikungunya fevers, cell lines derived from these mosquitoes, Aag-2 from Aedes aegypti and C6/36 HT from Aedes albopictus, are currently used to study the insect immune system. Here, we investigated the role of 14-3-3 proteins (ε and ζ isoform) in phagocytosis, the main cellular immune responses executed by the insects, using Aedes spp. cell lines. We evaluated the mRNA and protein expression of 14-3-3ε and 14-3-3ζ in C6/36 HT and Aag-2 cells, and demonstrated that both proteins were localised in the cytoplasm. Further, in C6/36 HT cells treated with a 14-3-3 specific inhibitor we observed a notable modification of cell morphology with filopodia-like structure caused through cytoskeleton reorganisation (co-localization of 14-3-3 proteins with F-actin), more importantly the decrease in Salmonella typhimurium, Staphylococcus aureus and E. coli phagocytosis and reduction in phagolysosome formation. Additionally, silencing of 14-3-3ε and 14-3-3ζ expression by mean of specific DsiRNA confirmed the decreased phagocytosis and phagolysosome formation of pHrodo labelled E. coli and S. aureus bacteria by Aag-2 cells. The 14-3-3ε and 14-3-3ζ proteins modulate cytoskeletal remodelling, and are essential for phagocytosis of Gram-positive and Gram-negative bacteria in Aedes spp. cell lines.

  6. Emerging role of lipid droplets in Aedes aegypti immune response against bacteria and Dengue virus

    PubMed Central

    Barletta, Ana Beatriz Ferreira; Alves, Liliane Rosa; Nascimento Silva, Maria Clara L.; Sim, Shuzhen; Dimopoulos, George; Liechocki, Sally; Maya-Monteiro, Clarissa M.; Sorgine, Marcos H. Ferreira

    2016-01-01

    In mammals, lipid droplets (LDs) are ubiquitous organelles that modulate immune and inflammatory responses through the production of lipid mediators. In insects, it is unknown whether LDs play any role during the development of immune responses. We show that Aedes aegypti Aag2 cells – an immune responsive cell lineage – accumulates LDs when challenged with Enterobacter cloacae, Sindbis, and Dengue viruses. Microarray analysis of Aag2 challenged with E.cloacae or infected with Dengue virus revealed high transcripts levels of genes associated with lipid storage and LDs biogenesis, correlating with the increased LDs numbers in those conditions. Similarly, in mosquitoes, LDs accumulate in midgut cells in response to Serratia marcescens and Sindbis virus or when the native microbiota proliferates, following a blood meal. Also, constitutive activation of Toll and IMD pathways by knocking-down their respective negative modulators (Cactus and Caspar) increases LDs numbers in the midgut. Our results show for the first time an infection-induced LDs accumulation in response to both bacterial and viral infections in Ae. Aegypti, and we propose a role for LDs in mosquito immunity. These findings open new venues for further studies in insect immune responses associated with lipid metabolism. PMID:26887863

  7. Engineering blood meal-activated systemic immunity in the yellow fever mosquito, Aedes aegypti.

    PubMed

    Kokoza, V; Ahmed, A; Cho, W L; Jasinskiene, N; James, A A; Raikhel, A

    2000-08-01

    Progress in molecular genetics makes possible the development of alternative disease control strategies that target the competence of mosquitoes to transmit pathogens. We tested the regulatory region of the vitellogenin (Vg) gene of Aedes aegypti for its ability to express potential antipathogen factors in transgenic mosquitoes. Hermes-mediated transformation was used to integrate a 2.1-kb Vg-promoter fragment driving the expression of the Defensin A (DefA) coding region, one of the major insect immune factors. PCR amplification of genomic DNA and Southern blot analyses, carried out through the ninth generation, showed that the Vg-DefA transgene insertion was stable. The Vg-DefA transgene was strongly activated in the fat body by a blood meal. The mRNA levels reached a maximum at 24-h postblood meal, corresponding to the peak expression time of the endogenous Vg gene. High levels of transgenic defensin were accumulated in the hemolymph of bloodfed female mosquitoes, persisting for 20-22 days after a single blood feeding. Purified transgenic defensin showed antibacterial activity comparable to that of defensin isolated from bacterially challenged control mosquitoes. Thus, we have been able to engineer the genetically stable transgenic mosquito with an element of systemic immunity, which is activated through the blood meal-triggered cascade rather than by infection. This work represents a significant step toward the development of molecular genetic approaches to the control of vector competence in pathogen transmission.

  8. Innexin AGAP001476 Is Critical for Mediating Anti-Plasmodium Responses in Anopheles Mosquitoes

    PubMed Central

    Li, Michelle W. M.; Wang, Jiuling; Zhao, Yang O.; Fikrig, Erol

    2014-01-01

    The Toll and IMD pathways are known to be induced upon Plasmodium berghei and Plasmodium falciparum infection, respectively. It is unclear how Plasmodium or other pathogens in the blood meal and their invasion of the midgut epithelium would trigger the innate immune responses in immune cells, in particular hemocytes. Gap junctions, which can mediate both cell-to-cell and cell-to-extracellular communication, may participate in this signal transduction. This study examined whether innexins, gap junction proteins in insects, are involved in anti-Plasmodium responses in Anopheles gambiae. Inhibitor studies using carbenoxolone indicated that blocking innexons resulted in an increase in Plasmodium oocyst number and infection prevalence. This was accompanied by a decline in TEP1 levels in carbenoxolone-treated mosquitoes. Innexin AGAP001476 mRNA levels in midguts were induced during Plasmodium infection and a knockdown of AGAP001476, but not AGAP006241, caused an induction in oocyst number. Silencing AGAP001476 caused a concurrent increase in vitellogenin levels, a TEP1 inhibitor, in addition to a reduced level of TEP1-LRIM1-APL1C complex in hemolymph. Both vitellogenin and TEP1 are regulated by Cactus under the Toll pathway. Simultaneous knockdown of cactus and AGAP001476 failed to reverse the near refractoriness induced by the knockdown of cactus, suggesting that the AGAP001476-mediated anti-Plasmodium response is Cactus-dependent. These data demonstrate a critical role for innexin AGAP001476 in mediating innate immune responses against Plasmodium through Toll pathway in mosquitoes. PMID:25035430

  9. PIWIs Go Viral: Arbovirus-Derived piRNAs in Vector Mosquitoes

    PubMed Central

    2016-01-01

    Vector mosquitoes are responsible for transmission of the majority of arthropod-borne (arbo-) viruses. Virus replication in these vectors needs to be sufficiently high to permit efficient virus transfer to vertebrate hosts. The mosquito immune response therefore is a key determinant for arbovirus transmission. Mosquito antiviral immunity is primarily mediated by the small interfering RNA pathway. Besides this well-established antiviral machinery, the PIWI-interacting RNA (piRNA) pathway processes viral RNA into piRNAs. In recent years, significant progress has been made in characterizing the biogenesis and function of these viral piRNAs. In this review, we discuss these developments, identify knowledge gaps, and suggest directions for future research. PMID:28033427

  10. Immune Response to Dengue and Zika.

    PubMed

    Ngono, Annie Elong; Shresta, Sujan

    2018-04-26

    Flaviviruses such as dengue (DENV), yellow fever (YFV), West Nile (WNV), and Zika (ZIKV) are human pathogens of global significance. In particular, DENV causes the most prevalent mosquito-borne viral diseases in humans, and ZIKV emerged from obscurity into the spotlight in 2016 as the etiologic agent of congenital Zika syndrome. Owing to the recent emergence of ZIKV as a global pandemic threat, the roles of the immune system during ZIKV infections are as yet unclear. In contrast, decades of DENV research implicate a dual role for the immune system in protection against and pathogenesis of DENV infection. As DENV and ZIKV are closely related, knowledge based on DENV studies has been used to prioritize investigation of ZIKV immunity and pathogenesis, and to accelerate ZIKV diagnostic, therapeutic, and vaccine design. This review discusses the following topics related to innate and adaptive immune responses to DENV and ZIKV: the interferon system as the key mechanism of host defense and viral target for immune evasion, antibody-mediated protection versus antibody-dependent enhancement, and T cell-mediated protection versus original T cell antigenic sin. Understanding the mechanisms that regulate the balance between immune-mediated protection and pathogenesis during DENV and ZIKV infections is critical toward development of safe and effective DENV and ZIKV therapeutics and vaccines.

  11. Landing response of Aedes (Stegomyia) polynesiensis mosquitoes to coloured targets.

    PubMed

    Chambers, E W; Bossin, H C; Ritchie, S A; Russell, R C; Dobson, S L

    2013-09-01

    Aedes polynesiensis Marks (Diptera: Culicidae) is the primary vector of lymphatic filariasis (LF) in the island countries and territories of the South Pacific. In the development of a novel control tool, the response of Ae. polynesiensis to six different colours (three solid fabrics, two patterned fabrics and a plastic tarp) was measured using a digital photographic system. Adult mosquitoes were placed into an environmental chamber and allowed to choose between a white target and one of six experimental targets. Mosquito landing frequency and landing duration were calculated. Adult female Ae. polynesiensis preferred all of the experimental targets to the white control target. Mosquito landing frequency was highest for the solid targets (black, navy blue and red) followed in turn by the two colour pattern targets and the polyethylene target. Mosquito landing duration was greater for experimental targets when compared with white control targets. Mosquito landing frequencies did not change over time during the course of the assay. The response of male Ae. polynesiensis was also measured when exposed to a 100% cotton black target. Male mosquitoes preferred the black target to the white control target, although at levels lower than that observed in female mosquitoes. The results suggest that future investigations evaluating the visual responses of Ae. polynesiensis mosquitoes are warranted, with a special emphasis on semi-field and field-based experiments. © 2013 The Royal Entomological Society.

  12. Repertoire of virus-derived small RNAs produced by mosquito and mammalian cells in response to dengue virus infection.

    PubMed

    Schirtzinger, Erin E; Andrade, Christy C; Devitt, Nicholas; Ramaraj, Thiruvarangan; Jacobi, Jennifer L; Schilkey, Faye; Hanley, Kathryn A

    2015-02-01

    RNA interference (RNAi) is the major defense of many arthropods against arthropod-borne RNA viruses (arboviruses), but the role of RNAi in vertebrate immunity to arboviruses is not clear. RNA viruses can trigger RNAi in vertebrate cells, but the vertebrate interferon response may obscure this interaction. We quantified virus-derived small RNAs (vRNAs) generated by mosquito (U4.4) cells and interferon-deficient (Vero) and interferon-competent (HuH-7) mammalian cells infected with a single isolate of mosquito-borne dengue virus. Mosquito cells produced significantly more vRNAs than mammalian cells, and mosquito cell vRNAs were derived from both the positive- and negative-sense dengue genomes whereas mammalian cell vRNAs were derived primarily from positive-sense genome. Mosquito cell vRNAs were predominantly 21 nucleotides in length whereas mammalian cell vRNAs were between 12 and 36 nucleotides with a modest peak at 24 nucleotides. Hot-spots, regions of the virus genome that generated a disproportionate number of vRNAs, overlapped among the cell lines. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Exotic mosquito threats require strategic surveillance and response planning.

    PubMed

    Webb, Cameron E; Doggett, Stephen L

    2016-12-14

    Mosquito-borne diseases caused by endemic pathogens such as Ross River, Barmah Forest and Murray Valley encephalitis viruses are an annual concern in New South Wales (NSW), Australia. More than a dozen mosquito species have been implicated in the transmission of these pathogens, with each mosquito occupying a specialised ecological niche that influences their habitat associations, host feeding preferences and the environmental drivers of their abundance. The NSW Arbovirus Surveillance and Mosquito Monitoring Program provides an early warning system for potential outbreaks of mosquito-borne disease by tracking annual activity of these mosquitoes and their associated pathogens. Although the program will effectively track changes in local mosquito populations that may increase with a changing climate, urbanisation and wetland rehabilitation, it will be less effective with current surveillance methodologies at detecting or monitoring changes in exotic mosquito threats, where different surveillance strategies need to be used. Exotic container-inhabiting mosquitoes such as Aedes aegypti and Ae. albopictus pose a threat to NSW because they are nuisance-biting pests and vectors of pathogens such as dengue, chikungunya and Zika viruses. International movement of humans and their belongings have spread these mosquitoes to many regions of the world. In recent years, these two mosquitoes have been detected by the Australian Government Department of Agriculture and Water Resources at local airports and seaports. To target the detection of these exotic mosquitoes, new trapping technologies and networks of surveillance locations are required. Additionally, incursions of these mosquitoes into urban areas of the state will require strategic responses to minimise substantial public health and economic burdens to local communities.

  14. The Immune Responses of the Animal Hosts of West Nile Virus: A Comparison of Insects, Birds, and Mammals.

    PubMed

    Ahlers, Laura R H; Goodman, Alan G

    2018-01-01

    Vector-borne diseases, including arboviruses, pose a serious threat to public health worldwide. Arboviruses of the flavivirus genus, such as Zika virus (ZIKV), dengue virus, yellow fever virus (YFV), and West Nile virus (WNV), are transmitted to humans from insect vectors and can cause serious disease. In 2017, over 2,000 reported cases of WNV virus infection occurred in the United States, with two-thirds of cases classified as neuroinvasive. WNV transmission cycles through two different animal populations: birds and mosquitoes. Mammals, particularly humans and horses, can become infected through mosquito bites and represent dead-end hosts of WNV infection. Because WNV can infect diverse species, research on this arbovirus has investigated the host response in mosquitoes, birds, humans, and horses. With the growing geographical range of the WNV mosquito vector and increased human exposure, improved surveillance and treatment of the infection will enhance public health in areas where WNV is endemic. In this review, we survey the bionomics of mosquito species involved in Nearctic WNV transmission. Subsequently, we describe the known immune response pathways that counter WNV infection in insects, birds, and mammals, as well as the mechanisms known to curb viral infection. Moreover, we discuss the bacterium Wolbachia and its involvement in reducing flavivirus titer in insects. Finally, we highlight the similarities of the known immune pathways and identify potential targets for future studies aimed at improving antiviral therapeutic and vaccination design.

  15. Battling the Bite: Tradeoffs in Immunity to Insect-Borne Pathogens.

    PubMed

    Schneider, David Samuel

    2016-06-21

    Effective pathogens are successful, by definition, because they can defeat our immune response. Pingen et al. (2016) in this issue of Immunity demonstrate that some mosquito-transmitted viruses depend upon a strong host immune response triggered by the innate immune response to the bite to promote dissemination through the body. Copyright © 2016. Published by Elsevier Inc.

  16. Relationship between exposure to vector bites and antibody responses to mosquito salivary gland extracts.

    PubMed

    Fontaine, Albin; Pascual, Aurélie; Orlandi-Pradines, Eve; Diouf, Ibrahima; Remoué, Franck; Pagès, Frédéric; Fusaï, Thierry; Rogier, Christophe; Almeras, Lionel

    2011-01-01

    Mosquito-borne diseases are major health problems worldwide. Serological responses to mosquito saliva proteins may be useful in estimating individual exposure to bites from mosquitoes transmitting these diseases. However, the relationships between the levels of these IgG responses and mosquito density as well as IgG response specificity at the genus and/or species level need to be clarified prior to develop new immunological markers to assess human/vector contact. To this end, a kinetic study of antibody levels against several mosquito salivary gland extracts from southeastern French individuals living in three areas with distinct ecological environments and, by implication, distinct Aedes caspius mosquito densities were compared using ELISA. A positive association was observed between the average levels of IgG responses against Ae. caspius salivary gland extracts and spatial Ae. caspius densities. Additionally, the average level of IgG responses increased significantly during the peak exposure to Ae. caspius at each site and returned to baseline four months later, suggesting short-lived IgG responses. The species-specificity of IgG antibody responses was determined by testing antibody responses to salivary gland extracts from Cx. pipiens, a mosquito that is present at these three sites at different density levels, and from two other Aedes species not present in the study area (Ae. aegypti and Ae. albopictus). The IgG responses observed against these mosquito salivary gland extracts contrasted with those observed against Ae. caspius salivary gland extracts, supporting the existence of species-specific serological responses. By considering different populations and densities of mosquitoes linked to environmental factors, this study shows, for the first time, that specific IgG antibody responses against Ae. caspius salivary gland extracts may be related to the seasonal and geographical variations in Ae. caspius density. Characterisation of such immunological

  17. Relationship between Exposure to Vector Bites and Antibody Responses to Mosquito Salivary Gland Extracts

    PubMed Central

    Orlandi-Pradines, Eve; Diouf, Ibrahima; Remoué, Franck; Pagès, Frédéric; Fusaï, Thierry; Rogier, Christophe; Almeras, Lionel

    2011-01-01

    Mosquito-borne diseases are major health problems worldwide. Serological responses to mosquito saliva proteins may be useful in estimating individual exposure to bites from mosquitoes transmitting these diseases. However, the relationships between the levels of these IgG responses and mosquito density as well as IgG response specificity at the genus and/or species level need to be clarified prior to develop new immunological markers to assess human/vector contact. To this end, a kinetic study of antibody levels against several mosquito salivary gland extracts from southeastern French individuals living in three areas with distinct ecological environments and, by implication, distinct Aedes caspius mosquito densities were compared using ELISA. A positive association was observed between the average levels of IgG responses against Ae. caspius salivary gland extracts and spatial Ae. caspius densities. Additionally, the average level of IgG responses increased significantly during the peak exposure to Ae. caspius at each site and returned to baseline four months later, suggesting short-lived IgG responses. The species-specificity of IgG antibody responses was determined by testing antibody responses to salivary gland extracts from Cx. pipiens, a mosquito that is present at these three sites at different density levels, and from two other Aedes species not present in the study area (Ae. aegypti and Ae. albopictus). The IgG responses observed against these mosquito salivary gland extracts contrasted with those observed against Ae. caspius salivary gland extracts, supporting the existence of species-specific serological responses. By considering different populations and densities of mosquitoes linked to environmental factors, this study shows, for the first time, that specific IgG antibody responses against Ae. caspius salivary gland extracts may be related to the seasonal and geographical variations in Ae. caspius density. Characterisation of such immunological

  18. Zika virus vaccines: immune response, current status, and future challenges.

    PubMed

    Richner, Justin M; Diamond, Michael S

    2018-05-09

    Zika virus (ZIKV) is the most recent mosquito-transmitted virus to cause a global health crisis following its entrance into a naïve population in the Western Hemisphere. Once the ZIKV outbreak began investigators rapidly established small and large animal models of pathogenesis, developed a number candidate vaccines using different platforms, and defined mechanisms of protection. In this review, we characterize the adaptive immune response elicited by ZIKV infections and vaccines, the status of ongoing clinical trials in humans, and discuss future challenges within the field. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus

    PubMed Central

    Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

    2017-01-01

    BACKGROUND Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. OBJECTIVES Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). METHODS Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. FINDINGS The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. MAIN CONCLUSIONS These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions. PMID:29211244

  20. Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus.

    PubMed

    Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

    2017-12-01

    Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions.

  1. Immune response

    MedlinePlus

    Innate immunity; Humoral immunity; Cellular immunity; Immunity; Inflammatory response; Acquired (adaptive) immunity ... normal and usually does not react against them. INNATE IMMUNITY Innate, or nonspecific, immunity is the defense ...

  2. Global Transcriptome Analysis of Aedes aegypti Mosquitoes in Response to Zika Virus Infection

    PubMed Central

    Etebari, Kayvan; Hegde, Shivanand; Saldaña, Miguel A.; Widen, Steven G.; Wood, Thomas G.

    2017-01-01

    ABSTRACT Zika virus (ZIKV) of the Flaviviridae family is a recently emerged mosquito-borne virus that has been implicated in the surge of the number of microcephaly instances in South America. The recent rapid spread of the virus led to its declaration as a global health emergency by the World Health Organization. The virus is transmitted mainly by the mosquito Aedes aegypti, which is also the vector of dengue virus; however, little is known about the interactions of the virus with the mosquito vector. In this study, we investigated the transcriptome profiles of whole A. aegypti mosquitoes in response to ZIKV infection at 2, 7, and 14 days postinfection using transcriptome sequencing. Results showed changes in the abundance of a large number of transcripts at each time point following infection, with 18 transcripts commonly changed among the three time points. Gene ontology analysis revealed that most of the altered genes are involved in metabolic processes, cellular processes, and proteolysis. In addition, 486 long intergenic noncoding RNAs that were altered upon ZIKV infection were identified. Further, we found changes of a number of potential mRNA target genes correlating with those of altered host microRNAs. The outcomes provide a basic understanding of A. aegypti responses to ZIKV and help to determine host factors involved in replication or mosquito host antiviral response against the virus. IMPORTANCE Vector-borne viruses pose great risks to human health. Zika virus has recently emerged as a global threat, rapidly expanding its distribution. Understanding the interactions of the virus with mosquito vectors at the molecular level is vital for devising new approaches in inhibiting virus transmission. In this study, we embarked on analyzing the transcriptional response of Aedes aegypti mosquitoes to Zika virus infection. Results showed large changes in both coding and long noncoding RNAs. Analysis of these genes showed similarities with other flaviviruses

  3. Global Transcriptome Analysis of Aedes aegypti Mosquitoes in Response to Zika Virus Infection.

    PubMed

    Etebari, Kayvan; Hegde, Shivanand; Saldaña, Miguel A; Widen, Steven G; Wood, Thomas G; Asgari, Sassan; Hughes, Grant L

    2017-01-01

    Zika virus (ZIKV) of the Flaviviridae family is a recently emerged mosquito-borne virus that has been implicated in the surge of the number of microcephaly instances in South America. The recent rapid spread of the virus led to its declaration as a global health emergency by the World Health Organization. The virus is transmitted mainly by the mosquito Aedes aegypti , which is also the vector of dengue virus; however, little is known about the interactions of the virus with the mosquito vector. In this study, we investigated the transcriptome profiles of whole A. aegypti mosquitoes in response to ZIKV infection at 2, 7, and 14 days postinfection using transcriptome sequencing. Results showed changes in the abundance of a large number of transcripts at each time point following infection, with 18 transcripts commonly changed among the three time points. Gene ontology analysis revealed that most of the altered genes are involved in metabolic processes, cellular processes, and proteolysis. In addition, 486 long intergenic noncoding RNAs that were altered upon ZIKV infection were identified. Further, we found changes of a number of potential mRNA target genes correlating with those of altered host microRNAs. The outcomes provide a basic understanding of A. aegypti responses to ZIKV and help to determine host factors involved in replication or mosquito host antiviral response against the virus. IMPORTANCE Vector-borne viruses pose great risks to human health. Zika virus has recently emerged as a global threat, rapidly expanding its distribution. Understanding the interactions of the virus with mosquito vectors at the molecular level is vital for devising new approaches in inhibiting virus transmission. In this study, we embarked on analyzing the transcriptional response of Aedes aegypti mosquitoes to Zika virus infection. Results showed large changes in both coding and long noncoding RNAs. Analysis of these genes showed similarities with other flaviviruses, including

  4. Regulation of the Immune Response to α-Gal and Vector-borne Diseases.

    PubMed

    Cabezas-Cruz, Alejandro; Mateos-Hernández, Lourdes; Pérez-Cruz, Magdiel; Valdés, James J; Mera, Isabel G Fernández de; Villar, Margarita; de la Fuente, José

    2015-10-01

    Vector-borne diseases (VBD) challenge our understanding of emerging diseases. Recently, arthropod vectors have been involved in emerging anaphylactic diseases. In particular, the immunoglobulin E (IgE) antibody response to the carbohydrate Galα1-3Galβ1-(3)4GlcNAc-R (α-gal) following a tick bite was associated with allergies to red meat, cetuximab, and gelatin. By contrast, an anti-α-gal IgM antibody response was shown to protect against mosquito-borne malaria. Herein, we highlight the interplay between the gut microbiota, vectors, transmitted pathogens, and the regulation of the immune response as a model to understand the protective or allergic effect of α-gal. Establishing the source of α-gal in arthropod vectors and the immune response to vector bites and transmitted pathogens will be essential for diagnosing, treating, and ultimately preventing these emerging anaphylactic and other vector-borne diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Systems analysis of protective immune responses to RTS,S malaria vaccination in humans

    PubMed Central

    Kazmin, Dmitri; Nakaya, Helder I.; Lee, Eva K.; Johnson, Matthew J.; van der Most, Robbert; van den Berg, Robert A.; Ballou, W. Ripley; Jongert, Erik; Wille-Reece, Ulrike; Ockenhouse, Christian; Aderem, Alan; Zak, Daniel E.; Sadoff, Jerald; Hendriks, Jenny; Wrammert, Jens; Ahmed, Rafi; Pulendran, Bali

    2017-01-01

    RTS,S is an advanced malaria vaccine candidate and confers significant protection against Plasmodium falciparum infection in humans. Little is known about the molecular mechanisms driving vaccine immunity. Here, we applied a systems biology approach to study immune responses in subjects receiving three consecutive immunizations with RTS,S (RRR), or in those receiving two immunizations of RTS,S/AS01 following a primary immunization with adenovirus 35 (Ad35) (ARR) vector expressing circumsporozoite protein. Subsequent controlled human malaria challenge (CHMI) of the vaccinees with Plasmodium-infected mosquitoes, 3 wk after the final immunization, resulted in ∼50% protection in both groups of vaccinees. Circumsporozoite protein (CSP)-specific antibody titers, prechallenge, were associated with protection in the RRR group. In contrast, ARR-induced lower antibody responses, and protection was associated with polyfunctional CD4+ T-cell responses 2 wk after priming with Ad35. Molecular signatures of B and plasma cells detected in PBMCs were highly correlated with antibody titers prechallenge and protection in the RRR cohort. In contrast, early signatures of innate immunity and dendritic cell activation were highly associated with protection in the ARR cohort. For both vaccine regimens, natural killer (NK) cell signatures negatively correlated with and predicted protection. These results suggest that protective immunity against P. falciparum can be achieved via multiple mechanisms and highlight the utility of systems approaches in defining molecular correlates of protection to vaccination. PMID:28193898

  6. Aedes mosquito saliva modulates Rift Valley fever virus pathogenicity.

    PubMed

    Le Coupanec, Alain; Babin, Divya; Fiette, Laurence; Jouvion, Grégory; Ave, Patrick; Misse, Dorothee; Bouloy, Michèle; Choumet, Valerie

    2013-01-01

    Rift Valley fever (RVF) is a severe mosquito-borne disease affecting humans and domestic ruminants. Mosquito saliva contains compounds that counteract the hemostatic, inflammatory, and immune responses of the host. Modulation of these defensive responses may facilitate virus infection. Indeed, Aedes mosquito saliva played a crucial role in the vector's capacity to effectively transfer arboviruses such as the Cache Valley and West Nile viruses. The role of mosquito saliva in the transmission of Rift Valley fever virus (RVFV) has not been investigated. Using a murine model, we explored the potential for mosquitoes to impact the course of RVF disease by determining whether differences in pathogenesis occurred in the presence or absence of mosquito saliva and salivary gland extract. C57BL/6NRJ male mice were infected with the ZH548 strain of RVFV via intraperitoneal or intradermal route, or via bites from RVFV-exposed mosquitoes. The virus titers in mosquitoes and mouse organs were determined by plaque assays. After intraperitoneal injection, RVFV infection primarily resulted in liver damage. In contrast, RVFV infection via intradermal injection caused both liver and neurological symptoms and this route best mimicked the natural infection by mosquitoes. Co-injections of RVFV with salivary gland extract or saliva via intradermal route increased the mortality rates of mice, as well as the virus titers measured in several organs and in the blood. Furthermore, the blood cell counts of infected mice were altered compared to those of uninfected mice. Different routes of infection determine the pattern in which the virus spreads and the organs it targets. Aedes saliva significantly increases the pathogenicity of RVFV.

  7. Drinking a hot blood meal elicits a protective heat shock response in mosquitoes.

    PubMed

    Benoit, Joshua B; Lopez-Martinez, Giancarlo; Patrick, Kevin R; Phillips, Zachary P; Krause, Tyler B; Denlinger, David L

    2011-05-10

    The mosquito's body temperature increases dramatically when it takes a blood meal from a warm-blooded, vertebrate host. By using the yellow fever mosquito, Aedes aegypti, we demonstrate that this boost in temperature following a blood meal prompts the synthesis of heat shock protein 70 (Hsp70). This response, elicited by the temperature of the blood meal, is most robust in the mosquito's midgut. When RNA interference is used to suppress expression of hsp70, protein digestion of the blood meal is impaired, leading to production of fewer eggs. We propose that Hsp70 protects the mosquito midgut from the temperature stress incurred by drinking a hot blood meal. Similar increases in hsp70 were documented immediately after blood feeding in two other mosquitoes (Culex pipiens and Anopheles gambiae) and the bed bug, Cimex lectularius, suggesting that this is a common protective response in blood-feeding arthropods.

  8. Countering a bioterrorist introduction of pathogen-infected mosquitoes through mosquito control.

    PubMed

    Tabachnick, Walter J; Harvey, William R; Becnel, James J; Clark, Gary G; Connelly, C Roxanne; Day, Jonathan F; Linser, Paul J; Linthicum, Kenneth J

    2011-06-01

    The release of infected mosquitoes or other arthropods by bioterrorists, i.e., arboterrorism, to cause disease and terror is a threat to the USA. A workshop to assess mosquito control response capabilities to mount rapid and effective responses to eliminate an arboterrorism attack provided recommendations to improve capabilities in the USA. It is essential that mosquito control professionals receive training in possible responses, and it is recommended that a Council for Emergency Mosquito Control be established in each state to coordinate training, state resources, and actions for use throughout the state.

  9. A model for the coevolution of immunity and immune evasion in vector-borne diseases with implications for the epidemiology of malaria.

    PubMed

    Koella, Jacob C; Boëte, C

    2003-05-01

    We describe a model of host-parasite coevolution, where the interaction depends on the investments by the host in its immune response and by the parasite in its ability to suppress (or evade) its host's immune response. We base our model on the interaction between malaria parasites and their mosquito hosts and thus describe the epidemiological dynamics with the Macdonald-Ross equation of malaria epidemiology. The qualitative predictions of the model are most sensitive to the cost of the immune response and to the intensity of transmission. If transmission is weak or the cost of immunity is low, the system evolves to a coevolutionarily stable equilibrium at intermediate levels of investment (and, generally, at a low frequency of resistance). At a higher cost of immunity and as transmission intensifies, the system is not evolutionarily stable but rather cycles around intermediate levels of investment. At more intense transmission, neither host nor parasite invests any resources in dominating its partner so that no resistance is observed in the population. These results may help to explain the lack of encapsulated malaria parasites generally observed in natural populations of mosquito vectors, despite strong selection pressure for resistance in areas of very intense transmission.

  10. Mosquito Vectors and the Globalization of Plasmodium falciparum Malaria.

    PubMed

    Molina-Cruz, Alvaro; Zilversmit, Martine M; Neafsey, Daniel E; Hartl, Daniel L; Barillas-Mury, Carolina

    2016-11-23

    Plasmodium falciparum malaria remains a devastating public health problem. Recent discoveries have shed light on the origin and evolution of Plasmodium parasites and their interactions with their vertebrate and mosquito hosts. P. falciparum malaria originated in Africa from a single horizontal transfer between an infected gorilla and a human, and became global as the result of human migration. Today, P. falciparum malaria is transmitted worldwide by more than 70 different anopheline mosquito species. Recent studies indicate that the mosquito immune system can be a barrier to malaria transmission and that the P. falciparum Pfs47 gene allows the parasite to evade mosquito immune detection. Here, we review the origin and globalization of P. falciparum and integrate this history with analysis of the biology, evolution, and dispersal of the main mosquito vectors. This new perspective broadens our understanding of P. falciparum population structure and the dispersal of important parasite genetic traits.

  11. Malaria immunity in man and mosquito: insights into unsolved mysteries of a deadly infectious disease

    PubMed Central

    Crompton, Peter D.; Moebius, Jacqueline; Portugal, Silvia; Waisberg, Michael; Hart, Geoffrey; Garver, Lindsey S.; Miller, Louis H.; Barillas, Carolina; Pierce, Susan K.

    2014-01-01

    Malaria is a mosquito-borne disease caused by parasites of the obligate intracellular Apicomplexa family, the most deadly of which, Plasmodium falciparum, prevails in Africa. Malaria imposes a huge health burden on the world’s most vulnerable populations, claiming the lives of nearly a million children and pregnant women each year in Africa alone. Although there is keen interest in eradicating malaria, we do not yet have the necessary tools to meet this challenge, including an effective malaria vaccine and adequate vector control strategies. Here we review what is known about the mechanisms at play in immune resistance to malaria in both the human and mosquito hosts at each step in the parasite’s complex life cycle with a view towards developing the tools that will contribute to the prevention of disease and death and ultimately the goal of malaria eradication. In so doing we hope to inspire immunologists to participate in defeating this devastating disease. PMID:24655294

  12. Behavioral Response of Aedes aegypti Mosquito towards Essential Oils Using Olfactometer

    PubMed Central

    Uniyal, Ashish; Tikar, Sachin N; Mendki, Murlidhar J; Singh, Ram; Shukla, Shakti V; Agrawal, Om P; Veer, Vijay; Sukumaran, Devanathan

    2016-01-01

    Background: Aedes aegypti mosquito is responsible for transmitting human diseases like dengue and chikungunya. Personal or space protection with insect repellents is a practical approach to reducing human mosquito contact, thereby minimizing disease transmission. Essential oils are natural volatile substances from plants used as protective measure against blood-sucking mosquitoes. Methods: Twenty-three essential oils were evaluated for their repellent effect against Ae. aegypti female mosquito in laboratory conditions using Y-tube olfactometer. Results: The essential oils exhibited varying degree of repellency. Litsea oil showed 50.31%, 60.2 %, and 77.26% effective mean repellency at 1 ppm, 10 ppm and 100 ppm respectively, while DEET exhibited 59.63%, 68.63%, 85.48% and DEPA showed 57.97%, 65.43%, and 80.62% repellency at respective above concentrations. Statistical analysis revealed that among the tested essential oils, litsea oil had effective repellency in comparison with DEET and DEPA against Ae. aegypti mosquito at all concentration. Essential oils, DEET and DEPA showed significant repellence against Ae. aegypti (P< 0.05) at all 3 concentration tested. Conclusion: Litsea oil exhibited effective percentage repellency similar to DEET and DEPA. The essential oils are natural plant products that may be useful for developing safer and newer herbal based effective mosquito repellents. PMID:27308295

  13. Zika virus alters the microRNA expression profile and elicits an RNAi response in Aedes aegypti mosquitoes

    PubMed Central

    Hart, Charles E.; Widen, Steven G.; Wood, Thomas G.; Thangamani, Saravanan; Asgari, Sassan

    2017-01-01

    Zika virus (ZIKV), a flavivirus transmitted primarily by Aedes aegypti, has recently spread globally in an unprecedented fashion, yet we have a poor understanding of host-microbe interactions in this system. To gain insights into the interplay between ZIKV and the mosquito, we sequenced the small RNA profiles in ZIKV-infected and non-infected Ae. aegypti mosquitoes at 2, 7 and 14 days post-infection. ZIKA induced an RNAi response in the mosquito with virus-derived short interfering RNAs and PIWI-interacting RNAs dramatically increased in abundance post-infection. Further, we found 17 host microRNAs (miRNAs) that were modulated by ZIKV infection at all time points. Strikingly, many of these regulated miRNAs have been reported to have their expression altered by dengue and West Nile viruses, while the response was divergent from that induced by the alphavirus Chikungunya virus in mosquitoes. This suggests that conserved miRNA responses occur within mosquitoes in response to flavivirus infection. This study expands our understanding of ZIKV-vector interactions and provides potential avenues to be further investigated to target ZIKV in the mosquito host. PMID:28715413

  14. Behavioral and electroantennographic responses of the tea mosquito, Helopeltis theivora, to female sex pheromones.

    PubMed

    Sachin, James P; Selvasundaram, R; Babu, A; Muraleedharan, N

    2008-12-01

    Responses of the tea mosquito, Helopeltis theivora (Waterhouse) (Hemiptera: Miridae), a major pest of tea, to female sex pheromone compounds were measured using wind tunnel and electroantennogram (EAG) bioassays. In the wind tunnel, male tea mosquitoes were found to be most attracted to a dichloromethane extract of the female thorax. Gas chromatography-mass spectrometry (GC-MS) analysis of female thoracic extracts and dynamic head space samples of virgin females showed the presence of five compounds: (Z)-3 hexenyl acetate, (Z)-3 hexenyl butanoate, (E)-2 hexenyl pentanoate, 2,4 dimethyl pentanal, and (E)-2-hexenol. Male tea mosquitoes were attracted to blends of (Z)-3 hexenyl acetate and (E)-2-hexenol in the wind tunnel with a 1:5 ratio eliciting the greatest response. EAG recordings of male antenna confirmed the ability of this blend to evoke antennal responses in male insects. Similarly active EAG responses were recorded toward female thoracic extract and a blend of (Z)-3 hexenyl acetate and (E)-2-hexenol. Behavioral responses of adult males are mediated by a blend of volatile female sex pheromone compounds, (Z)-3 hexenyl acetate and (E)-2-hexenol, at a ratio of 1:5. This female sex pheromone blend may be useful for tea mosquito control and management programs.

  15. Mosquito Bite Delivery of Dengue Virus Enhances Immunogenicity and Pathogenesis in Humanized Mice

    PubMed Central

    Cox, Jonathan; Mota, Javier; Sukupolvi-Petty, Soila; Diamond, Michael S.

    2012-01-01

    Dengue viruses (DENV) are transmitted to humans by the bite of Aedes aegypti or Aedes albopictus mosquitoes, with millions of infections annually in over 100 countries. The diseases they produce, which occur exclusively in humans, are dengue fever (DF) and dengue hemorrhagic fever (DHF). We previously developed a humanized mouse model of DF in which mice transplanted with human hematopoietic stem cells produced signs of DENV disease after injection with low-passage, wild-type isolates. Using these mice, but now allowing infected A. aegypti to transmit dengue virus during feeding, we observed signs of more severe disease (higher and more sustained viremia, erythema, and thrombocytopenia). Infected mice mounted innate (gamma interferon [IFN-γ] and soluble interleukin 2 receptor alpha [sIL-2Rα]) and adaptive (anti-DENV antibodies) immune responses that failed to clear viremia until day 56, while a mosquito bite alone induced strong immunomodulators (tumor necrosis factor alpha [TNF-α], IL-4, and IL-10) and thrombocytopenia. This is the first animal model that allows an evaluation of human immunity to DENV infection after mosquito inoculation. PMID:22573866

  16. The role of hemocytes in A. gambiae antiplasmodial immunity

    PubMed Central

    Ramirez, Jose Luis; Garver, Lindsey S.; Brayner, Fábio André; Alves, Luiz Carlos; Rodrigues, Janneth; Molina-Cruz, Alvaro; Barillas-Mury, Carolina

    2013-01-01

    Hemocytes synthesize key components of the mosquito complement-like system, but their role in the activation of antiplasmodial responses has not been established. The effect of activating Toll signaling in hemocytes on Plasmodium survival was investigated by transferring hemocytes or cell-free hemolymph from donor mosquitoes in which the suppressor cactus was silenced. These transfers greatly enhanced antiplasmodial immunity, indicating that hemocytes are active players in the activation of the complement-like system, through an effector(s) regulated by the Toll pathway. A comparative analysis of hemocyte populations between susceptible (S) G3 and the refractory (R) L3-5 A. gambiae mosquito strains did not reveal significant differences under basal conditions or in response to Plasmodium berghei infection. The response of S mosquitoes to different Plasmodium species revealed similar kinetics following infection with P. berghei, P. yoelii or P. falciparum, but the strength of the priming response was stronger in less compatible mosquito-parasite pairs. The Toll, Imd, STAT or JNK signaling cascades were not essential for the production of hemocyte differentiation factor (HDF) in response to P. berghei infection, but disruption of Toll, STAT or JNK abolished hemocyte differentiation in response to HDF. We conclude that hemocytes are key mediators of A. gambiae antiplasmodial responses. PMID:23886925

  17. Natural Mosquito-Pathogen Hybrid IgG4 Antibodies in Vector-Borne Diseases: A Hypothesis.

    PubMed

    Londono-Renteria, Berlin; Cardenas, Jenny C; Troupin, Andrea; Colpitts, Tonya M

    2016-01-01

    Chronic exposure to antigens may favor the production of IgG4 antibodies over other antibody types. Recent studies have shown that up to a 30% of normal human IgG4 is bi-specific and is able to recognize two antigens of different nature. A requirement for this specificity is the presence of both eliciting antigens in the same time and at the same place where the immune response is induced. During transmission of most vector-borne diseases, the pathogen is delivered to the vertebrate host along with the arthropod saliva during blood feeding and previous studies have shown the existence of IgG4 antibodies against mosquito salivary allergens. However, there is very little ongoing research or information available regarding IgG4 bi-specificity with regard to infectious disease, particularly during immune responses to vector-borne diseases, such as malaria, filariasis, or dengue virus infection. Here, we provide background information and present our hypothesis that IgG4 may not only be a useful tool to measure exposure to infected mosquito bites, but that these bi-specific antibodies may also play an important role in modulation of the immune response against malaria and other vector-borne diseases in endemic settings.

  18. Zika, dengue and yellow fever viruses induce differential anti-viral immune responses in human monocytic and first trimester trophoblast cells.

    PubMed

    Luo, Huanle; Winkelmann, Evandro R; Fernandez-Salas, Ildefonso; Li, Li; Mayer, Sandra V; Danis-Lozano, Rogelio; Sanchez-Casas, Rosa Ma; Vasilakis, Nikos; Tesh, Robert; Barrett, Alan D; Weaver, Scott C; Wang, Tian

    2018-03-01

    Zika virus (ZIKV) is a mosquito-borne flavivirus associated with severe neonatal birth defects, but the causative mechanism is incompletely understood. ZIKV shares sequence homology and early clinical manifestations with yellow fever virus (YFV) and dengue virus (DENV) and are all transmitted in urban cycles by the same species of mosquitoes. However, YFV and DENV have been rarely reported to cause congenital diseases. Here, we compared infection with a contemporary ZIKV strain (FSS13025) to YFV17D and DENV-4 in human monocytic cells (THP-1) and first-trimester trophoblasts (HTR-8). Our results suggest that all three viruses have similar tropisms for both cells. Nevertheless, ZIKV induced strong type 1 IFN and inflammatory cytokine and chemokine production in monocytes and peripheral blood mononuclear cells. Furthermore, ZIKV infection in trophoblasts induced lower IFN and higher inflammatory immune responses. Placental inflammation is known to contribute to the risk of brain damage in preterm newborns. Inhibition of toll-like receptor (TLR)3 and TLR8 each abrogated the inflammatory cytokine responses in ZIKV-infected trophoblasts. Our findings identify a potential link between maternal immune activation and ZIKV-induced congenital diseases, and a potential therapeutic strategy that targets TLR-mediated inflammatory responses in the placenta. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Exome and Transcriptome Sequencing of Aedes aegypti Identifies a Locus That Confers Resistance to Brugia malayi and Alters the Immune Response

    PubMed Central

    Juneja, Punita; Ariani, Cristina V.; Ho, Yung Shwen; Akorli, Jewelna; Palmer, William J.; Pain, Arnab; Jiggins, Francis M.

    2015-01-01

    Many mosquito species are naturally polymorphic for their abilities to transmit parasites, a feature which is of great interest for controlling vector-borne disease. Aedes aegypti, the primary vector of dengue and yellow fever and a laboratory model for studying lymphatic filariasis, is genetically variable for its capacity to harbor the filarial nematode Brugia malayi. The genome of Ae. aegypti is large and repetitive, making genome resequencing difficult and expensive. We designed exome captures to target protein-coding regions of the genome, and used association mapping in a wild Kenyan population to identify a single, dominant, sex-linked locus underlying resistance. This falls in a region of the genome where a resistance locus was previously mapped in a line established in 1936, suggesting that this polymorphism has been maintained in the wild for the at least 80 years. We then crossed resistant and susceptible mosquitoes to place both alleles of the gene into a common genetic background, and used RNA-seq to measure the effect of this locus on gene expression. We found evidence for Toll, IMD, and JAK-STAT pathway activity in response to early stages of B. malayi infection when the parasites are beginning to die in the resistant genotype. We also found that resistant mosquitoes express anti-microbial peptides at the time of parasite-killing, and that this expression is suppressed in susceptible mosquitoes. Together, we have found that a single resistance locus leads to a higher immune response in resistant mosquitoes, and we identify genes in this region that may be responsible for this trait. PMID:25815506

  20. Malaria vaccines and human immune responses.

    PubMed

    Long, Carole A; Zavala, Fidel

    2016-08-01

    Despite reductions in malaria episodes and deaths over the past decade, there is still significant need for more effective tools to combat this serious global disease. The positive results with the Phase III trial of RTS,S directed to the circumsporozoite protein of Plasmodium falciparum have established that a vaccine against malaria can provide partial protection to children in endemic areas, but its limited efficacy and relatively short window of protection mandate that new generations of more efficacious vaccines must be sought. Evidence shows that anti-parasite immune responses can control infection against other stages as well, but translating these experimental findings into vaccines for blood stages has been disappointing and clinical efforts to test a transmission blocking vaccine are just beginning. Difficulties include the biological complexity of the organism with a large array of stage-specific genes many of which in the erythrocytic stages are antigenically diverse. In addition, it appears necessary to elicit high and long-lasting antibody titers, address the redundant pathways of merozoite invasion, and still seek surrogate markers of protective immunity. Most vaccine studies have focused on a single or a few antigens with an apparent functional role, but this is likely to be too restrictive, and broad, multi-antigen, multi-stage vaccines need further investigation. Finally, novel tools and biological insights involving parasite sexual stages and the mosquito vector will provide new avenues for reducing or blocking malaria transmission. Published by Elsevier Ltd.

  1. Newer Vaccines against Mosquito-borne Diseases.

    PubMed

    Aggarwal, Anju; Garg, Neha

    2018-02-01

    Mosquitos are responsible for a number of protozoal and viral diseases. Malaria, dengue, Japanese encephalitis (JE) and chikungunya epidemics occur commonly all over the world, leading to marked mortality and morbidity in children. Zika, Yellow fever and West Nile fever are others requiring prevention. Environmental control and mosquito bite prevention are useful in decreasing the burden of disease but vaccination has been found to be most cost-effective and is the need of the hour. RTS,S/AS01 vaccine is the first malaria vaccine being licensed for use against P. falciparum malaria. Dengvaxia (CYD-TDV) against dengue was licensed first in Mexico in 2015. A Vero-cell derived, inactivated and alum-adjuvanted JE vaccine based on the SA14-14-2 strain was approved in 2009 in North America, Australia and various European countries. It can be used from 2 mo of age. In India, immunization is carried out in endemic regions at 1 y of age. Another inactivated Vero-cell culture derived Kolar strain, 821564XY, JE vaccine is being used in India. Candidate vaccines against dengue, chikungunya and West Nile fever are been discussed. A continued research and development of new vaccines are required for controlling these mosquito-borne diseases.

  2. Analysis of Thioester-Containing Proteins during the Innate Immune Response of Drosophila melanogaster

    PubMed Central

    Bou Aoun, Richard; Hetru, Charles; Troxler, Laurent; Doucet, Daniel; Ferrandon, Dominique; Matt, Nicolas

    2010-01-01

    Thioester-containing proteins (TEPs) are conserved proteins among insects that are thought to be involved in innate immunity. In Drosophila, the Tep family is composed of 6 genes named Tep1–Tep6. In this study, we investigated the phylogeny, expression pattern and roles of these genes in the host defense of Drosophila. Protostomian Tep genes are clustered in 3 distinct branches, 1 of which is specific to mosquitoes. Most D. melanogaster Tep genes are expressed in hemocytes, can be induced in the fat body, and are expressed in specific regions of the hypodermis. This expression pattern is consistent with a role in innate immunity. However, we find that TEP1, TEP2, and TEP4 are not strictly required in the body cavity to fight several bacterial and fungal infections. One possibility is that Drosophila TEPs act redundantly or that their absence can be compensated by other components of the immune response. TEPs may thus provide a subtle selective advantage during evolution. Alternatively, they may be required in host defense against specific as yet unidentified natural pathogens of Drosophila. PMID:21063077

  3. Flavivirus NS1 protein in infected host sera enhances viral acquisition by mosquitoes.

    PubMed

    Liu, Jianying; Liu, Yang; Nie, Kaixiao; Du, Senyan; Qiu, Jingjun; Pang, Xiaojing; Wang, Penghua; Cheng, Gong

    2016-06-20

    The arbovirus life cycle involves viral transfer between a vertebrate host and an arthropod vector, and acquisition of virus from an infected mammalian host by a vector is an essential step in this process. Here, we report that flavivirus nonstructural protein-1 (NS1), which is abundantly secreted into the serum of an infected host, plays a critical role in flavivirus acquisition by mosquitoes. The presence of dengue virus (DENV) and Japanese encephalitis virus NS1s in the blood of infected interferon-α and γ receptor-deficient mice (AG6) facilitated virus acquisition by their native mosquito vectors because the protein enabled the virus to overcome the immune barrier of the mosquito midgut. Active immunization of AG6 mice with a modified DENV NS1 reduced DENV acquisition by mosquitoes and protected mice against a lethal DENV challenge, suggesting that immunization with NS1 could reduce the number of virus-carrying mosquitoes as well as the incidence of flaviviral diseases. Our study demonstrates that flaviviruses utilize NS1 proteins produced during their vertebrate phases to enhance their acquisition by vectors, which might be a result of flavivirus evolution to adapt to multiple host environments.

  4. Flavivirus NS1 protein in infected host sera enhances viral acquisition by mosquitoes

    PubMed Central

    Liu, Jianying; Liu, Yang; Nie, Kaixiao; Du, Senyan; Qiu, Jingjun; Pang, Xiaojing; Wang, Penghua; Cheng, Gong

    2016-01-01

    Summary The arbovirus life cycle involves viral transfer between a vertebrate host and an arthropod vector, and acquisition of virus from an infected mammalian host by a vector is an essential step in this process. Here, we report that flavivirus nonstructural protein-1 (NS1), which is abundantly secreted into the serum of an infected host, plays a critical role in flavivirus acquisition by mosquitoes. The presence of dengue virus (DENV) and Japanese encephalitis virus (JEV) NS1s in the blood of infected interferon alpha and gamma receptor-deficient mice (AG6) facilitated virus acquisition by their native mosquito vectors because the protein enabled the virus to overcome the immune barrier of the mosquito midgut. Active immunization of AG6 mice with a modified DENV NS1 reduced DENV acquisition by mosquitoes and protected mice against a lethal DENV challenge, suggesting that immunization with NS1 could reduce the number of virus-carrying mosquitoes as well as the incidence of flaviviral diseases. Our study demonstrates that flaviviruses utilize NS1 proteins produced during their vertebrate phases to enhance their acquisition by vectors, which might be a result of flavivirus evolution to adapt to multiple host environments. PMID:27562253

  5. Exposure to West Nile Virus Increases Bacterial Diversity and Immune Gene Expression in Culex pipiens.

    PubMed

    Zink, Steven D; Van Slyke, Greta A; Palumbo, Michael J; Kramer, Laura D; Ciota, Alexander T

    2015-10-27

    Complex interactions between microbial residents of mosquitoes and arboviruses are likely to influence many aspects of vectorial capacity and could potentially have profound effects on patterns of arbovirus transmission. Such interactions have not been well studied for West Nile virus (WNV; Flaviviridae, Flavivirus) and Culex spp. mosquitoes. We utilized next-generation sequencing of 16S ribosomal RNA bacterial genes derived from Culex pipiens Linnaeus following WNV exposure and/or infection and compared bacterial populations and broad immune responses to unexposed mosquitoes. Our results demonstrate that WNV infection increases the diversity of bacterial populations and is associated with up-regulation of classical invertebrate immune pathways including RNA interference (RNAi), Toll, and Jak-STAT (Janus kinase-Signal Transducer and Activator of Transcription). In addition, WNV exposure alone, without the establishment of infection, results in similar alterations to microbial and immune signatures, although to a lesser extent. Multiple bacterial genera were found in greater abundance inWNV-exposed and/or infected mosquitoes, yet the most consistent and notable was the genus Serratia.

  6. Patterns of phenoloxidase activity in insecticide resistant and susceptible mosquitoes differ between laboratory-selected and wild-caught individuals.

    PubMed

    Cornet, Stéphane; Gandon, Sylvain; Rivero, Ana

    2013-10-31

    Insecticide resistance has the potential to alter vector immune competence and consequently affect the transmission of diseases. Using both laboratory isogenic strains and field-caught Culex pipiens mosquitoes, we investigated the effects of insecticide resistance on an important component of the mosquito immune system: the phenoloxidase (PO) activity. As infection risk varies dramatically with the age and sex of mosquitoes, allocation to PO immunity was quantified across different stages of the mosquito life cycle. Our results were consistent in showing that larvae have a higher PO activity than adults, females have a higher PO activity than males, and PO activity declines with adult age. We obtained, however, a marked discrepancy between laboratory and field-collected mosquitoes on the effect of insecticide resistance on PO activity. In the laboratory selected strains we found evidence of strong interactions between insecticide resistance and the age and sex of mosquitoes. In particular, 7 and 14 day old esterase-resistant adult females and acetylcholine-esterase resistant males had significantly higher PO activities than their susceptible counterparts. No such effects were, however, apparent in field-caught mosquitoes. Combined, the field and laboratory-based approaches employed in this study provide a powerful test of the effect of insecticide resistance on PO-mediated immunity. The use of laboratory-selected insecticide-resistant strains is still the most widely used method to investigate the pleiotropic effects of insecticide resistance. Our results suggest that the outcome of these laboratory-selected mosquitoes must be interpreted with caution and, whenever possible, compared with mosquitoes captured from the field.

  7. Does Zika virus infection affect mosquito response to repellents?

    PubMed Central

    Leal, Walter S.; Barbosa, Rosângela M. R.; Zeng, Fangfang; Faierstein, Gabriel B.; Tan, Kaiming; Paiva, Marcelo H. S.; Guedes, Duschinka R. D.; Crespo, Mônica M.; Ayres, Constância F. J.

    2017-01-01

    The World Health Organization (WHO) recommends that people travelling to or living in areas with Zika virus (ZIKV) outbreaks or epidemics adopt prophylactic measures to reduce or eliminate mosquito bites, including the use of insect repellents. It is, however, unknown whether repellents are effective against ZIKV-infected mosquitoes, in part because of the ethical concerns related to exposing a human subject’s arm to infected mosquitoes in the standard arm-in-cage assay. We used a previously developed, human subject-free behavioural assay, which mimics a human subject to evaluate the top two recommended insect repellents. Our measurements showed that DEET provided significantly higher protection than picaridin provided against noninfected, host-seeking females of the southern house mosquito, Culex quinquefasciatus, and the yellow fever mosquito, Aedes aegypti. When tested at lower doses, we observed a significant reduction in DEET-elicited protection against ZIKV-infected yellow fever mosquitoes from old and recent laboratory colonies. The reduction in protection is more likely associated with aging than the virus infection and could be compensated by applying a 5x higher dose of DEET. A substantial protection against ZIKV-infected and old noninfected mosquitoes was achieved with 5% DEET, which corresponds approximately to a 30% dose in the conventional arm-in-cage assays. PMID:28205633

  8. A deep insight into the sialotranscriptome of the mosquito, Psorophora albipes

    PubMed Central

    2013-01-01

    Background Psorophora mosquitoes are exclusively found in the Americas and have been associated with transmission of encephalitis and West Nile fever viruses, among other arboviruses. Mosquito salivary glands represent the final route of differentiation and transmission of many parasites. They also secrete molecules with powerful pharmacologic actions that modulate host hemostasis, inflammation, and immune response. Here, we employed next generation sequencing and proteome approaches to investigate for the first time the salivary composition of a mosquito member of the Psorophora genus. We additionally discuss the evolutionary position of this mosquito genus into the Culicidae family by comparing the identity of its secreted salivary compounds to other mosquito salivary proteins identified so far. Results Illumina sequencing resulted in 13,535,229 sequence reads, which were assembled into 3,247 contigs. All families were classified according to their in silico-predicted function/ activity. Annotation of these sequences allowed classification of their products into 83 salivary protein families, twenty (24.39%) of which were confirmed by our subsequent proteome analysis. Two protein families were deorphanized from Aedes and one from Ochlerotatus, while four protein families were described as novel to Psorophora genus because they had no match with any other known mosquito salivary sequence. Several protein families described as exclusive to Culicines were present in Psorophora mosquitoes, while we did not identify any member of the protein families already known as unique to Anophelines. Also, the Psorophora salivary proteins had better identity to homologs in Aedes (69.23%), followed by Ochlerotatus (8.15%), Culex (6.52%), and Anopheles (4.66%), respectively. Conclusions This is the first sialome (from the Greek sialo = saliva) catalog of salivary proteins from a Psorophora mosquito, which may be useful for better understanding the lifecycle of this mosquito and

  9. Maternal immunity enhances systemic recall immune responses upon oral immunization of piglets with F4 fimbriae.

    PubMed

    Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric

    2015-06-23

    F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.

  10. Plasmodium berghei: infectivity of mice to Anopheles stephensi mosquitoes.

    PubMed

    Butcher, G A; Sinden, R E; Billker, O

    1996-12-01

    The infectivity of P. berghei-infected TO mice to mosquitoes declines rapidly 2 to 5 days after blood inoculation, in spite of rising numbers of gametocytes in the blood. This pattern is typical of many malaria infections and various factors, particularly specific and nonspecific immune responses, have previously been implicated in the decline. Here we report that (1) simple physiological changes in the mouse blood, namely, falling pH and bicarbonate levels induced by high parasitaemias, are responsible for the sustained inhibition of infectivity; (2) the inhibition is reversible in vivo by the addition of sodium bicarbonate alone; (3) the inhibition occurs at the point of exflagellation; (4) contrary to previous observations (Kawamoto et al. 1992), exflagellation in P. berghei, like that in P. gallinaceum (Bishop and McConnachie 1956; Nijhout and Carter 1978; Nijhout 1979) and P. falciparum (Ogwan'g et al. 1993), is dependent on extracellular bicarbonate; and (5) induction of exflagellation by a mosquito factor is bicarbonate dependent. These new observations are critical to the design and interpretation of experiments on other transmission blocking phenomena.

  11. Vaccines and immunization strategies for dengue prevention

    PubMed Central

    Liu, Yang; Liu, Jianying; Cheng, Gong

    2016-01-01

    Dengue is currently the most significant arboviral disease afflicting tropical and sub-tropical countries worldwide. Dengue vaccines, such as the multivalent attenuated, chimeric, DNA and inactivated vaccines, have been developed to prevent dengue infection in humans, and they function predominantly by stimulating immune responses against the dengue virus (DENV) envelope (E) and nonstructural-1 proteins (NS1). Of these vaccines, a live attenuated chimeric tetravalent DENV vaccine developed by Sanofi Pasteur has been licensed in several countries. However, this vaccine renders only partial protection against the DENV2 infection and is associated with an unexplained increased incidence of hospitalization for severe dengue disease among children younger than nine years old. In addition to the virus-based vaccines, several mosquito-based dengue immunization strategies have been developed to interrupt the vector competence and effectively reduce the number of infected mosquito vectors, thus controlling the transmission of DENV in nature. Here we summarize the recent progress in the development of dengue vaccines and novel immunization strategies and propose some prospective vaccine strategies for disease prevention in the future. PMID:27436365

  12. Entomopathogenic fungal infection leads to temporospatial modulation of the mosquito immune system

    USDA-ARS?s Scientific Manuscript database

    Alternative methods of mosquito control are needed to tackle the rising burden of mosquito-borne diseases while minimizing the use of synthetic insecticides which are not only harmful to the environment but also are increasingly threatened by the rapid and widespread development of insecticide resis...

  13. Chromobacterium Csp_P reduces malaria and dengue infection in vector mosquitoes and has entomopathogenic and in vitro anti-pathogen activities.

    PubMed

    Ramirez, Jose Luis; Short, Sarah M; Bahia, Ana C; Saraiva, Raul G; Dong, Yuemei; Kang, Seokyoung; Tripathi, Abhai; Mlambo, Godfree; Dimopoulos, George

    2014-10-01

    Plasmodium and dengue virus, the causative agents of the two most devastating vector-borne diseases, malaria and dengue, are transmitted by the two most important mosquito vectors, Anopheles gambiae and Aedes aegypti, respectively. Insect-bacteria associations have been shown to influence vector competence for human pathogens through multi-faceted actions that include the elicitation of the insect immune system, pathogen sequestration by microbes, and bacteria-produced anti-pathogenic factors. These influences make the mosquito microbiota highly interesting from a disease control perspective. Here we present a bacterium of the genus Chromobacterium (Csp_P), which was isolated from the midgut of field-caught Aedes aegypti. Csp_P can effectively colonize the mosquito midgut when introduced through an artificial nectar meal, and it also inhibits the growth of other members of the midgut microbiota. Csp_P colonization of the midgut tissue activates mosquito immune responses, and Csp_P exposure dramatically reduces the survival of both the larval and adult stages. Ingestion of Csp_P by the mosquito significantly reduces its susceptibility to Plasmodium falciparum and dengue virus infection, thereby compromising the mosquito's vector competence. This bacterium also exerts in vitro anti-Plasmodium and anti-dengue activities, which appear to be mediated through Csp_P -produced stable bioactive factors with transmission-blocking and therapeutic potential. The anti-pathogen and entomopathogenic properties of Csp_P render it a potential candidate for the development of malaria and dengue control strategies.

  14. A Synergistic Transcriptional Regulation of Olfactory Genes Drives Blood-Feeding Associated Complex Behavioral Responses in the Mosquito Anopheles culicifacies.

    PubMed

    Das De, Tanwee; Thomas, Tina; Verma, Sonia; Singla, Deepak; Chauhan, Charu; Srivastava, Vartika; Sharma, Punita; Kumari, Seena; Tevatiya, Sanjay; Rani, Jyoti; Hasija, Yasha; Pandey, Kailash C; Dixit, Rajnikant

    2018-01-01

    Decoding the molecular basis of host seeking and blood feeding behavioral evolution/adaptation in the adult female mosquitoes may provide an opportunity to design new molecular strategy to disrupt human-mosquito interactions. Although there is a great progress in the field of mosquito olfaction and chemo-detection, little is known about the sex-specific evolution of the specialized olfactory system of adult female mosquitoes that enables them to drive and manage the complex blood-feeding associated behavioral responses. A comprehensive RNA-Seq analysis of prior and post blood meal olfactory system of An. culicifacies mosquito revealed a minor but unique change in the nature and regulation of key olfactory genes that may play a pivotal role in managing diverse behavioral responses. Based on age-dependent transcriptional profiling, we further demonstrated that adult female mosquito's chemosensory system gradually learned and matured to drive the host-seeking and blood feeding behavior at the age of 5-6 days. A time scale expression analysis of Odorant Binding Proteins (OBPs) unravels unique association with a late evening to midnight peak biting time. Blood meal-induced switching of unique sets of OBP genes and Odorant Receptors (Ors) expression coincides with the change in the innate physiological status of the mosquitoes. Blood meal follows up experiments further provide enough evidence that how a synergistic and concurrent action of OBPs-Ors may drive "prior and post blood meal" associated complex behavioral events. A dominant expression of two sensory appendages proteins (SAP-1 & SAP2) in the legs of An. culicifacies suggests that this mosquito species may draw an extra advantage of having more sensitive appendages than An. stephensi , an urban malarial vector in the Indian subcontinents. Finally, our molecular modeling analysis predicts crucial amino acid residues for future functional characterization of the sensory appendages proteins which may play a central

  15. Immune oncology, immune responsiveness and the theory of everything.

    PubMed

    Turan, Tolga; Kannan, Deepti; Patel, Maulik; Matthew Barnes, J; Tanlimco, Sonia G; Lu, Rongze; Halliwill, Kyle; Kongpachith, Sarah; Kline, Douglas E; Hendrickx, Wouter; Cesano, Alessandra; Butterfield, Lisa H; Kaufman, Howard L; Hudson, Thomas J; Bedognetti, Davide; Marincola, Francesco; Samayoa, Josue

    2018-06-05

    Anti-cancer immunotherapy is encountering its own checkpoint. Responses are dramatic and long lasting but occur in a subset of tumors and are largely dependent upon the pre-existing immune contexture of individual cancers. Available data suggest that three landscapes best define the cancer microenvironment: immune-active, immune-deserted and immune-excluded. This trichotomy is observable across most solid tumors (although the frequency of each landscape varies depending on tumor tissue of origin) and is associated with cancer prognosis and response to checkpoint inhibitor therapy (CIT). Various gene signatures (e.g. Immunological Constant of Rejection - ICR and Tumor Inflammation Signature - TIS) that delineate these landscapes have been described by different groups. In an effort to explain the mechanisms of cancer immune responsiveness or resistance to CIT, several models have been proposed that are loosely associated with the three landscapes. Here, we propose a strategy to integrate compelling data from various paradigms into a "Theory of Everything". Founded upon this unified theory, we also propose the creation of a task force led by the Society for Immunotherapy of Cancer (SITC) aimed at systematically addressing salient questions relevant to cancer immune responsiveness and immune evasion. This multidisciplinary effort will encompass aspects of genetics, tumor cell biology, and immunology that are pertinent to the understanding of this multifaceted problem.

  16. Recent developments in vaccination against malaria: Gamete vaccines and transmission-blocking immunity in malaria*

    PubMed Central

    Gwadz, Robert W.; Carter, Richard; Green, Ira

    1979-01-01

    We have recently proposed an approach to malaria control based on immunization of the host against extracellular malarial gametes, the stage in the mosquito guts, in order to block transmission by the mosquito vector. Our studies with avian and primate models have demonstrated that immunization of the host with extracellular gametes totally suppresses infectivity to the mosquito of a subsequent blood meal. Gametocytes within the erythrocytes are unaffected by the immunity, since resuspending the gametocytes in serum from normal nonimmune animals restores their infectivity to mosquitos. Immunity is mediated by antibodies that are ingested with the blood meal. These antibodies interact with extracellular gametes and prevent fertilization (the fusion of male and female gametes). Thus the infection in the mosquito is blocked, and in this way transmission is interrupted. PMID:317439

  17. In vivo imaging of microvascular changes in inflammatory human skin induced by tape stripping and mosquito saliva using optical microangiography

    NASA Astrophysics Data System (ADS)

    Baran, Utku; Choi, Woo J.; Wang, Ruikang K.

    2015-03-01

    Tape stripping on human skin induces mechanical disruptions of the epidermal barrier that lead to minor skin inflammation which leads to temporary changes in microvasculature. On the other hand, when mosquitoes probe the skin for blood feeding, they inject saliva in dermal tissue. Mosquito saliva is known to exert various biological activities, such as dermal mast cell degranulation, leading to fluid extravasation and neutrophil influx. This inflammatory response remain longer than the tape stripping caused inflammation. In this study, we demonstrate the capabilities of swept-source optical coherence tomography (OCT) in detecting in vivo microvascular response of inflammatory human skin. Optical microangiography (OMAG), noninvasive volumetric microvasculature in vivo imaging method, has been used to track the vascular responses after tape stripping and mosquito bite. Vessel density has been quantified and used to correlate with the degree of skin irritation. The proved capability of OMAG technique in visualizing the microvasculature network under inflamed skin condition can play an important role in clinical trials of treatment and diagnosis of inflammatory skin disorders as well as studying mosquito bite's perception by the immune system and its role in parasite transmission.

  18. Using infective mosquitoes to challenge monkeys with Plasmodium knowlesi in malaria vaccine studies.

    PubMed

    Murphy, Jittawadee R; Weiss, Walter R; Fryauff, David; Dowler, Megan; Savransky, Tatyana; Stoyanov, Cristina; Muratova, Olga; Lambert, Lynn; Orr-Gonzalez, Sachy; Zeleski, Katie Lynn; Hinderer, Jessica; Fay, Michael P; Joshi, Gyan; Gwadz, Robert W; Richie, Thomas L; Villasante, Eileen Franke; Richardson, Jason H; Duffy, Patrick E; Chen, Jingyang

    2014-06-03

    When rhesus monkeys (Macaca mulatta) are used to test malaria vaccines, animals are often challenged by the intravenous injection of sporozoites. However, natural exposure to malaria comes via mosquito bite, and antibodies can neutralize sporozoites as they traverse the skin. Thus, intravenous injection may not fairly assess humoral immunity from anti-sporozoite malaria vaccines. To better assess malaria vaccines in rhesus, a method to challenge large numbers of monkeys by mosquito bite was developed. Several species and strains of mosquitoes were tested for their ability to produce Plasmodium knowlesi sporozoites. Donor monkey parasitaemia effects on oocyst and sporozoite numbers and mosquito mortality were documented. Methylparaben added to mosquito feed was tested to improve mosquito survival. To determine the number of bites needed to infect a monkey, animals were exposed to various numbers of P. knowlesi-infected mosquitoes. Finally, P. knowlesi-infected mosquitoes were used to challenge 17 monkeys in a malaria vaccine trial, and the effect of number of infectious bites on monkey parasitaemia was documented. Anopheles dirus, Anopheles crascens, and Anopheles dirus X (a cross between the two species) produced large numbers of P. knowlesi sporozoites. Mosquito survival to day 14, when sporozoites fill the salivary glands, averaged only 32% when donor monkeys had a parasitaemia above 2%. However, when donor monkey parasitaemia was below 2%, mosquitoes survived twice as well and contained ample sporozoites in their salivary glands. Adding methylparaben to sugar solutions did not improve survival of infected mosquitoes. Plasmodium knowlesi was very infectious, with all monkeys developing blood stage infections if one or more infected mosquitoes successfully fed. There was also a dose-response, with monkeys that received higher numbers of infected mosquito bites developing malaria sooner. Anopheles dirus, An. crascens and a cross between these two species all were

  19. Toll immune signal activates cellular immune response via eicosanoids.

    PubMed

    Shafeeq, Tahir; Ahmed, Shabbir; Kim, Yonggyun

    2018-07-01

    Upon immune challenge, insects recognize nonself. The recognition signal will propagate to nearby immune effectors. It is well-known that Toll signal pathway induces antimicrobial peptide (AMP) gene expression. Eicosanoids play crucial roles in mediating the recognition signal to immune effectors by enhancing humoral immune response through activation of AMP synthesis as well as cellular immune responses, suggesting a functional cross-talk between Toll and eicosanoid signals. This study tested a cross-talk between these two signals. Two signal transducing factors (MyD88 and Pelle) of Toll immune pathway were identified in Spodoptera exigua. RNA interference (RNAi) of either SeMyD88 or SePelle expression interfered with the expression of AMP genes under Toll signal pathway. Bacterial challenge induced PLA 2 enzyme activity. However, RNAi of these two immune factors significantly suppressed the induction of PLA 2 enzyme activity. Furthermore, RNAi treatment prevented gene expression of cellular PLA 2 . Inhibition of PLA 2 activity reduced phenoloxidase activity and subsequent suppression in cellular immune response measured by hemocyte nodule formation. However, immunosuppression induced by RNAi of Toll signal molecules was significantly reversed by addition of arachidonic acid (AA), a catalytic product of PLA 2 . The addition also significantly reduced the enhanced fungal susceptibility of S. exigua treated by RNAi against two Toll signal molecules. These results indicate that there is a cross-talk between Toll and eicosanoid signals in insect immunity. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Response of adult mosquitoes to light-emitting diodes placed in resting boxes and in the field.

    PubMed

    Bentley, Michael T; Kaufman, Phillip E; Kline, Daniel L; Hogsette, Jerome A

    2009-09-01

    The response of adult mosquitoes to 4 light-emitting diode (LED) wavelengths was evaluated using diode-equipped sticky cards (DESCs) and diode-equipped resting boxes at 2 sites in north central Florida. Wavelengths evaluated were blue (470 nm), green (502 nm), red (660 nm), and infrared (IR) (860 nm). When trapping with DESCs, 15 mosquito species from 7 genera (Aedes, Anopheles, Coquillettidia, Culex, Mansonia, Psorophora, and Uranotaenia) were captured. Overall, approximately 43.8% of all mosquitoes were trapped on DESCs fitted with green LEDs. Significantly more females of Aedes infirmatus, Aedes vexans, and Culex nigripalpus were captured on DESCs fitted with blue LEDs compared with red or IR LEDs. DESCs with blue LEDs captured significantly more Culex erraticus females than those with IR LEDs. Using resting boxes, 12 species from 5 genera (Anopheles, Coquillettidia, Culex, Mansonia, and Uranotaenia) were collected. Resting boxes without LEDs captured 1,585 mosquitoes (22.2% of total). The fewest number of mosquitoes (16.7%) were collected from boxes affixed with the blue LEDs. Significantly more Anopheles quadrimaculatus females were aspirated from resting boxes fitted with red and IR LEDs than from those with blue or green LEDs, or from the unlit control. Blood-fed mosquitoes were recovered in highest numbers from unlit resting boxes, followed by resting boxes fitted with green, IR, and blue LEDs. Culex erraticus accounted for the majority of blood-fed mosquitoes followed by Coquillettidia perturbans. No blood-fed mosquitoes were recovered from resting boxes fitted with red LEDs.

  1. Non-Genetic Determinants of Mosquito Competence for Malaria Parasites

    PubMed Central

    Lefèvre, Thierry; Vantaux, Amélie; Dabiré, Kounbobr R.; Mouline, Karine; Cohuet, Anna

    2013-01-01

    Understanding how mosquito vectors and malaria parasites interact is of fundamental interest, and it also offers novel perspectives for disease control. Both the genetic and environmental contexts are known to affect the ability of mosquitoes to support malaria development and transmission, i.e., vector competence. Although the role of environment has long been recognized, much work has focused on host and parasite genetic effects. However, the last few years have seen a surge of studies revealing a great diversity of ways in which non-genetic factors can interfere with mosquito-Plasmodium interactions. Here, we review the current evidence for such environmentally mediated effects, including ambient temperature, mosquito diet, microbial gut flora, and infection history, and we identify additional factors previously overlooked in mosquito-Plasmodium interactions. We also discuss epidemiological implications, and the evolutionary consequences for vector immunity and parasite transmission strategies. Finally, we propose directions for further research and argue that an improved knowledge of non-genetic influences on mosquito-Plasmodium interactions could aid in implementing conventional malaria control measures and contribute to the design of novel strategies. PMID:23818841

  2. Modeling the impact of Plasmodium falciparum sexual stage immunity on the composition and dynamics of the human infectious reservoir for malaria in natural settings.

    PubMed

    Ouédraogo, André Lin; Eckhoff, Philip A; Luty, Adrian J F; Roeffen, Will; Sauerwein, Robert W; Bousema, Teun; Wenger, Edward A

    2018-05-01

    Malaria transmission remains high in Sub-Saharan Africa despite large-scale implementation of malaria control interventions. A comprehensive understanding of the transmissibility of infections to mosquitoes may guide the design of more effective transmission reducing strategies. The impact of P. falciparum sexual stage immunity on the infectious reservoir for malaria has never been studied in natural settings. Repeated measurements were carried out at start-wet, peak-wet and dry season, and provided data on antibody responses against gametocyte/gamete antigens Pfs48/45 and Pfs230 as anti-gametocyte immunity. Data on high and low-density infections and their infectiousness to anopheline mosquitoes were obtained using quantitative molecular methods and mosquito feeding assays, respectively. An event-driven model for P. falciparum sexual stage immunity was developed and fit to data using an agent based malaria model infrastructure. We found that Pfs48/45 and Pfs230 antibody densities increased with increasing concurrent gametocyte densities; associated with 55-70% reduction in oocyst intensity and achieved up to 44% reduction in proportions of infected mosquitoes. We showed that P. falciparum sexual stage immunity significantly reduces transmission of microscopic (p < 0.001) but not submicroscopic (p = 0.937) gametocyte infections to mosquitoes and that incorporating sexual stage immunity into mathematical models had a considerable impact on the contribution of different age groups to the infectious reservoir of malaria. Human antibody responses to gametocyte antigens are likely to be dependent on recent and concurrent high-density gametocyte exposure and have a pronounced impact on the likelihood of onward transmission of microscopic gametocyte densities compared to low density infections. Our mathematical simulations indicate that anti-gametocyte immunity is an important factor for predicting and understanding the composition and dynamics of the human infectious

  3. Immune responses in space flight

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.

    1998-01-01

    Space flight has been shown to have profound effects on immunological parameters of humans, monkeys and rodents. These studies have been carried out by a number of different laboratories. Among the parameters affected are leukocyte blastogenesis, natural killer cell activity, leukocyte subset distribution, cytokine production - including interferons and interleukins, and macrophage maturation and activity. These changes start to occur only after a few days space flight, and some changes continue throughout long-term space flight. Antibody responses have received only very limited study, and total antibody levels have been shown to be increased after long-term space flight. Several factors could be involved in inducing these changes. These factors could include microgravity, lack of load-bearing, stress, acceleration forces, and radiation. The mechanism(s) for space flight-induced changes in immune responses remain(s) to be established. Certainly, there can be direct effects of microgravity, or other factors, on cells that play a fundamental role in immune responses. However, it is now clear that there are interactions between the immune system and other physiological systems that could play a major role. For example, changes occurring in calcium use in the musculoskeletal system induced by microgravity or lack of use could have great impact on the immune system. Most of the changes in immune responses have been observed using samples taken immediately after return from space flight. However, there have been two recent studies that have used in-flight testing. Delayed-type hypersensitivity responses to common recall antigens of astronauts and cosmonauts have been shown to be decreased when tested during space flights. Additionally, natural killer cell and blastogenic activities are inhibited in samples taken from rats during space flight. Therefore, it is now clear that events occurring during space flight itself can affect immune responses. The biological

  4. Innate Immune Control of West Nile Virus Infection

    PubMed Central

    Arjona, Alvaro; Wang, Penghua; Montgomery, Ruth R.; Fikrig, Erol

    2011-01-01

    West Nile virus (WNV), from the Flaviviridae family, is a re-emerging zoonotic pathogen of medical importance. In humans, WNV infection may cause life-threatening meningoencephalitis or long-term neurologic sequelae. WNV is transmitted by Culex spp mosquitoes and both the arthropod vector and the mammalian host are equipped with antiviral innate immune mechanisms sharing a common phylogeny. As far as the current evidence is able to demonstrate, mosquitoes primarily rely on RNA interference, Toll, Imd and JAK-STAT signaling pathways for limiting viral infection, while mammals are provided with these and other more complex antiviral mechanisms involving antiviral effectors, inflammatory mediators, and cellular responses triggered by highly specialized pathogen detection mechanisms that often resemble their invertebrate ancestry. This mini-review summarizes our current understanding of how the innate immune systems of the vector and the mammalian host react to WNV infection and shape its pathogenesis. PMID:21790942

  5. Mosquito genomics. Highly evolvable malaria vectors: the genomes of 16 Anopheles mosquitoes.

    PubMed

    Neafsey, Daniel E; Waterhouse, Robert M; Abai, Mohammad R; Aganezov, Sergey S; Alekseyev, Max A; Allen, James E; Amon, James; Arcà, Bruno; Arensburger, Peter; Artemov, Gleb; Assour, Lauren A; Basseri, Hamidreza; Berlin, Aaron; Birren, Bruce W; Blandin, Stephanie A; Brockman, Andrew I; Burkot, Thomas R; Burt, Austin; Chan, Clara S; Chauve, Cedric; Chiu, Joanna C; Christensen, Mikkel; Costantini, Carlo; Davidson, Victoria L M; Deligianni, Elena; Dottorini, Tania; Dritsou, Vicky; Gabriel, Stacey B; Guelbeogo, Wamdaogo M; Hall, Andrew B; Han, Mira V; Hlaing, Thaung; Hughes, Daniel S T; Jenkins, Adam M; Jiang, Xiaofang; Jungreis, Irwin; Kakani, Evdoxia G; Kamali, Maryam; Kemppainen, Petri; Kennedy, Ryan C; Kirmitzoglou, Ioannis K; Koekemoer, Lizette L; Laban, Njoroge; Langridge, Nicholas; Lawniczak, Mara K N; Lirakis, Manolis; Lobo, Neil F; Lowy, Ernesto; MacCallum, Robert M; Mao, Chunhong; Maslen, Gareth; Mbogo, Charles; McCarthy, Jenny; Michel, Kristin; Mitchell, Sara N; Moore, Wendy; Murphy, Katherine A; Naumenko, Anastasia N; Nolan, Tony; Novoa, Eva M; O'Loughlin, Samantha; Oringanje, Chioma; Oshaghi, Mohammad A; Pakpour, Nazzy; Papathanos, Philippos A; Peery, Ashley N; Povelones, Michael; Prakash, Anil; Price, David P; Rajaraman, Ashok; Reimer, Lisa J; Rinker, David C; Rokas, Antonis; Russell, Tanya L; Sagnon, N'Fale; Sharakhova, Maria V; Shea, Terrance; Simão, Felipe A; Simard, Frederic; Slotman, Michel A; Somboon, Pradya; Stegniy, Vladimir; Struchiner, Claudio J; Thomas, Gregg W C; Tojo, Marta; Topalis, Pantelis; Tubio, José M C; Unger, Maria F; Vontas, John; Walton, Catherine; Wilding, Craig S; Willis, Judith H; Wu, Yi-Chieh; Yan, Guiyun; Zdobnov, Evgeny M; Zhou, Xiaofan; Catteruccia, Flaminia; Christophides, George K; Collins, Frank H; Cornman, Robert S; Crisanti, Andrea; Donnelly, Martin J; Emrich, Scott J; Fontaine, Michael C; Gelbart, William; Hahn, Matthew W; Hansen, Immo A; Howell, Paul I; Kafatos, Fotis C; Kellis, Manolis; Lawson, Daniel; Louis, Christos; Luckhart, Shirley; Muskavitch, Marc A T; Ribeiro, José M; Riehle, Michael A; Sharakhov, Igor V; Tu, Zhijian; Zwiebel, Laurence J; Besansky, Nora J

    2015-01-02

    Variation in vectorial capacity for human malaria among Anopheles mosquito species is determined by many factors, including behavior, immunity, and life history. To investigate the genomic basis of vectorial capacity and explore new avenues for vector control, we sequenced the genomes of 16 anopheline mosquito species from diverse locations spanning ~100 million years of evolution. Comparative analyses show faster rates of gene gain and loss, elevated gene shuffling on the X chromosome, and more intron losses, relative to Drosophila. Some determinants of vectorial capacity, such as chemosensory genes, do not show elevated turnover but instead diversify through protein-sequence changes. This dynamism of anopheline genes and genomes may contribute to their flexible capacity to take advantage of new ecological niches, including adapting to humans as primary hosts. Copyright © 2015, American Association for the Advancement of Science.

  6. Innate immune response to Burkholderia mallei.

    PubMed

    Saikh, Kamal U; Mott, Tiffany M

    2017-06-01

    Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin-cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei.

  7. Innate immune response to Burkholderia mallei

    PubMed Central

    Saikh, Kamal U.; Mott, Tiffany M.

    2017-01-01

    Purpose of review Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent findings Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin–cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Summary Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei. PMID:28177960

  8. Innate Immune Response to Rift Valley Fever Virus in Goats

    PubMed Central

    Nfon, Charles K.; Marszal, Peter; Zhang, Shunzhen; Weingartl, Hana M.

    2012-01-01

    Rift Valley fever (RVF), a re-emerging mosquito-borne disease of ruminants and man, was endemic in Africa but spread to Saudi Arabia and Yemen, meaning it could spread even further. Little is known about innate and cell-mediated immunity to RVF virus (RVFV) in ruminants, which is knowledge required for adequate vaccine trials. We therefore studied these aspects in experimentally infected goats. We also compared RVFV grown in an insect cell-line and that grown in a mammalian cell-line for differences in the course of infection. Goats developed viremia one day post infection (DPI), which lasted three to four days and some goats had transient fever coinciding with peak viremia. Up to 4% of peripheral blood mononuclear cells (PBMCs) were positive for RVFV. Monocytes and dendritic cells in PBMCs declined possibly from being directly infected with virus as suggested by in vitro exposure. Infected goats produced serum IFN-γ, IL-12 and other proinflammatory cytokines but not IFN-α. Despite the lack of IFN-α, innate immunity via the IL-12 to IFN-γ circuit possibly contributed to early protection against RVFV since neutralising antibodies were detected after viremia had cleared. The course of infection with insect cell-derived RVFV (IN-RVFV) appeared to be different from mammalian cell-derived RVFV (MAM-RVFV), with the former attaining peak viremia faster, inducing fever and profoundly affecting specific immune cell subpopulations. This indicated possible differences in infections of ruminants acquired from mosquito bites relative to those due to contact with infectious material from other animals. These differences need to be considered when testing RVF vaccines in laboratory settings. PMID:22545170

  9. Innate immune response to Rift Valley fever virus in goats.

    PubMed

    Nfon, Charles K; Marszal, Peter; Zhang, Shunzhen; Weingartl, Hana M

    2012-01-01

    Rift Valley fever (RVF), a re-emerging mosquito-borne disease of ruminants and man, was endemic in Africa but spread to Saudi Arabia and Yemen, meaning it could spread even further. Little is known about innate and cell-mediated immunity to RVF virus (RVFV) in ruminants, which is knowledge required for adequate vaccine trials. We therefore studied these aspects in experimentally infected goats. We also compared RVFV grown in an insect cell-line and that grown in a mammalian cell-line for differences in the course of infection. Goats developed viremia one day post infection (DPI), which lasted three to four days and some goats had transient fever coinciding with peak viremia. Up to 4% of peripheral blood mononuclear cells (PBMCs) were positive for RVFV. Monocytes and dendritic cells in PBMCs declined possibly from being directly infected with virus as suggested by in vitro exposure. Infected goats produced serum IFN-γ, IL-12 and other proinflammatory cytokines but not IFN-α. Despite the lack of IFN-α, innate immunity via the IL-12 to IFN-γ circuit possibly contributed to early protection against RVFV since neutralising antibodies were detected after viremia had cleared. The course of infection with insect cell-derived RVFV (IN-RVFV) appeared to be different from mammalian cell-derived RVFV (MAM-RVFV), with the former attaining peak viremia faster, inducing fever and profoundly affecting specific immune cell subpopulations. This indicated possible differences in infections of ruminants acquired from mosquito bites relative to those due to contact with infectious material from other animals. These differences need to be considered when testing RVF vaccines in laboratory settings.

  10. Tilapia show immunization response against Ich

    USDA-ARS?s Scientific Manuscript database

    This study compares the immune response of Nile tilapia and red tilapia against parasite Ichthyophthirius multifiliis (Ich) using a cohabitation challenge model. Both Nile and red tilapia showed strong immune response post immunization with live Ich theronts by IP injection or immersion. Blood serum...

  11. The immune response to human CMV

    PubMed Central

    La Rosa, Corinna; Diamond, Don J

    2012-01-01

    This review will summarize and interpret recent literature regarding the human CMV immune response, which is among the strongest measured and is the focus of attention for numerous research groups. CMV is a highly prevalent, globally occurring infection that rarely elicits disease in healthy immunocompetent hosts. The human immune system is unable to clear CMV infection and latency, but mounts a spirited immune-defense targeting multiple immune-evasion genes encoded by this dsDNA β-herpes virus. Additionally, the magnitude of cellular immune response devoted to CMV may cause premature immune senescence, and the high frequencies of cytolytic T cells may aggravate vascular pathologies. However, uncontrolled CMV viremia and life-threatening symptoms, which occur readily after immunosuppression and in the immature host, clearly indicate the essential role of immunity in maintaining asymptomatic co-existence with CMV. Approaches for harnessing the host immune response to CMV are needed to reduce the burden of CMV complications in immunocompromised individuals. PMID:23308079

  12. Serum Immune Responses Predict Rapid Disease Progression among Children with Crohn’s Disease: Immune Responses Predict Disease Progression

    PubMed Central

    Dubinsky, Marla C.; Lin, Ying-Chao; Dutridge, Debra; Picornell, Yoana; Landers, Carol J.; Farrior, Sharmayne; Wrobel, Iwona; Quiros, Antonio; Vasiliauskas, Eric A.; Grill, Bruce; Israel, David; Bahar, Ron; Christie, Dennis; Wahbeh, Ghassan; Silber, Gary; Dallazadeh, Saied; Shah, Praful; Thomas, Danny; Kelts, Drew; Hershberg, Robert M.; Elson, Charles O.; Targan, Stephan R.; Taylor, Kent D.; Rotter, Jerome I.; Yang, Huiying

    2007-01-01

    BACKGROUND AND AIM Crohn’s disease (CD) is a heterogeneous disorder characterized by diverse clinical phenotypes. Childhood-onset CD has been described as a more aggressive phenotype. Genetic and immune factors may influence disease phenotype and clinical course. We examined the association of immune responses to microbial antigens with disease behavior and prospectively determined the influence of immune reactivity on disease progression in pediatric CD patients. METHODS Sera were collected from 196 pediatric CD cases and tested for immune responses: anti-I2, anti-outer membrane protein C (anti-OmpC), anti-CBir1 flagellin (anti-CBir1), and anti-Saccharomyces-cerevisiae (ASCA) using ELISA. Associations between immune responses and clinical phenotype were evaluated. RESULTS Fifty-eight patients (28%) developed internal penetrating and/or stricturing (IP/S) disease after a median follow-up of 18 months. Both anti-OmpC (p < 0.0006) and anti-I2 (p < 0.003) were associated with IP/S disease. The frequency of IP/S disease increased with increasing number of immune responses (p trend = 0.002). The odds of developing IP/S disease were highest in patients positive for all four immune responses (OR (95% CI): 11 (1.5–80.4); p = 0.03). Pediatric CD patients positive for ≥1 immune response progressed to IP/S disease sooner after diagnosis as compared to those negative for all immune responses (p < 0.03). CONCLUSIONS The presence and magnitude of immune responses to microbial antigens are significantly associated with more aggressive disease phenotypes among children with CD. This is the first study to prospectively demonstrate that the time to develop a disease complication in children is significantly faster in the presence of immune reactivity, thereby predicting disease progression to more aggressive disease phenotypes among pediatric CD patients. PMID:16454844

  13. Interactions between Asaia, Plasmodium and Anopheles: new insights into mosquito symbiosis and implications in malaria symbiotic control.

    PubMed

    Capone, Aida; Ricci, Irene; Damiani, Claudia; Mosca, Michela; Rossi, Paolo; Scuppa, Patrizia; Crotti, Elena; Epis, Sara; Angeletti, Mauro; Valzano, Matteo; Sacchi, Luciano; Bandi, Claudio; Daffonchio, Daniele; Mandrioli, Mauro; Favia, Guido

    2013-06-18

    Malaria represents one of the most devastating infectious diseases. The lack of an effective vaccine and the emergence of drug resistance make necessary the development of new effective control methods. The recent identification of bacteria of the genus Asaia, associated with larvae and adults of malaria vectors, designates them as suitable candidates for malaria paratransgenic control.To better characterize the interactions between Asaia, Plasmodium and the mosquito immune system we performed an integrated experimental approach. Quantitative PCR analysis of the amount of native Asaia was performed on individual Anopheles stephensi specimens. Mosquito infection was carried out with the strain PbGFPCON and the number of parasites in the midgut was counted by fluorescent microscopy.The colonisation of infected mosquitoes was achieved using GFP or DsRed tagged-Asaia strains.Reverse transcriptase-PCR analysis, growth and phagocytosis tests were performed using An. stephensi and Drosophila melanogaster haemocyte cultures and DsRed tagged-Asaia and Escherichia coli strains. Using quantitative PCR we have quantified the relative amount of Asaia in infected and uninfected mosquitoes, showing that the parasite does not interfere with bacterial blooming. The correlation curves have confirmed the active replication of Asaia, while at the same time, the intense decrease of the parasite.The 'in vitro' immunological studies have shown that Asaia induces the expression of antimicrobial peptides, however, the growth curves in conditioned medium as well as a phagocytosis test, indicated that the bacterium is not an immune-target.Using fluorescent strains of Asaia and Plasmodium we defined their co-localisation in the mosquito midgut and salivary glands. We have provided important information about the relationship of Asaia with both Plasmodium and Anopheles. First, physiological changes in the midgut following an infected or uninfected blood meal do not negatively affect the

  14. Cellular immune responses to HIV

    NASA Astrophysics Data System (ADS)

    McMichael, Andrew J.; Rowland-Jones, Sarah L.

    2001-04-01

    The cellular immune response to the human immunodeficiency virus, mediated by T lymphocytes, seems strong but fails to control the infection completely. In most virus infections, T cells either eliminate the virus or suppress it indefinitely as a harmless, persisting infection. But the human immunodeficiency virus undermines this control by infecting key immune cells, thereby impairing the response of both the infected CD4+ T cells and the uninfected CD8+ T cells. The failure of the latter to function efficiently facilitates the escape of virus from immune control and the collapse of the whole immune system.

  15. Molecular Responses to the Zika Virus in Mosquitoes.

    PubMed

    Alfonso-Parra, Catalina; Avila, Frank W

    2018-05-03

    The Zika virus (ZIKV), originally discovered in 1947, did not become a major concern until the virus swept across the Pacific and into the Americas in the last decade, bringing with it news of neurological complications and birth defects in ZIKV affected areas. This prompted researchers to dissect the molecular interactions between ZIKV and the mosquito vector in an attempt to better understand not only the changes that occur upon infection, but to also identify molecules that may potentially enhance or suppress a mosquito’s ability to become infected and/or transmit the virus. Here, we review what is currently known regarding ZIKV-mosquito molecular interactions, focusing on ZIKV infection of Aedes aegypti and Aedes albopictus , the primary species implicated in transmitting ZIKV during the recent outbreaks.

  16. Ocular Manifestations of Mosquito-Transmitted Diseases.

    PubMed

    Karesh, James W; Mazzoli, Robert A; Heintz, Shannon K

    2018-03-01

    Of the 3,548 known mosquito species, about 100 transmit human diseases. Mosquitoes are distributed globally throughout tropical and temperate regions where standing water sources are available for egg laying and the maturation of larva. Female mosquitoes require blood meals for egg production. This is the main pathway for disease transmission. Mosquitoes carry several pathogenic organisms responsible for significant ocular pathology and vision loss including West Nile, Rift Valley, chikungunya, dengue viruses, various encephalitis viruses, malarial parasites, Francisella tularensis, microfilarial parasites, including Dirofilaria, Wuchereria, and Brugia spp., and human botfly larvae. Health care providers may not be familiar with many of these mosquito-transmitted diseases or their associated ocular findings delaying diagnosis, treatment, and recovery of visual function. This article aims to provide an overview of the ocular manifestations associated with mosquito-transmitted diseases.

  17. Cellular and Humoral Immunity Protect against Vaginal Zika Virus Infection in Mice.

    PubMed

    Scott, Jason M; Lebratti, Tania J; Richner, Justin M; Jiang, Xiaoping; Fernandez, Estefania; Zhao, Haiyan; Fremont, Daved H; Diamond, Michael S; Shin, Haina

    2018-01-17

    Zika virus (ZIKV), which can cause devastating disease in fetuses of infected pregnant women, can be transmitted by mosquito inoculation and sexual routes. Little is known about immune protection against sexually transmitted ZIKV. In this study, we show that previous infection through intravaginal or subcutaneous routes with a contemporary Brazilian strain of ZIKV can protect against subsequent intravaginal challenge with a homologous strain. Both routes of inoculation induced high titers of ZIKV-specific and neutralizing antibody in serum and the vaginal lumen. Virus-specific T cells were recruited to and retained in the female reproductive tract after intravaginal and subcutaneous ZIKV infection. Studies in mice with genetic or acquired deficiencies in B and/or T cells demonstrated that both lymphocyte populations redundantly protect against intravaginal challenge in ZIKV-immune animals. Passive transfer of ZIKV immune IgG or T cells significantly limited intravaginal infection of naïve mice, although antibody more effectively prevented dissemination throughout the reproductive tract. Collectively, our experiments begin to establish the immune correlates of protection against intravaginal ZIKV infection, which should inform vaccination strategies in non-pregnant and pregnant women. IMPORTANCE The recent ZIKV epidemic resulted in devastating outcomes in fetuses and may affect reproductive health. Unlike other flaviviruses, ZIKV can be spread by sexual contact as well as a mosquito vector. While previous studies have identified correlates of protection for mosquito-mediated infection, few have focused on immunity against sexual transmission. As exposure to ZIKV via mosquito bite has likely occurred to many living in endemic areas, our study addresses whether this route of infection can protect against subsequent sexual exposure. We demonstrate that subcutaneous ZIKV infection can protect against subsequent vaginal infection by generating both local antiviral T

  18. In vivo gene expression profiling of the entomopathogenic fungus Beauveria bassiana elucidates its infection stratagems in Anopheles mosquito.

    PubMed

    Lai, Yiling; Chen, Huan; Wei, Ge; Wang, Guandong; Li, Fang; Wang, Sibao

    2017-08-01

    The use of entomopathogenic fungi to control mosquitoes is a promising tool for reducing vector-borne disease transmission. To better understand infection stratagems of insect pathogenic fungi, we analyzed the global gene expression profiling of Beauveria bassiana at 36, 60, 84 and 108 h after topical infection of Anopheles stephensi adult mosquitoes using RNA sequencing (RNA-Seq). A total of 5,354 differentially expressed genes (DEGs) are identified over the course of fungal infection. When the fungus grows on the mosquito cuticle, up-regulated DEGs include adhesion-related genes involved in cuticle attachment, Pth11-like GPCRs hypothesized to be involved in host recognition, and extracellular enzymes involved in the degradation and penetration of the mosquito cuticle. Once in the mosquito hemocoel, the fungus evades mosquito immune system probably through up-regulating expression of β-1,3-glucan degrading enzymes and chitin synthesis enzymes for remodeling of cell walls. Moreover, six previous unknown SSCP (small secreted cysteine-rich proteins) are significantly up-regulated, which may serve as "effectors" to suppress host defense responses. B. bassiana also induces large amounts of antioxidant genes to mitigate host-generated exogenous oxidative stress. At late stage of infection, B. bassiana activates a broad spectrum of genes including nutrient degrading enzymes, some transporters and metabolism pathway components, to exploit mosquito tissues and hemolymph as a nutrient source for hyphal growth. These findings establish an important framework of knowledge for further comprehensive elucidation of fungal pathogenesis and molecular mechanism of Beauveria-mosquito interactions.

  19. Induction of pneumococcal polysaccharide-specific mucosal immune responses by oral immunization.

    PubMed

    VanCott, J L; Kobayashi, T; Yamamoto, M; Pillai, S; McGhee, J R; Kiyono, H

    1996-04-01

    Liposome and cholera toxin (CT) are considered to be effective antigen delivery vehicles and adjuvants for mucosal vaccines. The effect of these antigen delivery systems on adjuvant responses to mucosally administered pneumococcal polysaccharide (Pnup) was investigated in this study. Both mucosal (e.g. oral) and systemic (i.p.) immunization of mice with purified preparations of Pnup type 23F induced antigen-specific IgM responses in sera. Interestingly, oral immunization of as little as 10 micrograms of Pnup type 23F was sufficient to induce systemic IgM responses. Pnup-specific IgM antibodies peaked by day 7 and no booster responses were evident after a second dose on day 14. In order to examine whether IgG and IgA Pnup-specific immune responses are induced by mucosal immunization, the mucosal adjuvant CT was mixed with Pnup type 23 as an oral vaccine. Co-oral administration of CT and Pnup type 23F resulted in the induction of Pnup-specific faecal IgA antibodies. These results were confirmed by detecting antigen-specific IgA-spot-forming cells in mononuclear cell suspensions prepared from the intestine of immunized mice. These findings suggest that oral immunization with Pnup in the presence of mucosal adjuvants, such as CT, could induce Pnup-specific IgA responses whereas Pnup alone did not. In an attempt to further enhance antigen-specific antibody responses, Pnup type 23F was encapsulated in liposomes and used as mucosal vaccine. However, immunogenicity of Pnup was not improved.

  20. Transcriptional response to West Nile virus infection in the zebra finch (Taeniopygia guttata)

    USGS Publications Warehouse

    Newhouse, Daniel J.; Hofmeister, Erik K.; Balakrishnan, Christopher N.

    2017-01-01

    West Nile virus (WNV) is a widespread arbovirus that imposes a significant cost to both human and wildlife health. WNV exists in a bird-mosquito transmission cycle in which passerine birds act as the primary reservoir host. As a public health concern, the mammalian immune response to WNV has been studied in detail. Little, however, is known about the avian immune response to WNV. Avian taxa show variable susceptibility to WNV and what drives this variation is unknown. Thus, to study the immune response to WNV in birds, we experimentally infected captive zebra finches (Taeniopygia guttata). Zebra finches provide a useful model, as like many natural avian hosts they are moderately susceptible to WNV and thus provide sufficient viremia to infect mosquitoes. We performed RNAseq in spleen tissue during peak viremia to provide an overview of the transcriptional response. In general, we find strong parallels with the mammalian immune response to WNV, including upregulation of five genes in the Rig-I-like receptor signalling pathway, and offer insights into avian-specific responses. Together with complementary immunological assays, we provide a model of the avian immune response to WNV and set the stage for future comparative studies among variably susceptible populations and species.

  1. Hallmarks of response to immune checkpoint blockade

    PubMed Central

    Cogdill, Alexandria P; Andrews, Miles C; Wargo, Jennifer A

    2017-01-01

    Unprecedented advances have been made in the treatment of cancer through the use of immune checkpoint blockade, with approval of several checkpoint blockade regimens spanning multiple cancer types. However, responses to this form of therapy are not universal, and insights are clearly needed to identify optimal biomarkers of response and to combat mechanisms of therapeutic resistance. A working knowledge of the hallmarks of cancer yields insight into responses to immune checkpoint blockade, although the focus of this is rather tumour-centric and additional factors are pertinent, including host immunity and environmental influences. Herein, we describe the foundation for pillars and hallmarks of response to immune checkpoint blockade, with a discussion of their relevance to immune monitoring and mechanisms of resistance. Evolution of this understanding will ultimately help guide treatment strategies to enhance therapeutic responses. PMID:28524159

  2. The Anopheles innate immune system in the defense against malaria infection

    PubMed Central

    Clayton, April M.; Dong, Yuemei; Dimopoulos, George

    2014-01-01

    The multifaceted innate immune system of insects is capable of fighting infection by a variety of pathogens including those causing human malaria. Malaria transmission by the Anopheles mosquito depends on the Plasmodium parasite’s successful completion of its lifecycle in the insect vector, a process that involves interactions with several tissues and cell types as well as with the mosquito’s innate immune system. This review will discuss our current understanding of the Anopheles mosquito’s innate immune responses against the malaria parasite Plasmodium and the influence of the insect’s intestinal microbiota on parasite infection. PMID:23988482

  3. Heritability of Attractiveness to Mosquitoes

    PubMed Central

    Fernández-Grandon, G. Mandela; Gezan, Salvador A.; Armour, John A. L.; Pickett, John A.; Logan, James G.

    2015-01-01

    Female mosquitoes display preferences for certain individuals over others, which is determined by differences in volatile chemicals produced by the human body and detected by mosquitoes. Body odour can be controlled genetically but the existence of a genetic basis for differential attraction to insects has never been formally demonstrated. This study investigated heritability of attractiveness to mosquitoes by evaluating the response of Aedes aegypti (=Stegomyia aegypti) mosquitoes to odours from the hands of identical and non-identical twins in a dual-choice assay. Volatiles from individuals in an identical twin pair showed a high correlation in attractiveness to mosquitoes, while non-identical twin pairs showed a significantly lower correlation. Overall, there was a strong narrow-sense heritability of 0.62 (SE 0.124) for relative attraction and 0.67 (0.354) for flight activity based on the average of ten measurements. The results demonstrate an underlying genetic component detectable by mosquitoes through olfaction. Understanding the genetic basis for attractiveness could create a more informed approach to repellent development. PMID:25901606

  4. Spaceflight and immune responses of Rhesus monkeys

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald

    1994-01-01

    Evidence from both human and rodent studies indicates that alterations in immunological parameters occur after space flight. The objective of this project is to determine the effects of space flight on immune responses of Rhesus monkeys. The expected significance of the work is a determination of the range of immunological functions of the Rhesus monkey, a primate similar in many ways to man, affected by space flight. Changes in immune responses that could yield alterations in resistance to infection may be determined as well as the duration of alterations in immune responses. Additional information on the nature of cellular interactions for the generation of immune responses may also be obtained.

  5. Virus-like nanostructures for tuning immune response

    NASA Astrophysics Data System (ADS)

    Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.

    2015-11-01

    Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system.

  6. Uncovering the Repertoire of Endogenous Flaviviral Elements in Aedes Mosquito Genomes

    PubMed Central

    Suzuki, Yasutsugu; Frangeul, Lionel; Dickson, Laura B.; Blanc, Hervé; Verdier, Yann; Vinh, Joelle

    2017-01-01

    ABSTRACT Endogenous viral elements derived from nonretroviral RNA viruses have been described in various animal genomes. Whether they have a biological function, such as host immune protection against related viruses, is a field of intense study. Here, we investigated the repertoire of endogenous flaviviral elements (EFVEs) in Aedes mosquitoes, the vectors of arboviruses such as dengue and chikungunya viruses. Previous studies identified three EFVEs from Aedes albopictus cell lines and one from Aedes aegypti cell lines. However, an in-depth characterization of EFVEs in wild-type mosquito populations and individual mosquitoes in vivo has not been performed. We detected the full-length DNA sequence of the previously described EFVEs and their respective transcripts in several A. albopictus and A. aegypti populations from geographically distinct areas. However, EFVE-derived proteins were not detected by mass spectrometry. Using deep sequencing, we detected the production of PIWI-interacting RNA-like small RNAs, in an antisense orientation, targeting the EFVEs and their flanking regions in vivo. The EFVEs were integrated in repetitive regions of the mosquito genomes, and their flanking sequences varied among mosquito populations. We bioinformatically predicted several new EFVEs from a Vietnamese A. albopictus population and observed variation in the occurrence of those elements among mosquitoes. Phylogenetic analysis of an A. aegypti EFVE suggested that it integrated prior to the global expansion of the species and subsequently diverged among and within populations. The findings of this study together reveal the substantial structural and nucleotide diversity of flaviviral integrations in Aedes genomes. Unraveling this diversity will help to elucidate the potential biological function of these EFVEs. IMPORTANCE Endogenous viral elements (EVEs) are whole or partial viral sequences integrated in host genomes. Interestingly, some EVEs have important functions for host

  7. Uncovering the Repertoire of Endogenous Flaviviral Elements in Aedes Mosquito Genomes.

    PubMed

    Suzuki, Yasutsugu; Frangeul, Lionel; Dickson, Laura B; Blanc, Hervé; Verdier, Yann; Vinh, Joelle; Lambrechts, Louis; Saleh, Maria-Carla

    2017-08-01

    Endogenous viral elements derived from nonretroviral RNA viruses have been described in various animal genomes. Whether they have a biological function, such as host immune protection against related viruses, is a field of intense study. Here, we investigated the repertoire of endogenous flaviviral elements (EFVEs) in Aedes mosquitoes, the vectors of arboviruses such as dengue and chikungunya viruses. Previous studies identified three EFVEs from Aedes albopictus cell lines and one from Aedes aegypti cell lines. However, an in-depth characterization of EFVEs in wild-type mosquito populations and individual mosquitoes in vivo has not been performed. We detected the full-length DNA sequence of the previously described EFVEs and their respective transcripts in several A. albopictus and A. aegypti populations from geographically distinct areas. However, EFVE-derived proteins were not detected by mass spectrometry. Using deep sequencing, we detected the production of PIWI-interacting RNA-like small RNAs, in an antisense orientation, targeting the EFVEs and their flanking regions in vivo The EFVEs were integrated in repetitive regions of the mosquito genomes, and their flanking sequences varied among mosquito populations. We bioinformatically predicted several new EFVEs from a Vietnamese A. albopictus population and observed variation in the occurrence of those elements among mosquitoes. Phylogenetic analysis of an A. aegypti EFVE suggested that it integrated prior to the global expansion of the species and subsequently diverged among and within populations. The findings of this study together reveal the substantial structural and nucleotide diversity of flaviviral integrations in Aedes genomes. Unraveling this diversity will help to elucidate the potential biological function of these EFVEs. IMPORTANCE Endogenous viral elements (EVEs) are whole or partial viral sequences integrated in host genomes. Interestingly, some EVEs have important functions for host fitness and

  8. Mosquito repellents in frog skin

    PubMed Central

    Williams, C.R; Smith, B.P.C; Best, S.M; Tyler, M.J

    2006-01-01

    The search for novel insect repellents has been driven by health concerns over established synthetic compounds such as diethyl-m-toluamide (DEET). Given the diversity of compounds known from frog skin and records of mosquito bite and ectoparasite infestation, the presence of mosquito repellents in frogs seemed plausible. We investigated frog skin secretions to confirm the existence of mosquito repellent properties. Litoria caerulea secretions were assessed for mosquito repellency by topical application on mice. The secretions provided protection against host-seeking Culex annulirostris mosquitoes. Olfactometer tests using aqueous washes of skin secretions from L. caerulea and four other frog species were conducted to determine whether volatile components were responsible for repellency. Volatiles from Litoria rubella and Uperoleia mjobergi secretions were repellent to C. annulirostris, albeit not as repellent as a DEET control. The demonstration of endogenous insect repellents in amphibians is novel, and demonstrates that many aspects of frog chemical ecology remain unexplored. PMID:17148373

  9. Improving sneaky-sex in a low oxygen environment: reproductive and physiological responses of male mosquito fish to chronic hypoxia.

    PubMed

    Carter, Alecia J; Wilson, Robbie S

    2006-12-01

    Few studies have examined the adaptive significance of reversible acclimation responses. The aerobic performance and mating behaviour of the sexually coercive male eastern mosquito fish (Gambusia holbrooki) offers an excellent model system for testing the benefits of reversible acclimation responses to mating success. We exposed male mosquito fish to normoxic or hypoxic conditions for 4 weeks and tested their maximum sustained swimming performance and their ability to obtain coercive matings under both normoxic and hypoxic conditions. We predicted that hypoxia-acclimated males would possess greater swimming and mating performance in hypoxic conditions than normoxic-acclimated males, and vice versa when tested in normoxia. Supporting our predictions, we found the sustained swimming performance of male mosquito fish was greater in a hypoxic environment following long-term exposure to low partial pressures of oxygen. However, the benefits of acclimation responses to mating performance were dependent on whether they were tested in the presence or absence of male-male competition. In a non-competitive environment, male mosquito fish acclimated to hypoxic conditions spent a greater amount of time following females and obtained more copulations than normoxic-acclimated males when tested in low partial pressures of oxygen. When males were competed against each other for copulations, we found no influence of long-term exposure to different partial pressures of oxygen on mating behaviour. Thus, despite improvements in the aerobic capacity of male mosquito fish following long-term acclimation to hypoxic conditions, these benefits did not always manifest themselves in improved mating performance. This study represents one of the first experimental tests of the benefits of reversible acclimation responses, and indicates that the ecological significance of physiological plasticity may be more complicated than previously imagined.

  10. Genetic Dissection of Anopheles gambiae Gut Epithelial Responses to Serratia marcescens

    PubMed Central

    Stathopoulos, Stavros; Neafsey, Daniel E.; Lawniczak, Mara K. N.; Muskavitch, Marc A. T.; Christophides, George K.

    2014-01-01

    Genetic variation in the mosquito Anopheles gambiae profoundly influences its ability to transmit malaria. Mosquito gut bacteria are shown to influence the outcome of infections with Plasmodium parasites and are also thought to exert a strong drive on genetic variation through natural selection; however, a link between antibacterial effects and genetic variation is yet to emerge. Here, we combined SNP genotyping and expression profiling with phenotypic analyses of candidate genes by RNAi-mediated silencing and 454 pyrosequencing to investigate this intricate biological system. We identified 138 An. gambiae genes to be genetically associated with the outcome of Serratia marcescens infection, including the peptidoglycan recognition receptor PGRPLC that triggers activation of the antibacterial IMD/REL2 pathway and the epidermal growth factor receptor EGFR. Silencing of three genes encoding type III fibronectin domain proteins (FN3Ds) increased the Serratia load and altered the gut microbiota composition in favor of Enterobacteriaceae. These data suggest that natural genetic variation in immune-related genes can shape the bacterial population structure of the mosquito gut with high specificity. Importantly, FN3D2 encodes a homolog of the hypervariable pattern recognition receptor Dscam, suggesting that pathogen-specific recognition may involve a broader family of immune factors. Additionally, we showed that silencing the gene encoding the gustatory receptor Gr9 that is also associated with the Serratia infection phenotype drastically increased Serratia levels. The Gr9 antibacterial activity appears to be related to mosquito feeding behavior and to mostly rely on changes of neuropeptide F expression, together suggesting a behavioral immune response following Serratia infection. Our findings reveal that the mosquito response to oral Serratia infection comprises both an epithelial and a behavioral immune component. PMID:24603764

  11. Immune Response in Thyroid Cancer: Widening the Boundaries

    PubMed Central

    Ward, Laura Sterian

    2014-01-01

    The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy. PMID:25328756

  12. Oviposition responses of Aedes mosquitoes to bacterial isolates from attractive bamboo infusions.

    PubMed

    Ponnusamy, Loganathan; Schal, Coby; Wesson, Dawn M; Arellano, Consuelo; Apperson, Charles S

    2015-09-23

    The mosquitoes Aedes aegypti and Aedes albopictus are vectors of pathogenic viruses that cause major human illnesses including dengue, yellow fever and chikungunya. Both mosquito species are expanding their geographic distributions and now occur worldwide in temperate and tropical climates. Collection of eggs in oviposition traps (ovitraps) is commonly used for monitoring and surveillance of container-inhabiting Aedes populations by public health agencies charged with managing mosquito-transmitted illness. Addition of an organic infusion in these traps increases the number of eggs deposited. Gravid females are guided to ovitraps by volatile chemicals produced from the breakdown of organic matter by microbes. We previously isolated and cultured 14 species of bacteria from attractive experimental infusions, made from the senescent leaves of canebrake bamboo (Arundinaria gigantea). Cultures were grown for 24 h at 28 °C with constant shaking (120 rpm) and cell densities were determined with a hemocytometer. Behavioral responses to single bacterial isolates and to a mix of isolates at different cell densities were evaluated using two-choice sticky-screen bioassay methods with gravid Ae. aegypti and Ae. albopictus. In behavioral assays of a mix of 14 bacterial isolates, significantly greater attraction responses were exhibited by Ae. aegypti and Ae. albopictus to bacterial densities of 10(7) and 10(8) cells/mL than to the control medium. When we tested single bacterial isolates, seven isolates (B1, B2, B3, B5, B12, B13 and B14) were significantly attractive to Ae. aegypti, and six isolates (B1, B5, B7, B10, B13 and B14) significantly attracted Ae. albopictus. Among all the isolates tested at three different cell densities, bacterial isolates B1, B5, B13 and B14 were highly attractive to both Aedes species. Our results show that at specific cell densities, some bacteria significantly influence the attraction of gravid Ae. aegypti and Ae. albopictus females to

  13. Measles virus-induced suppression of immune responses.

    PubMed

    Griffin, Diane E

    2010-07-01

    Measles is an important cause of child mortality that has a seemingly paradoxical interaction with the immune system. In most individuals, the immune response is successful in eventually clearing measles virus (MV) infection and in establishing life-long immunity. However, infection is also associated with persistence of viral RNA and several weeks of immune suppression, including loss of delayed type hypersensitivity responses and increased susceptibility to secondary infections. The initial T-cell response includes CD8+ and T-helper 1 CD4+ T cells important for control of infectious virus. As viral RNA persists, there is a shift to a T-helper 2 CD4+ T-cell response that likely promotes B-cell maturation and durable antibody responses but may suppress macrophage activation and T-helper 1 responses to new infections. Suppression of mitogen-induced lymphocyte proliferation can be induced by lymphocyte infection with MV or by lymphocyte exposure to a complex of the hemagglutinin and fusion surface glycoproteins without infection. Dendritic cells (DCs) are susceptible to infection and can transmit infection to lymphocytes. MV-infected DCs are unable to stimulate a mixed lymphocyte reaction and can induce lymphocyte unresponsiveness through expression of MV glycoproteins. Thus, multiple factors may contribute both to measles-induced immune suppression and to the establishment of durable protective immunity.

  14. Immune Responses to HCV and Other Hepatitis Viruses

    PubMed Central

    Park, Su-Hyung; Rehermann, Barbara

    2014-01-01

    Summary Five human hepatitis viruses cause most acute and chronic liver disease worldwide. Over the past 25 years hepatitis C virus (HCV) in particular has received much interest because of its ability to persist in most immunocompetent adults and the lack of a protective vaccine. Here we examine innate and adaptive immune responses to HCV infection. Although HCV activates an innate immune response, it employs an elaborate set of mechanisms to evade interferon (IFN)-based antiviral immunity. By comparing innate and adaptive immune responses to HCV with those to hepatitis A and B viruses, we suggest that prolonged innate immune activation impairs the development of successful adaptive immune responses. Comparative immunology furthermore provides insights into the maintenance of immune protection. We conclude by discussing prospects for an HCV vaccine and future research needs for the hepatitis viruses. PMID:24439265

  15. Human transcriptome response to immunization with live-attenuated Venezuelan equine encephalitis virus vaccine (TC-83): Analysis of whole blood.

    PubMed

    Erwin-Cohen, Rebecca A; Porter, Aimee I; Pittman, Phillip R; Rossi, Cynthia A; DaSilva, Luis

    2017-01-02

    Venezuelan equine encephalitis virus (VEEV) is an important human and animal alphavirus pathogen transmitted by mosquitoes. The virus is endemic in Central and South America, but has also caused equine outbreaks in southwestern areas of the United States. In an effort to better understand the molecular mechanisms of the development of immunity to this important pathogen, we performed transcriptional analysis from whole, unfractionated human blood of patients who had been immunized with the live-attenuated vaccine strain of VEEV, TC-83. We compared changes in the transcriptome between naïve individuals who were mock vaccinated with saline to responses of individuals who received TC-83. Significant transcriptional changes were noted at days 2, 7, and 14 following vaccination. The top canonical pathways revealed at early and intermediate time points (days 2 and 7) included the involvement of the classic interferon response, interferon-response factors, activation of pattern recognition receptors, and engagement of the inflammasome. By day 14, the top canonical pathways included oxidative phosphorylation, the protein ubiquitination pathway, natural killer cell signaling, and B-cell development. Biomarkers were identified that differentiate between vaccinees and control subjects, at early, intermediate, and late stages of the development of immunity as well as markers which were common to all 3 stages following vaccination but distinct from the sham-vaccinated control subjects. The study represents a novel examination of molecular processes that lead to the development of immunity against VEEV in humans and which may be of value as diagnostic targets, to enhance modern vaccine design, or molecular correlates of protection.

  16. Dendritic Cell Immune Responses in HIV-1 Controllers.

    PubMed

    Martin-Gayo, Enrique; Yu, Xu G

    2017-02-01

    Robust HIV-1-specific CD8 T cell responses are currently regarded as the main correlate of immune defense in rare individuals who achieve natural, drug-free control of HIV-1; however, the mechanisms that support evolution of such powerful immune responses are not well understood. Dendritic cells (DCs) are specialized innate immune cells critical for immune recognition, immune regulation, and immune induction, but their possible contribution to HIV-1 immune defense in controllers remains ill-defined. Recent studies suggest that myeloid DCs from controllers have improved abilities to recognize HIV-1 through cytoplasmic immune sensors, resulting in more potent, cell-intrinsic type I interferon secretion in response to viral infection. This innate immune response may facilitate DC-mediated induction of highly potent antiviral HIV-1-specific T cells. Moreover, protective HLA class I isotypes restricting HIV-1-specific CD8 T cells may influence DC function through specific interactions with innate myelomonocytic MHC class I receptors from the leukocyte immunoglobulin-like receptor family. Bi-directional interactions between dendritic cells and HIV-1-specific T cells may contribute to natural HIV-1 immune control, highlighting the importance of a fine-tuned interplay between innate and adaptive immune activities for effective antiviral immune defense.

  17. North American Wetlands and Mosquito Control

    PubMed Central

    Rey, Jorge R.; Walton, William E.; Wolfe, Roger J.; Connelly, Roxanne; O’Connell, Sheila M.; Berg, Joe; Sakolsky-Hoopes, Gabrielle E.; Laderman, Aimlee D.

    2012-01-01

    Wetlands are valuable habitats that provide important social, economic, and ecological services such as flood control, water quality improvement, carbon sequestration, pollutant removal, and primary/secondary production export to terrestrial and aquatic food chains. There is disagreement about the need for mosquito control in wetlands and about the techniques utilized for mosquito abatement and their impacts upon wetlands ecosystems. Mosquito control in wetlands is a complex issue influenced by numerous factors, including many hard to quantify elements such as human perceptions, cultural predispositions, and political climate. In spite of considerable progress during the last decades, habitat protection and environmentally sound habitat management still remain inextricably tied to politics and economics. Furthermore, the connections are often complex, and occur at several levels, ranging from local businesses and politicians, to national governments and multinational institutions. Education is the key to lasting wetlands conservation. Integrated mosquito abatement strategies incorporate many approaches and practicable options, as described herein, and need to be well-defined, effective, and ecologically and economically sound for the wetland type and for the mosquito species of concern. The approach will certainly differ in response to disease outbreaks caused by mosquito-vectored pathogens versus quality of life issues caused by nuisance-biting mosquitoes. In this contribution, we provide an overview of the ecological setting and context for mosquito control in wetlands, present pertinent information on wetlands mosquitoes, review the mosquito abatement options available for current wetlands managers and mosquito control professionals, and outline some necessary considerations when devising mosquito control strategies. Although the emphasis is on North American wetlands, most of the material is applicable to wetlands everywhere. PMID:23222252

  18. Mosquito Control

    MedlinePlus

    ... Labs and Research Centers Contact Us Share Mosquito Control About Mosquitoes General Information Life Cycle Information from ... Repellent that is Right for You DEET Mosquito Control Methods Success in mosquito control: an integrated approach ...

  19. Impact of the blood meal on humoral immunity and microbiota in the gut of female Culicoides sonorensis

    USDA-ARS?s Scientific Manuscript database

    Although Culicoides sonorensis is an important vector of orbiviruses that cause significant disease in domestic and wild ruminants in the USA, little is known about factors contributing to midge vector competence. In other vectors such as mosquitoes, interactions between the humoral immune response,...

  20. Marburg virus survivor immune responses are Th1 skewed with limited neutralizing antibody responses.

    PubMed

    Stonier, Spencer W; Herbert, Andrew S; Kuehne, Ana I; Sobarzo, Ariel; Habibulin, Polina; Dahan, Chen V Abramovitch; James, Rebekah M; Egesa, Moses; Cose, Stephen; Lutwama, Julius Julian; Lobel, Leslie; Dye, John M

    2017-09-04

    Until recently, immune responses in filovirus survivors remained poorly understood. Early studies revealed IgM and IgG responses to infection with various filoviruses, but recent outbreaks have greatly expanded our understanding of filovirus immune responses. Immune responses in survivors of Ebola virus (EBOV) and Sudan virus (SUDV) infections have provided the most insight, with T cell responses as well as detailed antibody responses having been characterized. Immune responses to Marburg virus (MARV), however, remain almost entirely uncharacterized. We report that immune responses in MARV survivors share characteristics with EBOV and SUDV infections but have some distinct differences. MARV survivors developed multivariate CD4 + T cell responses but limited CD8 + T cell responses, more in keeping with SUDV survivors than EBOV survivors. In stark contrast to SUDV survivors, rare neutralizing antibody responses in MARV survivors diminished rapidly after the outbreak. These results warrant serious consideration for any vaccine or therapeutic that seeks to be broadly protective, as different filoviruses may require different immune responses to achieve immunity. © 2017 Stonier et al.

  1. Evaluation of mosquito responses to pyrethroid insecticides topically applied to sheep.

    PubMed

    Johnson, G D; Goosey, H B; Rolston, M G; Miller, W L; Hokit, D G; Redden, R R; Kott, R W

    2013-06-01

    A rise in the incidence of mosquito-transmitted Cache Valley virus (CVV) in lambs in 2011 prompted a study to evaluate on-animal pyrethroid insecticides to reduce mosquito attacks on sheep. Using enclosure traps for 1 night per wk for 6 wk, we compared engorgement rates of mosquitoes given the opportunity to feed on untreated sheep and sheep treated with 1 Python insecticide ear tag (containing 10% zeta-cypermethrin and 20% piperonyl butoxide) per animal or 2 synergized permethrin body spray treatments (containing 2.5% permethrin and 2.5% piperonyl butoxide). During the 6-wk study, 18,920 mosquitoes were collected in the animal-baited enclosure traps. Thirteen species were identified from these collections with the floodwater species Aedes increpitus and Ae. idahoensis making up 68% of the total. Potential CVV vector species, making up 25% of the samples, included Ae. vexans, Ae. dorsalis, Culex tarsalis, and Culiseta inornata. Traps baited with untreated sheep collected 9,701 mosquitoes with 65% of these engorged. Traps baited with sheep treated with Python ear tags or permethrin spray collected 4,034 and 4,555, respectively, with engorgement rates of 23% and 35%. Blood feeding on ear-tagged sheep was significantly reduced by as much as 90% compared to the untreated sheep, and protection lasted 4 wk or longer. Permethrin spray treatments were most effective within 24 h after application and provided better protection against Ae. dorsalis than the Python tag. Effectiveness of the permethrin spray diminished 1 wk after the 2nd application was made. The effect of these treatments appeared to be repellency because negligible mosquito mortality was observed at the time of collection. Further evaluation of these insecticides under conditions of natural exposure to a mosquito-borne pathogen is warranted.

  2. Mosquito Surveillance for Prevention and Control of Emerging Mosquito-Borne Diseases in Portugal — 2008–2014

    PubMed Central

    Osório, Hugo C.; Zé-Zé, Líbia; Amaro, Fátima; Alves, Maria J.

    2014-01-01

    Mosquito surveillance in Europe is essential for early detection of invasive species with public health importance and prevention and control of emerging pathogens. In Portugal, a vector surveillance national program—REVIVE (REde de VIgilância de VEctores)—has been operating since 2008 under the custody of Portuguese Ministry of Health. The REVIVE is responsible for the nationwide surveillance of hematophagous arthropods. Surveillance for West Nile virus (WNV) and other flaviviruses in adult mosquitoes is continuously performed. Adult mosquitoes—collected mainly with Centre for Disease Control light traps baited with CO2—and larvae were systematically collected from a wide range of habitats in 20 subregions (NUTS III). Around 500,000 mosquitoes were trapped in more than 3,000 trap nights and 3,500 positive larvae surveys, in which 24 species were recorded. The viral activity detected in mosquito populations in these years has been limited to insect specific flaviviruses (ISFs) non-pathogenic to humans. Rather than emergency response, REVIVE allows timely detection of changes in abundance and species diversity providing valuable knowledge to health authorities, which may take control measures of vector populations reducing its impact on public health. This work aims to present the REVIVE operation and to expose data regarding mosquito species composition and detected ISFs. PMID:25396768

  3. The salivary gland transcriptome of the eastern tree hole mosquito, Ochlerotatus triseriatus.

    PubMed

    Calvo, Eric; Sanchez-Vargas, Irma; Kotsyfakis, Michalis; Favreau, Amanda J; Barbian, Kent D; Pham, Van M; Olson, Kenneth E; Ribeiro, José M C

    2010-05-01

    Saliva of blood-sucking arthropods contains a complex mixture of peptides that affect their host's hemostasis, inflammation, and immunity. These activities can also modify the site of pathogen delivery and increase disease transmission. Saliva also induces hosts to mount an antisaliva immune response that can lead to skin allergies or even anaphylaxis. Accordingly, knowledge of the salivary repertoire, or sialome, of a mosquito is useful to provide a knowledge platform to mine for novel pharmacological activities, to develop novel vaccine targets for vector-borne diseases, and to develop epidemiological markers of vector exposure and candidate desensitization vaccines. The mosquito Ochlerotatus triseriatus is a vector of La Crosse virus and produces allergy in humans. In this work, a total of 1,575 clones randomly selected from an adult female O. triseriatus salivary gland cDNA library was sequenced and used to assemble a database that yielded 731 clusters of related sequences, 560 of which were singletons. Primer extension experiments were performed in selected clones to further extend sequence coverage, allowing for the identification of 159 protein sequences, 66 of which code for putative secreted proteins. Supplemental spreadsheets containing these data are available at http://exon.niaid.nih.gov/transcriptome/Ochlerotatus_triseriatus/S1/Ot-S1.xls and http://exon.niaid. nih.gov/transcriptome/Ochlerotatus_triseriatus/S2/Ot-S2.xls.

  4. Comparison of immune responses of brown-headed cowbird and related blackbirds to west Nile and other mosquito-borne encephalitis viruses.

    PubMed

    Reisen, William K; Hahn, D Caldwell

    2007-07-01

    The rapid geographic spread of West Nile virus (family Flaviviridae, genus Flavivirus, WNV) across the United States has stimulated interest in comparative host infection studies to delineate competent avian hosts critical for viral amplification. We compared the host competence of four taxonomically related blackbird species (Icteridae) after experimental infection with WNV and with two endemic, mosquito-borne encephalitis viruses, western equine encephalomyelitis virus (family Togaviridae, genus Alphavirus, WEEV), and St. Louis encephalitis virus (family Flaviviridae, genus Flavivirus, SLEV). We predicted differences in disease resistance among the blackbird species based on differences in life history, because they differ in geographic range and life history traits that include mating and breeding systems. Differences were observed among the response of these hosts to all three viruses. Red-winged Blackbirds were more susceptible to SLEV than Brewer's Blackbirds, whereas Brewer's Blackbirds were more susceptible to WEEV than Red-winged Blackbirds. In response to WNV infection, cowbirds showed the lowest mean viremias, cleared their infections faster, and showed lower antibody levels than concurrently infected species. Brown-headed Cowbirds also exhibited significantly lower viremia responses after infection with SLEV and WEEV as well as coinfection with WEEV and WNV than concurrently infected icterids. We concluded that cowbirds may be more resistant to infection to both native and introduced viruses because they experience heightened exposure to a variety of pathogens of parenting birds during the course of their parasitic life style.

  5. Comparison of immune responses of brown-headed cowbird and related blackbirds to West Nile and other mosquito-borne encephalitis viruses

    USGS Publications Warehouse

    Reisen, W.K.; Hahn, D.C.

    2007-01-01

    The rapid geographic spread of West Nile virus (family Flaviviridae, genus Flavivirus, WNV) across the United States has stimulated interest in comparative host infection studies to delineate competent avian hosts critical for viral amplification. We compared the host competence of four taxonomically related blackbird species (Icteridae) after experimental infection with WNV and with two endemic, mosquito-borne encephalitis viruses, western equine encephalomyelitis virus (family Togaviridae, genus Alphavirus, WEEV), and St, Louis encephalitis virus (family Flaviviridae, genus Flavivirus, SLEV). We predicted differences in disease resistance among the blackbird species based on differences in life history, because they differ in geographic range and life history traits that include mating and breeding systems. Differences were observed among the response of these hosts to all three viruses, Red-winged Blackbirds were more susceptible to SLEV than Brewer's Blackbirds, whereas Brewer's Blackbirds were more susceptible to WEEV than Red-winged Blackbirds. In response to WNV infection, cowbirds showed the lowest mean viremias, cleared their infections faster, and showed lower antibody levels than concurrently infected species. Brown-headed Cowbirds also exhibited significantly lower viremia responses after infection with SLEV and WEEV as well as coinfection with WEEV and WNV than concurrently infected icterids. We concluded that cowbirds may be more resistant to infection to both native and introduced viruses because they experience heightened exposure to a variety of pathogens of parenting birds during the course of their parasitic life style.

  6. Mosquito population dynamics from cellular automata-based simulation

    NASA Astrophysics Data System (ADS)

    Syafarina, Inna; Sadikin, Rifki; Nuraini, Nuning

    2016-02-01

    In this paper we present an innovative model for simulating mosquito-vector population dynamics. The simulation consist of two stages: demography and dispersal dynamics. For demography simulation, we follow the existing model for modeling a mosquito life cycles. Moreover, we use cellular automata-based model for simulating dispersal of the vector. In simulation, each individual vector is able to move to other grid based on a random walk. Our model is also capable to represent immunity factor for each grid. We simulate the model to evaluate its correctness. Based on the simulations, we can conclude that our model is correct. However, our model need to be improved to find a realistic parameters to match real data.

  7. Effect of insecticide-treated bed nets on house-entry by malaria mosquitoes: The flight response recorded in a semi-field study in Kenya.

    PubMed

    Spitzen, Jeroen; Koelewijn, Teun; Mukabana, W Richard; Takken, Willem

    2017-08-01

    Insecticide-treated nets are currently a major tool to reduce malaria transmission. Their level of repellency affects contact of the mosquito with the net, but may also influence the mosquito's entry into the house. The response of host-seeking malaria mosquitoes approaching the eave of an experimental house was recorded within a large screen house. We compared entry- and exit rates in relation to the presence in the house of different insecticide-treated bed nets (ITNs) with an untreated net. Mosquitoes were lured towards the house by dispensing a synthetic host-odour blend from within the net in the house. Complementary WHO bioassays revealed that the treated nets caused high knock-down- and mortality responses to the Anopheles gambiae sensu stricto strain tested. The proportion of mosquitoes that came into view of the cameras and subsequently entered the house did not differ between treated nets and the untreated net. Treated nets did not affect proportions of mosquitoes that exited the house and departed from view around the eave. However, the percentage of house-leaving and re-entering mosquitoes when an insecticide- treated net was present, was lower than in the presence of an untreated net. Our results indicated that there was no spatial repellent effect from pyrethroid-treated nets that influences house-entry at eave level. It is argued that the toxic effect of treated bed nets resulted in a reduced number of mosquitoes re-entering the house, which could thereby affect malaria transmission in neighbouring, unprotected houses. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Managing mosquito spaces: Citizen self-governance of disease vectors in a desert landscape.

    PubMed

    vonHedemann, Nicolena; Robbins, Paul; Butterworth, Melinda K; Landau, Katheryn; Morin, Cory W

    2017-01-01

    Public health agencies' strategies to control disease vectors have increasingly included "soft" mosquito management programs that depend on citizen education and changing homeowner behaviors. In an effort to understand public responses to such campaigns, this research assesses the case of Tucson, Arizona, where West Nile virus presents a serious health risk and where management efforts have focused on public responsibility for mosquito control. Using surveys, interviews, and focus groups, we conclude that citizens have internalized responsibilities for mosquito management but also expect public management of parks and waterways while tending to reject the state's interference with privately owned parcels. Resident preferences for individualized mosquito management hinge on the belief that mosquito-borne diseases are not a large threat, a pervasive distrust of state management, and a fear of the assumed use of aerial pesticides by state managers. Opinions on who is responsible for mosquitoes hinge on both perceptions of mosquito ecology and territorial boundaries, with implications for future disease outbreaks. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. The redox-sensing gene Nrf2 affects intestinal homeostasis, insecticide resistance, and Zika virus susceptibility in the mosquito Aedes aegypti.

    PubMed

    Bottino-Rojas, Vanessa; Talyuli, Octavio A C; Carrara, Luana; Martins, Ademir J; James, Anthony A; Oliveira, Pedro L; Paiva-Silva, Gabriela O

    2018-06-08

    Production and degradation of reactive oxygen species (ROS) are extensively regulated to ensure proper cellular responses to various environmental stimuli and stresses. Moreover, physiologically generated ROS function as secondary messengers that can influence tissue homeostasis. The cap'n'collar transcription factor known as nuclear factor erythroid-derived factor 2 (Nrf2) coordinates an evolutionarily conserved transcriptional activation pathway that mediates antioxidant and detoxification responses in many animal species, including insects and mammals. Here, we show that Nrf2-mediated signaling affects embryo survival, midgut homeostasis, and redox biology in Aedes aegypti , a mosquito species vector of dengue, Zika, and other disease-causing viruses. We observed that AeNrf2 silencing increases ROS levels and stimulates intestinal stem cell proliferation. Because ROS production is a major aspect of innate immunity in mosquito gut, we found that a decrease in Nrf2 signaling results in reduced microbiota growth and Zika virus infection. Moreover, we provide evidence that AeNrf2 signaling also controls transcriptional adaptation of A. aegypti to insecticide challenge. Therefore, we conclude that Nrf2-mediated response regulates assorted gene clusters in A. aegypti that determine cellular and midgut redox balance, affecting overall xenobiotic resistance and vectorial adaptation of the mosquito. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Synthetic predator cues impair immune function and make the biological pesticide Bti more lethal for vector mosquitoes.

    PubMed

    Op De Beeck, Lin; Janssens, Lizanne; Stoks, Robby

    2016-03-01

    The control of vector mosquitoes is one of the biggest challenges facing humankind with the use of chemical pesticides often leading to environmental impact and the evolution of resistance. Although to a lesser extent, this also holds for Bacillus thuringiensis israelensis (Bti), the most widely used biological pesticide to control mosquito populations. This raises the need for the development of integrated pest management strategies that allow the reduction of Bti concentrations without loss of the mosquito control efficiency. To this end, we tested in a laboratory experiment the combined effects of larval exposure to a sublethal Bti concentration and predation risk cues on life history and physiology of larval and adult Culex pipiens mosquitoes. Besides natural predator kairomones and prey alarm cues, we also tested synthetic kairomones of Notonecta predators. Neither Bti nor predation risk cues affected mortality, yet when both stressors were combined mortality increased on average by 133% compared to the treatment with only predation risk cues. This synergistic interaction was also present when Bti was combined with synthetic kairomones. This was further reflected in changes of the composite index of population performance, which suggested lowered per capita growth rates in mosquitoes exposed to Bti but only when Bti was combined with synthetic kairomones. Furthermore, predation risk cues shortened larval development time, reduced mass at metamorphosis in males, and had an immunosuppressive effect in larval and adult mosquitoes which may affect the mosquito vector competence. We provide the first demonstration that synthetic kairomones may generate similar effects on prey as natural kairomones. The identified immunosuppressive effect of synthetic kairomones and the novel lethal synergism type between a biological pesticide and synthetic predator kairomones provide an important proof of principle illustrating the potential of this combination for integrated

  11. Neuropeptide Substance P and the Immune Response

    PubMed Central

    Tehrani, Mohsen; Grace, Peter M.; Pothoulakis, Charalabos; Dana, Reza

    2016-01-01

    Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of activity of immune cells. This Review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immuno-biology of substance P and we discuss the clinical implications of its ability to modulate the immune response. PMID:27314883

  12. Neuropeptide substance P and the immune response.

    PubMed

    Mashaghi, Alireza; Marmalidou, Anna; Tehrani, Mohsen; Grace, Peter M; Pothoulakis, Charalabos; Dana, Reza

    2016-11-01

    Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of the activity of immune cells. This review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immunobiology of substance P and discuss the clinical implications of its ability to modulate the immune response.

  13. Long-term pathogenic response to Plasmodium relictum infection in Culex pipiens mosquito.

    PubMed

    Pigeault, Romain; Villa, Manon

    2018-01-01

    The transmission of Plasmodium within a vertebrate host population is strongly associated with the life history traits of its vector. Therefore the effect of malaria infection on mosquito fecundity and longevity has traditionally received a lot of attention. Several species of malaria parasites reduce mosquito fecundity, nevertheless almost all of the studies have focused only on the first gonotrophic cycle. Yet, during their lifetime, female mosquitoes go through several gonotrophic cycles, which raises the question of whether they are able to compensate the fecundity costs induced by the parasite. The impact of Plasmodium infection on female longevity is not so clear and has produced conflicting results. Here we measured the impact of Plasmodium relictum on its vector's longevity and fecundity during three consecutive gonotrophic cycles. In accordance with previous studies, we observed a negative impact of Plasmodium infection on mosquito (Culex pipiens) fecundity in the first gonotrophic cycle. Interestingly, despite having taken two subsequent uninfected blood meals, the negative impact of malaria parasite persisted. Nevertheless no impact of infection on mosquito longevity was observed. Our results are not in line with the hypothesis that the reduction of fecundity observed in infected mosquitoes is an adaptive strategy of Plasmodium to increase the longevity of its vector. We discuss the different underlying mechanisms that may explain our results.

  14. Cellular Immune Response to Cytomegalovirus Infection After Renal Transplantation

    PubMed Central

    Linnemann, Calvin C.; Kauffman, Carol A.; First, M. Roy; Schiff, Gilbert M.; Phair, John P.

    1978-01-01

    A prospective study of 15 patients who received renal transplants defined the effect of renal transplantation on the cellular immune response to cytomegalovirus infection. Of 15 patients, 14 developed cytomegalovirus infection, usually in the first 2 months after transplantation, and all infections were accompanied by a normal humoral immune response. After the initiation of immunosuppressive therapy and transplantation, there was a general depression of lymphocyte transformation, as reflected in the response to phytohemagglutinin, accompanied by a specific defect in cellular immunity, as indicated by lymphocyte transformation to cytomegalovirus antigen. Eleven patients had cellular immunity to cytomegalovirus before transplantation, and all of these became negative in the first month after transplantation. In subsequent months, only 6 of the 14 study patients with cytomegalovirus infection developed specific cellular immune responses to cytomegalovirus. This occurred most often in patients who had severe febrile illnesses in association with infection. The specific cellular immune response which developed in the posttransplant period did not persist in three of the patients. This study demonstrates the dissociation of the humoral and cellular immune response to cytomegalovirus infection in renal transplant patients and indicates the importance of the loss of cellular immunity in the appearance of infection. Previously infected patients lost their cell-mediated immunity and had reactivation infections despite the presence of serum antibody. PMID:215541

  15. Host Immune Response to Influenza A Virus Infection.

    PubMed

    Chen, Xiaoyong; Liu, Shasha; Goraya, Mohsan Ullah; Maarouf, Mohamed; Huang, Shile; Chen, Ji-Long

    2018-01-01

    Influenza A viruses (IAVs) are contagious pathogens responsible for severe respiratory infection in humans and animals worldwide. Upon detection of IAV infection, host immune system aims to defend against and clear the viral infection. Innate immune system is comprised of physical barriers (mucus and collectins), various phagocytic cells, group of cytokines, interferons (IFNs), and IFN-stimulated genes, which provide first line of defense against IAV infection. The adaptive immunity is mediated by B cells and T cells, characterized with antigen-specific memory cells, capturing and neutralizing the pathogen. The humoral immune response functions through hemagglutinin-specific circulating antibodies to neutralize IAV. In addition, antibodies can bind to the surface of infected cells and induce antibody-dependent cell-mediated cytotoxicity or complement activation. Although there are neutralizing antibodies against the virus, cellular immunity also plays a crucial role in the fight against IAVs. On the other hand, IAVs have developed multiple strategies to escape from host immune surveillance for successful replication. In this review, we discuss how immune system, especially innate immune system and critical molecules are involved in the antiviral defense against IAVs. In addition, we highlight how IAVs antagonize different immune responses to achieve a successful infection.

  16. Immunomodulator-based enhancement of anti smallpox immune responses.

    PubMed

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L; Ríos-Olivares, Eddy; Otero, Miguel

    2015-01-01

    The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.

  17. Laser mimicking mosquito bites for skin delivery of malaria sporozoite vaccines

    PubMed Central

    Zhou, Chang; Chen, Xinyuan; Zhang, Qi; Wang, Ji; Wu, Mei X.

    2015-01-01

    Immunization with radiation-attenuated sporozoites (RAS) via mosquito bites has been shown to induce sterile immunity against malaria in humans, but this route of vaccination is neither practical nor ethical. The importance of delivering RAS to the liver through circulation in eliciting immunity against this parasite has been recently verified by human studies showing that high-level protection was achieved only by intravenous (IV) administration of RAS, but not by intradermal (ID) or subcutaneous (SC) vaccination. Here, we report in a murine model that ID inoculation of RAS into laser-illuminated skin confers immune protection against malarial infection almost as effectively as IV immunization. Brief illumination of the inoculation site with a low power 532 nm Nd:YAG laser enhanced the permeability of the capillary beneath the skin, owing to hemoglobin-specific absorbance of the light. The increased blood vessel permeability appeared to facilitate an association of RAS with blood vessel walls by an as-yet-unknown mechanism, ultimately promoting a 7-fold increase in RAS entering circulation and reaching the liver over ID administration. Accordingly, ID immunization of RAS at a laser-treated site stimulated much stronger sporozoite-specific antibody and CD8+IFN-γ+ T cell responses than ID vaccination and provided nearly full protection against malarial infection, whereas ID immunization alone was ineffective. This novel, safe, and convenient strategy to augment efficacy of ID sporozoite-based vaccines warrants further investigation in big animals and in humans. PMID:25725360

  18. Laser mimicking mosquito bites for skin delivery of malaria sporozoite vaccines.

    PubMed

    Zhou, Chang; Chen, Xinyuan; Zhang, Qi; Wang, Ji; Wu, Mei X

    2015-04-28

    Immunization with radiation-attenuated sporozoites (RAS) via mosquito bites has been shown to induce sterile immunity against malaria in humans, but this route of vaccination is neither practical nor ethical. The importance of delivering RAS to the liver through circulation in eliciting immunity against this parasite has been recently verified by human studies showing that high-level protection was achieved only by intravenous (IV) administration of RAS, not by intradermal (ID) or subcutaneous (SC) vaccination. Here, we report in a murine model that ID inoculation of RAS into laser-illuminated skin confers immune protection against malarial infection almost as effectively as IV immunization. Brief illumination of the inoculation site with a low power 532 nm Nd:YAG laser enhanced the permeability of the capillary beneath the skin, owing to hemoglobin-specific absorbance of the light. The increased blood vessel permeability appeared to facilitate an association of RAS with blood vessel walls by an as-yet-unknown mechanism, ultimately promoting a 7-fold increase in RAS entering circulation and reaching the liver over ID administration. Accordingly, ID immunization of RAS at a laser-treated site stimulated much stronger sporozoite-specific antibody and CD8(+)IFN-γ(+) T cell responses than ID vaccination and provided nearly full protection against malarial infection, whereas ID immunization alone was ineffective. This novel, safe, and convenient strategy to augment efficacy of ID sporozoite-based vaccines warrants further investigation in large animals and in humans. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Identification of super-infected Aedes triseriatus mosquitoes collected as eggs from the field and partial characterization of the infecting La Crosse viruses

    PubMed Central

    2010-01-01

    of Ae. triseriatus mosquitoes, which could maintain LACV in nature. A gene-for-gene interaction involving the viral NSm gene and a vector innate immune response gene may condition stabilized infection. PMID:20412589

  20. Stress proteins and the immune response.

    PubMed

    Moseley, P

    2000-07-25

    The heat shock or stress response is one of the most highly conserved adaptive responses in nature. In single cell organisms, the stress response confers tolerance to a variety of stresses including hyperthermia, hyperoxia, hypoxia, and other perturbations, which alter protein synthesis. This tolerance phenomenon is also extremely important in the multicellular organism, resulting in not only thermal tolerance, but also resistance to stresses of the whole organism such as ischemia-reperfusion injury. Moreover, recent data indicates that these stress proteins have the ability to modulate the cellular immune response. Although the terms heat shock proteins (HSPs) and stress proteins are often used interchangeably, the term stress proteins includes the HSPs, the glucose-regulated proteins (GRPs) and ubiquitin. The stress proteins may be grouped by molecular weight ranging from the large 110 kDa HSP110 to ubiquitin at 8 kDa. These proteins serve as cellular chaperones, participating in protein synthesis and transport through the various cellular compartments. Because these proteins have unique cellular localizations, the chaperone function of the stress proteins often involves a transfer of peptides between stress proteins as the peptide is moved between cellular compartments. For example, HSP70 is a cytosolic and nuclear chaperone, which is critical for the transfer of cellular peptides in the mitochondrion through a hand-off that involves mitochondrial HSP60 at the inner mitochondrial membrane. Similarly, cytosolic proteins are transferred from HSP70 to gp96 as they move into the endoplasmic reticulum. The central role of the stress proteins in the transfer of peptides through the cell may be responsible for the recently recognized importance of the stress proteins in the modulation of the immune system [Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61

  1. Modulation of Host Learning in Aedes aegypti Mosquitoes.

    PubMed

    Vinauger, Clément; Lahondère, Chloé; Wolff, Gabriella H; Locke, Lauren T; Liaw, Jessica E; Parrish, Jay Z; Akbari, Omar S; Dickinson, Michael H; Riffell, Jeffrey A

    2018-02-05

    How mosquitoes determine which individuals to bite has important epidemiological consequences. This choice is not random; most mosquitoes specialize in one or a few vertebrate host species, and some individuals in a host population are preferred over others. Mosquitoes will also blood feed from other hosts when their preferred is no longer abundant, but the mechanisms mediating these shifts between hosts, and preferences for certain individuals within a host species, remain unclear. Here, we show that olfactory learning may contribute to Aedes aegypti mosquito biting preferences and host shifts. Training and testing to scents of humans and other host species showed that mosquitoes can aversively learn the scent of specific humans and single odorants and learn to avoid the scent of rats (but not chickens). Using pharmacological interventions, RNAi, and CRISPR gene editing, we found that modification of the dopamine-1 receptor suppressed their learning abilities. We further show through combined electrophysiological and behavioral recordings from tethered flying mosquitoes that these odors evoke changes in both behavior and antennal lobe (AL) neuronal responses and that dopamine strongly modulates odor-evoked responses in AL neurons. Not only do these results provide direct experimental evidence that olfactory learning in mosquitoes can play an epidemiological role, but collectively, they also provide neuroanatomical and functional demonstration of the role of dopamine in mediating this learning-induced plasticity, for the first time in a disease vector insect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology

    1984-08-01

    ND-R171 381 HUR IMMUNE RESPONSES TO DENGUE VIRUSES (U) 1/1 MASSRCHUSETTS UNIY M9DICAL SCHOOL WORCESTER F R~ ENNIS RUG 94 DRMt17-2-C-2233 UNCLASSIFIED...Responses to Dengue Viruses Annual Report 0(August 1983-July 1984) Francis A. Ennis, M.D. August 1984 Supported by U.S. Army Medical Research and...3M1- NO. SON No. Frederick, Maryland 21701-5012 61102A 61102BSI0 AA 104 11. TITLE Oxkf* Samqy Oao" Human Immune Responses to Dengue Viruses 12. PERSON

  3. More than just immune evasion: Hijacking complement by Plasmodium falciparum.

    PubMed

    Schmidt, Christoph Q; Kennedy, Alexander T; Tham, Wai-Hong

    2015-09-01

    Malaria remains one of the world's deadliest diseases. Plasmodium falciparum is responsible for the most severe and lethal form of human malaria. P. falciparum's life cycle involves two obligate hosts: human and mosquito. From initial entry into these hosts, malaria parasites face the onslaught of the first line of host defence, the complement system. In this review, we discuss the complex interaction between complement and malaria infection in terms of hosts immune responses, parasite survival and pathogenesis of severe forms of malaria. We will focus on the role of complement receptor 1 and its associated polymorphisms in malaria immune complex clearance, as a mediator of parasite rosetting and as an entry receptor for P. falciparum invasion. Complement evasion strategies of P. falciparum parasites will also be highlighted. The sexual forms of the malaria parasites recruit the soluble human complement regulator Factor H to evade complement-mediated killing within the mosquito host. A novel evasion strategy is the deployment of parasite organelles to divert complement attack from infective blood stage parasites. Finally we outline the future challenge to understand the implications of these exploitation mechanisms in the interplay between successful infection of the host and pathogenesis observed in severe malaria. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Immune Response And Anamnestic Immune Response In Children After A 3-Dose Primary Hepatitis B Vaccination.

    PubMed

    Afzal, Muhammad Faheem; Sultan, Muhammad Ashraf; Saleemi, Ahmad Imran

    2016-01-01

    Diseases caused by Hepatitis B virus (HBV) have a worldwide distribution. Pakistan adopted the recommendations of World Health Organization (WHO) for routine universal infant vaccination against hepatitis B in 2002, currently being administered at 6, 10, and 14 weeks of age in a combination vaccine. This study was conducted to determine the immune response & anamnestic immune response in children, 9 months-10 years of age, after a 3dose primary Hepatitis B vaccination. This cross sectional study was conducted in the Department of Paediatrics, King Edward Medical University/Mayo Hospital, Lahore, Pakistan, from January to June, 2014. A total of 200 children of either sex between the ages of 9 months to 10 years, documented to have received 3 doses of hepatitis B vaccines according to Expanded Program of Immunization (6,10,14 weeks) schedule in infancy, were recruited by consecutive sampling. The level of serum antiHBsAb by ELIZA was measured. Children with antiHBs titers ≥10 mIU/mL were considered to be immune. Those with anti HBsAb levels <10 mIU/mL were offered a booster dose of infant recombinant hepatitis B vaccine. The second serum sample was obtained 21-28 days following the administration of the booster dose and the anamnestic immune response was measured. Data was analysed using SPSS 17 to determine the relation between time interval since last vaccination and antibody titer. Chi square test was applied. Of the 200 children, protective antibody response was found in 58%. Median serological response was 18.60 (range 2.82 - 65.15). Antibody levels were found to have a statistically significant ( pvalue 0.019) negative correlation with the time since last administration of vaccine. A booster dose of Hepatitis B vacci ne was administered to all nonresponders, with each registering a statistically significant (pvalue 0.00) anamnestic response. The vaccination schedule with short dosage interval was unable to provide protection to 42% of the study population

  5. The unfolded protein response in immunity and inflammation

    PubMed Central

    Grootjans, Joep; Kaser, Arthur; Kaufman, Randal J.; Blumberg, Richard S.

    2017-01-01

    The unfolded protein response (UPR) is a highly conserved pathway that allows the cell to manage endoplasmic reticulum (ER) stress that is imposed by the secretory demands associated with environmental forces. In this role, the UPR has increasingly been shown to have crucial functions in immunity and inflammation. In this Review, we discuss the importance of the UPR in the development, differentiation, function and survival of immune cells in meeting the needs of an immune response. In addition, we review current insights into how the UPR is involved in complex chronic inflammatory diseases and, through its role in immune regulation, antitumour responses. PMID:27346803

  6. Acute olfactory response of Culex mosquitoes to a human- and bird-derived attractant

    PubMed Central

    Syed, Zainulabeuddin; Leal, Walter S.

    2009-01-01

    West Nile virus, which is transmitted by Culex mosquitoes while feeding on birds and humans, has emerged as the dominant vector borne disease in North America. We have identified natural compounds from humans and birds, which are detected with extreme sensitivity by olfactory receptor neurons (ORNs) on the antennae of Culex pipiens quinquefasciatus (Cx. quinquefasciatus). One of these semiochemicals, nonanal, dominates the odorant spectrum of pigeons, chickens, and humans from various ethnic backgrounds. We determined the specificity and sensitivity of all ORN types housed in different sensilla types on Cx. quinquefasciatus antennae. Here, we present a comprehensive map of all antennal ORNs coding natural ligands and their dose-response functions. Nonanal is detected by a large array of sensilla and is by far the most potent stimulus; thus, supporting the assumption that Cx. quinquefasciatus can smell humans and birds. Nonanal and CO2 synergize, thus, leading to significantly higher catches of Culex mosquitoes in traps baited with binary than in those with individual lures. PMID:19858490

  7. Injury-induced immune responses in Hydra.

    PubMed

    Wenger, Yvan; Buzgariu, Wanda; Reiter, Silke; Galliot, Brigitte

    2014-08-01

    The impact of injury-induced immune responses on animal regenerative processes is highly variable, positive or negative depending on the context. This likely reflects the complexity of the innate immune system that behaves as a sentinel in the transition from injury to regeneration. Early-branching invertebrates with high regenerative potential as Hydra provide a unique framework to dissect how injury-induced immune responses impact regeneration. A series of early cellular events likely require an efficient immune response after amputation, as antimicrobial defence, epithelial cell stretching for wound closure, migration of interstitial progenitors toward the wound, cell death, phagocytosis of cell debris, or reconstruction of the extracellular matrix. The analysis of the injury-induced transcriptomic modulations of 2636 genes annotated as immune genes in Hydra identified 43 genes showing an immediate/early pulse regulation in all regenerative contexts examined. These regulations point to an enhanced cytoprotection via ROS signaling (Nrf, C/EBP, p62/SQSMT1-l2), TNFR and TLR signaling (TNFR16-like, TRAF2l, TRAF5l, jun, fos-related, SIK2, ATF1/CREB, LRRC28, LRRC40, LRRK2), proteasomal activity (p62/SQSMT1-l1, Ced6/Gulf, NEDD8-conjugating enzyme Ubc12), stress proteins (CRYAB1, CRYAB2, HSP16.2, DnaJB9, HSP90a1), all potentially regulating NF-κB activity. Other genes encoding immune-annotated proteins such as NPYR4, GTPases, Swap70, the antiproliferative BTG1, enzymes involved in lipid metabolism (5-lipoxygenase, ACSF4), secreted clotting factors, secreted peptidases are also pulse regulated upon bisection. By contrast, metalloproteinases and antimicrobial peptide genes largely follow a context-dependent regulation, whereas the protease inhibitor α2macroglobulin gene exhibits a sustained up-regulation. Hence a complex immune response to injury is linked to wound healing and regeneration in Hydra. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights

  8. B cell function in the immune response to helminths

    PubMed Central

    Harris, Nicola

    2010-01-01

    Similar T helper (Th)2-type immune responses are generated against different helminths parasites, but the mechanisms that initiate Th2 immunity, and the specific immune components that mediate protection against these parasites, can vary greatly. B cells are increasingly recognized as important during the Th2-type immune response to helminths, and B cell activation might be a target for effective vaccine development. Antibody production is a function of B cells during helminth infection and understanding how polyclonal and antigen-specific antibodies contribute should provide important insights into how protective immunity develops. In addition, B cells might also contribute to the host response against helminths through antibody-independent functions including, antigen-presentation, as well as regulatory and effector activity. In this review, we examine the role of B cells during Th2-type immune response to these multicellular parasites. PMID:21159556

  9. Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses

    PubMed Central

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L.; Ríos-Olivares, Eddy; Otero, Miguel

    2015-01-01

    Background The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. Methods We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. Results The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. Conclusion These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform. PMID:25875833

  10. Innate immune escape by Dengue and West Nile viruses.

    PubMed

    Gack, Michaela U; Diamond, Michael S

    2016-10-01

    Dengue (DENV) and West Nile (WNV) viruses are mosquito-transmitted flaviviruses that cause significant morbidity and mortality worldwide. Disease severity and pathogenesis of DENV and WNV infections in humans depend on many factors, including pre-existing immunity, strain virulence, host genetics and virus-host interactions. Among the flavivirus-host interactions, viral evasion of type I interferon (IFN)-mediated innate immunity has a critical role in modulating pathogenesis. DENV and WNV have evolved effective strategies to evade immune surveillance pathways that lead to IFN induction and to block signaling downstream of the IFN-α/β receptor. Here, we discuss recent advances in our understanding of the molecular mechanisms by which DENV and WNV antagonize the type I IFN response in human cells. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Mucosal immune response to poliovirus vaccines in childhood.

    PubMed

    Ogra, P L

    1984-01-01

    Comparative evaluation of the systemic and secretory antibody response to live attenuated (oral) poliovirus vaccine ( OPV ) or inactivated poliovirus vaccine (IPV) has suggested that both vaccines are highly effective in inducing seroconversion and in preventing paralytic poliomyelitis. However, parenteral immunization with IPV does not appear to be highly effective in inducing secretory antibody response in the nasopharynx or alimentary tract during primary immunization. Reimmunization with IPV in subjects previously primed with parenterally administered IPV appears to result in a mild booster effect on the development of secretory antibody response. More significantly, rechallenge by the oral route with OPV in IPV-primed subjects resulted in a marked enhancement of secretory antibody response. In general, no suppression of systemic or secretory response to poliovirus was observed with either form ( OPV vs. IPV) or with route of immunization. These observations are discussed in relation to the immune response observed with other mucosally or parenterally administered antigens. Their implications in the development of oral tolerance are briefly reviewed.

  12. Mosquito bite anaphylaxis: immunotherapy with whole body extracts.

    PubMed

    McCormack, D R; Salata, K F; Hershey, J N; Carpenter, G B; Engler, R J

    1995-01-01

    Adverse reactions to mosquito bites have been recognized for some time. These usually consist of large local swellings and redness, generalized urticaria, angioedema and less easily definable responses such as nausea, dizziness, headaches, and lethargy. We report two patients who experienced systemic anaphylaxis from mosquito bites. Both were skin tested and given immunotherapy using whole body mosquito extracts. Skin testing using whole body mosquito extracts was positive to Aedes aegypti at 1/1,000 weight/volume (wt/vol) in one patient and to Aedes aegypti at 1/100,000 wt/vol, and Culex pipiens at 1/10,000 wt/vol in the other. Skin testing of ten volunteers without a history of adverse reactions to mosquito bites was negative. Immunotherapy using these extracts resulted in resolution of adverse reactions to mosquito bites in one patient and a decrease in reactions in the other. Immunotherapy with whole body mosquito extracts is a viable treatment option that can play a role in patients with mosquito bite-induced anaphylaxis. It may also result in severe side effects and one must determine the benefit versus risks for each individual patient.

  13. Effect of antipyretic analgesics on immune responses to vaccination.

    PubMed

    Saleh, Ezzeldin; Moody, M Anthony; Walter, Emmanuel B

    2016-09-01

    While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses.

  14. Malaria transmission blocking immunity and sexual stage vaccines for interrupting malaria transmission in Latin America

    PubMed Central

    Arévalo-Herrera, Myriam; Solarte, Yezid; Marin, Catherin; Santos, Mariana; Castellanos, Jenniffer; Beier, John C; Valencia, Sócrates Herrera

    2016-01-01

    Malaria is a vector-borne disease that is considered to be one of the most serious public health problems due to its high global mortality and morbidity rates. Although multiple strategies for controlling malaria have been used, many have had limited impact due to the appearance and rapid dissemination of mosquito resistance to insecticides, parasite resistance to multiple antimalarial drug, and the lack of sustainability. Individuals in endemic areas that have been permanently exposed to the parasite develop specific immune responses capable of diminishing parasite burden and the clinical manifestations of the disease, including blocking of parasite transmission to the mosquito vector. This is referred to as transmission blocking (TB) immunity (TBI) and is mediated by specific antibodies and other factors ingested during the blood meal that inhibit parasite development in the mosquito. These antibodies recognize proteins expressed on either gametocytes or parasite stages that develop in the mosquito midgut and are considered to be potential malaria vaccine candidates. Although these candidates, collectively called TB vaccines (TBV), would not directly stop malaria from infecting individuals, but would stop transmission from infected person to non-infected person. Here, we review the progress that has been achieved in TBI studies and the development of TBV and we highlight their potential usefulness in areas of low endemicity such as Latin America. PMID:21881775

  15. Aedes-Borne Virus-Mosquito Interactions: Mass Spectrometry Strategies and Findings.

    PubMed

    Pando-Robles, Victoria; Batista, Cesar V

    2017-06-01

    Aedes-borne viruses are responsible for high-impact neglected tropical diseases and unpredictable outbreaks such as the ongoing Zika epidemics. Aedes mosquitoes spread different arboviruses such as Dengue virus (DENV), Chikungunya virus (CHIKV), and Zika virus, among others, and are responsible for the continuous emergence and reemergence of these pathogens. These viruses have complex transmission cycles that include two hosts, namely the Aedes mosquito as a vector and susceptible vertebrate hosts. Human infection with arboviruses causes diseases that range from subclinical or mild to febrile diseases, encephalitis, and hemorrhagic fever. Infected mosquitoes do not show detectable signs of disease, even though the virus maintains a lifelong persistent infection. The infection of the Aedes mosquito by viruses involves a molecular crosstalk between cell and viral proteins. An understanding of how mosquito vectors and viruses interact is of fundamental interest, and it also offers novel perspectives for disease control. In recent years, mass spectrometry (MS)-based strategies in combination with bioinformatics have been successfully applied to identify and quantify global changes in cellular proteins, lipids, peptides, and metabolites in response to viral infection. Although the information about proteomics in the Aedes mosquito is limited, the information that has been reported can set up the basis for future studies. This review reflects how MS-based approaches have extended our understanding of Aedes mosquito biology and the development of DENV and CHIKV infection in the vector. Finally, this review discusses future challenges in the field.

  16. Conditioning Individual Mosquitoes to an Odor: Sex, Source, and Time

    PubMed Central

    Sanford, Michelle R.; Tomberlin, Jeffery K.

    2011-01-01

    Olfactory conditioning of mosquitoes may have important implications for vector-pathogen-host dynamics. If mosquitoes learn about specific host attributes associated with pathogen infection, it may help to explain the heterogeneity of biting and disease patterns observed in the field. Sugar-feeding is a requirement for survival in both male and female mosquitoes. It provides a starting point for learning research in mosquitoes that avoids the confounding factors associated with the observer being a potential blood-host and has the capability to address certain areas of close-range mosquito learning behavior that have not previously been described. This study was designed to investigate the ability of the southern house mosquito, Culex quinquefasciatus Say to associate odor with a sugar-meal with emphasis on important experimental considerations of mosquito age (1.2 d old and 3–5 d old), sex (male and female), source (laboratory and wild), and the time between conditioning and testing (<5 min, 1 hr, 2.5 hr, 5 hr, 10 hr, and 24 hr). Mosquitoes were individually conditioned to an odor across these different experimental conditions. Details of the conditioning protocol are presented as well as the use of binary logistic regression to analyze the complex dataset generated from this experimental design. The results suggest that each of the experimental factors may be important in different ways. Both the source of the mosquitoes and sex of the mosquitoes had significant effects on conditioned responses. The largest effect on conditioning was observed in the lack of positive response following conditioning for females aged 3–5 d derived from a long established colony. Overall, this study provides a method for conditioning experiments involving individual mosquitoes at close range and provides for future discussion of the relevance and broader questions that can be asked of olfactory conditioning in mosquitoes. PMID:21887384

  17. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100- Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies

    PubMed Central

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke

    2013-01-01

    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN) or the intrapulmonary (IPL) route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses. PMID:23936066

  18. Behavioural responses of females of two anopheline mosquito species to human-occupied, insecticide-treated and untreated bed nets

    PubMed Central

    2014-01-01

    Background Insecticide-treated bed nets (ITNs), used extensively to reduce human exposure to malaria, work through physical and chemical means to block or deter host-seeking mosquitoes. Despite the importance of ITNs, very little is known about how host-seeking mosquitoes behave around occupied bed nets. As a result, evidence-based evaluations of the effects of physical damage on bed net effectiveness are not possible and there is a dearth of knowledge on which to base ITN design. Methods The dispersion of colony-raised female Anopheles gambiae and Anopheles albimanus was observed in 2-hr laboratory experiments in which up to 200 mosquitoes were released inside a mosquito-proof 3 m × 3 m tent housing a bed net arrayed with 18 30 cm × 30 cm sticky screen squares on the sides, ends and roof. Numbers of mosquitoes caught on the sticky squares were interpreted as the ‘mosquito pressure’ on that part of the net. Results Presence of a human subject in the bed net significantly increased total mosquito pressure on the net for both species and significantly re-oriented An. gambiae to the roof of the net. Anopheles albimanus pressure was greatest on the bed net roof in both host-present and no-host conditions. The effects of different human subjects in the bed net, of different ambient conditions (dry, cool conditions vs warm, humid conditions) and of bed net treatment (deltamethrin-treated or no insecticide) on mosquito pressure patterns were tested for both species. Species-specific pressure patterns did not vary greatly as a result of any of these factors though some differences were noted that may be due the size of the different human subjects. Conclusions As a result of the interaction between host-seeking responses and the convective plume from the net occupant, species-specific mosquito pressure patterns manifest more or less predictably on the bed net. This has implications for bed net design and suggests that current methods of assessing damaged

  19. Anopheles sinensis mosquito insecticide resistance: comparison of three mosquito sample collection and preparation methods and mosquito age in resistance measurements.

    PubMed

    Xu, Tielong; Zhong, Daibin; Tang, Linhua; Chang, Xuelian; Fu, Fengyang; Yan, Guiyun; Zheng, Bin

    2014-01-28

    Insecticide resistance monitoring in malaria mosquitoes is essential for guiding the rational use of insecticides in vector control programs. Resistance bioassay is the first step for insecticide monitoring and it lays an important foundation for molecular examination of resistance mechanisms. In the literature, various mosquito sample collection and preparation methods have been used, but how mosquito sample collection and preparation methods affect insecticide susceptibility bioassay results is largely unknown. The objectives of this study were to determine whether mosquito sample collection and preparation methods affected bioassay results, which may cause incorrect classification of mosquito resistance status. The study was conducted in Anopheles sinensis mosquitoes in two study sites in central China. Three mosquito sample collection and preparation methods were compared for insecticide susceptibility, kdr frequencies and metabolic enzyme activities: 1) adult mosquitoes collected from the field; 2) F1 adults from field collected, blood-fed mosquitoes; and 3) adult mosquitoes reared from field collected larvae. Mosquito sample collection and preparation methods significantly affected mortality rates in the standard WHO tube resistance bioassay. Mortality rate of field-collected female adults was 10-15% higher than in mosquitoes reared from field-collected larvae and F1 adults from field collected blood-fed females. This pattern was consistent in mosquitoes from the two study sites. High kdr mutation frequency (85-95%) with L1014F allele as the predominant mutation was found in our study populations. Field-collected female adults consistently exhibited the highest monooxygenase and GST activities. The higher mortality rate observed in the field-collected female mosquitoes may have been caused by a mixture of mosquitoes of different ages, as older mosquitoes were more susceptible to deltamethrin than younger mosquitoes. Female adults reared from field

  20. DNA and protein co-immunization improves the magnitude and longevity of humoral immune responses in macaques.

    PubMed

    Jalah, Rashmi; Kulkarni, Viraj; Patel, Vainav; Rosati, Margherita; Alicea, Candido; Bear, Jenifer; Yu, Lei; Guan, Yongjun; Shen, Xiaoying; Tomaras, Georgia D; LaBranche, Celia; Montefiori, David C; Prattipati, Rajasekhar; Pinter, Abraham; Bess, Julian; Lifson, Jeffrey D; Reed, Steven G; Sardesai, Niranjan Y; Venzon, David J; Valentin, Antonio; Pavlakis, George N; Felber, Barbara K

    2014-01-01

    We tested the concept of combining DNA with protein to improve anti-HIV Env systemic and mucosal humoral immune responses. Rhesus macaques were vaccinated with DNA, DNA&protein co-immunization or DNA prime followed by protein boost, and the magnitude and mucosal dissemination of the antibody responses were monitored in both plasma and mucosal secretions. We achieved induction of robust humoral responses by optimized DNA vaccination delivered by in vivo electroporation. These responses were greatly increased upon administration of a protein boost. Importantly, a co-immunization regimen of DNA&protein injected in the same muscle at the same time induced the highest systemic binding and neutralizing antibodies to homologous or heterologous Env as well as the highest Env-specific IgG in saliva. Inclusion of protein in the vaccine resulted in more immunized animals with Env-specific IgG in rectal fluids. Inclusion of DNA in the vaccine significantly increased the longevity of systemic humoral immune responses, whereas protein immunization, either as the only vaccine component or as boost after DNA prime, was followed by a great decline of humoral immune responses overtime. We conclude that DNA&protein co-delivery in a simple vaccine regimen combines the strength of each vaccine component, resulting in improved magnitude, extended longevity and increased mucosal dissemination of the induced antibodies in immunized rhesus macaques.

  1. Antitumor immune responses mediated by dendritic cells

    PubMed Central

    Spel, Lotte; Boelens, Jaap-Jan; Nierkens, Stefan; Boes, Marianne

    2013-01-01

    Dendritic cells (DCs) are essential for the induction of adaptive immune responses against malignant cells by virtue of their capacity to effectively cross-present exogenous antigens to T lymphocytes. Dying cancer cells are indeed a rich source of antigens that may be harnessed for the development of DC-based vaccines. In particular, malignant cells succumbing to apoptosis, rather than necrosis, appear to release antigens in a manner that allows for the elicitation of adaptive immune responses. In this review, we describe the processes that mediate the cross-presentation of antigens released by apoptotic cancer cells to CD8+ T lymphocytes, resulting in the activation of protective tumor-specific immune responses. PMID:24482744

  2. Effect of antipyretic analgesics on immune responses to vaccination

    PubMed Central

    Saleh, Ezzeldin; Moody, M. Anthony; Walter, Emmanuel B.

    2016-01-01

    ABSTRACT While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses. PMID:27246296

  3. The development of a fully-integrated immune response model (FIRM) simulator of the immune response through integration of multiple subset models

    PubMed Central

    2013-01-01

    Background The complexity and multiscale nature of the mammalian immune response provides an excellent test bed for the potential of mathematical modeling and simulation to facilitate mechanistic understanding. Historically, mathematical models of the immune response focused on subsets of the immune system and/or specific aspects of the response. Mathematical models have been developed for the humoral side of the immune response, or for the cellular side, or for cytokine kinetics, but rarely have they been proposed to encompass the overall system complexity. We propose here a framework for integration of subset models, based on a system biology approach. Results A dynamic simulator, the Fully-integrated Immune Response Model (FIRM), was built in a stepwise fashion by integrating published subset models and adding novel features. The approach used to build the model includes the formulation of the network of interacting species and the subsequent introduction of rate laws to describe each biological process. The resulting model represents a multi-organ structure, comprised of the target organ where the immune response takes place, circulating blood, lymphoid T, and lymphoid B tissue. The cell types accounted for include macrophages, a few T-cell lineages (cytotoxic, regulatory, helper 1, and helper 2), and B-cell activation to plasma cells. Four different cytokines were accounted for: IFN-γ, IL-4, IL-10 and IL-12. In addition, generic inflammatory signals are used to represent the kinetics of IL-1, IL-2, and TGF-β. Cell recruitment, differentiation, replication, apoptosis and migration are described as appropriate for the different cell types. The model is a hybrid structure containing information from several mammalian species. The structure of the network was built to be physiologically and biochemically consistent. Rate laws for all the cellular fate processes, growth factor production rates and half-lives, together with antibody production rates and half

  4. Parameters of Mosquito-Enhanced West Nile Virus Infection.

    PubMed

    Moser, Lindsey A; Lim, Pei-Yin; Styer, Linda M; Kramer, Laura D; Bernard, Kristen A

    2016-01-01

    The arthropod-borne West Nile virus (WNV) emerged in New York State in 1999 and quickly spread throughout the United States. Transmission is maintained in an enzootic cycle in which infected mosquitoes transmit the virus to susceptible hosts during probing and feeding. Arthropod-derived components within the viral inoculum are increasingly acknowledged to play a role in infection of vertebrate hosts. We previously showed that Culex tarsalis mosquito saliva and salivary gland extract (SGE) enhance the in vivo replication of WNV. Here, we characterized the effective dose, timing, and proximity of saliva and SGE administration necessary for enhancement of WNV viremia using a mouse model. Mosquito saliva and SGE enhanced viremia in a dose-dependent manner, and a single mosquito bite or as little as 0.01 μg of SGE was effective at enhancing viremia, suggesting a potent active salivary factor. Viremia was enhanced when SGE was injected in the same location as virus inoculation from 24 h before virus inoculation through 12 h after virus inoculation. These results were confirmed with mosquito saliva deposited by uninfected mosquitoes. When salivary treatment and virus inoculation were spatially separated, viremia was not enhanced. In summary, the effects of mosquito saliva and SGE were potent, long lasting, and localized, and these studies have implications for virus transmission in nature, where vertebrate hosts are fed upon by both infected and uninfected mosquitoes over time. Furthermore, our model provides a robust system to identify the salivary factor(s) responsible for enhancement of WNV replication. Mosquito-borne viruses are a significant class of agents causing emerging infectious diseases. WNV has caused over 18,000 cases of neuroinvasive disease in the United States since its emergence. We have shown that Culex tarsalis mosquito saliva and SGE enhance the replication of WNV. We now demonstrate that saliva and SGE have potent, long-lasting, and localized

  5. Damage signals in the insect immune response

    PubMed Central

    Krautz, Robert; Arefin, Badrul; Theopold, Ulrich

    2014-01-01

    Insects and mammals share an ancient innate immune system comprising both humoral and cellular responses. The insect immune system consists of the fat body, which secretes effector molecules into the hemolymph and several classes of hemocytes, which reside in the hemolymph and of protective border epithelia. Key features of wound- and immune responses are shared between insect and mammalian immune systems including the mode of activation by commonly shared microbial (non-self) patterns and the recognition of these patterns by dedicated receptors. It is unclear how metazoan parasites in insects, which lack these shared motifs, are recognized. Research in recent years has demonstrated that during entry into the insect host, many eukaryotic pathogens leave traces that alert potential hosts of the damage they have afflicted. In accordance with terminology used in the mammalian immune systems, these signals have been dubbed danger- or damage-associated signals. Damage signals are necessary byproducts generated during entering hosts either by mechanical or proteolytic damage. Here, we briefly review the current stage of knowledge on how wound closure and wound healing during mechanical damage is regulated and how damage-related signals contribute to these processes. We also discuss how sensors of proteolytic activity induce insect innate immune responses. Strikingly damage-associated signals are also released from cells that have aberrant growth, including tumor cells. These signals may induce apoptosis in the damaged cells, the recruitment of immune cells to the aberrant tissue and even activate humoral responses. Thus, this ensures the removal of aberrant cells and compensatory proliferation to replace lost tissue. Several of these pathways may have been co-opted from wound healing and developmental processes. PMID:25071815

  6. Mosquito vectors and the spread of cancer: an overlooked connection?

    PubMed

    Benelli, Giovanni; Lo Iacono, Annalisa; Canale, Angelo; Mehlhorn, Heinz

    2016-06-01

    Mosquitoes (Diptera: Culicidae) represent a key threat for millions of humans and animals worldwide, vectoring important pathogens and parasites, including malaria, dengue, filariasis, and Zika virus. Besides mosquito-borne diseases, cancers figure among the leading causes of mortality worldwide. It is expected that annual cancer cases will rise from 14 million in 2012 to 22 million within the next two decades. Notably, there are few contrasting evidences of the relationship between cancer and mosquito-borne diseases, with special reference to malaria. However, analogies at the cellular level for the two diseases were reported. Recently, a significant association of malaria incidence with all cancer mortality in 50 USA states was highlighted and may be explained by the ability of Plasmodium to induce suppression of the immune system. However, it was hypothesized that Anopheles vectors may transmit obscure viruses linked with cancer development. The possible activation of cancer pathways by mosquito feeding events is not rare. For instance, the hamster reticulum cell sarcoma can be transmitted through the bites of Aedes aegypti by a transfer of tumor cells. Furthermore, mosquito bites may influence human metabolic pathways following different mechanisms, leading to other viral infections and/or oncogenesis. Hypersensitivity to mosquito bites is routed by a unique pathogenic mechanism linking Epstein-Barr virus infection, allergy, and oncogenesis. During dengue virus infection, high viral titers, macrophage infiltration, and tumor necrosis factor alpha production in the local tissues are the three key important events that lead to hemorrhage. Overall, basic epidemiological knowledge on the relationships occurring between mosquito vector activity and the spread of cancer is urgently needed, as well as detailed information about the ability of Culicidae to transfer viruses or tumor cells among hosts over time. Current evidences on nanodrugs with multipotency against

  7. P. falciparum Infection Durations and Infectiousness Are Shaped by Antigenic Variation and Innate and Adaptive Host Immunity in a Mathematical Model

    PubMed Central

    Eckhoff, Philip

    2012-01-01

    Many questions remain about P. falciparum within-host dynamics, immunity, and transmission–issues that may affect public health campaign planning. These gaps in knowledge concern the distribution of durations of malaria infections, determination of peak parasitemia during acute infection, the relationships among gametocytes and immune responses and infectiousness to mosquitoes, and the effect of antigenic structure on reinfection outcomes. The present model of intra-host dynamics of P. falciparum implements detailed representations of parasite and immune dynamics, with structures based on minimal extrapolations from first-principles biology in its foundations. The model is designed to quickly and readily accommodate gains in mechanistic understanding and to evaluate effects of alternative biological hypothesis through in silico experiments. Simulations follow the parasite from the liver-stage through the detailed asexual cycle to clearance while tracking gametocyte populations. The modeled immune system includes innate inflammatory and specific antibody responses to a repertoire of antigens. The mechanistic focus provides clear explanations for the structure of the distribution of infection durations through the interaction of antigenic variation and innate and adaptive immunity. Infectiousness to mosquitoes appears to be determined not only by the density of gametocytes but also by the level of inflammatory cytokines, which harmonizes an extensive series of study results. Finally, pre-existing immunity can either decrease or increase the duration of infections upon reinfection, depending on the degree of overlap in antigenic repertoires and the strength of the pre-existing immunity. PMID:23028698

  8. Mosquitoes of field and forest: the scale of habitat segregation in a diverse mosquito assemblage.

    PubMed

    Reiskind, M H; Griffin, R H; Janairo, M S; Hopperstad, K A

    2017-03-01

    Knowledge of the distribution of arthropod vectors across a landscape is important in determining the risk for vector-borne disease. This has been well explored for ticks, but not for mosquitoes, despite their importance in the transmission of a variety of pathogens. This study examined the importance of habitat, habitat edges, and the scale at which mosquito abundance and diversity vary in a rural landscape by trapping along transects from grassland areas into forest patches. Significant patterns of vector diversity and distinct mosquito assemblages across habitats were found. The scale of individual species' responses to habitat edges was often dramatic, with several species rarely straying even 10 m from the edge. The present results suggest blood-seeking mosquito species are faithful to certain habitats, which has consequences for patterns of vector diversity and risk for pathogen transmission. This implies that analysts of risk for pathogen transmission and foci of control, and developers of land management strategies should assess habitat at a finer scale than previously considered. © 2016 The Royal Entomological Society.

  9. Interplay between behavioural thermoregulation and immune response in mealworms.

    PubMed

    Catalán, Tamara P; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco

    2012-11-01

    Since the preferential body temperature should positively correlate with physiological performance, behavioural fever should enhance an organism's immune response under an immune challenge. Here we have studied the preferential body temperature (T(p)) and its consequences on immune response performance after an immune challenge in larvae of Tenebrio molitor. We evaluated T(p) and immune responses of larvae following a challenge with various concentrations of lipopolysaccharide (LPS), and we studied the correlation between T(p) and two immune traits, namely antibacterial and phenoloxidase (PO) activities. Larvae that were immune challenged with higher LPS concentrations (C(50) and C(100)) preferred in average, warmer temperatures than did larvae challenged with lower concentrations (C(0) and C(25)). T(p) of C(25)-C(100) (challenged)-mealworms was 2.3°C higher than of C(0) (control) larvae. At lower LPS concentration immune challenge (C(0) and C(25)) antibacterial activity correlated positively with T(p), but at C(50) and C(100) correlation was lose. PO activity was higher at higher LPS concentration, but its magnitude of response did not correlate with T(p) Our data suggest that behavioural fever may have a positive effect on host performance by enhancing antibacterial response under a low pathogen load situation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Immunization with Brucella VirB Proteins Reduces Organ Colonization in Mice through a Th1-Type Immune Response and Elicits a Similar Immune Response in Dogs

    PubMed Central

    Pollak, Cora N.; Wanke, María Magdalena; Estein, Silvia M.; Delpino, M. Victoria; Monachesi, Norma E.; Comercio, Elida A.; Fossati, Carlos A.

    2014-01-01

    VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. PMID:25540276

  11. Immunization with Brucella VirB proteins reduces organ colonization in mice through a Th1-type immune response and elicits a similar immune response in dogs.

    PubMed

    Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C

    2015-03-01

    VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  12. The temporal spectrum of adult mosquito population fluctuations: conceptual and modeling implications.

    PubMed

    Jian, Yun; Silvestri, Sonia; Brown, Jeff; Hickman, Rick; Marani, Marco

    2014-01-01

    An improved understanding of mosquito population dynamics under natural environmental forcing requires adequate field observations spanning the full range of temporal scales over which mosquito abundance fluctuates in natural conditions. Here we analyze a 9-year daily time series of uninterrupted observations of adult mosquito abundance for multiple mosquito species in North Carolina to identify characteristic scales of temporal variability, the processes generating them, and the representativeness of observations at different sampling resolutions. We focus in particular on Aedes vexans and Culiseta melanura and, using a combination of spectral analysis and modeling, we find significant population fluctuations with characteristic periodicity between 2 days and several years. Population dynamical modelling suggests that the observed fast fluctuations scales (2 days-weeks) are importantly affected by a varying mosquito activity in response to rapid changes in meteorological conditions, a process neglected in most representations of mosquito population dynamics. We further suggest that the range of time scales over which adult mosquito population variability takes place can be divided into three main parts. At small time scales (indicatively 2 days-1 month) observed population fluctuations are mainly driven by behavioral responses to rapid changes in weather conditions. At intermediate scales (1 to several month) environmentally-forced fluctuations in generation times, mortality rates, and density dependence determine the population characteristic response times. At longer scales (annual to multi-annual) mosquito populations follow seasonal and inter-annual environmental changes. We conclude that observations of adult mosquito populations should be based on a sub-weekly sampling frequency and that predictive models of mosquito abundance must include behavioral dynamics to separate the effects of a varying mosquito activity from actual changes in the abundance of the

  13. Immune Response to Giardia duodenalis

    PubMed Central

    Faubert, Gaétan

    2000-01-01

    The intestinal protozoan Giardia duodenalis is a widespread opportunistic parasite of humans and animals. This parasite inhabits the upper part of the small intestine and has a direct life cycle. After ingestion of cysts, which are the infective stage, the trophozoites emerge from the cysts in the duodenum and attach to the small intestinal mucosa of the host. Since the migration of trophozoites from the lumen of the intestine into surrounding tissues is an unusual occurrence, the immune response to Giardia remains localized. The identification of antigens that play a role in acquired immunity has been difficult because of the occurrence of antigenic variation and because, Giardia being an ubiquituous organism, it is possible that the antigenic profiles of isolates from different geographic areas will vary. Innate-immunity mechanisms play a role in the control and/or severity of the infection. Both humoral and cell-mediated immune responses play a role in acquired immunity, but the mechanisms involved are unknown. A variety of serological assays have been used to detect circulating antibodies in serum. Because of the biological characteristics of the parasite and the lack of suitable antigens, the sensitivity of serological assays remains poor. On the other hand, detection of antigens in feces of infected patients has met with success. Commercial kits are available, and they are reported to be more sensitive than microscopic examination for the detection of giardiasis on a single specimen. PMID:10627490

  14. Q fever in pregnant goats: humoral and cellular immune responses

    PubMed Central

    2013-01-01

    Q fever is a zoonosis caused by the intracellular bacterium Coxiella burnetii. Both humoral and cellular immunity are important in the host defence against intracellular bacteria. Little is known about the immune response to C. burnetii infections in domestic ruminants even though these species are the major source of Q fever in humans. To investigate the goat’s immune response we inoculated groups of pregnant goats via inhalation with a Dutch outbreak isolate of C. burnetii. All animals were successfully infected. Phase 1 and Phase 2 IgM- and IgG-specific antibodies were measured. Cellular immune responses were investigated by interferon-gamma, enzyme-linked immunosorbent spot test (IFN-γ Elispot), lymphocyte proliferation test (LPT) and systemic cytokines. After two weeks post inoculation (wpi), a strong anti-C. burnetii Phase 2 IgM and IgG antibody response was observed while the increase in IgM anti-Phase 1 antibodies was less pronounced. IgG anti-Phase 1 antibodies started to rise at 6 wpi. Cellular immune responses were observed after parturition. Our results demonstrated humoral and cellular immune responses to C. burnetii infection in pregnant goats. Cell-mediated immune responses did not differ enough to distinguish between Coxiella-infected and non-infected pregnant animals, whereas a strong-phase specific antibody response is detected after 2 wpi. This humoral immune response may be useful in the early detection of C. burnetii-infected pregnant goats. PMID:23915213

  15. The innate and adaptive immune response to avian influenza virus

    USDA-ARS?s Scientific Manuscript database

    Protective immunity against viruses is mediated by the early innate immune responses and later on by the adaptive immune responses. The early innate immunity is designed to contain and limit virus replication in the host, primarily through cytokine and interferon production. Most all cells are cap...

  16. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology

    1986-07-01

    0-1 NO- 3K1- INO. "඄o. ________________%______ 61102A 1611025810 AA r104 (U) xvne Im e Seepuses to Donueo viruses If Irms Al. W~al 71W c 4w O PIT(w...HUMAN IMMUNE RESPONSES TO DENGUE VIRUSES . .. .............. Accesion For NTIS CRAM DTIC TAB 0 ANNUAL REPORT Unannounced 0 Justification FRANCIS A...purp6se of this study is to define the Immune responses of humans to dengue viruses . These studies should provide data which will be helpful in

  17. SUMO-Enriched Proteome for Drosophila Innate Immune Response

    PubMed Central

    Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S.

    2015-01-01

    Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. PMID:26290570

  18. SUMO-Enriched Proteome for Drosophila Innate Immune Response.

    PubMed

    Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S

    2015-08-18

    Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. Copyright © 2015 Handu et al.

  19. UV light and urban pollution: bad cocktail for mosquitoes?

    PubMed

    Tetreau, Guillaume; Chandor-Proust, Alexia; Faucon, Frédéric; Stalinski, Renaud; Akhouayri, Idir; Prud'homme, Sophie M; Régent-Kloeckner, Myriam; Raveton, Muriel; Reynaud, Stéphane

    2014-01-01

    Mosquito breeding sites consist of water pools, which can either be large open areas or highly covered ponds with vegetation, thus with different light exposures combined with the presence in water of xenobiotics including polycyclic aromatic hydrocarbons (PAHs) generated by urban pollution. UV light and PAHs are abiotic factors known to both affect the mosquito insecticide resistance status. Nonetheless, their potential combined effects on the mosquito physiology have never been investigated. The present article aims at describing the effects of UV exposure alongside water contamination with two major PAH pollutants (fluoranthene and benzo[a]pyrene) on a laboratory population of the yellow fever mosquito Aedes aegypti. To evaluate the effects of PAH exposure and low energetic UV (UV-A) irradiation on mosquitoes, different parameters were measured including: (1) The PAH localization and its impact on cell mortality by fluorescent microscopy; (2) The detoxification capacities (cytochrome P450, glutathione-S-transferase, esterase); (3) The responses to oxidative stress (Reactive Oxygen Species-ROS) and (4) The tolerance of mosquito larvae to a bioinsecticide (Bacillus thuringiensis subsp. israelensis-Bti) and to five chemical insecticides (DDT, imidacloprid, permethrin, propoxur and temephos). Contrasting effects regarding mosquito cell mortality, detoxification and oxidative stress were observed as being dependent on the pollutant considered, despite the fact that the two PAHs belong to the same family. Moreover, UV is able to modify pollutant effects on mosquitoes, including tolerance to three insecticides (imidacloprid, propoxur and temephos), cell damage and response to oxidative stress. Taken together, our results suggest that UV and pollution, individually or in combination, are abiotic parameters that can affect the physiology and insecticide tolerance of mosquitoes; but the complexity of their direct effect and of their interaction will require further

  20. “Looking over the Backyard Fence”: Householders and Mosquito Control

    PubMed Central

    Mainali, Samir; Lamichhane, Ram Sharan; Clark, Kim; Beatty, Shelley; Fatouros, Maria; Neville, Peter; Oosthuizen, Jacques

    2017-01-01

    (1) Background: Vector-borne diseases are a significant public health problem in Western Australia. Mosquitoes are responsible for the transmission of a number of pathogens and may pose a serious nuisance problem. Prevention efforts in the State are multi-faceted and include physical, chemical, and cultural control methods for restricting mosquito breeding. This is less complex where breeding areas are located within public open spaces. In Australia’s developed urban areas, breeding sites are, however, frequently located within private residential landholdings, where the scope of public health officials to act is constrained by law and practicality. Consequently, mosquito prevention in these locations is predominantly the responsibility of the residents. This research addressed a gap, both in understanding the degree to which “backyard” mosquito breeding has the potential to contribute to local mosquito problems, and in assessing what residents “think and do” about mosquito control within their home environment. (2) Methods: The study was conducted in the Town of Bassendean, a metropolitan Local Government Area of Perth, Western Australia, in close proximity to two natural, productive mosquito breeding sites, namely Ashfield Flats and Bindaring Park. A total of 150 householders were randomly surveyed during the summer of 2015–2016, to gauge residents’ knowledge, attitudes, and practices (KAP (knowledge, attitudes, and practices) Survey) in regards to mosquitoes, their breeding and ecology, and avoidance or minimization strategies. The survey comprised nine questions covering residents’ knowledge (3 questions), attitudes (3 questions), and practices (3 questions), as well as additional questions regarding the basic demographics of the resident. Larvae were collected from backyard containers and reared to adults for species identification. A series of Encephalitis Vector Surveillance carbon dioxide (EVS CO2) traps were also deployed, to assess adult

  1. Immune function trade-offs in response to parasite threats.

    PubMed

    Kirschman, Lucas J; Quade, Adam H; Zera, Anthony J; Warne, Robin W

    2017-04-01

    Immune function is often involved in physiological trade-offs because of the energetic costs of maintaining constitutive immunity and mounting responses to infection. However, immune function is a collection of discrete immunity factors and animals should allocate towards factors that combat the parasite threat with the highest fitness cost. For example, animals on dispersal fronts of expanding population may be released from density-dependent diseases. The costs of immunity, however, and life history trade-offs in general, are often context dependent. Trade-offs are often most apparent under conditions of unusually limited resources or when animals are particularly stressed, because the stress response can shift priorities. In this study we tested how humoral and cellular immune factors vary between phenotypes of a wing dimorphic cricket and how physiological stress influences these immune factors. We measured constitutive lysozyme activity, a humoral immune factor, and encapsulation response, a cellular immune factor. We also stressed the crickets with a sham predator in a full factorial design. We found that immune strategy could be explained by the selective pressures encountered by each morph and that stress decreased encapsulation, but not lysozyme activity. These results suggest a possible trade-off between humoral and cellular immunity. Given limited resources and the expense of immune factors, parasite pressures could play a key factor in maintaining insect polyphenism via disruptive selection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Innate immune sensing and response to influenza.

    PubMed

    Pulendran, Bali; Maddur, Mohan S

    2015-01-01

    Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocompromised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza.

  3. Control of epithelial immune-response genes and implications for airway immunity and inflammation.

    PubMed

    Holtzman, M J; Look, D C; Sampath, D; Castro, M; Koga, T; Walter, M J

    1998-01-01

    A major goal of our research is to understand how immune cells (especially T cells) infiltrate the pulmonary airway during host defense and inflammatory disease (especially asthma). In that context, we have proposed that epithelial cells lining the airway provide critical biochemical signals for immune-cell influx and activation and that this epithelial-immune cell interaction is a critical feature of airway inflammation and hyperreactivity. In this brief report, we describe our progress in defining a subset of epithelial immune-response genes the expression of which is coordinated for viral defense both directly in response to replicating virus and indirectly under the control of a specific interferon-gamma signal transduction pathway featuring the Stat1 transcription factor as a critical relay signal between cytoplasm and nucleus. Unexpectedly, the same pathway is also activated during asthmatic airway inflammation in a setting where there is no apparent infection and no increase in interferon-gamma levels. The findings provide the first evidence of an overactive Stat1-dependent gene network in asthmatic airways and a novel molecular link between mucosal immunity and inflammation. The findings also offer the possibility that overactivity of Stat1-dependent genes might augment a subsequent T helper cell (Th1)-type response to virus or might combine with a heightened Th2-type response to allergen to account for more severe exacerbations of asthma.

  4. Antiviral macrophage responses in flavivirus encephalitis

    PubMed Central

    Ashhurst, Thomas Myles; van Vreden, Caryn; Munoz-Erazo, Luis; Niewold, Paula; Watabe, Kanami; Terry, Rachael L.; Deffrasnes, Celine; Getts, Daniel R.; King, Nicholas Jonathan Cole

    2013-01-01

    Mosquito-borne flaviviruses are a major current and emerging threat, affecting millions of people worldwide. Global climate change, combined with increasing proximity of humans to animals and mosquito vectors by expansion into natural habitats, coupled with the increase in international travel, have resulted in significant spread and concomitant increase in the incidence of infection and severe disease. Although neuroinvasive disease has been well described for some viral infections such as Japanese Encephalitis virus (JEV) and West Nile virus (WNV), others such as dengue virus (DENV) have recently displayed an emerging pattern of neuroinvasive disease, distinct from the previously observed, systemically-induced encephalomyelopathy. In this setting, the immune response is a crucial component of host defence, in preventing viral dissemination and invasion of the central nervous system (CNS). However, subversion of the anti-viral activities of macrophages by flaviviruses can facilitate viral replication and spread, enhancing the intensity of immune responses, leading to severe immune-mediated disease which may be further exacerbated during the subsequent infection with some flaviviruses. Furthermore, in the CNS myeloid cells may be responsible for inducing specific inflammatory changes, which can lead to significant pathological damage during encephalitis. The interaction of virus and cells of the myeloid lineage is complex, and this interaction is likely responsible at least in part, for crucial differences between viral clearance and pathology. Recent studies on the role of myeloid cells in innate immunity and viral control, and the mechanisms of evasion and subversion used by flaviviruses are rapidly advancing our understanding of the immunopathological mechanisms involved in flavivirus encephalitis and will lead to the development of therapeutic strategies previously not considered. PMID:24434318

  5. Innate immune response development in nestling tree swallows

    USGS Publications Warehouse

    Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.

    2011-01-01

    We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.

  6. Modeling Systems-Level Regulation of Host Immune Responses

    PubMed Central

    Thakar, Juilee; Pilione, Mylisa; Kirimanjeswara, Girish; Harvill, Eric T; Albert, Réka

    2007-01-01

    Many pathogens are able to manipulate the signaling pathways responsible for the generation of host immune responses. Here we examine and model a respiratory infection system in which disruption of host immune functions or of bacterial factors changes the dynamics of the infection. We synthesize the network of interactions between host immune components and two closely related bacteria in the genus Bordetellae. We incorporate existing experimental information on the timing of immune regulatory events into a discrete dynamic model, and verify the model by comparing the effects of simulated disruptions to the experimental outcome of knockout mutations. Our model indicates that the infection time course of both Bordetellae can be separated into three distinct phases based on the most active immune processes. We compare and discuss the effect of the species-specific virulence factors on disrupting the immune response during their infection of naive, antibody-treated, diseased, or convalescent hosts. Our model offers predictions regarding cytokine regulation, key immune components, and clearance of secondary infections; we experimentally validate two of these predictions. This type of modeling provides new insights into the virulence, pathogenesis, and host adaptation of disease-causing microorganisms and allows systems-level analysis that is not always possible using traditional methods. PMID:17559300

  7. Bacterial Outer Membrane Vesicles Induce Plant Immune Responses.

    PubMed

    Bahar, Ofir; Mordukhovich, Gideon; Luu, Dee Dee; Schwessinger, Benjamin; Daudi, Arsalan; Jehle, Anna Kristina; Felix, Georg; Ronald, Pamela C

    2016-05-01

    Gram-negative bacteria continuously pinch off portions of their outer membrane, releasing membrane vesicles. These outer membrane vesicles (OMVs) are involved in multiple processes including cell-to-cell communication, biofilm formation, stress tolerance, horizontal gene transfer, and virulence. OMVs are also known modulators of the mammalian immune response. Despite the well-documented role of OMVs in mammalian-bacterial communication, their interaction with plants is not well studied. To examine whether OMVs of plant pathogens modulate the plant immune response, we purified OMVs from four different plant pathogens and used them to treat Arabidopsis thaliana. OMVs rapidly induced a reactive oxygen species burst, medium alkalinization, and defense gene expression in A. thaliana leaf discs, cell cultures, and seedlings, respectively. Western blot analysis revealed that EF-Tu is present in OMVs and that it serves as an elicitor of the plant immune response in this form. Our results further show that the immune coreceptors BAK1 and SOBIR1 mediate OMV perception and response. Taken together, our results demonstrate that plants can detect and respond to OMV-associated molecules by activation of their immune system, revealing a new facet of plant-bacterial interactions.

  8. Agouron and immune response to commercialize remune immune-based treatment.

    PubMed

    James, J S

    1998-06-19

    Agouron Pharmaceuticals agreed in June to collaborate with The Immune Response Corporation on the final development and marketing of an immune-based treatment for HIV. Remune, the vaccine developed by Dr. Jonas Salk, is currently in Phase III randomized trials with 2,500 patients, and the trials are expected to be completed in April 1999. Immune-based treatments have been difficult to test, as there is no surrogate marker, like viral load, to determine if the drug is working. Agouron agreed to participate in the joint venture after reviewing encouraging results from preliminary trials in which remune was taken in combination with highly active antiretroviral drugs.

  9. Immune Responses and Protection of Aotus Monkeys Immunized with Irradiated Plasmodium vivax Sporozoites

    PubMed Central

    Jordán-Villegas, Alejandro; Perdomo, Anilza Bonelo; Epstein, Judith E.; López, Jesús; Castellanos, Alejandro; Manzano, María R.; Hernández, Miguel A.; Soto, Liliana; Méndez, Fabián; Richie, Thomas L.; Hoffman, Stephen L.; Arévalo-Herrera, Myriam; Herrera, Sócrates

    2011-01-01

    A non-human primate model for the induction of protective immunity against the pre-erythrocytic stages of Plasmodium vivax malaria using radiation-attenuated P. vivax sporozoites may help to characterize protective immune mechanisms and identify novel malaria vaccine candidates. Immune responses and protective efficacy induced by vaccination with irradiated P. vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups of six monkeys received two, five, or ten intravenous inoculations, respectively, of 100,000 irradiated P. vivax sporozoites; control groups received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that specifically recognized P. vivax sporozoites and the circumsporozoite protein. Additionally, immunization induced low levels of antigen-specific IFN-γ responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner. These findings suggest that the Aotus monkey model may be able to play a role in preclinical development of P. vivax pre-erythrocytic stage vaccines. PMID:21292877

  10. Modeling the interactions between pathogenic bacteria, bacteriophage and immune response

    NASA Astrophysics Data System (ADS)

    Leung, Chung Yin (Joey); Weitz, Joshua S.

    The prevalence of antibiotic-resistant strains of pathogenic bacteria has led to renewed interest in the use of bacteriophage (phage), or virus that infects bacteria, as a therapeutic agent against bacterial infections. However, little is known about the theoretical mechanism by which phage therapy may work. In particular, interactions between the bacteria, the phage and the host immune response crucially influences the outcome of the therapy. Few models of phage therapy have incorporated all these three components, and existing models suffer from unrealistic assumptions such as unbounded growth of the immune response. We propose a model of phage therapy with an emphasis on nonlinear feedback arising from interactions with bacteria and the immune response. Our model shows a synergistic effect between the phage and the immune response which underlies a possible mechanism for phage to catalyze the elimination of bacteria even when neither the immune response nor phage could do so alone. We study the significance of this effect for different parameters of infection and immune response, and discuss its implications for phage therapy.

  11. Relish2 mediates bursicon homodimer-induced prophylactic immunity in the mosquito Aedes aegypti

    USDA-ARS?s Scientific Manuscript database

    Bursicon is a neuropeptide hormone consisting of two cystine-knot proteins (burs a and burs ß), responsible for cuticle tanning and other developmental processes in insects. Recent studies show that each bursicon subunit forms homodimers that induce prophylactic immunity in Drosophila melanogaster. ...

  12. Vector competence of Aedes aegypti mosquitoes for filarial nematodes is affected by age and nutrient limitation.

    PubMed

    Ariani, Cristina V; Juneja, Punita; Smith, Sophia; Tinsley, Matthew C; Jiggins, Francis M

    2015-01-01

    Mosquitoes are one of the most important vectors of human disease. The ability of mosquitoes to transmit disease is dependent on the age structure of the population, as mosquitoes must survive long enough for the parasites to complete their development and infect another human. Age could have additional effects due to mortality rates and vector competence changing as mosquitoes senesce, but these are comparatively poorly understood. We have investigated these factors using the mosquito Aedes aegypti and the filarial nematode Brugia malayi. Rather than observing any effects of immune senescence, we found that older mosquitoes were more resistant, but this only occurred if they had previously been maintained on a nutrient-poor diet of fructose. Constant blood feeding reversed this decline in vector competence, meaning that the number of parasites remained relatively unchanged as mosquitoes aged. Old females that had been maintained on fructose also experienced a sharp spike in mortality after an infected blood meal ("refeeding syndrome") and few survived long enough for the parasite to develop. Again, this effect was prevented by frequent blood meals. Our results indicate that old mosquitoes may be inefficient vectors due to low vector competence and high mortality, but that frequent blood meals can prevent these effects of age. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Bovine immune response to inoculation with Neospora caninum surface antigen SRS2 lipopeptides mimics immune response to infection with live parasites.

    PubMed

    Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor

    2008-04-01

    Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.

  14. Peroxiredoxin 5 modulates immune response in Drosophila

    PubMed Central

    Radyuk, Svetlana N.; Michalak, Katarzyna; Klichko, Vladimir I.; Benes, Judith; Orr, William C.

    2010-01-01

    Background Peroxiredoxins are redox-sensing enzymes with multiple cellular functions. Previously, we reported on the potent antioxidant function of Drosophila peroxiredoxin 5 (dPrx5). Studies with mammalian and human cells suggest that peroxiredoxins can modulate immune-related signaling. Methods Survivorship studies and bacteriological analysis were used to determine resistance of flies to fungal and bacterial infections. RT-PCR and immunoblot analyses determined expression of dPrx5 and immunity factors in response to bacterial challenge. Double mutants for dprx5 gene and genes comprising the Imd/Relish and dTak1/Basket branches of the immune signaling pathways were used in epistatic analysis. Results The dprx5 mutant flies were more resistant to bacterial infection than controls, while flies overexpressing dPrx5 were more susceptible. The enhanced resistance to bacteria was accompanied by rapid induction of the Imd-dependent antimicrobial peptides, phosphorylation of the JNK kinase Basket and altered transcriptional profiling of the transient response genes, puckered, ets21C and relish, while the opposite effects were observed in flies over-expressing dPrx5. Epistatic analysis of double mutants, using attacin D and Puckered as read outs of activation of the Imd and JNK pathways, implicated dPrx5 function in the control of the dTak1-JNK arm of immune signaling. Conclusions Differential effects on fly survivorship suggested a trade-off between the antioxidant and immune functions of dPrx5. Molecular and epistatic analyses identified dPrx5 as a negative regulator in the dTak1-JNK arm of immune signaling. General significance Our findings suggest that peroxiredoxins play an important modulatory role in the Drosophila immune response. PMID:20600624

  15. The innate immune response during urinary tract infection and pyelonephritis

    PubMed Central

    Spencer, John David; Schwaderer, Andrew L.; Becknell, Brian; Watson, Joshua; Hains, David S.

    2013-01-01

    Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides – a ubiquitous component of the innate immune response. PMID:23732397

  16. The innate immune response during urinary tract infection and pyelonephritis.

    PubMed

    Spencer, John David; Schwaderer, Andrew L; Becknell, Brian; Watson, Joshua; Hains, David S

    2014-07-01

    Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides-a ubiquitous component of the innate immune response.

  17. Assessing humoral and cell-mediated immune response in Hawaiian green turtles, Chelonia mydas

    USGS Publications Warehouse

    Work, Thierry M.; Balazs, George H.; Rameyer, Robert; Chang, S.P.; Berestecky, J.

    2000-01-01

    Seven immature green turtles, Chelonia mydas, captured from Kaneohe Bay on the island of Oahu were used to evaluate methods for assessing their immune response. Two turtles each were immunized intramuscularly with egg white lysozyme (EWL) in Freund’s complete adjuvant, Gerbu, or ISA-70; a seventh turtle was immunized with saline only and served as a control. Humoral immune response was measured with an indirect enzyme linked immunosorbent assay (ELISA). Cell-mediated immune response was measured using in vitro cell proliferation assays (CPA) using whole blood or peripheral blood mononuclear cells (PBM) cultured with concanavalin A (ConA), phytohaemagglutinin (PHA), or soluble egg EWL antigen. All turtles, except for one immunized with Gerbu and the control, produced a detectable humoral immune response by 6 weeks which persisted for at least 14 weeks after a single immunization. All turtles produced an anamnestic humoral immune response after secondary immunization. Antigen specific cell-mediated immune response in PBM was seen in all turtles either after primary or secondary immunization, but it was not as consistent as humoral immune response; antigen specific cell-mediated immune response in whole blood was rarely seen. Mononuclear cells had significantly higher stimulation indices than whole blood regardless of adjuvant, however, results with whole blood had lower variability. Both Gerbu and ISA-70 appeared to potentiate the cell-mediated immune response when PBM or whole blood were cultured with PHA. This is the first time cell proliferation assays have been compared between whole blood and PBM for reptiles. This is also the first demonstration of antigen specific cell-mediated response in reptiles. Cell proliferation assays allowed us to evaluate the cell-mediated immune response of green turtles. However, CPA may be less reliable than ELISA for detecting antigen specific immune response. Either of the three adjuvants appears suitable to safely elicit a

  18. Apoptosis and other immune biomarkers predict influenza vaccine responsiveness.

    PubMed

    Furman, David; Jojic, Vladimir; Kidd, Brian; Shen-Orr, Shai; Price, Jordan; Jarrell, Justin; Tse, Tiffany; Huang, Huang; Lund, Peder; Maecker, Holden T; Utz, Paul J; Dekker, Cornelia L; Koller, Daphne; Davis, Mark M

    2013-04-16

    Despite the importance of the immune system in many diseases, there are currently no objective benchmarks of immunological health. In an effort to identifying such markers, we used influenza vaccination in 30 young (20-30 years) and 59 older subjects (60 to >89 years) as models for strong and weak immune responses, respectively, and assayed their serological responses to influenza strains as well as a wide variety of other parameters, including gene expression, antibodies to hemagglutinin peptides, serum cytokines, cell subset phenotypes and in vitro cytokine stimulation. Using machine learning, we identified nine variables that predict the antibody response with 84% accuracy. Two of these variables are involved in apoptosis, which positively associated with the response to vaccination and was confirmed to be a contributor to vaccine responsiveness in mice. The identification of these biomarkers provides new insights into what immune features may be most important for immune health.

  19. Immune and stress responses in oysters with insights on adaptation.

    PubMed

    Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude

    2015-09-01

    Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Innate Immune Sensing and Response to Influenza

    PubMed Central

    Pulendran, Bali; Maddur, Mohan S.

    2015-01-01

    Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocom-promised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza. PMID:25078919

  1. Anointing chemicals and ectoparasites: responses by ticks and mosquitoes to Citrus (Rutaceae) peel exudates and monoterpene constituents

    USDA-ARS?s Scientific Manuscript database

    Some birds and mammals rub their feathers or fur with the fruits or leaves of Citrus spp. or other Rutaceae, presumably to deter ectoparasites. We measured avoidance and other responses by the lone star tick (Amblyomma americanum) and the yellow fever mosquito (Aedes aegypti) to lemon peel exudate a...

  2. Mosquito populations dynamics associated with climate variations.

    PubMed

    Wilke, André Barretto Bruno; Medeiros-Sousa, Antônio Ralph; Ceretti-Junior, Walter; Marrelli, Mauro Toledo

    2017-02-01

    Mosquitoes are responsible for the transmission of numerous serious pathogens. Members of the Aedes and Culex genera, which include many important vectors of mosquito-borne diseases, are highly invasive and adapted to man-made environments. They are spread around the world involuntarily by humans and are highly adapted to urbanized environments, where they are exposed to climate-related abundance drivers. We investigated Culicidae fauna in two urban parks in the city of São Paulo to analyze the correlations between climatic variables and the population dynamics of mosquitoes in these urban areas. Mosquitoes were collected monthly over one year, and sampling sufficiency was evaluated after morphological identification of the specimens. The average monthly temperature and accumulated rainfall for the collection month and previous month were used to explain climate-related abundance drivers for the six most abundant species (Aedes aegypti, Aedes albopictus, Aedes fluviatilis, Aedes scapularis, Culex nigripalpus and Culex quinquefasciatus) and then analyzed using generalized linear statistical models and the Akaike Information Criteria corrected for small samples (AICc). The strength of evidence in favor of each model was evaluated using Akaike weights, and the explanatory model power was measured by McFadden's Pseudo-R 2 . Associations between climate and mosquito abundance were found in both parks, indicating that predictive models based on climate variables can provide important information on mosquito population dynamics. We also found that this association is species-dependent. Urbanization processes increase the abundance of a few mosquito species that are well adapted to man-made environments and some of which are important vectors of pathogens. Predictive models for abundance based on climate variables may help elucidate the population dynamics of urban mosquitoes and their impact on the risk of disease transmission, allowing better predictive scenarios to be

  3. Probiotics, antibiotics and the immune responses to vaccines

    PubMed Central

    Praharaj, Ira; John, Sushil M.; Bandyopadhyay, Rini; Kang, Gagandeep

    2015-01-01

    Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. PMID:25964456

  4. Probiotics, antibiotics and the immune responses to vaccines.

    PubMed

    Praharaj, Ira; John, Sushil M; Bandyopadhyay, Rini; Kang, Gagandeep

    2015-06-19

    Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  5. Characterization of host immune responses in Ebola virus infections.

    PubMed

    Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo

    2014-06-01

    Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.

  6. Arginine and Citrulline and the Immune Response in Sepsis

    PubMed Central

    Wijnands, Karolina A.P.; Castermans, Tessy M.R.; Hommen, Merel P.J.; Meesters, Dennis M.; Poeze, Martijn

    2015-01-01

    Arginine, a semi-essential amino acid is an important initiator of the immune response. Arginine serves as a precursor in several metabolic pathways in different organs. In the immune response, arginine metabolism and availability is determined by the nitric oxide synthases and the arginase enzymes, which convert arginine into nitric oxide (NO) and ornithine, respectively. Limitations in arginine availability during inflammatory conditions regulate macrophages and T-lymfocyte activation. Furthermore, over the past years more evidence has been gathered which showed that arginine and citrulline deficiencies may underlie the detrimental outcome of inflammatory conditions, such as sepsis and endotoxemia. Not only does the immune response contribute to the arginine deficiency, also the impaired arginine de novo synthesis in the kidney has a key role in the eventual observed arginine deficiency. The complex interplay between the immune response and the arginine-NO metabolism is further underscored by recent data of our group. In this review we give an overview of physiological arginine and citrulline metabolism and we address the experimental and clinical studies in which the arginine-citrulline NO pathway plays an essential role in the immune response, as initiator and therapeutic target. PMID:25699985

  7. The immune response to Nipah virus infection.

    PubMed

    Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J

    2012-09-01

    Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100 %. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research.

  8. Bicluster Pattern of Codon Context Usages between Flavivirus and Vector Mosquito Aedes aegypti: Relevance to Infection and Transcriptional Response of Mosquito Genes

    PubMed Central

    Behura, Susanta K.; Severson, David W.

    2014-01-01

    The mosquito Aedes aegypti is the primary vector of dengue virus (DENV) infection in most of the subtropical and tropical countries. Besides DENV, yellow fever virus (YFV) is also transmitted by A. aegypti. Susceptibility of A. aegypti to West Nile virus (WNV) has also been confirmed. Although studies have indicated correlation of codon bias between flaviviridae and their animal/insect hosts, it is not clear if codon sequences have any relation to susceptibility of A. aegypti to DENV, YFV and WNV. In the current study, usages of codon context sequences (codon pairs for neighboring amino acids) of the vector (A. aegypti) genome as well as the flaviviral genomes are investigated. We used bioinformatics methods to quantify codon context bias in a genome-wide manner of A. aegypti as well as DENV, WNV and YFV sequences. Mutual information statistics was applied to perform bicluster analysis of codon context bias between vector and flaviviral sequences. Functional relevance of the bicluster pattern was inferred from published microarray data. Our study shows that codon context bias of DENV, WNV and YFV sequences varies in a bicluster manner with that of specific sets of genes of A. aegypti. Many of these mosquito genes are known to be differentially expressed in response to flaviviral infection suggesting that codon context sequences of A. aegypti and the flaviviruses may play a role in the susceptible interaction between flaviviruses and this mosquito. The bias inusages of codon context sequences likely has a functional association with susceptibility of A. aegypti to flaviviral infection. The results from this study will allow us to conduct hypothesis driven tests to examine the role of codon contexts bias in evolution of vector-virus interactions at the molecular level. PMID:24838953

  9. Chemokine-mediated immune responses in the female genital tract mucosa.

    PubMed

    Deruaz, Maud; Luster, Andrew D

    2015-04-01

    The genital tract mucosa is the site where sexually transmitted infections gain entry to the host. The immune response at this site is thus critical to provide innate protection against pathogens that are seen for the very first time as well as provide long-term pathogen-specific immunity, which would be required for an effective vaccine against sexually transmitted infection. A finely regulated immune response is therefore required to provide an effective barrier against pathogens without compromising the capacity of the genital tract to allow for successful conception and fetal development. We review recent developments in our understanding of the immune response in the female genital tract to infectious pathogens, using herpes simplex virus-2, human immunodeficiency virus-1 and Chlamydia trachomatis as examples, with a particular focus on the role of chemokines in orchestrating immune cell migration necessary to achieve effective innate and adaptive immune responses in the female genital tract.

  10. Influence of ionizing radiation on the immune response

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brocadeszaalberg, O.

    1974-01-01

    The effects of ionizing radiation on the immune response are reviewed. Following an introduction on the function of the immune apparatus, the effect of radiation in the different cell types of the immune system is described. The possible consequences of these effects on the prognosis of radiation victims are discussed. (GRA)

  11. Essential oil of clove (Eugenia caryophyllata) augments the humoral immune response but decreases cell mediated immunity.

    PubMed

    Halder, Sumita; Mehta, Ashish K; Mediratta, Pramod K; Sharma, Krishna K

    2011-08-01

    The present study was undertaken to explore the effect of the essential oil isolated from the buds of Eugenia caryophyllata on some immunological parameters. Humoral immunity was assessed by measuring the hemagglutination titre to sheep red blood cells and delayed type hypersensitivity was assessed by measuring foot pad thickness. Clove oil administration produced a significant increase in the primary as well as secondary humoral immune response. In addition, it also produced a significant decrease in foot pad thickness compared with the control group. Thus, these results suggest that clove oil can modulate the immune response by augmenting humoral immunity and decreasing cell mediated immunity. Copyright © 2011 John Wiley & Sons, Ltd.

  12. Mosquito Life Cycle

    EPA Pesticide Factsheets

    Knowing the stages of the mosquito's life will help you prevent mosquitoes around your home and help you choose the right pesticides for your needs, if you decide to use them. All mosquito species go through four distinct stages during their live cycle.

  13. microRNA profiles and functions in mosquitoes

    PubMed Central

    Zhou, Shuisen; Wang, Jingwen; Hu, Wei

    2018-01-01

    Mosquitoes are incriminated as vectors for many crippling diseases, including malaria, West Nile fever, Dengue fever, and other neglected tropical diseases (NTDs). microRNAs (miRNAs) can interact with multiple target genes to elicit biological functions in the mosquitoes. However, characterization and function of individual miRNAs and their potential targets have not been fully determined to date. We conducted a systematic review of published literature following PRISMA guidelines. We summarize the information about miRNAs in mosquitoes to better understand their metabolism, development, and responses to microorganisms. Depending on the study, we found that miRNAs were dysregulated in a species-, sex-, stage-, and tissue/organ-specific manner. Aberrant miRNA expressions were observed in development, metabolism, host-pathogen interactions, and insecticide resistance. Of note, many miRNAs were down-regulated upon pathogen infection. The experimental studies have expanded the identification of miRNA target from the 3′ untranslated regions (UTRs) of mRNAs of mosquitoes to the 5′ UTRs of mRNAs of the virus. In addition, we discuss current trends in mosquito miRNA research and offer suggestions for future studies. PMID:29718912

  14. Novel flaviviruses from mosquitoes: Mosquito-specific evolutionary lineages within the phylogenetic group of mosquito-borne flaviviruses

    PubMed Central

    Huhtamo, Eili; Cook, Shelley; Moureau, Gregory; Uzcátegui, Nathalie Y.; Sironen, Tarja; Kuivanen, Suvi; Putkuri, Niina; Kurkela, Satu; Harbach, Ralph E.; Firth, Andrew E.; Vapalahti, Olli; Gould, Ernest A.; de Lamballerie, Xavier

    2014-01-01

    Novel flaviviruses that are genetically related to pathogenic mosquito-borne flaviviruses (MBFV) have been isolated from mosquitoes in various geographical locations, including Finland. We isolated and characterized another novel virus of this group from Finnish mosquitoes collected in 2007, designated as Ilomantsi virus (ILOV). Unlike the MBFV that infect both vertebrates and mosquitoes, the MBFV-related viruses appear to be specific to mosquitoes similar to the insect-specific flaviviruses (ISFs). In this overview of MBFV-related viruses we conclude that they differ from the ISFs genetically and antigenically. Phylogenetic analyses separated the MBFV-related viruses isolated in Africa, the Middle East and South America from those isolated in Europe and Asia. Serological cross-reactions of MBFV-related viruses with other flaviviruses and their potential for vector-borne transmission require further characterization. The divergent MBFV-related viruses are probably significantly under sampled to date and provide new information on the variety, properties and evolution of vector-borne flaviviruses. PMID:25108382

  15. Characterization of hemocytes from the mosquitoes Anopheles gambiae and Aedes aegypti.

    PubMed

    Castillo, J C; Robertson, A E; Strand, M R

    2006-12-01

    Hemocytes are an essential component of the mosquito immune system but current knowledge of the types of hemocytes mosquitoes produce, their relative abundance, and their functions is limited. Addressing these issues requires improved methods for collecting and maintaining mosquito hemocytes in vitro, and comparative data that address whether important vector species produce similar or different hemocyte types. Toward this end, we conducted a comparative study with Anopheles gambiae and Aedes aegypti. Collection method greatly affected the number of hemocytes and contaminants obtained from adult females of each species. Using a collection method called high injection/recovery, we concluded that hemolymph from An. gambiae and Ae. aegypti adult females contains three hemocyte types (granulocytes, oenocytoids and prohemocytes) that were distinguished from one another by a combination of morphological and functional markers. Significantly more hemocytes were recovered from An. gambiae females than Ae. aegypti. However, granulocytes were the most abundant cell type in both species while oenocytoids and prohemocytes comprised less than 10% of the total hemocyte population. The same hemocyte types were collected from larvae, pupae and adult males albeit the absolute number and proportion of each hemocyte type differed from adult females. The number of hemocytes recovered from sugar fed females declined with age but blood feeding transiently increased hemocyte abundance. Two antibodies tested as potential hemocyte markers (anti-PP06 and anti-Dox-A2) also exhibited alterations in staining patterns following immune challenge with the bacterium Escherichia coli.

  16. Onchocerciasis modulates the immune response to mycobacterial antigens

    PubMed Central

    Stewart, G R; Boussinesq, M; Coulson, T; Elson, L; Nutman, T; Bradley, J E

    1999-01-01

    Chronic helminth infection induces a type-2 cellular immune response. In contrast to this, mycobacterial infections commonly induce a type-1 immune response which is considered protective. Type-2 responses and diminished type-1 responses to mycobacteria have been previously correlated with active infection states such as pulmonary tuberculosis and lepromatous leprosy. The present study examines the immune responses of children exposed to both the helminth parasite Onchocerca volvulus and the mycobacterial infections, Mycobacterium tuberculosis and M. leprae. Proliferation of peripheral blood mononuclear cells (PBMC) and production of IL-4 in response to both helminth and mycobacterial antigen (PPD) decreased dramatically with increasing microfilarial (MF) density. Although interferon-gamma (IFN-γ) production strongly correlated with cellular proliferation, it was surprisingly not related to MF density for either antigen. IL-4 production in response to helminth antigen and PPD increased with ascending children's age. IFN-γ and cellular proliferation to PPD were not related to age, but in response to helminth antigen were significantly higher in children of age 9–12 years than children of either the younger age group (5–8 years) or the older group (13–16 years). Thus, there was a MF density-related down-regulation of cellular responsiveness and age-related skewing toward type 2 which was paralleled in response to both the helminth antigen and PPD. This parasite-induced immunomodulation of the response to mycobacteria correlates with a previous report of doubled incidence of lepromatous leprosy in onchocerciasis hyperendemic regions. Moreover, this demonstration that helminth infection in humans can modulate the immune response to a concurrent infection or immunological challenge is of critical importance to future vaccination strategies. PMID:10469056

  17. The Ocular Conjunctiva as a Mucosal Immunization Route: A Profile of the Immune Response to the Model Antigen Tetanus Toxoid

    PubMed Central

    Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana

    2013-01-01

    Background In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. Materials and methods BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. Results The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conclusion Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively. PMID

  18. The ocular conjunctiva as a mucosal immunization route: a profile of the immune response to the model antigen tetanus toxoid.

    PubMed

    Barisani-Asenbauer, Talin; Inic-Kanada, Aleksandra; Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana

    2013-01-01

    In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively.

  19. Sex differences in immune responses: Hormonal effects, antagonistic selection, and evolutionary consequences.

    PubMed

    Roved, Jacob; Westerdahl, Helena; Hasselquist, Dennis

    2017-02-01

    Males and females differ in both parasite load and the strength of immune responses and these effects have been verified in humans and other vertebrates. Sex hormones act as important modulators of immune responses; the male sex hormone testosterone is generally immunosuppressive while the female sex hormone estrogen tends to be immunoenhancing. Different sets of T-helper cells (Th) have important roles in adaptive immunity, e.g. Th1 cells trigger type 1 responses which are primarily cell-mediated, and Th2 cells trigger type 2 responses which are primarily humoral responses. In our review of the literature, we find that estrogen and progesterone enhance type 2 and suppress type 1 responses in females, whereas testosterone suppresses type 2 responses and shows an inconsistent pattern for type 1 responses in males. When we combine these patterns of generally immunosuppressive and immunoenhancing effects of the sex hormones, our results imply that the sex differences in immune responses should be particularly strong in immune functions associated with type 2 responses, and less pronounced with type 1 responses. In general the hormone-mediated sex differences in immune responses may lead to genetic sexual conflicts on immunity. Thus, we propose the novel hypothesis that sexually antagonistic selection may act on immune genes shared by the sexes, and that the strength of this sexually antagonistic selection should be stronger for type 2- as compared with type 1-associated immune genes. Finally, we put the consequences of sex hormone-induced effects on immune responses into behavioral and ecological contexts, considering social mating system, sexual selection, geographical distribution of hosts, and parasite abundance. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Enhancing the Immune Response to Recombinant Plague Antigens

    DTIC Science & Technology

    2006-05-01

    Wakelin. 2003. Effect of priming/booster immunisation protocols on immune response to canine parvovirus peptide induced by vaccination with a chimaeric...onset, the high mortality, and the rapid spread of the disease. Immunization against aerosolized plague presents a particular challenge for vaccine ...homologous boosting at increasing the magnitude and/or duration of the antibody response. 15. SUBJECT TERMS Biological warfare, vaccine , adjuvant

  1. Effect of adjuvants and route of immunizations on the immune response to recombinant plague antigens

    PubMed Central

    Uddowla, Sabena; Freytag, Lucy C.; Clements, John D.

    2007-01-01

    In this study, we compare four different adjuvants, LT(R192G), CpG ODN, MPL®TDM and alum, for their ability to affect the magnitude, distribution, and duration of antibody responses against F1-V, the lead-candidate antigen for the next generation vaccine against plague, in a murine model. In addition, three different routes of immunization – intranasal (IN), transcutaneous (TC), and subcutaneous (SC), were compared with each adjuvant. Since aerosol exposure to biological warfare agents is of primary concern, both serum and bronchioalveolar lavage (BAL) were analyzed for antigen-specific antibody responses. The most significant findings of the study reported here are that 1) the adjuvant influences the Type 1/Type 2 balance of the antibody response in both the serum and BAL, 2) mucosal immunization is not necessary to obtain F1-V-specific BAL responses, 3) non-traditional adjuvants such as LT(R192G) work when delivered SC, 4) the route of immunization affects the magnitude of the immune response, and 5) F1-V is highly immunogenic by some routes even in the absence of an exogenously applied adjuvant. These studies provide important insights into the influence of different classes of adjuvants on the immune outcome in biodefense vaccines and for development of new generation vaccines against other pathogens as well. PMID:17933440

  2. Costs of mounting an immune response during pregnancy in a lizard.

    PubMed

    Meylan, Sandrine; Richard, Murielle; Bauer, Sophie; Haussy, Claudy; Miles, Donald

    2013-01-01

    Immune defenses are of great benefit to hosts, but reducing the impact of infection by mounting an immune response also entails costs. However, the physiological mechanisms that generate the costs of an immune response remain poorly understood. Moreover, the majority of studies investigating the consequences of an immune challenge in vertebrates have been conducted on mammals and birds. The aim of this study is to investigate the physiological costs of mounting an immune response during gestation in an ectothermic species. Indeed, because ectothermic species are unable to internally regulate their body temperature, the apportionment of resources to homeostatic activities in ectothermic species can differ from that in endothermic species. We conducted this study on the common lizard Zootoca vivipara. We investigated the costs of mounting an immune response by injecting females with sheep red blood cells and quantified the consequences to reproductive performance (litter mass and success) and physiological performance (standard metabolic rate, endurance, and phytohemagglutinin response). In addition, we measured basking behavior. Our analyses revealed that mounting an immune response affected litter mass, physiological performance, and basking behavior. Moreover, we demonstrated that the modulation of an immune challenge is impacted by intrinsic factors, such as body size and condition.

  3. Multiscale modeling of mucosal immune responses

    PubMed Central

    2015-01-01

    Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut

  4. Multiscale modeling of mucosal immune responses.

    PubMed

    Mei, Yongguo; Abedi, Vida; Carbo, Adria; Zhang, Xiaoying; Lu, Pinyi; Philipson, Casandra; Hontecillas, Raquel; Hoops, Stefan; Liles, Nathan; Bassaganya-Riera, Josep

    2015-01-01

    Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut inflammation. Our modeling predictions dissect the mechanisms by which effector CD4+ T cell responses contribute to tissue damage in the gut mucosa following immune dysregulation.Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T

  5. [Effect of vitamine A on mice immune response induced by specific periodontal pathogenic bacteria-immunization].

    PubMed

    Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai

    2010-12-01

    The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (P<0.05); The levels of IgG2a increased obviously, whereas the levels of IgG1 subtype antibody conspicuous decreased, with a significant difference (P<0.05). Aa immunized group could induce body to produce a strong specific T-cell immune response, but Aa immunized+VAD group had a higher T cell proliferate response compared with Aa immunized+RD group, with a statistically significant difference (P<0.05); The expression of RANKL, IFN-γ and TNF-α supernatant increased, while the expression of IL-10 decreased (P<0.05). The lack of vitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).

  6. The immune response to Nipah virus infection

    PubMed Central

    Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J.

    2012-01-01

    Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100%. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research. PMID:22669317

  7. Cytomegalovirus infection enhances the immune response to influenza.

    PubMed

    Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai S; Angel, Cesar J L; Onengut-Gumuscu, Suna; Kidd, Brian A; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M

    2015-04-01

    Cytomegalovirus (CMV) is a β-herpesvirus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli, and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV status. In contrast, CMV-seropositive young adults exhibited enhanced antibody responses to influenza vaccination, increased CD8(+) T cell sensitivity, and elevated levels of circulating interferon-γ compared to seronegative individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the ubiquity of CMV infection in humans and many other species. Copyright © 2015, American Association for the Advancement of Science.

  8. A Modified Experimental Hut Design for Studying Responses of Disease-Transmitting Mosquitoes to Indoor Interventions: The Ifakara Experimental Huts

    PubMed Central

    Okumu, Fredros O.; Moore, Jason; Mbeyela, Edgar; Sherlock, Mark; Sangusangu, Robert; Ligamba, Godfrey; Russell, Tanya; Moore, Sarah J.

    2012-01-01

    Differences between individual human houses can confound results of studies aimed at evaluating indoor vector control interventions such as insecticide treated nets (ITNs) and indoor residual insecticide spraying (IRS). Specially designed and standardised experimental huts have historically provided a solution to this challenge, with an added advantage that they can be fitted with special interception traps to sample entering or exiting mosquitoes. However, many of these experimental hut designs have a number of limitations, for example: 1) inability to sample mosquitoes on all sides of huts, 2) increased likelihood of live mosquitoes flying out of the huts, leaving mainly dead ones, 3) difficulties of cleaning the huts when a new insecticide is to be tested, and 4) the generally small size of the experimental huts, which can misrepresent actual local house sizes or airflow dynamics in the local houses. Here, we describe a modified experimental hut design - The Ifakara Experimental Huts- and explain how these huts can be used to more realistically monitor behavioural and physiological responses of wild, free-flying disease-transmitting mosquitoes, including the African malaria vectors of the species complexes Anopheles gambiae and Anopheles funestus, to indoor vector control-technologies including ITNs and IRS. Important characteristics of the Ifakara experimental huts include: 1) interception traps fitted onto eave spaces and windows, 2) use of eave baffles (panels that direct mosquito movement) to control exit of live mosquitoes through the eave spaces, 3) use of replaceable wall panels and ceilings, which allow safe insecticide disposal and reuse of the huts to test different insecticides in successive periods, 4) the kit format of the huts allowing portability and 5) an improved suite of entomological procedures to maximise data quality. PMID:22347415

  9. Cellular immune response experiment MA-031

    NASA Technical Reports Server (NTRS)

    Criswell, B. S.

    1976-01-01

    Significant changes in phytohemagglutinin (PHA) lymphocytic responsiveness occurred in the cellular immune response of three astronauts during the 9 day flight of the Apollo Soyuz Test Project. Parameters studied were white blood cell concentrations, lymphocyte numbers, B- and T-lymphocyte distributions in peripheral blood, and lymphocyte responsiveness to PHA, pokeweed mitogen, Concanavalin A, and influenza virus antigen.

  10. Suppressive influences in the immune response to cancer.

    PubMed

    Bronte, Vincenzo; Mocellin, Simone

    2009-01-01

    Although much evidence has been gathered demonstrating that immune effectors can play a significant role in controlling tumor growth under natural conditions or in response to therapeutic manipulation, it is clear that malignant cells do evade immune surveillance in most cases. Considering that anticancer active specific immunotherapy seems to have reached a plateau of results and that currently no vaccination regimen is indicated as a standard anticancer therapy, the dissection of the molecular events underlying tumor immune escape is the necessary condition to make anticancer vaccines a therapeutic weapon effective enough to be implemented in the routine clinical setting. Recent years have witnessed significant advances in our understanding of the molecular mechanisms underlying tumor immune escape. These mechanistic insights are fostering the development of rationally designed therapeutics aimed to revert the immunosuppressive circuits that undermine an effective antitumor immune response. In this review, the best characterized mechanisms that allow cancer cells to evade immune surveillance are overviewed and the most debated controversies constellating this complex field are highlighted.

  11. Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis.

    PubMed

    Lemieux, Maxime W; Sonzogni-Desautels, Karine; Ndao, Momar

    2017-12-24

    In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between T H 1/T H 2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries.

  12. Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis

    PubMed Central

    Lemieux, Maxime W.; Sonzogni-Desautels, Karine; Ndao, Momar

    2017-01-01

    In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between TH1/TH2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries. PMID:29295550

  13. Fetal immune response to chorioamnionitis

    PubMed Central

    Kallapur, Suhas G.; Presicce, Pietro; Rueda, Cesar M.; Jobe, Alan H.; Chougnet, Claire A.

    2014-01-01

    Chorioamnionitis is a frequent cause of preterm birth and is associated with an increased risk for injury responses in the lung, GI tract, brain and other fetal organs. Chorioamnionitis is a polymicrobial non-traditional infectious disease because the organisms causing chorioamnionitis are generally of low virulence and colonize the amniotic fluid often for extended periods, and the host (mother and the fetus) does not have typical infection related symptoms such as fever. In this review, we discuss the effects of chorioamnionitis in experimental animal models that mimic the human disease. Our focus is on the immune changes in multiple fetal organs and the pathogenesis of chorioamnionitis induced injury in different fetal compartments. Since chorioamnionitis disproportionately affects preterm infants, we discuss the relevant developmental context for the immune system. We also provide a clinical context for the fetal responses. PMID:24390922

  14. Human Immune Response to Dengue Infections

    DTIC Science & Technology

    1989-07-31

    antigens of all 4 serotypes. These CTL lysed autologous fibroblasts infected with vaccinia-dengue recombinant viruses containing the E, or several non...responses of PBMC from a dengue 4-immune donor to call-free dengue viruses . .. ........... 6 Table 2. Lysis of dengue virus-infected fibroblasts by dengue...4-immune PBMC stimulated with dengue viruses ... ...... 7 Table 3. Inhibition of the lysis of dengue- infected fibroblasts by monoclonal anti-CD8

  15. Early-life inflammation, immune response and ageing.

    PubMed

    Khan, Imroze; Agashe, Deepa; Rolff, Jens

    2017-03-15

    Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. © 2017 The Author(s).

  16. Early-life inflammation, immune response and ageing

    PubMed Central

    2017-01-01

    Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. PMID:28275145

  17. Research Contributing to Improvements in Controlling Florida's Mosquitoes and Mosquito-borne Diseases.

    PubMed

    Tabachnick, Walter J

    2016-09-28

    Research on mosquitoes and mosquito-borne diseases has contributed to improvements in providing effective, efficient, and environmentally proper mosquito control. Florida has benefitted from several research accomplishments that have increased the state's mosquito control capabilities. Research with Florida's mosquitoes has resulted in the development of ecologically sound management of mosquito impoundments on Florida's east coast. This strategy, called Rotational Impoundment Management (RIM), has improved the ability to target the delivery of pesticides and has helped to reduce non-target effects and environmental damage. Research has led to the development of an arbovirus surveillance system which includes sentinel chicken surveillance, real time use of environmental contributing factors like meteorology and hydrology to target mosquito control, as well as public health efforts to mitigate disease outbreaks to areas with risk of disease. These research driven improvements have provided substantial benefits to all of Florida. More research is needed to meet the future challenges to reduce emerging pathogens like Zika virus and the consequences of environmental changes like global climate change that are likely to influence the effects of mosquito-borne pathogens on human health and well-being.

  18. Mosquito Biology and Mosquito-Borne Disease Awareness Among Island Communities In Malaysia.

    PubMed

    Shafie, Aziz; Roslan, Muhammad Aidil; Ngui, Romano; Lim, Yvonne Ai Lian; Sulaiman, Wan Yusoff Wan

    2016-12-01

    Mosquito-borne diseases have been increasing at an alarming rate over the past decades. In Malaysia, one finds several important mosquito-borne diseases such as Japanese encephalitis, dengue, malaria, and chikungunya. Mosquito surveillance and control programs are the most effective way of detecting and controlling mosquito-borne diseases, but these programs are less effective without an aware and well-informed general public. In 2014 we used a questionnaire to evaluate the extent of awareness of basic mosquito biology and mosquito-borne diseases in 6 villages, Kampung Masjid, Kampung Teluk Gedung, Kampung Teluk Dalam, Kampung Ujung Kelawai, Kampung Sungai Pinang Besar, and Kampung Sungai Pinang Kechil on Pangkor Island, Malaysia. A total of 1,012 individuals responded to the questionnaire, consisting of 790 Malay (78.1%), 164 Chinese (16.2%), and 58 Indian (5.7%). More than 60% (Malay = 73.7%, Chinese = 64.0%, Indian = 79.3%) of the respondents were familiar with basic mosquito biology and practiced personal protection against mosquito bites, and the association was statistically significant (P = 0.02). However, the majority of the respondents had limited knowledge on mosquito-borne diseases, and this varied significantly among the 3 ethnic groups (P = 0.0001). Our recommendations are to improve and intensify public health education outreach programs to the island residents and to encourage community participation in vector control programs.

  19. Engineering Immunity: Modulating Dendritic Cell Subsets and Lymph Node Response to Direct Immune-polarization and Vaccine Efficacy

    PubMed Central

    Leleux, Jardin; Atalis, Alexandra; Roy, Krishnendu

    2017-01-01

    While successful vaccines have been developed against many pathogens, there are still many diseases and pathogenic infections that are highly evasive to current vaccination strategies. Thus, more sophisticated approaches to control the type and quality of vaccine-induced immune response must be developed. Dendritic cells (DCs) are the sentinels of the body and play a critical role in immune response generation and direction by bridging innate and adaptive immunity. It is now well recognized that DCs can be separated into many subgroups, each of which has a unique function. Better understanding of how various DC subsets, in lymphoid organs and in the periphery, can be targeted through controlled delivery; and how these subsets modulate and control the resulting immune response could greatly enhance our ability to develop new, effective vaccines against complex diseases. In this review, we provide an overview of DC subset biology and discuss current immunotherapeutic strategies that utilize DC targeting to modulate and control immune responses. PMID:26489733

  20. Nest Mosquito Trap quantifies contact rates between nesting birds and mosquitoes.

    PubMed

    Caillouët, Kevin A; Riggan, Anna E; Rider, Mark; Bulluck, Lesley P

    2012-06-01

    Accurate estimates of host-vector contact rates are required for precise determination of arbovirus transmission intensity. We designed and tested a novel mosquito collection device, the Nest Mosquito Trap (NMT), to collect mosquitoes as they attempt to feed on unrestrained nesting birds in artificial nest boxes. In the laboratory, the NMT collected nearly one-third of the mosquitoes introduced to the nest boxes. We then used these laboratory data to estimate our capture efficiency of field-collected bird-seeking mosquitoes collected over 66 trap nights. We estimated that 7.5 mosquitoes per trap night attempted to feed on nesting birds in artificial nest boxes. Presence of the NMT did not have a negative effect on avian nest success when compared to occupied nest boxes that were not sampled with the trap. Future studies using the NMT may elucidate the role of nestlings in arbovirus transmission and further refine estimates of nesting bird and vector contact rates. © 2012 The Society for Vector Ecology.

  1. Nest Mosquito Trap quantifies contact rates between nesting birds and mosquitoes

    PubMed Central

    Caillouët, Kevin A.; Riggan, Anna E.; Rider, Mark; Bulluck, Lesley P.

    2012-01-01

    Accurate estimates of host-vector contact rates are required for precise determination of arbovirus transmission intensity. We designed and tested a novel mosquito collection device, the Nest Mosquito Trap (NMT), to collect mosquitoes as they attempt to feed on unrestrained nesting birds in artificial nest boxes. In the laboratory, the NMT collected nearly one-third of the mosquitoes introduced to the nest boxes. We then used these laboratory data to estimate our capture efficiency of field-collected bird-seeking mosquitoes collected over 66 trap nights. We estimated that 7.5 mosquitoes per trap night attempted to feed on nesting birds in artificial nest boxes. Presence of the NMT did not have a negative effect on avian nest success when compared to occupied nest boxes that were not sampled with the trap. Future studies using the NMT may elucidate the role of nestlings in arbovirus transmission and further refine estimates of nesting bird and vector contact rates. PMID:22548555

  2. Mosquito Bites

    MedlinePlus

    ... humans. Other mosquito-borne infections include yellow fever, malaria and some types of brain infection (encephalitis). Symptoms ... carry certain diseases, such as West Nile virus, malaria, yellow fever and dengue fever. The mosquito obtains ...

  3. Immunobiography and the Heterogeneity of Immune Responses in the Elderly: A Focus on Inflammaging and Trained Immunity

    PubMed Central

    Franceschi, Claudio; Salvioli, Stefano; Garagnani, Paolo; de Eguileor, Magda; Monti, Daniela; Capri, Miriam

    2017-01-01

    Owing to its memory and plasticity, the immune system (IS) is capable of recording all the immunological experiences and stimuli it was exposed to. The combination of type, dose, intensity, and temporal sequence of antigenic stimuli that each individual is exposed to has been named “immunobiography.” This immunological history induces a lifelong continuous adaptation of the IS, which is responsible for the capability to mount strong, weak or no response to specific antigens, thus determining the large heterogeneity of immunological responses. In the last years, it is becoming clear that memory is not solely a feature of adaptive immunity, as it has been observed that also innate immune cells are provided with a sort of memory, dubbed “trained immunity.” In this review, we discuss the main characteristics of trained immunity as a possible contributor to inflammaging within the perspective of immunobiography, with particular attention to the phenotypic changes of the cell populations known to be involved in trained immunity. In conclusion, immunobiography emerges as a pervasive and comprehensive concept that could help in understanding and interpret the individual heterogeneity of immune responses (to infections and vaccinations) that becomes particularly evident at old age and could affect immunosenescence and inflammaging. PMID:28861086

  4. Strain difference in the immune response to hydralazine in inbred guinea-pigs

    PubMed Central

    Ellman, L.; Inman, J.; Green, Ira

    1971-01-01

    Guinea-pigs were immunized with hydralazine in Freund's complete adjuvant. A marked strain difference in the immune response involving both anti-hydralazine antibody and delayed hypersensitivity to hydralazine was observed in different strains of guinea-pigs: Hartley guinea-pigs and inbred strain 13 guinea-pigs were able to mount a vigorous immune response to the drug while inbred strain 2 guinea-pigs appeared to be `low or non-responders'. This difference could not be explained in terms of metabolism of the drug in that no differences in acetylation were observed. Breeding studies suggest that immune responsiveness to hydralazine is inherited in an autosomal dominant manner. The immune response to hydralazine may be controlled by a `specific immune response gene' which appears not to be linked to the major strain 13 histocompatibility gene. Anti-nuclear and anti-DNA antibodies could not be demonstrated at a time when the animals manifested a strong immune response to hydralazine. Thus, the development of auto-immune phenomena does not appear to be related to the development of an immune response to the drug in short term immunization. Hydralazine-protein conjugates were synthesized, radio-iodinated and used in a Farr technique for the measurement of anti-hydralazine antibody. These techniques for the assay of anti-hydralazine antibodies may be useful in clinical investigations. Imagesp933-a PMID:5316639

  5. Factors that deregulate the protective immune response in tuberculosis.

    PubMed

    Hernandez-Pando, Rogelio; Orozco, Hector; Aguilar, Diana

    2009-01-01

    Tuberculosis (TB) is a chronic infectious disease which essentially affects the lungs and produces profound abnormalities on the immune system. Although most people infected by the tubercle bacillus (90%) do not develop the disease during their lifetime, when there are alterations in the immune system, such as co-infection with HIV, malnutrition, or diabetes, the risk of developing active disease increases considerably. Interestingly, during the course of active disease, even in the absence of immunosuppressive conditions, there is a profound and prolonged suppression of Mycobacterium tuberculosis-specific protective immune responses. Several immune factors can contribute to downregulate the protective immunity, permitting disease progression. In general, many of these factors are potent anti-inflammatory molecules that are probably overproduced with the intention to protect against tissue damage, but the consequence of this response is a decline in protective immunity facilitating bacilli growth and disease progression. Here the most significant participants in protective immunity are reviewed, in particular the factors that deregulate protective immunity in TB. Their manipulation as novel forms of immunotherapy are also briefly commented.

  6. piRNA Profiling of Dengue Virus Type 2-Infected Asian Tiger Mosquito and Midgut Tissues

    PubMed Central

    Wang, Yanhai; Jin, Binbin; Liu, Peiwen; Li, Jing; Chen, Xiaoguang; Gu, Jinbao

    2018-01-01

    The Asian tiger mosquito, Aedes albopictus, is a competent vector for the majority of arboviruses. The mosquito innate immune response is a primary determinant for arthropod-borne virus transmission, and the midgut is the first barrier to pathogen transmission. Mosquito antiviral immunity is primarily mediated by the small interfering RNA pathway. However, the roles that the P-element induced wimpy testis (PIWI)-interacting RNA (piRNA) pathway play in antiviral immunity in Ae. albopictus and its midgut still need further exploration. This study aimed to explore the profiles of both viral-derived and host-originated piRNAs in the whole body and midgut infected with Dengue virus 2 (DENV-2) in Ae. albopictus, and to elucidate gene expression profile differences of the PIWI protein family between adult females and their midguts. A deep sequencing-based method was used to identify and analyze small non-coding RNAs, especially the piRNA profiles in DENV-2-infected Ae. albopictus and its midgut. The top-ranked, differentially-expressed piRNAs were further validated using Stem-loop qRT-PCR. Bioinformatics analyses and reverse-transcription PCR (RT-PCR) methods were used to detect PIWI protein family members, and their expression profiles. DENV-2 derived piRNAs (vpiRNA, 24–30 nts) were observed in both infected Ae. albopictus and its midgut; however, only vpiRNA in the whole-body library had a weak preference for adenine at position 10 (10A) in the sense molecules as a feature of secondary piRNA. These vpiRNAs were not equally distributed, instead they were derived from a few specific regions of the genome, especially several hot spots, and displayed an obvious positive strand bias. We refer to the differentially expressed host piRNAs after DENV infection as virus-induced host endogenous piRNAs (vepiRNAs). However, we found that vepiRNAs were abundant in mosquito whole-body tissue, but deficient in the midgut. A total of eleven PIWI family genes were identified in Ae

  7. Immune response profiling in early rheumatoid arthritis: discovery of a novel interaction of treatment response with viral immunity

    PubMed Central

    2013-01-01

    Introduction It remains challenging to predict the outcomes of therapy in patients with rheumatoid arthritis (RA). The objective of this study was to identify immune response signatures that correlate with clinical treatment outcomes in patients with RA. Methods A cohort of 71 consecutive patients with early RA starting treatment with disease-modifying antirheumatic drugs (DMARDs) was recruited. Disease activity at baseline and after 21 to 24 weeks of follow-up was measured using the Disease Activity Score in 28 joints (DAS28). Immune response profiling was performed by analyzing multi-cytokine production from peripheral blood cells following incubation with a panel of stimuli, including a mixture of human cytomegalovirus (CMV) and Epstein-Barr virus (EBV) lysates. Profiles identified via principal components analysis (PCA) for each stimulus were then correlated with the ΔDAS28 from baseline to follow-up. A clinically meaningful improvement in the DAS28 was defined as a decrease of ≥1.2. Results A profile of T-cell cytokines (IL-13, IL-4, IL-5, IL-2, IL-12, and IFN-γ) produced in response to CMV/EBV was found to correlate with the ΔDAS28 from baseline to follow-up. At baseline, a higher magnitude of the CMV/EBV immune response profile predicted inadequate DAS28 improvement (mean PCA-1 scores: 65.6 versus 50.2; P = 0.029). The baseline CMV/EBV response was particularly driven by IFN-γ (P = 0.039) and IL-4 (P = 0.027). Among patients who attained clinically meaningful DAS28 improvement, the CMV/EBV PCA-1 score increased from baseline to follow-up (mean +11.6, SD 25.5), whereas among patients who responded inadequately to DMARD therapy, the CMV/EBV PCA-1 score decreased (mean -12.8, SD 25.4; P = 0.002). Irrespective of the ΔDAS28, methotrexate use was associated with up-regulation of the CMV/EBV response. The CMV/EBV profile was associated with positive CMV IgG (P <0.001), but not EBV IgG (P = 0.32), suggesting this response was related to

  8. Commensal Viruses of Mosquitoes: Host Restriction, Transmission, and Interaction with Arboviral Pathogens

    PubMed Central

    Hall, Roy A.; Bielefeldt-Ohmann, Helle; McLean, Breeanna J.; O’Brien, Caitlin A.; Colmant, Agathe M.G.; Piyasena, Thisun B.H.; Harrison, Jessica J.; Newton, Natalee D.; Barnard, Ross T.; Prow, Natalie A.; Deerain, Joshua M.; Mah, Marcus G.K.Y.; Hobson-Peters, Jody

    2016-01-01

    Recent advances in virus detection strategies and deep sequencing technologies have enabled the identification of a multitude of new viruses that persistently infect mosquitoes but do not infect vertebrates. These are usually referred to as insect-specific viruses (ISVs). These novel viruses have generated considerable interest in their modes of transmission, persistence in mosquito populations, the mechanisms that restrict their host range to mosquitoes, and their interactions with pathogens transmissible by the same mosquito. In this article, we discuss studies in our laboratory and others that demonstrate that many ISVs are efficiently transmitted directly from the female mosquito to their progeny via infected eggs, and, moreover, that persistent infection of mosquito cell cultures or whole mosquitoes with ISVs can restrict subsequent infection, replication, and transmission of some mosquito-borne viral pathogens. This suggests that some ISVs may act as natural regulators of arboviral transmission. We also discuss viral and host factors that may be responsible for their host restriction. PMID:28096646

  9. Novel flaviviruses from mosquitoes: mosquito-specific evolutionary lineages within the phylogenetic group of mosquito-borne flaviviruses.

    PubMed

    Huhtamo, Eili; Cook, Shelley; Moureau, Gregory; Uzcátegui, Nathalie Y; Sironen, Tarja; Kuivanen, Suvi; Putkuri, Niina; Kurkela, Satu; Harbach, Ralph E; Firth, Andrew E; Vapalahti, Olli; Gould, Ernest A; de Lamballerie, Xavier

    2014-09-01

    Novel flaviviruses that are genetically related to pathogenic mosquito-borne flaviviruses (MBFV) have been isolated from mosquitoes in various geographical locations, including Finland. We isolated and characterized another novel virus of this group from Finnish mosquitoes collected in 2007, designated as Ilomantsi virus (ILOV). Unlike the MBFV that infect both vertebrates and mosquitoes, the MBFV-related viruses appear to be specific to mosquitoes similar to the insect-specific flaviviruses (ISFs). In this overview of MBFV-related viruses we conclude that they differ from the ISFs genetically and antigenically. Phylogenetic analyses separated the MBFV-related viruses isolated in Africa, the Middle East and South America from those isolated in Europe and Asia. Serological cross-reactions of MBFV-related viruses with other flaviviruses and their potential for vector-borne transmission require further characterization. The divergent MBFV-related viruses are probably significantly under sampled to date and provide new information on the variety, properties and evolution of vector-borne flaviviruses. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Innate Immune Responses in Leprosy

    PubMed Central

    Pinheiro, Roberta Olmo; Schmitz, Veronica; Silva, Bruno Jorge de Andrade; Dias, André Alves; de Souza, Beatriz Junqueira; de Mattos Barbosa, Mayara Garcia; de Almeida Esquenazi, Danuza; Pessolani, Maria Cristina Vidal; Sarno, Euzenir Nunes

    2018-01-01

    Leprosy is an infectious disease that may present different clinical forms depending on host immune response to Mycobacterium leprae. Several studies have clarified the role of various T cell populations in leprosy; however, recent evidences suggest that local innate immune mechanisms are key determinants in driving the disease to its different clinical manifestations. Leprosy is an ideal model to study the immunoregulatory role of innate immune molecules and its interaction with nervous system, which can affect homeostasis and contribute to the development of inflammatory episodes during the course of the disease. Macrophages, dendritic cells, neutrophils, and keratinocytes are the major cell populations studied and the comprehension of the complex networking created by cytokine release, lipid and iron metabolism, as well as antimicrobial effector pathways might provide data that will help in the development of new strategies for leprosy management. PMID:29643852

  11. Transcriptional Profiling of the Immune Response to Marburg Virus Infection.

    PubMed

    Connor, John H; Yen, Judy; Caballero, Ignacio S; Garamszegi, Sara; Malhotra, Shikha; Lin, Kenny; Hensley, Lisa; Goff, Arthur J

    2015-10-01

    Marburg virus is a genetically simple RNA virus that causes a severe hemorrhagic fever in humans and nonhuman primates. The mechanism of pathogenesis of the infection is not well understood, but it is well accepted that pathogenesis is appreciably driven by a hyperactive immune response. To better understand the overall response to Marburg virus challenge, we undertook a transcriptomic analysis of immune cells circulating in the blood following aerosol exposure of rhesus macaques to a lethal dose of Marburg virus. Using two-color microarrays, we analyzed the transcriptomes of peripheral blood mononuclear cells that were collected throughout the course of infection from 1 to 9 days postexposure, representing the full course of the infection. The response followed a 3-stage induction (early infection, 1 to 3 days postexposure; midinfection, 5 days postexposure; late infection, 7 to 9 days postexposure) that was led by a robust innate immune response. The host response to aerosolized Marburg virus was evident at 1 day postexposure. Analysis of cytokine transcripts that were overexpressed during infection indicated that previously unanalyzed cytokines are likely induced in response to exposure to Marburg virus and further suggested that the early immune response is skewed toward a Th2 response that would hamper the development of an effective antiviral immune response early in disease. Late infection events included the upregulation of coagulation-associated factors. These findings demonstrate very early host responses to Marburg virus infection and provide a rich data set for identification of factors expressed throughout the course of infection that can be investigated as markers of infection and targets for therapy. Marburg virus causes a severe infection that is associated with high mortality and hemorrhage. The disease is associated with an immune response that contributes to the lethality of the disease. In this study, we investigated how the immune cells

  12. Preexisting Salmonella-specific immunity interferes with the subsequent development of immune responses against the Salmonella strains delivering H9N2 hemagglutinin.

    PubMed

    Hajam, Irshad Ahmed; Lee, John Hwa

    2017-06-01

    Recombinant Salmonella strains expressing foreign heterologous antigens have been extensively studied as promising live vaccine delivery vehicles. In this study, we constructed attenuated smooth (S-HA) and rough (R-HA) Salmonella strains expressing hemagglutinin (HA) of H9N2, a low pathogenic avian influenza A virus. We then investigated the HA-specific immune responses following oral immunization with either S-HA or R-HA strain in chicken model. We further examined the effects of the preexisting anti-Salmonella immunity on the subsequent elicitation of the HA and the Salmonella ompA specific immune responses. Our results showed that primary immunization with either the S-HA or the R-HA strain elicited comparable HA-specific immune responses and the responses were significantly (p<0.05) higher compared to the Salmonella vector control. When chickens were pre-immunized with the smooth Salmonella carrier alone and then vaccinated with either S-HA or R-HA strain 3, 6 and 9 weeks later, respectively, significant reductions were seen for HA-specific immune responses at week 6, a point which corresponded to the peak of the primary Salmonella-specific antibody responses. No reductions were seen at week 3 and 9, albeit, the HA-specific immune responses were boosted at week 9, a point which corresponded to the lowest primary Salmonella-specific antibody responses. The ompA recall responses remain refractory at week 3 and 6 following deliberate immunization with the carrier strain, but were significantly (p<0.05) increased at week 9 post-primary immunization. We conclude that preexisting anti-Salmonella immunity inhibits antigen-specific immune responses and this effect could be avoided by carefully selecting the time point when carrier-specific immune responses are relatively low. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight

    PubMed Central

    Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila

    2011-01-01

    Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297

  14. Innate Immune Responses to Cryptococcus.

    PubMed

    Heung, Lena J

    2017-09-01

    Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus , primarily the species C. neoformans , is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system.

  15. Leptospirosis in human: Biomarkers in host immune responses.

    PubMed

    Vk, Chin; Ty, Lee; Wf, Lim; Ywy, Wan Shahriman; An, Syafinaz; S, Zamberi; A, Maha

    2018-03-01

    Leptospirosis remains one of the most widespread zoonotic diseases caused by spirochetes of the genus Leptospira, which accounts for high morbidity and mortality globally. Leptospiral infections are often found in tropical and subtropical regions, with people exposed to contaminated environments or animal reservoirs are at high risk of getting the infection. Leptospirosis has a wide range of clinical manifestations with non-specific signs and symptoms and often misdiagnosed with other acute febrile illnesses at early stage of infection. Despite being one of the leading causes of zoonotic morbidity worldwide, there is still a gap between pathogenesis and human immune responses during leptospiral infection. It still remains obscure whether the severity of the infection is caused by the pathogenic properties of the Leptospira itself, or it is a consequence of imbalance host immune factors. Hence, in this review, we seek to summarize the past and present milestone findings on the biomarkers of host immune response aspects during human leptospiral infection, including cytokine and other immune mediators. A profound understanding of the interlink between virulence factors and host immune responses during human leptospirosis is imperative to identify potential biomarkers for diagnostic and prognostic applications as well as designing novel immunotherapeutic strategies in future. Copyright © 2017 Elsevier GmbH. All rights reserved.

  16. Viral Interference and Persistence in Mosquito-Borne Flaviviruses.

    PubMed

    Salas-Benito, Juan Santiago; De Nova-Ocampo, Mónica

    2015-01-01

    Mosquito-borne flaviviruses are important pathogens for humans, and the detection of two or more flaviviruses cocirculating in the same geographic area has often been reported. However, the epidemiological impact remains to be determined. Mosquito-borne flaviviruses are primarily transmitted through Aedes and Culex mosquitoes; these viruses establish a life-long or persistent infection without apparent pathological effects. This establishment requires a balance between virus replication and the antiviral host response. Viral interference is a phenomenon whereby one virus inhibits the replication of other viruses, and this condition is frequently associated with persistent infections. Viral interference and persistent infection are determined by several factors, such as defective interfering particles, competition for cellular factors required for translation/replication, and the host antiviral response. The interaction between two flaviviruses typically results in viral interference, indicating that these viruses share common features during the replicative cycle in the vector. The potential mechanisms involved in these processes are reviewed here.

  17. Light manipulation of mosquito behaviour: acute and sustained photic suppression of biting activity in the Anopheles gambiae malaria mosquito.

    PubMed

    Sheppard, Aaron D; Rund, Samuel S C; George, Gary F; Clark, Erin; Acri, Dominic J; Duffield, Giles E

    2017-06-16

    Host-seeking behaviours in anopheline mosquitoes are time-of-day specific, with a greater propensity for nocturnal biting. We investigated how a short exposure to light presented during the night or late day can inhibit biting activity and modulate flight activity behaviour. Anopheles gambiae (s.s.), maintained on a 12:12 LD cycle, were exposed transiently to white light for 10-min at the onset of night and the proportion taking a blood meal in a human biting assay was recorded every 2 h over an 8-h duration. The pulse significantly reduced biting propensity in mosquitoes 2 h following administration, in some trials for 4 h, and with no differences detected after 6 h. Conversely, biting levels were significantly elevated when mosquitoes were exposed to a dark treatment during the late day, suggesting that light suppresses biting behaviour even during the late daytime. These data reveal a potent effect of a discrete light pulse on biting behaviour that is both immediate and sustained. We expanded this approach to develop a method to reduce biting propensity throughout the night by exposing mosquitoes to a series of 6- or 10-min pulses presented every 2 h. We reveal both an immediate suppressive effect of light during the exposure period and 2 h after the pulse. This response was found to be effective during most times of the night: however, differential responses that were time-of-day specific suggest an underlying circadian property of the mosquito physiology that results in an altered treatment efficacy. Finally, we examined the immediate and sustained effects of light on mosquito flight activity behaviour following exposure to a 30-min pulse, and observed activity suppression during early night, and elevated activity during the late night. As mosquitoes and malaria parasites are becoming increasingly resistant to insecticide and drug treatment respectively, there is a necessity for the development of innovative control strategies beyond insecticide

  18. Mitigation of Inflammatory Immune Responses with Hydrophilic Nanoparticles.

    PubMed

    Li, Bowen; Xie, Jingyi; Yuan, Zhefan; Jain, Priyesh; Lin, Xiaojie; Wu, Kan; Jiang, Shaoyi

    2018-04-16

    While hydrophobic nanoparticles (NPs) have been long recognized to boost the immune activation, whether hydrophilic NPs modulate an immune system challenged by immune stimulators and how their hydrophilic properties may affect the immune response is still unclear. To answer this question, three polymers, poly(ethylene glycol) (PEG), poly(sulfobetaine) (PSB) and poly(carboxybetaine) (PCB), which are commonly considered hydrophilic, are studied in this work. For comparison, nanogels with uniform size and homogeneous surface functionalities were made from these polymers. Peripheral blood mononuclear cells (PBMCs) stimulated by lipopolysaccharide (LPS) and an LPS-induced lung inflammation murine model were used to investigate the influence of nanogels on the immune system. Results show that the treatment of hydrophilic nanogels attenuated the immune responses elicited by LPS both in vitro and in vivo. Moreover, we found that PCB nanogels, which have the strongest hydration and the lowest non-specific protein binding, manifested the best performance in alleviating the immune activation, followed by PSB and PEG nanogels. This reveals that the immunomodulatory effect of hydrophilic materials is closely related to their hydration characteristics and their ability to resist non-specific binding in complex media. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. A basic mathematical model of the immune response

    NASA Astrophysics Data System (ADS)

    Mayer, H.; Zaenker, K. S.; an der Heiden, U.

    1995-03-01

    Interaction of the immune system with a target population of, e.g., bacteria, viruses, antigens, or tumor cells must be considered as a dynamic process. We describe this process by a system of two ordinary differential equations. Although the model is strongly idealized it demonstrates how the combination of a few proposed nonlinear interaction rules between the immune system and its targets are able to generate a considerable variety of different kinds of immune responses, many of which are observed both experimentally and clinically. In particular, solutions of the model equations correspond to states described by immunologists as ``virgin state,'' ``immune state'' and ``state of tolerance.'' The model successfully replicates the so-called primary and secondary response. Moreover, it predicts the existence of a threshold level for the amount of pathogen germs or of transplanted tumor cells below which the host is able to eliminate the infectious organism or to reject the tumor graft. We also find a long time coexistence of targets and immune competent cells including damped and undamped oscillations of both. Plausibly the model explains that if the number of transformed cells or pathogens exeeds definable values (poor antigenicity, high reproduction rate) the immune system fails to keep the disease under control. On the other hand, the model predicts apparently paradoxical situations including an increased chance of target survival despite enhanced immune activity or therapeutically achieved target reduction. A further obviously paradoxical behavior consists of a positive effect for the patient up to a complete cure by adding an additional target challenge where the benefit of the additional targets depends strongly on the time point and on their amount. Under periodically pulsed stimulation the model may show a chaotic time behavior of both target growth and immune response.

  20. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel Therapeutic Formulation

    PubMed Central

    Almeida, Freya M Freyre; Blanco, Aracelys; Trujillo, Heidy; Hernández, Dunia; García, Daymir; Alba, José S; Abad, Matilde López; Merino, Nelson; Lobaina, Yadira

    2016-01-01

    ABSTRACT The development of therapeutic vaccines against chronic hepatitis B requires the capacity of the formulation to subvert a tolerated immune response as well as the evaluation of histopathological damage resulting from the treatment. In the present study, the dynamicity of induced immune response to hepatitis B surface antigen (HBsAg) was evaluated in transgenic mice that constitutively express the HBsAg gene (HBsAg-tg mice). After immunization with a vaccine candidate containing both surface (HBsAg) and core (HBcAg) antigens of hepatitis B virus (HBV), the effect of vaccination on clearance of circulating HBsAg and the potential histological alterations were examined. Transgenic (tg) and non-transgenic (Ntg) mice were immunized by intranasal (IN) and subcutaneous (SC) routes simultaneously. A control group received phosphate-buffered saline (PBS) by IN route and aluminum by SC route. Positive responses, at both humoral and cellular levels, were obtained after five immunizations in HBsAg-tg mice. Such responses were delayed and of lower intensity in tg mice, compared to vaccinated Ntg mice. Serum IgG response was characterized by a similar IgG subclass pattern. Even when HBsAg-specific CD8+ T cell responses were clearly detectable by gamma-interferon ELISPOT assay, histopathological alterations were not detected in any organ, including the liver and kidneys. Our study demonstrated, that it is possible to subvert the immune tolerance against HBsAg in tg mice, opening a window for new studies to optimize the schedule, dose, and formulation to improve the immune response to the therapeutic vaccine candidate. These results can be considered a safety proof to support clinical developments for the formulation under study. How to cite this article Freyre FM, Blanco A, Trujillo H, Hernández D, García D, Alba JS, Lopez M, Merino N, Lobaina Y, Aguilar JC. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel

  1. 3D mosquito screens to create window double screen traps for mosquito control.

    PubMed

    Khattab, Ayman; Jylhä, Kaisa; Hakala, Tomi; Aalto, Mikko; Malima, Robert; Kisinza, William; Honkala, Markku; Nousiainen, Pertti; Meri, Seppo

    2017-08-29

    Mosquitoes are vectors for many diseases such as malaria. Insecticide-treated bed nets and indoor residual spraying of insecticides are the principal malaria vector control tools used to prevent malaria in the tropics. Other interventions aim at reducing man-vector contact. For example, house screening provides additive or synergistic effects to other implemented measures. We used commercial screen materials made of polyester, polyethylene or polypropylene to design novel mosquito screens that provide remarkable additional benefits to those commonly used in house screening. The novel design is based on a double screen setup made of a screen with 3D geometric structures parallel to a commercial mosquito screen creating a trap between the two screens. Owing to the design of the 3D screen, mosquitoes can penetrate the 3D screen from one side but cannot return through the other side, making it a unidirectional mosquito screen. Therefore, the mosquitoes are trapped inside the double screen system. The permissiveness of both sides of the 3D screens for mosquitoes to pass through was tested in a wind tunnel using the insectary strain of Anopheles stephensi. Among twenty-five tested 3D screen designs, three designs from the cone, prism, or cylinder design groups were the most efficient in acting as unidirectional mosquito screens. The three cone-, prism-, and cylinder-based screens allowed, on average, 92, 75 and 64% of Anopheles stephensi mosquitoes released into the wind tunnel to penetrate the permissive side and 0, 0 and 6% of mosquitoes to escape through the non-permissive side, respectively. A cone-based 3D screen fulfilled the study objective. It allowed capturing 92% of mosquitoes within the double screen setup inside the wind tunnel and blocked 100% from escaping. Thus, the cone-based screen effectively acted as a unidirectional mosquito screen. This 3D screen-based trap design could therefore be used in house screening as a means of avoiding infective bites and

  2. Influences of Plant Traits on Immune Responses of Specialist and Generalist Herbivores

    PubMed Central

    Lampert, Evan

    2012-01-01

    Specialist and generalist insect herbivore species often differ in how they respond to host plant traits, particularly defensive traits, and these responses can include weakened or strengthened immune responses to pathogens and parasites. Accurate methods to measure immune response in the presence and absence of pathogens and parasites are necessary to determine whether susceptibility to these natural enemies is reduced or increased by host plant traits. Plant chemical traits are particularly important in that host plant metabolites may function as antioxidants beneficial to the immune response, or interfere with the immune response of both specialist and generalist herbivores. Specialist herbivores that are adapted to process and sometimes accumulate specific plant compounds may experience high metabolic demands that may decrease immune response, whereas the metabolic demands of generalist species differ due to more broad-substrate enzyme systems. However, the direct deleterious effects of plant compounds on generalist herbivores may weaken their immune responses. Further research in this area is important given that the ecological relevance of plant traits to herbivore immune responses is equally important in natural systems and agroecosystems, due to potential incompatibility of some host plant species and cultivars with biological control agents of herbivorous pests. PMID:26466545

  3. Photodynamic therapy for cancer and activation of immune response

    NASA Astrophysics Data System (ADS)

    Mroz, Pawel; Huang, Ying-Ying; Hamblin, Michael R.

    2010-02-01

    Anti-tumor immunity is stimulated after PDT for cancer due to the acute inflammatory response, exposure and presentation of tumor-specific antigens, and induction of heat-shock proteins and other danger signals. Nevertheless effective, powerful tumor-specific immune response in both animal models and also in patients treated with PDT for cancer, is the exception rather than the rule. Research in our laboratory and also in others is geared towards identifying reasons for this sub-optimal immune response and discovering ways of maximizing it. Reasons why the immune response after PDT is less than optimal include the fact that tumor-antigens are considered to be self-like and poorly immunogenic, the tumor-mediated induction of CD4+CD25+foxP3+ regulatory T-cells (T-regs), that are able to inhibit both the priming and the effector phases of the cytotoxic CD8 T-cell anti-tumor response and the defects in dendritic cell maturation, activation and antigen-presentation that may also occur. Alternatively-activated macrophages (M2) have also been implicated. Strategies to overcome these immune escape mechanisms employed by different tumors include combination regimens using PDT and immunostimulating treatments such as products obtained from pathogenic microorganisms against which mammals have evolved recognition systems such as PAMPs and toll-like receptors (TLR). This paper will cover the use of CpG oligonucleotides (a TLR9 agonist found in bacterial DNA) to reverse dendritic cell dysfunction and methods to remove the immune suppressor effects of T-regs that are under active study.

  4. Proteomic contributions to our understanding of vaccine and immune responses

    PubMed Central

    Galassie, Allison C.; Link, Andrew J.

    2015-01-01

    Vaccines are one of the greatest public health successes; yet, due to the empirical nature of vaccine design, we have an incomplete understanding of how the genes and proteins induced by vaccines contribute to the development of both protective innate and adaptive immune responses. While the advent of genomics has enabled new vaccine development and facilitated understanding of the immune response, proteomics identifies potentially new vaccine antigens with increasing speed and sensitivity. In addition, as proteomics is complementary to transcriptomic approaches, a combination of both approaches provides a more comprehensive view of the immune response after vaccination via systems vaccinology. This review details the advances that proteomic strategies have made in vaccine development and reviews how proteomics contributes to the development of a more complete understanding of human vaccines and immune responses. PMID:26172619

  5. Modelling the effects of phylogeny and body size on within-host pathogen replication and immune response.

    PubMed

    Banerjee, Soumya; Perelson, Alan S; Moses, Melanie

    2017-11-01

    Understanding how quickly pathogens replicate and how quickly the immune system responds is important for predicting the epidemic spread of emerging pathogens. Host body size, through its correlation with metabolic rates, is theoretically predicted to impact pathogen replication rates and immune system response rates. Here, we use mathematical models of viral time courses from multiple species of birds infected by a generalist pathogen (West Nile Virus; WNV) to test more thoroughly how disease progression and immune response depend on mass and host phylogeny. We use hierarchical Bayesian models coupled with nonlinear dynamical models of disease dynamics to incorporate the hierarchical nature of host phylogeny. Our analysis suggests an important role for both host phylogeny and species mass in determining factors important for viral spread such as the basic reproductive number, WNV production rate, peak viraemia in blood and competency of a host to infect mosquitoes. Our model is based on a principled analysis and gives a quantitative prediction for key epidemiological determinants and how they vary with species mass and phylogeny. This leads to new hypotheses about the mechanisms that cause certain taxonomic groups to have higher viraemia. For example, our models suggest that higher viral burst sizes cause corvids to have higher levels of viraemia and that the cellular rate of virus production is lower in larger species. We derive a metric of competency of a host to infect disease vectors and thereby sustain the disease between hosts. This suggests that smaller passerine species are highly competent at spreading the disease compared with larger non-passerine species. Our models lend mechanistic insight into why some species (smaller passerine species) are pathogen reservoirs and some (larger non-passerine species) are potentially dead-end hosts for WNV. Our techniques give insights into the role of body mass and host phylogeny in the spread of WNV and potentially

  6. An adenovirus prime/plasmid boost strategy for induction of equipotent immune responses to two dengue virus serotypes.

    PubMed

    Khanam, Saima; Rajendra, Pilankatta; Khanna, Navin; Swaminathan, Sathyamangalam

    2007-02-15

    Dengue is a public health problem of global significance for which there is neither an effective antiviral therapy nor a preventive vaccine. It is a mosquito-borne viral disease, caused by dengue (DEN) viruses, which are members of the Flaviviridae family. There are four closely related serotypes, DEN-1, DEN-2, DEN-3 and DEN-4, each of which is capable of causing disease. As immunity to any one serotype can potentially sensitize an individual to severe disease during exposure to a heterologous serotype, the general consensus is that an effective vaccine should be tetravalent, that is, it must be capable of affording protection against all four serotypes. The current strategy of creating tetravalent vaccine formulations by mixing together four monovalent live attenuated vaccine viruses has revealed the phenomenon of viral interference leading to the manifestation of immune responses biased towards a single serotype. This work stems from the emergence of (i) the DEN virus envelope (E) domain III (EDIII) as the most important region of the molecule from a vaccine perspective and (ii) the adenovirus (Ad) as a promising vaccine vector platform. We describe the construction of a recombinant, replication-defective Ad (rAd) vector encoding a chimeric antigen made of in-frame linked EDIIIs of DEN virus serotypes 2 and 4. Using this rAd vector, in conjunction with a plasmid vector encoding the same chimeric bivalent antigen, in a prime-boost strategy, we show that it is possible to elicit equipotent neutralizing and T cell responses specific to both DEN serotypes 2 and 4. Our data support the hypothesis that a DEN vaccine targeting more than one serotype may be based on a single DNA-based vector to circumvent viral interference. This work lays the foundation for developing a single Ad vector encoding EDIIIs of all four DEN serotypes to evoke a balanced immune response against each one of them. Thus, this work has implications for the development of safe and effective

  7. Strain-Specific Protective Effect of the Immunity Induced by Live Malarial Sporozoites under Chloroquine Cover

    PubMed Central

    Wijayalath, Wathsala; Cheesman, Sandra; Tanabe, Kazuyuki; Handunnetti, Shiroma; Carter, Richard; Pathirana, Sisira

    2012-01-01

    The efficacy of a whole-sporozoite malaria vaccine would partly be determined by the strain-specificity of the protective responses against malarial sporozoites and liver-stage parasites. Evidence from previous reports were inconsistent, where some studies have shown that the protective immunity induced by irradiated or live sporozoites in rodents or humans were cross-protective and in others strain-specific. In the present work, we have studied the strain-specificity of live sporozoite-induced immunity using two genetically and immunologically different strains of Plasmodium cynomolgi, Pc746 and PcCeylon, in toque monkeys. Two groups of monkeys were immunized against live sporozoites of either the Pc746 (n = 5), or the PcCeylon (n = 4) strain, by the bites of 2–4 sporozoite-infected Anopheles tessellates mosquitoes per monkey under concurrent treatments with chloroquine and primaquine to abrogate detectable blood infections. Subsequently, a group of non-immunized monkeys (n = 4), and the two groups of immunized monkeys were challenged with a mixture of sporozoites of the two strains by the bites of 2–5 infective mosquitoes from each strain per monkey. In order to determine the strain-specificity of the protective immunity, the proportions of parasites of the two strains in the challenge infections were quantified using an allele quantification assay, Pyrosequencing™, based on a single nucleotide polymorphism (SNP) in the parasites’ circumsporozoite protein gene. The Pyrosequencing™ data showed that a significant reduction of parasites of the immunizing strain in each group of strain-specifically immunized monkeys had occurred, indicating a stronger killing effect on parasites of the immunizing strain. Thus, the protective immunity developed following a single, live sporozoite/chloroquine immunization, acted specifically against the immunizing strain and was, therefore, strain-specific. As our experiment does not allow us to determine the

  8. West Nile virus: immunity and pathogenesis.

    PubMed

    Lim, Stephanie M; Koraka, Penelope; Osterhaus, Albert D M E; Martina, Byron E E

    2011-06-01

    West Nile virus (WNV) is a neurotropic, arthropod-borne flavivirus that is maintained in an enzootic cycle between mosquitoes and birds, but can also infect and cause disease in horses and humans. WNV is endemic in parts of Africa, Europe, the Middle East, and Asia, and since 1999 has spread to North America, Mexico, South America, and the Caribbean. WNV infects the central nervous system (CNS) and can cause severe disease in a small minority of infected humans, mostly immunocompromised or the elderly. This review discusses some of the mechanisms by which the immune system can limit dissemination of WNV infection and elaborates on the mechanisms involved in pathogenesis. Reasons for susceptibility to WNV-associated neuroinvasive disease in less than 1% of cases remain unexplained, but one favored hypothesis is that the involvement of the CNS is associated with a weak immune response allowing robust WNV replication in the periphery and spread of the virus to the CNS.

  9. Innate Immune Response to Burkholderia mallei

    DTIC Science & Technology

    2017-02-16

    stimulate immune responses via TLR4 activation that may contribute to persistent infection. Summary Mortality is high due to septicemia and immune...phosphorylation of adenosine monophosphate- activated protein kinase (AMPK); regulators of NF-κB signaling pathway (e.g. IκBα, GSK3β, Src, and STAT1) and mitogen... activated protein kinases (e.g. p38, ERK1/2 and c-Myc) (13). The degrees in which target host proteins or processes are modulated correlated to the

  10. Immune Responses in Rhinovirus-Induced Asthma Exacerbations.

    PubMed

    Steinke, John W; Borish, Larry

    2016-11-01

    Acute asthma exacerbations are responsible for urgent care visits and hospitalizations; they interfere with school and work productivity, thereby driving much of the morbidity and mortality associated with asthma. Approximately 80 to 85 % of asthma exacerbations in children, adolescents, and less frequently adults are associated with viral upper respiratory tract viral infections, and rhinovirus (RV) accounts for ∼60-70 % of these virus-associated exacerbations. Evidence suggests that it is not the virus itself but the nature of the immune response to RV that drives this untoward response. In particular, evidence supports the concept that RV acts to exacerbate an ongoing allergic inflammatory response to environmental allergens present at the time of the infection. The interaction of the ongoing IgE- and T cell-mediated response to allergen superimposed on the innate and adaptive immune responses to the virus and how this leads to triggering of an asthma exacerbation is discussed.

  11. Insecticide susceptibility of Anopheles mosquitoes changes in response to variations in the larval environment.

    PubMed

    Owusu, Henry F; Chitnis, Nakul; Müller, Pie

    2017-06-16

    Insecticide resistance threatens the success achieved through vector control in reducing the burden of malaria. An understanding of insecticide resistance mechanisms would help to develop novel tools and strategies to restore the efficacy of insecticides. Although we have substantially improved our understanding of the genetic basis of insecticide resistance over the last decade, we still know little of how environmental variations influence the mosquito phenotype. Here, we measured how variations in larval rearing conditions change the insecticide susceptibility phenotype of adult Anopheles mosquitoes. Anopheles gambiae and A. stephensi larvae were bred under different combinations of temperature, population density and nutrition, and the emerging adults were exposed to permethrin. Mosquitoes bred under different conditions showed considerable changes in mortality rates and body weight, with nutrition being the major factor. Weight is a strong predictor of insecticide susceptibility and bigger mosquitoes are more likely to survive insecticide treatment. The changes can be substantial, such that the same mosquito colony may be considered fully susceptible or highly resistant when judged by World Health Organization discriminatory concentrations. The results shown here emphasise the importance of the environmental background in developing insecticide resistance phenotypes, and caution for the interpretation of data generated by insecticide susceptibility assays.

  12. Evasion of Influenza A Viruses from Innate and Adaptive Immune Responses

    PubMed Central

    van de Sandt, Carolien E.; Kreijtz, Joost H. C. M.; Rimmelzwaan, Guus F.

    2012-01-01

    The influenza A virus is one of the leading causes of respiratory tract infections in humans. Upon infection with an influenza A virus, both innate and adaptive immune responses are induced. Here we discuss various strategies used by influenza A viruses to evade innate immune responses and recognition by components of the humoral and cellular immune response, which consequently may result in reduced clearing of the virus and virus-infected cells. Finally, we discuss how the current knowledge about immune evasion can be used to improve influenza A vaccination strategies. PMID:23170167

  13. Research Contributing to Improvements in Controlling Florida’s Mosquitoes and Mosquito-Borne Diseases

    PubMed Central

    Tabachnick, Walter J.

    2016-01-01

    Research on mosquitoes and mosquito-borne diseases has contributed to improvements in providing effective, efficient, and environmentally proper mosquito control. Florida has benefitted from several research accomplishments that have increased the state’s mosquito control capabilities. Research with Florida’s mosquitoes has resulted in the development of ecologically sound management of mosquito impoundments on Florida’s east coast. This strategy, called Rotational Impoundment Management (RIM), has improved the ability to target the delivery of pesticides and has helped to reduce non-target effects and environmental damage. Research has led to the development of an arbovirus surveillance system which includes sentinel chicken surveillance, real time use of environmental contributing factors like meteorology and hydrology to target mosquito control, as well as public health efforts to mitigate disease outbreaks to areas with risk of disease. These research driven improvements have provided substantial benefits to all of Florida. More research is needed to meet the future challenges to reduce emerging pathogens like Zika virus and the consequences of environmental changes like global climate change that are likely to influence the effects of mosquito-borne pathogens on human health and well-being. PMID:27690112

  14. Nitric oxide and redox mechanisms in the immune response

    PubMed Central

    Wink, David A.; Hines, Harry B.; Cheng, Robert Y. S.; Switzer, Christopher H.; Flores-Santana, Wilmarie; Vitek, Michael P.; Ridnour, Lisa A.; Colton, Carol A.

    2011-01-01

    The role of redox molecules, such as NO and ROS, as key mediators of immunity has recently garnered renewed interest and appreciation. To regulate immune responses, these species trigger the eradication of pathogens on the one hand and modulate immunosuppression during tissue-restoration and wound-healing processes on the other. In the acidic environment of the phagosome, a variety of RNS and ROS is produced, thereby providing a cauldron of redox chemistry, which is the first line in fighting infection. Interestingly, fluctuations in the levels of these same reactive intermediates orchestrate other phases of the immune response. NO activates specific signal transduction pathways in tumor cells, endothelial cells, and monocytes in a concentration-dependent manner. As ROS can react directly with NO-forming RNS, NO bioavailability and therefore, NO response(s) are changed. The NO/ROS balance is also important during Th1 to Th2 transition. In this review, we discuss the chemistry of NO and ROS in the context of antipathogen activity and immune regulation and also discuss similarities and differences between murine and human production of these intermediates. PMID:21233414

  15. Dose-Dependent Behavioral Response of the Mosquito Aedes albopictus to Floral Odorous Compounds

    PubMed Central

    Hao, Huiling; Sun, Jingcheng; Dai, Jianqing

    2013-01-01

    The value of using plant volatiles as attractants for trapping and spatial repellents to protect hosts against mosquitoes has been widely recognized. The current study characterized behavioral responses of Aedes albopictus (Skuse) (Diptera: Culicidae) to different concentrations, ranging from 6 to 96%, of several common floral odorous compounds, including linalool, geraniol, citronellal, eugenol, anisaldehyde, and citral, using a wind tunnel olfactometer system. The results indicated that female mosquitoes reacted differently to different concentrations of the tested compounds, and the reactions also were different when those chemicals were tested alone or in the presence of human host odor. When tested alone, anisaldehyde was attractive at all tested concentrations, eugenol was attractive only at concentrations of 48–96%, while citronellal, linalool, citral, and geraniol were attractive at lower concentrations and repellent at higher concentrations. When tested in the presence of a human host, all compounds except for anisaldehyde at all tested concentrations showed host-seeking inhibition to certain degrees. Based on the results, it was concluded that anisaldehyde was effective in attracting Ae. albopictus when used alone but could also remarkably inhibit the host-seeking ability at a concentration of 96%, while citral, geraniol, linalool, citronellal, and eugenol are suitable as spatial repellents. PMID:24779928

  16. The Toll immune signaling pathway control conserved anti-dengue defenses across diverse Ae. aegypti strains and against multiple dengue virus serotypes

    PubMed Central

    Ramirez, Jose L.; Dimopoulos, George

    2010-01-01

    Dengue virus has become one of the most important arboviral pathogens affecting the world today. The virus is transmitted among humans by the mosquitoes Aedes aegypti and Ae. albopictus. Like other vector-borne pathogens, this virus encounters innate immune defenses within the mosquito vector that limit infection. We have previously demonstrated the involvement of the Toll pathway in the anti-dengue defense at 7 days after infection. In the present study, we have investigated the activity of this immune signaling pathway against different dengue virus serotypes at the early stages of infection in laboratory and field-derived mosquito strains. Our studies corroborate the importance of the Toll pathway in the anti-dengue defense repertoire at 3 days after an infectious blood meal, when new virions are released from the midgut for dissemination and infection of other mosquito tissues. These immune defenses are furthermore conserved among different Ae. aegypti strains and can act against a broad range of dengue virus serotypes. PMID:20079370

  17. Innate Immune Responses to Cryptococcus

    PubMed Central

    Heung, Lena J.

    2017-01-01

    Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus, primarily the species C. neoformans, is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system. PMID:28936464

  18. Transcriptomics of the Vaccine Immune Response: Priming With Adjuvant Modulates Recall Innate Responses After Boosting.

    PubMed

    Santoro, Francesco; Pettini, Elena; Kazmin, Dmitri; Ciabattini, Annalisa; Fiorino, Fabio; Gilfillan, Gregor D; Evenroed, Ida M; Andersen, Peter; Pozzi, Gianni; Medaglini, Donata

    2018-01-01

    Transcriptomic profiling of the immune response induced by vaccine adjuvants is of critical importance for the rational design of vaccination strategies. In this study, transcriptomics was employed to profile the effect of the vaccine adjuvant used for priming on the immune response following re-exposure to the vaccine antigen alone. Mice were primed with the chimeric vaccine antigen H56 of Mycobacterium tuberculosis administered alone or with the CAF01 adjuvant and boosted with the antigen alone. mRNA sequencing was performed on blood samples collected 1, 2, and 7 days after priming and after boosting. Gene expression analysis at day 2 after priming showed that the CAF01 adjuvanted vaccine induced a stronger upregulation of the innate immunity modules compared with the unadjuvanted formulation. The immunostimulant effect of the CAF01 adjuvant, used in the primary immunization, was clearly seen after a booster immunization with a low dose of antigen alone. One day after boost, we observed a strong upregulation of multiple genes in blood of mice primed with H56 + CAF01 compared with mice primed with the H56 alone. In particular, blood transcription modules related to innate immune response, such as monocyte and neutrophil recruitment, activation of antigen-presenting cells, and interferon response were activated. Seven days after boost, differential expression of innate response genes faded while a moderate differential expression of T cell activation modules was appreciable. Indeed, immunological analysis showed a higher frequency of H56-specific CD4+ T cells and germinal center B cells in draining lymph nodes, a strong H56-specific humoral response and a higher frequency of antibody-secreting cells in spleen of mice primed with H56 + CAF01. Taken together, these data indicate that the adjuvant used for priming strongly reprograms the immune response that, upon boosting, results in a stronger recall innate response essential for shaping the downstream

  19. Verification of immune response optimality through cybernetic modeling.

    PubMed

    Batt, B C; Kompala, D S

    1990-02-09

    An immune response cascade that is T cell independent begins with the stimulation of virgin lymphocytes by antigen to differentiate into large lymphocytes. These immune cells can either replicate themselves or differentiate into plasma cells or memory cells. Plasma cells produce antibody at a specific rate up to two orders of magnitude greater than large lymphocytes. However, plasma cells have short life-spans and cannot replicate. Memory cells produce only surface antibody, but in the event of a subsequent infection by the same antigen, memory cells revert rapidly to large lymphocytes. Immunologic memory is maintained throughout the organism's lifetime. Many immunologists believe that the optimal response strategy calls for large lymphocytes to replicate first, then differentiate into plasma cells and when the antigen has been nearly eliminated, they form memory cells. A mathematical model incorporating the concept of cybernetics has been developed to study the optimality of the immune response. Derived from the matching law of microeconomics, cybernetic variables control the allocation of large lymphocytes to maximize the instantaneous antibody production rate at any time during the response in order to most efficiently inactivate the antigen. A mouse is selected as the model organism and bacteria as the replicating antigen. In addition to verifying the optimal switching strategy, results showing how the immune response is affected by antigen growth rate, initial antigen concentration, and the number of antibodies required to eliminate an antigen are included.

  20. Early life socioeconomic position and immune response to persistent infections among elderly Latinos.

    PubMed

    Meier, Helen C S; Haan, Mary N; Mendes de Leon, Carlos F; Simanek, Amanda M; Dowd, Jennifer B; Aiello, Allison E

    2016-10-01

    Persistent infections, such as cytomegalovirus (CMV), herpes simplex virus-1 (HSV-1), Helicobacter pylori (H. pylori), and Toxoplasma gondii (T. gondii), are common in the U.S. but their prevalence varies by socioeconomic status. It is unclear if early or later life socioeconomic position (SEP) is a more salient driver of disparities in immune control of these infections. Using data from the Sacramento Area Latino Study on Aging, we examined whether early or later life SEP was the strongest predictor of immune control later in life by contrasting two life course models, the critical period model and the chain of risk model. Early life SEP was measured as a latent variable, derived from parental education and occupation, and food availability. Indicators for SEP in later life included education level and occupation. Individuals were categorized by immune response to each pathogen (seronegative, low, medium and high) with increasing immune response representing poorer immune control. Cumulative immune response was estimated using a latent profile analysis with higher total immune response representing poorer immune control. Structural equation models were used to examine direct, indirect and total effects of early life SEP on each infection and cumulative immune response, controlling for age and gender. The direct effect of early life SEP on immune response was not statistically significant for the infections or cumulative immune response. Higher early life SEP was associated with lower immune response for T. gondii, H. pylori and cumulative immune response through pathways mediated by later life SEP. For CMV, higher early life SEP was both directly associated and partially mediated by later life SEP. No association was found between SEP and HSV-1. Findings from this study support a chain of risk model, whereby early life SEP acts through later life SEP to affect immune response to persistent infections in older age. Copyright © 2016 Elsevier Ltd. All rights

  1. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus.

    PubMed

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete

    2009-07-30

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.

  2. Factors Associated With Pediatrician Responses to Alternative Immunization Schedule Requests.

    PubMed

    Mohanty, Salini; Feemster, Kristen A; Buttenheim, Alison; Moser, Charlotte A; Field, Robert I; Mayer, Whitney; Carroll-Scott, Amy

    2018-02-01

    We conducted a cross-sectional online survey among 4 chapters of the American Academy of Pediatrics from July through October 2014 to describe characteristics of pediatricians and practices associated with practice-level responses to alternative immunization schedule requests. Among 374 pediatricians, 58% reported frequent alternative immunization schedule requests and 24% reported feeling comfortable using them. Pediatricians who work in practices that accommodate alternative immunization schedule requests have increased odds of having a high frequency of alternative immunization schedule requests, and beliefs that relationships with families would be negatively affected if they refused requests. Practices that discontinue care to families who request alternative immunization schedules have increased odds of being a private group practice and having a formal office vaccine policy. Pediatricians are frequently asked to use alternative immunization schedules and many are not comfortable using them. Practice-level responses to alternative immunization schedules are associated with characteristics of pediatricians and practices.

  3. Eosinophils in mucosal immune responses

    PubMed Central

    Travers, J; Rothenberg, M E

    2015-01-01

    Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184

  4. Spaceflight and Development of Immune Responses

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald

    1996-01-01

    Evidence from both human and rodent studies has indicated that alterations in immunological parameters occur after space flight. The number of flight experiments has been small, and the full breadth of immunological alterations occurring after space flight remains to be established. Among the major effects on immune responses after space flight that have been reported are: alterations in lymphocyte blastogenesis and natural killer cell activity, alterations in production of cytokines, changes in leukocyte sub-population distribution, and decreases in the ability of bone marrow cells to respond to colony stimulating factors. Changes have been reported in immunological parameters of both humans and rodents. The significance of these alterations in relation to resistance to infection remains to be established. The objective of the studies contained in this project was to determine the effects of space flight on immune responses of pregnant rats and their offspring. The hypothesis was that space flight and the attendant period of microgravity will result in alteration of immunological parameters of both the pregnant rats as well as their offspring carried in utero during the flight. The parameters tested included: production of cytokines, composition of leukocyte sub- populations, response of bone marrow/liver cells to granulocyte/monocyte colony stimulating factor, and leukocyte blastogenesis. Changes in immune responses that could yield alterations in resistance to infection were determined. This yielded useful information for planning studies that could contribute to crew health. Additional information that could eventually prove useful to determine the potential for establishment of a permanent colony in space was obtained.

  5. Effect of gender and sex hormones on immune responses following shock.

    PubMed

    Angele, M K; Schwacha, M G; Ayala, A; Chaudry, I H

    2000-08-01

    Several clinical and experimental studies show a gender dimorphism of the immune and organ responsiveness in the susceptibility to and morbidity from shock, trauma, and sepsis. In this respect, cell-mediated immune responses are depressed in males after trauma-hemorrhage, whereas they are unchanged or enhanced in females. Sex hormones contribute to this gender-specific immune response after adverse circulatory conditions. Specifically, studies indicate that androgens are responsible for the immunodepression after trauma-hemorrhage in males. In contrast, female sex steroids seem to exhibit immunoprotective properties after trauma and severe blood loss, because administration of estrogen prevents the androgen-induced immunodepression in castrated male mice. Nonetheless, the precise underlying mechanisms for these immunomodulatory effects of sex steroids after shock remain unknown. Although testosterone depletion, testosterone receptor antagonism, or estrogen treatment has been shown to prevent the depression of immune functions after trauma-hemorrhage, it remains to be established whether differences in the testosterone-estradiol ratio are responsible for the immune dysfunction. Furthermore, sex hormone receptors have been identified on various immune cells, suggesting direct effects. Thus, the immunomodulatory properties of sex hormones after trauma-hemorrhage might represent novel therapeutic strategies for the treatment of immunodepression in trauma patients.

  6. Identification and Characterization of Two Novel RNA Viruses from Anopheles gambiae Species Complex Mosquitoes

    PubMed Central

    Carissimo, Guillaume; Eiglmeier, Karin; Reveillaud, Julie; Holm, Inge; Diallo, Mawlouth; Diallo, Diawo; Vantaux, Amélie; Kim, Saorin; Ménard, Didier; Siv, Sovannaroth; Belda, Eugeni; Bischoff, Emmanuel; Antoniewski, Christophe; Vernick, Kenneth D.

    2016-01-01

    Mosquitoes of the Anopheles gambiae complex display strong preference for human bloodmeals and are major malaria vectors in Africa. However, their interaction with viruses or role in arbovirus transmission during epidemics has been little examined, with the exception of O’nyong-nyong virus, closely related to Chikungunya virus. Deep-sequencing has revealed different RNA viruses in natural insect viromes, but none have been previously described in the Anopheles gambiae species complex. Here, we describe two novel insect RNA viruses, a Dicistrovirus and a Cypovirus, found in laboratory colonies of An. gambiae taxa using small-RNA deep sequencing. Sequence analysis was done with Metavisitor, an open-source bioinformatic pipeline for virus discovery and de novo genome assembly. Wild-collected Anopheles from Senegal and Cambodia were positive for the Dicistrovirus and Cypovirus, displaying high sequence identity to the laboratory-derived virus. Thus, the Dicistrovirus (Anopheles C virus, AnCV) and Cypovirus (Anopheles Cypovirus, AnCPV) are components of the natural virome of at least some anopheline species. Their possible influence on mosquito immunity or transmission of other pathogens is unknown. These natural viruses could be developed as models for the study of Anopheles-RNA virus interactions in low security laboratory settings, in an analogous manner to the use of rodent malaria parasites for studies of mosquito anti-parasite immunity. PMID:27138938

  7. A multiherbal formulation influencing immune response in vitro.

    PubMed

    Menghini, L; Leporini, L; Scanu, N; Pintore, G; Ferrante, C; Recinella, L; Orlando, G; Vacca, M; Brunetti, L

    2012-02-01

    Aim of this study was to evaluate the effects of phytocomplexes of Uncaria, Shiitake and Ribes in terms of viability and inflammatory response on immune cell-derived cultures. Standardized extracts of Uncaria, Shitake and Ribes and their commercial formulation were tested on cell lines PBMC, U937 and macrophage. The activity was evaluated in terms of cell viability (MTT test), variations of oxidative marker release (ROS and PGE2) and modulatory effects on immune response (gene expression of IL-6, IL-8 and TNFα, RT-PCR). Cell viability was not affected by extracts, except subtle variations observed only at higher doses (>250 µg/mL). The extract mixture was well tolerated, with no effects on cell viability up to doses of 500 µg/mL. Pre-treatment of macrophages with subtoxic doses of the extracts reduced the basal release of oxidative markers and enhanced the cell response to exogenous oxidant stimulation, as revealed by ROS and PGE2 release reduction. The same treatment on macrophage resulted in a selective modulation of the immune response, as shown by an increase of IL-6 mRNA and, partially, IL-8 mRNA, while a reduction was observed for TNFα mRNA. Data confirm that extracts and their formulations can act as regulator of the immune system with mechanisms involving the oxidative stress and the release of selected proinflammatory cytokines.

  8. Pathogen recognition in the innate immune response.

    PubMed

    Kumar, Himanshu; Kawai, Taro; Akira, Shizuo

    2009-04-28

    Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.

  9. Inflammatory cytokines in the brain: does the CNS shape immune responses?

    PubMed

    Owens, T; Renno, T; Taupin, V; Krakowski, M

    1994-12-01

    Immune responses in the central nervous system (CNS) have traditionally been regarded as representing the intrusion of an unruly, ill-behaved mob of leukocytes into the well-ordered and organized domain of thought and reason. However, results accumulated over the past few years suggest that, far from being an immunologically privileged organ, T lymphocytes may be regular and frequent visitors to the CNS, for purposes of immune surveillance. Here, Trevor Owens and colleagues propose that the brain itself can regulate or shape immune responses therein. Furthermore, given that the immune cells may be subverted to autoimmunity, they suggest that the study of inflammatory autoimmune disease in the brain may shed light on the ability of the local environment to regulate immune responses.

  10. Behavioral response of the malaria mosquito, Anopheles gambiae, to human sweat inoculated with axilla bacteria and to volatiles composing human axillary odor.

    PubMed

    Frei, Jérôme; Kröber, Thomas; Troccaz, Myriam; Starkenmann, Christian; Guerin, Patrick M

    2017-02-01

    The responses of Anopheles gambiae Giles sensu stricto (Diptera: Culicidae) to odors from male and female axillary sweat incubated with human axilla bacteria were recorded in a dual-choice olfactometer. Staphylococcus epidermidis was selected for its low odor-producing pattern, Corynebacterium jeikeium for its strong Nα-acylglutamine aminoacylase activity liberating carboxylic acids including (R)/(S)-3-hydroxy-3-methylhexanoic acid (HMHA) and Staphylococcus haemolyticus for its capacity to liberate sulfur-containing compounds including (R/S)-3-methyl-3-sulfanylhexan-1-ol (MSH). Anopheles gambiae behavioral responses were evaluated under (i) its responsiveness to take off and undertake sustained upwind flight and (ii) its discriminating capacity between the two olfactometer arms bearing a test odor in either one or both arms. Experiments were conducted in the presence of carbon dioxide pulses as a behavioral sensitizer. Anopheles gambiae clearly discriminated for the olfactometer arm conveying odor generated by incubating any of the three bacteria species with either male or female sweat. Whereas An. gambiae did not discriminate between male and female sterile sweat samples in the olfactometer, the mosquito consistently showed a preference for male sweat over female sweat incubated with the same bacterium, independent of the species used as inoculum. Sweat incubated with C. jeikeium rendered mosquitoes particularly responsive and this substrate elicited the strongest preference for male over female sweat. Tested on their own, neither HMHA nor MSH elicited a clear discriminating response but did affect mosquito responsiveness. These findings serve as a basis for further research on the odor-mediated anthropophilic host-seeking behavior of An. gambiae. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. Drosophila blood cells and their role in immune responses.

    PubMed

    Vlisidou, Isabella; Wood, Will

    2015-04-01

    Drosophila melanogaster has been extensively used to study the humoral arm of innate immunity because of the developmental and functional parallels with mammalian innate immunity. However, the fly cellular response to infection is far less understood. Investigative work on Drosophila haemocytes, the immunosurveillance cells of the insect, has revealed that they fulfil roles similar to mammalian monocytes and macrophages. They respond to wound signals and orchestrate the coagulation response. In addition, they phagocytose and encapsulate invading pathogens, and clear up apoptotic bodies controlling inflammation. This review briefly describes the Drosophila haematopoietic system and discusses what is currently known about the contribution of haemocytes to the immune response upon infection and wounding, during all stages of development. © 2015 FEBS.

  12. SIRT1 and HIF1α signaling in metabolism and immune responses.

    PubMed

    Yu, Qing; Dong, Lin; Li, Yan; Liu, Gaungwei

    2018-04-01

    SIRT1 and HIF1α are regarded as two key metabolic sensors in cellular metabolism pathways and play vital roles in influencing immune responses. SIRT1 and HIF1α regulate immune responses in metabolism-dependent and -independent ways. Here, we summarized the recent knowledge of SIRT1 and HIF1α signaling in metabolism and immune responses. HIF1α is a direct target of SIRT1. Sometimes, SIRT1 and HIF1α cooperate or act separately to mediate immune responses. In innate immune responses, SIRT1 can regulate the glycolytic activity of myeloid-derived suppressor cells (MDSCs) and influence MDSC functional differentiation. SIRT1 can regulate monocyte function through NF-κB and PGC-1, accompanying an increased NAD + level. The SIRT1-HIF1α axis bridges the innate immune signal to an adaptive immune response by directing cytokine production of dendritic cells in a metabolism-independent manner, promoting the differentiation of CD4 + T cells. For adaptive immune cells, SIRT1 can mediate the differentiation of inflammatory T cell subsets in a NAD + -dependent manner. HIF1α can stimulate some glycolysis-associated genes and regulate the ATP and ROS generations. In addition, SIRT1-and HIF1α-associated metabolism inhibits the activity of mTOR, thus negatively regulating the differentiation and function of Th9 cells. As immune cells are crucial in controlling immune-associated diseases, SIRT1-and HIF1α associated-metabolism is closely linked to immune-associated diseases, including infection, tumors, allergic airway inflammation, and autoimmune diseases. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Influence of bedding type on mucosal immune responses.

    PubMed

    Sanford, Amy N; Clark, Stephanie E; Talham, Gwen; Sidelsky, Michael G; Coffin, Susan E

    2002-10-01

    The mucosal immune system interacts with the external environment. In the study reported here, we found that bedding materials can influence the intestinal immune responses of mice. We observed that mice housed on wood, compared with cotton bedding, had increased numbers of Peyer's patches (PP) visible under a dissecting microscope. In addition, culture of lymphoid organs revealed increased production of total and virus-specific IgA by PP and mesenteric lymph node (MLN) lymphocytes from mice housed on wood, compared with cotton bedding. However, bedding type did not influence serum virus-specific antibody responses. These observations indicate that bedding type influences the intestinal immune system and suggest that this issue should be considered by mucosal immunologists and personnel at animal care facilities.

  14. Malnutrition: Modulator of Immune Responses in Tuberculosis

    PubMed Central

    Chandrasekaran, Padmapriyadarsini; Saravanan, Natarajan; Bethunaickan, Ramalingam; Tripathy, Srikanth

    2017-01-01

    Nutrition plays a major role in the management of both acute and chronic diseases, in terms of body’s response to the pathogenic organism. An array of nutrients like macro- and micro-nutrients, vitamins, etc., are associated with boosting the host’s immune responses against intracellular pathogens including mycobacterium tuberculosis (M.tb). These nutrients have an immunomodulatory effects in controlling the infection and inflammation process and nutritional deficiency of any form, i.e., malnutrition may lead to nutritionally acquired immunodeficiency syndrome, which greatly increases an individual’s susceptibility to progression of infection to disease. This narrative review looks at the various mechanisms by which nutrition or its deficiency leads to impaired cell mediated and humoral immune responses, which in turn affects the ability of an individual to fight M.tb infection or disease. There is very little evidence in the literature that any specific food on its own or a specific quantity can alter the course of TB disease or be effective in the treatment of malnutrition. Further clinical trials or studies will be needed to recommend and to better understand the link between malnutrition, tuberculosis, and impaired immunity. PMID:29093710

  15. CELLS INVOLVED IN THE IMMUNE RESPONSE

    PubMed Central

    Singhal, Sharwan K.; Richter, Maxwell

    1968-01-01

    Cell suspensions of immune rabbit lymph nodes and spleen were capable of undergoing blastogenesis and mitosis and of incorporating tritiated thymidine when maintained in culture with the specific antigen in vitro. They did not respond to other, non-cross-reacting antigens. The blastogenic response obtained with immune lymph node cells could be correlated with the antibody synthesizing capacity of fragment cultures prepared from the same lymph nodes. Cell suspensions of immune bone marrow responded to non-cross-reacting antigens only whereas cell suspensions of immune thymus, sacculus rotundus, and appendix did not respond when exposed to any of the antigens tested. On the other hand, neither fragments nor cell suspensions prepared from lymph nodes, spleen, and thymus of normal, unimmunized rabbits responded with antibody formation and blastogenesis when exposed to any of the antigens. However, normal bone marrow cells responded with marked blastogenesis and tritiated thymidine uptake. The specificity of this in vitro bone marrow response was demonstrated by the fact that the injection of a protein antigen in vivo resulted in the loss of reactivity by the marrow cell to that particular antigen but not to the other, non-cross-reacting antigens. Furthermore, bone marrow cells of tolerant rabbits failed to respond to the specific antigen in vitro. It was also demonstrated that normal bone marrow cells incubated with antigen are capable of forming antibody which could be detected by the fluorescent antibody technique. This response of the bone marrow cells has been localized to the lymphocyte-rich fraction of the bone marrow. It is concluded that the bone marrow lymphocyte, by virtue of its capacity to react with blastogenesis and mitosis and with antibody formation upon initial exposure to the antigen, a capacity not possessed by lymphocytes of the other lymphoid organs, has a preeminent role in the sequence of cellular events culminating in antibody formation. PMID

  16. EVOLUTION OF THE IMMUNE RESPONSE

    PubMed Central

    Papermaster, Ben W.; Condie, Richard M.; Finstad, Joanne; Good, Robert A.

    1964-01-01

    1. The California hagfish, Eptatretus stoutii, seems to be completely lacking in adaptive immunity: it forms no detectable circulating antibody despite intensive stimulation with a range of antigens; it does not show reactivity to old tuberculin following sensitization with BCG; and gives no evidence of homograft immunity. 2. Studies on the sea lamprey, Petromyzon marinus, have been limited to the response to bacteriophage T2 and hemocyanin in small groups of spawning animals. They suggest that the lamprey may have a low degree of immunologic reactivity. 3. One holostean, the bowfin (Amia calva) and the guitarfish (Rhinobatos productus), an elasmobranch, showed a low level of primary response to phage and hemocyanin. The response is slow and antibody levels low. Both the bowfin and the guitarfish showed a vigorous secondary response to phage, but neither showed much enhancement of reactivity to hemocyanin in the secondary response. The bowfin formed precipitating antibody to hemocyanin, but the guitarfish did not. Both hemagglutinating and precipitating antibody to hemocyanin were also observed in the primary response of the black bass. 4. The bowfin was successfully sensitized to Ascaris antigen, and lesions of the delayed type developed after challenge at varying intervals following sensitization. 5. The horned shark (Heterodontus franciscii) regularly cleared hemocyanin from the circulation after both primary and secondary antigenic stimulation, and regularly formed hemagglutinating antibody, but not precipitating antibody, after both primary and secondary stimulation with this antigen. These animals regularly cleared bacteriophage from the circulation after both the primary and secondary stimulation with bacteriophage T2. Significant but small amounts of antibody were produced in a few animals in the primary response, and larger amounts in the responding animals after secondary antigenic stimulation. 6. Studies by starch gel and immunoelectrophoresis show that

  17. The Immune Response in Measles: Virus Control, Clearance and Protective Immunity.

    PubMed

    Griffin, Diane E

    2016-10-12

    Measles is an acute systemic viral infection with immune system interactions that play essential roles in multiple stages of infection and disease. Measles virus (MeV) infection does not induce type 1 interferons, but leads to production of cytokines and chemokines associated with nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) signaling and activation of the NACHT, LRR and PYD domains-containing protein (NLRP3) inflammasome. This restricted response allows extensive virus replication and spread during a clinically silent latent period of 10-14 days. The first appearance of the disease is a 2-3 day prodrome of fever, runny nose, cough, and conjunctivitis that is followed by a characteristic maculopapular rash that spreads from the face and trunk to the extremities. The rash is a manifestation of the MeV-specific type 1 CD4⁺ and CD8⁺ T cell adaptive immune response with lymphocyte infiltration into tissue sites of MeV replication and coincides with clearance of infectious virus. However, clearance of viral RNA from blood and tissues occurs over weeks to months after resolution of the rash and is associated with a period of immunosuppression. However, during viral RNA clearance, MeV-specific antibody also matures in type and avidity and T cell functions evolve from type 1 to type 2 and 17 responses that promote B cell development. Recovery is associated with sustained levels of neutralizing antibody and life-long protective immunity.

  18. The host immune response to Clostridium difficile infection

    PubMed Central

    2013-01-01

    Clostridium difficile infection (CDI) is the most common infectious cause of healthcare-acquired diarrhoea. Outcomes of C. difficile colonization are varied, from asymptomatic carriage to fulminant colitis and death, due in part to the interplay between the pathogenic virulence factors of the bacterium and the counteractive immune responses of the host. Secreted toxins A and B are the major virulence factors of C. difficile and induce a profound inflammatory response by intoxicating intestinal epithelial cells causing proinflammatory cytokine release. Host cell necrosis, vascular permeability and neutrophil infiltration lead to an elevated white cell count, profuse diarrhoea and in severe cases, dehydration, hypoalbuminaemia and toxic megacolon. Other bacterial virulence factors, including surface layer proteins and flagella proteins, are detected by host cell surface signal molecules that trigger downstream cell-mediated immune pathways. Human studies have identified a role for serum and faecal immunoglobulin levels in protection from disease, but the recent development of a mouse model of CDI has enabled studies into the precise molecular interactions that trigger the immune response during infection. Key effector molecules have been identified that can drive towards a protective anti-inflammatory response or a damaging proinflammatory response. The limitations of current antimicrobial therapies for CDI have led to the development of both active and passive immunotherapies, none of which have, as yet been formally approved for CDI. However, recent advances in our understanding of the molecular basis of host immune protection against CDI may provide an exciting opportunity for novel therapeutic developments in the future. PMID:25165542

  19. Mosquito repellency of novel Trifluoromethylphenyl amides

    USDA-ARS?s Scientific Manuscript database

    Human diseases caused by mosquito-transmitted pathogens include malaria, dengue and yellow fever and are responsible for several million human deaths every year, according to the World Health Organization (WHO). Our current research projects focus on the development of new insecticides and repellent...

  20. Comparative genomic analysis of the Tribolium immune system

    PubMed Central

    Zou, Zhen; Evans, Jay D; Lu, Zhiqiang; Zhao, Picheng; Williams, Michael; Sumathipala, Niranji; Hetru, Charles; Hultmark, Dan; Jiang, Haobo

    2007-01-01

    Background Tribolium castaneum is a species of Coleoptera, the largest and most diverse order of all eukaryotes. Components of the innate immune system are hardly known in this insect, which is in a key phylogenetic position to inform us about genetic innovations accompanying the evolution of holometabolous insects. We have annotated immunity-related genes and compared them with homologous molecules from other species. Results Around 300 candidate defense proteins are identified based on sequence similarity to homologs known to participate in immune responses. In most cases, paralog counts are lower than those of Drosophila melanogaster or Anopheles gambiae but are substantially higher than those of Apis mellifera. The genome contains probable orthologs for nearly all members of the Toll, IMD, and JAK/STAT pathways. While total numbers of the clip-domain serine proteinases are approximately equal in the fly (29), mosquito (32) and beetle (30), lineage-specific expansion of the family is discovered in all three species. Sixteen of the thirty-one serpin genes form a large cluster in a 50 kb region that resulted from extensive gene duplications. Among the nine Toll-like proteins, four are orthologous to Drosophila Toll. The presence of scavenger receptors and other related proteins indicates a role of cellular responses in the entire system. The structures of some antimicrobial peptides drastically differ from those in other orders of insects. Conclusion A framework of information on Tribolium immunity is established, which may serve as a stepping stone for future genetic analyses of defense responses in a nondrosophiline genetic model insect. PMID:17727709

  1. Intravital imaging of cutaneous immune responses.

    PubMed

    Nakamizo, Satoshi; Egawa, Gyohei; Bing, Jasmine Tan Kah; Kabashima, Kenji

    2018-05-25

    Various immune cells are present in the skin and modulate the cutaneous immune response. In order to capture such dynamic phenomena, intravital imaging is an important technique and there is a possibility to provide substantial information that is not available using conventional histological analysis. Multiphoton microscope enable direct, three-dimensional, minimally invasive imaging of biological samples with high spatiotemporal resolution, and now become the main method for intravital imaging studies. Here, we will introduce the latest knowledge obtained by intravital imaging of the skin. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response.

    PubMed

    Zhong, Hong; Ma, Minjuan; Liang, Tingming; Guo, Li

    2018-01-01

    In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction.

  3. Flying in tune: sexual recognition in mosquitoes.

    PubMed

    Gibson, Gabriella; Russell, Ian

    2006-07-11

    Mosquitoes hear with their antennae, which in most species are sexually dimorphic. Johnston, who discovered the mosquito auditory organ at the base of the antenna 150 years ago, speculated that audition was involved with mating behaviour. Indeed, male mosquitoes are attracted to female flight tones. The male auditory organ has been proposed to act as an acoustic filter for female flight tones, but female auditory behavior is unknown. We show, for the first time, interactive auditory behavior between males and females that leads to sexual recognition. Individual males and females both respond to pure tones by altering wing-beat frequency. Behavioral auditory tuning curves, based on minimum threshold sound levels that elicit a change in wing-beat frequency to pure tones, are sharper than the mechanical tuning of the antennae, with males being more sensitive than females. We flew opposite-sex pairs of tethered Toxorhynchites brevipalpis and found that each mosquito alters its wing-beat frequency in response to the flight tone of the other, so that within seconds their flight-tone frequencies are closely matched, if not completely synchronized. The flight tones of same-sex pairs may converge in frequency but eventually diverge dramatically.

  4. Characterization of the immune response of domestic fowl following immunization with proteins extracted from Dermanyssus gallinae.

    PubMed

    Harrington, David; Din, Hatem Mohi El; Guy, Jonathan; Robinson, Karen; Sparagano, Olivier

    2009-03-23

    Dermanyssus gallinae is the most significant ectoparasite of European poultry egg laying production systems due to high costs of control and associated production losses as well as adverse effects on bird welfare. In this study, soluble proteins were extracted from unfed D. gallinae (DGE) using a urea-based detergent and ultra-filtration, passed through a 0.22 microm filter and blended aseptically with adjuvant. One group of laying hens was immunized with DGE and adjuvant (Montanide ISA 50 V) whilst another group (Control) received physiological saline and adjuvant. All birds were immunized on two occasions, 21 days apart. Antibody response to immunization was determined by ELISA and western blotting using immunoglobulins (Igs) extracted from egg yolk. DGE immunization of hens resulted in a significant (P<0.05) IgY response compared to controls, although there was no significant difference in IgM response between treatments. A number of proteins were identified by western blotting using IgY antibodies from DGE immunized birds, most prominently at 40 and 230kDa. Analysis of proteins from approximately corresponding bands on SDS-PAGE confirmed the identity of tropomyosin, whilst other proteins showed high sequence homology with myosin and actin from other arachnid and insect species. Immunization of hens with DGE resulted in a 50.6% increase in mite mortality (P<0.001) 17h after feeding when tested by an in vitro mite feeding model. Data in this study demonstrate that somatic antigens from D. gallinae can be used to stimulate a protective immune response in laying hens. Further work is needed to identify other proteins of interest that could confer higher protection against D. gallinae, as well as optimization of the vaccination and in vitro testing protocol.

  5. Interplay of parasite-driven immune responses and autoimmunity.

    PubMed

    Zaccone, Paola; Burton, Oliver T; Cooke, Anne

    2008-01-01

    As more facts emerge regarding the ways in which parasite-derived molecules modulate the host immune response, it is possible to envisage how a lack of infection by agents that once infected humans commonly might contribute to the rise in autoimmune disease. Through effects on cells of both the innate and adaptive arms of the immune response, parasites can orchestrate a range of outcomes that are beneficial not only to parasites, in terms of facilitating their life cycles, but also to their host, in limiting pathology.

  6. Arbovirus Prevalence in Mosquitoes, Kenya

    PubMed Central

    Sutherland, Laura J.; Muiruri, Samuel; Muchiri, Eric M.; Gray, Laurie R.; Zimmerman, Peter A.; Hise, Amy G.; King, Charles H.

    2011-01-01

    Few studies have investigated the many mosquito species that harbor arboviruses in Kenya. During the 2006–2007 Rift Valley fever outbreak in North Eastern Province, Kenya, exophilic mosquitoes were collected from homesteads within 2 affected areas: Gumarey (rural) and Sogan-Godud (urban). Mosquitoes (n = 920) were pooled by trap location and tested for Rift Valley fever virus and West Nile virus. The most common mosquitoes trapped belonged to the genus Culex (75%). Of 105 mosquito pools tested, 22% were positive for Rift Valley fever virus, 18% were positive for West Nile virus, and 3% were positive for both. Estimated mosquito minimum infection rates did not differ between locations. Our data demonstrate the local abundance of mosquitoes that could propagate arboviral infections in Kenya and the high prevalence of vector arbovirus positivity during a Rift Valley fever outbreak. PMID:21291594

  7. Inbreeding effects on immune response in free-living song sparrows (Melospiza melodia).

    PubMed

    Reid, Jane M; Arcese, Peter; Keller, Lukas F; Elliott, Kyle H; Sampson, Laura; Hasselquist, Dennis

    2007-03-07

    The consequences of inbreeding for host immunity to parasitic infection have broad implications for the evolutionary and dynamical impacts of parasites on populations where inbreeding occurs. To rigorously assess the magnitude and the prevalence of inbreeding effects on immunity, multiple components of host immune response should be related to inbreeding coefficient (f) in free-living individuals. We used a pedigreed, free-living population of song sparrows (Melospiza melodia) to test whether individual responses to widely used experimental immune challenges varied consistently with f. The patagial swelling response to phytohaemagglutinin declined markedly with f in both females and males in both 2002 and 2003, although overall inbreeding depression was greater in males. The primary antibody response to tetanus toxoid declined with f in females but not in males in both 2004 and 2005. Primary antibody responses to diphtheria toxoid were low but tended to decline with f in 2004. Overall inbreeding depression did not solely reflect particularly strong immune responses in outbred offspring of immigrant-native pairings or weak responses in highly inbred individuals. These data indicate substantial and apparently sex-specific inbreeding effects on immune response, implying that inbred hosts may be relatively susceptible to parasitic infection to differing degrees in males and females.

  8. Mosquito, adult (image)

    MedlinePlus

    This illustration shows an adult southern house mosquito. This mosquito feeds on blood and is the carrier of many diseases, such as encephalitis, West Nile, dengue fever, yellow fever, and others. ( ...

  9. Anti-tumor immune response after photodynamic therapy

    NASA Astrophysics Data System (ADS)

    Mroz, Pawel; Castano, Ana P.; Wu, Mei X.; Kung, Andrew L.; Hamblin, Michael R.

    2009-06-01

    Anti-tumor immunity is stimulated after PDT due a number of factors including: the acute inflammatory response caused by PDT, release of antigens from PDT-damaged tumor cells, priming of the adaptive immune system to recognize tumor-associated antigens (TAA), and induction of heat-shock proteins. The induction of specific CD8+ T-lymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy as it would allow the treatment of tumors that may have already metastasized. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. We have carried out in vivo PDT with a BPD-mediated vascular regimen using a pair of BALB/c mouse colon carcinomas: CT26 wild type expressing the naturally occurring retroviral antigen gp70 and CT26.CL25 additionally expressing beta-galactosidase (b-gal) as a model tumor rejection antigen. PDT of CT26.CL25 cured 100% of tumors but none of the CT26WT tumors (all recurred). Cured CT26.CL25 mice were resistant to rechallenge. Moreover mice with two bilateral CT26.CL25 tumors that had only one treated with PDT demonstrated spontaneous regression of 70% of untreated contralateral tumors. T-lymphocytes were isolated from lymph nodes of PDT cured mice that recognized a particular peptide specific to b-gal antigen. T-lymphocytes from LN were able to kill CT26.CL25 target cells in vitro but not CT26WT cells as shown by a chromium release assay. CT26.CL25 tumors treated with PDT and removed five days later had higher levels of Th1 cytokines than CT26 WT tumors showing a higher level of immune response. When mice bearing CT26WT tumors were treated with a regimen of low dose cyclophosphamide (CY) 2 days before, PDT led to 100% of cures (versus 0% without CY) and resistance to rechallenge. Low dose CY is thought to deplete regulatory T-cells (Treg, CD4+CD25+foxp

  10. Mosquito control pesticides and sea surface temperatures have differential effects on the survival and oxidative stress response of coral larvae.

    PubMed

    Ross, Cliff; Olsen, Kevin; Henry, Michael; Pierce, Richard

    2015-04-01

    The declining health of coral reefs is intensifying worldwide at an alarming rate due to the combined effects of land-based sources of pollution and climate change. Despite the persistent use of mosquito control pesticides in populated coastal areas, studies examining the survival and physiological impacts of early life-history stages of non-targeted marine organisms are limited. In order to better understand the combined effects of mosquito pesticides and rising sea surface temperatures, we exposed larvae from the coral Porites astreoides to selected concentrations of two major mosquito pesticide ingredients, naled and permethrin, and seawater elevated +3.5 °C. Following 18-20 h of exposure, larvae exposed to naled concentrations of 2.96 µg L(-1) or greater had significantly reduced survivorship compared to controls. These effects were not detected in the presence of permethrin or elevated temperature. Furthermore, larval settlement, post-settlement survival and zooxanthellae density were not impacted by any treatment. To evaluate the sub-lethal stress response of larvae, several oxidative stress endpoints were utilized. Biomarker responses to pesticide exposure were variable and contingent upon pesticide type as well as the specific biomarker being employed. In some cases, such as with protein carbonylation and catalase gene expression, the effects of naled exposure and temperature were interactive. In other cases pesticide exposure failed to induce any sub-lethal stress response. Overall, these results demonstrate that P. astreoides larvae have a moderate degree of resistance against short-term exposure to ecologically relevant concentrations of pesticides even in the presence of elevated temperature. In addition, this work highlights the importance of considering the complexity and differential responses encountered when examining the impacts of combined stressors that occur on varying spatial scales.

  11. Area-wide management of Aedes albopictus: choice of study sites based on geospatial characteristics, socioeconomic factors, and mosquito populations

    USDA-ARS?s Scientific Manuscript database

    Aedes (Stegomyia) albopictus (Skuse), the Asian tiger mosquito, is an introduced invasive species in the U.S. responsible for a significant proportion of service requests to local mosquito control programs. This container-utilizing mosquito is refractory to standard mosquito abatement measures in th...

  12. Radiation-induced immune responses: mechanisms and therapeutic perspectives.

    PubMed

    Jeong, Hoibin; Bok, Seoyeon; Hong, Beom-Ju; Choi, Hyung-Seok; Ahn, G-One

    2016-09-01

    Recent advancement in the radiotherapy technology has allowed conformal delivery of high doses of ionizing radiation precisely to the tumors while sparing large volume of the normal tissues, which have led to better clinical responses. Despite this technological advancement many advanced tumors often recur and they do so within the previously irradiated regions. How could tumors recur after receiving such high ablative doses of radiation? In this review, we outlined how radiation can elicit anti-tumor responses by introducing some of the cytokines that can be induced by ionizing radiation. We then discuss how tumor hypoxia, a major limiting factor responsible for failure of radiotherapy, may also negatively impact the anti-tumor responses. In addition, we highlight how there may be other populations of immune cells including regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSCs), and tumor-associated macrophages (TAMs) that can be recruited to tumors interfering with the anti-tumor immunity. Finally, the impact of irradiation on tumor hypoxia and the immune responses according to different radiotherapy regimen is also delineated. It is indeed an exciting time to see that radiotherapy is being combined with immunotherapy in the clinic and we hope that this review can add an excitement to the field.

  13. The role of dehydroepiandrosterone on functional innate immune responses to acute stress.

    PubMed

    Prall, Sean P; Larson, Emilee E; Muehlenbein, Michael P

    2017-12-01

    The androgen dehydroepiandrosterone (DHEA) responds to stress activation, exhibits anti-glucocorticoid properties, and modulates immunity in diverse ways, yet little is known of its role in acute stress responses. In this study, the effects of DHEA and its sulfate ester DHEA-S on human male immune function during exposure to an acute stressor is explored. Variation in DHEA, DHEA-S, testosterone, and cortisol, along with bacterial killing assays, was measured in response to a modified Trier Social Stress test in 27 young adult males. Cortisol was positively related to salivary innate immunity but only for participants who also exhibited high DHEA responses. Additionally, DHEA positively and DHEA-S negatively predicted salivary immunity, but the opposite was observed for serum-based innate immunity. The DHEA response to acute stress appears to be an important factor in stress-mediated immunological responses, with differential effects on immunity dependent upon the presence of other hormones, primarily cortisol and DHEA-S. These results suggest that DHEA plays an important role, alongside other hormones, in modulating immunological shifts during acute stress. Copyright © 2017 John Wiley & Sons, Ltd.

  14. RNA-Seq Reveals an Integrated Immune Response in Nucleated Erythrocytes

    PubMed Central

    Morera, Davinia; Roher, Nerea; Ribas, Laia; Balasch, Joan Carles; Doñate, Carmen; Callol, Agnes; Boltaña, Sebastian; Roberts, Steven; Goetz, Giles; Goetz, Frederick W.; MacKenzie, Simon A.

    2011-01-01

    Background Throughout the primary literature and within textbooks, the erythrocyte has been tacitly accepted to have maintained a unique physiological role; namely gas transport and exchange. In non-mammalian vertebrates, nucleated erythrocytes are present in circulation throughout the life cycle and a fragmented series of observations in mammals support a potential role in non-respiratory biological processes. We hypothesised that nucleated erythrocytes could actively participate via ligand-induced transcriptional re-programming in the immune response. Methodology/Principal Findings Nucleated erythrocytes from both fish and birds express and regulate specific pattern recognition receptor (PRR) mRNAs and, thus, are capable of specific pathogen associated molecular pattern (PAMP) detection that is central to the innate immune response. In vitro challenge with diverse PAMPs led to de novo specific mRNA synthesis of both receptors and response factors including interferon-alpha (IFNα) that exhibit a stimulus-specific polysomal shift supporting active translation. RNA-Seq analysis of the PAMP (Poly (I∶C), polyinosinic∶polycytidylic acid)-erythrocyte response uncovered diverse cohorts of differentially expressed mRNA transcripts related to multiple physiological systems including the endocrine, reproductive and immune. Moreover, erythrocyte-derived conditioned mediums induced a type-1 interferon response in macrophages thus supporting an integrative role for the erythrocytes in the immune response. Conclusions/Significance We demonstrate that nucleated erythrocytes in non-mammalian vertebrates spanning significant phylogenetic distance participate in the immune response. RNA-Seq studies highlight a mRNA repertoire that suggests a previously unrecognized integrative role for the erythrocytes in other physiological systems. PMID:22046430

  15. Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response

    PubMed Central

    Zhong, Hong; Ma, Minjuan

    2018-01-01

    In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction. PMID:29484304

  16. Dengue virus infection: current concepts in immune mechanisms and lessons from murine models

    PubMed Central

    Guabiraba, Rodrigo; Ryffel, Bernhard

    2014-01-01

    Dengue viruses (DENV), a group of four serologically distinct but related flaviviruses, are responsible for one of the most important emerging viral diseases. This mosquito-borne disease has a great impact in tropical and subtropical areas of the world in terms of illness, mortality and economic costs, mainly due to the lack of approved vaccine or antiviral drugs. Infections with one of the four serotypes of DENV (DENV-1–4) result in symptoms ranging from an acute, self-limiting febrile illness, dengue fever, to severe dengue haemorrhagic fever or dengue shock syndrome. We reviewed the existing mouse models of infection, including the DENV-2-adapted strain P23085. The role of CC chemokines, interleukin-17 (IL-17), IL-22 and invariant natural killer T cells in mediating the exacerbation of disease in immune-competent mice is highlighted. Investigations in both immune-deficient and immune-competent mouse models of DENV infection may help to identify key host–pathogen factors and devise novel therapies to restrain the systemic and local inflammatory responses associated with severe DENV infection. PMID:24182427

  17. Role of muscarinic receptors in the regulation of immune and inflammatory responses

    PubMed Central

    Razani-Boroujerdi, Seddigheh; Behl, Muskaan; Hahn, Fletcher F.; Pena-Philippides, Juan Carlos; Hutt, Julie; Sopori, Mohan L.

    2008-01-01

    Leukocytes contain both nicotinic and muscarinic receptors, and while activation of nicotinic receptors suppresses immune/inflammatory responses, the role of muscarinic receptors in immunity is unclear. We examined the effects of a muscarinic receptor antagonist (atropine) and agonist (oxotremorine), administered chronically through miniosmotic pumps, on immune/inflammatory responses in the rat. Results show that while oxotremorine stimulated, atropine inhibited the antibody and T-cell proliferative responses. Moreover, atropine also suppressed the turpentine-induced leukocytic infiltration and tissue injury, and inhibited chemotaxis of leukocytes toward neutrophil and monocyte/lymphocyte chemoattractants. Thus, activation of nicotinic and muscarinic receptors has opposite effects on the immune/inflammatory responses. PMID:18190972

  18. A comparative study of an innate immune response in Lamprologine cichlid fishes.

    PubMed

    O'Connor, Constance M; Reddon, Adam R; Marsh-Rollo, Susan E; Hellmann, Jennifer K; Ligocki, Isaac Y; Hamilton, Ian M; Balshine, Sigal

    2014-10-01

    Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding (Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour (Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.

  19. A comparative study of an innate immune response in Lamprologine cichlid fishes

    NASA Astrophysics Data System (ADS)

    O'Connor, Constance M.; Reddon, Adam R.; Marsh-Rollo, Susan E.; Hellmann, Jennifer K.; Ligocki, Isaac Y.; Hamilton, Ian M.; Balshine, Sigal

    2014-10-01

    Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding ( Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour ( Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.

  20. The potential for flower nectar to allow mosquito to mosquito transmission of Francisella tularensis.

    PubMed

    Kenney, Adam; Cusick, Austin; Payne, Jessica; Gaughenbaugh, Anna; Renshaw, Andrea; Wright, Jenna; Seeber, Roger; Barnes, Rebecca; Florjanczyk, Aleksandr; Horzempa, Joseph

    2017-01-01

    Francisella tularensis is disseminated in nature by biting arthropods such as mosquitoes. The relationship between mosquitoes and F. tularensis in nature is highly ambiguous, due in part to the fact that mosquitoes have caused significant tularemia outbreaks despite being classified as a mechanical vector of F. tularensis. One possible explanation for mosquitoes being a prominent, yet mechanical vector is that these insects feed on flower nectar between blood meals, allowing for transmission of F. tularensis between mosquitoes. Here, we aimed to assess whether F. tularensis could survive in flower nectar. Moreover, we examined if mosquitoes could interact with or ingest and transmit F. tularensis from one source of nectar to another. F. tularensis exhibited robust survivability in flower nectar with concentrations of viable bacteria remaining consistent with the rich growth medium. Furthermore, F. tularensis was able to survive (albeit to a lesser extent) in 30% sucrose (a nectar surrogate) over a period of time consistent with that of a typical flower bloom. Although we observed diminished bacterial survival in the nectar surrogate, mosquitoes that fed on this material became colonized with F. tularensis. Finally, colonized mosquitoes were capable of transferring F. tularensis to a sterile nectar surrogate. These data suggest that flower nectar may be capable of serving as a temporary source of F. tularensis that could contribute to the amplification of outbreaks. Mosquitoes that feed on an infected mammalian host and subsequently feed on flower nectar could deposit some F. tularensis bacteria into the nectar in the process. Mosquitoes subsequently feeding on this nectar source could potentially become colonized by F. tularensis. Thus, the possibility exists that flower nectar may allow for vector-vector transmission of F. tularensis.

  1. Immune response to measles vaccine in Peruvian children.

    PubMed Central

    Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.

    2001-01-01

    OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811

  2. The importance of temperature fluctuations in understanding mosquito population dynamics and malaria risk.

    PubMed

    Beck-Johnson, Lindsay M; Nelson, William A; Paaijmans, Krijn P; Read, Andrew F; Thomas, Matthew B; Bjørnstad, Ottar N

    2017-03-01

    Temperature is a key environmental driver of Anopheles mosquito population dynamics; understanding its central role is important for these malaria vectors. Mosquito population responses to temperature fluctuations, though important across the life history, are poorly understood at a population level. We used stage-structured, temperature-dependent delay-differential equations to conduct a detailed exploration of the impacts of diurnal and annual temperature fluctuations on mosquito population dynamics. The model allows exploration of temperature-driven temporal changes in adult age structure, giving insights into the population's capacity to vector malaria parasites. Because of temperature-dependent shifts in age structure, the abundance of potentially infectious mosquitoes varies temporally, and does not necessarily mirror the dynamics of the total adult population. In addition to conducting the first comprehensive theoretical exploration of fluctuating temperatures on mosquito population dynamics, we analysed observed temperatures at four locations in Africa covering a range of environmental conditions. We found both temperature and precipitation are needed to explain the observed malaria season in these locations, enhancing our understanding of the drivers of malaria seasonality and how temporal disease risk may shift in response to temperature changes. This approach, tracking both mosquito abundance and age structure, may be a powerful tool for understanding current and future malaria risk.

  3. The host immune response to gastrointestinal nematode infection in sheep.

    PubMed

    McRae, K M; Stear, M J; Good, B; Keane, O M

    2015-12-01

    Gastrointestinal nematode infection represents a major threat to the health, welfare and productivity of sheep populations worldwide. Infected lambs have a reduced ability to absorb nutrients from the gastrointestinal tract, resulting in morbidity and occasional mortality. The current chemo-dominant approach to nematode control is considered unsustainable due to the increasing incidence of anthelmintic resistance. In addition, there is growing consumer demand for food products from animals not subjected to chemical treatment. Future mechanisms of nematode control must rely on alternative, sustainable strategies such as vaccination or selective breeding of resistant animals. Such strategies take advantage of the host's natural immune response to nematodes. The ability to resist gastrointestinal nematode infection is considered to be dependent on the development of a protective acquired immune response, although the precise immune mechanisms involved in initiating this process remain to be fully elucidated. In this study, current knowledge on the innate and acquired host immune response to gastrointestinal nematode infection in sheep and the development of immunity is reviewed. © 2015 John Wiley & Sons Ltd.

  4. Effects of combination of leaf resources on competition in container mosquito larvae.

    PubMed

    Reiskind, M H; Zarrabi, A A; Lounibos, L P

    2012-08-01

    Resource diversity is critical to fitness in many insect species, and may determine the coexistence of competitive species and the function of ecosystems. Plant material provides the nutritional base for numerous aquatic systems, yet the consequences of diversity of plant material have not been studied in aquatic container systems important for the production of mosquitoes. To address how diversity in leaf detritus affects container-inhabiting mosquitoes, we examined how leaf species affect competition between two container inhabiting mosquito larvae, Aedes aegypti and Aedes albopictus, that co-occur in many parts of the world. We tested the hypotheses that leaf species changes the outcome of intra- and interspecific competition between these mosquito species, and that combinations of leaf species affect competition in a manner not predictable based upon the response to each leaf species alone (i.e. the response to leaf combinations is non-additive). We find support for our first hypothesis that leaf species can affect competition, evidence that, in general, leaf combination alters competitive interactions, and no support that leaf combination impacts interspecific competition differently than intraspecific competition. We conclude that combinations of leaves increase mosquito production non-additively such that combinations of leaves act synergistically, in general, and result in higher total yield of adult mosquitoes in most cases, although certain leaf combinations for A. albopictus are antagonistic. We also conclude that leaf diversity does not have a different effect on interspecific competition between A. aegypti and A. albopictus, relative to intraspecific competition for each mosquito.

  5. [Bone marrow stromal damage mediated by immune response activity].

    PubMed

    Vojinović, J; Kamenov, B; Najman, S; Branković, Lj; Dimitrijević, H

    1994-01-01

    The aim of this work was to estimate influence of activated immune response on hematopoiesis in vitro, using the experimental model of BCG immunized BALB/c mice and in patients with chronic immunoactivation: long-lasting infections, autoimmunity or malignancy. We correlated changes in long term bone marrow cultures (Dexter) and NBT reduction with appearance of anemia in patients and experimental model of immunization by BCG. Increased spontaneous NBT reduction pointed out role of macrophage activation in bone marrow stroma damage. Long-term bone marrow cultures showed reduced number of hematopoietic cells, with predomination of fibroblasts and loss of fat cells. This results correlated with anemia and leucocytosis with stimulated myelopoiesis in peripheral blood. Activation of immune response, or acting of any agent that directly changes extracellular matrix and cellularity of bone marrow, may result in microenviroment bone marrow damage that modify hematopoiesis.

  6. The Lung Immune Response to Nontypeable Haemophilus influenzae (Lung Immunity to NTHi)

    PubMed Central

    King, Paul T.; Sharma, Roleen

    2015-01-01

    Haemophilus influenzae is divided into typeable or nontypeable strains based on the presence or absence of a polysaccharide capsule. The typeable strains (such as type b) are an important cause of systemic infection, whilst the nontypeable strains (designated as NTHi) are predominantly respiratory mucosal pathogens. NTHi is present as part of the normal microbiome in the nasopharynx, from where it may spread down to the lower respiratory tract. In this context it is no longer a commensal and becomes an important respiratory pathogen associated with a range of common conditions including bronchitis, bronchiectasis, pneumonia, and particularly chronic obstructive pulmonary disease. NTHi induces a strong inflammatory response in the respiratory tract with activation of immune responses, which often fail to clear the bacteria from the lung. This results in recurrent/persistent infection and chronic inflammation with consequent lung pathology. This review will summarise the current literature about the lung immune response to nontypeable Haemophilus influenzae, a topic that has important implications for patient management. PMID:26114124

  7. Modeled response of the West Nile virus vector Culex quinquefasciatus to changing climate using the dynamic mosquito simulation model

    NASA Astrophysics Data System (ADS)

    Morin, Cory W.; Comrie, Andrew C.

    2010-09-01

    Climate can strongly influence the population dynamics of disease vectors and is consequently a key component of disease ecology. Future climate change and variability may alter the location and seasonality of many disease vectors, possibly increasing the risk of disease transmission to humans. The mosquito species Culex quinquefasciatus is a concern across the southern United States because of its role as a West Nile virus vector and its affinity for urban environments. Using established relationships between atmospheric variables (temperature and precipitation) and mosquito development, we have created the Dynamic Mosquito Simulation Model (DyMSiM) to simulate Cx. quinquefasciatus population dynamics. The model is driven with climate data and validated against mosquito count data from Pasco County, Florida and Coachella Valley, California. Using 1-week and 2-week filters, mosquito trap data are reproduced well by the model ( P < 0.0001). Dry environments in southern California produce different mosquito population trends than moist locations in Florida. Florida and California mosquito populations are generally temperature-limited in winter. In California, locations are water-limited through much of the year. Using future climate projection data generated by the National Center for Atmospheric Research CCSM3 general circulation model, we applied temperature and precipitation offsets to the climate data at each location to evaluate mosquito population sensitivity to possible future climate conditions. We found that temperature and precipitation shifts act interdependently to cause remarkable changes in modeled mosquito population dynamics. Impacts include a summer population decline from drying in California due to loss of immature mosquito habitats, and in Florida a decrease in late-season mosquito populations due to drier late summer conditions.

  8. Radiation induces an antitumour immune response to mouse melanoma.

    PubMed

    Perez, Carmen A; Fu, Allie; Onishko, Halina; Hallahan, Dennis E; Geng, Ling

    2009-12-01

    Irradiation of cancer cells can cause immunogenic death. We used mouse models to determine whether irradiation of melanoma can enhance the host antitumour immune response and function as an effective vaccination strategy, and investigated the molecular mechanisms involved in this radiation-induced response. For in vivo studies, C57BL6/J mice and the B16F0 melanoma cell line were used in a lung metastasis model, intratumoural host immune activation assays, and tumour growth delay studies. In vitro studies included a dendritic cell (DC) phagocytosis assay, detection of cell surface exposure of the protein calreticulin (CRT), and small interfering RNA (siRNA)-mediated depletion of CRT cellular levels. Irradiation of cutaneous melanomas prior to their resection resulted in more than 20-fold reduction in lung metastases after systemic challenge with untreated melanoma cells. A syngeneic vaccine derived from irradiated melanoma cells also induced adaptive immune response markers in irradiated melanoma implants. Our data indicate a trend for radiation-induced increase in melanoma cell surface exposure of CRT, which is involved in the enhanced phagocytic activity of DC against irradiated melanoma cells (VIACUC). The present study suggests that neoadjuvant irradiation of cutaneous melanoma tumours prior to surgical resection can stimulate an endogenous anti-melanoma host immune response.

  9. MAN, MOSQUITOES AND MICROBES.

    ERIC Educational Resources Information Center

    SCHOONOVER, ROBERT A.

    THE CONTROL OF MOSQUITOES IS A MATTER OF INCREASING CONCERN IN THE STATE OF FLORIDA. A BRIEF DESCRIPTION OF THE LIFE CYCLE, VARIOUS SPECIES, CONTROL, AND DESCRIPTION OF DISEASES TRANSMITTED BY THE MOSQUITO WAS PRESENTED. THE ARTICLE CONCLUDED THAT MOSQUITO CONTROL IS NOT ONLY A HEALTH PROBLEM, BUT ALSO A MATTER OF IMPROVED ECONOMICS IN RELATION TO…

  10. Adjuvant effects of saponins on animal immune responses*

    PubMed Central

    Rajput, Zahid Iqbal; Hu, Song-hua; Xiao, Chen-wen; Arijo, Abdullah G.

    2007-01-01

    Vaccines require optimal adjuvants including immunopotentiator and delivery systems to offer long term protection from infectious diseases in animals and man. Initially it was believed that adjuvants are responsible for promoting strong and sustainable antibody responses. Now it has been shown that adjuvants influence the isotype and avidity of antibody and also affect the properties of cell-mediated immunity. Mostly oil emulsions, lipopolysaccharides, polymers, saponins, liposomes, cytokines, ISCOMs (immunostimulating complexes), Freund’s complete adjuvant, Freund’s incomplete adjuvant, alums, bacterial toxins etc., are common adjuvants under investigation. Saponin based adjuvants have the ability to stimulate the cell mediated immune system as well as to enhance antibody production and have the advantage that only a low dose is needed for adjuvant activity. In the present study the importance of adjuvants, their role and the effect of saponin in immune system is reviewed. PMID:17323426

  11. Ubiquitin enzymes in the regulation of immune responses.

    PubMed

    Ebner, Petra; Versteeg, Gijs A; Ikeda, Fumiyo

    2017-08-01

    Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses.

  12. Higher Mosquito Production in Low-Income Neighborhoods of Baltimore and Washington, DC: Understanding Ecological Drivers and Mosquito-Borne Disease Risk in Temperate Cities

    PubMed Central

    LaDeau, Shannon L.; Leisnham, Paul T.; Biehler, Dawn; Bodner, Danielle

    2013-01-01

    Mosquito-vectored pathogens are responsible for devastating human diseases and are (re)emerging in many urban environments. Effective mosquito control in urban landscapes relies on improved understanding of the complex interactions between the ecological and social factors that define where mosquito populations can grow. We compared the density of mosquito habitat and pupae production across economically varying neighborhoods in two temperate U.S. cities (Baltimore, MD and Washington, DC). Seven species of mosquito larvae were recorded. The invasive Aedes albopictus was the only species found in all neighborhoods. Culex pipiens, a primary vector of West Nile virus (WNV), was most abundant in Baltimore, which also had more tire habitats. Both Culex and Aedes pupae were more likely to be sampled in neighborhoods categorized as being below median income level in each city and Aedes pupae density was also greater in container habitats found in these lower income neighborhoods. We infer that lower income residents may experience greater exposure to potential disease vectors and Baltimore residents specifically, were at greater risk of exposure to the predominant WNV vector. However, we also found that resident-reported mosquito nuisance was not correlated with our measured risk index, indicating a potentially important mismatch between motivation needed to engage participation in control efforts and the relative importance of control among neighborhoods. PMID:23583963

  13. The potential for flower nectar to allow mosquito to mosquito transmission of Francisella tularensis

    PubMed Central

    Payne, Jessica; Gaughenbaugh, Anna; Renshaw, Andrea; Wright, Jenna; Seeber, Roger; Barnes, Rebecca; Florjanczyk, Aleksandr; Horzempa, Joseph

    2017-01-01

    Francisella tularensis is disseminated in nature by biting arthropods such as mosquitoes. The relationship between mosquitoes and F. tularensis in nature is highly ambiguous, due in part to the fact that mosquitoes have caused significant tularemia outbreaks despite being classified as a mechanical vector of F. tularensis. One possible explanation for mosquitoes being a prominent, yet mechanical vector is that these insects feed on flower nectar between blood meals, allowing for transmission of F. tularensis between mosquitoes. Here, we aimed to assess whether F. tularensis could survive in flower nectar. Moreover, we examined if mosquitoes could interact with or ingest and transmit F. tularensis from one source of nectar to another. F. tularensis exhibited robust survivability in flower nectar with concentrations of viable bacteria remaining consistent with the rich growth medium. Furthermore, F. tularensis was able to survive (albeit to a lesser extent) in 30% sucrose (a nectar surrogate) over a period of time consistent with that of a typical flower bloom. Although we observed diminished bacterial survival in the nectar surrogate, mosquitoes that fed on this material became colonized with F. tularensis. Finally, colonized mosquitoes were capable of transferring F. tularensis to a sterile nectar surrogate. These data suggest that flower nectar may be capable of serving as a temporary source of F. tularensis that could contribute to the amplification of outbreaks. Mosquitoes that feed on an infected mammalian host and subsequently feed on flower nectar could deposit some F. tularensis bacteria into the nectar in the process. Mosquitoes subsequently feeding on this nectar source could potentially become colonized by F. tularensis. Thus, the possibility exists that flower nectar may allow for vector-vector transmission of F. tularensis. PMID:28486521

  14. Tips to Prevent Mosquito Bites

    MedlinePlus

    ... mosquitoes using insecticides. Use Structural Barriers Cover all gaps in walls, doors, and windows to prevent mosquitoes ... into pants and pants into socks to cover gaps in your clothing where mosquitoes can get to ...

  15. Repurposing Ospemifene for Potentiating an Antigen-Specific Immune Response

    PubMed Central

    Kao, Chiao-Jung; Wurz, Gregory T.; Lin, Yi-Chen; Vang, Daniel P.; Phong, Brian; DeGregorio, Michael W.

    2016-01-01

    Objective Ospemifene, an estrogen receptor agonist/antagonist approved for treatment of dyspareunia and vaginal dryness in postmenopausal women, has potential new indications as an immune modulator. The overall objective of the present series of preclinical studies was to evaluate the immunomodulatory activity of ospemifene in combination with a peptide cancer vaccine. Methods Immune regulating effects, mechanism of action and structure activity relationships of ospemifene and related compounds were evaluated by examining expression of T cell activating cytokines in vitro, and antigen-specific immune response and cytotoxic T-lymphocyte activity in vivo. The effects of ospemifene (OSP) on the immune response to a peptide cancer vaccine (PV) were evaluated following chronic [control (n=22); OSP 50 mg/kg (n=16); PV (n=6); OSP+PV (n=11)], intermittent [control (n=10); OSP 10 and 50 mg/kg (n=11); PV (n=11); combination treatment (n=11 each dose)] and pretreatment [control; OSP 100 mg/kg; PV 100 µg; combination treatment (n=8 all groups)] ospemifene oral dosing schedules in a total of 317 mixed-sex tumor-bearing and non-tumor-bearing mice. Results The results showed that ospemifene induced expression of the key TH1 cytokines interferon gamma and interleukin-2 in vitro, which may be mediated by stimulating T cells through phosphoinositide 3-kinase and calmodulin signaling pathways. In combination with an antigen-specific peptide cancer vaccine, ospemifene increased antigen-specific immune response and increased cytotoxic T-lymphocyte activity in tumor-bearing and non-tumor-bearing mice. The pretreatment, intermittent, and chronic dosing schedules of ospemifene activate naïve T cells, modulate antigen-induced tolerance and reduce tumor-associated, pro-inflammatory cytokines, respectively. Conclusions Taken together, ospemifene’s dose response and schedule-dependent immune modulating activity offers a method of tailoring and augmenting the efficacy of previously failed

  16. Smart wing rotation and trailing-edge vortices enable high frequency mosquito flight

    NASA Astrophysics Data System (ADS)

    Bomphrey, Richard J.; Nakata, Toshiyuki; Phillips, Nathan; Walker, Simon M.

    2017-03-01

    Mosquitoes exhibit unusual wing kinematics; their long, slender wings flap at remarkably high frequencies for their size (>800 Hz)and with lower stroke amplitudes than any other insect group. This shifts weight support away from the translation-dominated, aerodynamic mechanisms used by most insects, as well as by helicopters and aeroplanes, towards poorly understood rotational mechanisms that occur when pitching at the end of each half-stroke. Here we report free-flight mosquito wing kinematics, solve the full Navier-Stokes equations using computational fluid dynamics with overset grids, and validate our results with in vivo flow measurements. We show that, although mosquitoes use familiar separated flow patterns, much of the aerodynamic force that supports their weight is generated in a manner unlike any previously described for a flying animal. There are three key features: leading-edge vortices (a well-known mechanism that appears to be almost ubiquitous in insect flight), trailing-edge vortices caused by a form of wake capture at stroke reversal, and rotational drag. The two new elements are largely independent of the wing velocity, instead relying on rapid changes in the pitch angle (wing rotation) at the end of each half-stroke, and they are therefore relatively immune to the shallow flapping amplitude. Moreover, these mechanisms are particularly well suited to high aspect ratio mosquito wings.

  17. Chikungunya Virus Infection of Aedes Mosquitoes.

    PubMed

    Wong, Hui Vern; Chan, Yoke Fun; Sam, I-Ching; Sulaiman, Wan Yusof Wan; Vythilingam, Indra

    2016-01-01

    In vivo infection of mosquitoes is an important method to study and characterize arthropod-borne viruses. Chikungunya virus (CHIKV) is a mosquito-borne alphavirus that is transmitted primarily by Aedes mosquitoes. In this chapter, we describe a protocol for infection of CHIKV in two species of Aedes mosquitoes, Aedes aegypti and Aedes albopictus, together with the isolation of CHIKV in different parts of the infected mosquito such as midgut, legs, wings, salivary gland, head, and saliva. This allows the study of viral infection, replication and dissemination within the mosquito vector.

  18. Sweet waste extract uptake by a mosquito vector: Survival, biting, fecundity responses, and potential epidemiological significance.

    PubMed

    Dieng, Hamady; Satho, Tomomitsu; Abang, Fatimah; Meli, Nur Khairatun Khadijah Binti; Ghani, Idris A; Nolasco-Hipolito, Cirilo; Hakim, Hafijah; Miake, Fumio; Ahmad, Abu Hassan; Noor, Sabina; Zuharah, Wan Fatma; Ahmad, Hamdan; Majid, Abdul Hafiz A; Morales Vargas, Ronald E; Morales, Noppawan P; Attrapadung, Siriluck; Noweg, Gabriel Tonga

    2017-05-01

    In nature, adult mosquitoes typically utilize nectar as their main energy source, but they can switch to other as yet unidentified sugary fluids. Contemporary lifestyles, with their associated unwillingness to consume leftovers and improper disposal of waste, have resulted in the disposal of huge amounts of waste into the environment. Such refuse often contains unfinished food items, many of which contain sugar and some of which can collect water from rain and generate juices. Despite evidence that mosquitoes can feed on sugar-rich suspensions, semi-liquids, and decaying fruits, which can be abundant in garbage sites, the impacts of sweet waste fluids on dengue vectors are unknown. Here, we investigated the effects of extracts from some familiar sweet home waste items on key components of vectorial capacity of Aedes aegypti. Adult mosquitoes were fed one of five diets in this study: water (WAT); sucrose (SUG); bakery product (remnant of chocolate cake, BAK); dairy product (yogurt, YOG); and fruit (banana (BAN). Differences in survival, response time to host, and egg production were examined between groups. For both males and females, maintenance on BAK extract resulted in marked survival levels that were similar to those seen with SUG. Sweet waste extracts provided better substrates for survival compared to water, but this superiority was mostly seen with BAK. Females maintained on BAK, YOG, and BAN exhibited shorter response times to a host compared to their counterparts maintained on SUG. The levels of egg production were equivalent in waste extract- and SUG-fed females. The findings presented here illustrate the potential of sweet waste-derived fluids to contribute to the vectorial capacity of dengue vectors and suggest the necessity of readdressing the issue of waste disposal, especially that of unfinished sweet foods. Such approaches can be particularly relevant in dengue endemic areas where rainfall is frequent and waste collection infrequent. Copyright

  19. Area-wide management of Aedes albopictus: II. Gauging the efficacy of traditional integrated pest control measures against urban container mosquitoes

    USDA-ARS?s Scientific Manuscript database

    Aedes (Stegomyia) albopictus (Skuse), the Asian tiger mosquito, is an introduced invasive species in the U.S. responsible for a significant proportion of service requests to local mosquito control programs. This container-utilizing mosquito is refractory to standard mosquito abatement measures in th...

  20. A systematic review of mosquito coils and passive emanators: defining recommendations for spatial repellency testing methodologies.

    PubMed

    Ogoma, Sheila B; Moore, Sarah J; Maia, Marta F

    2012-12-07

    Mosquito coils, vaporizer mats and emanators confer protection against mosquito bites through the spatial action of emanated vapor or airborne pyrethroid particles. These products dominate the pest control market; therefore, it is vital to characterize mosquito responses elicited by the chemical actives and their potential for disease prevention. The aim of this review was to determine effects of mosquito coils and emanators on mosquito responses that reduce human-vector contact and to propose scientific consensus on terminologies and methodologies used for evaluation of product formats that could contain spatial chemical actives, including indoor residual spraying (IRS), long lasting insecticide treated nets (LLINs) and insecticide treated materials (ITMs). PubMed, (National Centre for Biotechnology Information (NCBI), U.S. National Library of Medicine, NIH), MEDLINE, LILAC, Cochrane library, IBECS and Armed Forces Pest Management Board Literature Retrieval System search engines were used to identify studies of pyrethroid based coils and emanators with key-words "Mosquito coils" "Mosquito emanators" and "Spatial repellents". It was concluded that there is need to improve statistical reporting of studies, and reach consensus in the methodologies and terminologies used through standardized testing guidelines. Despite differing evaluation methodologies, data showed that coils and emanators induce mortality, deterrence, repellency as well as reduce the ability of mosquitoes to feed on humans. Available data on efficacy outdoors, dose-response relationships and effective distance of coils and emanators is inadequate for developing a target product profile (TPP), which will be required for such chemicals before optimized implementation can occur for maximum benefits in disease control.

  1. Current views on the mechanisms of immune responses to trauma and infection

    PubMed Central

    Michalak, Grzegorz; Słotwiński, Robert

    2015-01-01

    According to the World Health Organization, post-traumatic mortality rates are still very high and show an increasing tendency. Disorders of innate immune response that may increase the risk of serious complications play a key role in the immunological system response to trauma and infection. The mechanism of these disorders is multifactorial and is still poorly understood. The changing concepts of systemic inflammatory response syndrome (SIRS) and compensatory anti-inflammatory response syndrome (CARS) early inflammatory response, presented in this work, have been extended to genetic studies. Overexpression of genes and increased production of immune response mediators are among the main causes of multiple organ dysfunction syndrome (MODS). Changes in gene expression detected early after injury precede the occurrence of subsequent complications with a typical clinical picture. Rapid depletion of energy resources leads to immunosuppression and persistent inflammation and immune suppression catabolism syndrome (PICS). Early diagnosis of immune disorders and appropriate nutritional therapy can significantly reduce the incidence of complications, length of hospital stay, and mortality. The study presents the development of knowledge and current views explaining the mechanisms of the immune response to trauma and infection. PMID:26557036

  2. Sex-specific consequences of an induced immune response on reproduction in a moth.

    PubMed

    Barthel, Andrea; Staudacher, Heike; Schmaltz, Antje; Heckel, David G; Groot, Astrid T

    2015-12-16

    Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life histories, sex-specific resource investment strategies to achieve an optimal immune response following an infection can be expected. We investigated immune response induction of females and males of Heliothis virescens in response to the entomopathogenic bacterium Serratia entomophila, and its effects on mating success and the female sexual signal. We found that females had higher expression levels of immune-related genes after bacterial challenge than males. However, males maintained a higher baseline expression of immune-related genes than females. The increased investment in immunity of female moths was negatively correlated with mating success and the female sexual signal. Male mating success was unaffected by bacterial challenge. Our results show that the sexes differed in their investment strategies: females invested in immune defense after a bacterial challenge, indicating facultative immune deployment, whereas males had higher baseline immunity than females, indicating immune maintenance. Interestingly, these differences in investment were reflected in the mate choice assays. As female moths are the sexual signallers, females need to invest resources in their attractiveness. However, female moths appeared to invest in immunity at the cost of reproductive effort.

  3. Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

    PubMed Central

    Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

    2013-01-01

    Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

  4. Immune response in the lungs following oral immunization with bacterial lysates of respiratory pathogens.

    PubMed Central

    Ruedl, C; Frühwirth, M; Wick, G; Wolf, H

    1994-01-01

    We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system. PMID:7496936

  5. Immune response in the lungs following oral immunization with bacterial lysates of respiratory pathogens.

    PubMed

    Ruedl, C; Frühwirth, M; Wick, G; Wolf, H

    1994-03-01

    We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system.

  6. Behavioral Fever Drives Epigenetic Modulation of the Immune Response in Fish.

    PubMed

    Boltana, Sebastian; Aguilar, Andrea; Sanhueza, Nataly; Donoso, Andrea; Mercado, Luis; Imarai, Monica; Mackenzie, Simon

    2018-01-01

    Ectotherms choose the best thermal conditions to mount a successful immune response, a phenomenon known as behavioral fever. The cumulative evidence suggests that behavioral fever impacts positively upon lymphocyte proliferation, inflammatory cytokine expression, and other immune functions. In this study, we have explored how thermal choice during infection impacts upon underpinning molecular processes and how temperature increase is coupled to the immune response. Our results show that behavioral fever results in a widespread, plastic imprint on gene regulation, and lymphocyte proliferation. We further explored the possible contribution of histone modification and identified global associations between temperature and histone changes that suggest epigenetic remodeling as a result of behavioral fever. Together, these results highlight the critical importance of thermal choice in mobile ectotherms, particularly in response to an infection, and demonstrate the key role of epigenetic modification to orchestrate the thermocoupling of the immune response during behavioral fever.

  7. A cognitive computational model inspired by the immune system response.

    PubMed

    Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim

    2014-01-01

    The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective.

  8. Lessons from mosquitoes' painless piercing.

    PubMed

    Gurera, Dev; Bhushan, Bharat; Kumar, Navin

    2018-05-18

    Arthropods are the largest group of the living organisms. They attack other organisms by biting, stinging, or piercing and sucking. Among various medically important arthropods, which feed on living hosts, mosquitoes' piercing spread viruses which have been reported to cause the highest number of deaths annually. The primary cause of the deaths is malaria, which is spread by infected mosquitoes' piercing. This study aims at elucidating lessons from mosquitoes' painless piercing. Mosquitoes pierce using their fascicle, which is a bundle of coherently functioning six stylets. Based on experiments and available literature, it is presented that mosquitoes painlessly pierce using a combination of the numbing, the fascicle's serrated design, the vibratory actuation, and the graded and frequency-dependent mechanical properties of the labrum. Based on this understanding, a mosquito-inspired microneedle design has also been proposed. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Mosquito-disseminated pyriproxyfen yields high breeding-site coverage and boosts juvenile mosquito mortality at the neighborhood scale.

    PubMed

    Abad-Franch, Fernando; Zamora-Perea, Elvira; Ferraz, Gonçalo; Padilla-Torres, Samael D; Luz, Sérgio L B

    2015-04-01

    Mosquito-borne pathogens pose major public health challenges worldwide. With vaccines or effective drugs still unavailable for most such pathogens, disease prevention heavily relies on vector control. To date, however, mosquito control has proven difficult, with low breeding-site coverage during control campaigns identified as a major drawback. A novel tactic exploits the egg-laying behavior of mosquitoes to have them disseminate tiny particles of a potent larvicide, pyriproxyfen (PPF), from resting to breeding sites, thus improving coverage. This approach has yielded promising results at small spatial scales, but its wider applicability remains unclear. We conducted a four-month trial within a 20-month study to investigate mosquito-driven dissemination of PPF dust-particles from 100 'dissemination stations' (DSs) deployed in a 7-ha sub-area to surveillance dwellings and sentinel breeding sites (SBSs) distributed over an urban neighborhood of about 50 ha. We assessed the impact of the trial by measuring juvenile mosquito mortality and adult mosquito emergence in each SBS-month. Using data from 1,075 dwelling-months, 2,988 SBS-months, and 29,922 individual mosquitoes, we show that mosquito-disseminated PPF yielded high coverage of dwellings (up to 100%) and SBSs (up to 94.3%). Juvenile mosquito mortality in SBSs (about 4% at baseline) increased by over one order of magnitude during PPF dissemination (about 75%). This led to a >10-fold decrease of adult mosquito emergence from SBSs, from approximately 1,000-3,000 adults/month before to about 100 adults/month during PPF dissemination. By expanding breeding-site coverage and boosting juvenile mosquito mortality, a strategy based on mosquito-disseminated PPF has potential to substantially enhance mosquito control. Sharp declines in adult mosquito emergence can lower vector/host ratios, reducing the risk of disease outbreaks. This approach is a very promising complement to current and novel mosquito control strategies

  10. Mosquito-Disseminated Pyriproxyfen Yields High Breeding-Site Coverage and Boosts Juvenile Mosquito Mortality at the Neighborhood Scale

    PubMed Central

    Abad-Franch, Fernando; Zamora-Perea, Elvira; Ferraz, Gonçalo; Padilla-Torres, Samael D.; Luz, Sérgio L. B.

    2015-01-01

    Background Mosquito-borne pathogens pose major public health challenges worldwide. With vaccines or effective drugs still unavailable for most such pathogens, disease prevention heavily relies on vector control. To date, however, mosquito control has proven difficult, with low breeding-site coverage during control campaigns identified as a major drawback. A novel tactic exploits the egg-laying behavior of mosquitoes to have them disseminate tiny particles of a potent larvicide, pyriproxyfen (PPF), from resting to breeding sites, thus improving coverage. This approach has yielded promising results at small spatial scales, but its wider applicability remains unclear. Methodology/Principal Findings We conducted a four-month trial within a 20-month study to investigate mosquito-driven dissemination of PPF dust-particles from 100 ‘dissemination stations’ (DSs) deployed in a 7-ha sub-area to surveillance dwellings and sentinel breeding sites (SBSs) distributed over an urban neighborhood of about 50 ha. We assessed the impact of the trial by measuring juvenile mosquito mortality and adult mosquito emergence in each SBS-month. Using data from 1,075 dwelling-months, 2,988 SBS-months, and 29,922 individual mosquitoes, we show that mosquito-disseminated PPF yielded high coverage of dwellings (up to 100%) and SBSs (up to 94.3%). Juvenile mosquito mortality in SBSs (about 4% at baseline) increased by over one order of magnitude during PPF dissemination (about 75%). This led to a >10-fold decrease of adult mosquito emergence from SBSs, from approximately 1,000–3,000 adults/month before to about 100 adults/month during PPF dissemination. Conclusions/Significance By expanding breeding-site coverage and boosting juvenile mosquito mortality, a strategy based on mosquito-disseminated PPF has potential to substantially enhance mosquito control. Sharp declines in adult mosquito emergence can lower vector/host ratios, reducing the risk of disease outbreaks. This approach is a very

  11. Immune response to functionalized mesoporous silica nanoparticles for targeted drug delivery

    NASA Astrophysics Data System (ADS)

    Heidegger, Simon; Gößl, Dorothée; Schmidt, Alexandra; Niedermayer, Stefan; Argyo, Christian; Endres, Stefan; Bein, Thomas; Bourquin, Carole

    2015-12-01

    Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized antigen-presenting cells such as dendritic cells. The silica nanoparticles showed a favorable toxicity profile and did not affect the viability of primary immune cells from the spleen in relevant concentrations. Cargo-free MSN induced only very low immune responses in primary cells as determined by surface expression of activation markers and release of pro-inflammatory cytokines such as Interleukin-6, -12 and -1β. In contrast, when surface-functionalized MSN with a pH-responsive polymer capping were loaded with an immune-activating drug, the synthetic Toll-like receptor 7 agonist R848, a strong immune response was provoked. We thus demonstrate that MSN represent an efficient drug delivery vehicle to primary immune cells that is both non-toxic and non-inflammagenic, which is a prerequisite for the use of these particles in biomedical applications.Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized

  12. Dietary astaxanthin enhances immune response in dogs.

    PubMed

    Chew, Boon P; Mathison, Bridget D; Hayek, Michael G; Massimino, Stefan; Reinhart, Gregory A; Park, Jean Soon

    2011-04-15

    No information is available on the possible role of astaxanthin on immune response in domestic canine. Female Beagle dogs (9-10 mo old; 8.2 ± 0.2 kg body weight) were fed 0, 10, 20 or 40 mg astaxanthin daily and blood sampled on wk 0, 6, 12, and 16 for assessing the following: lymphoproliferation, leukocyte subpopulations, natural killer (NK) cell cytotoxicity, and concentrations of blood astaxanthin, IgG, IgM and acute phase proteins. Delayed-type hypersensitivity (DTH) response was assessed on wk 0, 12 and 16. Plasma astaxanthin increased dose-dependently and reached maximum concentrations on wk 6. Dietary astaxanthin enhanced DTH response to vaccine, concanavalin A-induced lymphocyte proliferation (with the 20mg dose at wk 12) and NK cell cytotoxic activity. In addition, dietary astaxanthin increased concentrations of IgG and IgM, and B cell population. Plasma concentrations of C reactive protein were lower in astaxanthin-fed dogs. Therefore, dietary astaxanthin heightened cell-mediated and humoral immune response and reduced DNA damage and inflammation in dogs. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Climate change, population immunity, and hyperendemicity in the transmission threshold of dengue.

    PubMed

    Oki, Mika; Yamamoto, Taro

    2012-01-01

    It has been suggested that the probability of dengue epidemics could increase because of climate change. The probability of epidemics is most commonly evaluated by the basic reproductive number (R(0)), and in mosquito-borne diseases, mosquito density (the number of female mosquitoes per person [MPP]) is the critical determinant of the R(0) value. In dengue-endemic areas, 4 different serotypes of dengue virus coexist-a state known as hyperendemicity-and a certain proportion of the population is immune to one or more of these serotypes. Nevertheless, these factors are not included in the calculation of R(0). We aimed to investigate the effects of temperature change, population immunity, and hyperendemicity on the threshold MPP that triggers an epidemic. We designed a mathematical model of dengue transmission dynamics. An epidemic was defined as a 10% increase in seroprevalence in a year, and the MPP that triggered an epidemic was defined as the threshold MPP. Simulations were conducted in Singapore based on the recorded temperatures from 1980 to 2009 The threshold MPP was estimated with the effect of (1) temperature only; (2) temperature and fluctuation of population immunity; and (3) temperature, fluctuation of immunity, and hyperendemicity. When only the effect of temperature was considered, the threshold MPP was estimated to be 0.53 in the 1980s and 0.46 in the 2000s, a decrease of 13.2%. When the fluctuation of population immunity and hyperendemicity were considered in the model, the threshold MPP decreased by 38.7%, from 0.93 to 0.57, from the 1980s to the 2000s. The threshold MPP was underestimated if population immunity was not considered and overestimated if hyperendemicity was not included in the simulations. In addition to temperature, these factors are particularly important when quantifying the threshold MPP for the purpose of setting goals for vector control in dengue-endemic areas.

  14. European Surveillance for West Nile Virus in Mosquito Populations

    PubMed Central

    Engler, Olivier; Savini, Giovanni; Papa, Anna; Figuerola, Jordi; Groschup, Martin H.; Kampen, Helge; Medlock, Jolyon; Vaux, Alexander; Wilson, Anthony J.; Werner, Doreen; Jöst, Hanna; Goffredo, Maria; Capelli, Gioia; Federici, Valentina; Tonolla, Mauro; Patocchi, Nicola; Flacio, Eleonora; Portmann, Jasmine; Rossi-Pedruzzi, Anya; Mourelatos, Spiros; Ruiz, Santiago; Vázquez, Ana; Calzolari, Mattia; Bonilauri, Paolo; Dottori, Michele; Schaffner, Francis; Mathis, Alexander; Johnson, Nicholas

    2013-01-01

    A wide range of arthropod-borne viruses threaten both human and animal health either through their presence in Europe or through risk of introduction. Prominent among these is West Nile virus (WNV), primarily an avian virus, which has caused multiple outbreaks associated with human and equine mortality. Endemic outbreaks of West Nile fever have been reported in Italy, Greece, France, Romania, Hungary, Russia and Spain, with further spread expected. Most outbreaks in Western Europe have been due to infection with WNV Lineage 1. In Eastern Europe WNV Lineage 2 has been responsible for human and bird mortality, particularly in Greece, which has experienced extensive outbreaks over three consecutive years. Italy has experienced co-circulation with both virus lineages. The ability to manage this threat in a cost-effective way is dependent on early detection. Targeted surveillance for pathogens within mosquito populations offers the ability to detect viruses prior to their emergence in livestock, equine species or human populations. In addition, it can establish a baseline of mosquito-borne virus activity and allow monitoring of change to this over time. Early detection offers the opportunity to raise disease awareness, initiate vector control and preventative vaccination, now available for horses, and encourage personal protection against mosquito bites. This would have major benefits through financial savings and reduction in equid morbidity/mortality. However, effective surveillance that predicts virus outbreaks is challenged by a range of factors including limited resources, variation in mosquito capture rates (too few or too many), difficulties in mosquito identification, often reliant on specialist entomologists, and the sensitive, rapid detection of viruses in mosquito pools. Surveillance for WNV and other arboviruses within mosquito populations varies between European countries in the extent and focus of the surveillance. This study reviews the current status of

  15. Immune response at birth, long-term immune memory and 2 years follow-up after in-utero anti-HBV DNA immunization.

    PubMed

    Fazio, V M; Ria, F; Franco, E; Rosati, P; Cannelli, G; Signori, E; Parrella, P; Zaratti, L; Iannace, E; Monego, G; Blogna, S; Fioretti, D; Iurescia, S; Filippetti, R; Rinaldi, M

    2004-03-01

    Infections occurring at the end of pregnancy, during birth or by breastfeeding are responsible for the high toll of death among first-week infants. In-utero DNA immunization has demonstrated the effectiveness in inducing specific immunity in newborns. A major contribution to infant immunization would be achieved if a vaccine proved able to be protective as early as at the birth, preventing the typical 'first-week infections'. To establish its potential for use in humans, in-utero DNA vaccination efficiency has to be evaluated for short- and long-term safety, protection at delivery, efficacy of boosts in adults and effective window/s for modulation of immune response during pregnancy, in an animal model suitable with human development. Here we show that a single intramuscular in-utero anti-HBV DNA immunization at two-thirds of pig gestation produces, at birth, antibody titers considered protective in humans. The boost of antibody titers in every animal following recall at 4 and 10 months demonstrates the establishment of immune memory. The safety of in-utero fetus manipulation is guaranteed by short-term (no fetus loss, lack of local alterations, at-term spontaneous delivery, breastfeeding) and long-term (2 years) monitoring. Treatment of fetuses closer to delivery results in immune ignorance without induction of tolerance. This result highlights the repercussion of selecting the appropriate time point when this approach is used to deliver therapeutic genes. All these findings illustrate the relevance of naked DNA-based vaccination technology in therapeutic efforts aimed to prevent the high toll of death among first-week infants.

  16. Effect of nanovaccine chemistry on humoral immune response kinetics and maturation

    NASA Astrophysics Data System (ADS)

    Haughney, Shannon L.; Ross, Kathleen A.; Boggiatto, Paola M.; Wannemuehler, Michael J.; Narasimhan, Balaji

    2014-10-01

    Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry facilitated differential kinetics of development of antibody titers, avidity, and epitope specificity. The results provide new insights into the underlying role(s) of nanoparticle chemistry in providing long-lived humoral immunity and aid in the rational design of nanovaccine formulations to induce long-lasting and mature antibody responses.Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry

  17. Phenytoin promotes Th2 type immune response in mice

    PubMed Central

    Okada, K; Sugiura, T; Kuroda, E; Tsuji, S; Yamashita, U

    2001-01-01

    The effects of chronic administration of phenytoin, a common anticonvulsive drug, on immune responses were studied in mice. Anti-keyhole limpet haemocyanin (KLH) IgE antibody response after KLH-immunization was enhanced in phenytoin-treated mice. Proliferative responses of spleen cells induced with KLH, concanavalin A (ConA), lipopolysaccharide and anti-CD3 antibody were reduced in phenytoin-treated mice. Accessory function of spleen adherent cells on ConA-induced T cell proliferative response was reduced in phenytoin-treated mice. KLH-induced IL-4 production of spleen cells was enhanced, while IFN-γ production was reduced in phenytoin-treated mice. In addition, production of IL-1α, but not IL-6 and IL-12 by spleen adherent cells from phenytoin-treated mice was reduced. Natural killer cell activity was reduced in phenytoin-treated mice. These results suggest that phenytoin treatment preferentially induces a Th2 type response. We also observed that plasma ACTH and corticosterone levels were increased in phenytoin-treated mice, and speculated that phenytoin might act directly and indirectly, through HPA axis activation, on the immune system to modulate Th1/Th2 balance. PMID:11472401

  18. Ubiquitin enzymes in the regulation of immune responses

    PubMed Central

    Ebner, Petra; Versteeg, Gijs A.; Ikeda, Fumiyo

    2017-01-01

    Abstract Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses. PMID:28524749

  19. Response of adult mosquitoes to light emitting diodes placed in resting boxes and in the field.

    USDA-ARS?s Scientific Manuscript database

    Resting boxes are passive devices used to attract and capture mosquitoes seeking shelter. Increasing the attractiveness of these devices could improve their effectiveness. Light emitting diodes (LEDs) can be attractive to mosquitoes when used together with other trapping devices. Therefore restin...

  20. IL-2 infusion abrogates humoral immune responses in humans.

    PubMed Central

    Gottlieb, D J; Prentice, H G; Heslop, H E; Bello, C; Brenner, M K

    1992-01-01

    Although IL-2 infusion enhances cell-mediated cytotoxicity in patients with neoplastic disease, administration is paradoxically associated with a modest fall in total serum IgG and an increased risk of infection. We now show that the adverse effects of IL-2 infusion on the humoral immune system are substantial. Although IL-2 induces the B cell growth and differentiating factors IL-4 and IL-6, infusion abrogates primary antibody responses entirely and reduces secondary antibody responses 50-fold following antigen challenge. There is no evidence of the generation of cells with suppressive activity on B cells but IL-2 increases the ratio of circulating virgin:memory cells. These results may help to explain the increased rate of bacterial infection in patients receiving IL-2. As IL-2 plays a central role in the generation of an immune response, the finding that it is also sufficiently immunosuppressive to inhibit primary- and secondary-type antibody responses suggests that exploration of the underlying mechanisms may provide insights into immune system homeostasis and may offer new approaches to therapeutic immunosuppression. Images Fig. 1 PMID:1544235

  1. Convergence between a mosquito-eating predator's natural diet and its prey-choice behaviour

    PubMed Central

    Jackson, Robert R.; Deng, Chan

    2016-01-01

    On the basis of 1115 records of Evarcha culicivora feeding in the field, we can characterize this East African jumping spider (Salticidae) as being distinctively stenophagic. We can also, on the basis of laboratory prey-choice experiments, characterize E. culicivora as having a specialized prey-classification system and a hierarchy of innate preferences for various categories of mosquitoes and other arthropods. Prey from the field belonged to 10 arthropod orders, but 94.5% of the prey records were dipterans. Mosquitoes were the dominant prey (80.2% of the records), with the majority (82.9%) of the mosquitoes being females, and thereafter midges were the most common prey (9.2% of the records). Preference profiles that were determined from experiments showed strong convergence with natural diet in some, but not all, instances. In experiments, E. culicivora adults appeared to distinguish between six prey categories and juveniles between seven, with blood-carrying anopheline female mosquitoes being ranked highest in preference. For adults, this was followed by blood-carrying culicine female mosquitoes and then anopheline female mosquitoes not carrying blood, but these two preferences were reversed for juveniles. Moreover, for juveniles, but not for adults, anopheline male mosquitoes seem to be a distinct prey category ranked in preference after blood-carrying culicine females and, for both adults and juveniles, preference for midges is evident when the alternatives are not mosquitoes. These findings illustrate the importance of going beyond simply specifying preferred prey categories when characterizing predators as ‘specialized’ and a need to make clear conceptual distinctions between a predator's natural diet, the prey categories that are relevant to the predator, and the predator's prey-choicebehaviour. PMID:28083103

  2. Detection of the Invasive Mosquito Species Aedes (Stegomyia) albopictus (Diptera: Culicidae) in Portugal.

    PubMed

    Osório, Hugo Costa; Zé-Zé, Líbia; Neto, Maria; Silva, Sílvia; Marques, Fátima; Silva, Ana Sofia; Alves, Maria João

    2018-04-21

    The Asian tiger mosquito Aedes albopictus is an invasive mosquito originating from the Asia-Pacific region. This species is of major concern to public and veterinary health because of its vector role in the transmission of several pathogens, such as chikungunya, dengue, and Zika viruses. In Portugal, a National Vector Surveillance Network (REde de VIgilância de VEctores—REVIVE) is responsible for the surveillance of autochthonous, but also invasive, mosquito species at points of entry, such as airports, ports, storage areas, and specific border regions with Spain. At these locations, networks of mosquito traps are set and maintained under surveillance throughout the year. In September 2017, Ae. albopictus was detected for the first time in a tyre company located in the North of Portugal. Molecular typing was performed, and a preliminary phylogenetic analysis indicated a high similarity with sequences of Ae. albopictus collected in Europe. A prompt surveillance response was locally implemented to determine its dispersal and abundance, and adult mosquitoes were screened for the presence of arboviral RNA. A total of 103 specimens, 52 immatures and 51 adults, were collected. No pathogenic viruses were detected. Despite the obtained results suggest low abundance of the population locally introduced, the risk of dispersal and potential establishment of Ae. albopictus in Portugal has raised concern for autochthonous mosquito-borne disease outbreaks.

  3. Wolbachia infection reduces blood-feeding success in the dengue fever mosquito, Aedes aegypti.

    PubMed

    Turley, Andrew P; Moreira, Luciano A; O'Neill, Scott L; McGraw, Elizabeth A

    2009-09-15

    The mosquito Aedes aegypti was recently transinfected with a life-shortening strain of the endosymbiont Wolbachia pipientis (wMelPop) as the first step in developing a biocontrol strategy for dengue virus transmission. In addition to life-shortening, the wMelPop-infected mosquitoes also exhibit increased daytime activity and metabolic rates. Here we sought to quantify the blood-feeding behaviour of Wolbachia-infected females as an indicator of any virulence or energetic drain associated with Wolbachia infection. In a series of blood-feeding trials in response to humans, we have shown that Wolbachia-infected mosquitoes do not differ in their response time to humans, but that as they age they obtain fewer and smaller blood meals than Wolbachia-uninfected controls. Lastly, we observed a behavioural characteristic in the Wolbachia infected mosquitoes best described as a "bendy" proboscis that may explain the decreased biting success. Taken together the evidence suggests that wMelPop infection may be causing tissue damage in a manner that intensifies with mosquito age and that leads to reduced blood-feeding success. These behavioural changes require further investigation with respect to a possible physiological mechanism and their role in vectorial capacity of the insect. The selective decrease of feeding success in older mosquitoes may act synergistically with other Wolbachia-associated traits including life-shortening and viral protection in biocontrol strategies.

  4. Detection of the Invasive Mosquito Species Aedes (Stegomyia) albopictus (Diptera: Culicidae) in Portugal

    PubMed Central

    Osório, Hugo Costa; Zé-Zé, Líbia; Neto, Maria; Silva, Sílvia; Marques, Fátima; Silva, Ana Sofia; Alves, Maria João

    2018-01-01

    The Asian tiger mosquito Aedes albopictus is an invasive mosquito originating from the Asia-Pacific region. This species is of major concern to public and veterinary health because of its vector role in the transmission of several pathogens, such as chikungunya, dengue, and Zika viruses. In Portugal, a National Vector Surveillance Network (REde de VIgilância de VEctores—REVIVE) is responsible for the surveillance of autochthonous, but also invasive, mosquito species at points of entry, such as airports, ports, storage areas, and specific border regions with Spain. At these locations, networks of mosquito traps are set and maintained under surveillance throughout the year. In September 2017, Ae. albopictus was detected for the first time in a tyre company located in the North of Portugal. Molecular typing was performed, and a preliminary phylogenetic analysis indicated a high similarity with sequences of Ae. albopictus collected in Europe. A prompt surveillance response was locally implemented to determine its dispersal and abundance, and adult mosquitoes were screened for the presence of arboviral RNA. A total of 103 specimens, 52 immatures and 51 adults, were collected. No pathogenic viruses were detected. Despite the obtained results suggest low abundance of the population locally introduced, the risk of dispersal and potential establishment of Ae. albopictus in Portugal has raised concern for autochthonous mosquito-borne disease outbreaks. PMID:29690531

  5. [Immune response to live influenza vaccine].

    PubMed

    Naĭkhin, A N; Rekstin, A R; Barantseva, I B; Donina, S A; Desheva, Iu A; Grigor'eva, E P; Kiseleva, I V; Rudenko, L G

    2002-01-01

    Priority data on the induction, by using a Russian live cold-adapted reassortant influenza vaccine (LIV), of the cellular and humoral immunity with regard for attenuation and genetic reassortment of vaccine stains as well as with regard for the age of vaccinated persons and the production of Th1 (IFNY, IL-2) and Th2 (IL-4) cytokine markers in vitro are presented. It was demonstrated in vivo that a pathogenic virus of the A group by far more actively induced the lymphocyte apoptosis as compared with attenuated genetically reassorted stains. Unlike the influenza pathogenic virus, the genetically attenuated and reassorted strain did not produce any negative effects on the induction of cellular immunity. A comparative study of the LIV immunogenic properties in vaccinated persons showed an advantage of LIV over inactivated influenza vaccine (IIV) in stimulating the cellular and local immunity in the elderly. Unlike IIV, LIV induced an active and balanced immune response developing due to Th1 and Th2 activation. LIV was found to stimulate well enough the production of IFN and IL-2 in both young and old persons.

  6. Visualizing Non Infectious and Infectious Anopheles gambiae Blood Feedings in Naive and Saliva-Immunized Mice

    PubMed Central

    Choumet, Valerie; Attout, Tarik; Chartier, Loïc; Khun, Huot; Sautereau, Jean; Robbe-Vincent, Annie; Brey, Paul; Huerre, Michel; Bain, Odile

    2012-01-01

    Background Anopheles gambiae is a major vector of malaria and lymphatic filariasis. The arthropod-host interactions occurring at the skin interface are complex and dynamic. We used a global approach to describe the interaction between the mosquito (infected or uninfected) and the skin of mammals during blood feeding. Methods Intravital video microscopy was used to characterize several features during blood feeding. The deposition and movement of Plasmodium berghei sporozoites in the dermis were also observed. We also used histological techniques to analyze the impact of infected and uninfected feedings on the skin cell response in naive mice. Results The mouthparts were highly mobile within the skin during the probing phase. Probing time increased with mosquito age, with possible effects on pathogen transmission. Repletion was achieved by capillary feeding. The presence of sporozoites in the salivary glands modified the behavior of the mosquitoes, with infected females tending to probe more than uninfected females (86% versus 44%). A white area around the tip of the proboscis was observed when the mosquitoes fed on blood from the vessels of mice immunized with saliva. Mosquito feedings elicited an acute inflammatory response in naive mice that peaked three hours after the bite. Polynuclear and mast cells were associated with saliva deposits. We describe the first visualization of saliva in the skin by immunohistochemistry (IHC) with antibodies directed against saliva. Both saliva deposits and sporozoites were detected in the skin for up to 18 h after the bite. Conclusion This study, in which we visualized the probing and engorgement phases of Anopheles gambiae blood meals, provides precise information about the behavior of the insect as a function of its infection status and the presence or absence of anti-saliva antibodies. It also provides insight into the possible consequences of the inflammatory reaction for blood feeding and pathogen transmission. PMID

  7. Visualizing non infectious and infectious Anopheles gambiae blood feedings in naive and saliva-immunized mice.

    PubMed

    Choumet, Valerie; Attout, Tarik; Chartier, Loïc; Khun, Huot; Sautereau, Jean; Robbe-Vincent, Annie; Brey, Paul; Huerre, Michel; Bain, Odile

    2012-01-01

    Anopheles gambiae is a major vector of malaria and lymphatic filariasis. The arthropod-host interactions occurring at the skin interface are complex and dynamic. We used a global approach to describe the interaction between the mosquito (infected or uninfected) and the skin of mammals during blood feeding. Intravital video microscopy was used to characterize several features during blood feeding. The deposition and movement of Plasmodium berghei sporozoites in the dermis were also observed. We also used histological techniques to analyze the impact of infected and uninfected feedings on the skin cell response in naive mice. The mouthparts were highly mobile within the skin during the probing phase. Probing time increased with mosquito age, with possible effects on pathogen transmission. Repletion was achieved by capillary feeding. The presence of sporozoites in the salivary glands modified the behavior of the mosquitoes, with infected females tending to probe more than uninfected females (86% versus 44%). A white area around the tip of the proboscis was observed when the mosquitoes fed on blood from the vessels of mice immunized with saliva. Mosquito feedings elicited an acute inflammatory response in naive mice that peaked three hours after the bite. Polynuclear and mast cells were associated with saliva deposits. We describe the first visualization of saliva in the skin by immunohistochemistry (IHC) with antibodies directed against saliva. Both saliva deposits and sporozoites were detected in the skin for up to 18 h after the bite. This study, in which we visualized the probing and engorgement phases of Anopheles gambiae blood meals, provides precise information about the behavior of the insect as a function of its infection status and the presence or absence of anti-saliva antibodies. It also provides insight into the possible consequences of the inflammatory reaction for blood feeding and pathogen transmission.

  8. Exploiting mosquito sugar feeding to detect mosquito-borne pathogens

    PubMed Central

    Hall-Mendelin, Sonja; Ritchie, Scott A.; Johansen, Cheryl A.; Zborowski, Paul; Cortis, Giles; Dandridge, Scott; Hall, Roy A.; van den Hurk, Andrew F.

    2010-01-01

    Arthropod-borne viruses (arboviruses) represent a global public health problem, with dengue viruses causing millions of infections annually, while emerging arboviruses, such as West Nile, Japanese encephalitis, and chikungunya viruses have dramatically expanded their geographical ranges. Surveillance of arboviruses provides vital data regarding their prevalence and distribution that may be utilized for biosecurity measures and the implementation of disease control strategies. However, current surveillance methods that involve detection of virus in mosquito populations or sero-conversion in vertebrate hosts are laborious, expensive, and logistically problematic. We report a unique arbovirus surveillance system to detect arboviruses that exploits the process whereby mosquitoes expectorate virus in their saliva during sugar feeding. In this system, infected mosquitoes captured by CO2-baited updraft box traps are allowed to feed on honey-soaked nucleic acid preservation cards within the trap. The cards are then analyzed for expectorated virus using real-time reverse transcription-PCR. In field trials, this system detected the presence of Ross River and Barmah Forest viruses in multiple traps deployed at two locations in Australia. Viral RNA was preserved for at least seven days on the cards, allowing for long-term placement of traps and continuous collection of data documenting virus presence in mosquito populations. Furthermore no mosquito handling or processing was required and cards were conveniently shipped to the laboratory overnight. The simplicity and efficacy of this approach has the potential to transform current approaches to vector-borne disease surveillance by streamlining the monitoring of pathogens in vector populations. PMID:20534559

  9. Escaping Deleterious Immune Response in Their Hosts: Lessons from Trypanosomatids

    PubMed Central

    Geiger, Anne; Bossard, Géraldine; Sereno, Denis; Pissarra, Joana; Lemesre, Jean-Loup; Vincendeau, Philippe; Holzmuller, Philippe

    2016-01-01

    The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, Trypanosoma cruzi, and Leishmania spp. are important human pathogens causing human African trypanosomiasis (HAT or sleeping sickness), Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs, or sandflies, and affect millions of people worldwide. In humans, extracellular African trypanosomes (T. brucei) evade the hosts’ immune defenses, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response. This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite–host interactions and will focus on: clinical and epidemiological importance of diseases; life cycles: parasites–hosts–vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen-presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation. PMID:27303406

  10. Microbial Degradation of Cellular Kinases Impairs Innate Immune Signaling and Paracrine TNFα Responses

    PubMed Central

    Barth, Kenneth; Genco, Caroline Attardo

    2016-01-01

    The NFκB and MAPK signaling pathways are critical components of innate immunity that orchestrate appropriate immune responses to control and eradicate pathogens. Their activation results in the induction of proinflammatory mediators, such as TNFα a potent bioactive molecule commonly secreted by recruited inflammatory cells, allowing for paracrine signaling at the site of an infection. In this study we identified a novel mechanism by which the opportunistic pathogen Porphyromonas gingivalis dampens innate immune responses by disruption of kinase signaling and degradation of inflammatory mediators. The intracellular immune kinases RIPK1, TAK1, and AKT were selectively degraded by the P. gingivalis lysine-specific gingipain (Kgp) in human endothelial cells, which correlated with dysregulated innate immune signaling. Kgp was also observed to attenuate endothelial responsiveness to TNFα, resulting in a reduction in signal flux through AKT, ERK and NFκB pathways, as well as a decrease in downstream proinflammatory mRNA induction of cytokines, chemokines and adhesion molecules. A deficiency in Kgp activity negated decreases to host cell kinase protein levels and responsiveness to TNFα. Given the essential role of kinase signaling in immune responses, these findings highlight a unique mechanism of pathogen-induced immune dysregulation through inhibition of cell activation, paracrine signaling, and dampened cellular proinflammatory responses. PMID:27698456

  11. Immune responses to bioengineered organs

    PubMed Central

    Ochando, Jordi; Charron, Dominique; Baptista, Pedro M.; Uygun, Basak E.

    2017-01-01

    Purpose of review Organ donation in the United States registered 9079 deceased organ donors in 2015. This high percentage of donations allowed organ transplantation in 29 851 recipients. Despite increasing numbers of transplants performed in comparison with previous years, the numbers of patients that are in need for a transplant increase every year at a higher rate. This reveals that the discrepancy between the demand and availability of organs remains fundamental problem in organ transplantation. Recent findings Development of bioengineered organs represents a promising approach to increase the pool of organs for transplantation. The technology involves obtaining complex three-dimensional scaffolds that support cellular activity and functional remodeling though tissue recellularization protocols using progenitor cells. This innovative approach integrates cross-thematic approaches from specific areas of transplant immunology, tissue engineering and stem cell biology, to potentially manufacture an unlimited source of donor organs for transplantation. Summary Although bioengineered organs are thought to escape immune recognition, the potential immune reactivity toward each of its components has not been studied in detail. Here, we summarize the host immune response toward different progenitor cells and discuss the potential implications of using nonself biological scaffolds to develop bioengineered organs. PMID:27926545

  12. Sugar-sensitive neurone responses and sugar feeding preferences influence lifespan and biting behaviours of the Afrotropical malaria mosquito, Anopheles gambiae.

    PubMed

    Kessler, Sébastien; Vlimant, Michèle; Guerin, Patrick M

    2015-03-01

    Floral nectar is the main source of carbohydrates for many insects including mosquitoes. Nonetheless, the physiological mechanisms underlying feeding on carbohydrates by the Afrotropical malaria mosquito Anopheles gambiae remain poorly understood. Here, we tested whether sugar sensitivity and sugar feeding preferences correlate with longevity in A. gambiae. We also tested whether feeding females on different sugar diets influences their biting behaviours. Electrophysiological recordings show that sugar neurones on the labella of females are most sensitive to sucrose, mixtures of glucose and fructose, and to melezitose; other sugars tested, including glucose and fructose presented alone, only weakly activate these taste neurones. Mosquitoes survive longest on sucrose, the most preferred sugar. Whereas feeding on a mixture of glucose and fructose is preferred over fructose or glucose alone, fructose supports higher longevity than either glucose or the mixture of the two hexoses. Females that had previously fed on glucose show a stronger biting response than those fed on sucrose, perhaps in an effort to compensate for their lower energetic state. These findings contribute to our understanding of the physiological basis of sugar feeding in A. gambiae and indicate how the sugar diet can affect laboratory-reared A. gambiae biting behaviours.

  13. Dynamic two-photon imaging of the immune response to Toxoplasma gondii infection.

    PubMed

    Luu, L; Coombes, J L

    2015-03-01

    Toxoplasma gondii is a highly successful parasite that can manipulate host immune responses to optimize its persistence and spread. As a result, a highly complex relationship exists between T. gondii and the immune system of the host. Advances in imaging techniques, and in particular, the application of two-photon microscopy to mouse infection models, have made it possible to directly visualize interactions between parasites and the host immune system as they occur in living tissues. Here, we will discuss how dynamic imaging techniques have provided unexpected new insight into (i) how immune responses are dynamically regulated by cells and structures in the local tissue environment, (ii) how protective responses to T. gondii are generated and (iii) how the parasite exploits the immune system for its own benefit. © 2014 John Wiley & Sons Ltd.

  14. The Modulation of Adaptive Immune Responses by Bacterial Zwitterionic Polysaccharides

    PubMed Central

    Stephen, Tom Li; Groneck, Laura; Kalka-Moll, Wiltrud Maria

    2010-01-01

    The detection of pathogen-derived molecules as foreign particles by adaptive immune cells triggers T and B lymphocytes to mount protective cellular and humoral responses, respectively. Recent immunological advances elucidated that proteins and some lipids are the principle biological molecules that induce protective T cell responses during microbial infections. Polysaccharides are important components of microbial pathogens and many vaccines. However, research concerning the activation of the adaptive immune system by polysaccharides gained interest only recently. Traditionally, polysaccharides were considered to be T cell-independent antigens that did not directly activate T cells or induce protective immune responses. Here, we review several recent advances in “carbohydrate immunobiology”. A group of bacterial polysaccharides that are known as “zwitterionic polysaccharides (ZPSs)” were recently identified as potent immune modulators. The immunomodulatory effect of ZPSs required antigen processing and presentation by antigen presenting cells, the activation of CD4 T cells and subpopulations of CD8 T cells and the modulation of host cytokine responses. In this review, we also discuss the potential use of these unique immunomodulatory ZPSs in new vaccination strategies against chronic inflammatory conditions, autoimmunity, infectious diseases, allergies and asthmatic conditions. PMID:21234388

  15. Immune response in asymptomatic smokers.

    PubMed

    Zeidel, A; Beilin, B; Yardeni, I; Mayburd, E; Smirnov, G; Bessler, H

    2002-09-01

    It has been demonstrated that cigarette smoking affects the immune system. Impairment of alveolar mononuclear cell function, described previously, may contribute to the higher rate of postoperative respiratory infections. However, increased susceptibility of smokers to infections of other origin (e.g. wound-related) implies that tobacco effect is not restricted to the respiratory immune competent cells. The present study was designed to investigate the systemic effect of tobacco smoking as it exerted on blood-derived immune cells. We measured systemic cytotoxic activity of natural killer cells, production of pro- and anti-inflammatory cytokines by blood mononuclear cells and their proliferation in response to mitogens. To minimize the immunosuppressive effect of other smoke-related factors, the smokers with chronic obstructive pulmonary disease (COPD) were excluded from this study. Peripheral blood mononuclear cells (PBMC) from 24 chronic asymptomatic smokers, and 28 controls, age and gender matched, were isolated and incubated in vitro with lipopolysaccharide (LPS) or phytohemagglutinin (PHA) to induce secretion of IL-1beta, IL-1ra, IL-6, IL-10, TNFalpha and IL-2, respectively, from mononuclear cells. The level of the cytokines in the supernatants was measured using ELISA kits. The proliferative response to the mitogens PHA and concanavalin A (ConA) was evaluated by 3H-thymidine incorporation and NK cell cytotoxicity by 51Cr release assay. Mononuclear cells from smokers showed increased production of the pro-inflammatory cytokines IL-1beta, IL-6 and TNFalpha and enhanced proliferative response to mitogens as compared to non-smoking population. The secretion of IL-2 and the anti-inflammatory cytokines IL-1ra and IL-10 was similar in both groups. NK cell cytotoxic activity was suppressed in the smokers. Cigarette smokers without chronic obstructive pulmonary disease (COPD) exhibit impaired NK cytotoxic activity in peripheral blood and unbalanced systemic production

  16. CELL SURFACE SIGNALING MOLECULES IN THE CONTROL OF IMMUNE RESPONSES: A TIDE MODEL

    PubMed Central

    Zhu, Yuwen; Yao, Sheng; Chen, Lieping

    2011-01-01

    Summary A large numbers of cell surface signaling molecules (CSSMs) have been molecularly identified and functionally characterized in recent years and, via these studies, our knowledge in the control of immune response has increased exponentially. Two major lines of evidence emerge. First, the majority of immune cells rely on one or few CSSMs to deliver a primary triggering signal to sense their environment, leading to initiation of an immune response. Second, both costimulatory CSSMs that promote the response, and coinhibitory CSSMs that inhibit the response, are required to control direction and magnitude of a given immune response. With such tight feedback, immune responses are tuned and returned to baseline. These findings extend well beyond our previous observation in the requirement for lymphocyte activation and argue a revisit of the traditional “two-signal model” for activation and tolerance of lymphocytes. Here we propose a “tide” model to accommodate and interpret current experimental findings. PMID:21511182

  17. Trypanosomatid parasites in Austrian mosquitoes

    PubMed Central

    Schoener, Ellen; Uebleis, Sarah Susanne; Cuk, Claudia; Nawratil, Michaela; Obwaller, Adelheid G.; Zechmeister, Thomas; Rádrová, Jana; Zittra, Carina

    2018-01-01

    Trypanosomatid flagellates have not been studied in Austria in any detail. In this study, specific nested PCR, targeted on the ribosomal small subunit, was used to determine the occurrence and diversity of trypanosomatids in wild-caught mosquitoes sampled across Eastern Austria in the years 2014−2015. We collected a total of 29,975 mosquitoes of 19 species divided in 1680 pools. Of these, 298 (17.7%), representing 12 different mosquito species, were positive for trypanosomatid DNA. In total, seven trypanosomatid spp. were identified (three Trypanosoma, three Crithidia and one Herpetomonas species), with the highest parasite species diversity found in the mosquito host Coquillettidia richiardii. The most frequent parasite species belonged to the mammalian Trypanosoma theileri/cervi species complex (found in 105 pools; 6.3%). The avian species T. culicavium (found in 69 pools; 4.1%) was only detected in mosquitoes of the genus Culex, which corresponds to their preference for avian hosts. Monoxenous trypanosomatids of the genus Crithidia and Herpetomonas were found in 20 (1.3%) mosquito pools. One third (n = 98) of the trypanosomatid positive mosquito pools carried more than one parasite species. This is the first large scale study of trypanosomatid parasites in Austrian mosquitoes and our results are valuable in providing an overview of the diversity of these parasites in Austria. PMID:29672618

  18. Plant Immune Responses Against Viruses: How Does a Virus Cause Disease?[OA

    PubMed Central

    Mandadi, Kranthi K.; Scholthof, Karen-Beth G.

    2013-01-01

    Plants respond to pathogens using elaborate networks of genetic interactions. Recently, significant progress has been made in understanding RNA silencing and how viruses counter this apparently ubiquitous antiviral defense. In addition, plants also induce hypersensitive and systemic acquired resistance responses, which together limit the virus to infected cells and impart resistance to the noninfected tissues. Molecular processes such as the ubiquitin proteasome system and DNA methylation are also critical to antiviral defenses. Here, we provide a summary and update of advances in plant antiviral immune responses, beyond RNA silencing mechanisms—advances that went relatively unnoticed in the realm of RNA silencing and nonviral immune responses. We also document the rise of Brachypodium and Setaria species as model grasses to study antiviral responses in Poaceae, aspects that have been relatively understudied, despite grasses being the primary source of our calories, as well as animal feed, forage, recreation, and biofuel needs in the 21st century. Finally, we outline critical gaps, future prospects, and considerations central to studying plant antiviral immunity. To promote an integrated model of plant immunity, we discuss analogous viral and nonviral immune concepts and propose working definitions of viral effectors, effector-triggered immunity, and viral pathogen-triggered immunity. PMID:23709626

  19. Immune response and immunopathology during toxoplasmosis1

    PubMed Central

    Dupont, Christopher D.; Christian, David A.; Hunter, Christopher A.

    2012-01-01

    Toxoplasma gondii is a protozoan parasite of medical and veterinary significance that is able to infect any warm-blooded vertebrate host. In addition to its importance to public health, several inherent features of the biology of T. gondii have made it an important model organism to study host-pathogen interactions. One factor is the genetic tractability of the parasite, which allows studies on the microbial factors that affect virulence and allows the development of tools that facilitate immune studies. Additionally, mice are natural hosts for T. gondii, and the availability of numerous reagents to study the murine immune system makes this an ideal experimental system to understand the functions of cytokines and effector mechanisms involved in immunity to intracellular microorganisms. In this article, we will review current knowledge of the innate and adaptive immune responses required for resistance to toxoplasmosis, the events that lead to the development of immunopathology, and the natural regulatory mechanisms that limit excessive inflammation during this infection. PMID:22955326

  20. Perillyl alcohol suppresses antigen-induced immune responses in the lung

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide

    Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4{sup +} T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes,more » its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4{sup +} T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects.« less

  1. A modified live canine parvovirus vaccine. II. Immune response.

    PubMed

    Carmichael, L E; Joubert, J C; Pollock, R V

    1983-01-01

    The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.

  2. Mesenchymal stem cells: a double-edged sword in regulating immune responses

    PubMed Central

    Li, W; Ren, G; Huang, Y; Su, J; Han, Y; Li, J; Chen, X; Cao, K; Chen, Q; Shou, P; Zhang, L; Yuan, Z-R; Roberts, A I; Shi, S; Le, A D; Shi, Y

    2012-01-01

    Mesenchymal stem cells (MSCs) have been employed successfully to treat various immune disorders in animal models and clinical settings. Our previous studies have shown that MSCs can become highly immunosuppressive upon stimulation by inflammatory cytokines, an effect exerted through the concerted action of chemokines and nitric oxide (NO). Here, we show that MSCs can also enhance immune responses. This immune-promoting effect occurred when proinflammatory cytokines were inadequate to elicit sufficient NO production. When inducible nitric oxide synthase (iNOS) production was inhibited or genetically ablated, MSCs strongly enhance T-cell proliferation in vitro and the delayed-type hypersensitivity response in vivo. Furthermore, iNOS−/− MSCs significantly inhibited melanoma growth. It is likely that in the absence of NO, chemokines act to promote immune responses. Indeed, in CCR5−/−CXCR3−/− mice, the immune-promoting effect of iNOS−/− MSCs is greatly diminished. Thus, NO acts as a switch in MSC-mediated immunomodulation. More importantly, the dual effect on immune reactions was also observed in human MSCs, in which indoleamine 2,3-dioxygenase (IDO) acts as a switch. This study provides novel information about the pathophysiological roles of MSCs. PMID:22421969

  3. Repelling mosquitoes with essential oils

    NASA Astrophysics Data System (ADS)

    Riley, L.

    2017-12-01

    Mosquitoes carry diseases than can lead to serious illness and death. According to the World Health Organization, mosquitoes infect over 300 million people a year with Malaria and Dengue Fever, two life threatening diseases vectored by mosquitoes. Although insecticides are the most effective way to control mosquitoes, they are not always environmentally friendly. Therefore, alternative tactics should be considered. In this study, we looked at the repellency of various essential oils on female Aedes aegypti through a series of laboratory assays.

  4. Innate immune responses following Kawasaki disease and toxic shock syndrome

    PubMed Central

    Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R.; Levin, Michael; Burgner, David; Curtis, Nigel

    2018-01-01

    The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory. PMID:29447181

  5. Innate immune responses following Kawasaki disease and toxic shock syndrome.

    PubMed

    Chen, Katherine Y H; Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R; Levin, Michael; Burgner, David; Curtis, Nigel

    2018-01-01

    The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory.

  6. Nanotechnology, neuromodulation & the immune response: discourse, materiality & ethics.

    PubMed

    Fins, Joseph J

    2015-04-01

    Drawing upon the American Pragmatic tradition in philosophy and the more recent work of philosopher Karen Barad, this paper examines how scientific problems are both obscured, and resolved by our use of language describing the natural world. Using the example of the immune response engendered by neural implants inserted in the brain, the author explains how this discourse has been altered by the advent of nanotechnology methods and devices which offer putative remedies that might temper the immune response in the central nervous system. This emergent nanotechnology has altered this problem space and catalyzed one scientific community to acknowledge a material reality that was always present, if not fully acknowledged.

  7. A Cognitive Computational Model Inspired by the Immune System Response

    PubMed Central

    Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim

    2014-01-01

    The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective. PMID:25003131

  8. Angiotensin converting enzyme over expression in myelocytes enhances the immune response

    PubMed Central

    Bernstein, Kenneth E.; Gonzalez-Villalobos, Romer A.; Giani, Jorge F.; Shah, Kandarp; Bernstein, Ellen; Janjulia, Tea; Koronyo, Yosef; Shi, Peng D.; Koronyo-Hamaoui, Maya; Fuchs, Sebastien; Shen, Xiao Z.

    2015-01-01

    Angiotensin converting enzyme (ACE) plays an important role in blood pressure control. ACE also has effects on renal function, reproduction, hematopoiesis and several aspects of the immune response. ACE 10/10 mice over express ACE in monocytic cells; macrophages from ACE 10/10 mice demonstrate increased polarization towards a proinflammatory phenotype. As a result, ACE 10/10 mice have a highly effective immune response following challenge with either melanoma, bacterial infection or Alzheimer’s disease. The ACE 10/10 mice suggest that enhanced monocytic function greatly contributes to the ability of the immune response to defend against a wide variety of antigenic and non-antigenic challenges. PMID:24633750

  9. Induction of the immune response suppression in mice inoculated with Candida albicans.

    PubMed

    Valdez, J C; Mesón, D E; Sirena, A; de Petrino, S F; Eugenia, M; de Jorrat, B B; de Valdex, M G

    1986-03-01

    There is a controversy in respect to the immunological response (humoral or cellular) concerning the defense against Candida albicans. Candidosis would induce sub-populations of suppressor cells in the host cell-immune response. This report tries to show the effect of different doses of C. albicans (alive or heat-killed) on the expression of cell-mediated and humoral immunity. The effect upon cell immunity was determined by inoculating different lots of singeneic mice, doses of varied concentration of C. albicans and checking for delayed-type hipersensitivity (D.T.H.). D.T.H. was also controlled in syngeneic normal mice which had previously been injected with inoculated mice spleen cells. Humoral immunity was assayed by measuring the induced blastogenesis by Pokeweed Mitogen on spleen mononuclear cells with different doses of C. albicans. Results obtained show that the different doses gave origin to: Suppression of humoral and cell response (10(8) alive); Suppression of only humoral response (10(6) alive); Suppression of cell response and increase of humoral response (10(9) dead); Increase of both responses (10(8) dead).

  10. Mitochondrial dysfunction as a trigger of innate immune responses and inflammation.

    PubMed

    West, A Phillip

    2017-11-01

    A growing literature indicates that mitochondria are key participants in innate immune pathways, functioning as both signaling platforms and contributing to effector responses. In addition to regulating antiviral signaling and antibacterial immunity, mitochondria are also important drivers of inflammation caused by sterile injury. Much research on mitochondrial control of immunity now centers on understanding how mitochondrial constituents released during cellular damage simulate the innate immune system. When mitochondrial integrity is compromised, mitochondrial damage-associated molecular patterns engage pattern recognition receptors, trigger inflammation, and promote pathology in an expanding list of diseases. Here, I review the emerging knowledge of mitochondrial dysfunction in innate immune responses and discuss how environmental exposures may induce mitochondrial damage to potentiate inflammation and human disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Immune system development during early childhood in tropical Latin America: evidence for the age-dependent down regulation of the innate immune response.

    PubMed

    Teran, Rommy; Mitre, Edward; Vaca, Maritza; Erazo, Silvia; Oviedo, Gisela; Hübner, Marc P; Chico, Martha E; Mattapallil, Joseph J; Bickle, Quentin; Rodrigues, Laura C; Cooper, Philip J

    2011-03-01

    The immune response that develops in early childhood underlies the development of inflammatory diseases such as asthma and there are few data from tropical Latin America (LA). This study investigated the effects of age on the development of immunity during the first 5 years of life by comparing innate and adaptive immune responses in Ecuadorian children aged 6-9 months, 22-26 months, and 48-60 months. Percentages of naïve CD4+ T cells declined with age while those of memory CD4(+) and CD8(+) T cells increased indicating active development of the immune system throughout the first five years. Young infants had greater innate immune responses to TLR agonists compared to older children while regulatory responses including SEB-induced IL-10 and percentages of FoxP3(+) T-regulatory cells decreased with age. Enhanced innate immunity in early life may be important for host defense against pathogens but may increase the risk of immunopathology. Copyright © 2010 Elsevier Inc. All rights reserved.

  12. Surviving Sepsis: Taming a Deadly Immune Response

    MedlinePlus

    ... Issues Subscribe August 2014 Print this issue Surviving Sepsis Taming a Deadly Immune Response En español Send ... Mouth? Looking at Lupus Wise Choices Signs of Sepsis Sepsis can be hard to spot, because its ...

  13. The influence of the microbiota on the immune response to transplantation

    PubMed Central

    Bartman, Caroline; Chong, Anita S.; Alegre, Maria-Luisa

    2015-01-01

    Purpose of review In the past decade, appreciation of the important effects of commensal microbes on immunity has grown exponentially. The effect of the microbiota on transplantation has only recently begun to be explored; however, our understanding of the mechanistic details of host-microbe interactions is still lacking. Recent findings It has become clear that transplantation is associated with changes in the microbiota in many different settings although what clinical events and therapeutic interventions contribute to these changes remains to be parsed out. Research groups have begun to identify associations between specific communities of organisms and transplant outcomes but it remains to be established whether microbial changes precede or follow transplant rejection episodes. Finally, results from continuing exploration of basic mechanisms by which microbial communities affect innate and adaptive immunity in various animal models of disease continues to inform research on the microbiota’s effects on immune responses against transplanted organs. Summary Commensal microbes may alter immune responses to organ transplantation, but direct experiments are only beginning in the field to identify species and immune pathways responsible for these putative effects. PMID:25563985

  14. Respiratory tract immune response to microbial pathogens.

    PubMed

    Wilkie, B N

    1982-11-15

    Effective resistance to respiratory tract infection depends principally on specific immunity on mucosal surfaces of the upper or lower respiratory tract. Respiratory tract immune response comprises antibody and cell-mediated systems and may be induced most readily by surface presentation of replicating agents but can result from parenteral or local presentation of highly immunogenic antigens. Upper and lower respiratory tract systems differ in immunologic competence, with the lungs having a greater inventory of protective mechanisms than the trachea or nose. Several effective vaccines have been developed for prevention or modification of respiratory tract diseases.

  15. Immune correlates of protection for dengue: State of the art and research agenda.

    PubMed

    Katzelnick, Leah C; Harris, Eva

    2017-08-24

    Dengue viruses (DENV1-4) are mosquito-borne flaviviruses estimated to cause up to ∼400 million infections and ∼100 million dengue cases each year. Factors that contribute to protection from and risk of dengue and severe dengue disease have been studied extensively but are still not fully understood. Results from Phase 3 vaccine efficacy trials have recently become available for one vaccine candidate, now licensed for use in several countries, and more Phase 2 and 3 studies of additional vaccine candidates are ongoing, making these issues all the more urgent and timely. At the "Summit on Dengue Immune Correlates of Protection", held in Annecy, France, on March 8-9, 2016, dengue experts from diverse fields came together to discuss the current understanding of the immune response to and protection from DENV infection and disease, identify key unanswered questions, discuss data on immune correlates and plans for comparison of results across assays/consortia, and propose a research agenda for investigation of dengue immune correlates, all in the context of both natural infection studies and vaccine trials. Copyright © 2017.

  16. Masking of antigenic epitopes by antibodies shapes the humoral immune response to influenza

    PubMed Central

    Zarnitsyna, Veronika I.; Ellebedy, Ali H.; Davis, Carl; Jacob, Joshy; Ahmed, Rafi; Antia, Rustom

    2015-01-01

    The immune responses to influenza, a virus that exhibits strain variation, show complex dynamics where prior immunity shapes the response to the subsequent infecting strains. Original antigenic sin (OAS) describes the observation that antibodies to the first encountered influenza strain, specifically antibodies to the epitopes on the head of influenza's main surface glycoprotein, haemagglutinin (HA), dominate following infection with new drifted strains. OAS suggests that responses to the original strain are preferentially boosted. Recent studies also show limited boosting of the antibodies to conserved epitopes on the stem of HA, which are attractive targets for a ‘universal vaccine’. We develop multi-epitope models to explore how pre-existing immunity modulates the immune response to new strains following immunization. Our models suggest that the masking of antigenic epitopes by antibodies may play an important role in describing the complex dynamics of OAS and limited boosting of antibodies to the stem of HA. Analysis of recently published data confirms model predictions for how pre-existing antibodies to an epitope on HA decrease the magnitude of boosting of the antibody response to this epitope following immunization. We explore strategies for boosting of antibodies to conserved epitopes and generating broadly protective immunity to multiple strains. PMID:26194761

  17. Assessment of the innate immune response in the periparturient cow.

    PubMed

    Trevisi, Erminio; Minuti, Andrea

    2018-02-01

    The transition period is the most critical phase in the life of high yielding dairy cows. Within a few weeks, cows are submitted to many challenges (physiological, nutritional, psychological, management) that require prompt and effective adaptive responses. The immune system is involved in this process, and many changes of the cow's immune system components have been observed around calving. Cows are considered to be immunosuppressed in late lactation, and available data suggest that the immune system is dysregulated around parturition. Significant attention has been focused on modification of cellular functions (e.g. the reduction of phagocytosis and diapedesis), but growing interest concerns the components of the innate immune system, which often exhibits increased responses such as susceptibility to inflammatory events and the related acute phase response (APR). Systemic inflammation plays a significant role in early lactation, affects many liver functions and has been associated with the impairment of cow performance (i.e. reduced feed intake, milk yield, fertility, welfare). The assessment of variations in immune-metabolic indices offers opportunities to predict the onset of the health troubles and to anticipate the proper therapies needed to guarantee health, good welfare and fertility in the following lactation. The frequency of diseases (metabolic and infectious) before calving is rare, but several clues suggest that various metabolic and immune variations can begin during the dry period. Interesting preliminary results encourage this perspective and possible candidates are suggested. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Selection for avian immune response: a commercial breeding company challenge.

    PubMed

    Fulton, J E

    2004-04-01

    Selection for immune function in the commercial breeding environment is a challenging proposition for commercial breeding companies. Immune response is only one of many traits that are under intensive selection, thus selection pressure needs to be carefully balanced across multiple traits. The selection environment (single bird cages, biosecure facilities, controlled environment) is a very different environment than the commercial production facilities (multiple bird cages, potential disease exposure, variable environment) in which birds are to produce. The testing of individual birds is difficult, time consuming, and expensive. It is essential that the results of any tests be relevant to actual disease or environmental challenge in the commercial environment. The use of genetic markers as indicators of immune function is being explored by breeding companies. Use of genetic markers would eliminate many of the limitations in enhancing immune function currently encountered by commercial breeding companies. Information on genetic markers would allow selection to proceed without subjecting breeding stock to disease conditions and could be done before production traits are measured. These markers could be candidate genes with known interaction or involvement with disease pathology or DNA markers that are closely linked to genetic regions that influence the immune response. The current major limitation to this approach is the paucity of mapped chicken immune response genes and the limited number of DNA markers mapped on the chicken genome. These limitations should be eliminated once the chicken genome is sequenced.

  19. Arbovirus Isolations from Mosquitoes Collected During 1988 in the Senegal River Basin

    DTIC Science & Technology

    1992-01-01

    traps. Twenty virus isolations from Culex. . Aedes . and .4nopheles mosquitoes were recovered from six locations: Fanaye Diery (11). Bode (four), Matam...viral strain when Plreparation e)(immune sera it inhibited -> 50% of the virus dose. When an- tisera to some viruses were not available at the Mouse...test. viruses in mice showed close antigenic similarity Group I consisted of three isolates (12-401, 20- to Babanki (BBK) virus . 130. and 22-17) that

  20. Do NIR spectra collected from laboratory-reared mosquitoes differ from those collected from wild mosquitoes?

    USDA-ARS?s Scientific Manuscript database

    Do near infrared spectra from lab-reared mosquitoes differ from spectra from wild mosquitoes? Near infrared spectroscopy (NIRS) can classify the age of lab-reared mosquitoes as younger or older than seven days with accuracy greater than 80%. Hence, it has been proposed in several studies as a comple...

  1. Driven to extinction? The ethics of eradicating mosquitoes with gene-drive technologies.

    PubMed

    Pugh, Jonathan

    2016-09-01

    Mosquito-borne diseases represent a significant global disease burden, and recent outbreaks of such diseases have led to calls to reduce mosquito populations. Furthermore, advances in 'gene-drive' technology have raised the prospect of eradicating certain species of mosquito via genetic modification. This technology has attracted a great deal of media attention, and the idea of using gene-drive technology to eradicate mosquitoes has been met with criticism in the public domain. In this paper, I shall dispel two moral objections that have been raised in the public domain against the use of gene-drive technologies to eradicate mosquitoes. The first objection invokes the concept of the 'sanctity of life' in order to claim that we should not drive an animal to extinction. In response, I follow Peter Singer in raising doubts about general appeals to the sanctity of life, and argue that neither individual mosquitoes nor mosquitoes species considered holistically are appropriately described as bearing a significant degree of moral status. The second objection claims that seeking to eradicate mosquitoes amounts to displaying unacceptable degrees of hubris. Although I argue that this objection also fails, I conclude by claiming that it raises the important point that we need to acquire more empirical data about, inter alia, the likely effects of mosquito eradication on the ecosystem, and the likelihood of gene-drive technology successfully eradicating the intended mosquito species, in order to adequately inform our moral analysis of gene-drive technologies in this context. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  2. Immune reactivity to dengue and Aedes albopictus mosquitoes in the population from Macao, China, before dengue occurrence.

    PubMed

    De Carvalho, Isabel Lopes; Rocha, Diara Kady; Almeida, A Paulo G

    2011-01-01

    A serological survey was conducted in Macao, China, in 753 individuals, with the objective of looking for antibodies to the mosquito, Aedes albopictus (Skuse 1894) (Diptera: Culicidae), and to dengue, before the occurrence of any autochthonous dengue cases. Blood samples were collected at several public health services, a questionnaire was answered, and enzyme-linked immunosorbant assay (ELISA) and Western blot techniques were performed with extracts of mosquito head and thorax (HT). Anti-Aedes albopictus IgG antibodies were present in titres 1:10(2)-1:10(3) in 9%, and in titres 1:10(4)-1:10(5) in 42% of the sera tested. This reactivity was more frequent (59%) in the population which had resided only in Macao in the 2 years previous to the survey, as opposed to those that had also resided in other areas (50%). From the 230 reactive sera selected for immunoblot, 48 (21%) reacted with a wide range of proteins from above 224 kDa to 21 kDa, with different patterns according to individual sera. Proteins in the intervals 35.3-28.7 kDa and 28.7-21.1 kDa were labelled by the greatest number of sera, 15 and 19 respectively. The presence of anti-Aedes albopictus antibodies presented a statistical relation to skin reaction to mosquito bites, but immunoblot patterns did not. Anti-dengue IgG antibodies were found in 48% of the subjects, with a higher proportion in people who had resided out of Macao, or who were nationals from dengue-endemic neighboring countries. Anti-dengue reactivity was in agreement with anti-mosquito reactivity in half of the population. It would be interesting to see if this proportion has changed since dengue became endemic in Macao in 2001.

  3. Differential Immune Responses to New World and Old World Mammalian Arenaviruses

    PubMed Central

    Ly, Hinh

    2017-01-01

    Some New World (NW) and Old World (OW) mammalian arenaviruses are emerging, zoonotic viruses that can cause lethal hemorrhagic fever (HF) infections in humans. While these are closely related RNA viruses, the infected hosts appear to mount different types of immune responses against them. Lassa virus (LASV) infection, for example, results in suppressed immune function in progressive disease stage, whereas patients infected with Junín virus (JUNV) develop overt pro-inflammatory cytokine production. These viruses have also evolved different molecular strategies to evade host immune recognition and activation. This paper summarizes current progress in understanding the differential immune responses to pathogenic arenaviruses and how the information can be exploited toward the development of vaccines against them. PMID:28498311

  4. Evasion of adaptive and innate immune response mechanisms by γ-herpesviruses

    PubMed Central

    Feng, Pinghui; Moses, Ashlee; Früh, Klaus

    2015-01-01

    γ-Herpesviral immune evasion mechanisms are optimized to support the acute, lytic and the longterm, latent phase of infection. During acute infection, specific immune modulatory proteins limit, but also exploit, the antiviral activities of cell intrinsic innate immune responses as well as those of innate and adaptive immune cells. During latent infection, a restricted gene expression program limits immune targeting and cis-acting mechanisms to reduce the antigen presentation as well as antigenicity of latency-associated proteins. Here, we will review recent progress in our understanding of γ-herpesviral immune evasion strategies. PMID:23735334

  5. Quantitative analysis of harmonic convergence in mosquito auditory interactions

    PubMed Central

    Aldersley, Andrew; Champneys, Alan; Robert, Daniel

    2016-01-01

    This article analyses the hearing and behaviour of mosquitoes in the context of inter-individual acoustic interactions. The acoustic interactions of tethered live pairs of Aedes aegypti mosquitoes, from same and opposite sex mosquitoes of the species, are recorded on independent and unique audio channels, together with the response of tethered individual mosquitoes to playbacks of pre-recorded flight tones of lone or paired individuals. A time-dependent representation of each mosquito's non-stationary wing beat frequency signature is constructed, based on Hilbert spectral analysis. A range of algorithmic tools is developed to automatically analyse these data, and used to perform a robust quantitative identification of the ‘harmonic convergence’ phenomenon. The results suggest that harmonic convergence is an active phenomenon, which does not occur by chance. It occurs for live pairs, as well as for lone individuals responding to playback recordings, whether from the same or opposite sex. Male–female behaviour is dominated by frequency convergence at a wider range of harmonic combinations than previously reported, and requires participation from both partners in the duet. New evidence is found to show that male–male interactions are more varied than strict frequency avoidance. Rather, they can be divided into two groups: convergent pairs, typified by tightly bound wing beat frequencies, and divergent pairs, that remain widely spaced in the frequency domain. Overall, the results reveal that mosquito acoustic interaction is a delicate and intricate time-dependent active process that involves both individuals, takes place at many different frequencies, and which merits further enquiry. PMID:27053654

  6. Induction of complex immune responses and strong protection against retrovirus challenge by adenovirus-based immunization depends on the order of vaccine delivery.

    PubMed

    Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke

    2017-02-06

    In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.

  7. MosquitoMap and the Mal-area calculator: new web tools to relate mosquito species distribution with vector borne disease

    PubMed Central

    2010-01-01

    Background Mosquitoes are important vectors of diseases but, in spite of various mosquito faunistic surveys globally, there is a need for a spatial online database of mosquito collection data and distribution summaries. Such a resource could provide entomologists with the results of previous mosquito surveys, and vector disease control workers, preventative medicine practitioners, and health planners with information relating mosquito distribution to vector-borne disease risk. Results A web application called MosquitoMap was constructed comprising mosquito collection point data stored in an ArcGIS 9.3 Server/SQL geodatabase that includes administrative area and vector species x country lookup tables. In addition to the layer containing mosquito collection points, other map layers were made available including environmental, and vector and pathogen/disease distribution layers. An application within MosquitoMap called the Mal-area calculator (MAC) was constructed to quantify the area of overlap, for any area of interest, of vector, human, and disease distribution models. Data standards for mosquito records were developed for MosquitoMap. Conclusion MosquitoMap is a public domain web resource that maps and compares georeferenced mosquito collection points to other spatial information, in a geographical information system setting. The MAC quantifies the Mal-area, i.e. the area where it is theoretically possible for vector-borne disease transmission to occur, thus providing a useful decision tool where other disease information is limited. The Mal-area approach emphasizes the independent but cumulative contribution to disease risk of the vector species predicted present. MosquitoMap adds value to, and makes accessible, the results of past collecting efforts, as well as providing a template for other arthropod spatial databases. PMID:20167090

  8. MosquitoMap and the Mal-area calculator: new web tools to relate mosquito species distribution with vector borne disease.

    PubMed

    Foley, Desmond H; Wilkerson, Richard C; Birney, Ian; Harrison, Stanley; Christensen, Jamie; Rueda, Leopoldo M

    2010-02-18

    Mosquitoes are important vectors of diseases but, in spite of various mosquito faunistic surveys globally, there is a need for a spatial online database of mosquito collection data and distribution summaries. Such a resource could provide entomologists with the results of previous mosquito surveys, and vector disease control workers, preventative medicine practitioners, and health planners with information relating mosquito distribution to vector-borne disease risk. A web application called MosquitoMap was constructed comprising mosquito collection point data stored in an ArcGIS 9.3 Server/SQL geodatabase that includes administrative area and vector species x country lookup tables. In addition to the layer containing mosquito collection points, other map layers were made available including environmental, and vector and pathogen/disease distribution layers. An application within MosquitoMap called the Mal-area calculator (MAC) was constructed to quantify the area of overlap, for any area of interest, of vector, human, and disease distribution models. Data standards for mosquito records were developed for MosquitoMap. MosquitoMap is a public domain web resource that maps and compares georeferenced mosquito collection points to other spatial information, in a geographical information system setting. The MAC quantifies the Mal-area, i.e. the area where it is theoretically possible for vector-borne disease transmission to occur, thus providing a useful decision tool where other disease information is limited. The Mal-area approach emphasizes the independent but cumulative contribution to disease risk of the vector species predicted present. MosquitoMap adds value to, and makes accessible, the results of past collecting efforts, as well as providing a template for other arthropod spatial databases.

  9. Using barcoded Zika virus to assess virus population structure in vitro and in Aedes aegypti mosquitoes.

    PubMed

    Weger-Lucarelli, James; Garcia, Selene M; Rückert, Claudia; Byas, Alex; O'Connor, Shelby L; Aliota, Matthew T; Friedrich, Thomas C; O'Connor, David H; Ebel, Gregory D

    2018-06-20

    Arboviruses such as Zika virus (ZIKV, Flaviviridae; Flavivirus) must replicate in both mammalian and insect hosts possessing strong immune defenses. Accordingly, transmission between and replication within hosts involves genetic bottlenecks, during which viral population size and genetic diversity may be significantly reduced. To help quantify these bottlenecks and their effects, we constructed 4 "barcoded" ZIKV populations that theoretically contain thousands of barcodes each. After identifying the most diverse barcoded virus, we passaged this virus 3 times in 2 mammalian and mosquito cell lines and characterized the population using deep sequencing of the barcoded region of the genome. C6/36 maintain higher barcode diversity, even after 3 passages, than Vero. Additionally, field-caught mosquitoes exposed to the virus to assess bottlenecks in a natural host. A progressive reduction in barcode diversity occurred throughout systemic infection of these mosquitoes. Differences in bottlenecks during systemic spread were observed between different populations of Aedes aegypti. Copyright © 2018. Published by Elsevier Inc.

  10. Persistent oscillations and backward bifurcation in a malaria model with varying human and mosquito populations: implications for control.

    PubMed

    Ngonghala, Calistus N; Teboh-Ewungkem, Miranda I; Ngwa, Gideon A

    2015-06-01

    We derive and study a deterministic compartmental model for malaria transmission with varying human and mosquito populations. Our model considers disease-related deaths, asymptomatic immune humans who are also infectious, as well as mosquito demography, reproduction and feeding habits. Analysis of the model reveals the existence of a backward bifurcation and persistent limit cycles whose period and size is determined by two threshold parameters: the vectorial basic reproduction number Rm, and the disease basic reproduction number R0, whose size can be reduced by reducing Rm. We conclude that malaria dynamics are indeed oscillatory when the methodology of explicitly incorporating the mosquito's demography, feeding and reproductive patterns is considered in modeling the mosquito population dynamics. A sensitivity analysis reveals important control parameters that can affect the magnitudes of Rm and R0, threshold quantities to be taken into consideration when designing control strategies. Both Rm and the intrinsic period of oscillation are shown to be highly sensitive to the mosquito's birth constant λm and the mosquito's feeding success probability pw. Control of λm can be achieved by spraying, eliminating breeding sites or moving them away from human habitats, while pw can be controlled via the use of mosquito repellant and insecticide-treated bed-nets. The disease threshold parameter R0 is shown to be highly sensitive to pw, and the intrinsic period of oscillation is also sensitive to the rate at which reproducing mosquitoes return to breeding sites. A global sensitivity and uncertainty analysis reveals that the ability of the mosquito to reproduce and uncertainties in the estimations of the rates at which exposed humans become infectious and infectious humans recover from malaria are critical in generating uncertainties in the disease classes.

  11. Oral immunization of mice with transgenic tomato fruit expressing respiratory syncytial virus-F protein induces a systemic immune response.

    PubMed

    Sandhu, J S; Krasnyanski, S F; Domier, L L; Korban, S S; Osadjan, M D; Buetow, D E

    2000-04-01

    Respiratory syncytial virus (RSV) is one of the most important pathogens of infancy and early childhood. Here a fruit-based edible subunit vaccine against RSV was developed by expressing the RSV fusion (F) protein gene in transgenic tomato plants. The F-gene was expressed in ripening tomato fruit under the control of the fruit-specific E8 promoter. Oral immunization of mice with ripe transgenic tomato fruits led to the induction of both serum and mucosal RSV-F specific antibodies. The ratio of immunoglobulin subclasses produced in response to immunization suggested that a type 1 T-helper cell immune response was preferentially induced. Serum antibodies showed an increased titer when the immunized mice were exposed to inactivated RSV antigen.

  12. Long-term Immunogenicity of a Single Dose of Japanese Encephalitis Chimeric Virus Vaccine in Toddlers and Booster Response 5 Years After Primary Immunization.

    PubMed

    Kosalaraksa, Pope; Watanaveeradej, Veerachai; Pancharoen, Chitsanu; Capeding, Maria Rosario; Feroldi, Emmanuel; Bouckenooghe, Alain

    2017-04-01

    Japanese encephalitis (JE) is an important mosquito-borne viral disease that is endemic in Asia, Western Pacific countries and Northern Australia. Although there is no antiviral treatment, vaccination is effective in preventing this disease. We followed a cohort of 596 children for 5 years after primary vaccination at 12-18 months of age with JE chimeric virus vaccine (JE-CV; IMOJEV) in a multicenter, phase III trial in Thailand and the Philippines to assess antibody persistence and safety. At the end of the 5 years, a subgroup of 85 participants, at 1 site in Thailand, was followed after administration of a JE-CV booster vaccination. JE antibody titers were measured annually after primary vaccination and 28 days after booster vaccination using a 50% plaque reduction neutralization test. Seroprotection was defined as a JE-CV neutralizing antibody titer ≥10 (1/dil). Kaplan-Meier survival analysis was used to estimate the proportion of participants maintaining protective JE-CV neutralizing antibody titers. At 1, 2, 3, 4 and 5 years after vaccination with JE-CV, 88.5%, 82.9%, 78.2%, 74.0% and 68.6% of the participants followed remained seroprotected. Geometric mean titers in the subgroup assessed after receipt of a booster dose increased from 61.2 (95% confidence interval: 43.8-85.7) pre-booster to 4951 (95% confidence interval: 3928-6241) 28 days post-booster, with all participants seroprotected. There were no safety concerns identified. Protective immune responses persisted for at least 5 years after a JE-CV primary immunization in the majority of participants. JE-CV booster induced a robust immune response even after a 5-year interval.

  13. Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.

    PubMed

    Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna

    2014-01-01

    Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.

  14. Humoral and Cellular Response in Humans After Immunization with Influenza Vaccine

    PubMed Central

    Ruben, Frederick L.; Jackson, George G.; Gotoff, Samuel P.

    1973-01-01

    The peripheral blood lymphocyte response and hemagglutination inhibition antibody titers were measured in nine adults before and after immunization with a killed split influenza virus vaccine. Cord blood lymphocytes were tested with the influenza antigen to exclude a nonspecific mitogenic effect. All of the subjects demonstrated preexisting antibody titers and antigen recognition by lymphocytes prior to immunization. The in vitro lymphocyte response after vaccination parallels the humoral antibody response to influenza antigen. PMID:4762112

  15. Modulation of Human Immune Response by Fungal Biocontrol Agents

    PubMed Central

    Konstantinovas, Cibele; de Oliveira Mendes, Tiago A.; Vannier-Santos, Marcos A.; Lima-Santos, Jane

    2017-01-01

    Although the vast majority of biological control agents is generally regarded as safe for humans and environment, the increased exposure of agriculture workers, and consumer population to fungal substances may affect the immune system. Those compounds may be associated with both intense stimulation, resulting in IgE-mediated allergy and immune downmodulation induced by molecules such as cyclosporin A and mycotoxins. This review discusses the potential effects of biocontrol fungal components on human immune responses, possibly associated to infectious, inflammatory diseases, and defective defenses. PMID:28217107

  16. Work stress and innate immune response.

    PubMed

    Boscolo, P; Di Gioacchino, M; Reale, M; Muraro, R; Di Giampaolo, L

    2011-01-01

    Several reports highlight the relationship between blood NK cytotoxic activity and life style. Easy life style, including physical activity, healthy dietary habits as well as good mental health are characterized by an efficient immune response. Life style is related to the type of occupational activity since work has a central part in life either as source of income or contributing to represent the social identity. Not only occupational stress, but also job loss or insecurity are thus considered serious stressful situations, inducing emotional disorders which may affect both neuroendocrine and immune systems; reduced reactivity to mitogens and/or decreased blood NK cytotoxic activity was reported in unemployed workers or in those with a high perception of job insecurity and/or job stress. Although genetic factors have a key role in the pathogenesis of autoimmune disorders, occupational stress (as in night shifts) was reported associated to an increased incidence of autoimmune disorders. Monitoring blood NK response may thus be included in the health programs as an indirect index of stressful job and/or poor lifestyle.

  17. Acquired transmission-blocking immunity to Plasmodium vivax in a population of southern coastal Mexico.

    PubMed

    Ramsey, J M; Salinas, E; Rodríguez, M H

    1996-05-01

    Naturally acquired transmission-blocking immunity to Plasmodium vivax was studied in three groups of patients from the southern coast of Mexico: primary cases (Group A, 61% of the study population), secondary cases with the prior infection seven or more months earlier (Group B, 23%), and secondary cases with the previous malaria experience within six months of the present study (Group C, 16%). Anopheles albimanus mosquitoes were fed with patients' infected blood cells in the presence of autologous or control serum, with or without heat-inactivation. Patients from all three groups had transmission-blocking immunity, although the quality and quantity of this blocking activity was significantly higher in the two secondary patient groups (B and C). Only primary malaria cases produced transmission-enhancing activity (23% of the cases), which was dependent on heat-labile serum components. The levels of patient group transmission-blocking immunity and mosquito infectivity were used to calculate the probabilities of a mosquito becoming infective after taking a blood meal from a P. vivax-infected patient from any one of the three groups. This probability was 0.025, with Group A patients providing the major source of these infections (92% risk from Group A and 4% risk for Groups B and C).

  18. Responses of antennal olfactory receptors in the yellow fever mosquito Aedes aegypti to human body odours.

    PubMed

    Pappenberger, B; Geier, M; Boeckh, J

    1996-01-01

    Recent behavioural studies have demonstrated that human body odours which female Aedes aegypti find attractive exert their effects as complex mixtures of synergistically acting components. We have attempted to clarify the sensory mechanisms underlying the perception of these complex host odours by studying the responses of sensory cells underneath the A3-type sensilla of the mosquito antenna to both a human skin wash extract and the extract's active chromatographic fractions. The reaction patterns show that the host stimuli elicit responses from several types of receptor cells in a typical across-fibre pattern mode. It seems as if this is another case where the essential message in a biologically significant odour consists of a complex pattern of compounds that is encoded in an according complex response pattern by a cooperating set of primary sensory neurons of different odour specificities.

  19. The Immune Response to Acute Focal Cerebral Ischemia and Associated Post-stroke Immunodepression: A Focused Review

    PubMed Central

    Famakin, Bolanle M.

    2014-01-01

    It is currently well established that the immune system is activated in response to transient or focal cerebral ischemia. This acute immune activation occurs in response to damage, and injury, to components of the neurovascular unit and is mediated by the innate and adaptive arms of the immune response. The initial immune activation is rapid, occurs via the innate immune response and leads to inflammation. The inflammatory mediators produced during the innate immune response in turn lead to recruitment of inflammatory cells and the production of more inflammatory mediators that result in activation of the adaptive immune response. Under ideal conditions, this inflammation gives way to tissue repair and attempts at regeneration. However, for reasons that are just being understood, immunosuppression occurs following acute stroke leading to post-stroke immunodepression. This review focuses on the current state of knowledge regarding innate and adaptive immune activation in response to focal cerebral ischemia as well as the immunodepression that can occur following stroke. A better understanding of the intricate and complex events that take place following immune response activation, to acute cerebral ischemia, is imperative for the development of effective novel immunomodulatory therapies for the treatment of acute stroke. PMID:25276490

  20. Superficial Immunity: Antimicrobial Responses Are More Than Skin Deep.

    PubMed

    Mack, Madison R; Kim, Brian S

    2016-07-19

    The skin barrier is essential for host defense, but how the skin provides protection when the barrier is breached is not well understood. In this issue of Immunity, Gallo and colleagues report that keratinocytes integrate signals from antimicrobial peptides via MAVS signaling to amplify their antiviral immune response. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Immune Response in Mussels To Environmental Pollution.

    ERIC Educational Resources Information Center

    Pryor, Stephen C.; Facher, Evan

    1997-01-01

    Describes the use of mussels in measuring the extent of chemical contamination and its variation in different coastal regions. Presents an experiment to introduce students to immune response and the effects of environmental pollution on marine organisms. Contains 14 references. (JRH)

  2. Effect of rituximab on human in vivo antibody immune responses.

    PubMed

    Pescovitz, Mark D; Torgerson, Troy R; Ochs, Hans D; Ocheltree, Elizabeth; McGee, Paula; Krause-Steinrauf, Heidi; Lachin, John M; Canniff, Jennifer; Greenbaum, Carla; Herold, Kevan C; Skyler, Jay S; Weinberg, Adriana

    2011-12-01

    B-lymphocyte depletion with rituximab has been shown to benefit patients with various autoimmune diseases. We have previously demonstrated that this benefit is also apparent in patients with newly diagnosed type 1 diabetes. The effect of rituximab on in vivo antibody responses, particularly during the period of B-lymphocyte depletion, is incompletely determined. This study was designed to assess this knowledge void. In patients with recent-onset type 1 diabetes treated with rituximab (n = 46) or placebo (n = 29), antibody responses to neoantigen phiX174 during B-lymphocyte depletion and with hepatitis A (as a second neoantigen) and tetanus/diphtheria (as recall antigens) after B-lymphocyte recovery were studied. Anti- tetanus, diphtheria, mumps, measles, and rubella titers were measured before and after treatment by means of ELISA. Antibody titers and percentage IgM versus percentage IgG to phiX174 were measured by means of phage neutralization. B-lymphocyte subsets were determined by means of flow cytometry. No change occurred in preexisting antibody titers. Tetanus/diphtheria and hepatitis A immunization responses were protective in the rituximab-treated subjects, although significantly blunted compared with those seen in the controls subjects, when immunized at the time of B-lymphocyte recovery. Anti-phiX174 responses were severely reduced during the period of B-lymphocyte depletion, but with B-lymphocyte recovery, anti-phiX174 responses were within the normal range. During the time of B-lymphocyte depletion, rituximab recipients had a decreased antibody response to neoantigens and significantly lower titers after recall immunization with diphtheria and tetanus toxoid. With recovery, immune responses return toward normal. Immunization during the time of B-lymphocyte depletion, although ineffective, does not preclude a subsequent response to the antigen. Copyright © 2011 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights

  3. Tissue-enriched expression profiles in Aedes aegypti identify hemocyte-specific transcriptome responses to infection

    PubMed Central

    Choi, Young-Jun; Fuchs, Jeremy F.; Mayhew, George F.; Yu, Helen E.; Christensen, Bruce M.

    2012-01-01

    Hemocytes are integral components of mosquito immune mechanisms such as phagocytosis, melanization, and production of antimicrobial peptides. However, our understanding of hemocyte-specific molecular processes and their contribution to shaping the host immune response remains limited. To better understand the immunophysiological features distinctive of hemocytes, we conducted genome-wide analysis of hemocyte-enriched transcripts, and examined how tissue-enriched expression patterns change with the immune status of the host. Our microarray data indicate that the hemocyte-enriched trascriptome is dynamic and context-dependent. Analysis of transcripts enriched after bacterial challenge in circulating hemocytes with respect to carcass added a dimension to evaluating infection-responsive genes and immune-related gene families. We resolved patterns of transcriptional change unique to hemocytes from those that are likely shared by other immune responsive tissues, and identified clusters of genes preferentially induced in hemocytes, likely reflecting their involvement in cell type specific functions. In addition, the study revealed conserved hemocyte-enriched molecular repertoires which might be implicated in core hemocyte function by cross-species meta-analysis of microarray expression data from Anopheles gambiae and Drosophila melanogaster. PMID:22796331

  4. Dietary Animal Plasma Proteins Improve the Intestinal Immune Response in Senescent Mice.

    PubMed

    Miró, Lluïsa; Garcia-Just, Alba; Amat, Concepció; Polo, Javier; Moretó, Miquel; Pérez-Bosque, Anna

    2017-12-11

    Increased life expectancy has promoted research on healthy aging. Aging is accompanied by increased non-specific immune activation (inflammaging) which favors the appearance of several disorders. Here, we study whether dietary supplementation with spray-dried animal plasma (SDP), which has been shown to reduce the activation of gut-associated lymphoid tissue (GALT) in rodents challenged by S. aureus enterotoxin B (SEB), and can also prevent the effects of aging on immune system homeostasis. We first characterized GALT in a mouse model of accelerated senescence (SAMP8) at different ages (compared to mice resistant to accelerated senescence; SAMR1). Second, we analyzed the SDP effects on GALT response to an SEB challenge in SAMP8 mice. In GALT characterization, aging increased the cell number and the percentage of activated Th lymphocytes in mesenteric lymph nodes and Peyer's patches (all, p < 0.05), as well as the expression of IL-6 and TNF-α in intestinal mucosa (both, p < 0.05). With respect to GALT response to the SEB challenge, young mice showed increased expression of intestinal IL-6 and TNF-α, as well as lymphocyte recruitment and activation (all, p < 0.05). However, the immune response of senescent mice to the SEB challenge was weak, since SEB did not change cell recruitment or the percentage of activated Th lymphocytes. Mice supplemented with SDP showed improved capacity to respond to the SEB challenge, similar to the response of the young mice. These results indicate that senescent mice have an impaired mucosal immune response characterized by unspecific GALT activation and a weak specific immune response. SDP supplementation reduces non-specific basal immune activation, allowing for the generation of specific responses.

  5. Evaluation of mucosal adjuvants and immunization routes for the induction of systemic and mucosal humoral immune responses in macaques.

    PubMed

    Veazey, Ronald S; Siddiqui, Asna; Klein, Katja; Buffa, Viviana; Fischetti, Lucia; Doyle-Meyers, Lara; King, Deborah F; Tregoning, John S; Shattock, Robin J

    2015-01-01

    Delivering vaccine antigens to mucosal surfaces is potentially very attractive, especially as protection from mucosal infections may be mediated by local immune responses. However, to date mucosal immunization has had limited successes, with issues of both safety and poor immunogenicity. One approach to improve immunogenicity is to develop adjuvants that are effective and safe at mucosal surfaces. Differences in immune responses between mice and men have overstated the value of some experimental adjuvants which have subsequently performed poorly in the clinic. Due to their closer similarity, non-human primates can provide a more accurate picture of adjuvant performance. In this study we immunised rhesus macaques (Macaca mulatta) using a unique matrix experimental design that maximised the number of adjuvants screened while reducing the animal usage. Macaques were immunised by the intranasal, sublingual and intrarectal routes with the model protein antigens keyhole limpet haemocyanin (KLH), β-galactosidase (β-Gal) and ovalbumin (OVA) in combination with the experimental adjuvants Poly(I:C), Pam3CSK4, chitosan, Thymic Stromal Lymphopoietin (TSLP), MPLA and R848 (Resiquimod). Of the routes used, only intranasal immunization with KLH and R848 induced a detectable antibody response. When compared to intramuscular immunization, intranasal administration gave slightly lower levels of antigen specific antibody in the plasma, but enhanced local responses. Following intranasal delivery of R848, we observed a mildly inflammatory response, but no difference to the control. From this we conclude that R848 is able to boost antibody responses to mucosally delivered antigen, without causing excess local inflammation.

  6. The Role of the Immune Response in the Pathogenesis of Bronchiectasis.

    PubMed

    King, Paul T

    2018-01-01

    Bronchiectasis is a prevalent respiratory condition characterised by permanent and abnormal dilation of the lung airways (bronchi). There are a large variety of causative factors that have been identified for bronchiectasis; all of these compromise the function of the immune response to fight infection. A triggering factor may lead to the establishment of chronic infection in the lower respiratory tract. The bacteria responsible for the lower respiratory tract infection are usually found as commensals in the upper respiratory tract microbiome. The consequent inflammatory response to infection is largely responsible for the pathology of this condition. Both innate and adaptive immune responses are activated. The literature has highlighted the central role of neutrophils in the pathogenesis of bronchiectasis. Proteases produced in the lung by the inflammatory response damage the airways and lead to the pathological dilation that is the pathognomonic feature of bronchiectasis. The small airways demonstrate infiltration with lymphoid follicles that may contribute to localised small airway obstruction. Despite aggressive treatment, most patients will have persistent disease. Manipulating the immune response in bronchiectasis may potentially have therapeutic potential.

  7. A humoral immune response confers protection against Haemophilus ducreyi infection.

    PubMed

    Cole, Leah E; Toffer, Kristen L; Fulcher, Robert A; San Mateo, Lani R; Orndorff, Paul E; Kawula, Thomas H

    2003-12-01

    Haemophilus ducreyi is the etiologic agent of the sexually transmitted genital ulcer disease chancroid. Neither naturally occurring chancroid nor experimental infection with H. ducreyi results in protective immunity. Likewise, a single inoculation of H. ducreyi does not protect pigs against subsequent infection. Accordingly, we used the swine model of chancroid infection to examine the impact of multiple inoculations on a host's immune response. After three successive inoculations with H. ducreyi, pigs developed a modestly protective immune response evidenced by the decreased recovery of viable bacteria from lesions. All lesions biopsied 2 days after the first and second inoculations contained viable H. ducreyi cells, yet only 55% of the lesions biopsied 2 days after the third inoculation did. Nearly 90% of the lesions biopsied 7 days after the first inoculation contained viable H. ducreyi cells, but this percentage dropped to only 16% after the third inoculation. Between the first and third inoculations, the average recovery of CFU from lesions decreased approximately 100-fold. The reduced recovery of bacteria corresponded directly with a fivefold increase in H. ducreyi-specific antibody titers and the emergence of bactericidal activity. These immune sera were protective when administered to naïve pigs prior to challenge with H. ducreyi. These data suggest that pigs mount an effective humoral immune response to H. ducreyi after multiple exposures to the organism.

  8. F4+ ETEC infection and oral immunization with F4 fimbriae elicits an IL-17-dominated immune response.

    PubMed

    Luo, Yu; Van Nguyen, Ut; de la Fe Rodriguez, Pedro Y; Devriendt, Bert; Cox, Eric

    2015-10-21

    Enterotoxigenic Escherichia coli (ETEC) are an important cause of post-weaning diarrhea (PWD) in piglets. Porcine-specific ETEC strains possess different fimbrial subtypes of which F4 fimbriae are the most frequently associated with ETEC-induced diarrhea in piglets. These F4 fimbriae are potent oral immunogens that induce protective F4-specific IgA antibody secreting cells at intestinal tissues. Recently, T-helper 17 (Th17) cells have been implicated in the protection of the host against extracellular pathogens. However, it remains unknown if Th17 effector responses are needed to clear ETEC infections. In the present study, we aimed to elucidate if ETEC elicits a Th17 response in piglets and if F4 fimbriae trigger a similar response. F4(+) ETEC infection upregulated IL-17A, IL-17F, IL-21 and IL-23p19, but not IL-12 and IFN-γ mRNA expression in the systemic and mucosal immune system. Similarly, oral immunization with F4 fimbriae triggered a Th17 signature evidenced by an upregulated mRNA expression of IL-17F, RORγt, IL-23p19 and IL-21 in the peripheral blood mononuclear cells (PBMCs). Intriguingly, IL-17A mRNA levels were unaltered. To further evaluate this difference between systemic and mucosal immune responses, we assayed the cytokine mRNA profile of F4 fimbriae stimulated PBMCs. F4 fimbriae induced IL-17A, IL-17F, IL-22 and IL-23p19, but downregulated IL-17B mRNA expression. Altogether, these data indicate a Th17 dominated response upon oral immunization with F4 fimbriae and F4(+) ETEC infection. Our work also highlights that IL-17B and IL-17F participate in the immune response to protect the host against F4(+) ETEC infection and could aid in the design of future ETEC vaccines.

  9. Muscles provide protection during microbial infection by activating innate immune response pathways in Drosophila and zebrafish.

    PubMed

    Chatterjee, Arunita; Roy, Debasish; Patnaik, Esha; Nongthomba, Upendra

    2016-06-01

    Muscle contraction brings about movement and locomotion in animals. However, muscles have also been implicated in several atypical physiological processes including immune response. The role of muscles in immunity and the mechanism involved has not yet been deciphered. In this paper, using Drosophila indirect flight muscles (IFMs) as a model, we show that muscles are immune-responsive tissues. Flies with defective IFMs are incapable of mounting a potent humoral immune response. Upon immune challenge, the IFMs produce anti-microbial peptides (AMPs) through the activation of canonical signaling pathways, and these IFM-synthesized AMPs are essential for survival upon infection. The trunk muscles of zebrafish, a vertebrate model system, also possess the capacity to mount an immune response against bacterial infections, thus establishing that immune responsiveness of muscles is evolutionarily conserved. Our results suggest that physiologically fit muscles might boost the innate immune response of an individual. © 2016. Published by The Company of Biologists Ltd.

  10. Mosquito Consumption by Insectivorous Bats: Does Size Matter?

    PubMed Central

    Gonsalves, Leroy; Bicknell, Brian; Law, Brad; Webb, Cameron; Monamy, Vaughan

    2013-01-01

    Insectivorous bats have often been touted as biological control for mosquito populations. However, mosquitoes generally represent only a small proportion of bat diet. Given the small size of mosquitoes, restrictions imposed on prey detectability by low frequency echolocation, and variable field metabolic rates (FMR), mosquitoes may not be available to or profitable for all bats. This study investigated whether consumption of mosquitoes was influenced by bat size, which is negatively correlated with echolocation frequency but positively correlated with bat FMR. To assess this, we investigated diets of five eastern Australian bat species (Vespadelus vulturnus Thomas, V. pumilus Gray, Miniopterus australis Tomes, Nyctophilus gouldi Tomes and Chalinolobus gouldii Gray) ranging in size from 4-14 g in coastal forest, using molecular analysis of fecal DNA. Abundances of potential mosquito and non-mosquito prey were concurrently measured to provide data on relative prey abundance. Aedes vigilax was locally the most abundant mosquito species, while Lepidoptera the most abundant insect order. A diverse range of prey was detected in bat feces, although members of Lepidoptera dominated, reflecting relative abundance at trap sites. Consumption of mosquitoes was restricted to V. vulturnus and V. pumilus, two smaller sized bats (4 and 4.5 g). Although mosquitoes were not commonly detected in feces of V. pumilus, they were present in feces of 55 % of V. vulturnus individuals. To meet nightly FMR requirements, Vespadelus spp. would need to consume ~600-660 mosquitoes on a mosquito-only diet, or ~160-180 similar sized moths on a moth-only diet. Lower relative profitability of mosquitoes may provide an explanation for the low level of mosquito consumption among these bats and the absence of mosquitoes in feces of larger bats. Smaller sized bats, especially V. vulturnus, are likely to be those most sensitive to reductions in mosquito abundance and should be monitored during mosquito

  11. Maternal LAMP/p55gagHIV-1 DNA immunization induces in utero priming and a long-lasting immune response in vaccinated neonates.

    PubMed

    Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi

    2012-01-01

    Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods.

  12. Maternal LAMP/p55gagHIV-1 DNA Immunization Induces In Utero Priming and a Long-Lasting Immune Response in Vaccinated Neonates

    PubMed Central

    Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi

    2012-01-01

    Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods. PMID:22355381

  13. Plant extracts as potential mosquito larvicides

    PubMed Central

    Ghosh, Anupam; Chowdhury, Nandita; Chandra, Goutam

    2012-01-01

    Mosquitoes act as a vector for most of the life threatening diseases like malaria, yellow fever, dengue fever, chikungunya ferver, filariasis, encephalitis, West Nile Virus infection, etc. Under the Integrated Mosquito Management (IMM), emphasis was given on the application of alternative strategies in mosquito control. The continuous application of synthetic insecticides causes development of resistance in vector species, biological magnification of toxic substances through the food chain and adverse effects on environmental quality and non target organisms including human health. Application of active toxic agents from plant extracts as an alternative mosquito control strategy was available from ancient times. These are non-toxic, easily available at affordable prices, biodegradable and show broad-spectrum target-specific activities against different species of vector mosquitoes. In this article, the current state of knowledge on phytochemical sources and mosquitocidal activity, their mechanism of action on target population, variation of their larvicidal activity according to mosquito species, instar specificity, polarity of solvents used during extraction, nature of active ingredient and promising advances made in biological control of mosquitoes by plant derived secondary metabolites have been reviewed. PMID:22771587

  14. Plant extracts as potential mosquito larvicides.

    PubMed

    Ghosh, Anupam; Chowdhury, Nandita; Chandra, Goutam

    2012-05-01

    Mosquitoes act as a vector for most of the life threatening diseases like malaria, yellow fever, dengue fever, chikungunya ferver, filariasis, encephalitis, West Nile Virus infection, etc. Under the Integrated Mosquito Management (IMM), emphasis was given on the application of alternative strategies in mosquito control. The continuous application of synthetic insecticides causes development of resistance in vector species, biological magnification of toxic substances through the food chain and adverse effects on environmental quality and non target organisms including human health. Application of active toxic agents from plant extracts as an alternative mosquito control strategy was available from ancient times. These are non-toxic, easily available at affordable prices, biodegradable and show broad-spectrum target-specific activities against different species of vector mosquitoes. In this article, the current state of knowledge on phytochemical sources and mosquitocidal activity, their mechanism of action on target population, variation of their larvicidal activity according to mosquito species, instar specificity, polarity of solvents used during extraction, nature of active ingredient and promising advances made in biological control of mosquitoes by plant derived secondary metabolites have been reviewed.

  15. Neuro-Immune Mechanisms in Response to Venezuelan Equine Encephalitis Virus Infection

    DTIC Science & Technology

    2000-01-01

    iii ABSTRACT NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION Major Bruce A. Schoneboom directed by Franziska B...Grieder, DVM, Ph.D., Assistant Professor of Microbiology and Immunology, Molecular and Cellular Biology, and Neuroscience Venezuelan equine ...3. DATES COVERED - 4. TITLE AND SUBTITLE NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION 5a. CONTRACT

  16. How might infant and paediatric immune responses influence malaria vaccine efficacy?

    PubMed

    Moormann, A M

    2009-09-01

    Naturally acquired immunity to malaria requires repeat infections yet does not engender sterile immunity or long-lasting protective immunologic memory. This renders infants and young children the most susceptible to malaria-induced morbidity and mortality, and the ultimate target for a malaria vaccine. The prevailing paradigm is that infants initially garner protection due to transplacentally transferred anti-malarial antibodies and other intrinsic factors such as foetal haemoglobin. As these wane infants have an insufficient immune repertoire to prevent genetically diverse Plasmodium infections and an inability to control malaria-induced immunopathology. This Review discusses humoral, cell-mediated and innate immune responses to malaria and how each contributes to protection - focusing on how deficiencies in infant and paediatric immune responses might influence malaria vaccine efficacy in this population. In addition, burgeoning evidence suggests a role for inhibitory receptors that limit immunopathology and guide the development of long-lived immunity. Precisely how age or malaria infections influence the function of these regulators is unknown. Therefore the possibility that infants may not have the immune-dexterity to balance effective parasite clearance with timely immune-regulation leading to protective immunologic memory is considered. And thus, malaria vaccines tested in adults and older children may not be predictive for trials conducted in infants.

  17. Acquired immunity to amyloodiniosis is associated with an antibody response.

    PubMed

    Cobb, C S; Levy, M G; Noga, E J

    1998-10-08

    The dinoflagellate Amyloodinium ocellatum, which causes amyloodiniosis or 'marine velvet disease', is one of the most serious ectoparasitic diseases plaguing warmwater marine fish culture worldwide. We report that tomato clownfish Amphiprion frenatus develop strong immunity to Amyloodinium ocellatum infection following repeated nonlethal challenges and that specific antibodies are associated with this response. Reaction of immune fish antisera against dinospore and trophont-derived antigens in Western blots indicated both shared and stage-specific antibody-antigen reactions. A mannan-binding-protein affinity column was used to isolate IgM-like antibody from A. frenatus serum. The reduced Ig consisted of one 70 kD heavy chain and one 32 kD light chain with an estimated molecular weight of 816 kD for the native molecule. Immunoglobulin (Ig) isolated from immune but not non-immune fish serum significantly inhibited parasite infectivity in vitro. An enzyme-linked immunosorbent assay (ELISA) was developed using polyclonal rabbit antibody produced against affinity-purified A. frenatus Ig. Anti-Amyloodinium serum antibody was not always detectable in immune fish, although serum antibody titers in immune fish increased after repeated exposure to the parasite. These results suggest that there may be a localized antibody response in skin/gill epithelial tissue, although antibody was rarely detected in skin mucus.

  18. Immunosuppressive activity of tilmicosin on the immune responses in mice.

    PubMed

    Guan, Shuang; Song, Yu; Guo, Weixiao; Chu, Xiao; Zhang, Xiaozhe; Wang, Dacheng; Lu, Jing; Deng, Xuming

    2011-06-01

    Tilmicosin, a semi-synthetic macrolide antibiotic that is only used in the veterinary clinic, was evaluated for its immunosuppressive activity on the immune responses to ovalbumin (OVA) in mice. Tilmicosin suppressed concanavalin A (Con A)- and lipopolysaccharide (LPS)-stimulated splenocyte proliferation in vitro. BALB/c mice were immunized subcutaneously with OVA on day 1 and 4. Beginning on the day of boosting immunization, the mice were administered intraperitoneally with tilmicosin at a single dose of 10, 30, and 90 mg/kg for 10 consecutive days. On day 14, blood samples were collected for measuring specific total-immunoglobulin G (total-IgG), IgG1, IgG2b, and splenocytes were harvested for determining lymphocyte proliferation and interleukin-2 (IL-2), interferon-γ (IFN-γ), IL-4 production. The results demonstrated that tilmicosin could significantly suppress Con A-induced splenocyte proliferation in a dose-dependent manner, decrease LPS-and OVA-induced splenocyte proliferation only at high concentration, produced less IL-2, IL-4, and IFN-γ as compared to the control in the OVA-immunized mice. Moreover, the OVA-specific IgG, IgG1, and IgG2b levels in the OVA-immunized mice were reduced by tilmicosin. These results suggest that tilmicosin could suppress the cellular and humoral immune response in mice.

  19. Optimization of a Membrane Feeding Assay for Plasmodium vivax Infection in Anopheles albimanus.

    PubMed

    Vallejo, Andrés F; Rubiano, Kelly; Amado, Andres; Krystosik, Amy R; Herrera, Sócrates; Arévalo-Herrera, Myriam

    2016-06-01

    Individuals exposed to malaria infections for a long time develop immune responses capable of blocking Plasmodium transmission to mosquito vectors, potentially limiting parasite spreading in nature. Development of a malaria TB vaccine requires a better understanding of the mechanisms and main effectors responsible for transmission blocking (TB) responses. The lack of an in vitro culture system for Plasmodium vivax has been an important drawback for development of a standardized method to assess TB responses to this parasite. This study evaluated host, vector, and parasite factors that may influence Anopheles mosquito infection in order to develop an efficient and reliable assay to assess the TB immunity. A total of 94 P. vivax infected patients were enrolled as parasite donors or subjects of direct mosquito feeding in two malaria endemic regions of Colombia (Tierralta, and Buenaventura). Parasite infectiousness was assessed by membrane feeding assay or direct feeding assay using laboratory reared Anopheles mosquitoes. Infection was measured by qPCR and by microscopically examining mosquito midguts at day 7 for the presence of oocysts. Best infectivity was attained in four day old mosquitoes fed at a density of 100 mosquitos/cage. Membrane feeding assays produced statistically significant better infections than direct feeding assays in parasite donors; cytokine profiles showed increased IFN-γ, TNF and IL-1 levels in non-infectious individuals. Mosquito infections and parasite maturation were more reliably assessed by PCR compared to microscopy. We evaluated mosquito, parasite and host factors that may affect the outcome of parasite transmission as measured by artificial membrane feeding assays. Results have led us to conclude that: 1) optimal mosquito infectivity occurs with mosquitoes four days after emergence at a cage density of 100; 2) mosquito infectivity is best quantified by PCR as it may be underestimated by microscopy; 3) host cellular immune response did

  20. Transcriptomic immune response of Tenebrio molitor pupae to parasitization by Scleroderma guani.

    PubMed

    Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin

    2013-01-01

    Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host-parasitoid interaction.

  1. Transcriptomic Immune Response of Tenebrio molitor Pupae to Parasitization by Scleroderma guani

    PubMed Central

    Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin

    2013-01-01

    Background Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. Methodology/Principal Findings In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. Conclusions/Significance obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host

  2. Aspergillus-Associated Airway Disease, Inflammation, and the Innate Immune Response

    PubMed Central

    Chotirmall, Sanjay H.; Al-Alawi, Mazen; Logan, P. Mark; Greene, Catherine M.; McElvaney, Noel G.

    2013-01-01

    Aspergillus moulds exist ubiquitously as spores that are inhaled in large numbers daily. Whilst most are removed by anatomical barriers, disease may occur in certain circumstances. Depending on the underlying state of the human immune system, clinical consequences can ensue ranging from an excessive immune response during allergic bronchopulmonary aspergillosis to the formation of an aspergilloma in the immunocompetent state. The severest infections occur in those who are immunocompromised where invasive pulmonary aspergillosis results in high mortality rates. The diagnosis of Aspergillus-associated pulmonary disease is based on clinical, radiological, and immunological testing. An understanding of the innate and inflammatory consequences of exposure to Aspergillus species is critical in accounting for disease manifestations and preventing sequelae. The major components of the innate immune system involved in recognition and removal of the fungus include phagocytosis, antimicrobial peptide production, and recognition by pattern recognition receptors. The cytokine response is also critical facilitating cell-to-cell communication and promoting the initiation, maintenance, and resolution of the host response. In the following review, we discuss the above areas with a focus on the innate and inflammatory response to airway Aspergillus exposure and how these responses may be modulated for therapeutic benefit. PMID:23971044

  3. Tailoring the Immune Response via Customization of Pathogen Gene Expression.

    PubMed

    Runco, Lisa M; Stauft, Charles B; Coleman, J Robert

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.

  4. Tailoring the Immune Response via Customization of Pathogen Gene Expression

    PubMed Central

    Runco, Lisa M.; Stauft, Charles B.

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development. PMID:24719769

  5. Ecosystem and immune systems: Hierarchial response provides resilience against invasions

    USGS Publications Warehouse

    Allen, Craig R.

    2001-01-01

    Janssen (2001) provides the stimulus for thoughtful comparison and consideration of the ranges of responses exhibited by immune systems and ecological systems in the face of perturbations such as biological invasions. It may indeed be informative to consider the similarities of the responses to invasions exhibited by immune systems and ecological systems. Clearly, both types of systems share a general organizational structure with all other complex hierarchical systems. Their organization provides these systems with resilience. However, when describing the response of ecological-economic systems to invasions, Janssen emphasizes the human-economic response. I would like to expand on his comparison by focusing on how resilience is maintained in complex systems under the threat of invasion.

  6. pH-Responsive Micelle-Based Cytoplasmic Delivery System for Induction of Cellular Immunity.

    PubMed

    Yuba, Eiji; Sakaguchi, Naoki; Kanda, Yuhei; Miyazaki, Maiko; Koiwai, Kazunori

    2017-11-04

    (1) Background: Cytoplasmic delivery of antigens is crucial for the induction of cellular immunity, which is an important immune response for the treatment of cancer and infectious diseases. To date, fusogenic protein-incorporated liposomes and pH-responsive polymer-modified liposomes have been used to achieve cytoplasmic delivery of antigen via membrane rupture or fusion with endosomes. However, a more versatile cytoplasmic delivery system is desired for practical use. For this study, we developed pH-responsive micelles composed of dilauroyl phosphatidylcholine (DLPC) and deoxycholic acid and investigated their cytoplasmic delivery performance and immunity-inducing capability. (2) Methods: Interaction of micelles with fluorescence dye-loaded liposomes, intracellular distribution of micelles, and antigenic proteins were observed. Finally, antigen-specific cellular immune response was evaluated in vivo using ELIspot assay. (3) Results: Micelles induced leakage of contents from liposomes via lipid mixing at low pH. Micelles were taken up by dendritic cells mainly via macropinocytosis and delivered ovalbumin (OVA) into the cytosol. After intradermal injection of micelles and OVA, OVA-specific cellular immunity was induced in the spleen. (4) Conclusions: pH-responsive micelles composed of DLPC and deoxycholic acid are promising as enhancers of cytosol delivery of antigens and the induction capability of cellular immunity for the treatment of cancer immunotherapy and infectious diseases.

  7. The transcriptome of the mosquito Aedes fluviatilis (Diptera: Culicidae), and transcriptional changes associated with its native Wolbachia infection.

    PubMed

    Caragata, E P; Pais, F S; Baton, L A; Silva, J B L; Sorgine, M H F; Moreira, L A

    2017-01-03

    Wolbachia is a bacterial endosymbiont that naturally infects a wide range of insect species, and causes drastic changes to host biology. Stable infections of Wolbachia in mosquitoes can inhibit infection with medically important pathogens such as dengue virus and malaria-causing Plasmodium parasites. However, some native Wolbachia strains can enhance infection with certain pathogens, as is the case for the mosquito Aedes fluviatilis, where infection with Plasmodium gallinaceum is enhanced by the native wFlu Wolbachia strain. To better understand the biological interactions between mosquitoes and native Wolbachia infections, and to investigate the process of pathogen enhancement, we used RNA-Seq to generate the transcriptome of Ae. fluviatilis with and without Wolbachia infection. In total, we generated 22,280,160 Illumina paired-end reads from Wolbachia-infected and uninfected mosquitoes, and used these to make a de novo transcriptome assembly, resulting in 58,013 contigs with a median sequence length of 443 bp and an N50 of 2454 bp. Contigs were annotated through local alignments using BlastX, and associated with both gene ontology and KEGG orthology terms. Through baySeq, we identified 159 contigs that were significantly upregulated due to Wolbachia infection, and 98 that were downregulated. Critically, we saw no changes to Toll or IMD immune gene transcription, but did see evidence that wFlu infection altered the expression of several bacterial recognition genes, and immune-related genes that could influence Plasmodium infection. wFlu infection also had a widespread effect on a number of host physiological processes including protein, carbohydrate and lipid metabolism, and oxidative stress. We then compared our data set with transcriptomic data for other Wolbachia infections in Aedes aegypti, and identified a core set of 15 gene groups associated with Wolbachia infection in mosquitoes. While the scale of transcriptional changes associated with wFlu infection

  8. Suppression of secondary immune response by antilymphocyte serum: time relationship between immunization and administration of antilymphocyte serum.

    PubMed Central

    Reuben, C; Sundaram, K; Phondke, G P

    1979-01-01

    The effect of antilymphocyte serum (ALS) on the secondary humoral immune response to sheep erythrocytes (SRBC) in rats was studied by the Jerne plaque assay technique. Its effect was also studied on the delayed hypersensitivity (DH) response to SRBC by the foot pad swelling test. ALS(N), which was prepared against lymphocytes from normal rats, had no effect on the secondary humoral and cellular response or on the primary cellular response, when administered postantigenically. ALS(I), which was raised against lymph node cells from SRBC immunized rats produced significant immunosuppression of the secondary response to SRBC when administered either before or after the antigenic injections. In the case of DH, ALS(I) behaved just like ALS(N) having no effect on the secondary response and suppressing the primary only when administered prior to the antigen. PMID:369994

  9. Enhancement of Th1 immune responses to recombinant influenza nucleoprotein by Ribi adjuvant.

    PubMed

    Cargnelutti, Diego E; Sanchez, María A V; Alvarez, Paula; Boado, Lorena; Mattion, Nora; Scodeller, Eduardo A

    2013-04-01

    A broad coverage influenza vaccine against multiple viral strains based on the viral nucleoprotein (NP) is a goal pursued by many laboratories. If the goal is to formulate the vaccine with recombinant NP it is essential to count on adjuvants capable of inducing cellular immunity. This work have studied the effect of the monophosphoryl lipid A and trehalose dimycolate, known as the Ribi Adjuvant System (RAS), in the immune response induced in mice immunized with recombinant NP. The NP was formulated with RAS and used to immunize BALB/c mice. Immunizations with NP-RAS increased the humoral and cellular immune responses compared to unadjuvanted NP. The predominant antibody isotype was IgG2a, suggesting the development of a Th1 response. Analysis of the cytokines from mice immunized with NP-RAS showed a significant increase in the production of IFN-g and a decreased production of IL-10 and IL-4 compared to controls without RAS. These results are similar to those usually obtained using Freund’s adjuvant, known to induce Th1 and CTL responses when co-administered with purified proteins, and suggest that a similar approach may be possible to enhance the performance of a T-cell vaccine containing NP.

  10. Bivalve immunity and response to infections: Are we looking at the right place?

    PubMed

    Allam, Bassem; Pales Espinosa, Emmanuelle

    2016-06-01

    Significant progress has been made in the understanding of cellular and molecular mediators of immunity in invertebrates in general and bivalve mollusks in particular. Despite this information, there is a lack of understanding of factors affecting animal resistance and specific responses to infections. This in part results from limited consideration of the spatial (and to some extent temporal) heterogeneity of immune responses and very limited information on host-pathogen (and microbes in general) interactions at initial encounter/colonization sites. Of great concern is the fact that most studies on molluscan immunity focus on the circulating hemocytes and the humoral defense factors in the plasma while most relevant host-microbe interactions occur at mucosal interfaces. This paper summarizes information available on the contrasting value of information available on focal and systemic immune responses in infected bivalves, and highlights the role of mucosal immune factors in host-pathogen interactions. Available information underlines the diversity of immune effectors at molluscan mucosal interfaces and highlights the tailored immune response to pathogen stimuli. This context raises fascinating basic research questions around host-microbe crosstalk and feedback controls of these interactions and may lead to novel disease mitigation strategies and improve the assessment of resistant crops or the screening of probiotic candidates. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Humoural immune response and pathological analysis in patients with false immune diagnosis of cystic echinococcosis

    PubMed Central

    Chen, X; Zhang, J; Feng, X; Chen, X; Yin, S; Wen, H; Zheng, S

    2014-01-01

    The patients with false immune diagnosis of hydatid disease were investigated for the humoural immune response to analyse the possible reasons and mechanism leading to false immune diagnosis. Two hundred and thirty-nine patients with nature-unknown cysts and 30 healthy controls were detected by immunological assays (four hydatid antigen-based immunogold filtration assay and enzyme-linked immune absorbent assay) and ultrasound. Sensitivity of and specificity of immunological assay and ultrasound were calculated, respectively. The serological diagnosis was compared with surgical pathology to screen the patients with false immune diagnosis for the immunoglobulin measurement and pathological analysis. The history and cyst characteristics were also reviewed. The results indicate the immunoglobulin has little influence on false immunodiagnosis. The false-negative immunodiagnosis was caused by the cysts' inactive status while the false positive caused by previous rupture, antigen cross-reaction. The clinical diagnosis of cystic echinococcosis requires a combination of immunodiagnosis and ultrasonography, which is the necessary complementary confirmation. PMID:24372157

  12. General Information about Mosquitoes

    MedlinePlus

    ... they can use without posing unreasonable risk to human health and the environment. State and local government agencies play a critical role in protecting public health from mosquito-borne ... use of pesticides for mosquito control is appropriate for their area. ...

  13. How sex and age affect immune responses, susceptibility to infections, and response to vaccination

    PubMed Central

    Giefing-Kröll, Carmen; Berger, Peter; Lepperdinger, Günter; Grubeck-Loebenstein, Beatrix

    2015-01-01

    Do men die young and sick, or do women live long and healthy? By trying to explain the sexual dimorphism in life expectancy, both biological and environmental aspects are presently being addressed. Besides age-related changes, both the immune and the endocrine system exhibit significant sex-specific differences. This review deals with the aging immune system and its interplay with sex steroid hormones. Together, they impact on the etiopathology of many infectious diseases, which are still the major causes of morbidity and mortality in people at old age. Among men, susceptibilities toward many infectious diseases and the corresponding mortality rates are higher. Responses to various types of vaccination are often higher among women thereby also mounting stronger humoral responses. Women appear immune-privileged. The major sex steroid hormones exhibit opposing effects on cells of both the adaptive and the innate immune system: estradiol being mainly enhancing, testosterone by and large suppressive. However, levels of sex hormones change with age. At menopause transition, dropping estradiol potentially enhances immunosenescence effects posing postmenopausal women at additional, yet specific risks. Conclusively during aging, interventions, which distinctively consider the changing level of individual hormones, shall provide potent options in maintaining optimal immune functions. PMID:25720438

  14. Carotenoids, immune response and the expression of sexual ornaments in male greenfinches ( Carduelis chloris)

    NASA Astrophysics Data System (ADS)

    Aguilera, Eduardo; Amat, Juan A.

    2007-11-01

    Allocation trade-offs of carotenoids between their use in the immune system and production of sexual ornaments have been suggested as a proximate mechanism maintaining honesty of sexual signals. To test this idea, we experimentally examined whether carotenoid availability in the diet was related to variation in antibody response to novel antigens in male greenfinches ( Carduelis chloris aurantiiventris), a species with extensive carotenoid-dependent plumage colouration. We also measured the cost of mounting a humoral response in terms of circulating carotenoids. Finally, we examined the relationship between plumage colour, immune response and circulating carotenoids. We found that males with carotenoid-supplemented diets showed stronger antibody response than non-supplemented birds. We also found that activation of the immune system significantly reduced circulating carotenoids (24.9% lower in immune-challenged birds than in control birds). Finally, intensity (chroma) of ventral plumage colouration of males, a character directly related to concentration of total carotenoids in feathers, was negatively correlated with the immune response and circulating carotenoids in winter. These results support the idea that carotenoids are a limiting resource and that males trade ornamental colouration against immune response.

  15. Interference of Aspergillus fumigatus with the immune response.

    PubMed

    Heinekamp, Thorsten; Schmidt, Hella; Lapp, Katrin; Pähtz, Vera; Shopova, Iordana; Köster-Eiserfunke, Nora; Krüger, Thomas; Kniemeyer, Olaf; Brakhage, Axel A

    2015-03-01

    Aspergillus fumigatus is a saprotrophic filamentous fungus and also the most prevalent airborne fungal pathogen of humans. Depending on the host's immune status, the variety of diseases caused by A. fumigatus ranges from allergies in immunocompetent hosts to life-threatening invasive infections in patients with impaired immunity. In contrast to the majority of other Aspergillus species, which are in most cases nonpathogenic, A. fumigatus features an armory of virulence determinants to establish an infection. For example, A. fumigatus is able to evade the human complement system by binding or degrading complement regulators. Furthermore, the fungus interferes with lung epithelial cells, alveolar macrophages, and neutrophil granulocytes to prevent killing by these immune cells. This chapter summarizes the different strategies of A. fumigatus to manipulate the immune response. We also discuss the potential impact of recent advances in immunoproteomics to improve diagnosis and therapy of an A. fumigatus infection.

  16. Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection.

    PubMed

    Zhang, Jie; Liu, Huan; Wei, Bin

    Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1.

  17. Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection*

    PubMed Central

    Zhang, Jie; Liu, Huan; Wei, Bin

    2017-01-01

    Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1. PMID:28378566

  18. Malaria infection in mosquitoes decreases the personal protection offered by permethrin-treated bednets.

    PubMed

    Thiévent, Kevin; Hofer, Lorenz; Rapp, Elise; Tambwe, Mgeni Mohamed; Moore, Sarah; Koella, Jacob C

    2018-05-04

    Insecticides targeting adult mosquitoes are the main way of controlling malaria. They work not only by killing mosquitoes, but also by repelling and irritating them. Indeed their repellent action gives valuable personal protection against biting mosquitoes. In the context of malaria control this personal protection is especially relevant when mosquitoes are infectious, whereas to protect the community we would prefer that the mosquitoes that are not yet infectious are killed (so, not repelled) by the insecticide. As the infectious stage of malaria parasites increases the motivation of mosquitoes to bite, we predicted that it would also change their behavioural response to insecticides. With two systems, a laboratory isolate of the rodent malaria Plasmodium berghei infecting Anopheles gambiae and several isolates of P. falciparum obtained from schoolchildren in Tanzania that infected Anopheles arabiensis, we found that mosquitoes harbouring the infectious stage (the sporozoites) of the parasite were less repelled by permethrin-treated nets than uninfected ones. Our results suggest that, at least in the laboratory, malaria infection decreases the personal protection offered by insecticide-treated nets at the stage where the personal protection is most valuable. Further studies must investigate whether these results hold true in the field and whether the less effective personal protection can be balanced by increased community protection.

  19. Evaluation of a Noncontact, Alternative Mosquito Repellent Assay System.

    PubMed

    Tisgratog, Rungarun; Kongmee, Monthathip; Sanguanpong, Unchalee; Prabaripai, Atchariya; Bangs, Michael J; Chareonviriyaphap, Theeraphap

    2016-09-01

    A novel noncontact repellency assay system (NCRAS) was designed and evaluated as a possible alternative method for testing compounds that repel or inhibit mosquitoes from blood feeding. Deet and Aedes aegypti were used in a controlled laboratory setting. Using 2 study designs, a highly significant difference were seen between deet-treated and untreated skin placed behind the protective screens, indicating that deet was detected and was acting as a deterrence to mosquito landing and probing behavior. However, a 2nd study showed significant differences between protected (behind a metal screen barrier) and unprotected (exposed) deet-treated forearms, indicating the screen mesh might restrict the detection of deet and thus influences landing/biting response. These findings indicate the prototype NCRAS shows good promise but requires further evaluation and possible modification in design and testing protocol to achieve more desirable operational attributes in comparison with direct skin-contact repellency mosquito assays.

  20. Mosquitoes: A Resource Book for the Classroom.

    ERIC Educational Resources Information Center

    Gillmor, Mary S.; And Others

    This booklet was written for anyone interested in growing mosquitoes and experimenting with them. There are three major sections: (1) rationale for studying mosquitoes, (2) raising mosquitoes, and (3) some scientific findings. The first section describes basic information about mosquitoes. The second section includes information about materials,…

  1. Dissociation of Innate Immune Responses in Microglia Infected with Listeria monocytogenes

    PubMed Central

    Frande-Cabanes, Elisabet; Fernandez-Prieto, Lorena; Calderon-Gonzalez, Ricardo; Rodríguez-Del Río, Estela; Yañez-Diaz, Sonsoles; López-Fanarraga, Monica; Alvarez-Domínguez, Carmen

    2014-01-01

    Microglia, the innate immune cells of the brain, plays a central role in cerebral listeriosis. Here, we present evidence that microglia control Listeria infection differently than macrophages. Infection of primary microglial cultures and murine cell lines with Listeria resulted in a dual function of the two gene expression programmes involved in early and late immune responses in macrophages. Whereas the bacterial gene hly seems responsible for both transcriptional programmes in macrophages, Listeria induces in microglia only the tumor necrosis factor (TNF)-regulated transcriptional programme. Listeria also represses in microglia the late immune response gathered in two clusters, microbial degradation, and interferon (IFN)-inducible genes. The bacterial gene actA was required in microglia to induce TNF-regulated responses and to repress the late response. Isolation of microglial phagosomes revealed a phagosomal environment unable to destroy Listeria. Microglial phagosomes were also defective in several signaling and trafficking components reported as relevant for Listeria innate immune responses. This transcriptional strategy in microglia induced high levels of TNF-α and monocyte chemotactic protein-1 and low production of other neurotoxic compounds such as nitric oxide, hydrogen peroxide, and Type I IFNs. These cytokines and toxic microglial products are also released by primary microglia, and this cytokine and chemokine cocktail display a low potential to trigger neuronal apoptosis. This overall bacterial strategy strongly suggests that microglia limit Listeria inflammation pattern exclusively through TNF-mediated responses to preserve brain integrity. GLIA 2014;62:233–246 PMID:24311463

  2. Antimicrobial autophagy: a conserved innate immune response in Drosophila.

    PubMed

    Moy, Ryan H; Cherry, Sara

    2013-01-01

    Autophagy is a highly conserved degradative pathway that has rapidly emerged as a critical component of immunity and host defense. Studies have implicated autophagy genes in restricting the replication of a diverse array of pathogens, including bacteria, viruses and protozoans. However, in most cases, the in vivo role of antimicrobial autophagy against pathogens has been undefined. Drosophila provides a genetically tractable model system that can be easily adapted to study autophagy in innate immunity, and recent studies in flies have demonstrated that autophagy is an essential antimicrobial response against bacteria and viruses in vivo. These findings reveal striking conservation of antimicrobial autophagy between flies and mammals, and in particular, the role of pathogen-associated pattern recognition in triggering this response. This review discusses our current understanding of antimicrobial autophagy in Drosophila and its potential relevance to human immunity. Copyright © 2013 S. Karger AG, Basel.

  3. Polysaccharides Isolated from Açaí Fruit Induce Innate Immune Responses

    PubMed Central

    Holderness, Jeff; Schepetkin, Igor A.; Freedman, Brett; Kirpotina, Liliya N.; Quinn, Mark T.; Hedges, Jodi F.; Jutila, Mark A.

    2011-01-01

    The Açaí (Acai) fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fractions could activate γδ T cells. Contrary to previous reports, we did not identify agonist activity in the polyphenol fraction; however, the Acai polysaccharide fraction induced robust γδ T cell stimulatory activity in human, mouse, and bovine PBMC cultures. To characterize the immune response to Acai polysaccharides, we fractionated the crude polysaccharide preparation and tested these fractions for activity in human PBMC cultures. The largest Acai polysaccharides were the most active in vitro as indicated by activation of myeloid and γδ T cells. When delivered in vivo, Acai polysaccharide induced myeloid cell recruitment and IL-12 production. These results define innate immune responses induced by the polysaccharide component of Acai and have implications for the treatment of asthma and infectious disease. PMID:21386979

  4. Zymosan-induced immune challenge modifies the stress response of hypoxic air-breathing fish (Anabas testudineus Bloch): Evidence for reversed patterns of cortisol and thyroid hormone interaction, differential ion transporter functions and non-specific immune response.

    PubMed

    Simi, S; Peter, Valsa S; Peter, M C Subhash

    2017-09-15

    Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential

  5. Human disease causing viruses vectored by mosquitoes

    USDA-ARS?s Scientific Manuscript database

    There are a number of disease-causing viruses transmitted to people primarily through the bite of infected mosquitoes. Female mosquitoes take blood meals to produce eggs (Fig. 1). A mosquito that bites an infected animal may pick up a virus within the blood meal. If the mosquito is the appropriate s...

  6. Responses of innate immune cells to group A Streptococcus

    PubMed Central

    Fieber, Christina; Kovarik, Pavel

    2014-01-01

    Group A Streptococcus (GAS), also called Streptococcus pyogenes, is a Gram-positive beta-hemolytic human pathogen which causes a wide range of mostly self-limiting but also several life-threatening diseases. Innate immune responses are fundamental for defense against GAS, yet their activation by pattern recognition receptors (PRRs) and GAS-derived pathogen-associated molecular patterns (PAMPs) is incompletely understood. In recent years, the use of animal models together with the powerful tools of human molecular genetics began shedding light onto the molecular mechanisms of innate immune defense against GAS. The signaling adaptor MyD88 was found to play a key role in launching the immune response against GAS in both humans and mice, suggesting that PRRs of the Toll-like receptor (TLR) family are involved in sensing this pathogen. The specific TLRs and their ligands have yet to be identified. Following GAS recognition, induction of cytokines such as TNF and type I interferons (IFNs), leukocyte recruitment, phagocytosis, and the formation of neutrophil extracellular traps (NETs) have been recognized as key events in host defense. A comprehensive knowledge of these mechanisms is needed in order to understand their frequent failure against GAS immune evasion strategies. PMID:25325020

  7. Progress with viral vectored malaria vaccines: A multi-stage approach involving "unnatural immunity".

    PubMed

    Ewer, Katie J; Sierra-Davidson, Kailan; Salman, Ahmed M; Illingworth, Joseph J; Draper, Simon J; Biswas, Sumi; Hill, Adrian V S

    2015-12-22

    Viral vectors used in heterologous prime-boost regimens are one of very few vaccination approaches that have yielded significant protection against controlled human malaria infections. Recently, protection induced by chimpanzee adenovirus priming and modified vaccinia Ankara boosting using the ME-TRAP insert has been correlated with the induction of potent CD8(+) T cell responses. This regimen has progressed to field studies where efficacy against infection has now been reported. The same vectors have been used pre-clinically to identify preferred protective antigens for use in vaccines against the pre-erythrocytic, blood-stage and mosquito stages of malaria and this work is reviewed here for the first time. Such antigen screening has led to the prioritization of the PfRH5 blood-stage antigen, which showed efficacy against heterologous strain challenge in non-human primates, and vectors encoding this antigen are in clinical trials. This, along with the high transmission-blocking activity of some sexual-stage antigens, illustrates well the capacity of such vectors to induce high titre protective antibodies in addition to potent T cell responses. All of the protective responses induced by these vectors exceed the levels of the same immune responses induced by natural exposure supporting the view that, for subunit vaccines to achieve even partial efficacy in humans, "unnatural immunity" comprising immune responses of very high magnitude will need to be induced. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy

    PubMed Central

    Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia

    2018-01-01

    Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy. PMID:29619026

  9. Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy.

    PubMed

    Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia

    2018-01-01

    Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy.

  10. Climate Change, Population Immunity, and Hyperendemicity in the Transmission Threshold of Dengue

    PubMed Central

    Oki, Mika; Yamamoto, Taro

    2012-01-01

    Background It has been suggested that the probability of dengue epidemics could increase because of climate change. The probability of epidemics is most commonly evaluated by the basic reproductive number (R0), and in mosquito-borne diseases, mosquito density (the number of female mosquitoes per person [MPP]) is the critical determinant of the R0 value. In dengue-endemic areas, 4 different serotypes of dengue virus coexist–a state known as hyperendemicity–and a certain proportion of the population is immune to one or more of these serotypes. Nevertheless, these factors are not included in the calculation of R0. We aimed to investigate the effects of temperature change, population immunity, and hyperendemicity on the threshold MPP that triggers an epidemic. Methods and Findings We designed a mathematical model of dengue transmission dynamics. An epidemic was defined as a 10% increase in seroprevalence in a year, and the MPP that triggered an epidemic was defined as the threshold MPP. Simulations were conducted in Singapore based on the recorded temperatures from 1980 to 2009 The threshold MPP was estimated with the effect of (1) temperature only; (2) temperature and fluctuation of population immunity; and (3) temperature, fluctuation of immunity, and hyperendemicity. When only the effect of temperature was considered, the threshold MPP was estimated to be 0.53 in the 1980s and 0.46 in the 2000s, a decrease of 13.2%. When the fluctuation of population immunity and hyperendemicity were considered in the model, the threshold MPP decreased by 38.7%, from 0.93 to 0.57, from the 1980s to the 2000s. Conclusions The threshold MPP was underestimated if population immunity was not considered and overestimated if hyperendemicity was not included in the simulations. In addition to temperature, these factors are particularly important when quantifying the threshold MPP for the purpose of setting goals for vector control in dengue-endemic areas. PMID:23144746

  11. Comparison of the immune responses in BALB/c mice following immunization with DNA-based and live attenuated vaccines delivered via different routes.

    PubMed

    Cai, Ming-sheng; Deng, Shu-xuan; Li, Mei-li

    2013-02-18

    The objective of this study was to compare immune responses induced in BALB/c mice following immunization with pcDNA-GPV-VP2 DNA by gene gun bombardment (6 μg) or by intramuscular (im) injection (100 μg) with the responses to live attenuated vaccine by im injection (100 μl). pcDNA3.1 (+) and physiological saline were used as controls. Peripheral blood samples were collected at 3, 7, 14, 21, 28, 35, 49, 63, 77 and 105 d after immunization. T lymphocyte proliferation was analyzed by MTT assay and enumeration of CD4(+), and CD8(+) T cell populations in peripheral blood was performed by flow cytometric analysis. Indirect ELISA was used to detect IgG levels. Cellular and humoral responses were induced by pcDNA-GPV-VP2 DNA and live virus vaccines. No differences were observed in T cell proliferation and CD8(+) T cell responses induced by the genetic vaccine regardless of the route of delivery. However, CD4(+) T cell responses and humoral immunity were enhanced in following gene gun immunization compared with im injection of the genetic vaccine. Cellular and humoral immunity was enhanced in following gene gun delivery of the genetic vaccine compared with the live attenuated vaccine. In conclusion, the pcDNA-GPV-VP2 DNA vaccine induced enhanced cellular and humoral immunity compared with that induced by the live attenuated vaccine. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Post-hurricane Rita mosquito surveillance and the efficacy of Air Force aerial applications for mosquito control in east Texas.

    PubMed

    Breidenbaugh, Mark S; Haagsma, Karl A; Walker, Wes W; Sanders, David M

    2008-06-01

    Post-Hurricane Rita mosquito surveillance was carried out in 4 east Texas counties to determine mosquito abundance, species composition, and need for mosquito control. Subsequently, aerial applications of naled (Dibrom) for mosquito control were made by the Air Force Aerial Spray Flight, while continued surveillance documented the efficacy of the applications. Psorophora columbiae was the predominant species in landing counts. Twenty-two mosquito species were represented in light trap collections with Aedes atlanitcus/tormentor, Culex nigripalpus, Ae. vexans, and Ps. columbiae making up 91% of the total. A total of 102,001 ha (252,052 acres) were aerially treated based on high mosquito abundance, exposure of first responders and residents to nuisance biting, and local interruption of electric utilities. A significant 90% decline in mosquito abundance was observed posttreatment.

  13. Aquatic insect predators and mosquito control.

    PubMed

    Shaalan, Essam Abdel-Salam; Canyon, Deon V

    2009-12-01

    Mosquitoes are serious biting pests and obligate vectors of many vertebrate pathogens. Their immature larval and pupal life stages are a common feature in most tropical and many temperate water bodies and often form a significant proportion of the biomass. Control strategies rely primarily on the use of larvicides and environmental modification to reduce recruitment and adulticides during periods of disease transmission. Larvicides are usually chemical but can involve biological toxins, agents or organisms. The use of insect predators in mosquito control has been exploited in a limited fashion and there is much room for further investigation and implementation. Insects that are recognized as having predatorial capacity with regard to mosquito prey have been identified in the Orders Odonata, Coleoptera, Diptera (primarily aquatic predators), and Hemiptera (primarily surface predators). Although their capacity is affected by certain biological and physical factors, they could play a major role in mosquito control. Furthermore, better understanding for the mosquitoes-predators relationship(s) could probably lead to satisfactory reduction of mosquito-borne diseases by utilizing either these predators in control programs, for instance biological and/or integrated control, or their kairomones as mosquitoes' ovipoisting repellents. This review covers the predation of different insect species on mosquito larvae, predator-prey-habitat relationships, co-habitation developmental issues, survival and abundance, oviposition avoidance, predatorial capacity and integrated vector control.

  14. Immune responses to implants - a review of the implications for the design of immunomodulatory biomaterials.

    PubMed

    Franz, Sandra; Rammelt, Stefan; Scharnweber, Dieter; Simon, Jan C

    2011-10-01

    A key for long-term survival and function of biomaterials is that they do not elicit a detrimental immune response. As biomaterials can have profound impacts on the host immune response the concept emerged to design biomaterials that are able to trigger desired immunological outcomes and thus support the healing process. However, engineering such biomaterials requires an in-depth understanding of the host inflammatory and wound healing response to implanted materials. One focus of this review is to outline the up-to-date knowledge on immune responses to biomaterials. Understanding the complex interactions of host response and material implants reveals the need for and also the potential of "immunomodulating" biomaterials. Based on this knowledge, we discuss strategies of triggering appropriate immune responses by functional biomaterials and highlight recent approaches of biomaterials that mimic the physiological extracellular matrix and modify cellular immune responses. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Glassy Dynamics in the Adaptive Immune Response Prevents Autoimmune Disease

    NASA Astrophysics Data System (ADS)

    Sun, Jun; Deem, Michael

    2006-03-01

    The immune system normally protects the human host against death by infection. However, when an immune response is mistakenly directed at self antigens, autoimmune disease can occur. We describe a model of protein evolution to simulate the dynamics of the adaptive immune response to antigens. Computer simulations of the dynamics of antibody evolution show that different evolutionary mechanisms, namely gene segment swapping and point mutation, lead to different evolved antibody binding affinities. Although a combination of gene segment swapping and point mutation can yield a greater affinity to a specific antigen than point mutation alone, the antibodies so evolved are highly cross-reactive and would cause autoimmune disease, and this is not the chosen dynamics of the immune system. We suggest that in the immune system a balance has evolved between binding affinity and specificity in the mechanism for searching the amino acid sequence space of antibodies. Our model predicts that chronic infection may lead to autoimmune disease as well due to cross-reactivity and suggests a broad distribution for the time of onset of autoimmune disease due to chronic exposure. The slow search of antibody sequence space by point mutation leads to the broad of distribution times.

  16. Allethrin-Based Mosquito Control Device Causing Knockdown, Morbidity, and Mortality in Four Species of Field-Caught Mosquitoes (Diptera: Culicidae).

    PubMed

    Bibbs, Christopher S; Fulcher, Ali; Xue, Rui-De

    2015-07-01

    A mosquito control device marketed for spatial repellency, the ThermaCELL Mosquito Repellent Appliance, was evaluated in semifield trials against multiple field-caught species of mosquito. Using paper and mesh cages, mosquito test groups of at least 30 mosquitoes were suspended in a 2,337 cubic foot outdoor space while two ThermaCELL repellent devices were active. After 30 min of treatment, cages were moved to the laboratory to observe knockdown, morbidity, and mortality for 24 h. Species tested included Aedes atlanticus Dyar and Knab (98% average mortality), Psorophora ferox Humboldt (97% average mortality), Psorophora columbiae Dyar and Knab (96% average mortality), and Aedes taeniorhynchus Wiedemann (84% average mortality). The repellent devices showed effectiveness with high knockdown and mortality across all species tested. Mosquito control devices like the ThermaCELL Mosquito Repellent Appliance may have further practical applications to help combat viral exposures by limiting host mosquitoes. Such devices may provide a functional alternative to DEET dependence in the current state of mosquito management. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. The nature of immune responses to urinary tract infections

    PubMed Central

    Abraham, Soman N.; Miao, Yuxuan

    2016-01-01

    The urinary tract is constantly exposed to microorganisms that inhabit the gastrointestinal tract, but generally the urinary tract resists infection by gut microorganisms. This resistance to infection is mainly ascribed to the versatility of the innate immune defences in the urinary tract as the adaptive immune responses are limited, particularly when only the lower urinary tract is infected. In recent years, as the strengths and weaknesses of the immune system of the urinary tract have emerged and as the virulence attributes of uropathogens are recognized, several potentially effective and unconventional strategies to contain or prevent urinary tract infections have emerged. PMID:26388331

  18. RNA Editing, ADAR1, and the Innate Immune Response.

    PubMed

    Wang, Qingde; Li, Xiaoni; Qi, Ruofan; Billiar, Timothy

    2017-01-18

    RNA editing, particularly A-to-I RNA editing, has been shown to play an essential role in mammalian embryonic development and tissue homeostasis, and is implicated in the pathogenesis of many diseases including skin pigmentation disorder, autoimmune and inflammatory tissue injury, neuron degeneration, and various malignancies. A-to-I RNA editing is carried out by a small group of enzymes, the adenosine deaminase acting on RNAs (ADARs). Only three members of this protein family, ADAR1-3, exist in mammalian cells. ADAR3 is a catalytically null enzyme and the most significant function of ADAR2 was found to be in editing on the neuron receptor GluR-B mRNA. ADAR1, however, has been shown to play more significant roles in biological and pathological conditions. Although there remains much that is not known about how ADAR1 regulates cellular function, recent findings point to regulation of the innate immune response as an important function of ADAR1. Without appropriate RNA editing by ADAR1, endogenous RNA transcripts stimulate cytosolic RNA sensing receptors and therefore activate the IFN-inducing signaling pathways. Overactivation of innate immune pathways can lead to tissue injury and dysfunction. However, obvious gaps in our knowledge persist as to how ADAR1 regulates innate immune responses through RNA editing. Here, we review critical findings from ADAR1 mechanistic studies focusing on its regulatory function in innate immune responses and identify some of the important unanswered questions in the field.

  19. Ubiquitination in the antiviral immune response.

    PubMed

    Davis, Meredith E; Gack, Michaela U

    2015-05-01

    Ubiquitination has long been known to regulate fundamental cellular processes through the induction of proteasomal degradation of target proteins. More recently, 'atypical' non-degradative types of polyubiquitin chains have been appreciated as important regulatory moieties by modulating the activity or subcellular localization of key signaling proteins. Intriguingly, many of these non-degradative types of ubiquitination regulate the innate sensing pathways initiated by pattern recognition receptors (PRRs), ultimately coordinating an effective antiviral immune response. Here we discuss recent advances in understanding the functional roles of degradative and atypical types of ubiquitination in innate immunity to viral infections, with a specific focus on the signaling pathways triggered by RIG-I-like receptors, Toll-like receptors, and the intracellular viral DNA sensor cGAS. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants

    PubMed Central

    Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo

    2017-01-01

    Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871

  1. Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants.

    PubMed

    Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo

    2008-10-09

    Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.

  2. Efficacy of Mosquito Traps for Collecting Potential West Nile Mosquito Vectors in a Natural Mediterranean Wetland

    PubMed Central

    Roiz, David; Roussel, Marion; Muñoz, Joaquin; Ruiz, Santiago; Soriguer, Ramón; Figuerola, Jordi

    2012-01-01

    Surveillance, research, and control of mosquito-borne diseases such as West Nile virus require efficient methods for sampling mosquitoes. We compared the efficacy of BG-Sentinel and Centers for Disease Control and Prevention (CDC)-CO2 traps in terms of the abundances of host-seeking and blood-fed female mosquitoes and the origin of mosquito bloodmeals. Our results indicate that BG-Sentinel traps that use CO2 and attractants are as effective as CDC-CO2 traps for Culex mosquito species, Ochlerotatus caspius, and they are also highly efficient at capturing Anopheles atroparvus host-seeking and blood-fed females with or without CO2. The CDC-CO2 trap is the least efficient method for capturing blood-fed females. BG-Sentinel traps with attractants and CO2 were significantly better at capturing mosquitoes that had fed on mammals than the unbaited BG-Sentinel and CDC-CO2 traps in the cases of An. atroparvus and Cx. theileri. These results may help researchers to optimize trapping methods by obtaining greater sample sizes and saving time and money. PMID:22492149

  3. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  4. Live attenuated influenza vaccine (LAIV) impacts innate and adaptive immune responses.

    PubMed

    Lanthier, Paula A; Huston, Gail E; Moquin, Amy; Eaton, Sheri M; Szaba, Frank M; Kummer, Lawrence W; Tighe, Micheal P; Kohlmeier, Jacob E; Blair, Patrick J; Broderick, Michael; Smiley, Stephen T; Haynes, Laura

    2011-10-13

    Influenza A infection induces a massive inflammatory response in the lungs that leads to significant illness and increases the susceptibility to secondary bacterial pneumonia. The most efficient way to prevent influenza infection is through vaccination. While inactivated vaccines induce protective levels of serum antibodies to influenza hemaglutinin (HA) and neuraminidase (NA) surface proteins, these are strain specific and offer little protection against heterosubtypic influenza viruses. In contrast, live attenuated influenza vaccines (LAIVs) induce a T cell response in addition to antibody responses against HA and NA surface proteins. Importantly, LAIV vaccination induces a response in a mouse model that protects against illness due to heterosubtypic influenza strains. While it is not completely clear what is the mechanism of action of LAIV heterosubtypic protection in humans, it has been shown that LAIV induces heterosubtypic protection in mice that is dependent upon a Type 1 immune response and requires CD8 T cells. In this study, we show that LAIV-induced immunity leads to significantly reduced viral titers and inflammatory responses in the lungs of mice following heterosubtypic infection. Not only are viral titers reduced in LAIV vaccinated mice, the amounts of inflammatory cytokines and chemokines in lung tissue are significantly lower. Additionally, we show that LAIV vaccination of healthy adults also induces a robust Type 1 memory response including the production of chemokines and cytokines involved in T cell activation and recruitment. Thus, our results indicate that LAIV vaccination functions by inducing immune memory which can act to modulate the immune response to subsequent heterosubtypic challenge by influencing both innate and adaptive responses. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Immune responses of poultry to Newcastle disease virus.

    PubMed

    Kapczynski, Darrell R; Afonso, Claudio L; Miller, Patti J

    2013-11-01

    Newcastle disease (ND) remains a constant threat to poultry producers worldwide, in spite of the availability and global employment of ND vaccinations since the 1950s. Strains of Newcastle disease virus (NDV) belong to the order Mononegavirales, family Paramyxoviridae, and genus Avulavirus, are contained in one serotype and are also known as avian paramyxovirus serotype-1 (APMV-1). They are pleomorphic in shape and are single-stranded, non-segmented, negative sense RNA viruses. The virus has been reported to infect most orders of birds and thus has a wide host range. Isolates are characterized by virulence in chickens and the presence of basic amino acids at the fusion protein cleavage site. Low virulent NDV typically produce subclinical disease with some morbidity, whereas virulent isolates can result in rapid, high mortality of birds. Virulent NDV are listed pathogens that require immediate notification to the Office of International Epizootics and outbreaks typically result in trade embargos. Protection against NDV is through the use of vaccines generated with low virulent NDV strains. Immunity is derived from neutralizing antibodies formed against the viral hemagglutinin and fusion glycoproteins, which are responsible for attachment and spread of the virus. However, new techniques and technologies have also allowed for more in depth analysis of the innate and cell-mediated immunity of poultry to NDV. Gene profiling experiments have led to the discovery of novel host genes modulated immediately after infection. Differences in virus virulence alter host gene response patterns have been demonstrated. Furthermore, the timing and contributions of cell-mediated immune responses appear to decrease disease and transmission potential. In view of recent reports of vaccine failure from many countries on the ability of classical NDV vaccines to stop spread of disease, renewed interest in a more complete understanding of the global immune response of poultry to NDV will be

  6. Plant immunity: unravelling the complexity of plant responses to biotic stresses.

    PubMed

    Miller, Robert Neil Gerard; Costa Alves, Gabriel Sergio; Van Sluys, Marie-Anne

    2017-03-01

    Plants are constantly exposed to evolving pathogens and pests, with crop losses representing a considerable threat to global food security. As pathogen evolution can overcome disease resistance that is conferred by individual plant resistance genes, an enhanced understanding of the plant immune system is necessary for the long-term development of effective disease management strategies. Current research is rapidly advancing our understanding of the plant innate immune system, with this multidisciplinary subject area reflected in the content of the 18 papers in this Special Issue. Advances in specific areas of plant innate immunity are highlighted in this issue, with focus on molecular interactions occurring between plant hosts and viruses, bacteria, phytoplasmas, oomycetes, fungi, nematodes and insect pests. We provide a focus on research across multiple areas related to pathogen sensing and plant immune response. Topics covered are categorized as follows: binding proteins in plant immunity; cytokinin phytohormones in plant growth and immunity; plant-virus interactions; plant-phytoplasma interactions; plant-fungus interactions; plant-nematode interactions; plant immunity in Citrus; plant peptides and volatiles; and assimilate dynamics in source/sink metabolism. Although knowledge of the plant immune system remains incomplete, the considerable ongoing scientific progress into pathogen sensing and plant immune response mechanisms suggests far reaching implications for the development of durable disease resistance against pathogens and pests. © The Author 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  7. Serological responses and immunity to superinfection with avian malaria in experimentally-infected Hawaii Amakihi

    USGS Publications Warehouse

    Atkinson, Carter T.; Dusek, Robert J.; Lease, Julie K.

    2001-01-01

    Six of seven Hawaii Amakihi (Hemignathus virens) with chronic malarial infections had no increases in peripheral parasitemia, declines in food consumption, or loss of body weight when rechallenged with the homologous isolate of Plasmodium relictum 61 to 62 days after initial infection. Five uninfected control amakihi exposed at the same time to infective mosquito bites developed acute infections with high parasitemias. Reductions in food consumption and loss of body weight occurred in all control birds and three of these individuals eventually died. When surviving birds were rechallenged >2 yr later with either the same parasite isolate or an isolate of P. relictum collected on the island of Kauai, all individuals were immune to superinfection. Chronically infected birds developed antibodies to a common suite of malarial antigens ranging in size from 22 to 170 kDa that were detectable as early as 8 days post infection on immunoblots of SDS-polyacrylamide gels. Antibodies to this suite of malarial antigens persisted as long as 1,248 days after initial infection and were consistently detectable at times when parasites were not easily found by microscopy on Giemsa-stained blood smears. The immunoblotting method that is described here appears to be an effective technique for identifying birds with chronic, low-intensity malarial infections when circulating parasites are not easily detectable by microscopy. Hawaiian honeycreepers that are capable of recovering from acute infections develop concomitant immunity to superinfection, making them functionally immune in areas where malaria transmission has become endemic.

  8. Host Immune Status and Response to Hepatitis E Virus Infection

    PubMed Central

    Krain, Lisa J.; Nelson, Kenrad E.

    2014-01-01

    SUMMARY Hepatitis E virus (HEV), identified over 30 years ago, remains a serious threat to life, health, and productivity in developing countries where access to clean water is limited. Recognition that HEV also circulates as a zoonotic and food-borne pathogen in developed countries is more recent. Even without treatment, most cases of HEV-related acute viral hepatitis (with or without jaundice) resolve within 1 to 2 months. However, HEV sometimes leads to acute liver failure, chronic infection, or extrahepatic symptoms. The mechanisms of pathogenesis appear to be substantially immune mediated. This review covers the epidemiology of HEV infection worldwide, the humoral and cellular immune responses to HEV, and the persistence and protection of antibodies produced in response to both natural infection and vaccines. We focus on the contributions of altered immune states (associated with pregnancy, human immunodeficiency virus [HIV], and immunosuppressive agents used in cancer and transplant medicine) to the elevated risks of chronic infection (in immunosuppressed/immunocompromised patients) and acute liver failure and mortality (among pregnant women). We conclude by discussing outstanding questions about the immune response to HEV and interactions with hormones and comorbid conditions. These questions take on heightened importance now that a vaccine is available. PMID:24396140

  9. Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes.

    PubMed

    Liu, Yang; Liu, Jianying; Du, Senyan; Shan, Chao; Nie, Kaixiao; Zhang, Rudian; Li, Xiao-Feng; Zhang, Renli; Wang, Tao; Qin, Cheng-Feng; Wang, Penghua; Shi, Pei-Yong; Cheng, Gong

    2017-05-25

    Zika virus (ZIKV) remained obscure until the recent explosive outbreaks in French Polynesia (2013-2014) and South America (2015-2016). Phylogenetic studies have shown that ZIKV has evolved into African and Asian lineages. The Asian lineage of ZIKV was responsible for the recent epidemics in the Americas. However, the underlying mechanisms through which ZIKV rapidly and explosively spread from Asia to the Americas are unclear. Non-structural protein 1 (NS1) facilitates flavivirus acquisition by mosquitoes from an infected mammalian host and subsequently enhances viral prevalence in mosquitoes. Here we show that NS1 antigenaemia determines ZIKV infectivity in its mosquito vector Aedes aegypti, which acquires ZIKV via a blood meal. Clinical isolates from the most recent outbreak in the Americas were much more infectious in mosquitoes than the FSS13025 strain, which was isolated in Cambodia in 2010. Further analyses showed that these epidemic strains have higher NS1 antigenaemia than the FSS13025 strain because of an alanine-to-valine amino acid substitution at residue 188 in NS1. ZIKV infectivity was enhanced by this amino acid substitution in the ZIKV FSS13025 strain in mosquitoes that acquired ZIKV from a viraemic C57BL/6 mouse deficient in type I and II interferon (IFN) receptors (AG6 mouse). Our results reveal that ZIKV evolved to acquire a spontaneous mutation in its NS1 protein, resulting in increased NS1 antigenaemia. Enhancement of NS1 antigenaemia in infected hosts promotes ZIKV infectivity and prevalence in mosquitoes, which could have facilitated transmission during recent ZIKV epidemics.

  10. Ebola Virus Glycoprotein Induces an Innate Immune Response In vivo via TLR4

    PubMed Central

    Lai, Chih-Yun; Strange, Daniel P.; Wong, Teri Ann S.; Lehrer, Axel T.; Verma, Saguna

    2017-01-01

    Ebola virus (EBOV), a member of the Filoviridae family, causes the most severe form of viral hemorrhagic fever. Although no FDA licensed vaccine or treatment against Ebola virus disease (EVD) is currently available, Ebola virus glycoprotein (GP) is the major antigen used in all candidate Ebola vaccines. Recent reports of protection as quickly as within 6 days of administration of the rVSV-based vaccine expressing EBOV GP before robust humoral responses were generated suggests that the innate immune responses elicited early after vaccination may contribute to the protection. However, the innate immune responses induced by EBOV GP in the absence of viral vectors or adjuvants have not been fully characterized in vivo. Our recent studies demonstrated that immunization with highly purified recombinant GP in the absence of adjuvants induced a robust IgG response and partial protection against EBOV infection suggesting that GP alone can induce protective immunity. In this study we investigated the early immune response to purified EBOV GP alone in vitro and in vivo. We show that GP was efficiently internalized by antigen presenting cells and subsequently induced production of key inflammatory cytokines. In vivo, immunization of mice with EBOV GP triggered the production of key Th1 and Th2 innate immune cytokines and chemokines, which directly governed the recruitment of CD11b+ macrophages and CD11c+ dendritic cells to the draining lymph nodes (DLNs). Pre-treatment of mice with a TLR4 antagonist inhibited GP-induced cytokine production and recruitment of immune cells to the DLN. EBOV GP also upregulated the expression of costimulatory molecules in bone marrow derived macrophages suggesting its ability to enhance APC stimulatory capacity, which is critical for the induction of effective antigen-specific adaptive immunity. Collectively, these results provide the first in vivo evidence that early innate immune responses to EBOV GP are mediated via the TLR4 pathway and are

  11. Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response

    PubMed Central

    Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J.; Repasky, Elizabeth A.; Hylander, Bonnie L.

    2018-01-01

    An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were

  12. Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response.

    PubMed

    Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J; Repasky, Elizabeth A; Hylander, Bonnie L

    2018-01-01

    An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were

  13. Impact of Chronic Viral Infection on T-Cell Dependent Humoral Immune Response.

    PubMed

    Rodriguez, Stéphane; Roussel, Mikaël; Tarte, Karin; Amé-Thomas, Patricia

    2017-01-01

    During the last decades, considerable efforts have been done to decipher mechanisms supported by microorganisms or viruses involved in the development, differentiation, and function of immune cells. Pathogens and their associated secretome as well as the continuous inflammation observed in chronic infection are shaping both innate and adaptive immunity. Secondary lymphoid organs are functional structures ensuring the mounting of adaptive immune response against microorganisms and viruses. Inside these organs, germinal centers (GCs) are the specialized sites where mature B-cell differentiation occurs leading to the release of high-affinity immunoglobulin (Ig)-secreting cells. Different steps are critical to complete B-cell differentiation process, including proliferation, somatic hypermutations in Ig variable genes, affinity-based selection, and class switch recombination. All these steps require intense interactions with cognate CD4 + helper T cells belonging to follicular helper lineage. Interestingly, pathogens can disturb this subtle machinery affecting the classical adaptive immune response. In this review, we describe how viruses could act directly on GC B cells, either through B-cell infection or by their contribution to B-cell cancer development and maintenance. In addition, we depict the indirect impact of viruses on B-cell response through infection of GC T cells and stromal cells, leading to immune response modulation.

  14. Characterization of the immune response to canine parvovirus induced by vaccination with chimaeric plant viruses.

    PubMed

    Nicholas, Benjamin L; Brennan, F R; Martinez-Torrecuadrada, J L; Casal, J I; Hamilton, W D; Wakelin, D

    2002-06-21

    NIH mice were vaccinated subcutaneously or intranasally with chimaeric cow pea mosaic virus (CPMV) constructs expressing a 17-mer peptide sequence from canine parvovirus (CPV) as monomers or dimers on the small or large protein surface subunits. Responses to the chimaeric virus particles (CVPs) were compared with those of mice immunized with the native virus or with parvovirus peptide conjugated to keyhole limpet haemocyanin (KLH). The characteristics of the immune response to vaccination were examined by measuring serum and mucosal antibody responses in ELISA, in vitro antigen-induced spleen cell proliferation and cytokine responses. Mice made strong antibody responses to the native plant virus and peptide-specific responses to two of the four CVP constructs tested which were approximately 10-fold lower than responses to native plant virus. The immune response generated by the CVP constructs showed a marked TH1 bias, as determined by a predominantly IgG(2a) isotype peptide-specific antibody response and the release of IFN-gamma but not IL-4 or IL-5 from lymphocytes exposed to antigen in vitro. In comparison, parvovirus peptide conjugated to KLH generated an IgG(1)-biased (TH2) response. These data indicate that the presentation of peptides on viral particles could be used to bias the immune response in favor of a TH1 response.Anti-viral and anti-peptide IgA were detected in intestinal and bronchial lavage fluid of immunized mice, demonstrating that a mucosal immune response to CPV can be generated by systemic and mucosal immunization with CVP vaccines. Serum antibody from both subcutaneously-vaccinated and intranasally-vaccinated mice showed neutralizing activity against CPV in vitro.

  15. Acquired immune response to oncogenic human papillomavirus associated with prophylactic cervical cancer vaccines.

    PubMed

    Einstein, Mark H

    2008-04-01

    Human papillomavirus (HPV) is a common infection among women and a necessary cause of cervical cancer. Oncogenic HPV types infecting the anogenital tract have the potential to induce natural immunity, but at present we do not clearly understand the natural history of infection in humans and the mechanisms by which the virus can evade the host immune response. Natural acquired immune responses against HPV may be involved in the clearance of infection, but persistent infection with oncogenic virus types leads to the development of precancerous lesions and cancer. B cell responses are important for viral neutralization, but antibody responses in patients with cervical cancer are poor. Prophylactic vaccines targeting oncogenic virus types associated with cervical cancer have the potential to prevent up to 80% of cervical cancers by targeting HPV types 16 and 18. Clinical data show that prophylactic vaccines are effective in inducing antibody responses and in preventing persistent infection with HPV, as well as the subsequent development of high-grade cervical intraepithelial neoplasia. This article reviews the known data regarding natural immune responses to HPV and those developed by prophylactic vaccination.

  16. Difference in immune response in vaccinated and unvaccinated Swedish individuals after the 2009 influenza pandemic

    PubMed Central

    2014-01-01

    Background Previous exposures to flu and subsequent immune responses may impact on 2009/2010 pandemic flu vaccine responses and clinical symptoms upon infection with the 2009 pandemic H1N1 influenza strain. Qualitative and quantitative differences in humoral and cellular immune responses associated with the flu vaccination in 2009/2010 (pandemic H1N1 vaccine) and natural infection have not yet been described in detail. We designed a longitudinal study to examine influenza- (flu-) specific immune responses and the association between pre-existing flu responses, symptoms of influenza-like illness (ILI), impact of pandemic flu infection, and pandemic flu vaccination in a cohort of 2,040 individuals in Sweden in 2009–2010. Methods Cellular flu-specific immune responses were assessed by whole-blood antigen stimulation assay, and humoral responses by a single radial hemolysis test. Results Previous seasonal flu vaccination was associated with significantly lower flu-specific IFN-γ responses (using a whole-blood assay) at study entry. Pandemic flu vaccination induced long-lived T-cell responses (measured by IFN-γ production) to influenza A strains, influenza B strains, and the matrix (M1) antigen. In contrast, individuals with pandemic flu infection (PCR positive) exhibited increased flu-specific T-cell responses shortly after onset of ILI symptoms but the immune response decreased after the flu season (spring 2010). We identified non-pandemic-flu vaccinated participants without ILI symptoms who showed an IFN-γ production profile similar to pandemic-flu infected participants, suggesting exposure without experiencing clinical symptoms. Conclusions Strong and long-lived flu-M1 specific immune responses, defined by IFN-γ production, in individuals after vaccination suggest that M1-responses may contribute to protective cellular immune responses. Silent flu infections appeared to be frequent in 2009/2010. The pandemic flu vaccine induced qualitatively and quantitatively

  17. Dissecting innate immune responses with the tools of systems biology.

    PubMed

    Smith, Kelly D; Bolouri, Hamid

    2005-02-01

    Systems biology strives to derive accurate predictive descriptions of complex systems such as innate immunity. The innate immune system is essential for host defense, yet the resulting inflammatory response must be tightly regulated. Current understanding indicates that this system is controlled by complex regulatory networks, which maintain homoeostasis while accurately distinguishing pathogenic infections from harmless exposures. Recent studies have used high throughput technologies and computational techniques that presage predictive models and will be the foundation of a systems level understanding of innate immunity.

  18. Interplay between immune responses to HLA and non-HLA self-antigens in allograft rejection.

    PubMed

    Angaswamy, Nataraju; Tiriveedhi, Venkataswarup; Sarma, Nayan J; Subramanian, Vijay; Klein, Christina; Wellen, Jason; Shenoy, Surendra; Chapman, William C; Mohanakumar, T

    2013-11-01

    Recent studies strongly suggest an increasing role for immune responses against self-antigens (Ags) which are not encoded by the major histocompatibility complex in the immunopathogenesis of allograft rejection. Although, improved surgical techniques coupled with improved methods to detect and avoid sensitization against donor human leukocyte antigen (HLA) have improved the immediate and short term function of transplanted organs. However, acute and chronic rejection still remains a vexing problem for the long term function of the transplanted organ. Immediately following organ transplantation, several factors both immune and non immune mechanisms lead to the development of local inflammatory milieu which sets the stage for allograft rejection. Traditionally, development of antibodies (Abs) against mismatched donor HLA have been implicated in the development of Ab mediated rejection. However, recent studies from our laboratory and others have demonstrated that development of humoral and cellular immune responses against non-HLA self-Ags may contribute in the pathogenesis of allograft rejection. There are reports demonstrating that immune responses to self-Ags especially Abs to the self-Ags as well as cellular immune responses especially through IL17 has significant pro-fibrotic properties leading to chronic allograft failure. This review summarizes recent studies demonstrating the role for immune responses to self-Ags in allograft immunity leading to rejection as well as present recent evidence suggesting there is interplay between allo- and autoimmunity leading to allograft dysfunction. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  19. A novel mosquito ubiquitin targets viral envelope protein for degradation and reduces virion production during dengue virus infection.

    PubMed

    Troupin, Andrea; Londono-Renteria, Berlin; Conway, Michael J; Cloherty, Erin; Jameson, Samuel; Higgs, Stephen; Vanlandingham, Dana L; Fikrig, Erol; Colpitts, Tonya M

    2016-09-01

    Dengue virus (DENV) is a mosquito-borne flavivirus that causes significant human disease and mortality in the tropics and subtropics. By examining the effects of virus infection on gene expression, and interactions between virus and vector, new targets for prevention of infection and novel treatments may be identified in mosquitoes. We previously performed a microarray analysis of the Aedes aegypti transcriptome during infection with DENV and found that mosquito ubiquitin protein Ub3881 (AAEL003881) was specifically and highly down-regulated. Ubiquitin proteins have multiple functions in insects, including marking proteins for proteasomal degradation, regulating apoptosis and mediating innate immune signaling. We used qRT-PCR to quantify gene expression and infection, and RNAi to reduce Ub3881 expression. Mosquitoes were infected with DENV through blood feeding. We transfected DENV protein expression constructs to examine the effect of Ub3881 on protein degradation. We used site-directed mutagenesis and transfection to determine what amino acids are involved in Ub3881-mediated protein degradation. Immunofluorescence, Co-immunoprecipitation and Western blotting were used to examine protein interactions and co-localization. The overexpression of Ub3881, but not related ubiquitin proteins, decreased DENV infection in mosquito cells and live Ae. aegypti. The Ub3881 protein was demonstrated to be involved in DENV envelope protein degradation and reduce the number of infectious virions released. We conclude that Ub3881 has several antiviral functions in the mosquito, including specific viral protein degradation. Our data highlights Ub3881 as a target for future DENV prevention strategies in the mosquito transmission vector. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  20. An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response

    PubMed Central

    Buckley, Katherine M.; Rast, Jonathan P.

    2017-01-01

    The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN) approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17), are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism. PMID:29109720